WorldWideScience

Sample records for epidermal necrolysis induced

  1. PHENYTOIN INDUCED TOXIC EPIDERMAL NECROLYSIS: A CASE REPORT

    OpenAIRE

    S. M. Biradar; Pathi Indu; Anand P. Ambali

    2017-01-01

    The drug induced Toxic epidermal necrolysis (TEN) is an acute emergency and is potentially life threatening if not treated promptly. It is obvious that patients with TEN demand much more meticulous and aggressive therapy for better outcome. Adverse drug reactions (ADRs) are one of the most leading causes of death among hospitalized patients; these may vary from mild rashes to severe reactions such as Stevens-Johnson syndrome (SJS) and Toxic epidermal necrolysis. Though the Phenytoin is an ant...

  2. Suspected lamotrigine-induced toxic epidermal necrolysis.

    Science.gov (United States)

    Chaffin, J J; Davis, S M

    1997-06-01

    To describe a patient who developed toxic epidermal necrolysis (TEN) possibly secondary to lamotrigine use. A 74-year-old white man with a history of probable complex partial seizures was admitted to the neurology service for a prolonged postictal state. His antiepileptic regimen was changed while he was in the hospital to include lamotrigine. After 19 days of hospitalization and 14 days of lamotrigine therapy, the patient became febrile. The next day he developed a rash which progressed within 4 days to TEN, diagnosed by skin biopsy. All suspected drugs were discontinued, including lamotrigine. The patient was treated with hydrotherapy in the burn unit. His symptoms improved and he was discharged from the hospital 26 days after the rash developed. During lamotrigine's premarketing clinical trials, the manufacturer reported several cases of Stevens-Johnson syndrome and TEN. There are several published case reports of lamotrigine-induced severe skin reactions. All of these reports included patients being treated with both valproic acid and lamotrigine. Our patient was exposed to phenytoin, carbamazepine, clindamycin, and lamotrigine, but not valproic acid. The patient reported prior use of phenytoin with no skin rash. Carbamazepine was the antiepileptic drug the patient was maintained on prior to his hospital admission, and the symptoms of TEN resolved while he was still receiving carbamazepine. The patient received only two doses of clindamycin, which makes this agent an unlikely cause of TEN. Because of the temporal relationship of the onset of the patient's rash and several drugs that are known to cause severe rashes, it is not certain which drug was the definite culprit. However, based on the evidence from the literature, lamotrigine appears to be the causative agent.

  3. Phenolphthalein-induced toxic epidermal necrolysis.

    Science.gov (United States)

    Artymowicz, R J; Childs, A L; Paolini, L

    1997-10-01

    To report a case of phenolphthalein-induced toxic epidermal necrolysis (TEN) in a patient maintained on several other medications more commonly known to be associated with TEN. A 78-year-old white man presented with intractable lower back pain and constipation. On day 1 of admission, the patient exhibited a diffuse urticarial rash over his trunk and extremities. History revealed that the patient had taken a combination phenolphthalein/docusate sodium (Correctol) over-the-counter laxative 1 day prior to admission. He had a similar urticarial rash 1.5 years earlier with this product and was instructed not to use it. A biopsy was performed and evidence from light microscopic analysis of the tissue led to a diagnosis of TEN. Furosemide, spironolactone, allopurinol, and hydroxyurea were considered possible causes of the reaction and were discontinued. Despite this, the lesions worsened in severity. The patient subsequently responded well to intravenous antibiotics, intravenous corticosteroids, and local wound care. Furosemide, spironolactone, hydroxyurea, allopurinol, and docusate were all reintroduced without reactivation of the lesions. Phenolphthalein is the active ingredient in several over-the-counter laxative preparations and has only rarely been reported to cause TEN. (It is no longer contained in Correctol.) To our knowledge, this case report represents only the third description of laxative-induced TEN. Although this patient had been exposed to several other medications more commonly associated with TEN, his long-term tolerance of and uneventful rechallenge with these medications exclude them as potential catalysts to this drug reaction. The patient's previous rash and the temporal relation of this event and the ingestion of phenolphthalein, as well as the similarity of this case to other reports, point to phenolphthalein as the cause of TEN in this patient. TEN is a rare disorder that can be fatal in up to 30% of patients. Clinicians should include

  4. Sjögren-like pluriglandular exocrine insufficiency after drug-induced toxic epidermal necrolysis.

    OpenAIRE

    Sabán, J.; Pais, J. R.; Rodríguez, J. L.; Boixeda, D.

    1991-01-01

    We present the case of a patient that progressively developed xerophthalmia, xerostomia, cutaneous xerosis and exocrine pancreatic insufficiency 3 months after metamizole-induced toxic epidermal necrolysis. Though the association of Sjögren's syndrome and exocrine pancreatic impairment is well established, the Sjögren-like syndrome after drug-induced toxic epidermal necrolysis in association with such a wide exocrine glandular insufficiency has not been previously described, to our knowledge.

  5. Acetaminophen induced Steven Johnson syndrome-toxic epidermal necrolysis overlap.

    Science.gov (United States)

    Khawaja, Ali; Shahab, Ahmed; Hussain, Syed Ather

    2012-05-01

    Steven Johnson Syndrome and Toxic Epidermal Necrolysis are rare but severe form of hypersensitivity inflammatory reactions to multiple offending agents including drugs. Acetaminophen is extensively used due to its analgesic and anti-pyretic properties. It is rendered to be relatively safe, with hepatotoxicity considered to be the major adverse effect. However, very few cases of Steven Johnson Syndrome and Toxic Epidermal Necrolysis have been reported with acetaminophen usage in the past. We present the case of a 40 years old lady who developed an overlap of the two condition after taking several doses of acetaminophen for fever. She presented with widespread maculopapular rash, stinging in the eyes, oral mucosal ulcerations and high grade fever. She was successfully treated with corticosteroid therapy along with the supportive treatment. This case addresses the fact, that severe hypersensitivity reactions can occur with acetaminophen which can be potentially life threatening.

  6. Stevens - Johnson Syndrome and Toxic Epidermal Necrolysis; Extensive Review of Reports of Drug-Induced Etiologies, and Possible Therapeutic Modalities

    Directory of Open Access Journals (Sweden)

    Adegbenro Omotuyi John Fakoya

    2018-03-01

    Full Text Available Stevens - Johnson Syndrome and Toxic Epidermal Necrolysis are adverse hypersensitivity reactions that affect the skin and mucous membranes. They are characterised by erythematous macules and hemorrhagic erosions of the mucous membranes. Epidermal detachments of varying degrees of severity also occur in these conditions. Various aetiologies are associated with these conditions, with adverse drug reaction being the most common. Though the worldwide incidence of these conditions is recorded as low, diverse types of medication are being observed to lead to these conditions. This review compiles information on the details of Stevens-Johnson syndrome and Toxic Epidermal Necrolysis, the pathophysiology, therapeutic management, and largely considers the drug-induced etiologies associated with these conditions.

  7. Rapidly Developing Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Viktoria Oline Barrios Poulsen

    2013-01-01

    Full Text Available Severe cutaneous reactions with potentially fatal outcomes can have many different causes. The Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are rare. They are characterized by a low incidence but high mortality, and drugs are most commonly implicated. Urgent active therapy is required. Prompt recognition and withdrawal of suspect drug and rapid intervention can result in favourable outcome. No further international guidelines for treatment exist, and much of the treatment relies on old or experimental concepts with no scientific evidence. We report on a 54-year-old man experiencing rapidly developing drug-induced severe TEN and presented multiorgan failure involving the respiratory and circulatory system, coagulopathy, and renal insufficiency. Detachment counted 30% of total body surface area (TBSA. SCORTEN = 5, indicating a mortality rate >90%. The patient was sedated and mechanically ventilated, supported with fluids and inotropes to maintain a stable circulation. Component therapy was guided by thromboelastography (TEG. The patient received plasmapheresis, and shock reversal treatment was initiated. He was transferred to a specialized intensive care burn unit within 24 hours from admittance. The initial care was continued, and hemodialysis was started. Pulmonary, circulatory, and renal sequelae resolved with intensive care, and re-epithelialization progressed slowly. The patient was discharged home on hospital day 19.

  8. Fatal Stevens-Johnson syndrome/toxic epidermal necrolysis induced by allopurinol-rituximab-bendamustine therapy.

    Science.gov (United States)

    Fallon, Michael J; Heck, Jessica N

    2015-10-01

    Stevens-Johnson syndrome/toxic epidermal necrolysis overlap is an acute hypersensitivity reaction that compromises the integrity of mucous membranes and cutaneous tissue. While the pathophysiology of this syndrome has not been fully elucidated, it is commonly associated with the medication use and carries a significant mortality risk of approximately 30%. No commonalities among causative medications have been identified, and determining the offending agent can be challenging. This case report describes fatal Stevens-Johnson syndrome/toxic epidermal necrolysis overlap in a patient after receiving his first cycle of allopurinol, rituximab, and bendamustine treatment for non-Hodgkin's B-cell lymphoma. An analysis of FDA Medwatch adverse reaction case reports involving allopurinol, rituximab, and bendamustine is also presented. © The Author(s) 2014.

  9. Toxic epidermal necrolysis, DRESS, AGEP : Do overlap cases exist?

    NARCIS (Netherlands)

    Bouvresse, Sophie; Valeyrie-Allanore, Laurence; Ortonne, Nicolas; Konstantinou, Marie Pauline; Kardaun, Sylvia H.; Bagot, Martine; Wolkenstein, Pierre; Roujeau, Jean-Claude

    2012-01-01

    Background: Severe cutaneous adverse reactions to drugs (SCARs) include acute generalized exanthematous pustulosis (AGEP), drug reaction with eosinophilia and systemic symptoms (DRESS) and epidermal necrolysis (Stevens-Johnson syndrome-toxic epidermal necrolysis [SJS-TEN]). Because of the varied

  10. A case of steroid-induced psychosis in a child having nephrotic syndrome with toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    Sae Yoon Kim

    2010-03-01

    Full Text Available Toxic epidermal necrolysis (TEN and Stevens–Johnson syndrome (SJS are rare, life-threatening mucocutaneous diseases, usually attributable to drugs and infections. Corticosteroids have been used in the management of TEN for the last 30 years. This remains controversial and is still much debated. TEN can occur despite administration of high doses of systemic corticosteroids. The psychiatric side effects of corticosteroids can include headache, insomnia, depression, and mood disorders with or without psychotic episodes. Steroid-induced psychosis is dealt with by tapering or discontinuing the steroid; antipsychotics are also sometimes used. We report a case of an 11-year-old boy who was admitted with TEN. He had also been diagnosed as having nephrotic syndrome in the past. Remission was achieved through induction therapy and by maintaining the use of steroids. After a full-dose intravenous dexamethasone for TEN, he showed psychotic symptoms. We diagnosed him as having steroid-induced psychosis. We tapered the steroid use and initiated an atypical antipsychotic medication, olazapine and intravenous immunoglobulin (IV-IG. His symptoms dramatically improved and he was discharged.

  11. Oral lesions associated with Nevirapine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis: A report of 10 cases.

    Science.gov (United States)

    Reddy, Ramana Bv; Shekar, P Chandra; Chandra, K Lalith Prakash; Aravind, Rs

    2013-09-01

    Stevens-Johnson Syndrome (SJS) and toxic epidermal necrolysis (TEN) are closely related severe, acute mucocutaneous reactions usually caused by drugs. They are acute life-threatening conditions and cause widespread necrosis of the epithelium. There is persistence of a high risk of SJS or TEN in relation to human immunodeficiency virus (HIV) infection associated with exposure to nevirapine (NVP). In this article, we present nine cases of SJS and one case of TEN in HIV-seropositive individuals who developed cutaneous, oral, ocular and genital lesions while being treated with NVP.

  12. Toxic epidermal necrolysis: a paradigm of critical illness

    Science.gov (United States)

    Estrella-Alonso, Alfonso; Aramburu, José Antonio; González-Ruiz, Mercedes Yolanda; Cachafeiro, Lucía; Sánchez, Manuel Sánchez; Lorente, José A.

    2017-01-01

    Toxic epidermal necrolysis is an adverse immunological skin reaction secondary in most cases to the administration of a drug. Toxic epidermal necrolysis, Stevens-Johnson syndrome, and multiform exudative erythema are part of the same disease spectrum. The mortality rate from toxic epidermal necrolysis is approximately 30%. The pathophysiology of toxic epidermal necrolysis is similar in many respects to that of superficial skin burns. Mucosal involvement of the ocular and genital epithelium is associated with serious sequelae if the condition is not treated early. It is generally accepted that patients with toxic epidermal necrolysis are better treated in burn units, which are experienced in the management of patients with extensive skin loss. Treatment includes support, elimination, and coverage with biosynthetic derivatives of the skin in affected areas, treatment of mucosal involvement, and specific immunosuppressive treatment. Of the treatments tested, only immunoglobulin G and cyclosporin A are currently used in most centers, even though there is no solid evidence to recommend any specific treatment. The particular aspects of the treatment of this disease include the prevention of sequelae related to the formation of synechiae, eye care to prevent serious sequelae that can lead to blindness, and specific immunosuppressive treatment. Better knowledge of the management principles of toxic epidermal necrolysis will lead to better disease management, higher survival rates, and lower prevalence of sequelae. PMID:29340540

  13. Steven-Johnson Syndrome (SJS and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Erkan Alpsoy

    2010-12-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are rare, life-threatening conditions with a high mortality rate. SJS and TEN are used to denote a group of disorders closely related to each other, characterized by extensive epidermal necrolysis, and usually induced by drugs. Keratinocyte apoptosis is the main reason for widespread epidermal detachment. Drugs or their methobolites can act as a hapten after binding to the keratinocyte surface and initiate cytotoxic immunological attack. Drug-specific CD8+cytotoxic T cells mediate keratinocyte apoptosis by the Fas/FasL pathway and perforin/granzyme pathway. Although numerous drugs have been noted as responsible, sulfonamide class of antibiotics, anticonvulsants, beta-lactam antibiotics, allopurinol, nonsteroidal anti-inflammatory drugs, nevirapine and thiacetazone are the most frequently reported causative ones. Early diagnosis and withdrawal of suspected drug or drugs are one of the most important steps in the treatment. Other diseases resembling SJS/TEN should be excluded as soon as possible. Although various topical and systemic treatments have recently been used, ideal supportive care is still the most important and effective therapeutic approach. SCORTEN, a scoring system used to predict mortality in TEN, has been widely used in recent years. Transfer to a burn unit or intensive care unit is recommended for patients with a SCORTEN 3 (mortality rate; 35.3% or over. In this paper, we aimed to review clinical findings, aetiopathogenesis and treatment of these syndromes in the light of current literature.

  14. Griseofulvin and/or Terbinafine Induced Toxic Epidermal Necrolysis in an Adult Female Patient - A Case Report.

    Science.gov (United States)

    Jadeja, Dharamvirsinh; Jaiswal, Chandra S; Panchasra, Ashwin; Tripathi, Chandrabhanu B

    2016-01-01

    An 18 years old female patient, who was taking treatment for tinea cruris developed Toxic Epidermal Necrolysis (TEN) due to therapeutic dose of griseofulvin with concomitant use of terbinafine. Both the drugs were stopped; patient's condition was gradually improved after starting the treatment. As per WHO-UMC causality assessment criteria, association between reaction and drug was possible (for both griseofulvin and terbinafine). Griseofulvin and terbinafine, both are widely used as an oral antifungal agent to treat fungal infections, careful monitoring is required in the initial periods of the treatment to prevent such type of serious adverse drug reaction. We report a case of TEN possibly caused by griseofulvin with concomitant use of terbinafine resulting in diagnostic difficulty.

  15. Fatal toxic epidermal necrolysis associated with minoxidil.

    Science.gov (United States)

    Karaoui, Lamis R; Chahine-Chakhtoura, Corinne

    2009-04-01

    Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this

  16. Fatal Toxic Epidermal Necrolysis Induced by Carbamazepine Treatment in a Patient Who Previously had Carbamazepine-induced Stevens-Johnson Syndrome

    Directory of Open Access Journals (Sweden)

    Li-Yen Huang

    2007-12-01

    Full Text Available Toxic epidermal necrolysis (TEN is a rare but life-threatening skin disease that is most commonly drug-induced. It has recently been suggested that Stevens-Johnson syndrome (SJS belongs to the same group of skin disorders, although it has a lower mortality rate than TEN. We report the case of a 26-year-old male schizophrenic patient with a history of carbamazepine-induced SJS 5 years earlier. At the time of his current admission, he was admitted to our psychiatry department with acute agitation due to schizophrenia. However, the patient and his family denied history of drug allergy. After 3 days of carbamazepine treatment, the patient developed TEN (body surface area > 90%. He was transferred to the burn center, but despite appropriate treatment, including intravenous hydrocortisone 200 mg q6h and being covered with sterile biological material, he died. It is important to note that re-administration of a drug that previously caused SJS may lead to TEN, which has a very high mortality rate.

  17. Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

    African Journals Online (AJOL)

    Stevens-Johnson syndrome (SJS) is a form of toxic epidermal necrolysis (TEN) a rare but life-threatening hypersensitivity reactions that affect the skin and mucous membranes. The most common triggers are drugs, but they can also be triggered by infections. Granulysin has been recently identified as the major molecule ...

  18. Steven johnsons syndrome and toxic epidermal necrolysis: A review

    OpenAIRE

    Sri ram Anne; Sreya Kosanam; Lakshmi Prasanthi N

    2014-01-01

    Toxic epidermal necrolysis (TEN) and Stevens Johnson Syndrome (SJS) are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infection...

  19. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Science.gov (United States)

    2010-01-01

    Toxic epidermal necrolysis (TEN) and Stevens Johnson Syndrome (SJS) are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP), disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS). Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis using SCORTEN

  20. Steven johnsons syndrome and toxic epidermal necrolysis: A review

    Directory of Open Access Journals (Sweden)

    Sri ram Anne

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.

  1. Association of CYP2C9*3 with phenytoin-induced Stevens-Johnson syndrome and toxic epidermal necrolysis: A systematic review and meta-analysis.

    Science.gov (United States)

    Wu, X; Liu, W; Zhou, W

    2017-12-23

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe cutaneous adverse reactions that can be induced by phenytoin (PHT). CYP2C9*3 is the key enzyme in PHT metabolism. The aim of this meta-analysis was to evaluate the association between CYP2C9*3 and PHT-induced SJS/TEN. An extensive search was performed in multiple databases, including the Cochrane Library, EMBASE, PubMed, OVID and EBSCO. Studies exploring the relationship between CYP2C9*3 and PHT-induced SJS and TEN were included. Odds ratios (ORs) with corresponding 95% confidence intervals (CI) were calculated for dichotomous data. Data analysis was performed using Review Manager (version 5.3). Four studies, with 117 PHT-induced SJS/TEN cases and 338 matched controls (PHT-tolerant patients) or 4231 population controls (general population), were identified. SJS and TEN were found to be significantly associated with the CYP2C9*3 allele, comparing both matched controls (OR, 8.93; 95% CI, 2.63-30.36; P = .0005) with substantial heterogeneity (I 2  = 46%) and population controls (OR, 8.88; 95% CI, 5.01-15.74; P < .00001). A significant association between CYP2C9*3 and PHT-induced SJS/TEN was identified, especially in a Thai population. CYP2C9*3 is thus a credible predictive genetic marker of PHT-induced SJS/TEN. Further multicenter studies and large prospective observational studies are, however, still required to determine the influence of CYP2C*3 on blood levels of PHT and its metabolites, and their association with SJS/TEN. © 2017 John Wiley & Sons Ltd.

  2. Association of human leukocyte antigen variants and allopurinol-induced Stevens-Johnson syndrome and toxic epidermal necrolysis: A meta-analysis.

    Science.gov (United States)

    Li, Xingang; Zhao, Zhigang; Sun, Shu-Sen

    2017-05-01

    The association between human leukocyte antigen (HLA) variants and allopurinol-induced Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) was evaluated through a pooled analysis of published studies. A comprehensive search was performed in multiple databases, including PubMed, MEDLINE, ISI Web of Knowledge, EMBASE, Cochrane Register of Controlled Trials, and Science Direct. Studies investigating the association between HLA alleles with allopurinol-induced SJS or TEN were retrieved, and the data were independently extracted. The overall odds ratios (ORs) with corresponding 95% confidence intervals were calculated to determine the association between the presence of HLA variant in at least one allele and allopurinol-induced SJS or TEN. To test the robustness of the meta-analysis results, a sensitivity analysis was performed by removing each study one at a time and calculating the pooled ORs of the remaining studies. The fixed-effects and random-effects models were used to pool the collected data. A total of 4 studies with 81 allopurinol-induced SJS or TEN cases and matched controls (allopurinol-tolerant patients) or population controls (general population) were identified. SJS and TEN were found to be significantly associated with HLA-A*33:03 and HLA-C*03:02 alleles in both groups of studies with matched controls and population controls. All of the pooled ORs were not significantly affected by the remaining studies and different modeling methods, indicating robust results. A strong association was found between HLA-A*33:03 and HLA-C*03:02 alleles and allopurinol-induced SJS or TEN, especially in an Asian population. Copyright © 2017 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

  3. Relationship between the HLA-B*1502 allele and carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis: a systematic review and meta-analysis.

    Science.gov (United States)

    Tangamornsuksan, Wimonchat; Chaiyakunapruk, Nathorn; Somkrua, Ratchadaporn; Lohitnavy, Manupat; Tassaneeyakul, Wichittra

    2013-09-01

    The US Food and Drug Administration recommends screening for the HLA-B*1502 allele before initiation of carbamazepine therapy in patients of Asian ancestry, but there remains unclear evidence of a relationship between HLA-B*1502 and Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) among carbamazepine users, especially in some racial/ethnic populations. To determine the relationship between the HLA-B*1502 allele and carbamazepine-induced SJS and TEN. A comprehensive search of the following data sources was performed without language restriction from the inception of the database until January 8, 2013: EMBASE, PubMed, clinicaltrials.gov, Cochrane Library, IPA (International Pharmaceutical Abstracts), HuGENet (Human Genome Epidemiology Network), and CINAHL (Cumulative Index to Nursing and Allied Health Literature), and the reference lists of identified studies. Inclusion criteria were studies that investigated the relationship between HLA-B*1502 and carbamazepine-induced SJS and TEN and that reported sufficient data for calculating the frequency of HLA-B*1502 carriers among cases and controls. The search yielded 525 articles, of which 16 met the inclusion criteria. The studies included 227 SJS or TEN cases, 602 matched control subjects, and 2949 population control subjects. Two reviewers independently extracted the following data: study design, eligibility criteria, diagnostic criteria, patient demographics, genotype distribution, HLA-B genotyping technique, selection of cases and controls, dosage of carbamazepine and duration of use, and results of Hardy-Weinberg equilibrium in the control group. The Newcastle-Ottawa Scale was used to assess the quality of studies. The overall odds ratios (ORs) with corresponding 95% CIs were calculated using a random-effects model. The primary analysis was based on matched control studies. Subgroup analyses by race/ethnicity were also performed. The primary outcome was carbamazepine-induced SJS and TEN. The

  4. Toxic epidermal necrolysis - management issues and treatment options.

    Science.gov (United States)

    Widgerow, Alan D

    2011-01-01

    Toxic epidermal necrolysis (TEN) and Steven-Johnson syndrome (SJS) are characterized by extensive necrosis and cleavage of the epidermis from the dermis akin to a superficial or partial thickness burn. Sepsis is the usual cause of mortality but much of the pathophysiologic process results from an outpouring of cytokines and matrixmetalloproteinases (MMPs) which have a destructive effect on the extracellular matrix and may play a part in the epidermal/dermal cleavage seen with this disease. Recent attention has been focused on the modulation of proteases in an attempt to decrease the MMP-mediated destruction. Nanocrystalline silver (NCS) is one such agent that has good anti-microbial efficacy, but is also effective in modulating MMP levels. Twelve cases of confirmed TEN that were treated with NCS were analyzed with a view to assessing efficacy and setting logical guidelines for managing this condition, particularly in relation to immunosupressed patients. From this study important issues have been highlighted for discussion.

  5. Incidence, outcomes, and resource use in children with Stevens-Johnson syndrome and toxic epidermal necrolysis.

    Science.gov (United States)

    Antoon, James W; Goldman, Jennifer L; Lee, Brian; Schwartz, Alan

    2018-01-09

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are life-threatening cutaneous reactions, typically to drugs or infection. The incidence and outcomes of these conditions in children are unknown. The objective of this study was to report the overall burden of Stevens-Johnson syndrome and toxic epidermal necrolysis in children in the United States. We performed a retrospective cohort analysis of children and adolescents younger than 18 years of age using the 2009 and 2012 Kids' Inpatient Database. We identified 1486 children and adolescents hospitalized with a diagnosis of Stevens-Johnson syndrome or toxic epidermal necrolysis. The national incidence per 100 000 was 6.3 for Stevens-Johnson syndrome, 0.7 for Stevens-Johnson syndrome/toxic epidermal necrolysis overlap syndrome, and 0.5 for toxic epidermal necrolysis. The highest incidence in children was in those aged 11-15 years (38.4 per 100 000). Toxic epidermal necrolysis and Stevens-Johnson syndrome/toxic epidermal necrolysis overlap syndrome were associated with longer stay, greater mortality, and higher hospital charges than those with Stevens-Johnson syndrome. Hospital mortality was highest in children with toxic epidermal necrolysis and in children aged 0-5 years. The incidence of Stevens-Johnson syndrome and toxic epidermal necrolysis in children is higher than reported in adults, and there are significant age-based variations in incidence and outcomes across the pediatric population. Further study is needed to determine the most effective treatment strategies to reduce costs and improve outcomes in children hospitalized with severe cutaneous reactions. © 2018 Wiley Periodicals, Inc.

  6. Current Perspectives on Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Lerch, Marianne; Mainetti, Carlo; Terziroli Beretta-Piccoli, Benedetta; Harr, Thomas

    2018-02-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are considered a delayed-type hypersensitivity reaction to drugs. They represent true medical emergencies and an early recognition and appropriate management is decisive for the survival. SJS/TEN manifest with an "influenza-like" prodromal phase (malaise, fever), followed by painful cutaneous and mucous membrane (ocular, oral, and genital) lesions, and other systemic symptoms. The difference between SJS, SJS/TEN overlap, and TEN is defined by the degree of skin detachment: SJS is defined as skin involvement of  30%, and SJS/TEN overlap as 10-30% skin involvement. The diagnosis of different degrees of epidermal necrolysis is based on the clinical assessment in conjunction with the corresponding histopathology. The mortality rates for SJS and TEN have decreased in the last decades. Today, the severity-of-illness score for toxic epidermal necrolysis (SCORTEN) is available for SJS/TEN severity assessment. Drugs with a high risk of causing SJS/TEN are anti-infective sulfonamides, anti-epileptic drugs, non-steroidal anti-inflammatory drugs of the oxicam type, allopurinol, nevirapine, and chlormezanone. Besides conventional drugs, herbal remedies and new biologicals should be considered as causative agents. The increased risk of hypersensitivity reactions to certain drugs may be linked to specific HLA antigens. Our understanding of the pathogenesis of SJS/TEN has improved: drug-specific T cell-mediated cytotoxicity, genetic linkage with HLA- and non-HLA-genes, TCR restriction, and cytotoxicity mechanisms were clarified. However, many factors contributing to epidermal necrolysis still have to be identified, especially in virus-induced and autoimmune forms of epidermal necrolysis not related to drugs. In SJS/TEN, the most common complications are ocular, cutaneous, or renal. Nasopharyngeal, esophageal, and genital mucosal involvement with blisters, erosions as well as secondary development of strictures

  7. Effectiveness, safety and tolerability of cyclosporine versus supportive treatment in Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis: A record-based study.

    Science.gov (United States)

    Mohanty, Swosti; Das, Anupam; Ghosh, Anupama; Sil, Amrita; Gharami, Ramesh Chandra; Bandyopadhyay, Debabrata; Das, Nilay Kanti

    2017-01-01

    Toxic epidermal necrolysis and Stevens-Johnson syndrome comprise life-threatening, drug-induced mucocutaneous disease spectrum. Interest in cyclosporine, a calcineurin inhibitor that can block the function of T-cells, has increased with the discovery of the importance of granulysin in apoptosis in toxic epidermal necrolysis. In our hospital, cyclosporine is given to Stevens-Johnson syndrome/toxic epidermal necrolysis patients as an adjunctive therapy. This study is an observational, record-based study comparing the effectiveness and safety of patients receiving cyclosporine versus only supportive therapy. Medical records as bed-head tickets and laboratory investigation reports of Stevens-Johnson syndrome/toxic epidermal necrolysis patients admitted in the hospital over a period of 1 year were collected. Data regarding clinico-demographic profile, suspected drug causing Stevens-Johnson's syndrome/toxic epidermal necrolysis, SCORTEN, body surface area involved, treatment received and outcome were obtained. Twenty-eight patients were analyzed. Nineteen belonged to the cyclosporine group (supportive treatment + cyclosporine), nine to supportive treatment only group. Among the suspected drugs, antiepileptics formed the major group (28.6%). Five patients in the supportive only group and one in the cyclosporine group died. Time for stabilization and reepithelialization and duration of recovery were significantly lower in the cyclosporine group (P Stevens-Johnson syndrome/toxic epidermal necrolysis may decrease the risk of dying, may provide faster healing of lesions and might lead to early discharge from hospital.

  8. A case report on toxic epidermal necrolysis with etoricoxib.

    Science.gov (United States)

    Kameshwari, J S; Devde, Raju

    2015-01-01

    Etoricoxib is a selective cyclo-oxygenase 2 (COX-2) enzyme inhibitor and is exploited for its analgesic activity in various disease conditions like osteoarthritis, gouty arthritis, acute pain including postoperative dental pain and primary dysmenorrhea, etc. Although highly efficacious in pain management the safety profile of this COX-2 inhibitor is yet to be established in a broader sense. Short-term clinical trials and postmarketing surveillance have shown a very rare incidence of very serious skin reactions like Steven Johnson syndrome or toxic epidermal necrolysis (TEN). In this case report, we summarize regarding a patient who developed TEN after treatment with etoricoxib for osteoarthritis that later resolved in 15 days after withdrawal and symptomatic treatment.

  9. Collagen sheet dressings for cutaneous lesions of toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    S Bhattacharya

    2011-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is associated with a significant mortality of 30-50% and long-term sequelae. Treatment includes early admission to a burn unit, where management with precise fluid, electrolyte, protein, and energy supplementation, moderate mechanical ventilation, and expert wound care can be provided. Specific treatment with immunosuppressive drugs or immunoglobulins did not show an improved outcome in most studies and remains controversial. We have treated the cutaneous lesions of seven patients of TEN with collagen sheet dressings and have found a significant reduction in morbidity. The sheets are a one-time dressing, easy to apply and they reduce fluid loss, prevent infection, reduce pain, avoid repeated dressings and gradually peal off as the underlying lesions heal.

  10. Perforated Sigmoid Diverticulitis in the Presence of Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    P. Heye

    2014-02-01

    Full Text Available Even though the incidence of toxic epidermal necrolysis (TEN is low, it is also associated with a high mortality rate. The condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. We present a case of perforated sigmoid diverticulitis in the presence of TEN. The patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of TEN. Characteristic abdominal symptoms, however, were missing. Gastrointestinal involvement in TEN appears to be a poor prognostic factor; medical staff must therefore be alert to patients with TEN who complain of abdominal discomfort. The exact pathogenesis, however, remains unclear.

  11. Toxic epidermal necrolysis associated with deflazacort therapy with nephrotic syndrome

    Directory of Open Access Journals (Sweden)

    Eun Chae Lee

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN is a drug-related fatal disease. Extensive necrosis of the epidermis can lead to serious complications. This report describes two cases of TEN, associated with deflazacort (DFZ, in two boys, aged 4 years and 14 years, with nephrotic syndrome (NS. The 14-year-old male teenager received DFZ following NS relapse. After 17 days, pruritic papules appeared on the lower extremities. Another case involved a 4-year-old boy receiving DFZ and enalapril. After a 41-day DFZ treatment period, erythematous papules appeared on the palms and soles. Within 3 days, both boys developed widespread skin lesions (>50% and were admitted to the intensive care unit for resuscitative and supportive treatment. The patients showed improvement after intravenous immunoglobulin-G therapy. Owing to the rapid, fatal course of TEN, clinicians need to be aware of the adverse effects of this drug when treating cases of NS.

  12. Perforated sigmoid diverticulitis in the presence of toxic epidermal necrolysis.

    Science.gov (United States)

    Heye, P; Descloux, A; Singer, G; Rosenberg, R; Kocher, T

    2014-01-01

    Even though the incidence of toxic epidermal necrolysis (TEN) is low, it is also associated with a high mortality rate. The condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. We present a case of perforated sigmoid diverticulitis in the presence of TEN. The patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of TEN. Characteristic abdominal symptoms, however, were missing. Gastrointestinal involvement in TEN appears to be a poor prognostic factor; medical staff must therefore be alert to patients with TEN who complain of abdominal discomfort. The exact pathogenesis, however, remains unclear.

  13. Steven’s Johnson Syndrome and Toxic Epidermal Necrolysis in Children

    OpenAIRE

    Hakan Turan; Sevgül Vatansever; Özlem Özdemir; Yakup Canıtez; Hayriye Sarıcaoğlu

    2008-01-01

    Aim: The aim of this study was to consider clinical features, laboratory findings, treatment alternatives, complications and responsible agents of Steven’s Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) in childhood. Materials and Method: The patients who were diagnosed with Steven’s Johnson syndrome (SJS) or Toxic Epidermal Necrolysis (TEN) and followed by Department of Dermatology, Division of Pediatric Neurology and Division of Pediatric Allergy of Uludag University Faculty of...

  14. Toxic Epidermal Necrolysis in an Irradiated Patient Treated with a Nanocrystalline Silver Dressing

    OpenAIRE

    Vern-Gross, Tamara Z.; Kowal-Vern, Areta; Poulakidas, Stathis J.

    2012-01-01

    Toxic epidermal necrolysis syndrome is a severe exfoliative condition, which may be triggered by anticonvulsant medication. We report a case of toxic epidermal necrolysis syndrome in a 43-year-old female who was receiving radiotherapy for brain metastases from a recurring breast cancer and phenytoin. She had 80% total body surface area involvement and recovered successfully with the application of a nanocrystalline silver dressing.

  15. Toxic Epidermal Necrolysis in an Irradiated Patient Treated with a Nanocrystalline Silver Dressing

    Directory of Open Access Journals (Sweden)

    Tamara Z. Vern-Gross

    2012-03-01

    Full Text Available Toxic epidermal necrolysis syndrome is a severe exfoliative condition, which may be triggered by anticonvulsant medication. We report a case of toxic epidermal necrolysis syndrome in a 43-year-old female who was receiving radiotherapy for brain metastases from a recurring breast cancer and phenytoin. She had 80% total body surface area involvement and recovered successfully with the application of a nanocrystalline silver dressing.

  16. Toxic epidermal necrolysis, DRESS, AGEP: Do overlap cases exist?

    Directory of Open Access Journals (Sweden)

    Bouvresse Sophie

    2012-09-01

    Full Text Available Abstract Background Severe cutaneous adverse reactions to drugs (SCARs include acute generalized exanthematous pustulosis (AGEP, drug reaction with eosinophilia and systemic symptoms (DRESS and epidermal necrolysis (Stevens-Johnson syndrome–toxic epidermal necrolysis [SJS-TEN]. Because of the varied initial presentation of such adverse drug reactions, diagnosis may be difficult and suggests overlap among SCARs. Overlapping SCARs are defined as cases fulfilling the criteria for definite or probable diagnosis of at least 2 ADRs according to scoring systems for AGEP, DRESS and SJS-TEN. We aimed to evaluate the prevalence of overlap among SCARs among cases in the referral hospital in France. Methods We retrospectively analyzed data for 216 patients hospitalized in the referral centre over 7 years with a discharge diagnosis of AGEP (n = 45, DRESS (n = 47, SJS-TEN (n = 80 or “drug rash” (n = 44. Each case with detailed clinical data and a skin biopsy specimen was scored for AGEP, DRESS and SJS-TEN by use of diagnostic scores elaborated by the RegiSCAR group. Results In total, 45 of 216 cases (21% had at least 2 possible diagnoses: 35 had a single predominant diagnosis (definite or probable, 7 had several possible diagnoses and 3 (2.1% of 145 confirmed SCARs were overlap SCARs. Conclusions Despite ambiguities among SCARs, confirmed overlap cases are rare. This study did not avoid pitfalls linked to its retrospective nature and selection bias. In the acute stage of disease, early identification of severe ADRs can be difficult because of clinical or biologic overlapping features and missing data on histology, biology and evolution. Retrospectively analyzing cases by use of diagnostic algorithms can lead to reliable discrimination among AGEP, DRESS and SJS-TEN.

  17. Stevens-Johnson syndrome and toxic epidermal necrolysis: a review

    Directory of Open Access Journals (Sweden)

    Anthony Wong

    Full Text Available SUMMARY Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are uncommon, acute and potentially life-threatening adverse cutaneous drug reactions. These pathologies are considered a hypersensitivity reaction and can be triggered by drugs, infections and malignancies. The drugs most often involved are allopurinol, some antibiotics, including sulfonamides, anticonvulsants such as carbamazepine, and some non-steroid anti-inflammatory drugs (NSAIDs. Necrosis of keratinocytes is manifested clinically by epidermal detachment, leading to scalded skin appearance. The rash begins on the trunk with subsequent generalization, usually sparing the palmoplantar areas. Macular lesions become purplish, and epidermal detachment occurs, resulting in flaccid blisters that converge and break, resulting in extensive sloughing of necrotic skin. Nikolsky's sign is positive in perilesional skin. SJS and TEN are considered to be two ends of the spectrum of one disease, differing only by their extent of skin detachment. Management of patients with SJS or TEN requires three measures: removal of the offending drug, particularly drugs known to be high-risk; supportive measures and active interventions. Early diagnosis of the disease, recognition of the causal agent and the immediate withdrawal of the drug are the most important actions, as the course of the disease is often rapid and fatal.

  18. Research Directions in Genetic Predispositions to Stevens-Johnson Syndrome / Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Manolio, Teri A; Hutter, Carolyn M; Avigan, Mark; Cibotti, Ricardo; Davis, Robert L; Denny, Joshua C; Grenade, Lois La; Wheatley, Lisa M; Carrington, Mary N; Chantratita, Wasun; Chung, Wen-Hung; Dalton, Andrea D; Hung, Shuen-Iu; Lee, Ming Ta Michael; Leeder, J Steven; Lertora, Juan J L; Mahasirimongkol, Surakameth; McLeod, Howard L; Mockenhaupt, Maja; Pacanowski, Michael; Phillips, Elizabeth J; Pinheiro, Simone; Pirmohamed, Munir; Sung, Cynthia; Suwankesawong, Wimon; Trepanier, Lauren; Tumminia, Santa J; Veenstra, David; Yuliwulandari, Rika; Shear, Neil H

    2018-03-01

    Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) is one of the most devastating of adverse drug reactions (ADRs) and was, until recently, essentially unpredictable. With the discovery of several risk alleles for drug-induced SJS/TEN and the demonstration of effectiveness of screening in reducing incidence, the stage is set for implementation of preventive strategies in populations at risk. Yet much remains to be learned about this potentially fatal complication of commonly used drugs. © 2017 American Society for Clinical Pharmacology and Therapeutics.

  19. A review of toxic epidermal necrolysis management in Japan

    Directory of Open Access Journals (Sweden)

    Yuri Kinoshita

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

  20. Severe flucloxacillin-induced acute generalized exanthematous pustulosis (AGEP), with toxic epidermal necrolysis (TEN)-like features : does overlap between AGEP and TEN exist? Clinical report and review of the literature

    NARCIS (Netherlands)

    van Hattem, S.; Beerthuizen, G. I.; Kardaun, S. H.

    2014-01-01

    Acute generalized exanthematous pustulosis (AGEP) and Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) are rare but severe cutaneous adverse drug reactions. Especially in TEN, large areas of the skin and mucosae may become detached. Although AGEP and SJS/TEN are distinct entities with

  1. Pediatric Toxic Epidermal Necrolysis: Experience of a Tertiary Burn Center.

    Science.gov (United States)

    Rizzo, Julie A; Johnson, Rebekah; Cartie, Richard J

    2015-01-01

    Pediatric toxic epidermal necrolysis (TEN) is a rare and potentially fatal skin disease with a multitude of causative factors and no consensus on treatment guidelines and, as a result, it has a variety of short- and long-term outcomes. We present the experience of a large specialty burn center to share our diagnostic and treatment principles. A retrospective review from 1989 to 2010 at the Joseph M. Still Burn Center was performed to find patients with a diagnosis of Steven-Johnson syndrome (SJS) or TEN. Information was obtained on demographic and physiologic parameters such as age, race, total body surface area involved, treatments, hospital stay, and need for ventilator support. We identified SJS or TEN in 21 patients. Prescription drugs were the most common etiology (in 15 patients), with antibiotics as the most common causative agent. Histology confirmed the clinical diagnosis of TEN in 14 patients. Our treatment plan included a multidisciplinary team, early initiation of intravenous immunoglobulin, bronchoscopy, strict management of electrolyte and fluid balances, and meticulous surgical wound care. Mortality was 9.5%. Our experience in treating this rare but devastating disease affords us the opportunity to share the diagnostic dilemmas we faced and the treatment principles we used to treat this unique patient population successfully. © 2015 Wiley Periodicals, Inc.

  2. Drug-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in children: 20 years study in a tertiary care hospital.

    Science.gov (United States)

    Techasatian, Leelawadee; Panombualert, Sunee; Uppala, Rattapon; Jetsrisuparb, Charoon

    2017-06-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe lifethreatening skin conditions. The most common cause of these manifestations is medications. Beside discontinued of the culprit drug, systemic corticosteroids were used as a primary treatment option among pediatric population. This study aimed to explore causative drugs (drug group/ latent period), treaments, complications, and treatment outcome (morbidity, mortality, length of hospital stay) of SJS and TEN in children. A retrospective chart was reviewed during the period of 1992 to 2012 at Srinagarind Hospital, Faculty of Medicine, Khon Kaen University, Thailand. SJS and TEN were clinically diagnosed and confirmed by pediatric dermatologists. Other possible causes other than druginduced SJS and TEN were excluded. A total of 30 patients was recorded, including 24 (80%) SJS patients and 6 (20%) TEN patients. The mean age was 6.9 years (SD 4.4). Male to female ratio was 1.5:1. Antiepileptic drug group was the most common causative drug (n=18, 60%), followed by antibiotic drug group (n=8, 26.6%), and others (n=4, 13.3%) which included nonsteroidal antiinflammtory drugs (NSAIDs) and chemotherapy drugs. Systemic corticosteroids were used in 29 patients (96.6%). Intravenous immunoglobulin was used in one TEN patient (3.3%). There was a medium correlation between time to treatment (systemic corticosteroids) and the length of hospital stay (Spearman correlation coefficient=0.63, P=0.005). Two TEN patients (6.6%) died. Carbamazepine was the most common causative drug of SJS and TEN in our study. The severity of skin detachment is not correlated to severity of ocular findings. However, the persistent of ocular complications up to one year is suggested for promptly appropriate ocular treatment in all SJS and TEN patients. Our data suggested that early administration of systemic corticosteroid may reduce the length of hospital stay and should be considered for the treatment of pediatric

  3. Stevens-Johnson syndrome and toxic epidermal necrolysis at the University Hospital of the West Indies, Jamaica.

    Science.gov (United States)

    East-Innis, A D; Thompson, D S

    2013-09-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are uncommon acute dermatologic disorders. The purpose of this study was to examine the frequency, aetiology and outcome of cases of Stevens-Johnson syndrome and toxic epidermal necrolysis admitted to the dermatology ward at the University Hospital of the West Indies. This was a retrospective study looking at all patients who were admitted with a diagnosis of Stevens-Johnson syndrome, Stevens-Johnson syndrome/toxic epidermal necrolysis overlap syndrome and toxic epidermal necrolysis over a nine-year period. The results showed almost equal numbers of males and females. The drugs most commonly implicated were phenytoin and cotrimoxazole. The most common complications were hepatic impairment and ophthalmic complications. Stevens-Johnson syndrome and toxic epidermal necrolysis contribute significantly to morbidity and mortality of patients on the dermatology ward although mortality was low compared to other studies.

  4. Toxic epidermal necrolysis associated with severe cytomegalovirus infection in a patient on regular hemodialysis.

    Directory of Open Access Journals (Sweden)

    Dina Khalaf

    2011-01-01

    Full Text Available Primary illness with cytomegalovirus leads to latent infection with possible reactivations especially in the immunocompromised patients. Toxic epidermal necrolysis is an immune mediated cytotoxic reaction. A fifty years old female diabetic hypertensive patient with end stage renal disease was admitted with fever of unknown origin, constitutional symptoms, vague upper gastrointestinal symptoms and skin rash. Upper gastrointestinal endoscopic biopsy confirmed her diagnosis with cytomegalovirus esophagitis and duodenitis. Cytomegalovirus immunoglobulin M and immunoglobulin G levels were negative but polymerase chain reaction showed fulminant viremia. Biopsy of the skin rash was consistent with toxic epidermal necrolysis. Despite treatment with Ganciclovir, intravenous immunoglobulins, and granulocyte colony stimulating factor the patient’s condition rapidly deteriorated and she died due to multiorgan failure, disseminated intravascular coagulopathy and overwhelming sepsis. Probably there is a true association linking toxic epidermal necrolysis to fulminant reactivation of cytomegalovirus. The aim of this anecdote is reporting a newly recognized presentation of cytomegalovirus.

  5. Toxic Epidermal Necrolysis-Like Lesions and Systemic Lupus Erythematosus Possibly Triggered by Sulfasalazine

    DEFF Research Database (Denmark)

    Krabbe, Simon; Gül, Cigdem; Andersen, Bjarne

    2016-01-01

    This case report describes a patient with arthritis of the large joints, bilateral sacroiliitis, and positive anti-SSA and anti-dsDNA antibody, who received sulfasalazine and shortly thereafter became critically ill. He developed toxic epidermal necrolysis, hemolytic anemia, lymphopenia, markedly...

  6. Stevens-Johnson syndrome progressing to toxic epidermal necrolysis with haloperidol and carbamazepine combination

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2011-01-01

    Full Text Available Carbamazepine and other anticonvulsants are commoner cause of severe adverse cutaneous drug reactions such as erythema multiforme, toxic epidermal necrolysis (TEN, and Stevens-Johnson syndrome (SJS. We report a case of SJS rapidly progressing to TEN with a combination of haloperidol and carbamazepine in a patient with bipolar affective disorder. The pathophysiological mechanism underlying this reaction is discussed.

  7. Dexamethasone pulse therapy for Stevens-Johnson syndrome/toxic epidermal necrolysis

    NARCIS (Netherlands)

    Kardaun, Sylvia H.; Jonkman, Marcel F.

    2007-01-01

    Mortality in Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) is high. Apart from intensive supportive therapy, no generally accepted specific treatment regimen exists. The role of corticosteroids in SJS/TEN is controversial. It is possible that high-dose pulse therapy with

  8. Successful dexamethasone pulse therapy in a toxic epidermal necrolysis (TEN) patient featuring recurrent TEN to oxazepam

    NARCIS (Netherlands)

    van der Meer, J B; Schuttelaar, M L; Toth, G G; Kardaun, S H; Beerthuizen, G; de Jong, M C; Jonkman, M F; Nieuwenhuis, P

    2001-01-01

    A 62-year-old female patient is described who developed toxic epidermal necrolysis (TEN) after medication with phenytoin and oxazepam. Initially phenytoin was discontinued and dexamethasone pulse therapy (1.5 mg/kg on 3 consecutive days) was initiated on the tenth day of skin disease. This resulted

  9. Comprehensive Survival Analysis of a Cohort of Patients with Stevens Johnson Syndrome and Toxic Epidermal Necrolysis

    NARCIS (Netherlands)

    Sekula, Peggy; Dunant, Ariane; Mockenhaupt, Maja; Naldi, Luigi; Bavinck, Jan Nico Bouwes; Halevy, Sima; Kardaun, Sylvia; Sidoroff, Alexis; Liss, Yvonne; Schumacher, Martin; Roujeau, Jean-Claude

    Stevens Johnson syndrome and toxic epidermal necrolysis are severe cutaneous adverse reactions that are of major concern because of high mortality rates. On the basis of data collected in the RegiSCAR study, the aim was to assess risk factors (including modalities of patient management) for

  10. Evaluation of the patients diagnosed with Stevens Johnson syndrome and toxic epidermal necrolysis: a single center experience.

    Science.gov (United States)

    Çekiç, Şükrü; Canıtez, Yakup; Sapan, Nihat

    2016-09-01

    Stevens Johnson syndrome and toxic epidermal necrolysis are severe acute mucocutaneous diseases. In this study, we evaluated the clinical aspects of Steven Johnson syndrome, toxic epidermal necrolysis and Stevens-Johnson syndrome/toxic epidermal necrolysis overlap patients who admitted to our clinics in the last five years. Eleven patients diagnosed as Stevens-Johnson syndrome, toxic epidermal necrolysis and Stevens-Johnson syndrome/toxic epidermal necrolysis overlap in Department of Pediatric Allergy in Uludağ University School of Medicine were included in this study. Clinical findings, laboratory tests and response to treatments were evaluated via electronic files. Two of the patients had Stevens-Johnson syndrome, four had Stevens-Johnson syndrome/toxic epidermal necrolysis overlap, and five had toxic epidermal necrolysis. The median period for drug usage was 10 days (2-44 days). Herpes simpleks virus IgM antibody was detected two patients. The median healing time was 38 days 26-94 days). Maculopapular eruptions and oral mucositis were seen in all patients. Vesicul or bullae, epidermal detachment and ocular involvement in 10 of patients. Wound care, H1 antihistamine and methyl prednisolon were used in all patients, intravenous immunoglobulin were used in 7 patients and cyclosporine in 1 patient. Sequel lesions developed in 2 of the patients and there was no death. Anticonvulsants, antibiotics and non steroid anti-inflammatory drugs play a major role in the etiology of Stevens-Johnson syndrome and toxic epidermal necrolysis. Anticonvulsants are associated with severe disease. The patients with proper wound care and treatment with immunosuppressive drugs can be recovered without or with minimal sequelae.

  11. Association of the HLA-B alleles with carbamazepine-induced Stevens-Johnson syndrome/toxic epidermal necrolysis in the Javanese and Sundanese population of Indonesia: the important role of the HLA-B75 serotype.

    Science.gov (United States)

    Yuliwulandari, Rika; Kristin, Erna; Prayuni, Kinasih; Sachrowardi, Qomariyah; Suyatna, Franciscus D; Menaldi, Sri Linuwih; Wichukchinda, Nuanjun; Mahasirimongkol, Surakameth; Cavallari, Larisa H

    2017-12-01

    Carbamazepine (CBZ) is a common cause of life-threatening cutaneous adverse drug reactions such as Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Previous studies have reported a strong association between the HLA genotype and CBZ-induced SJS/TEN. We investigated the association between the HLA genotype and CBZ-induced SJS/TEN in Javanese and Sundanese patients in Indonesia. Nine unrelated patients with CBZ-induced SJS/TEN and 236 healthy Javanese and Sundanese controls were genotyped for HLA-B and their allele frequencies were compared. The HLA-B*15:02 allele was found in 66.7% of the patients with CBZ-induced SJS/TEN, but only in 29.4% of tolerant control (p = 0.029; odds ratio [OR]: 6.5; 95% CI: 1.2-33.57) and 22.9% of healthy controls (p = 0.0021; OR: 6.78; 95% CI: 1.96-23.38). These findings support the involvement of HLA-B*15:02 in CBZ-induced SJS/TEN reported in other Asian populations. Interestingly, we also observed the presence of the HLA-B*15:21 allele. HLA-B*15:02 and HLA-B*15:21 are members of the HLA-B75 serotype, for which a greater frequency was observed in CBZ-induced SJS/TEN (vs tolerant control [p = 0.0078; OR: 12; 95% CI: 1.90-75.72] and vs normal control [p = 0.0018; OR: 8.56; 95% CI: 1.83-40]). Our findings suggest that screening for the HLA-B75 serotype can predict the risk of CBZ-induced SJS/TEN more accurately than screening for a specific allele.

  12. Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Wen-Hung Chung

    2010-01-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

  13. Structural modeling of HLA-B*1502/peptide/carbamazepine/T-cell receptor complex architecture: implication for the molecular mechanism of carbamazepine-induced Stevens-Johnson syndrome/toxic epidermal necrolysis.

    Science.gov (United States)

    Zhou, Peng; Zhang, Shilei; Wang, Yewang; Yang, Chao; Huang, Jian

    2016-08-01

    Drug-induced adverse reactions are a significant problem in healthcare worldwide and are estimated to cost billions of dollars annually in the United States. A portion of such reactions is observed to strongly associate with certain human leukocyte antigen (HLA) alleles; one of the strongest associations is the HLA-B*1502 protein with carbamazepine (CBZ)-induced Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) - the odds ratio value can even be higher than one thousand. The particularly strong association in CBZ-induced SJS/TEN suggests that the HLA-B*1502 is not only a genetic marker but also a participant in the pathogenesis of the disease. In the current study, we attempt to computationally model the atomic-level structure of the complete HLA-B*1502/peptide/CBZ/T-cell receptor (TCR) complex architecture based on prior knowledge obtained from epidemiological investigations as well as in vitro and in vivo assays. The model tells a different story about the molecular mechanism of CBZ-induced SJS/TEN from that previously reported for abacavir (ABC)-induced hypersensitivity (HSR); the CBZ molecule is located at the interface between HLA-B*1502/peptide and TCR, directly contacts the P3-P6 residues of antigen peptide, and bound within a pocket region encompassed by two TCR CDR3 fingers. Molecular dynamics simulation and binding energy analysis further reveal that the CBZ shows considerably high affinity to TCR over HLA-B*1502/peptide, which can tightly interact with the former rather than the latter. From the model, two hypotheses are proposed that can well explain most previous observations and are expected to guide next wet-lab experiments. This study could help to promote our understanding of the molecular mechanism and pathological implication underlying CBZ-induced SJS/TEN.

  14. Toxic epidermal necrolysis due to concomitant use of lamotrigine and valproic acid

    Directory of Open Access Journals (Sweden)

    Sukhjot Kaur

    2013-01-01

    Full Text Available Anti-epileptic drugs can be associated with a wide spectrum of cutaneous adverse reactions ranging from simple maculopapular rashes to more severe and life threatening reactions like Stevens-Johnson syndrome and toxic epidermal necrolysis. These rashes are well documented with older antiepileptic drugs like phenytoin, phenobarbitone and carbamazapine. Lamotrigine is a newer, unrelated antiepileptic drug that causes skin rashes in 3-10% of new users. Higher starting dose or rapid escalation, concurrent treatment with valproic acid, and a previous history of a rash with other antiepileptic drugs are well recognized risk factors for lamotrigine related serious rashes. We report two patients with toxic epidermal necrolysis, resulting from concomitant use of lamotrigine and valproic acid. It is emphasized that clinicians adhere to the recommended dosage guidelines and adopt a slow dose titration when initiating treatment with lamotrigine.

  15. Validation of a novel real-time PCR assay for detection of HLA-B*15:02 allele for prevention of carbamazepine - Induced Stevens-Johnson syndrome/Toxic Epidermal Necrolysis in individuals of Asian ancestry.

    Science.gov (United States)

    Nguyen, Dinh Van; Vidal, Christopher; Chu, Hieu Chi; Do, Nga Thi Quynh; Tran, Tu Thi Linh; Le, Huong Thi Minh; Fulton, Richard B; Li, Jamma; Fernando, Suran L

    2016-12-01

    Screening for the HLA-B*15:02 allele has been recommended to prevent carbamazepine (CBZ) - induced Stevens-Johnson syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) in individuals with Asian ancestry. We aimed, therefore, to develop and validate a robust and inexpensive method for detection of the HLA-B*15:02 allele. Real-time PCR using TaqMan® probes followed by SYBR® Green was used to detect the HLA-B*15:02 allele prior to treatment with CBZ therapy. A total of 121 samples were tested. The assay has a sensitivity of 100% (95% CI: 76.84-100.0%), a specificity of 100% (95% CI: 96.61-100%), a positive predictive value of 100% (95% CI: 76.84-100%) and a negative predictive value of 100.0% (95% CI: 96.61-100.0%), respectively. There was 100% agreement between our results and genotyping using Luminex SSO/SBT/SSP. The lowest limit of detection of the TaqMan® probe is 0.05ng/μl and the SYBR® Green is 0.5ng/μl of DNA. The unit cost of using the TaqMan® probe followed by SYBR® Green is only $4.7 USD. We developed a novel assay for the detection of the HLA-B*15:02 allele, which is robust, inexpensive and suitable for screening individuals of Asian ancestry in the prevention of CBZ-induced SJS/TEN. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  16. Pediatric Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Halted by Etanercept.

    Science.gov (United States)

    Gavigan, Geneviève M; Kanigsberg, Nordau D; Ramien, Michele L

    2018-02-01

    We report a case of an 11-year-old female with Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) overlap, most likely triggered by sulfamethoxazole-trimethoprim, who was treated with the combination of methylprednisolone, cyclosporine, and etanercept. Her condition stabilized and her skin involvement did not progress after the addition of etanercept. To our knowledge, this is the first report of etanercept for pediatric SJS/TEN.

  17. HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Science.gov (United States)

    2017-03-03

    MATERIAL CLASSIFIED? D YES rgj NO 4. IS THIS MATERIAL SUBJECT TO ANY LEGAL RESTRICTIONS FOR PUBLICATION OR PRESENTATION THROUGH A COLLABORATIVE...syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe cutaneous adverse drug reactions (ADRs) associated lllith significant morbidity and...Immunologic markers and enzymes associated with drug metabolism. HLA·B types in particular have been associated with ADRs; however to date these

  18. Toxic Epidermal Necrolysis-Like Lesions and Systemic Lupus Erythematosus Possibly Triggered by Sulfasalazine

    DEFF Research Database (Denmark)

    Krabbe, Simon; Gül, Cigdem; Andersen, Bjarne

    2016-01-01

    elevated ferritin, and muscle wasting. A diagnosis of systemic lupus erythematosus was made, and mycophenolate mofetil and systemic glucocorticoids brought this severe disease under control. Toxic epidermal necrolysis-like lesions and hemophagocytic syndrome have been reported as manifestations of systemic...... lupus erythematosus. This patient possibly had spondyloarthritis or an undifferentiated connective tissue disease at presentation, and we suggest, based on the timing of events, that sulfasalazine may have acted as a trigger of the severe disease manifestations....

  19. Stevens-Johnson syndrome and toxic epidermal necrolysis: epidemiological and clinical outcomes analysis in public hospitals*

    Science.gov (United States)

    Arantes, Luana Bernardes; Reis, Carmélia Santiago; Novaes, Alice Garbi; de Carvalho, Marta Rodrigues; Göttems, Leila Bernarda Donato; Novaes, Maria Rita Carvalho Garbi

    2017-01-01

    Background Adverse drug reactions are harmful and involuntary responses to drugs that occur at doses normally used for a given condition. Among them are Stevens-Johnson syndrome and toxic epidermal necrolysis, both rare and potentially fatal conditions. Objectives To analyze the epidemiological and clinical characteristics related to patients diagnosed with Stevens-Johnson syndrome and toxic epidermal necrolysis in public hospitals in the Federal District - Brazil. Methods Retrospective, cross-sectional and descriptive study, in which data were collected referring to patients hospitalized in the public healthcare system of the Federal District from 1999 to 2014. Results: Between 1999 and 2014, 86 cases of hospitalized patients with diagnosis of Stevens-Johnson syndrome and toxic epidermal necrolysis in the Federal District were reported. The majority of patients were women; the most affected age group was 0 to 10 years. Patients older than 60 years (elderly) represent 6.98% of the cases. Most patients admitted to the referral hospital were discharged. However, occurrence of deaths exceeded that of discharge in elderly patients. Limitations of the study There is fragility in the registry of hospitalization of patients, both in the hospital information system and in the medical records of the reference hospital. Conclusion There is a need for greater production and better dissemination of information on the incidence of adverse drug reactions. PMID:29166503

  20. Stevens-Johnson syndrome and toxic epidermal necrolysis: epidemiological and clinical outcomes analysis in public hospitals.

    Science.gov (United States)

    Arantes, Luana Bernardes; Reis, Carmélia Santiago; Novaes, Alice Garbi; Carvalho, Marta Rodrigues de; Göttems, Leila Bernarda Donato; Novaes, Maria Rita Carvalho Garbi

    2017-01-01

    Adverse drug reactions are harmful and involuntary responses to drugs that occur at doses normally used for a given condition. Among them are Stevens-Johnson syndrome and toxic epidermal necrolysis, both rare and potentially fatal conditions. To analyze the epidemiological and clinical characteristics related to patients diagnosed with Stevens-Johnson syndrome and toxic epidermal necrolysis in public hospitals in the Federal District - Brazil. Retrospective, cross-sectional and descriptive study, in which data were collected referring to patients hospitalized in the public healthcare system of the Federal District from 1999 to 2014. Results: Between 1999 and 2014, 86 cases of hospitalized patients with diagnosis of Stevens-Johnson syndrome and toxic epidermal necrolysis in the Federal District were reported. The majority of patients were women; the most affected age group was 0 to 10 years. Patients older than 60 years (elderly) represent 6.98% of the cases. Most patients admitted to the referral hospital were discharged. However, occurrence of deaths exceeded that of discharge in elderly patients. There is fragility in the registry of hospitalization of patients, both in the hospital information system and in the medical records of the reference hospital. There is a need for greater production and better dissemination of information on the incidence of adverse drug reactions.

  1. HLA-B*15:02 association with carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in an Indian population: a pooled-data analysis and meta-analysis.

    Science.gov (United States)

    Khor, Amy Hui-Ping; Lim, Kheng-Seang; Tan, Chong-Tin; Wong, Su-Ming; Ng, Ching-Ching

    2014-11-01

    This study aimed to investigate the prevalence and association of HLA-B*15:02 with carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis (CBZ-SJS/TEN) in the Indian population in Malaysia, which mostly originated from Southern India. HLA-B alleles in five Indian case patients with CBZ-SJS/TEN and 52 CBZ-tolerant controls, and followed by a pooled sample of seven cases from two centers in Malaysia were analyzed. Positive association for HLA-B*15:02 with CBZ-SJS/TEN was detected in Indians (40% [2/5] vs. 3.8% [2/52], odds ratio [OR] 16.7, p = 0.0349), of which 80% (4/5) of the Indian patients originated from Southern India. A pooled sample of seven cases showed stronger association between HLA-B*15:02 and CBZ-SJS/TEN (57.1% [4/7] vs. 3.8% [2/52], OR 33.3, 95% confidence interval [CI] 4.25-162.21, p = 1.05 × 10(-3)). Subsequent meta-analysis on Indians from Malaysia and India further demonstrated a significant and strong association between HLA-B*15:02 and CBZ-SJS/TEN (OR 38.54; 95% CI 6.83-217.34, p < 1.0 × 10(-4)). Our study is the first on Indians predominantly from Southern India that demonstrated HLA-B*15:02 as a strong risk factor for CBZ-SJS/TEN despite a low population allele frequency. This stressed the importance of testing for HLA-B*15:02, irrespective of the ancestral background, including populations with low allele frequency. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.

  2. Burn Center Care of Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Cartotto, Robert

    2017-07-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are rare, life-threatening, cutaneous drug reactions. Medications are the most common cause, although an infection may be responsible. A link between genetics and certain medications has been established. Clinical diagnosis should be confirmed with biopsy. When the area of epidermal detachment approaches 30%, burn center care is advisable. An ophthalmologist should be consulted to optimize ocular care. Pharmacologic interruption has been sought but there is little consensus on the most appropriate agent and no high-quality studies have been conducted to demonstrate if any of these agents lead to improved survival. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

  3. Effect of Infectious Diseases on the Pathogenesis of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Okamoto-Uchida, Yoshimi; Nakamura, Ryosuke; Sai, Kimie; Imatoh, Takuya; Matsunaga, Kayoko; Aihara, Michiko; Saito, Yoshiro

    2017-01-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe cutaneous adverse drug reactions. Recent studies have revealed that the prevalence of SJS/TEN is associated with genetic backgrounds, such as polymorphisms in human leukocyte antigens (HLAs). However, non-genetic factors contributing to the etiology of SJS/TEN are largely unknown. This study aimed to assess the involvement of concurrent infection on the pathological states of SJS/TEN, examining the severity of cutaneous symptoms and ocular involvement as well as the time to onset in drug-induced SJS/TEN patients. We recruited 257 Japanese SJS/TEN patients from June 2006 to September 2013 through a nationwide case collection network and participating hospitals and reviewed the clinical information including patient backgrounds, primary disease and medication status. Association between infection and pathological states of SJS/TEN was assessed using univariate and multivariate analyses. The concurrent infectious group of SJS/TEN patients showed a significantly higher rate of exhibiting severer dermatological and ophthalmological phenotypes and an earlier onset of SJS/TEN than the non-infectious group. Our results suggest that the infection could be a risk factor to cause severer symptoms and earlier onset of SJS/TEN.

  4. Stevens-Johnson syndrome / toxic epidermal necrolysis: an Asia-Pacific perspective

    Science.gov (United States)

    2013-01-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe cutaneous adverse reactions (SCAR) to drugs which are associated with significant morbidity and mortality. High risk drugs in Asia are similar to those reported worldwide. Human leukocyte antigen (HLA)-related risk alleles for carbamazepine and allopurinol SCAR are unique to Asians. Although prognostic scoring systems like the SCORTEN have been used for more than a decade, pitfalls and caveats need to be recognized, in particular in patients with multiple medical co-morbidities and systemic features in SJS/TEN. In centres without a tertiary Burns Centre, SJS/TEN patients can still be managed successfully in general and dermatology wards with well-executed supportive/nursing care. Controversy remains regarding the effectiveness of immunomodulation in reducing SJS/TEN morbidity, mortality and hastening re-epithelialization. Despite paucity of robust evidence, intravenous immunoglobulins and ciclosporin remain the most commonly used modalities worldwide. Acute and long-term ocular effects are an important source of morbidity for which emerging ophthalmic therapies appear promising. Quality of life issues have now become an important outcome in patients with SJS/TEN as they often impact survivors' future attitudes towards pharmacotherapy. Even though pharmacogenetic testing for high-risk drugs appears to be the panacea for preventing carbamazepine- and allopurinol-induced SJS/TEN in ethnic Asians, many issues remain before health regulators in our region can conclusively determine whether testing should be made mandatory or highly recommended as standard of care. PMID:24260726

  5. Topical Treatment for Stevens - Johnson Syndrome and Toxic Epidermal Necrolysis: A Review

    Directory of Open Access Journals (Sweden)

    Schandra Purnamawati

    2016-08-01

    Full Text Available Background: Stevens - Johnson syndrome (SJS and Toxic Epidermal Necrolysis (TEN are currently regarded to be same disease entity which differs only in the extent and severity of epidermal sloughing. Both are potentially life-threatening mucocutaneous immunologic reaction, which are most frequently induced by drug consumption. The epithelial destruction of skin and mucosal membrane can cause both acute as well as chronic/ long term outcomes in term of  late sequelae during the course of the disease. Sequelae often occur during the late phase of SJS/TEN and become a significant problem due its chronicity and severe degree of impairment, which leads to deterioration of quality of life for the patients. This may prevented or decreased in terms of intensity if the patient’s received prompt and sufficient topical therapy, particularly in managing lesions on the mucosa of the eye, oral, and genital. Objective : This review underlines topical therapies which could be delivered for management of mucocutaneous lesions from SJS/ TEN, aimed to prevent late sequelae due to SJS – TEN in order to improve the life quality of SJS – TEN survivors. Conclusion: SJS/ TEN frequently lead to late sequeale which includes skin, ocular, oral, and genital involvement. These sequelaes are often severe and chonic. Thus, may cause significant decrease in quality of life of SJS/TEN survivors. It is therefore most important to detect them early in order to manage them adequately. To date, we still have an impression that the specific sequelae of SJS – TEN are often late diagnosed and insufficiently treated. Finally, we want to emphasize that for mucosal involvement in particular, such as ocular, genital and oral involvement, a careful topical treatment have to be taken into special consideration in order to prevent severe late sequelae. 

  6. Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat

    Directory of Open Access Journals (Sweden)

    Roberta Sartori

    2016-06-01

    Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.

  7. Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: An Analysis of Triggers and Implications for Improving Prevention.

    Science.gov (United States)

    Miliszewski, Monica A; Kirchhof, Mark G; Sikora, Sheena; Papp, Anthony; Dutz, Jan P

    2016-11-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are severe mucocutaneous adverse drug reactions characterized by extensive epidermal detachment. The mortality rates have been reported to vary between 1% and 5% for Stevens-Johnson syndrome and 25% and 35% for patients with toxic epidermal necrolysis. Studies have shown that early recognition and prompt withdrawal of the causative agent leads to increased patient survival. A retrospective chart review was conducted on 64 patients admitted to Vancouver General Hospital with a diagnosis of Stevens-Johnson syndrome or toxic epidermal necrolysis from 2001 to 2011. The aim of this study was to identify the medications most often implicated in triggering Stevens-Johnson syndrome and toxic epidermal necrolysis, as well as to delineate the timeline of identification and removal of these triggers. A trigger was identified in 75% of cases. Allopurinol was the single most common offending agent (20% of cases). Anticonvulsants and antibiotics were common triggers. The offending agent was often removed at time of hospital admission/diagnosis but not at onset of symptoms. A history of prior culprit drug exposure with previous mucocutaneous adverse reaction was noted in 19% of cases with identified triggers. Asians and Native North Americans had a higher mortality than whites, and Asians more frequently had allopurinol as a trigger. The onset and high mortality rate of Stevens-Johnson syndrome/toxic epidermal necrolysis may be related to unawareness of the early signs and symptoms of Stevens-Johnson syndrome and toxic epidermal necrolysis, the common drug triggers that cause it, and what investigations (human leukocyte antigen typing in Asians) can be done to prevent it. Copyright © 2016. Published by Elsevier Inc.

  8. Cost-effectiveness analysis of HLA-B*58: 01 genetic testing before initiation of allopurinol therapy to prevent allopurinol-induced Stevens-Johnson syndrome/toxic epidermal necrolysis in a Malaysian population.

    Science.gov (United States)

    Chong, Huey Yi; Lim, Yi Heng; Prawjaeng, Juthamas; Tassaneeyakul, Wichittra; Mohamed, Zahurin; Chaiyakunapruk, Nathorn

    2018-02-01

    Studies found a strong association between allopurinol-induced Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) and the HLA-B*58:01 allele. HLA-B*58:01 screening-guided therapy may mitigate the risk of allopurinol-induced SJS/TEN. This study aimed to evaluate the cost-effectiveness of HLA-B*58:01 screening before allopurinol therapy initiation compared with the current practice of no screening for Malaysian patients with chronic gout in whom a hypouricemic agent is indicated. This cost-effectiveness analysis adopted a societal perspective with a lifetime horizon. A decision tree model coupled with Markov models were developed to estimate the costs and outcomes, represented by quality-adjusted life years (QALYs) gained, of three treatment strategies: (a) current practice (allopurinol initiation without HLA-B*58:01 screening); (b) HLA-B*58:01 screening before allopurinol initiation; and (c) alternative treatment (probenecid) without HLA-B*58:01 screening. The model was populated with data from literature review, meta-analysis, and published government documents. Cost values were adjusted for the year 2016, with costs and health outcomes discounted at 3% per annum. A series of sensitivity analysis including probabilistic sensitivity analysis were carried out to determine the robustness of the findings. Both HLA-B*58:01 screening and probenecid prescribing were dominated by current practice. Compared with current practice, HLA-B*58:01 screening resulted in 0.252 QALYs loss per patient at an additional cost of USD 322, whereas probenecid prescribing resulted in 1.928 QALYs loss per patient at an additional cost of USD 2203. One SJS/TEN case would be avoided for every 556 patients screened. At the cost-effectiveness threshold of USD 8695 per QALY, the probability of current practice being the best choice is 99.9%, in contrast with 0.1 and 0% in HLA-B*58:01 screening and probenecid prescribing, respectively. This is because of the low incidence of

  9. Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

    African Journals Online (AJOL)

    implicated drugs are nevirapine and co-trimoxazole.3. SJS and TEN rarely occur without any prior drug use, and in the .... bacterial infection due to low saliva production and ulceration with fibrinous exudative inflammation which .... PH, Bouchard CS, Dart JK, Gai X, Gomes JA. Stevens-Johnson Syndrome/. Toxic Epidermal ...

  10. [Nursing diagnoses for the patient with toxic epidermal necrolysis: a case study].

    Science.gov (United States)

    Carneiro, Taize Muritiba; Silva, Iranete Almeida Sousa

    2012-01-01

    This is a retrospective case study of a patient affected by toxic epidermal necrolysis in the intensive care unit of a public hospital, with the goal to apprehend, starting from the clinical judgments of the nurses, theirs nursing diagnoses. Thirteen nursing diagnoses were evidenced and, also, it was evidenced the necessity of the theoretical improvement of those professionals about the Systematization of Nursing Care, and on the sense of value that this practice may add to nursing in the pursuit of individualized assistance to the patients under their care.

  11. Guidelines for the management of Stevens-Johnson syndrome/toxic epidermal necrolysis: An Indian perspective.

    Science.gov (United States)

    Gupta, Lalit Kumar; Martin, Abhay Mani; Agarwal, Nidheesh; D'Souza, Paschal; Das, Sudip; Kumar, Rajesh; Pande, Sushil; Das, Nilay Kanti; Kumaresan, Muthuvel; Kumar, Piyush; Garg, Anubhav; Singh, Saurabh

    2016-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are severe, life-threatening mucocutaneous adverse drug reactions with a high morbidity and mortality that require immediate medical care. The various immunomodulatory treatments include systemic corticosteroids, cyclosporine, intravenous immunoglobulin, cyclophosphamide, plasmapheresis and tumor necrosis factor-α inhibitors. The ideal therapy of Stevens-Johnson syndrome/toxic epidermal necrolysis still remains a matter of debate as there are only a limited number of studies of good quality comparing the usefulness of different specific treatments. The aim of this article is to comprehensively review the published medical literature and frame management guidelines suitable in the Indian perspective. The Indian Association of Dermatologists, Venereologists and Leprologists (IADVL) assigned the task of preparing these guidelines to its special interest group on cutaneous adverse drug reactions. The group performed a comprehensive English language literature search for management options in Stevens-Johnson syndrome/toxic epidermal necrolysis across multiple databases (PubMed, EMBASE, MEDLINE and Cochrane) for keywords (alone and in combination) and MeSH items such as "guidelines," "Stevens-Johnson syndrome," "toxic epidermal necrolysis," "corticosteroids," "intravenous immunoglobulin," "cyclosporine" and "management." The available evidence was evaluated using the strength of recommendation taxonomy and graded using a three-point scale. A draft of clinical recommendations was developed on the best available evidence which was also scrutinized and critically evaluated by the IADVL Academy of Dermatology. Based on the inputs received, this final consensus statement was prepared. A total of 104 articles (meta-analyses, prospective and retrospective studies, reviews [including chapters in books], previous guidelines [including Indian guidelines of 2006] and case series) were critically evaluated and the evidence

  12. Early toxic epidermal necrolysis syndrome post-intra-cranial tumor resection.

    Science.gov (United States)

    Ramachandren, Thavenesh K; Petrilli, Renée Ma

    2016-11-01

    SJS and TEN are two rare self-limited but serious cutaneous drug reactions with significant morbidity and mortality. There are many drugs associated with the condition. We report a case of early TEN syndrome post Carbamazepine use, review the current literature and discuss the management challenges. A 51-year-old female was admitted to hospital for investigation and management of complex partial seizures secondary to a meningioma. She was commenced on 100mg BD of Carbamazepine for seizure control and discharged home. Surgical resection of the meningioma was performed electively 2 weeks later. A localized erythematous macular rash mainly in the left shoulder was noted on postoperative day 3. Two days later, the patient had sloughing of the mucosa of the lips in addition to progression of the rash. Early Toxic Epidermal Necrolysis (TEN) syndrome was diagnosed by the Burns and Dermatology teams and the culprit drug was discontinued. Skin biopsy confirmed the diagnosis. The patient was commenced on intravenous immunoglobulins with excellent improvement in skin integrity and resolution of excoriations noted on discharge. Stevens - Johnson syndrome (SJS) and TEN are two rare self-limited but serious cutaneous drug reactions with significant morbidity and mortality. The current treatment of TENS/SJS is divided into early management and symptom control. The immediate cessation of the culprit drug is quintessential. There is vast documented evidence of carbamazepine- induced SJS/TEN in patients of Asian ethnicity due to the presence of the HLA allele B*1502. HLA-B*1502 screening should be performed when using aromatic anticonvulsants such as carbamazepine in high-risk patients. © The Author(s) 2015.

  13. Toxic epidermal necrolysis (TEN): the Chelsea and Westminster Hospital wound management algorithm.

    Science.gov (United States)

    Abela, Christopher; Hartmann, Christoph E A; De Leo, A; de Sica Chapman, Anna; Shah, Hetul; Jawad, Mohammad; Bunker, Christopher B; Williams, Greg J P; Leon-Villapalos, Jorge

    2014-08-01

    Toxic epidermal necrolysis syndrome (TEN) is a potentially catastrophic exfoliative muco-cutaneous disorder first described by Lyell in 1956. It represents the most extensive form of Steven-Johnson syndrome. TEN is defined varyingly around the globe, but in the United Kingdom the consensus opinion describes the process as involving >30% of the total body surface area. It can rapidly become more extensive and threatens life. The estimated annual incidence is approximately 1-2 cases per million population. The risk of mortality increases with surface area involved and meta-analysis of the literature shows this risk to be between 16% and 55%. Over a six month period the Chelsea and Westminster Hospital Burns Service treated five consecutive patients with more than 80% total body surface area involvement or a more than 80% mortality risk, using the severity-of-illness score for toxic epidermal necrolysis (SCORTEN). All patients were treated according to the Chelsea and Westminster Hospital wound management algorithm with excellent outcome and no mortalities. The aim of this paper is to propose a generic TEN wound management algorithm according to the severity of skin lesions, using a simple wound grading system. Copyright © 2014 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  14. Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis (SJS/TEN): Could Retinoids Play a Causative Role?

    Science.gov (United States)

    Mawson, Anthony R.; Eriator, Ike; Karre, Sridhar

    2015-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with syndrome can be induced by numerous medications and typically occurs 1–4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression. PMID:25579087

  15. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee

    2013-06-01

    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  16. Long-term Sequelae of Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Yang, Che-Wen; Cho, Yung-Tsu; Chen, Kai-Lung; Chen, Yi-Chun; Song, Hsiang-Lin; Chu, Chia-Yu

    2016-05-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe cutaneous adverse drug reactions characterized by different extents of epidermal necrosis and mucosal breakdown. A limited number of studies have reported the long-term patterns of SJS and TEN complications in patient populations over long follow-up periods. The aim of this retrospective study was to collect data on long-term sequelae in patients admitted for SJS, SJS/TEN overlap, or TEN between 1998 and 2012. Among all 102 patients eligible for analysis, the 2 most common sequelae were cutaneous and ocular problems, both with incidences of 44.1%. Visceral organ involvement was observed in 2 patients with irreversible deterioration of chronic kidney disease and in one patient with interstitial lung disease. Autoimmune disease was present in 6 patients: Sjögren's syndrome or Sjögren-like syndrome in 5 patients and concomitant systemic lupus erythematosus and Hashimoto thyroiditis in one patient.

  17. Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis : Are Drug Dictionaries Correctly Informing Physicians Regarding the Risk?

    NARCIS (Netherlands)

    Haddad, Cynthia; Sidoroff, Alexis; Kardaun, Sylvia H.; Mockenhaupt, Maja; Creamer, Daniel; Dunant, Ariane; Roujeau, Jean-Claude

    Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) are severe drug reactions associated with high mortality and multiple incapacitating sequelae. In the past 20 years, two large multinational case control studies, published in 1995 and 2008, had identified different degrees of drug

  18. Interleukin-15 Is Associated with Severity and Mortality in Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis

    NARCIS (Netherlands)

    Su, Shih-Chi; Mockenhaupt, Maja; Wolkenstein, Pierre; Dunant, Ariane; Le Gouvello, Sabine; Chen, Chun-Bing; Chosidow, Olivier; Valeyrie-Allanore, Laurence; Bellon, Teresa; Sekula, Peggy; Wang, Chuang-Wei; Schumacher, Martin; Kardaun, Sylvia H.; Hung, Shuen-Iu; Roujeau, Jean-Claude; Chung, Wen-Hung

    Early diagnosis and prognosis monitoring for Stevens-Johnson syndrome/toxic epidermal necrolysis (TEN) still remain a challenge. This study aims to explore any cytokine/chemokine with prognostic potential in StevensJohnson syndrome/TEN. Through screening a panel of 28 serological factors, IL-6,

  19. Is intravenous immunoglobulin effective in toxic epidermal necrolysis and Stevens-Johnson syndrome?

    Directory of Open Access Journals (Sweden)

    Lucas Navajas

    2014-10-01

    Full Text Available Toxic epidermal necrolysis and Stevens-Johnson syndrome are severe cutaneous adverse drug reactions. Intravenous immunoglobulin is described as a therapeutic option, however its use is still controversial. Using Epistemonikos database, which is maintained by screening over 20 databases, we identified six systematic reviews, including 39 primary studies. We combined the evidence using tables for summary of findings, following the GRADE approach, and concluded there is uncertainty about the effects of intravenous immunoglobulin because the certainty of the evidence is very low; it probably leads to important adverse effects; and has high cost. Intravenous immunoglobulin should not be used outside the context of a clinical trial, or only in cases where other treatments have failed and there are no resource constraints.

  20. Generalized bullous fixed drug eruption imitating toxic epidermal necrolysis: a case report and literature review.

    Science.gov (United States)

    Mitre, Victoria; Applebaum, Danielle S; Albahrani, Yasser; Hsu, Sylvia

    2017-07-15

    Fixed drug eruption (FDE) is defined as sharply demarcated erythematous patches or plaques that occur secondary to systemic exposure to a causative medication. Eruptions are deemed "fixed" because upon repeated exposure they recur at previously affected sites. Generalized bullous fixed drug eruption (GBFDE) is a rare FDE variant occurring in patients with a previous history of FDE. Given the extensive cutaneous involvement and the frequent mucosal ulcerations associated with GBFDE, it is challenging to discern these lesions from Steven-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). The presence of significantly elevated lesional and serum granulysin in SJS/TEN is an important discriminating factor because granulysin levels remain significantly lower in GBFDE. The implementation of an immunochromatographic test for rapid detection of elevated granulysin levels could therefore facilitate the early diagnosis of SJS/TEN. We report a case of GBFDE to elucidate the characteristic differences in clinical presentation, histopathology, and immunohistochemistry that can facilitate diagnosis.

  1. Toxic epidermal necrolysis and Steven Johnson syndrome: 11-years experience and outcome.

    Science.gov (United States)

    Gravante, G; Delogu, D; Marianetti, M; Trombetta, M; Esposito, G; Montone, A

    2007-01-01

    Toxic epidermal necrolysis and Steven Johnson syndrome are rare diseases that usually follow drug-exposures. The authors present one retrospective study with their management and focus their retrospective analysis on finding prognostic factors. We reviewed charts of admitted patients from January 1995 to December 2005. Only those with an histologic-proved diagnosis were included in the study. Causative drugs, symptoms, management and outcome were recorded and analysed. We found 32 patients that met inclusion criteria. Mortality rate was 34.4% (11/32). Age, delay of referral, Total Burn Surface Area, white blood cells, creatinine, blood sodium, immunoglobulins therapy and more than two different types of blood bacterial species isolated were significantly correlated with death (p < 0.05). These data confirm prognostic factors already present in literature and find that the number of different bacterial species isolated from blood increase mortality. Further prospective studies are necessary to confirm these findings.

  2. Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis and Treatment With a Biologic: A Case Report

    Science.gov (United States)

    Chong, Ian; Chao, Alice

    2017-01-01

    Introduction One of the most dangerous dermatologic emergencies is Stevens-Johnson Syndrome (SJS)/toxic epidermal necrolysis (TEN). Although a rare disease, it can often lead to significant mortality. Case Presentation In this case report, we present a 77-year-old man who developed a sloughing rash that was secondary to a nonsteroidal anti-inflammatory drug. In addition to the recommended supportive care, the patient was treated with etanercept, a new, less commonly used intervention. Discussion We provide a brief review of SJS/TEN. Nonsteroidal anti-inflammatory drugs are a rare cause of SJS/TEN, and additionally, the use of biologics is a novel treatment modality for SJS/TEN. PMID:28488978

  3. Burn unit care of Stevens Johnson syndrome/toxic epidermal necrolysis: A survey.

    Science.gov (United States)

    Le, Hong-Gam; Saeed, Hajirah; Mantagos, Iason S; Mitchell, Caroline M; Goverman, Jeremy; Chodosh, James

    2016-06-01

    Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) is a systemic disease that can be associated with debilitating acute and chronic complications across multiple organ systems. As patients with acute SJS/TEN are often treated in a burn intensive care unit (BICU), we surveyed burn centers across the United States to determine their approach to the care of these patients. The goal of our study was to identify best practices and possible variations in the care of patients with acute SJS/TEN. We demonstrate that the method of diagnosis, use of systemic therapies, and involvement of subspecialists varied significantly between burn centers. Beyond supportive care provided to every patient, our data highlights a lack of standardization in the acute care of patients with SJS/TEN. A comprehensive guideline for the care of patients with acute SJS/TEN is indicated. Copyright © 2015 Elsevier Ltd and ISBI. All rights reserved.

  4. Clinical characteristics and treatment outcome of Stevens-Johnson syndrome and toxic epidermal necrolysis

    Science.gov (United States)

    CHANTAPHAKUL, HIROSHI; SANON, THANOMSAK; KLAEWSONGKRAM, JETTANONG

    2015-01-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are erythematous skin lesions with blister formation accompanied by mucosal involvement. These conditions are considered to be life-threatening illnesses. Understanding the clinical presentation, risk factors, treatment options and results will be advantageous for physicians in the management of patients in the future. The aim of the present study was to review and analyze the clinical manifestations, drug implications, treatment and outcome of patients with SJS and/or TEN who had been hospitalized in a tertiary care center. All hospitalized patients with SJS and/or TEN during a 5-year period were retrospectively reviewed. The clinical severity was graded according to the score of toxic epidermal necrolysis (SCORTEN) scale. Clinical symptoms, diagnosis, possible precipitating factors, management and outcome data were collected for analysis. A total of 43 patients (mean age, 49.5 years) were hospitalized and classified into the SJS group (55.8%), SJS/TEN overlap group (20.9%) and TEN group (23.3%). The majority of the patients (90.7%) had mucocutaneous eruptions associated with oral drug administration. Allopurinol, anticonvulsants and antibiotics were the most common causative agents for the mucocutaneous eruption. Twenty-eight patients (65.1%) were treated with corticosteroids. The mortality rate was 6.9%. Comparison between the survival group and the non-survival group revealed that patient age >70 years (P=0.014) and body surface area involvement >20% (P<0.01) were the significant factors associated with mortality. The use of systemic steroids was higher in the survival group in comparison with the non-survival group (65.1 vs. 0%, respectively; P=0.014). The mucocutaneous eruptions in SJS and TEN are mostly caused by medication. With early recognition and treatment, the mortality rate in this study was lower than that in previous reports. Patient age and the area of mucocutaneous involvement

  5. Fever in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in Pediatric Cases: Laboratory Work-up and Antibiotic Therapy.

    Science.gov (United States)

    Paulmann, Maren; Mockenhaupt, Maja

    2017-05-01

    Fever is a symptom that often accompanies skin eruptions, especially in children. It can be a sign of an infectious condition presenting with exanthems or it may precede an exanthematous eruption. Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe reactions affecting skin and mucosa with blisters and erosions. High fever occurs in these conditions, frequently before the skin and/or mucosa is affected.

  6. UK guidelines for the management of Stevens-Johnson syndrome/toxic epidermal necrolysis in adults 2016.

    Science.gov (United States)

    Creamer, D; Walsh, S A; Dziewulski, P; Exton, L S; Lee, H Y; Dart, J K G; Setterfield, J; Bunker, C B; Ardern-Jones, M R; Watson, K M T; Wong, G A E; Philippidou, M; Vercueil, A; Martin, R V; Williams, G; Shah, M; Brown, D; Williams, P; Mohd Mustapa, M F; Smith, C H

    2016-06-01

    The overall objective of the guideline is to provide up-to-date, evidence-based recommendations for the diagnosis and management of the full spectrum of Stevens-Johnson syndrome (SJS), toxic epidermal necrolysis (TEN) and SJS-TEN overlap in adults during the acute phase of the disease. The document aims to. Copyright © 2016 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  7. Hospital management and clinical factors associated with ophthalmic involvement in toxic epidermal necrolysis.

    Science.gov (United States)

    Hii, Belinda W; Mahar, Patrick D; Wasiak, Jason; Hall, Anthony J; Paul, Eldho; Marsh, Philip; Buck, Danielle A; Cleland, Heather

    2014-08-01

    Toxic Epidermal Necrolysis (TEN) is characterized by an exfoliative rash resembling widespread burns. It is often considered on the same spectrum of disease as Stevens Johnson Syndrome but is distinguished by epidermal detachment of >30% of total body surface area (TBSA). Ocular involvement of TEN may result in complications requiring intensive topical, systemic or operative treatment. This study aimed to identify the current hospital management of, and factors associated with, ophthalmic involvement in adult TEN patients. All adult TEN patients admitted to the Victorian Adult Burns Service over an 12-year period were included. Retrospective data analyzed included patient demographics, site of TEN involvement, % TBSA, complications, duration of ocular follow up and visual outcomes. TEN patients with and without ocular involvement were compared. Cutaneous involvement of the head and neck was found to be significantly associated with ocular involvement of TEN. Age, TBSA involvement, presence of a prodrome, and presence of comorbidities were not found to be significantly associated with ocular involvement. Management of ophthalmic involvement of TEN varied between patients. Clinicians should have a high index of suspicion for ocular involvement when exfoliation of the head and neck is present and should seek ophthalmological advice early in the course of disease. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  8. Toxic epidermal necrolysis and Steven-Johnson syndrome in oncologic patients.

    Science.gov (United States)

    Gravante, G; Delogu, D; Marianetti, M; Esposito, G; Montone, A

    2007-01-01

    We reviewed our case-load of patients with Toxic Epidermal Necrolysis (TEN) and analysed this oncologic disease in order to define the prevalence of this comorbidity and find eventual clinical and prognostic differences, specific of this subgroup of patients. We reviewed charts from January 1995 to December 2005. Only those patients with a TEN diagnosis proved with an histologic examination were included. Causative drugs, symptoms, management and outcome were recorded and analysed. We found 32 patients with TEN and 9 of them (28%) had also cancer. The comparison among oncologic vs. the rest of patients showed no significant differences in age, delay of referral, % surface area epidermal detachment, blood chemistry, immunoglobulins therapy and bacterial isolation of species throughout the recovery (p > 0.05). Oncologic diseases were the most frequent comorbidities in our series. There were no differences in the length of stay, duration of disease or mortality between patients with and without cancer. However, due to the small number of patients, future larger prospective studies are necessary to confirm these findings.

  9. Stevens–Johnson syndrome and toxic epidermal necrolysis in an academic hospital setting: a 5-year retrospective study

    Directory of Open Access Journals (Sweden)

    Ewa Stocka-Łabno

    2016-10-01

    Full Text Available Introduction: Toxic epidermal necrolysis and Stevens–Johnson syndrome are acute life-threatening mucocutaneous reactions to drugs. The aims of the study were to identify these drugs and characterize population prone to these reactions. Materials and Methods: Data including demographics, culprit drug, clinical characteristics, course of disease, treatment given, and therapeutic responses were retrospectively collected from medical records of 31 patients admitted to Department of Dermatology from January 2009 to December 2014. Results: Drugs most commonly involved in Stevens–Johnson syndrome were antimicrobials: ciprofloxacin, doxycycline, cefuroxime, trimethoprim, amoxicillin, clindamycin, co-trimoxazole (50% of patients and nonsteroidal anti-inflammatory drugs: ibuprofen, naproxen, metamizole, piroxicam (29% of patients. Drugs involved in toxic epidermal necrolysis were antimicrobials: sulfasalazine, co-trimoxazole, cefuroxime, clindamycin (71% of patients and anticonvulsants: lamotrigine (29% of patients. The comorbidities’ characteristic for the group of patients affected by toxic epidermal necrolysis were psychiatric and autoimmune disorders. The most common complication was infection. Two patients died and in both cases the cause of death was sepsis. Conclusion: The study indicates that in observed population drugs with the highest risk of most severe reactions are lamotrigine (anticonvulsant and antimicrobials (most commonly sulfonamides, therefore it is advisable to consider carefully administration of these drugs, especially to patients with history of autoimmune reactions.

  10. Stevens-Johnson syndrome and toxic epidermal necrolysis-like cutaneous presentation of chikungunya fever: A case series.

    Science.gov (United States)

    Garg, Taru; Sanke, Sarita; Ahmed, Riaz; Chander, Ram; Basu, Srikanta

    2018-03-24

    Chikungunya fever is a benign, self-limiting, acute viral illness. An epidemic occurred in New Delhi, India, in August and September 2016. We observed many cases with atypical cutaneous features mimicking Stevens-Johnson syndrome and toxic epidermal necrolysis during this epidemic, especially in infants and children. Twenty-one children (13 [61.9%] boys, 8 [38%] girls) presenting with vesico-bullous and necrotic lesions were reviewed. Cutaneous presentation included vesicles and bullae with purpuric macules and necrosis, seen in 16 (76%) patients. Skin lesions resolved in 5-7 days, leaving behind hyperpigmentation in seven (33.3%) patients and hypopigmentation in three (14.2%). Minor oral erosions were observed in three (14.2%) patients, and palmoplantar erythema was seen in four (19.04%). It is essential for dermatologists to understand the Stevens-Johnson syndrome and toxic epidermal necrolysis-like presentation of chikungunya and not to misinterpret it as true Stevens-Johnson syndrome and toxic epidermal necrolysis, which will lead to unnecessary intervention and management. © 2018 Wiley Periodicals, Inc.

  11. Plasma Lipid Profiling of Patients with Chronic Ocular Complications Caused by Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Saito, Kosuke; Ueta, Mayumi; Maekawa, Keiko; Sotozono, Chie; Kinoshita, Shigeru; Saito, Yoshiro

    2016-01-01

    Stevens-Johnson syndrome (SJS) and its severe variant, toxic epidermal necrolysis (TEN), are drug-induced acute inflammatory vesiculobullous reactions of the skin and mucous membranes, including the ocular surface. Even after recovery from skin symptoms, some SJS/TEN patients continue to suffer with severe ocular complications (SOCs). Therefore, this study aims to understand the pathophysiology of chronic SOCs. Because plasma lipid profiling has emerged as a useful tool to understand pathophysiological alterations in the body, we performed plasma lipid profiling of 17 patients who suffered from SJS/TEN-associated chronic SOCs. A lipidomics approach yielded 386 lipid molecules and demonstrated that plasma levels of inflammatory oxylipins increased in patients with SJS/TEN-associated chronic SOCs. In addition, oxidized phosphatidylcholines and ether-type diacylglycerols increased in the patients with chronic SOCs, while phosphoglycerolipids decreased. When we compared these lipidomic profiles with those of patients with atopic dermatitis, we found that patients with chronic SOCs, specifically, had decreased levels of ether-type phosphatidylcholines (ePCs) containing arachidonic acid (AA), such as PC(18:0e/20:4) and PC(20:0e/20:4). To confirm our finding, we recruited additional patients, who suffered from SOC associated with SJS/TEN (up to 51 patients), and validated the decreased plasma levels of AA-containing ePCs. Our study provides insight into the alterations of plasma lipidomic profiles in chronic SOCs and into the pathophysiology of SJS/TEN-associated chronic SOCs.

  12. Toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Bygum, Anette; Andersen, Klaus Ejner

    2006-01-01

    Toxic epidermal necrolysis (TEN) is a rare, mostly drug-induced life-threatening mucocutaneous reaction with generalised symptoms and internal organ involvement. Current treatment strategy focuses on supportive intensive care with close collaboration among many specialties. Specific therapies...

  13. Not All Drugs Are Created Equal: The Importance of Causative Agent in Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Cooney, Ryan; Beck, Anna; Gonzalez, Beverly; Gamelli, Richard L; Mosier, Michael J

    2016-01-01

    Toxic epidermal necrolysis (TEN), Steven-Johnson Syndrome (SJS), and SJS/TEN overlap make up a spectrum of severe mucocutaneous disease that is an adverse reaction to a large number of medications and various infectious agents. Little is known about the differences in acute course of illness depending on the inciting agent, which prompted the authors to further explore their experience with TEN. In a retrospective analysis, 88 patients ≥18 years old were identified with biopsy-confirmed TEN and a variety of variables were analyzed. The authors evaluated for differences in presentation and hospital course between drug class and medication half-life using Kruskal-Wallis for continuous variables and χ or Fisher's exact test for categorical variables. Those subjects with the inciting agent of allopurinol had 100% incidence of acute kidney injury (AKI), significantly higher than other drug classes with antibiotics having the second highest incidence at 14%. Medications with a half-life of <6 hours were also associated with a higher incidence of AKI. Acutely there are significant clinical differences in TEN patients depending on the drug class and medication half-life of the inciting agent. Allopurinol, drugs with a short half-life, and a diagnosis of TEN were all associated with greater incidence of AKI. This is the first time that the relationship between clinical course and inciting agent has been examined in a United States population.

  14. The first reported case of ureteral perforation in a patient with severe toxic epidermal necrolysis syndrome.

    Science.gov (United States)

    Baccaro, Leopoldo M; Sakharpe, Aniket; Miller, April; Amani, Hamed

    2014-01-01

    The aim of this study was to briefly review toxic epidermal necrolysis syndrome (TENS) and Steven Johnson Syndrome (SJS), as well as describe the unique complication of ureteral perforation. A case of ureteral perforation in an 18-year old woman with TENS was documented and reviewed. In addition to studying this unusual presentation the authors have also provided a brief review of TENS and SJS along with several common complications of this disease process. The patient in question suffered a severe case of TENS with extensive mucocutaneous involvement. After 2 weeks of intensive therapy, she suddenly became anuric. She developed obstructive uropathy and bilateral hydronephrosis from mucosal debris and sludge. A left forniceal rupture was visualized on pyelography. SJS and TENS are two different presentations in the spectrum of the same disease process. There have been descriptions of gastrointestinal, respiratory, vaginal, and ocular mucosal involvement, including cases of corneal and colonic perforation. However, acute renal failure secondary to ureteral obstruction and perforation has never been described. Although rare, one must entertain every possibility when attempting to diagnose complications of the disease.

  15. The Epidemiology of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in the UK.

    Science.gov (United States)

    Frey, Noel; Jossi, Janine; Bodmer, Michael; Bircher, Andreas; Jick, Susan S; Meier, Christoph R; Spoendlin, Julia

    2017-06-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare but life-threatening mucocutaneous diseases. SJS/TEN mostly manifest as a reaction to new drug use, but little is known about their incidence and epidemiology. We conducted a large observational study on the epidemiology of SJS/TEN using data from the UK-based Clinical Practice Research Datalink. Among 551 validated SJS/TEN patients, we calculated an incidence rate of 5.76 SJS/TEN cases per million person-years between 1995 and 2013, which was consistent throughout the study period and was highest in patients aged 1-10 years and 80 years or older. Within a 1:4 matched case-control analysis, black and Asian patients were at a 2-fold risk of SJS/TEN when compared with white patients. Among patients with epilepsy and gout, odds ratios for SJS/TEN were significantly increased only in the presence of recent new drug treatment with antiepileptics or allopurinol, respectively. We observed statistically significant associations between SJS/TEN and pre-existing depression, lupus erythematosus, recent pneumonia, chronic kidney disease, and active cancer, but confounding by drug use needs to be followed up. This large and longitudinal observational study on the epidemiology of SJS/TEN contributes to the understanding of this still underinvestigated severe skin disease in a European and largely white study population. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. The Epidemiology of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in China

    Directory of Open Access Journals (Sweden)

    Shang-Chen Yang

    2018-01-01

    Full Text Available Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN are life-threatening disease. However, there are only few epidemiologic studies of SJS/TEN from China. To analyze the clinical characteristics, causality, and outcome of treatment for SJS/TEN in China, we reviewed case reports of patients with SJS/TEN from the China National Knowledge Infrastructure (CNKI and Wanfang database from 2006 to 2016 and patients with SJS/TEN who were admitted to the First Affiliated Hospital of Fujian Medical University during the same period. There were 166 patients enrolled, including 70 SJS, 2 SJS/TEN overlap, and 94 TEN. The most common offending drugs were antibiotics (29.5% and anticonvulsants (24.1%. Carbamazepine, allopurinol, and penicillins were the most common single offending drugs (17.5%, 9.6%, and 7.2%. Chinese patent medicines accounted for 5.4%. There were 76 (45.8% patients receiving systemic steroid and intravenous immunoglobulin (IVIG in combination therapy, especially for TEN (80.3%, and others were treated with systemic steroids alone. Mortality rate of combination treatment comparing with steroid alone in TEN patients had no statistical significance. In conclusion, carbamazepine and allopurinol were the leading causative drugs for SJS/TEN in China. Combination of IVIG and steroids is a common treatment for TEN, but its efficacy in improving mortality needs further investigation.

  17. STAPHYLOCOCCAL SCALDED SKIN SYNDROME MIMICKING TOXIC EPIDERMAL NECROLYSIS IN A HEALTHY ADULT

    Directory of Open Access Journals (Sweden)

    Tomoko Oishi

    2013-07-01

    Full Text Available Introduction: Staphylococcal scaled skin syndrome (SSSS presents generalized form bullous impetigo caused by Staphylococcus aureus (S. aureus infection, typically seen in infants and children. SSSS may occur also in adults; however, the majority of adult cases are those with immunosuppression. Atypical clinical features of impetigo in adults sometimes make it difficult to diagnose correctly. Case Report: A 74-year-old healthy woman was hospitalized, complaining of extensive desquamative erythema and a number of erosions. She was administered oral antiviral drugs under suspicion of herpes zoster prior to 10 days. Initial diagnosis on the admission was toxic epidermal necrolysis (TEN due to antiviral tablets; however, steroid pulse therapy resulted in no effect. Bacterial culture yielded coagulase-positive methicillin-resistent S. aureus, producing exfoliative toxin B. A biopsy specimen showed subcorneal splitting of the epidermis. The diffuse erosions gradually improved over 10 days by the treatment with intravenous antibiotics. Conclusions: The differentiation between streptococcal scaled skin syndrome (SSSS and TEN is sometimes difficult. It is important to remind SSSS when we suspect TEN, even in healthy adults..

  18. Stevens-Johnson syndrome and toxic epidermal necrolysis in childhood-onset systemic lupus erythematosus patients: a multicenter study

    Directory of Open Access Journals (Sweden)

    Ana Paula Sakamoto

    2017-07-01

    Full Text Available Objective: To assess Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN in a large population of childhood-onset systemic lupus erythematosus (cSLE patients. Methods: Multicenter study including 852 cSLE patients followed in Pediatric Rheumatology centers in São Paulo, Brazil. SJS was defined as epidermal detachment below 10% of body surface area (BSA, overlap SJS-TEN 10-30% and TEN greater than 30% of BSA. Results: SJS and TEN was observed in 5/852 (0.6% cSLE female patients, three patients were classified as SJS and two patients were classified as overlap SJS-TEN; TEN was not observed. The mean duration of SJS and overlap SJS-TEN was 15 days (range 7-22 and antibiotics induced four cases. Regarding extra-cutaneous manifestations, hepatomegaly was observed in two cSLE patients, nephritis in two and neuropsychiatric involvement and conjunctivitis were observed respectively in one patient. Hematological involvement included lymphopenia in four, leucopenia in three and thrombocytopenia in two patients. The mean SLEDAI-2K score was 14.8 (range 6-30. Laboratory analysis showed low C3, C4 and/or CH50 in two patients and the presence of anti-dsDNA autoantibody in two patients. One patient had lupus anticoagulant and another one had anticardiolipin IgG. All patients were treated with steroids and four needed additional treatment such as intravenous immunoglobulin in two patients, hydroxychloroquine and azathioprine in two and intravenous cyclophosphamide in one patient. Sepsis was observed in three cSLE patients. Two patients required intensive care and death was observed in one patient. Conclusion: Our study identified SJS and overlap SJS-TEN as rare manifestations of active cSLE associated with severe multisystemic disease, with potentially lethal outcome.

  19. Identifying the incidence of rash, Stevens-Johnson syndrome and toxic epidermal necrolysis in patients taking lamotrigine: a systematic review of 122 randomized controlled trials.

    Science.gov (United States)

    Bloom, Romi; Amber, Kyle T

    2017-01-01

    Lamotrigine is an antiepileptic drug used for the treatment of epilepsy, bipolar disorder and numerous off-label uses. The development of rash significantly affects its use. The most concerning of these adverse reactions is Stevens-Johnson syndrome/toxic epidermal necrolysis. We performed a systematic review of randomized controlled trials using lamotrigine as a monotherapy to quantify the incidence of cutaneous reactions, particularly Stevens-Johnson syndrome/toxic epidermal necrolysis. Of a total of 4,364 papers regarding lamotrigine, 122 studies met our inclusion and exclusion criteria. In total, 18,698 patients were included with 1,570 (8.3%) of patients experiencing an adverse dermatologic reaction. The incidence of Stevens-Johnson syndrome/toxic epidermal necrolysis was 0.04%.

  20. Genitourinary involvement and management in children with Stevens-Johnson syndrome and toxic epidermal necrolysis.

    Science.gov (United States)

    Van Batavia, J P; Chu, D I; Long, C J; Jen, M; Canning, D A; Weiss, D A

    2017-10-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are devastating hypersensitivity disorders that cause epidermal cell death and can affect all epidermal surfaces, including the urethra, vagina, labial and scrotal skin. Despite the well-described ocular and orofacial manifestations of SJS/TEN, there is a paucity of reports on the genitourinary (GU) symptoms and their management. Specifically, consulting services often ask the pediatric urology team if it is safe to place a urethral catheter, but there is no data in the literature to help guide management. The present study sought to review all pediatric cases of SJS/TEN in a tertiary care hospital to determine the incidence and optimal management of GU manifestations, including the use of urethral catheters. With IRB approval, cases of SJS and TEN that were managed as an inpatient between January 2008 and June 2015 were retrospectively reviewed in order to identify the extent of GU involvement/manifestations, the treatment provided, use of urethral catheterization and long-term follow-up or complications. Thirty-one patients (15 female, 16 male; age range 2-18 years) presented with SJS or TEN over the study period. Etiologies for SJS/TEN included mycoplasma infection (48%) and medications (45%). Incidences of GU manifestations at presentation and their management are shown in Summary Table. Overall, 74% of patients had genital involvement of skin lesions. In 12 cases (39%), urology consultation was obtained. Twenty patients (61%) complained of dysuria and one child had gross hematuria in the setting of meatal lesion. Petroleum jelly was used in the majority of patients. A urethral catheter was placed in eight patients (25.8%, four female, four male) with a range of duration of 7-23 days. No patient developed hematuria or any other complications (i.e. strictures or urinary symptoms) after catheter removal. One boy required lysis of penile adhesions in the short-term. One of each gender developed

  1. Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: Associations, Outcomes, and Pathobiology-Thirty Years of Progress but Still Much to Be Done.

    Science.gov (United States)

    Stern, Robert S; Divito, Sherrie J

    2017-05-01

    Although rare, Stevens-Johnson syndrome and toxic epidermal necrolysis remain among the most devastating of acute conditions involving the skin. In the past 30 years, tremendous progress has been made in understanding the causes and pathobiology of this often life-threatening condition. Su et al demonstrate associations between IL 15 serum levels and the outcome of patients with Stevens-Johnson syndrome and toxic epidermal necrolysis. Their findings provide ideas for further investigations that may help us better understand the role of cytokines in this T-cell mediate disease and provides clues to possible new therapies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Stevens-Johnson syndrome and toxic epidermal necrolysis: efficacy of intravenous immunoglobulin and a review of treatment options.

    Science.gov (United States)

    Teo, L; Tay, Y K; Liu, T T; Kwok, C

    2009-01-01

    Toxic epidermal necrolysis (TEN) is a rare, severe adverse drug reaction. Steven-Johnson syndrome (SJS) represents the milder end of the spectrum. The exact pathogenesis of TEN and SJS is still unknown and many drugs, including prednisolone, cyclosporin and intravenous immunoglobulin (IVIG), have been used in an attempt to halt the disease process. The use of IVIG in particular is controversial. We share our experience with the use of IVIG in six patients with TEN. We will also review the various proposed mechanisms underlying TEN, the mechanism of action of IVIG in TEN and summarise useful treatment options.

  3. Severe idiosyncratic drug reactions with epidermal necrolysis: A 5-year study

    Directory of Open Access Journals (Sweden)

    I O Fadeyibi

    2011-01-01

    Full Text Available Introduction: Idiosyncratic drug reactions (IDRs are unexpected responses to a drug. The spectrums of severe cutaneous reactions include Stevens-Johnson Syndrome (SJS, SJS/Lyell Syndrome and Toxic Epidermal Necrolysis (TEN. The conditions are associated with high mortality. This study was designed to determine the causal agents, patterns of presentations, review the management and make recommendations to reduce the incidence and mortality of this class of drug reactions. Materials and Methods: A retrospective study was made of patients seen with IDR in the Lagos State University Teaching Hospital, LASUTH, between January, 2004 and December, 2008. They were cases admitted with bullous skin eruptions with associated systemic symptoms. Results: Sixty-seven patients were seen, with 45 (67.2% satisfying the inclusion criteria. Fifteen males and 30 females were involved, giving a male to female (M:F ratio of 1:2. Their ages ranged from 7 to 79 years (mean, 40.02 ± 17.89 years. Peak incidences occurred among the 20-24 and 30-34 year age groups. The causal agents were antibiotics (48.89%, sulphonamides (24.44%, herbal preparations (17.78% and artemisinin drugs (8.89%. Conclusions: The age groups with the peak incidence are the most likely to indulge more in drug abuse in environments with poor drug control. Diagnosis of SJS, SJS/TEN and TEN were missed in many patients at first contact due to the progressive nature of the conditions. Patients needed reviews at regular intervals when IDR was suspected. Health education to prevent drug abuse is important and herbal preparations should be scientifically studied to determine the efficacy and side-effects.

  4. Toxic epidermal necrolysis and its impact on physiotherapy management: a case report

    Directory of Open Access Journals (Sweden)

    J. Schneiderman

    2010-02-01

    Full Text Available The purpose of this paper is to report on the modified physiotherapy intervention  for  toxic  epidermal  necrolysis  (TEN  in  a 31 year old pregnant human immunodeficiency virus (HIV seropositive woman  on antiretroviral  therapy.  Physiotherapy  intervention  consisted  of  nebulisation  and  the  active  cycle  of  breathing  technique  in  order to  clear  secretions.  To restore  lung  volumes,  the  active  cycle  of  breath-ing  technique  was  utilized  in  addition  to  positive  expiratory  pressure,  incentive  spirometry  and  positioning. Passive  and  active  exercises and  stretches  were  employed  to  maintain  and  regain  range  of  motion in  affected  limbs.  Following  intervention, positive  changes  were  noted  in  outcome  measures  such  as  secretion clearance, breath sounds and general function. It is concluded that physiotherapy intervention has a role to play in the rehabilitation of patients with TEN.

  5. Retrospective Analysis of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in 88 Chinese Patients.

    Science.gov (United States)

    Wang, Li; Mei, Xue-Ling

    2017-05-05

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are life-threatening diseases with high mortality rates. This study was designed to analyze the pathogenic factors, clinical manifestations, complications, treatment, and prognosis of SJS/TEN and to explore the differences between surviving and deceased patients. SJS/TEN patients admitted to Beijing Friendship Hospital from January 2006 to December 2015 were included in the study. Patients' data were retrospectively analyzed. Comparative studies were performed on the survival group and the deceased group, and Fisher's exact probability test was used for statistical analysis. Among the 88 patients included, 40 (45.5%) were male with a mean age of 45 ± 18 years. Forty-eight (54.5%) had SJS, 34 (38.6%) had SJS/TEN, and 6 (6.8%) had TEN. Fifty-three (60.2%) cases were caused by medications, mainly antibiotics (n = 24) followed by traditional Chinese medicines (n = 7). Forty-two cases (47.7%) developed visceral damage. Eighty-two patients improved or recovered and were discharged from hospital, and six patients died. Comparative studies on the survival group and the deceased group showed that the presence of malignant tumor ( χ2 = 27.969,P 100 times/min ( χ2 = 6.347, P= 0.012), detached skin area >20% ( χ2 = 5.594, P= 0.018), concurrent mucosal involvement at the mouth, eyes, and external genitals ( χ2 = 4.945, P= 0.026), subsequent accompanying liver/kidney damage ( χ2 = 11.839, P= 0.001, and χ2 = 36.302,P 2 ( χ2 = 37.148,P < 0.001) increased the risk of death. SJS/TEN is mainly caused by medications, and nearly half of patients develop visceral damage. Multiple factors increase the mortality risk.

  6. Ocular Manifestations of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in Children.

    Science.gov (United States)

    Catt, Caroline J; Hamilton, Gavin M; Fish, Joel; Mireskandari, Kamiar; Ali, Asim

    2016-06-01

    To describe the acute and chronic ocular manifestations of Stevens-Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), and SJS/TEN Overlap syndrome (Overlap syndrome) in children. Retrospective case series. Medical records of children admitted to the Hospital for Sick Children between 2001 and 2011 with SJS, TEN, and Overlap syndrome were reviewed. Demographic information, all abnormal ophthalmic findings (and median time to first diagnosis), visual acuities, and ophthalmic treatments prescribed were collected for each eye for every patient. Thirty-six children were identified for inclusion in the study. Twenty-nine (81%) had acute ocular involvement, including all patients with TEN (n = 7). Conjunctivitis was the most common (78%) clinical sign. This, together with conjunctival membranes and subconjunctival hemorrhage, were the earliest signs, presenting by a median of 1 day. The percentage of patients and median time to occurrence of complications were as follows: for lid margin ulceration and corneal epithelial defects, 25%, 3 days; conjunctival ulceration, 39%, 3.5 days; symblepharon, 28%, 4 weeks; corneal opacification, 11%, 4 months; limbal stem cell failure, 8%, 7 months; and corneal vascularisation, 8%, 10 months after admission. Over 90% of children maintain a visual acuity of 20/40 or better in each eye at a mean follow-up of 1.4 years. Ocular involvement in SJS, TEN, and Overlap syndrome is common and the ocular manifestations may develop many months after the initial presentation, mandating the need for long-term follow-up of these children. Despite the high frequency of sight-threatening disease, most children maintain good vision in the long term. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. A retrospective analysis of Stevens-Johnson syndrome/toxic epidermal necrolysis treated with corticosteroids.

    Science.gov (United States)

    Liu, Wenmin; Nie, Xiaojuan; Zhang, Li

    2016-12-01

    Toxic epidermal necrolysis (TEN) and Stevens-Johnson syndrome (SJS) are severe mucocutaneous reactions that incur high mortality, and in which the systemic application of corticosteroids remains controversial. This study aimed to determine the optimal protocols for the use of corticosteroids and treatment measures. We performed a retrospective analysis of 70 patients with SJS/TEN who were hospitalized between January 2008 and May 2015 in the Department of Dermatology, Shandong Provincial Hospital, and treated with corticosteroids. Expected and actual mortality rates in patients treated with different doses of corticosteroids, according to SCORTEN, were compared. The diagnoses associated with initial corticosteroid use differed significantly between the low- and high-dose groups (P = 0.041). There were significant differences between expected and actual mortality rates according to the use of corticosteroid therapy (P = 0.0168, standardized mortality ratio [SMR] = 0.30). There was a statistical difference between expected and actual mortality rates in the low-dose group (P = 0.0145, SMR = 0.20). Serum albumin levels were significantly lower in patients administered corticosteroids additive therapy (31.12 ± 8.32 g/l vs. 35.54 ± 5.82 g/l; P = 0.016), and the rate of use of antibiotics was higher among patients in the additive therapy group than in the non-additive group (94.7% vs. 60.8%). Our research supports the use of corticosteroids for the systemic treatment of SJS/TEN. Corticosteroids should be used in a timely manner and in accordance with disease severity, age, underlying diseases, serum albumin level, and concurrent treatment with antimicrobial therapy. © 2016 The International Society of Dermatology.

  8. Toxic epidermal necrolysis and its impact on physiotherapy management: a case report

    Directory of Open Access Journals (Sweden)

    J. Schneiderman

    2010-01-01

    Full Text Available The purpose of this paper is to report on the modified physiotherapy intervention  for  toxic  epidermal  necrolysis  (TEN  in  a 31 year old pregnant human immunodeficiency virus (HIV seropositive woman  on antiretroviral  therapy.  Physiotherapy  intervention  consisted  of  nebulisation  and  the  active  cycle  of  breathing  technique  in  order to  clear  secretions.  To restore  lung  volumes,  the  active  cycle  of  breath-ing  technique  was  utilized  in  addition  to  positive  expiratory  pressure,  incentive  spirometry  and  positioning. Passive  and  active  exercises and  stretches  were  employed  to  maintain  and  regain  range  of  motion in  affected  limbs.  Following  intervention, positive  changes  were  noted  in  outcome  measures  such  as  secretion clearance, breath sounds and general function. It is concluded that physiotherapy intervention has a role to play in the rehabilitation of patients with TEN.

  9. Internet accounts of serious adverse drug reactions: a study of experiences of Stevens-Johnson syndrome and toxic epidermal necrolysis.

    Science.gov (United States)

    Butt, Tehreem F; Cox, Anthony R; Oyebode, Jan R; Ferner, Robin E

    2012-12-01

    Life-threatening adverse drug reactions (ADRs) such as Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) continue to affect patients' lives long after the event. Survivors and their relatives rely heavily on Internet sources for support and advice, but narratives of their experiences posted on patient websites have not been explored previously. The aim of the study was to illuminate patient experience by analysing Internet narratives of drug-induced SJS and TEN and considering the reasons for postings on patient websites, and the concerns they reflect. We also aimed to compare these experiences with a previous study of survivors of SJS and TEN conducted by face-to-face interview. We searched for unsolicited personal narratives or descriptions of drug-induced SJS and TEN posted on the Internet between February 2009 and June 2010, and analysed them using a thematic qualitative approach. We analysed 208 Internet descriptions. Motivation for posting on the Internet included a desire to share experiences and to seek advice from others. Patients and their relatives expressed concern that the ADR may be hereditary, worries about effects on fertility and a fear of recurrence. They also wished to increase awareness of the potential harms from medicines and to inform others of the suspected cause of the ADR. Individuals experiencing SJS or TEN had many unanswered questions and concerns long after the event. Our findings could guide health professionals in the management of survivors of the ADR, and in communicating more effectively with patients and their relatives. Internet forum postings of patient experiences of ADRs provide insight into patient concerns and supplement findings from detailed face-to-face interviews.

  10. Steven Johnson Syndrome and Toxic Epidermal Necrolysis in a burn unit: A 15-year experience.

    Science.gov (United States)

    McCullough, M; Burg, M; Lin, E; Peng, D; Garner, W

    2017-02-01

    The diffuse epidermal exfoliation seen in Steven Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) is similar to skin loss in second degree burns, and many of these patients are referred for treatment at burn centers. Treatment can differ markedly from center to center, and mortality can range from 25% to 70%, including a considerable morbidity. However, our experience over a 15-year period from 2000 to 2015 with 40 patients found a mortality rate of only 10% (4/40). The purpose of this paper is to discuss our treatment algorithm as a model for other centers treating SJS/TENs patients. Records were reviewed for all patients admitted to the LAC+USC burn unit between 2000 and 2015 and 40 patients were identified with biopsy-proven SJS or TENS. These cases were reviewed for age, gender, initial and greatest TBSA, causative drug, pre-existing medical conditions, and morbidity and mortality. All data were entered into the SPSS statistical software package and all statistical analyses were performed using this program. Our treatment algorithm focused on early referral to a specialty burn unit, immediate discontinuation of the offending drug, fluid resuscitation, nutritional supplementation, and meticulous wound care. Average time to transfer to a burn unit was 3.36 days. Silver-releasing antimicrobial dressings were applied to the affected skin surface and changed every 3 days. Mupirocin coated petroleum gauze was used for facial involvement. Steroids were tapered and discontinued if initiated at an outside facility (58% of patients), and starting after 2001, all patients received a course of IVIG. All patients received fluid resuscitation and the majority received supplemental tube feedings (69%). Average length of total stay was 17.1 days and length of ICU stay 15.9 days. While 44% were transferred to another facility for further rehabilitative care, 37% of patients discharge to home. In patients discharged home with complete resolution of skin lesions, time

  11. Causes and Treatment Outcomes of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in 82 Adult Patients

    Science.gov (United States)

    Kim, Hye-In; Park, Ga-Young; Kwon, Eu-Gene; Kim, Hyo-Hoon; Jeong, Ju-Young; Chang, Hyun-Ha; Lee, Jong-Myung; Kim, Neung-Su

    2012-01-01

    Background/Aims Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are predominantly known as medication-induced diseases. However, at our institution, we have experienced more cases of non-drug-related SJS and TEN than expected. Therefore, we studied the difference between non-drug-related and drug-related SJS and TEN in terms of clinical characteristics and prognoses. Methods The etiologies, clinical characteristics, and treatment outcomes for 82 adult patients with SJS and TEN were retrospectively reviewed. Results A total of 71 patients (86.6%) were classified as having SJS, and the other 11 patients (13.4%) were classified as having TEN. Drug-related cases were more common (43, 52.4%) than non-drug-related cases (39, 47.6%). Anticonvulsants (12/82, 14.6%) and antibiotics (9/82, 11%) were the most common causative medications. Anemia (p = 0.017) and C-reactive protein of ≥ 5 mg/dL (p = 0.026) were more common in the drug-related cases than in the non-drug-related cases. Intravenous steroid therapy was used as the main treatment regimen (70/82, 85.4%). Of the 82 patients, 8 (9.8%) died during the clinical course. A univariate analysis for mortality showed statistical significance for the following: kidney function abnormality, pneumonia, hemoglobin of < 10 g/dL, and combined underlying diseases. In a multivariate analysis, only pneumonia was statistically significant (odds ratio, 25.79; p = 0.009). Conclusions Drugs were the most frequent cause of these diseases. However, non-drug-related causes also contributed to a significant proportion of cases. Physicians should keep this in mind when documenting patient history. In addition, early recognition and treatment may be important for better outcomes. PMID:22707893

  12. Evaluation of SCORTEN on a Cohort of Patients With Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis Included in the RegiSCAR Study

    NARCIS (Netherlands)

    Sekula, Peggy; Liss, Yvonne; Davidovici, Batya; Dunant, Ariane; Roujeau, Jean-Claude; Kardaun, Sylvia; Naldi, Luigi; Schumacher, Martin; Mockenhaupt, Maja

    2011-01-01

    The purpose of this study was to evaluate the severity-of-illness score called SCORTEN with respect to its predictive ability and by using data obtained in the RegiSCAR study, the most comprehensive European registry of patients with Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis

  13. Effectiveness, safety and tolerability of cyclosporine versus supportive treatment in Stevens–Johnson Syndrome/Toxic Epidermal Necrolysis: A record-based study

    Directory of Open Access Journals (Sweden)

    Swosti Mohanty

    2017-01-01

    Conclusion: Cyclosporine (5 mg/kg/day for 10 days from onset of Stevens–Johnson syndrome/toxic epidermal necrolysis may decrease the risk of dying, may provide faster healing of lesions and might lead to early discharge from hospital.

  14. Stevens-Johnson syndrome and toxic epidermal necrolysis in patients with lupus erythematosus : a descriptive study of 17 cases from a national registry and review of the literature

    NARCIS (Netherlands)

    Ziemer, M.; Kardaun, S. H.; Liss, Y.; Mockenhaupt, M.

    Background Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe cutaneous adverse reactions with high morbidity and mortality. Some expressions of lupus erythematosus (LE) may cause enormous difficulties in differentiating them from SJS and TEN by showing large areas of

  15. Treatment of toxic epidermal necrolysis by a multidisciplinary team. A review of literature and treatment results.

    Science.gov (United States)

    Papp, Anthony; Sikora, Sheena; Evans, Morgan; Song, Diana; Kirchhof, Mark; Miliszewski, Monica; Dutz, Jan

    2018-04-04

    Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) are mucocutaneous hypersensitivity reactions, usually to drugs or their metabolites. TEN is the most severe involving greater than 30% of the total body surface area (TBSA). Management of these patients usually benefits from a large multidisciplinary team for both wound and medical management. Treatment of these patients varies between centers and physicians and there is lack of a standardized treatment protocol in the medical literature. To review the literature and complete a retrospective review of patients treated at Vancouver General Hospital over a 11-year period. A retrospective chart review of all patients diagnosed with SJS/TEN and treated at Vancouver General Hospital from 2001 to 2011 was completed. Data collected include patient demographics, time to transfer to a burn center, SCORTEN calculation, suspected cause of TEN, %TBSA involved, length of stay in hospital and ICU, medications, dressings, infections/cultures, fluids, mucosal involvement, teams involved, associated complications, morbidity and mortality. Data is reported quantitatively. A total of 67 patients were identified (28 SJS, 21 SJS/TEN overlap, 18 TEN). In SJS/TEN overlap and TEN patients, oral mucosa and trunk were the primary sites involved. SCORTEN calculations were highest in the TEN group. Plastic surgery was consulted in 53% of TEN cases, 52% of SJS/TEN cases and 25% of SJS cases. Patients were admitted to a burn unit in 74% of TEN cases, 57% of TEN/SJS cases and 21% of SJS cases. Time from symptoms to diagnosis and transfer to a burn unit was highest for TEN patients. Time from presentation to diagnosis was highest in SJS/TEN overlap. Triggers were identified in 67-82% of cases. Treatment varied widely. Patients were treated conservatively, with steroids, IVIg, and cyclosporine alone or in combination. Observed mortality was higher than predicted by SCORTEN for patients treated with IVIg and lower for those treated

  16. Pediatric Stevens-Johnson syndrome and toxic epidermal necrolysis in the United States.

    Science.gov (United States)

    Hsu, Derek Y; Brieva, Joaquin; Silverberg, Nanette B; Paller, Amy S; Silverberg, Jonathan I

    2017-05-01

    Little is known about the epidemiology of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) in children. We sought to determine the morbidity, mortality, and comorbid health conditions of SJS and TEN in US children. This was a cross-sectional study of the 2009 to 2012 Nationwide Inpatient Sample, which contains a representative 20% sample of all US hospitalizations. Sociodemographics, inflation-adjusted cost, length of stay, comorbidities, and mortality were analyzed using descriptive statistics and multivariate regression analyses. The incidences of SJS, SJS-TEN, and TEN were a mean 5.3, 0.8, and 0.4 cases per million children per year in the US, respectively. Prolonged length of stay and higher costs of care (SJS: 9.4 ± 0.6 days, $24,947 ± $3171; SJS-TEN: 15.7 ± 1.5 days, $63,787 ± $8014; TEN: 20.4 ± 6.3 days, $102,243 ± $37,588) were observed compared with all other admissions (4.6 ± 0.1 days, $10,496 ± $424). Mortality was 0% for SJS, 4% for SJS-TEN, and 16% for TEN. In regression models, predictors of mortality included renal failure (adjusted OR [aOR] 300.28, 95% confidence interval [CI] 48.59->999.99), malignancy (aOR 54.33, 95% CI 9.40-314.22), septicemia (aOR 30.45, 95% CI 7.91-117.19), bacterial infection (aOR 20.38, 95% CI 5.44-76.36), and epilepsy (aOR 5.56, 95% CI 1.37-26.2). Data regarding treatment were not available. Date of diagnosis of comorbidities was not present, precluding temporal analysis. Pediatric SJS/TEN poses a substantial health burden in the United States. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  17. Is acetaminophen associated with a risk of Stevens-Johnson syndrome and toxic epidermal necrolysis? Analysis of the French Pharmacovigilance Database.

    Science.gov (United States)

    Lebrun-Vignes, Bénédicte; Guy, Claire; Jean-Pastor, Marie-Josèphe; Gras-Champel, Valérie; Zenut, Marie

    2018-02-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare but severe mostly drug-induced cutaneous reactions. Acetaminophen is an over-the-counter drug used worldwide to treat pain and reduce fever. In 2013, the US Food and Drug Administration informed the public that acetaminophen was associated with a rare risk of SJS/TEN. The aim of the present retrospective study was to analyse reports of acetaminophen as a possible suspect in the development of SJS/TEN from the French Pharmacovigilance Database (FPDB). Cases of TEN/SJS with acetaminophen as a suspect drug registered in the FPDB, collected from January 2002 to December 2013, were analysed by an expert group. The algorithm of drug causality for epidermal necrolysis (ALDEN) was used as a reference tool for SJS/TEN to assess the causality of each suspect drug. After exclusion of 16 nonvalidated cases, 112 cases (47 TEN, 51 SJS, 14 SJS/TEN overlaps) involving 574 suspected drugs (5⋅1/case) were analysed. In 80 cases, the acetaminophen ALDEN score was inferior or equal to that of other drugs, associated with a higher suspicion for causality. In 32 cases, acetaminophen had the highest score but matched with a 'very unlikely' or 'unlikely' causality in 12 cases. For the 20 remaining cases with a 'possible' or ' probable' causality, a protopathic or a confounding bias was likely in 14 cases. After analysis of the French pharmacovigilance data using the ALDEN algorithm, we found no obvious SJS/TEN risk related to the use of acetaminophen in this large national series. © 2017 The British Pharmacological Society.

  18. Stevens Johnson syndrome, toxic epidermal necrolysis and SJS-TEN overlap: A retrospective study of causative drugs and clinical outcome

    Directory of Open Access Journals (Sweden)

    Sharma Vinod

    2008-01-01

    Full Text Available Background and Aims: Stevens Johnson syndrome (SJS, toxic epidermal necrolysis (TEN and SJS-TEN overlap are serious adverse cutaneous drug reactions. Drugs are often implicated in these reactions. Methods: A retrospective analysis of inpatients′ data with these dermatological diagnoses were carried out for three years, to study the causative drugs, clinical outcome, and mortality in these conditions. Results: Thirty patients (15 TEN, nine SJS-TEN overlap, and six SJS were admitted. In 21 cases, multiple drugs were implicated whereas single drugs were responsible in nine. Anticonvulsants (35.08% were the most commonly implicated drugs followed by antibiotics (33.33% and NSAIDS (24.56%. Twenty-five patients recovered whereas five died (four TEN, one SJS-TEN overlap. Conclusion: Anticonvulsants, antibiotics and NSAIDs were the most frequently implicated drugs. TEN causes higher mortality than both SJS and SJS-TEN overlap.

  19. Role of nanocrystalline silver dressings in the management of toxic epidermal necrolysis (TEN) and TEN/Stevens-Johnson syndrome overlap.

    Science.gov (United States)

    Smith, Saxon D; Dodds, Annabel; Dixit, Shreya; Cooper, Alan

    2015-11-01

    Toxic epidermal necrolysis (TEN) and Stevens-Johnson syndrome (SJS) are severe mucocutaneous eruptions. There is currently no defined optimal approach to wound care. The objective of this study was to evaluate silver dressings in the wound-care management of TEN and SJS/TEN syndrome overlap with a retrospective case review of nine patients with TEN and SJS/TEN overlap presenting to our institution. Nanocrystalline silver dressings appear to be useful in the rapid commencement of healing in these patients. TEN and SJS/TEN overlap are rare conditions. This contributed to a relatively small number of cases included in the study. The ease of application, antimicrobial properties and low frequency of change make nanocrystalline silver dressings ideal in TEN/SJS. © 2014 The Australasian College of Dermatologists.

  20. Antiepileptic drugs toxicity: A case of toxic epidermal necrolysis in patient with phenytoin prophylaxis post-cranial radiation for brain metastases.

    Science.gov (United States)

    AlQuliti, Khalid; Ratrout, Basem; AlZaki, Alaa

    2014-09-01

    Treatment of epilepsy with antiepileptic drugs (AED) is effective and remains the principal mode of management. A group of adverse effects and drug toxicity can develop immediately or later in the course of treatment. AEDs also have the potential of precipitating idiosyncratic adverse effects including serious cutaneous, hematological and hepatic events. Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare but severe cutaneous adverse reactions are related to or caused by a variety of medications including AEDs, they carry a high mortality and morbidity rate, accurate diagnosis and rapid treatment may improve the prognosis. To characterize the clinical features and methods of differentiating Stevens-Johnson syndrome from toxic epidermal necrolysis using a case study and to identify other factors that may contribute to this critical illness. Clinical knowledge of potential sever adverse reaction of AEDs is essential and may overcome treatment failure with major impact on health-related quality of life in people with epilepsy.

  1. Indications for intubation and early tracheostomy in patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Williams, Rachael; Hodge, Juvonda; Ingram, Walter

    2016-04-01

    Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) result in epidermal sloughing and mucositis. There are no published guidelines for intubation and early tracheostomy in this patient population. A retrospective chart review of 40 patients admitted from 2010 to 2015 with SJS and TEN was conducted. Descriptive statistics and significance were calculated. Of the 43% of patients who underwent early tracheostomy, 100% had oral involvement while the initial total body surface area (TBSA) was 70% or more in 41% of patients (P < .05). TBSA progressed 15% or more in 53% of patients with 6% having airway involvement and a neurologic diagnosis mandating intubation. Mortality was 17%. Indications for intubation and early tracheostomy for SJS and TEN are documented oral involvement plus one of the following: initial TBSA 70% or more; progression of TBSA involved from hospital day 1 to hospital day 3, 15% TBSA or more; underlying neurologic diagnosis preventing airway protection; and documented airway involvement on direct laryngoscopy. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Nine years of a single referral center management of Stevens-Johnson syndrome and toxic epidermal necrolysis (Lyell's syndrome).

    Science.gov (United States)

    Monteiro, Diana; Egipto, Paula; Barbosa, Julia; Horta, Ricardo; Amarante, Jose; Silva, Pedro; Silva, Alvaro

    2017-06-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) corresponds to a rare and acute life-threatening mucocutaneous reactions characterized by extensive necrosis and epidermal detachment. There are no efficacious pharmaceutical interventions proven through large clinical trials. We sought to study clinical cases admitted in our institution in order to determine which drugs and medical comorbidities or treatments impacted the mortality. In a retrospective study over 9 years we evaluated all patients presenting biopsy-proven SJS or TEN for age, gender, total body surface area involved, causing agents, SCORTEN score, blood transfusion, steroid administration, intubation, length of intensive care stay and death rate. Statistical analysis was done using SPSS statistical software. The highest incidence of SJS and TEN was in age group of 71-80 years. Of the 30 patients, 30% died from SJS/TEN, mainly due sepsis. For each subgroup SJS/TEN overlap had the highest mortality. The highest mortality was from antibiotic treatment as causing agent. Step-wise regression analysis identified mechanical ventilation requirement and age over 65 years as mortality high-risk factors. The most crucial interventions are discontinuation of the offending drug and prompt referral to a burn unit, which helps in early diagnosis and decrease mortality in these diseases. When SJS/TEN is caused by antibiotics suspicion of developing fatal sepsis should be high, independently of patients' medical condition.

  3. Role of Oxidative and Nitrosative Stress in Pathophysiology of Toxic Epidermal Necrolysis and Stevens Johnson Syndrome-A Pilot Study.

    Science.gov (United States)

    Peter, Dincy; Amirtharaj, G Jayakumar; Mathew, Teena; Pulimood, Susanne; Ramachandran, Anup

    2015-01-01

    Oxidative and nitrosative stress caused by drug metabolism may be a trigger for keratinocyte apoptosis in the epidermis seen in toxic epidermal necrolysis (TEN) and Stevens Johnson syndrome (SJS). To estimate oxidative damage in the serum and to examine the role of nitric oxide in mediating epidermal damage in patients with TEN and SJS. A prospective study was conducted among TEN and SJS patients and controls in a tertiary care center between January 2006 and February 2010. Patients with a maculopapular drug rash without detachment of skin constituted the control group 1 (drug exposed). Patients without a drug rash constituted the control group 2 (drug unexposed). The serum values of protein carbonyls, malondialdehyde, conjugated diene and nitrates were measured. Two-group comparison with the non-parametric Mann-Whitney U test was used. Significance of differences if any was established using Pearson's Chi-square test. Ten patients in the SJS-TEN group (study group), 8 patients in control group 1 and 7 patients in control group 2 were included. More than one drug was implicated in 4/10 patients in group 1 and 3/8 patients in group 2. SCORTEN of 0, 1 and 3 at admission were seen in 2, 6 and 2 patients, respectively. The serum values of protein carbonyls, malondialdehyde, conjugated diene and nitrates were not significantly increased in the study group when compared to the controls. There was no elevation of oxidative stress markers in patients with TEN and SJS as compared to the control population.

  4. Systemic lupus erythematosus presenting as Stevens-Johnson syndrome and toxic epidermal necrolysis: a report of three cases.

    Science.gov (United States)

    Lee, H Y; Tey, H L; Pang, S M; Thirumoorthy, T

    2011-05-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are life-threatening dermatological conditions that are characterized by mucositis, epidermal detachment and erosions. The underlying etiology in SJS and TEN is almost invariably secondary to drugs. Rarely, other causes such as systemic lupus erythematosus (SLE), infections and vaccinations have been implicated. This report describes three patients with SLE who presented with manifestations of SJS/TEN without a clear drug causality. All three patients presented with photodistributed macular exanthema, which evolved to target lesions, bullae, erosions or sheet-like detachment. This was associated with oral mucositis and conjunctivitis. The onset of the rash was insidious with a protracted clinical course. Ultraviolet exposure and steroid tapering appear to be precipitating factors. In two of the patients, SJS and TEN were the initial presentation of lupus. Although SJS and TEN are almost invariably due to medications, they may, rarely, be an initial presentation of lupus, particularly when associated with an initial photodistribution, absence of genital involvement and a prolonged clinical course.

  5. Predicting Mechanical Ventilation and Mortality: Early and Late Indicators in Steven-Johnson Syndrome and Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Beck, Anna; Cooney, Ryan; Gamelli, Richard L; Mosier, Michael J

    2016-01-01

    Steven-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are characterized by loss of the epidermis, often accompanied by sloughing of the oral mucosa and airway, which may be associated with the need for mechanical ventilation. We retrospectively examined our SJS and TEN population for factors predictive of the need for mechanical ventilation and mortality. Over more than a 7-year period, 74 subjects of ≥18 years old with biopsy-confirmed SJS-TEN were identified. Variables within the first 3 days of admission and throughout the entire hospital stay were analyzed for their value in predicting the need for mechanical ventilation and mortality. Predictive variables were examined using univariate and multivariate logistic regression analyses. Of our 74 subjects, 28 (37.8%) required mechanical ventilation and 11 (13.9%) died, all of whom were intubated. Patients requiring ventilation had a significantly higher %TBSA loss of epidermis on admission and progressive epidermal loss after admission. On multivariate analysis, acute kidney injury within the first 3 days of admission and fewer days from symptom onset to admission were statistically significant in predicting need for mechanical ventilation. In addition, the early need for mechanical ventilation, early serum bicarbonate mechanical ventilation in adult TEN subjects is associated with higher mortality. This is the first time that mechanical ventilation has been specifically examined in the recent U.S. SJS and TEN population. The early recognition of patients at risk for ventilation may help guide management, especially in those patients admitted early after symptom development with acute kidney injury and extensive, progressing epidermal loss.

  6. Factors associated with increased mortality in a predominantly HIV-infected population with Stevens Johnson syndrome and toxic epidermal necrolysis.

    Directory of Open Access Journals (Sweden)

    Lauren Knight

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening drug reactions with a higher incidence in HIV-infected persons. SJS/TEN are associated with skin and mucosal failure, predisposing to systemic bacterial infection (BSI, a major cause of death. There are limited data on risk factors associated with BSI and and mortality in HIV-infected people with SJS/TEN.We conducted a retrospective study of patients admitted to a university hospital with SJS/TEN over a 3 year period. We evaluated their underlying illnesses, eliciting drugs, predictive value of bacterial skin cultures and other factors associated with mortality and BSI in a predominantly HIV-infected population by comparing characteristics of the patients who demised and those who survived.We admitted 86 cases during the study period and 67/86(78% were HIV-infected. Tuberculosis was the commonest co-morbidity, diagnosed in 12/86(14% cases. Skin cultures correlated with BSI by the same organism in 7/64(11% cases and 6/7 were Gram-negative. Two of the 8 cases of Gram-negative BSI had an associated Gram-negative skin culture, although not always the same organism. All 8 fatalities had >30% epidermal detachment, 7 were HIV-infected, 6 died of BSI and 6 had tuberculosis.Having >30% epidermal detachment in SJS/TEN carries an increased risk of BSI and mortality. Tuberculosis and BSI are associated with higher risk of death in SJS/TEN. Our data suggests there may be an association between Gram-negative BSI and Gram-negative skin infection.

  7. The risk of Stevens-Johnson syndrome and toxic epidermal necrolysis in new users of antiepileptic drugs.

    Science.gov (United States)

    Frey, Noel; Bodmer, Michael; Bircher, Andreas; Rüegg, Stephan; Jick, Susan S; Meier, Christoph R; Spoendlin, Julia

    2017-12-01

    Older antiepileptic drugs (AEDs) are known to cause Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN). However, evidence for newer AED is sparse. We quantified risks of SJS/TEN in association with use of all AEDs in the United Kingdom. In a matched case-control study of 480 previously validated SJS/TEN cases (1995-2013) we used conditional logistic regression to calculate odds ratios (ORs) with 95% confidence intervals (CIs), and calculated absolute risks of SJS/TEN within separate cohorts of new users of 28 AEDs. We assessed causality between drugs and SJS/TEN in each exposed case, using an adapted version of the algorithm of drug causality for epidermal necrolysis (ALDEN) score. We observed a strong association between SJS/TEN and new use of carbamazepine (OR 92.57, 95% CI 19.89-∞), phenytoin (OR 49.96, 95% CI 10.13-∞), and lamotrigine (OR 26.90, 95% CI 4.88-∞), where causality, according to the ALDEN score, was very probable or probable for most exposed cases. Absolute risks for SJS/TEN were highest for phenytoin (45.86 cases/100,000 exposed), lamotrigine (44.17 cases/100,000 exposed), and carbamazepine (20.38 cases/100,000 exposed). Despite increased ORs for valproate (40,941 exposed), gabapentin (116,037 exposed), pregabalin (59,967 exposed), and clobazam (4,300 exposed), ALDEN suggested no causal association. There were no observed cases of SJS/TEN among new users of levetiracetam (n = 96,77), clonazepam (n = 18,075), or topiramate (n = 11,307). The results of our study are consistent with those of previous studies of SJS/TEN, which found increased risks of SJS/TEN in new use of carbamazepine, phenytoin, and lamotrigine. Despite frequent use, no ALDEN-score confirmed cases were observed in new users of valproate, gabapentin, pregabalin, levetiracetam, topiramate, or clonazepam. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  8. Comparison of the acute ocular manifestations of Stevens-Johnson syndrome and toxic epidermal necrolysis in Chinese eyes: a 15-year retrospective study.

    Science.gov (United States)

    Chow, Loraine L W; Shih, Kendrick C; Chan, Johnny C Y; Lai, Jimmy S M; Ng, Alex L K

    2017-05-12

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare but life-threatening conditions that initially affect the skin and mucous membranes. The aim of this study was to compare the acute ocular manifestations between SJS and TEN. The initial presenting ophthalmic records of patients with either SJS ( = 30% involvement), who were treated at one tertiary burn center in Hong Kong between 1999 and 2014, were retrospectively analyzed and compared. A total of 20 SJS and 12 TEN cases were included. All were drug-induced. The patient demographics and treatment received were comparable. Overall, 40% of SJS and 75% of TEN patients had acute ocular surface inflammation. When comparing the two groups, there was a significant difference in the number of cases with mild involvement (5% in SJS, 42% in TEN, p = 0.01), while no statistically significant differences were found (p > 0.05) comparing between the moderate (15% in SJS, 0% in TEN) and severe groups (20% in SJS, 33% in TEN). Ocular surface inflammation was common during the acute phase in both SJS and TEN. TEN had a significantly higher number of cases with mild ocular involvement when compared with SJS, but no significant difference between the number of moderate and severe cases between the two groups.

  9. Skin rash in the intensive care unit: Stevens-Johnson syndrome, toxic epidermal necrolysis, or a rare manifestation of a hidden cutaneous malignancy: A case report.

    Science.gov (United States)

    Al-Saffar, Farah; Ibrahim, Saif; Patel, Pujan; Jacob, Rafik; Palacio, Carlos; Cury, James

    2016-03-01

    Skin rashes are infrequently encountered in the intensive care units, either as a result or as a cause of admission. The entities of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) form a spectrum of desquamating skin diseases that have multiple etiologies, the most common being drug-related reactions; very rarely, the cause may be cutaneous malignancies. We herein present a unique case of a 54-year-old male patient with psoriasis treated with methotrexate, who presented with a cellulitis-like clinical picture, then developed a severe progressive systemic inflammatory response syndrome, and progressed clinically to SJS, then TEN even after discontinuing the antibiotics and methotrexate. A skin biopsy demonstrated an aggressive and rapidly-progressing T-cell lymphoma. The present case highlights the necessity of skin biopsy when encountering SJS and TEN in the ICU in order to identify potentially treatable/controllable causes. Although it appeared reasonable to correlate TEN solely to medications, the skin biopsies clearly demonstrated an aggressive T-cell skin lymphoma. In a patient with a better general condition it may have been helpful to treat this malignancy. TEN is a life-threatening condition and skin biopsy is the cornerstone of diagnosis, despite the presence of multiple risk factors and the typical physical findings of a drug-induced reaction.

  10. [In vivoconfocal microscopic observation of corneal changes in patients with chronic Stevens-Johnson syndrome or toxic epidermal necrolysis].

    Science.gov (United States)

    Gao, T T; Li, Y; Liu, J; Long, Q

    2017-03-11

    Objective: To describe corneal alterations visible on in vivo confocal microscopy in patients with debilitating ocular sequelae caused by Stevens-Johnson syndrome (SJS) or toxic epidermal necrolysis (TEN). Methods: Twenty-two eyes of 11 consecutive patients suffering from chronic SJS or TEN were studied using slit lamp and in vivo confocal microscopy in the Ophthalmology Outpatient Department of Peking Union Medical College Hospital from March 2014 to April 2015. Results: Dry eye with meibomian gland dysfunction (19 eyes of 10 patients, 86.4%) was the most frequent clinical sequelae. Two patients (3 eyes, 13.6%) had severe vison loss with corneal neovascularization and conjunctivization. One patient had asymmetric binocular disease. Corneal epithelial cells were observed at an active state in 10 patients (19 eyes, 86.4%) and corneal stromal cells at an active state in all patients (22 eyes, 100%). Twenty eyes (10 patients, 91%) were noted with abnormal nerve layout and 10 eyes (5 patients, 45.5%) with dendritic cell infiltration around pathological nerve damages. Numerous inflammory cells were observed in 6 eyes (3 patients, 27.3%). Conclusions: The corneas of patients with chronic ocular sequelae associated with SJS or TEN present a number of abnormalities. In vivo confocal microscopy is a potetial useful tool for therapeutic indications and for follow-up of the debilitating chronic ocular problems linked to SJS and TEN. (Chin J Ophthalmol, 2017, 53:177-181) .

  11. Stevens-Johnson syndrome and toxic epidermal necrolysis in Dr. Hasan Sadikin General Hospital Bandung, Indonesia from 2009-2013

    Science.gov (United States)

    Suwarsa, Oki; Dharmadji, Hartati Purbo; Sutedja, Endang

    2016-01-01

    Background Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe cutaneous adverse reactions (SCAR) with high mortality and have a significant public health impact because of high mortality and morbidity. Objective To describe data the epidemiological features, etiology, and treatment of retrospectively reviewed data of all patients with SJS and TEN. Methods Retrospective study was conducted in patients with SJS and TEN treated from January 1, 2009 to December 31, 2013 in Dr. Hasan Sadikin General Hospital Bandung, Indonesia. Results A total of 57 patients were enrolled in the study. Thirty-nine cases of SJS (21 males and 18 females), 7 cases of SJS overlapping TEN (4 males and 3 females), and 11 cases of TEN (5 males and 6 females) were reported. All cases of SJS and TEN were caused by drugs, such as paracetamol (16.56%), carbamazepine (7%), amoxicillin (5.73%), ibuprofen (4.46%), rifampicin (3.18%), and trihexyphenidyl (3.18%). All cases were treated systemically with corticosteroid alone (100%). Seven from 57 patients (12,28%) died; 5 cases developed sepsis and 2 cases developed respiratory failure. The mortality rate was 7.69% in SJS, 0% in SJS/TEN overlap, and 36.36% in TEN. Conclusion The role of systemic corticosteroids in SJS and TEN are still controversial, but with a prompt and earlier treatment reduces mortality and improves outcomes of SJS and TEN patients. PMID:26844219

  12. [Stevens-Johnson syndrome and toxic epidermal necrolysis (SJSTEN) related to insecticide: Second case in the literature and potential implications].

    Science.gov (United States)

    Moullan, M; Ahossi, V; Zwetyenga, N

    2016-06-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis (SJSTEN) is a rare acute drug reaction characterized by the brutal destruction of the superficial layer of the skin and mucosa. SJSTEN is favoured by some drugs (90 % of cases) and genetic factors. It occurs at any age in both sexes. The pathophysiology is not completely understood. To our knowledge, only one case linked to an insecticide has been described. We present the second case involving a combination of lambdacyhalothrin and thiamethoxam. A 34-year-old farmer was admitted in emergency for a severe allergic reaction occurring few days after the use of an insecticide to treat his field with no particular precaution. The disease progression was swift: deterioration of general condition, generalized itching, blisters, bubbles, hyperthermia, tachycardia, significant oral pain and oral lesions and dysphagia. Hands, feet were concerned and external genitalia was responsible for burning urination. Oral lesions have rapidly evolved from edema to infected lesions. The diagnosis of SJSTEN was confirmed by histopathology. After complete assessment and adequate treatment, the patient was discharged after 17 days of hospitalization. The etiological research concluded to a probable poisoning by lambdacyhalothrin and thiamethoxam. This is the second published case of a SJSTEN linked to an insecticide combining lambdacyhalothrin and thiamethoxam. Manufacturers, users, regulators and physicians should take these data into account. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  13. Factors Contributing to Long-Term Severe Visual Impairment in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Passara Jongkhajornpong

    2017-01-01

    Full Text Available Purpose. To study the correlation between demographics and clinical variables and long-term severe visual impairment in patients with Stevens-Johnson syndrome (SJS or toxic epidermal necrolysis (TEN. Methods. A retrospective chart review of SJS/TEN patients between 2004 and 2014 was conducted. Demographics, causative agents, ocular manifestations, and visual outcomes were collected. The data were analyzed using a multivariate logistic regression model. Results. Of the 89 patients including SJS (65, 73.03%, TEN (15, 16.85%, and SJS-TEN overlap (9, 10.11%, 55 were female. The mean age was 41.58 ± 19.17 years. The most common identified agents were medications. Among these groups, antibiotics were the most prevalent (47.19%. Three patients (3.7% had unknown etiology. Antibiotics and nonpharmaceutical triggers were significantly associated with long-term severe visual impairment (odds ratio 4.32; P=0.015 and 7.20; P=0.037, resp.. There was a significant negative relationship between HIV infection and long-term severe visual impairment (P=0.021. Among all chronic ocular complications, only corneal neovascularization significantly correlated with severe visual impairment (P=0.001. Conclusions. SJS/TEN patients caused by nonpharmaceutical triggers or antibiotics have an increased risk of developing long-term severe visual impairment from corneal neovascularization. HIV infection might be a protective factor against long-term poor visual outcomes.

  14. Factors Contributing to Long-Term Severe Visual Impairment in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Science.gov (United States)

    Siriyotha, Sukanya; Kanokrungsee, Silada; Chuckpaiwong, Varintorn

    2017-01-01

    Purpose. To study the correlation between demographics and clinical variables and long-term severe visual impairment in patients with Stevens-Johnson syndrome (SJS) or toxic epidermal necrolysis (TEN). Methods. A retrospective chart review of SJS/TEN patients between 2004 and 2014 was conducted. Demographics, causative agents, ocular manifestations, and visual outcomes were collected. The data were analyzed using a multivariate logistic regression model. Results. Of the 89 patients including SJS (65, 73.03%), TEN (15, 16.85%), and SJS-TEN overlap (9, 10.11%), 55 were female. The mean age was 41.58 ± 19.17 years. The most common identified agents were medications. Among these groups, antibiotics were the most prevalent (47.19%). Three patients (3.7%) had unknown etiology. Antibiotics and nonpharmaceutical triggers were significantly associated with long-term severe visual impairment (odds ratio 4.32; P = 0.015 and 7.20; P = 0.037, resp.). There was a significant negative relationship between HIV infection and long-term severe visual impairment (P = 0.021). Among all chronic ocular complications, only corneal neovascularization significantly correlated with severe visual impairment (P = 0.001). Conclusions. SJS/TEN patients caused by nonpharmaceutical triggers or antibiotics have an increased risk of developing long-term severe visual impairment from corneal neovascularization. HIV infection might be a protective factor against long-term poor visual outcomes. PMID:28458921

  15. Microbiological findings and antibacterial therapy in Stevens-Johnson syndrome/toxic epidermal necrolysis patients from a Swedish Burn Center.

    Science.gov (United States)

    Tocco-Tussardi, Ilaria; Huss, Fredrik; Presman, Benjamin

    2017-05-01

    Superimposed infections/sepsis are the major cause of morbidity/mortality in Stevens-Johnson syndrome/Toxic Epidermal Necrolysis (SJS/TEN). It is a delicate balance between avoiding new pharmaceuticals and prophylactically treat an incipient infection. The objective of this study was to investigate the rates and types of infection-microbials and antibiotics involved in SJS/TEN patients. Microbiology and clinical data were collected for SJS/TEN patients admitted to our Burn Center from January 2010 through January 2016. A total of 24 patients were admitted over the study period. There were 303 bacterial cultures taken whereof 113 (37.3%) were positive (median of 4.4 per patient). Twenty-two (91.7%) patients had at least 1 positive sample recorded. Fifteen (62.5%) patients had a confirmed episode of sepsis with skin being the most common source of colonization (77.8%). Eleven (45.8%) patients received empiric antibiotic therapy at referral facility/prior to admission to our Center. Patients who grew a higher number of different species were significantly less likely to have received early empiric antimicrobial therapy (P < .001). Secondary bacterial infection and sepsis were a highly common finding in our patient population. Despite the risk of resistance and further immunological provocation, empirical antibiotic treatment might have a place in clinical management. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Role of Oxidative and Nitrosative Stress in Pathophysiology of Toxic Epidermal Necrolysis and Stevens Johnson Syndrome—A Pilot Study

    Science.gov (United States)

    Peter, Dincy; Amirtharaj, G Jayakumar; Mathew, Teena; Pulimood, Susanne; Ramachandran, Anup

    2015-01-01

    Background: Oxidative and nitrosative stress caused by drug metabolism may be a trigger for keratinocyte apoptosis in the epidermis seen in toxic epidermal necrolysis (TEN) and Stevens Johnson syndrome (SJS). Aims: To estimate oxidative damage in the serum and to examine the role of nitric oxide in mediating epidermal damage in patients with TEN and SJS. Materials and Methods: A prospective study was conducted among TEN and SJS patients and controls in a tertiary care center between January 2006 and February 2010. Patients with a maculopapular drug rash without detachment of skin constituted the control group 1 (drug exposed). Patients without a drug rash constituted the control group 2 (drug unexposed). The serum values of protein carbonyls, malondialdehyde, conjugated diene and nitrates were measured. Two-group comparison with the non-parametric Mann–Whitney U test was used. Significance of differences if any was established using Pearson's Chi-square test. Results: Ten patients in the SJS-TEN group (study group), 8 patients in control group 1 and 7 patients in control group 2 were included. More than one drug was implicated in 4/10 patients in group 1 and 3/8 patients in group 2. SCORTEN of 0, 1 and 3 at admission were seen in 2, 6 and 2 patients, respectively. The serum values of protein carbonyls, malondialdehyde, conjugated diene and nitrates were not significantly increased in the study group when compared to the controls. Conclusions: There was no elevation of oxidative stress markers in patients with TEN and SJS as compared to the control population. PMID:26538686

  17. Survey of Nonprescription Medication and Antibiotic Use in Patients with Stevens-Johnson Syndrome, Toxic Epidermal Necrolysis, and Overlap Syndrome

    Directory of Open Access Journals (Sweden)

    Katherine J. Sullivan

    2018-02-01

    Full Text Available Stevens-Johnson syndrome (SJS, toxic epidermal necrolysis (TEN, and overlap syndrome (SJS-TEN are rare, serious skin and mucosa break-down conditions frequently associated with antibiotic use. The role of nonprescription medications alone, or in combination with antibiotics in triggering SJS/TEN, is largely unknown. This study summarized data collected from patient surveys about nonprescription and antibiotic use prior to a SJS/TEN diagnosis. The survey was administered online to members of the U.S. SJS Foundation who had been diagnosed with SJS/TEN or were the parent of a child who had been diagnosed with SJS/TEN. Respondents were asked about nonprescription medications taken within the year before diagnosis, and the approximate point in time before diagnosis that they had taken them. They were also asked about specific prescription medications, including antibiotics, that they took before diagnosis. An estimated 4500 patients received an invitation to complete the survey. 251 patients completed it, resulting in a response rate of 5.6%. The mean age of respondents was 43 years (SD (standard deviation = 17.3 and 70% were female. 32.3% of respondents indicated that a prescription antibiotic triggered their reaction. 14.1% indicated a nonprescription medication had triggered their SJS/TEN, and 18.1% said a nonprescription medication may have triggered their SJS/TEN. 85.5% of respondents said they took a nonprescription medication within three months of their SJS/TEN diagnosis. Of those respondents who reported that an antibiotic triggered their SJS/TEN, 35.2% reported taking a nonprescription medication within the three months prior to their diagnosis. This survey captured valuable information about nonprescription and antibiotic use in SJS/TEN patients. It is important for future studies to estimate the impact of antibiotics on SJS/TEN, and account for nonprescription medication use in that relationship.

  18. Interleukin-15 Is Associated with Severity and Mortality in Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis.

    Science.gov (United States)

    Su, Shih-Chi; Mockenhaupt, Maja; Wolkenstein, Pierre; Dunant, Ariane; Le Gouvello, Sabine; Chen, Chun-Bing; Chosidow, Olivier; Valeyrie-Allanore, Laurence; Bellon, Teresa; Sekula, Peggy; Wang, Chuang-Wei; Schumacher, Martin; Kardaun, Sylvia H; Hung, Shuen-Iu; Roujeau, Jean-Claude; Chung, Wen-Hung

    2017-05-01

    Early diagnosis and prognosis monitoring for Stevens-Johnson syndrome/toxic epidermal necrolysis (TEN) still remain a challenge. This study aims to explore any cytokine/chemokine with prognostic potential in Stevens-Johnson syndrome/TEN. Through screening a panel of 28 serological factors, IL-6, IL-8, IL-15, tumor necrosis factor-α, and granulysin were upregulated in patients with Stevens-Johnson syndrome/TEN and selected for the further validation in total 155 patients with Stevens-Johnson syndrome/TEN, including 77 from Taiwan and 78 from the Registry of Severe Cutaneous Adverse Reactions. Among these factors evaluated, the levels of IL-15 (r = 0.401; P < 0.001) and granulysin (r = 0.223; P = 0.026) were significantly correlated with the disease severity in 112 samples after excluding patients with insufficient data to calculate the score of TEN. In addition, IL-15 was also associated with mortality (P = 0.002; odds ratio, 1.09; 95% confidence interval, 1.03-1.14; P = 0.001; adjusted odds ratio, 1.10; 95% confidence interval, 1.04-1.16). Consistent results were obtained after the exclusion of Taiwanese patients with sepsis to rule out possible confounders. Moreover, IL-15 was shown to enhance cytotoxicity of cultured natural killer cells and blister cells from patients with TEN. Our findings highlight a usefulness of IL-15 in prognosis monitoring and therapeutic intervention of this devastating condition. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Validation of Stevens-Johnson syndrome or toxic epidermal necrolysis diagnoses in the Clinical Practice Research Datalink.

    Science.gov (United States)

    Frey, Noel; Bircher, Andreas; Bodmer, Michael; Jick, Susan S; Meier, Christoph R; Spoendlin, Julia

    2017-04-01

    To evaluate the validity of recorded diagnoses of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) in the Clinical Practice Research Datalink (CPRD). We identified patients with a diagnosis of SJS or TEN between 1995 and 2013 in the CPRD. We reviewed information from patient records, free text, and hospital episode statistics (HES) data, and excluded patients with no indication of a secondary care referral. Remaining patients were classified as probable, possible, or unlikely cases of SJS/TEN by two specialised clinicians or based on pre-defined classification criteria. We quantified positive predictive values (PPV) for all SJS/TEN patients and for patients categorised as 'probable/possible' cases of SJS/TEN, based on a representative subsample of 118 patients for whom we had unequivocal information (original discharge letters or HES data). We identified 1324 patients with a diagnosis of SJS/TEN, among whom 638 had a secondary care referral recorded. Of those, 565 were classified as probable or possible cases after expert review. We calculated a PPV of 0.79 (95% CI, 0.71-0.86) for all SJS/TEN patients with a recorded secondary care referral, and a PPV of 0.87 (95% CI, 0.81-0.93) for probable/possible cases. After excluding 14 false positive patients, our study population consisted of 551 SJS/TEN patients. Diagnoses of SJS/TEN are recorded with moderate diagnostic accuracy in the CPRD, which was substantially improved by additional expert review of all available information. We established a large population-based SJS/TEN study population of high diagnostic validity from the CPRD. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  20. Carbamazepine - The commonest cause of toxic epidermal necrolysis and Stevens-Johnson syndrome: A study of 7 years

    Directory of Open Access Journals (Sweden)

    Devi K

    2005-01-01

    Full Text Available Background : Toxic epidermal necrolysis (TEN and Stevens-Johnson syndrome (SJS are a group of severe life threatening drug reactions. The drugs commonly implicated as the cause of these drug reactions vary depending on host factors and the prescription pattern of drugs in that particular area. Aim : The aim of the study was to find the drugs implicated as the cause of SJS/TEN in the patients admitted in the dermatology ward at the Medical College, Thrissur and to find the clinical outcome. Methods : It was a retrospective study of 7 years from 1997 to 2004. The case records of all patients with a clinical diagnosis of TEN or SJS were studied in detail regarding the drugs implicated as the cause, the management and the clinical outcome. Results : During the study period, 41 patients in the age group ranging from 12 to 72 years were treated as inpatients, of which 20 were males and 21 were females. The commonest drug implicated as the cause of SJS/TEN was carbamazepine (44%. The indication for carbamazepine was control of pain in more than 50% of the cases. Presence of a major systemic disease before the onset of SJS/TEN was associated with a bad prognosis. Conclusion : The increased use of carbamazepine, especially for control of pain, may be the reason for the increased incidence of SJS/TEN due to the same drug. Awareness about the drugs implicated in life threatening drug reactions will help physicians in preventing them by judicious use of the drugs.

  1. Survey of Nonprescription Medication and Antibiotic Use in Patients with Stevens-Johnson Syndrome, Toxic Epidermal Necrolysis, and Overlap Syndrome.

    Science.gov (United States)

    Sullivan, Katherine J; Jeffres, Meghan N; Dellavalle, Robert P; Valuck, Robert; Anderson, Heather D

    2018-02-01

    Stevens-Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), and overlap syndrome (SJS-TEN) are rare, serious skin and mucosa break-down conditions frequently associated with antibiotic use. The role of nonprescription medications alone, or in combination with antibiotics in triggering SJS/TEN, is largely unknown. This study summarized data collected from patient surveys about nonprescription and antibiotic use prior to a SJS/TEN diagnosis. The survey was administered online to members of the U.S. SJS Foundation who had been diagnosed with SJS/TEN or were the parent of a child who had been diagnosed with SJS/TEN. Respondents were asked about nonprescription medications taken within the year before diagnosis, and the approximate point in time before diagnosis that they had taken them. They were also asked about specific prescription medications, including antibiotics, that they took before diagnosis. An estimated 4500 patients received an invitation to complete the survey. 251 patients completed it, resulting in a response rate of 5.6%. The mean age of respondents was 43 years (SD (standard deviation) = 17.3) and 70% were female. 32.3% of respondents indicated that a prescription antibiotic triggered their reaction. 14.1% indicated a nonprescription medication had triggered their SJS/TEN, and 18.1% said a nonprescription medication may have triggered their SJS/TEN. 85.5% of respondents said they took a nonprescription medication within three months of their SJS/TEN diagnosis. Of those respondents who reported that an antibiotic triggered their SJS/TEN, 35.2% reported taking a nonprescription medication within the three months prior to their diagnosis. This survey captured valuable information about nonprescription and antibiotic use in SJS/TEN patients. It is important for future studies to estimate the impact of antibiotics on SJS/TEN, and account for nonprescription medication use in that relationship.

  2. Stevens-Johnson syndrome/toxic epidermal necrolysis and erythema multiforme drug-related hospitalisations in a national administrative database.

    Science.gov (United States)

    Sousa-Pinto, Bernardo; Araújo, Luís; Freitas, Alberto; Correia, Osvaldo; Delgado, Luís

    2018-01-01

    Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) and erythema multiforme (EM) are immunologically-mediated dermatological disorders commonly triggered by drug exposure and/or other external agents. We aimed to characterise SJS/TEN- and EM-drug-related hospitalisations in a nationwide administrative database, focusing on demographic and clinical characteristics, and in the most frequently implicated drug classes. We analysed all drug-related hospitalisations with associated diagnosis of SJS/TEN or EM in Portuguese hospitals between 2009 and 2014. We compared gender, age, comorbidities, length of stay, and in-hospital mortality and estimated the number of episodes per million packages sold of drug classes. Predictors of in-hospital mortality were investigated in both conditions by logistic regression. There were 132 SJS/TEN-related and 122 EM-related hospitalisations. Incidence and in-hospital mortality of SJS/TEN episodes (24.2%) were consistent with previous studies. HIV co-infection was more common among SJS/TEN hospitalisations (9 vs. 2% with EM; P  = 0.009). Liver disease, advanced age, and a TEN diagnosis, were significantly associated with higher risk of mortality in patients with SJS/TEN. The highest numbers of SJS/TEN and EM episodes per million drug packages sold were observed for antivirals (8.7 and 1.5, respectively), antineoplastic/immunosuppressive drugs (5.6 and 3.9, respectively) and hypouricaemic drugs (5.0 and 2.4, respectively). SJS/TEN in-hospital mortality is high, and its risk factors include advanced age, liver disease, and TEN diagnosis. The drug classes most frequently associated with these conditions include antivirals, hypouricaemic drugs and antineoplastic/immunosuppressive drugs. Administrative databases seem useful in the study of SJS/TEN drug-related hospitalisations, yielding results consistent with previous studies and on a nationwide basis.

  3. Retrospective analysis of Stevens-Johnson syndrome and toxic epidermal necrolysis in 87 Japanese patients--Treatment and outcome.

    Science.gov (United States)

    Yamane, Yumiko; Matsukura, Setsuko; Watanabe, Yuko; Yamaguchi, Yukie; Nakamura, Kazuko; Kambara, Takeshi; Ikezawa, Zenro; Aihara, Michiko

    2016-01-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare but severe adverse drug reactions with high mortality. To present the clinical characteristics of SJS and TEN in Japan and evaluate the efficacy of treatments, we retrospectively analyzed cases of SJS and TEN treated in 2 university hospitals during 2000-2013. Fifty-two cases of SJS (21 males and 31 females; average age, 55.1 years) and 35 cases of TEN (17 males and 18 females; average age, 56.6 years) were included in this study. Twenty-eight cases of SJS (53.8%) and all cases of TEN were caused by drugs. Hepatitis was the most common organ involvement in both SJS and TEN. Renal dysfunction, intestinal disorder, and respiratory disorder were also involved in some cases. The major complication was pneumonia and sepsis. All cases except for 3 cases were treated systemically with corticosteroids. Steroid pulse therapy was performed in 88.6% of TEN. Plasmapheresis and/or immunoglobulin therapy was combined with steroid therapy mainly in TEN after 2007. The mortality rate was 6.9% and the rates for SJS and TEN were 1.9% and 14.3%, respectively. These were much lower than predicted mortality according to a severity-of-illness scoring system for TEN prognosis (SCORTEN) score. When comparing the mortality rate between 2000-2006 and 2007-2013, it was decreased from 4.5% to 0.0% in SJS and from 22.2% to 5.3% in TEN. Treatment with steroid pulse therapy in combination with plasmapheresis and/or immunoglobulin therapy seems to have contributed to prognostic improvement in SJS/TEN. Copyright © 2015 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  4. ABC transporters and the proteasome complex are implicated in susceptibility to Stevens-Johnson syndrome and toxic epidermal necrolysis across multiple drugs.

    Directory of Open Access Journals (Sweden)

    Paola Nicoletti

    Full Text Available Stevens-Johnson syndrome (SJS and Toxic Epidermal Necrolysis (TEN represent rare but serious adverse drug reactions (ADRs. Both are characterized by distinctive blistering lesions and significant mortality rates. While there is evidence for strong drug-specific genetic predisposition related to HLA alleles, recent genome wide association studies (GWAS on European and Asian populations have failed to identify genetic susceptibility alleles that are common across multiple drugs. We hypothesize that this is a consequence of the low to moderate effect size of individual genetic risk factors. To test this hypothesis we developed Pointer, a new algorithm that assesses the aggregate effect of multiple low risk variants on a pathway using a gene set enrichment approach. A key advantage of our method is the capability to associate SNPs with genes by exploiting physical proximity as well as by using expression quantitative trait loci (eQTLs that capture information about both cis- and trans-acting regulatory effects. We control for known bias-inducing aspects of enrichment based analyses, such as: 1 gene length, 2 gene set size, 3 presence of biologically related genes within the same linkage disequilibrium (LD region, and, 4 genes shared among multiple gene sets. We applied this approach to publicly available SJS/TEN genome-wide genotype data and identified the ABC transporter and Proteasome pathways as potentially implicated in the genetic susceptibility of non-drug-specific SJS/TEN. We demonstrated that the innovative SNP-to-gene mapping phase of the method was essential in detecting the significant enrichment for those pathways. Analysis of an independent gene expression dataset provides supportive functional evidence for the involvement of Proteasome pathways in SJS/TEN cutaneous lesions. These results suggest that Pointer provides a useful framework for the integrative analysis of pharmacogenetic GWAS data, by increasing the power to detect

  5. Systemic Immunomodulating Therapies for Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A Systematic Review and Meta-analysis.

    Science.gov (United States)

    Zimmermann, Stefanie; Sekula, Peggy; Venhoff, Moritz; Motschall, Edith; Knaus, Jochen; Schumacher, Martin; Mockenhaupt, Maja

    2017-06-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are rare but severe adverse reactions with high mortality. There is no evidence-based treatment, but various systemic immunomodulating therapies are used. To provide an overview on possible immunomodulating treatments for SJS/TEN and estimate their effects on mortality compared with supportive care. A literature search was performed in December 2012 for articles published in MEDLINE, MEDLINE Daily, MEDLINE Inprocess, Web of Science, EMBASE, Scopus, and the Cochrane Library (Central) from January 1990 through December 2012, and updated in December 2015, in the English, French, Spanish, and German languages looking for treatment proposals for SJS/TEN. Other sources were screened manually. Initially, 157 randomized and nonrandomized studies on therapies (systemic immunomodulating therapies or supportive care) for SJS/TEN were selected. Relevant data were extracted from articles. Authors were contacted for further information. Finally, 96 studies with sufficient information regarding eligibility and adequate quality scores were considered in the data synthesis. All steps were performed independently by 2 investigators. Meta-analyses on aggregated study data (random-effects model) and individual patient data (IPD) (logistic regression adjusted for confounders) were performed to assess therapeutic efficacy. In the analysis of IPD, 2 regression models, stratified and unstratified by study, were fitted. Therapy effects on mortality were expressed in terms of odds ratios (ORs) with 95% CIs. Overall, 96 studies (3248 patients) were included. Applied therapies were supportive care or systemic immunomodulating therapies, including glucocorticosteroids, intravenous immunoglobulins, cyclosporine, plasmapheresis, thalidomide, cyclophosphamide, hemoperfusion, tumor necrosis factor inhibitors, and granulocyte colony-stimulating factors. Glucocorticosteroids were associated with a survival benefit for patients in all

  6. CYP2C19*2 status in patients with Stevens-Johnson syndrome and toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    Laska AJ

    2017-05-01

    Full Text Available Amanda J Laska,1 Marie J Han,1 Josh A Lospinoso,2 Patrick J Brown,1 Thomas M Beachkofsky1 1Department of Dermatology, San Antonio Uniformed Services Health Education Consortium, San Antonio, TX, 2780th Military Intelligence Brigade, Ft Meade, MD, USA Purpose: Genetic polymorphisms have been linked to an increased predisposition to developing certain diseases. For example, patients of Han-Chinese descent carrying the HLA-B*1502 allele are at an increased risk of developing Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN if given carbamazepine. Given the complexity of in vivo drug metabolism, it is plausible that the activity of enzyme systems unrelated to specific drug metabolism may be important. Although multiple biomarkers have been identified in unique ethnic groups, there has yet to be a study investigating the presence of the slow metabolizing allele of CYP2C19, denoted CYP2C19*2, in diverse groups and the risk of developing SJS/TEN. Patients and methods: This study looked into the carrier status of CYP2C19*2, a poor metabolizing variant of CYP2C19, in patients diagnosed with SJS/TEN. We looked at its status in our series as a whole and when patients were divided by ethnicity. Genomic DNA was extracted from formalin-fixed paraffin-embedded tissue of patients with biopsy-proven SJS/TEN and real-time polymerase chain reaction was used to assess for the presence of CYP2C19*2. Results: CYP2C19*2 status was determined in 47 patients. Twenty-nine of these 47 patients had a single medication implicated as causing their disease, and eight of these patients were heterozygous or homozygous for CYP2C19*2. There was insufficient evidence to conclude that the presence of CYP2C19*2 is an independent predictor of risk for developing SJS/TEN in our series as a whole. This analysis also confirmed that the frequency of the CYP2C19*2 polymorphism within the different ethnicities in our series did not vary statistically from reported ethnic

  7. Incidence, causative factors and mortality rates of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) in northern Italy: data from the REACT registry.

    Science.gov (United States)

    Diphoorn, Janouk; Cazzaniga, Simone; Gamba, Chiara; Schroeder, Jan; Citterio, Antonella; Rivolta, Alma Lisa; Vighi, Giuseppe Danilo; Naldi, Luigi

    2016-02-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are rare but severe cutaneous adverse drug reactions. We assessed incidence, drug exposure and mortality, analysing data obtained from the Lombardy Registry of Severe Cutaneous Reactions (REACT). Data were collected from hospitals in the Italian Lombardy region (9,502,272 people). A trained monitor was sent to the reporting hospital to collect data on drug exposure and clinical features. The algorithm for drug causality for epidermal necrolysis algorithm was applied to assess drug causality. Defined Daily Dose (DDD) was used to express drug consumption. From April 2009 to November 2014, 17 cases of TEN and 59 cases of SJS were collected. The overall incidence rate was 1.40 cases (95%CI, 1.12-1.76) per million people per year. A total of 15 cases died during hospitalization with a mortality rate of 16.9% for SJS and 29.4% for TEN. Overall, 55.4% of cases had a probable or very probable relation with drug exposure. In a total of five patients (6.6%), no causative drug for the reaction was identifiable. Allopurinol contributed to the highest number of cases (23 cases), while the highest incidence based on more than one case reported was observed for cotrimoxazole and lamotrigine, with 5.37 cases (95%CI, 2.09-13.80) and 3.54 (95%CI, 1.21-10.42) per 10 million DDD/year, respectively. We confirmed that SJS and TEN are rare adverse cutaneous reactions. As expected, mortality was influenced by the degree of skin detachment. The profile of drugs associated with the reactions was in agreement with data from other surveillance systems. Copyright © 2015 John Wiley & Sons, Ltd.

  8. Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A Concise Review with a Comprehensive Summary of Therapeutic Interventions Emphasizing Supportive Measures.

    Science.gov (United States)

    Schneider, Jeremy A; Cohen, Philip R

    2017-06-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are two of the most severe dermatologic conditions occurring in the inpatient setting. There is a lack of consensus regarding appropriate management of SJS and TEN. The scientific literature pertaining to SJS and TEN (subsequently referred to as SJS/TEN) is summarized and assessed. In addition, an interventional approach for the clinician is provided. PubMed was searched with the key words: corticosteroids, cyclosporine, etanercept, intravenous immunoglobulin, Stevens-Johnson syndrome, and toxic epidermal necrolysis. The papers generated by the search, and their references, were reviewed. Supportive care is the most universally accepted intervention for SJS/TEN. Specific guidelines differ from the care required for patients with thermal burns. Adjuvant therapies are utilized in most severe cases, but the data are thus far underwhelming and underpowered. Using systemic corticosteroids as sole therapy is not supported. A consensus regarding combined corticosteroids and intravenous immunoglobulin (IVIG) has not been reached. Data regarding IVIG, currently the standard of care for most referral centers, is conflicting. Newer studies regarding cyclosporine and tumor necrosis factor inhibitors are promising, but not powered to provide definitive evidence of efficacy. Data regarding plasmapheresis is equivocal. Thalidomide increases mortality. Clinicians who manage SJS/TEN should seek to employ interventions with the greatest impact on their patients' condition. While supportive care measures may seem an obvious aspect of SJS/TEN patient care, providers should understand that these interventions are imperative and that they differ from the care recommended for other critically ill or burn patients. While adjuvant therapies are frequently discussed and debated for hospitalized patients with SJS/TEN, a standardized management approach is not yet clear based on the current data. Therefore, until further data

  9. Antecedent Drug Exposure Aetiology and Management Protocols in Steven-Johnson Syndrome and Toxic Epidermal Necrolysis, A Hospital Based Prospective Study.

    Science.gov (United States)

    Farhat, Samina; Banday, Muddasir; Hassan, Iffat

    2016-01-01

    The study sought to identify the magnitude and characteristic of severe cutaneous adverse reactions (SCAR's) like Steven-Johnson syndrome (SJS) and Toxic Epidermal Necrolysis (TEN). A prospective study was conducted by the Department of Pharmacology in association with Department of Dermatology in SMHS hospital. The study was carried out from June 2013-June 2015 on hospitalized cases of cutaneous adverse drug reaction reporting in hospital. The SCAR's were reported in a structured questionnaire based on adverse drug reaction (ADR) reporting form provided by the Central Drug Standard Control Organization (CDSCO) Ministry of Health and Family welfare, Government of India. The SCAR's were analysed for their characteristics, causality, severity and prognosis. Causality assessment was done by using a validated ADR probability scale of Naranjo as well as WHO Uppsala Monitoring Center (WHO-UMC) system for standardized case causality assessment. The management protocol were analysed for their clinical outcome through a proper follow up period. A total of 52 hospitalized cases of cutaneous adverse drug reactions were reported during the study period. We identified a total of 15 cases (28%) of SCAR's involving 9(17%) of SJS and 6 (12%) of TEN. SJS was seen in 2(22%) males and 7(78%) females. TEN was seen in all females (100%) and in no male. Drugs implicated in causing these life threatening reactions were identified as anticonvulsant agents like carbamazepine (CBZ), phenytoin (PHT) and Lamotrigine (LTG), oxicam NSAID, Sulfasalazine and levofloxacin. Despite higher reported mortality rates in SJS and TEN all patients survived with 2 patients surviving TEN suffered from long term opthalmological sequelae of the disease. Present study suggest that drug induced cutaneous eruptions are common ranging from common nuisance rashes to rare life threatening diseases like SJS and TEN, SJS/TEN typically occur 1-3 weeks after initiation of therapy. Aromatic AED's, LTG, oxicam NSAID

  10. Retrospective analysis of Steven Johnson syndrome and toxic epidermal necrolysis over a period of 5 years from northern Karnataka, India.

    Science.gov (United States)

    Naveen, Kikkeri Narayanasetty; Pai, Varadraj V; Rai, Vijetha; Athanikar, Sharatchandra B

    2013-01-01

    Cutaneous drug reactions are the most common type of adverse drug reactions. Adverse cutaneous drug reactions form 2-3% of the hospitalized patients. 2% of these are potentially serious. This study aims to detect the drugs commonly implicated in Steven Johnson Syndrome-Toxic Epidermal Necrosis (SJS-TEN). A retrospective analysis was done in all patients admitted in the last five years in SDM hospital with the diagnosis of SJS-TEN. A total of 22 patients with SJS-TEN were studied. In 11 patients anti-epileptics was the causal drug and in 7, anti-microbials was the causal drug. Recovery was much faster in case of anti epileptics induced SJS-TEN as compared to that induced by ofloxacin. SJS-TEN induced by ofloxacin has a higher morbidity and mortality compared to anti convulsants.

  11. Severe delayed skin reactions related to drugs in the paediatric age group: A review of the subject by way of three cases (Stevens-Johnson syndrome, toxic epidermal necrolysis and DRESS).

    Science.gov (United States)

    Belver, M T; Michavila, A; Bobolea, I; Feito, M; Bellón, T; Quirce, S

    2016-01-01

    Severe delayed drug-induced skin reactions in children are not common but potentially serious. This article describes aspects concerning the etiology, pathogenesis and clinical manifestations of these processes; it presents three paediatric cases, namely STS (Steven Johnson Syndrome), TEN (toxic epidermal necrolysis), probably related to amoxicillin/clavulanate and ibuprofen and DRESS (a drug reaction with eosinophilia and systemic symptoms) secondary to phenytoin; and in relation to them, the diagnosis and the treatment of these processes are discussed and reviewed. The AGEP (acute generalised exanthematous pustulosis) is also reviewed. The aetiological diagnosis of severe non-immediate reactions is difficult, and the value of current allergological testing is not well defined in these cases. Diagnosis is based on clinical history, the empirical risk of drugs to trigger SJS/TEN or DRESS, and the in vivo and in vitro testing of the suspect drug. Skin biopsy confirms that the clinical diagnosis and delayed hypersensitivity tests, especially the patch test and the lymphoblastic transformation test (LTT), may be important to confirm the aetiological diagnosis, in our cases emphasising the latter. These diseases can be life threatening (especially DRESS and TEN) and/or have a high rate of major complications or sequelae (SJS/TEN). The three cases described progressed well without sequelae. All were treated with corticosteroids, which is the most currently accepted treatment although the effect has not been clearly demonstrated. Copyright © 2015 SEICAP. Published by Elsevier Espana. All rights reserved.

  12. In Silico Risk Assessment of HLA-A*02:06-Associated Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis Caused by Cold Medicine Ingredients

    Directory of Open Access Journals (Sweden)

    Hideto Isogai

    2013-01-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are severe drug hypersensitivities with high mortality. Typical over-the-counter drugs of cold medicines are suggested to be causative. As multiple ingredients are generally contained in cold medicines, it is of particular interest to investigate which ingredients are responsible for SJS/TEN. However, experimental examination of causal relationships between SJS/TEN and a particular drug molecule is not straightforward. Significant association between HLA-A*02:06 and SJS/TEN with severe ocular surface complications has been observed in the Japanese. In the present study, we have undertaken in silico docking simulations between various ingredients contained in cold medicines available in Japan and the HLA-A*02:06 molecule. We use the composite risk index (CRI that is the absolute value of the binding affinity multiplied by the daily dose to assess the potential risk of the adverse reactions. The drugs which have been recognized as causative drugs of SJS/TEN in Japan have revealed relatively high CRI, and the association between SJS/TEN and HLA-A*02:06 has been qualitatively verified. The results have also shown that some drugs whose links to SJS/TEN have not been clinically recognized in Japan show the high CRI and suggested that attention should be paid to their adverse drug reactions.

  13. Evaluation of SCORTEN on a cohort of patients with Stevens-Johnson syndrome and toxic epidermal necrolysis included in the RegiSCAR study.

    Science.gov (United States)

    Sekula, Peggy; Liss, Yvonne; Davidovici, Batya; Dunant, Ariane; Roujeau, Jean-Claude; Kardaun, Sylvia; Naldi, Luigi; Schumacher, Martin; Mockenhaupt, Maja

    2011-01-01

    The purpose of this study was to evaluate the severity-of-illness score called SCORTEN with respect to its predictive ability and by using data obtained in the RegiSCAR study, the most comprehensive European registry of patients with Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). For advanced comparisons, an auxiliary score (AS) was defined using data obtained in a previous study. Three hundred sixty-nine patients with SJS/TEN were included in RegiSCAR between 2003 and 2005. The data needed for calculation of SCORTEN were available for 45% of patients. The score revealed a moderate predictive ability with a slight underestimation of the total number of in-hospital deaths by 11%, an area under the receiver operating characteristic curve of 0.75, and a Brier score of 0.14. Problems could be seen by analyzing subgroups such as patients with TEN. The AS was better calibrated but discriminated worse (area under the receiver operating characteristic curve: 0.72; Brier score: 0.14). With the help of a refined score derived from SCORTEN and AS, potential for a possible improvement could be demonstrated. The authors were able to show that the predictive ability of SCORTEN is acceptable. Although improvement might be possible, SCORTEN remains the tool of choice, whereas AS might be an alternative in retrospective settings with missing laboratory data.

  14. Cyclosporine treatment for Stevens-Johnson syndrome/toxic epidermal necrolysis: Retrospective analysis of a cohort treated in a specialized referral center.

    Science.gov (United States)

    Lee, Haur Yueh; Fook-Chong, Stephanie; Koh, Hong Yi; Thirumoorthy, Tharmotharampillai; Pang, Shiu Ming

    2017-01-01

    Treatment of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) remains controversial. We sought to evaluate the impact of cyclosporine on hospital mortality in patients with SJS/TEN. All patients with SJS and TEN admitted to our center from 2011 to 2014 were treated under a standardized protocol that allowed for cyclosporine therapy if the inclusion and exclusion criteria were met. Clinical data were reviewed retrospectively. Comparative analysis was made on mortality outcomes with patients treated with cyclosporine versus what was expected based on SCORTEN. In all, 44 patients were admitted during the study period. A total of 24 patients received cyclosporine and the remaining 20 patients were treated supportively. SCORTEN predicted 7.2 deaths and 3 were observed in the group treated with cyclosporine. In the group treated supportively, SCORTEN predicted 5.9 deaths and 6 deaths were observed. The standardized mortality ratio of SJS/TEN treated with cyclosporine was 0.42 (95% confidence interval 0.09-1.22). Small sample size, retrospective design, and referral bias are limitations. The use of cyclosporine may improve mortality in SJS/TEN and needs to be validated in controlled studies. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  15. Investigation of Monnose-Binding Lectin gene Polymorphism in Patients with Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome

    Directory of Open Access Journals (Sweden)

    Sevil Toka

    2012-09-01

    Full Text Available Objective: Monnose-Binding lectin (MBL appears to play an important role in the immune system. The genetic polymorphisms in the MBL2 gene can result in a reduction of serum levels, leading to a predisposition to recurrent infection. The aim of this study is to investigate the influence of a polymorphism in codon 54 of the MBL2 gene on the susceptibility to Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome (EM, SJS and SJS/TEN overlap syndrome. Material and Methods: Our study included 64 patients who were clinically and/or histopathologically diagnosed with EM, SJS, and SJS/TEN overlap syndrome and 66 healthy control subjects who were genotyped for the MBL2 gene codon 54 polymorphism using the PCR-RFLP method. For all statistical analyses, the level of significance was set at p<0.05. Results: The prevalence of the B allele was 18% in the EM, SJS and SJS/TEN patient groups and 13% in the control group. No significant differences in allele frequencies of any polymorphism were observed between the patient and control groups, although the B allele was more frequent in the patient groups (p=0.328.Conclusion: Our results provide no evidence of a relationship between MBL2 gene codon 54 polymorphism and the susceptibility to EM, SJS and SJS/TEN overlap syndrome. However, these findings should be confirmed in studies with a larger sample size.

  16. A six-month prospective study to find out the treatment outcome, prognosis and offending drugs in toxic epidermal necrolysis from an urban institution in Kolkata

    Directory of Open Access Journals (Sweden)

    Sudip Das

    2013-01-01

    Full Text Available Toxic epidermal necrolysis is the life-threatening dermatological emergency, most often an adverse cutaneous drug reaction with high mortality. A 6-month prospective study was conducted in our institution to find out the offending drugs, to assess the prognosis on admission using SCORTEN: Severity of illness score and to find out the treatment outcome. Anticonvulsants, NSAIDs and sulphonamides are the common offending agents; but in our study, 2 were due to homeopathic medicines. Out of 20 patients, on the date of admission SCORTEN prognostic score was 2 in 11 patients, 3 in 8 patients and 4 in 1 patient. Eighteen patients were treated with dexamethasone intramuscular injection and 2 patients got intravenous immunoglobulin (IVIG. All patients survived without any mortality. Though improvement was slightly faster with IVIG, early administration of corticosteroids was also of encouraging efficacy and should be considered in developing countries due to low cost. No mortality in our study suggests need to validate the SCORTEN index in our country in a large number of patients.

  17. Racial disparities in the risk of Stevens-Johnson Syndrome and toxic epidermal necrolysis as urate-lowering drug adverse events in the United States.

    Science.gov (United States)

    Lu, Na; Rai, Sharan K; Terkeltaub, Robert; Kim, Seoyoung C; Menendez, Mariano E; Choi, Hyon K

    2016-10-01

    HLA-B*5801 allele carriage (a strong determinant of allopurinol hypersensitivity syndrome) varies substantially among races, which may lead to racial disparities in the risk of Stevens-Johnson Syndrome (SJS) and toxic epidermal necrolysis (TEN) in the context of urate-lowering drug adverse events (ULDAEs). We examined this hypothesis in a large, racially diverse, and generalizable setting. Using a database representative of US hospitalizations (2009-2013), we investigated the racial distribution of hospitalized SJS/TEN (principal discharge diagnosis) as ULDAEs (ICD-9-CM Classification of External Causes). Our reference groups included the US Census population, US allopurinol users, and ULDAE hospitalizations without SJS/TEN. We identified 606 cases hospitalized for SJS/TEN as ULDAEs (mean age = 68 years; 44% male), among which there was an overrepresentation of Asians (27%) and Blacks (26%), and an underrepresentation of Whites (29%) and Hispanics (% too-low-to-report), compared with the US Census population (5%, 12%, 67%, and 15%, respectively). The hospitalization rate ratios for SJS/TEN among Asians, Blacks, and Whites were 11.9, 5.0, and 1.0 (referent), respectively. These associations persisted using other national referents. According to the NHANES 2009-2012, allopurinol constituted 96.8% of urate-lowering drug use, followed by probenecid (2.1%). These national data indicate that Asians and Blacks have a substantially higher risk of SJS/TEN as ULDAEs than Whites (or Hispanics), correlating well with corresponding frequencies of HLA-B*5801 in the US population (i.e., 7.4%, 4%, 1%, and 1%, respectively). Given its market dominance and established association with SJS/TEN, our findings support the use of vigilance in these minorities when considering allopurinol. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. The Effect of Intravenous Immunoglobulin Combined with Corticosteroid on the Progression of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A Meta-Analysis

    Science.gov (United States)

    Ye, Liang-ping; Zhang, Cheng; Zhu, Qi-xing

    2016-01-01

    Background Intravenous immunoglobulin (IVIG) treatment is commonly used to treat Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) with controversial therapeutic effect. Methods We conducted a comprehensive meta-analysis through combining the published eligible studies to evaluate the effectiveness of IVIG on SJS and TEN treatment. Results A total of 26 studies were selected from public available databases. The combination of IVIG and corticosteroid markedly reduced the recovery time (by 1.63 days, 95% CI: 0.83–2.43, P < 0.001), compared with solo corticosteroid group. The favorable effects were greater in Asian (2.19, 95% CI: 1.41–2.97, P < 0.001), TEN (2.56, 95% CI: 0.35–4.77, P = 0.023) and high-dose IVIG treated individuals (1.78, 95% CI: 0.42–3.14, P = 0.010). The hospitalization length reduced by 3.19 days (95% CI: 0.08–6.30, P = 0.045), though the outcome was proven to be unstable. We found heterogeneities, which sources were probably regional factors. Besides, IVIG was inclined to decrease SJS/TEN mortality (SMR: 0.84, 95% CI: 0.66–1.08, P = 0.178). This impact was possibly more profound when patients were treated with high dose IVIG (SMR: 0.74, 95% CI: 0.50–1.08, P = 0.116), or when patients were diagnosed as TEN (SMR: 0.68, 95% CI: 0.45–1.01, P = 0.058). Conclusions Our current meta-analysis suggests that IVIG combined with corticosteroid could reduce recovery time for SJS and TEN. This effect is greater among Asian patients. Whereas, its impact on reducing mortality is not significant. PMID:27902746

  19. IKZF1, a new susceptibility gene for cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis with severe mucosal involvement.

    Science.gov (United States)

    Ueta, Mayumi; Sawai, Hiromi; Sotozono, Chie; Hitomi, Yuki; Kaniwa, Nahoko; Kim, Mee Kum; Seo, Kyoung Yul; Yoon, Kyung-Chul; Joo, Choun-Ki; Kannabiran, Chitra; Wakamatsu, Tais Hitomi; Sangwan, Virender; Rathi, Varsha; Basu, Sayan; Ozeki, Takeshi; Mushiroda, Taisei; Sugiyama, Emiko; Maekawa, Keiko; Nakamura, Ryosuke; Aihara, Michiko; Matsunaga, Kayoko; Sekine, Akihiro; Gomes, José Álvaro Pereira; Hamuro, Junji; Saito, Yoshiro; Kubo, Michiaki; Kinoshita, Shigeru; Tokunaga, Katsushi

    2015-06-01

    Stevens-Johnson syndrome (SJS) and its severe form, toxic epidermal necrolysis (TEN), are acute inflammatory vesiculobullous reactions of the skin and mucous membranes, including the ocular surface, oral cavity, and genitals. These reactions are very rare but are often associated with inciting drugs, infectious agents, or both. We sought to identify susceptibility loci for cold medicine-related SJS/TEN (CM-SJS/TEN) with severe mucosal involvement (SMI). A genome-wide association study was performed in 808 Japanese subjects (117 patients with CM-SJS/TEN with SMI and 691 healthy control subjects), and subsequent replication studies were performed in 204 other Japanese subjects (16 cases and 188 control subjects), 117 Korean subjects (27 cases and 90 control subjects), 76 Indian subjects (20 cases and 56 control subjects), and 174 Brazilian subjects (39 cases and 135 control subjects). In addition to the most significant susceptibility region, HLA-A, we identified IKZF1, which encodes Ikaros, as a novel susceptibility gene (meta-analysis, rs4917014 [G vs. T]; odds ratio, 0.5; P = 8.5 × 10(-11)). Furthermore, quantitative ratios of the IKZF1 alternative splicing isoforms Ik1 and Ik2 were significantly associated with rs4917014 genotypes. We identified IKZF1 as a susceptibility gene for CM-SJS/TEN with SMI not only in Japanese subjects but also in Korean and Indian subjects and showed that the Ik2/Ik1 ratio might be influenced by IKZF1 single nucleotide polymorphisms, which were significantly associated with susceptibility to CM-SJS/TEN with SMI. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  20. The Effect of Intravenous Immunoglobulin Combined with Corticosteroid on the Progression of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Liang-Ping Ye

    Full Text Available Intravenous immunoglobulin (IVIG treatment is commonly used to treat Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN with controversial therapeutic effect.We conducted a comprehensive meta-analysis through combining the published eligible studies to evaluate the effectiveness of IVIG on SJS and TEN treatment.A total of 26 studies were selected from public available databases. The combination of IVIG and corticosteroid markedly reduced the recovery time (by 1.63 days, 95% CI: 0.83-2.43, P < 0.001, compared with solo corticosteroid group. The favorable effects were greater in Asian (2.19, 95% CI: 1.41-2.97, P < 0.001, TEN (2.56, 95% CI: 0.35-4.77, P = 0.023 and high-dose IVIG treated individuals (1.78, 95% CI: 0.42-3.14, P = 0.010. The hospitalization length reduced by 3.19 days (95% CI: 0.08-6.30, P = 0.045, though the outcome was proven to be unstable. We found heterogeneities, which sources were probably regional factors. Besides, IVIG was inclined to decrease SJS/TEN mortality (SMR: 0.84, 95% CI: 0.66-1.08, P = 0.178. This impact was possibly more profound when patients were treated with high dose IVIG (SMR: 0.74, 95% CI: 0.50-1.08, P = 0.116, or when patients were diagnosed as TEN (SMR: 0.68, 95% CI: 0.45-1.01, P = 0.058.Our current meta-analysis suggests that IVIG combined with corticosteroid could reduce recovery time for SJS and TEN. This effect is greater among Asian patients. Whereas, its impact on reducing mortality is not significant.

  1. Incidence of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A Nationwide Population-Based Study Using National Health Insurance Database in Korea.

    Science.gov (United States)

    Yang, Min-Suk; Lee, Jin Yong; Kim, Jayeun; Kim, Gun-Woo; Kim, Byung-Keun; Kim, Ju-Young; Park, Heung-Woo; Cho, Sang-Heon; Min, Kyung-Up; Kang, Hye-Ryun

    2016-01-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are life-threatening diseases; however, it is hard to estimate their incidence due to the rarity of these diseases. We evaluated the incidence of SJS and TEN using a nationwide administrative database. We used a national medical insurance review system (Health Insurance Review and Assessment) database which contained the claim data of the entire nation from 2009 to 2013 to estimate the accurate incidence of SJS and TEN in Korea. The diagnostic codes of L511 (SJS) or L512 (TEN) from the International Classification of Diseases-10th revision were used to define the target study population. We also retrospectively followed up a 2011 SJS and TEN cohort for 24 months in order to assess the in-hospital mortality, related complications and total claims cost due to SJS and TEN. A total of 1,167 (938 SJS and 229 TEN) cases were newly diagnosed from 2010 to 2013. The age- and sex-standardized annual incidences estimated in this study were 3.96 to 5.03 in SJS and 0.94 to 1.45 in TEN per million. There was no significant change in annual incidence throughout the study periods. When analyzed by 10-year age groups, the annual incidence was the lowest in group 20-29 years and the highest in group 70 for both SJS and TEN. Based on the 2011 cohort analysis, the in-hospital mortality were 5.7 and 15.1% for SJS and TEN, respectively. The mortality increased with age, particularly, after 40 years of age. Among the complications related with SJS or TEN, ocular sequelae was the most common (43.1 and 43.4% of SJS and TEN patients, respectively) followed by urethral sequelae (5.7 and 9.4% of SJS and TEN patients, respectively). Overall, our data suggest that SJS, and TEN are infrequent but constantly arise throughout the years.

  2. Retrospective Analysis of Corticosteroid Treatment in Stevens-Johnson Syndrome and/or Toxic Epidermal Necrolysis over a Period of 10 Years in Vajira Hospital, Navamindradhiraj University, Bangkok

    Science.gov (United States)

    Prompongsa, Sirikarn

    2014-01-01

    Background. Stevens-Johnson syndrome (SJS) and/or toxic epidermal necrolysis (TEN) are uncommon and life-threatening drug reaction associated with a high morbidity and mortality. Objective. We studied SJS and/or TEN by conducting a retrospective analysis of 87 patients treated during a 10-year period. Methods. We conducted a retrospective review of the records of all patients with a diagnosis of SJS and/or TEN based on clinical features and histological confirmation of SJS and/or TEN was not available at the Department of Medicine, Vajira hospital, Bangkok, Thailand. The data were collected from two groups from 2003 to 2007 and 2008 to 2012. Results. A total of 87 cases of SJS and/or TEN were found, comprising 44 males and 43 females whose mean age was 46.5 years. The average length of stay was 17 days. Antibiotics, anticonvulsants, and allopurinol were the major culprit drugs in both groups. The mean SCORTEN on admission was 2.1 in first the group while 1.7 in second the group. From 2008 to 2012, thirty-nine patients (76.5%) were treated with corticosteroids while only eight patients (22.2%) were treated between 2003 and 2007. The mortality rate declined from 25% from the first group to 13.7% in the second group. Complications between first and second groups had no significant differences. Conclusions. Short-term corticosteroids may contribute to a reduced mortality rate in SJS and/or TEN without increasing secondary infection. Further well-designed studies are required to compare the effect of corticosteroids treatment for SJS and/or TEN. PMID:25024697

  3. Variable levels of apoptotic signal-associated cytokines in the disease course of patients with Stevens-Johnson syndrome and toxic epidermal necrolysis.

    Science.gov (United States)

    Yang, Yongsheng; Li, Feng; Du, Juan; Shen, Yanyun; Lin, Jinran; Zhu, Xiaohua; Luo, Xiaoqun; Liang, Jun; Xu, Jinhua

    2017-08-01

    Keratinocyte death is a hallmark of Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN). Apoptotic signal-associated cytokines, such as TNF-α, sFasL, granulysin, sTRAIL and IFN-γ have been reported to participate in keratinocyte apoptosis. However, their levels are variable, which hampers the elucidation of the role of these cytokines. We sought to determine whether cytokine levels vary with disease course. The serum cytokine levels of 24 patients and blister fluid of 10 were analysed by enzyme-linked immunosorbent assay on the first day of their admission to hospital and were evaluated at different time points in the disease course. Meanwhile, surface markers (CD3, CD4, CD8, CD1a, CD14, CD16+56 and CD68) of blister fluid cells were measured by flow cytometry. The concentrations of all cytokines in the serum and blister fluid were higher than those in the controls and were more elevated in the blister fluid than in the serum. Moreover, sTRAIL, IFN-γ and TNF-α quantities were relatively stable, while those of sFasL and granulysin decreased rapidly in the disease course. On the first day, CD8+ T and natural killer cells were predominant in the blister fluid but their relative percentage diminished gradually, while that of CD14+ cells increased. Our study confirmed there are high but variable levels of these cytokines in SJS/TEN, especially in the early phase and different tendencies are manifested in the disease course. © 2016 The Australasian College of Dermatologists.

  4. A cross-sectional comparative study on chronic ocular manifestations of Stevens-Johnson syndrome and toxic epidermal necrolysis in Chinese eyes: a 15-year case series.

    Science.gov (United States)

    Chow, Loraine L W; Ng, Alex L K; Chow, Sharon S W; Choy, Bonnie N K; Shih, Kendrick C; Wong, Ian Y H; Chan, Johnny C Y; Lai, Jimmy S M

    2017-05-25

    To compare the chronic ocular manifestations in Stevens-Johnson syndrome and toxic epidermal necrolysis patients from a 15-year cohort. All SJS and TEN patients admitted to our burn intensive care unit between 1999 and 2014 were invited for assessment. Slit-lamp examination was performed, and ocular condition was graded according to the Sotozono scoring System, which depended on the extent of cornea, conjunctiva and lid involvement. Tear osmolarity was also measured. A total of 18 SJS and 4 TEN cases with an average of 92 and 135 months from disease onset were included. The average age of onset was 46.4 ± 16.6 in SJS and 43.5 ± 19.3 in TEN patients. The LogMAR visual acuity was 0.209 ± 0.591 in SJS and 0.489 ± 0.688 in TEN patients (p = 0.048). The average total Sotozono score was 3.75 ± 7.32 in SJS and 6.88 ± 9.49 in TEN (p = 0.358). Neither the age of onset (p = 0.787), length of follow-up (p = 0.256) nor disease type (SJS vs TEN, p = 0.188) predicted the Sotozono score. There was a statistically significant correlation between Sotozono score and LogMAR VA (r s  = 0.437, p = 0.003). The average total Sotozono score was higher in the TEN group than in the SJS group, but the difference was not statistically significant. Nevertheless, the score correlated with the visual acuity which was statistically worse in the TEN group.

  5. A decade of burn unit experience with Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis: Clinical pathological diagnosis and risk factor awareness.

    Science.gov (United States)

    Lim, Victoria M; Do, Annie; Berger, Timothy G; Nguyen, Austin H; DeWeese, Jeffrey; Malone, J David; Jordan, Kathleen; Hom, Fred; Tuffanelli, Lucia; Fillari, Paula; Siu, Shirley; Grossman, Richard

    2016-06-01

    Stevens-Johnson Syndrome (SJS)/Toxic Epidermal Necrolysis (TEN) is a rare and often fatal spectrum of mucocutaneous diseases usually attributable to severe adverse drug reactions. Burn units are referral centers for patients at the most extreme end of the disease continuum. Our burn center admits a much higher percentage of TEN (>30% BSA) cases than reported in most prior reviews. The purpose of this study was to analyze the diagnostic and prognostic value of variables collected on referred SJS/TEN patients. We retrospectively analyzed 94 patients admitted to our unit with a presumptive SJS/TEN diagnosis made in most cases by the referring center. Most of the diagnoses were clinical. Fifty of the 94 patients underwent biopsy when the clinical diagnosis was questionable. Of the 50 patients who underwent biopsy, 18 (36%) received an alternative diagnosis. Analysis was therefore limited to 76 patients, i.e. 44 patients felt to have firm clinical diagnoses plus 32 patients with diagnoses confirmed by biopsy. Mean age was 54.3 years (17-93) and overall gender ratio was 43 F vs. 33 M (56.6% vs. 43.4%). Mean LOS was 15.2 days (1-48) and overall mortality was 23.7% (18/76). Univariate analysis revealed percent body surface area (%BSA) did not show statistically significant association with mortality. Histopathological correlation for diagnosis is not standardized across institutions worldwide. Due to challenges in the diagnosis of SJS/TEN and the high incidence of error in clinical diagnosis, it is recommended that all patients with presumed SJS/TEN receive skin biopsies with H&E and direct immunofluorescence. We propose a diagnostic approach in order to address this need. Lack of association between %BSA and mortality suggests that all biopsy-proven SJS/TEN cases belong in specialty centers due to the unstable nature of the disease and risk for rapid progression. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  6. A multicenter review of toxic epidermal necrolysis treated in U.S. burn centers at the end of the twentieth century.

    Science.gov (United States)

    Palmieri, T L; Greenhalgh, D G; Saffle, J R; Spence, R J; Peck, M D; Jeng, J C; Mozingo, D W; Yowler, C J; Sheridan, R L; Ahrenholz, D H; Caruso, D M; Foster, K N; Kagan, R J; Voigt, D W; Purdue, G F; Hunt, J L; Wolf, S; Molitor, F

    2002-01-01

    Toxic epidermal necrolysis (TEN) is a potentially fatal disorder that involves large areas of skin desquamation. Patients with TEN are often referred to burn centers for expert wound management and comprehensive care. The purpose of this study was to define the presenting characteristics and treatment of TEN before and after admission to regional burn centers and to evaluate the efficacy of burn center treatment for this disorder. A retrospective multicenter chart review was completed for patients admitted with TEN to 15 burn centers from 1995 to 2000. Charts were reviewed for patient characteristics, non-burn hospital and burn center treatment, and outcome. A total of 199 patients were admitted. Patients had a mean age of 47 years, mean 67.7% total body surface area skin slough, and mean Acute Physiology and Chronic Health Evaluation (APACHE II) score of 10. Sixty-four patients died, for a mortality rate of 32%. Mortality increased to 51% for patients transferred to a burn center more than one week after onset of disease. Burn centers and non-burn hospitals differed in their use of enteral nutrition (70 vs 12%, respectively, P < 0.05), prophylactic antibiotics (22 vs 37.9%, P < 0.05), corticosteroid use (22 vs 51%, P < 0.05), and wound management. Age, body surface area involvement, APACHE II score, complications, and parenteral nutrition before transfer correlated with increased mortality. The treatment of TEN differs markedly between burn centers and non-burn centers. Early transport to a burn unit is warranted to improve patient outcome.

  7. [Factors associated with the severity of acute ocular involvement in Stevens-Johnson syndrome and toxic epidermal necrolysis in sub-Saharan Africa].

    Science.gov (United States)

    Saka, B; Dzidzinyo, K; Akakpo, S; Téclessou, J; Nouhou Diori, A; Maneh, N; Mahamadou, G; Gnassingbé, W; Abilogun-Chokki, A; Mouhari-Toure, A; Boubacar, Y Ali; Kombaté, K; Balo, K; Tchangai-Walla, K; Pitché, P

    2018-02-24

    The purpose of this study was to identify risk factors associated with the severity of acute ocular involvement in Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) in sub-Saharan Africa. A retrospective study was carried out at the dermatology department in collaboration with the ophthalmology department for SJS/TEN patients between January 2000 and December 2016 in Lomé (Togo). The severity of acute ocular involvement was evaluated using the Power classification, and the drug eruption score was assessed using de Bastuji-Garin classification. A total of 107 cases of SJS/TEN (84 cases of SJS, 20 cases of TEN and 3 cases of overlap syndrome) were analyzed. There were 71 women and 36 men, with an average age of 32.3±12.5 years (range: 5 to 75 years). Sulfonamides (37.4%) were the most commonly used drugs followed by nevirapine (22.4%). HIV serology was positive in 46 (58.2%) of the 79 patients tested. A total of 54 (50.5%) patients had acute ocular involvement, which was mild in 29.9% of patients, moderate in 13.1% and severe in 7.5%. In multivariate analysis, exposure to sulfadoxine was the sole factor associated with moderate or severe acute ocular involvement in SJS/TEN (adjusted odds ratio=3.3; 95% CI=[1.1; 10.2]). Exposure to sulfadoxine was identified in our study as a risk factor associated with the severity of acute ocular involvement in SJS/TEN. Multicenter studies should be conducted in sub-Saharan Africa to confirm this associated risk factor. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  8. HLA-A*31: 01 and HLA-B*15:02 association with Stevens-Johnson syndrome and toxic epidermal necrolysis to carbamazepine in a multiethnic Malaysian population.

    Science.gov (United States)

    Khor, Amy Hui-Ping; Lim, Kheng-Seang; Tan, Chong-Tin; Kwan, Zhenli; Tan, Wooi-Chiang; Wu, David Bin-Chia; Ng, Ching-Ching

    2017-07-01

    The majority of the carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis CBZ-SJS/TEN are associated with HLA-B*15:02 in Asian populations where this allele is common. In contrast, the association with HLA-A*31:01 is only reported in Japanese and Europeans. This study aimed to further investigate the association with HLA-A*31:01 besides HLA-B*15:02 in a multiethnic Malaysian population. Twenty-eight CBZ-SJS/TEN cases and 227 CBZ-tolerant controls were recruited. Association was tested by comparing carrier frequencies of the alleles between cases and controls. Significant associations were detected between HLA-B*15:02 and CBZ-SJS/TEN in independent ethnic groups: Malays [P=2.00×10; odds ratio (OR): 49.0; 95% confidence interval (CI): 9.36-256.81], Chinese (P=0.0047; OR: 14.3; 95% CI: 2.38-86.03) and Indians (P=0.04; OR: 13.8; 95% CI: 1.51-124.99). Combined analysis of all ethnic groups showed a significant association with OR Cochran-Mantel-Haenszel (ORCMH) of 26.6 (95% CI: 12.80-55.25; PCMH=2.31×10). In Indians, HLA-A*31:01 was found to be associated significantly with CBZ-SJS/TEN (P=0.023; OR: 10.4; 95% CI: 1.64-65.79) and combined analyses of both variants, HLA-A*31:01 and HLA-B*15:02, increased the strength of the association (P=0.0068; OR: 14.3; 95% CI: 2.20-92.9). Besides HLA-B*15:02, our study found a new association between HLA-A*31:01 and CBZ-SJS/TEN in Indians.

  9. STEVENS-JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART I. DETERMINATION, ETIOLOGY, PATHOGENESIS, CLINICAL MANIFESTATIONS, SYSTEMIC TREATMENT

    Directory of Open Access Journals (Sweden)

    V.F. Zhernosek

    2011-01-01

    Full Text Available Part I of the literature review provides modern terminology and classification of Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN, which is now considered different ways of treating the single pathological process induced in children by infections, drugs, malignant and autoimmune diseases. It illustrates in detail the latest data on pathogenesis, describes clinical manifestations of both scenarios and their transition forms. Special emphasis is made on the organisation of care for patients with SJS and TEN. It details various aspects of systemic therapy.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, systemic treatment, children.

  10. Necrolisis epidérmica tóxica inducida por fármacos: Caso clínico Toxical epidermal necrolysis related to the use of drugs: Case report

    Directory of Open Access Journals (Sweden)

    L. Melloni Magnelli

    2008-12-01

    Full Text Available El Síndrome de Stevens Johnson (SSJ ha sido definido como un eritema multiforme vesiculobulloso de la piel y de otros órganos y se considera que es la etapa inicial de una reacción dérmica cuya forma más severa de presentación es la Necrolisis Epidérmica Tóxica (NET. Se manifiesta como una reacción sistémica inflamatoria aguda que involucra más del 30 % de la superficie corporal. Etiológicamente está relacionada con el uso de fármacos e un 60 % de los casos, sin embargo el herpes simple, infecciones por micoplasma y algunos factores genéticos, están considerados también como posibles desencadenantes. El SSJ presenta un pródromos catarral de entre 1 a 14 días de duración; el hallazgo clínico más importante son las lesiones máculo-papilares que se extienden centrípetamente y evolucionan a vesículas confluentes, afectando por lo general a la mucosa oral, conjuntival y al área genital. El SSJ evoluciona ocasionalmente a NET, que se caracteriza por dolor intenso y pérdida de la superficie epitelial, comprometiendo las funciones vitales del organismo, ocasionando un desequilibrio hidroelectrolítico, un compromiso renal y ocular, un gran catabolismo y un riesgo potencial de sepsis. Presentamos el caso de un menor de 3 años de edad, con antecedentes de cuadro viral; la hipertermia le ocasionó crisis convulsivas que fueron tratadas con Difenilhidantonína. Durante su hospitalización desarrolló un cuadro de SSJ/NET al cual sobrevivió. Enfatizamos la etiología multifactorial del síndrome en la que se combinaron sinergicamente medicamentos e infección como factores predisponentes del proceso.Stevens Johnson Syndrome (SJS has been defined as a vesiculobullous multiform erythema of the skin and other organs. It´s considered as initial stage of a dermal reaction in which the most severe form of presentation is Toxic Epidermal Necrolysis (TEN. This is an acute systemic inflammatory disease that involves more than 30% of

  11. Methotrexate-induced necrolysis in tumoral-stage mycosis fungoides: a challenging diagnosis.

    Science.gov (United States)

    Mna, Amira Ben; Souissi, Asmahene; Halouani, Slim; El Euch, Dalenda; Zahani, Alia; Kchir, Nidham; Zaraa, Ines; Mokni, Mourad

    2016-01-15

    Methotrexate-induced cutaneous ulceration is a rare but potentially serious drug adverse reaction. This adverse reaction of methotrexate therapy has been initially described in psoriasis patients and is unusual in patients with cutaneous T-cell lymphoma. In 1978, Mc Donald et al reported the first three cases of cutaneous ulcerations in patients treated for a mycosis fungoides with intravenous infusions of methotrexate. Since then, few cases of methotrexate-induced skin ulcers in patients with mycosis fungoides have been published. We report an additional patient with erythrodermic mycosis fungoides who developed cutaneous ulcerations as a sole manifestation of methotrexate toxicity.

  12. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  13. HLA-A*3101 and carbamazepine-induced hypersensitivity reactions in Europeans.

    LENUS (Irish Health Repository)

    McCormack, Mark

    2011-03-24

    Carbamazepine causes various forms of hypersensitivity reactions, ranging from maculopapular exanthema to severe blistering reactions. The HLA-B*1502 allele has been shown to be strongly correlated with carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS-TEN) in the Han Chinese and other Asian populations but not in European populations.

  14. Fetal effects of epidermal growth factor deficiency induced in rats by autoantibodies against epidermal growth factor

    DEFF Research Database (Denmark)

    Raaberg, Lasse; Nexø, Ebba; Jørgensen, P E

    1995-01-01

    We have used rats with epidermal growth factor (EGF) autoantibodies to study the role of EGF deficiency during perinatal development. The study was focused on organs known to contain EGF or its receptor. Compared with controls, the offspring of autoimmune rats had a higher perinatal mortality and...

  15. Stevens Johnsons syndrom og toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

    2013-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

  16. UV-induced unscheduled DNA synthesis in cultured human epidermal and dermal cells

    International Nuclear Information System (INIS)

    Hosomi, Jiro; Kuroki, Toshio

    1985-01-01

    DNA repair in human epidermal cells, a target of skin carcinogenesis, was examined by measuring unscheduled DNA synthesis on autoradiographs. Epidermal cells were obtained from normal subjects and all experiments were performed on primary cultures. UV-irradiation induced unscheduled DNA synthesis in human epidermal cells dose-dependently at doses of 5 to 20 J/m 2 . The range of induction varied 3-fold in 9 cultures derived from different donors. No correlation was found between the extent of unscheduled DNA synthesis and the age or sex of the donors. For comparison, human dermal fibroblasts and mouse epidermal and dermal cells were examined under the same conditions. In human dermal cells, the number of grains was about 3.3 times that in epidermal cells. Mouse epidermal cells isolated from newborn C3H/He and Sencar mice showed almost the same extent of unscheduled DNA synthesis as human cells, but the response of dermal fibroblasts of mice was about 2 to 3 times less than that of human fibroblasts. The relevance of these differences among individuals, cell types and species is discussed. (author)

  17. Chronic administration of epidermal growth factor to pigs induces growth, especially of the urinary tract with accumulation of epithelial glycoconjugates

    DEFF Research Database (Denmark)

    Vinter-Jensen, Lars; Juhl, C O; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) receptor hyperstimulation induced by systemically administered EGF or by the development of transgenic mice overexpressing transforming growth factor alpha (TGF alpha) or other EGF-related ligands is known to induce various effects, such as acceleration...

  18. microRNA-184 Induces a Commitment Switch to Epidermal Differentiation.

    Science.gov (United States)

    Nagosa, Sara; Leesch, Friederike; Putin, Daria; Bhattacharya, Swarnabh; Altshuler, Anna; Serror, Laura; Amitai-Lange, Aya; Nasser, Waseem; Aberdam, Edith; Rouleau, Matthieu; Tattikota, Sudhir G; Poy, Matthew N; Aberdam, Daniel; Shalom-Feuerstein, Ruby

    2017-12-12

    miR-184 is a highly evolutionary conserved microRNA (miRNA) from fly to human. The importance of miR-184 was underscored by the discovery that point mutations in miR-184 gene led to corneal/lens blinding disease. However, miR-184-related function in vivo remained unclear. Here, we report that the miR-184 knockout mouse model displayed increased p63 expression in line with epidermal hyperplasia, while forced expression of miR-184 by stem/progenitor cells enhanced the Notch pathway and induced epidermal hypoplasia. In line, miR-184 reduced clonogenicity and accelerated differentiation of human epidermal cells. We showed that by directly repressing cytokeratin 15 (K15) and FIH1, miR-184 induces Notch activation and epidermal differentiation. The disease-causing miR-184 C57U mutant failed to repress K15 and FIH1 and to induce Notch activation, suggesting a loss-of-function mechanism. Altogether, we propose that, by targeting K15 and FIH1, miR-184 regulates the transition from proliferation to early differentiation, while mis-expression or mutation in miR-184 results in impaired homeostasis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour

    International Nuclear Information System (INIS)

    Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.

    1996-01-01

    Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)

  20. Fluconazole induced herpes labialis-like lesions in an adult male

    Directory of Open Access Journals (Sweden)

    Harish C. Goel

    2009-12-01

    Full Text Available Fluconazole is a bistriazole commonly prescribed for thetreatment of various fungal infections caused by yeasts and dermatophytes. However, there have been several reports of rare Adverse Drug Reactions (ADRs like Fixed Dose Eruption (FDE, Toxic Epidermal Necrolysis and Stevens Johnson Syndrome following oral administration of fluconazole. We report a rare case of fluconazole induced oral mucosal lesions, mimicking herpes labialis, in a 34 year old male patient receiving oral fluconazole for the treatment of allergic fungal sinusitis.

  1. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.

    Science.gov (United States)

    Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F

    2005-09-15

    Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.

  2. Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

    International Nuclear Information System (INIS)

    Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

    2011-01-01

    Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

  3. Radioautographic measurement of electron-induced epidermal kinetic effects in different aged rats

    International Nuclear Information System (INIS)

    Sargent, E.V.; Burns, F.J.

    1987-01-01

    We have previously shown that the ability of rat epidermal cells to repair electron-induced DNA damage decreases as a function of age. The present investigation was performed to examine the relationship between this finding and sensitivity of epidermal cells to the cytotoxic effects of the radiation. Male CD rats at ages 2, 28, 100, 200, 420, and 728 days were injected with [ 3 H]-thymidine [( 3 H]Thd) at a dose of 2 mu Ci/g body weight. One hour later, the rats were anesthetized and the dorsal skin irradiated with various doses of 0.8 meV electrons at a dose rate of 660 rads/min. At 24 h after irradiation, radioautographs were made of a sheet of epidermis that was separated by trypsinization from the underlying dermis. Labeled cells were scored either as singlets or doublets (adjacent labeled cells). The percent labeled cells and percent labeled cells as doublets were determined. The estimated labeling index (the proportion of cells labeled by a single exposure to [ 3 H]Thd) of the epidermal basal layer decreased as a function of age. The slope of the semilog plot of the percent labeled cells as doublets as a function of electron dose indicates that the Do value decreases with increasing age. The results show, however, that the greatest difference in sensitivity occurs between 2-day (neonatal) and 28-day (pubescent) animals and again between 420-day (adult) and 728-day (senescent) animals

  4. Epidermal growth factor receptor is a preferred target for treating amyloid-β-induced memory loss.

    Science.gov (United States)

    Wang, Lei; Chiang, Hsueh-Cheng; Wu, Wenjuan; Liang, Bin; Xie, Zuolei; Yao, Xinsheng; Ma, Weiwei; Du, Shuwen; Zhong, Yi

    2012-10-09

    Current understanding of amyloid-β (Aβ) metabolism and toxicity provides an extensive list of potential targets for developing drugs for treating Alzheimer's disease. We took two independent approaches, including synaptic-plasticity-based analysis and behavioral screening of synthetic compounds, for identifying single compounds that are capable of rescuing the Aβ-induced memory loss in both transgenic fruit fly and transgenic mouse models. Two clinically available drugs and three synthetic compounds not only showed positive effects in behavioral tests but also antagonized the Aβ oligomers-induced activation of the epidermal growth factor receptor (EGFR). Such surprising converging outcomes from two parallel approaches lead us to conclude that EGFR is a preferred target for treating Aβ-induced memory loss.

  5. Msx2 supports epidermal competency during wound induced hair follicle neogenesis.

    Science.gov (United States)

    Hughes, Michael W; Jiang, Ting-Xin; Plikus, Maksim V; Guerrero-Juarez, Christian Fernando; Lin, Chein-Hong; Schafer, Christopher; Maxson, Robert; Widelitz, Randall B; Chuong, Cheng-Ming

    2018-03-22

    Cutaneous wounds in adult mammals typically heal by scarring. However, large full-thickness wounds undergo wound-induced hair follicle neogenesis (WIHN), a novel form of regeneration. Here, we demonstrate WIHN requires transient expression of epidermal Msx2 in two phases; the wound margin early and the wound center late. Msx2 expression is present in the migrating epithelium during early wound healing, and then presents in the epithelium and mesenchyme later in the wound center. WIHN is abrogated in germline and epithelial-specific Msx2 mutant mice. Unlike the full-length Msx2 promoter, a minimal Msx2 promoter fails activation in the wound center, suggesting complex regulation of Msx2 expression. The Msx2 promoter binding sites include Tcf/Lef, Jun/Creb, Pax3 and three SMAD sites. However, basal epithelial-induced BMP suppression by Noggin over-expression did not affect WIHN. We propose Msx2 signaling is required for the epidermis to acquire spatiotemporal competence during WIHN. Topologically, hair regeneration dominates in the wound center coinciding with late Msx2 expression. Together, these results suggest intrinsic Msx2 expression supports epithelial competency during hair follicle neogenesis. This work provides insight into endogenous mechanisms modulating competency of adult epidermal progenitors for mammalian ectodermal appendage neogenesis, and offers the novel target Msx2 for future regeneration-promoting therapies. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Overexpression of cyclin D1 induces the reprogramming of differentiated epidermal cells into stem cell-like cells.

    Science.gov (United States)

    Zhao, Along; Yang, Leilei; Ma, Kui; Sun, Mengli; Li, Lei; Huang, Jin; Li, Yang; Zhang, Cuiping; Li, Haihong; Fu, Xiaobing

    2016-01-01

    It has been reported that Wnt/β-catenin is critical for dedifferentiation of differentiated epidermal cells. Cyclin D1 (CCND1) is a β-catenin target gene. In this study, we provide evidence that overexpression of CCND1 induces reprogramming of epidermal cells into stem cell-like cells. After introducing CCND1 gene into differentiated epidermal cells, we found that the large flat-shaped cells with a small nuclear-cytoplasmic ratio changed into small round-shaped cells with a large nuclear-cytoplasmic ratio. The expressions of CK10, β1-integrin, Oct4 and Nanog in CCND1 induced cells were remarkably higher than those in the control group (P cells exhibited a high colony-forming ability and a long-term proliferative potential. When the induced cells were implanted into a wound of laboratory animal model, the wound healing was accelerated. These results suggested that overexpression of CCND1 induced the reprogramming of differentiated epidermal cells into stem cell-like cells. This study may also offer a new approach to yield epidermal stem cells for wound repair and regeneration.

  7. Chronic administration of epidermal growth factor to pigs induces growth, especially of the urinary tract with accumulation of epithelial glycoconjugates

    DEFF Research Database (Denmark)

    Vinter-Jensen, Lars; Juhl, C O; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) receptor hyperstimulation induced by systemically administered EGF or by the development of transgenic mice overexpressing transforming growth factor alpha (TGF alpha) or other EGF-related ligands is known to induce various effects, such as acceleration of developmen...

  8. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  9. GLP-1/Exendin-4 induces β-cell proliferation via the epidermal growth factor receptor.

    Science.gov (United States)

    Fusco, Joseph; Xiao, Xiangwei; Prasadan, Krishna; Sheng, Qingfeng; Chen, Congde; Ming, Yung-Ching; Gittes, George

    2017-08-22

    Exendin-4 is a long acting glucagon-like peptide 1 (GLP-1) analogue that is an agonist for the GLP-1 receptor, a G-protein coupled receptor (GPCR). Exendin-4 is used to clinically improve glucose tolerance in diabetic patients due to its ability to enhance insulin secretion. In rodents, and possibly in humans, exendin-4 can stimulate β-cell proliferation. The exact mechanism of action to induce β-cell proliferation is not well understood. Here, using a β-cell specific epidermal growth factor receptor (EGFR) null mouse, we show that exendin-4 induced an increase in proliferation and β-cell mass through EGFR. Thus, our study sheds light on the role of EGFR signaling in the effects of exendin-4 on the control of blood glucose metabolism and β-cell mass.

  10. Role for the Epidermal Growth Factor Receptor in Chemotherapy-Induced Alopecia

    Science.gov (United States)

    Bichsel, Kyle J.; Gogia, Navdeep; Malouff, Timothy; Pena, Zachary; Forney, Eric; Hammiller, Brianna; Watson, Patrice; Hansen, Laura A.

    2013-01-01

    Treatment of cancer patients with chemotherapeutics like cyclophosphamide often causes alopecia as a result of premature and aberrant catagen. Because the epidermal growth factor receptor (EGFR) signals anagen hair follicles to enter catagen, we hypothesized that EGFR signaling may be involved in cyclophosphamide-induced alopecia. To test this hypothesis, skin-targeted Egfr mutant mice were generated by crossing floxed Egfr and Keratin 14 promoter-driven Cre recombinase mice. Cyclophosphamide treatment of control mice resulted in alopecia while Egfr mutant skin was resistant to cyclophosphamide-induced alopecia. Egfr mutant skin entered catagen normally, as indicated by dermal papilla condensation and decreased follicular proliferation, but did not progress to telogen as did Egfr wild type follicles. Egfr mutant follicles responded with less proliferation, apoptosis, and fewer p53-positive cells after cyclophosphamide. Treatment of control mice with the EGFR inhibitors erlotinib or gefitinib similarly suppressed alopecia and catagen progression by cyclophosphamide. Secondary analysis of clinical trials utilizing EGFR-targeted therapies and alopecia-inducing chemotherapy also revealed evidence for involvement of EGFR in chemotherapy-induced alopecia. Taken together, our results demonstrated the involvement of EGFR signaling in chemotherapy-induced alopecia, which will help in the design of novel therapeutic regimens to minimize chemotherapy-induced alopecia. PMID:23894460

  11. Blue-light-induced rapid chloroplast de-anchoring in Vallisneria epidermal cells.

    Science.gov (United States)

    Sakai, Yuuki; Inoue, Shin-ichiro; Harada, Akiko; Shimazaki, Ken-Ichiro; Takagi, Shingo

    2015-01-01

    In the outer periclinal cytoplasm of leaf epidermal cells of an aquatic angiosperm Vallisneria, blue light induces "chloroplast de-anchoring", a rapid decline in the resistance of chloroplasts against centrifugal force. Chloroplast de-anchoring is known induced within 1 min of irradiation with high-fluence-rate blue light specifically, preceding the commencement of chloroplasts migration toward the anticlinal cytoplasm. However, its regulatory mechanism has remained elusive, although pharmacological analysis suggested that a calcium release from intracellular calcium stores is necessary for the response. In search of the responsible photoreceptors, immunoblotting analysis using antibodies against phototropins demonstrated that cross-reactive polypeptides of 120-kDa exist in the plasma-membrane fraction prepared from the leaves. In vitro phosphorylation analysis revealed that 120-kDa polypeptides were phosphorylated by exposure to blue light in a fluence-dependent manner. The blue-light-induced phosphorylation activity was sensitive to a Ser/Thr kinase inhibitor, staurosporine, and unusually was retained at a high level for a long time in darkness. Furthermore, phototropin gene homologs (Vallisneria PHOTOTROPIN1 and PHOTOTROPIN2) expressed in leaves were isolated. We propose that calcium-regulated chloroplast de-anchoring, possibly mediated by phototropins, is an initial process of the blue-light-induced avoidance response of chloroplasts in Vallisneria. © 2014 Institute of Botany, Chinese Academy of Sciences.

  12. Epidermal fatty acid binding protein promotes high-fat diet-induced skin inflammation

    Science.gov (United States)

    Rao, Enyu; Sun, Yanwen; Grossmann, Michael E.; Morris, Rebecca J.; Cleary, Margot P.; Li, Bing

    2015-01-01

    SUMMARY Defining specific cellular and molecular mechanisms in most obesity-related diseases remains an important challenge. Here we report a serendipitous finding that consumption of a high-fat diet (HFD) greatly increased the occurrence of skin lesions in C57BL/6 mice. We demonstrated that HFD induced the accumulation of a specific type of CD11c+ macrophages in skin preceding detectable lesions. These cells primed skin to induce IL-1β and IL-18 signaling, which further promoted the cytokines IFNγ- and IL-17-mediated skin inflammation. Mechanistically, epidermal fatty acid binding protein (E-FABP) was significantly upregulated in skin of obese mice, which coupled lipid droplet formation and NLRP3 inflammasome activation. Deficiency of E-FABP in obese mice decreased recruitment of CD11c+ macrophages in skin tissues, reduced production of IL-1β and IL-18, and consequently dampened activation of effector T cells. Furthermore, E-FABP deficient mice are completely resistant to HFD-induced skin lesions. Collectively, E-FABP represents a molecular sensor triggering HFD-induced skin inflammation. PMID:25992864

  13. Epidermal Fatty Acid binding protein promotes skin inflammation induced by high-fat diet.

    Science.gov (United States)

    Zhang, Yuwen; Li, Qiang; Rao, Enyu; Sun, Yanwen; Grossmann, Michael E; Morris, Rebecca J; Cleary, Margot P; Li, Bing

    2015-05-19

    Defining specific cellular and molecular mechanisms in most obesity-related diseases remains an important challenge. Here we report a serendipitous finding that consumption of a high-fat diet (HFD) greatly increased the occurrence of skin lesions in C57BL/6 mice. We demonstrated that HFD induced the accumulation of a specific type of CD11c(+) macrophages in skin preceding detectable lesions. These cells primed skin to induce IL-1β and IL-18 signaling, which further promoted the cytokines IFN-γ- and IL-17-mediated skin inflammation. Mechanistically, epidermal fatty acid binding protein (E-FABP) was significantly upregulated in skin of obese mice, which coupled lipid droplet formation and NLRP3 inflammasome activation. Deficiency of E-FABP in obese mice decreased recruitment of CD11c(+) macrophages in skin tissues, reduced production of IL-1β and IL-18, and consequently dampened activation of effector T cells. Furthermore, E-FABP-deficient mice are completely resistant to HFD-induced skin lesions. Collectively, E-FABP represents a molecular sensor triggering HFD-induced skin inflammation. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Epidermal growth factor receptor signaling mediates aldosterone-induced profibrotic responses in kidney

    Energy Technology Data Exchange (ETDEWEB)

    Sheng, Lili; Yang, Min; Ding, Wei [Department of Nephrology, Shanghai Fifth People' s Hospital, Fudan University, Shanghai 200240 (China); Zhang, Minmin [Department of Nephrology, Shanghai Huashan Hospital, Fudan University, Shanghai 200240 (China); Niu, Jianying [Department of Nephrology, Shanghai Fifth People' s Hospital, Fudan University, Shanghai 200240 (China); Qiao, Zhongdong [School of Life Science and Biotechnology, Shanghai Jiaotong University, Shanghai 200240 (China); Gu, Yong, E-mail: yonggu@vip.163.com [Department of Nephrology, Shanghai Fifth People' s Hospital, Fudan University, Shanghai 200240 (China); Department of Nephrology, Shanghai Huashan Hospital, Fudan University, Shanghai 200240 (China)

    2016-08-01

    Aldosterone has been recognized as a risk factor for the development of chronic kidney disease (CKD). Studies have indicated that enhanced activation of epidermal growth factor receptor (EGFR) is associated with the development and progression of renal fibrosis. But if EGFR is involved in aldosterone-induced renal fibrosis is less investigated. In the present study, we examined the effect of erlotinib, an inhibitor of EGFR tyrosine kinase activity, on the progression of aldosterone-induced renal profibrotic responses in a murine model underwent uninephrectomy. Erlotinib-treated rats exhibited relieved structural lesion comparing with rats treated with aldosterone alone, as characterized by glomerular hypertrophy, mesangial cell proliferation and expansion. Also, erlotinib inhibited the expression of TGF-β, α-SMA and mesangial matrix proteins such as collagen Ⅳ and fibronectin. In cultured mesangial cells, inhibition of EGFR also abrogated aldosterone-induced expression of extracellular matrix proteins, cell proliferation and migration. We also demonstrated that aldosterone induced the phosphorylation of EGFR through generation of ROS. And the activation of EGFR resulted in the phosphorylation of ERK1/2, leading to the activation of profibrotic pathways. Taken together, we concluded that aldosterone-mediated tissue fibrosis relies on ROS induced EGFR/ERK activation, highlighting EGFR as a potential therapeutic target for modulating renal fibrosis. - Highlights: • EGFR was involved in aldosterone-induced renal profibrotic responses. • Aldosterone-induced EGFR activation was mediated by MR-dependent ROS generation. • EGFR activated the MAPK/ERK1/2 signaling to promote renal fibrosis.

  15. Epidermal growth factor receptor expression in radiation-induced dog lung tumors by immunocytochemical localization

    Energy Technology Data Exchange (ETDEWEB)

    Leung, F.L.; Park, J.F.; Dagle, G.E.

    1993-06-01

    In studies to determine the role of growth factors in radiation-induced lung cancer, epidermal growth factor (EGFR) expression was examined by immunocytochemistry in 51 lung tumors from beagle dogs exposed to inhaled plutonium; 21 of 51 (41%) tumors were positive for EGFR. The traction of tumors positive for EGFR and the histological type of EGFR-positive tumors in the plutonium-exposed dogs were not different from spontaneous dog lung tumors, In which 36% were positive for EGFR. EGFR involvement in Pu-induced lung tumors appeared to be similar to that in spontaneous lung tumors. However, EGFR-positive staining was observed in only 1 of 16 tumors at the three lowest Pu exposure levels, compared to 20 of 35 tumors staining positive at the two highest Pu exposure levels. The results in dogs were in good agreement with the expression of EGFR reported in human non-small cell carcinoma of the lung, suggesting that Pu-induced lung tumors in the dog may be a suitable animal model to investigate the role of EGFR expression in lung carcinogenesis. In humans, EGFR expression in lung tumors has been primarily related to histological tumor types. In individual dogs with multiple primary lung tumors, the tumors were either all EGFR positive or EGFR negative, suggesting that EGFR expression may be related to the response of the individual dog as well as to the histological type of tumor.

  16. Genetic dissection of epidermal growth factor receptor signaling during luteinizing hormone-induced oocyte maturation.

    Directory of Open Access Journals (Sweden)

    Minnie Hsieh

    Full Text Available Recent evidence that luteinizing hormone (LH stimulation of ovulatory follicles causes transactivation of the epidermal growth factor receptor (EGFR has provided insights into the mechanisms of ovulation. However, the complete array of signals that promote oocyte reentry into the meiotic cell cycle in the follicle are still incompletely understood. To elucidate the signaling downstream of EGFR involved in oocyte maturation, we have investigated the LH responses in granulosa cells with targeted ablation of EGFR. Oocyte maturation and ovulation is disrupted when EGFR expression is progressively reduced. In granulosa cells from mice with either global or granulosa cell-specific disruption of EGFR signaling, LH-induced phosphorylation of MAPK3/1, p38MAPK, and connexin-43 is impaired. Although the LH-induced decrease in cGMP is EGFR-dependent in wild type follicles, LH still induces a decrease in cGMP in Egfr(delta/f Cyp19-Cre follicles. Thus compensatory mechanisms appear activated in the mutant. Spatial propagation of the LH signal in the follicle also is dependent on the EGF network, and likely is important for the control of signaling to the oocyte. Thus, multiple signals and redundant pathways contribute to regulating oocyte reentry into the cell cycle.

  17. The role of epidermal cytokines in the generation of cutaneous immune reactions and ultraviolet radiation-induced immune suppression

    International Nuclear Information System (INIS)

    Ullrich, S.E.

    1995-01-01

    The immune suppression generated by UV exposure is a major risk factor for skin cancer patients. This finding has fuelled efforts to understand the mechanisms involved in the immune suppression induced by exposure to UV radiation. This article reviews the recent findings on the role of epidermal cytokines in the generation of an immune response and their role in the induction of immune suppression induced by UV exposure. (UK)

  18. Epidermal stem cells are defined by global histone modifications that are altered by Myc-induced differentiation.

    Directory of Open Access Journals (Sweden)

    Michaela Frye

    2007-08-01

    Full Text Available Activation of Myc induces epidermal stem cells to exit their niche and differentiate into sebocytes and interfollicular epidermis, a process that is associated with widespread changes in gene transcription. We have identified chromatin modifications that are characteristic of epidermal stem cells and investigated the effects of Myc activation. Quiescent stem cells in the interfollicular epidermis and the hair follicle bulge had high levels of tri-methylated histone H3 at lysine 9 and H4 at lysine 20. Chromatin in both stem cell populations was hypoacteylated at histone H4 and lacked mono-methylation of histone H4 at lysine 20. Myc-induced exit from the stem cell niche correlated with increased acetylation at histone H4 and transiently increased mono-methylation at lysine 20. The latter was replaced by epigenetic modifications that are largely associated with chromatin silencing: di-methylation at histone H3 lysine 9 and histone H4 lysine 20. These modifications correlated with changes in the specific histone methyltransferases Set8 and Ash-1. The Myc-induced switch from mono- to di-methylated H4K20 required HDAC activity and was blocked by the HDAC inhibitor trichostatin A (TSA. TSA treatment induced a similar epidermal phenotype to activation of Myc, and activation of Myc in the presence of TSA resulted in massive stimulation of terminal differentiation. We conclude that Myc-induced chromatin modifications play a major role in Myc-induced exit from the stem cell compartment.

  19. Sulfur mustard induces the formation of keratin aggregates in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Dillman, James F.; McGary, Kriston L.; Schlager, John J.

    2003-01-01

    The vesicant sulfur mustard is an alkylating agent that has the capacity to cross-link biological molecules. We are interested in identifying specific proteins that are altered upon sulfur mustard exposure. Keratins are particularly important for the structural integrity of skin, and several genetically inherited blistering diseases have been linked to mutations in keratin 5 and keratin 14. We examined whether sulfur mustard exposure alters keratin biochemistry in cultured human epidermal keratinocytes. Western blotting with specific monoclonal antibodies revealed the formation of stable high-molecular-weight 'aggregates' containing keratin 14 and/or keratin 5. These aggregates begin to form within 15 min after sulfur mustard exposure. These aggregates display a complex gel electrophoresis pattern between ∼100 and ∼200 kDa. Purification and analysis of these aggregates by one- and two-dimensional gel electrophoresis and mass spectrometry confirmed the presence of keratin 14 and keratin 5 and indicate that at least some of the aggregates are composed of keratin 14-keratin 14, keratin 14-keratin 5, or keratin 5-keratin 5 dimers. These studies demonstrate that sulfur mustard induces keratin aggregation in keratinocytes and support further investigation into the role of keratin aggregation in sulfur mustard-induced vesication

  20. Eosinophil peroxidase signals via epidermal growth factor-2 to induce cell proliferation.

    LENUS (Irish Health Repository)

    Walsh, Marie-Therese

    2011-11-01

    Eosinophils exert many of their inflammatory effects in allergic disorders through the degranulation and release of intracellular mediators, including a set of cationic granule proteins that include eosinophil peroxidase. Studies suggest that eosinophils are involved in remodeling. In previous studies, we showed that eosinophil granule proteins activate mitogen-activated protein kinase signaling. In this study, we investigated the receptor mediating eosinophil peroxidase-induced signaling and downstream effects. Human cholinergic neuroblastoma IMR32 and murine melanoma B16.F10 cultures, real-time polymerase chain reaction, immunoprecipitations, and Western blotting were used in the study. We showed that eosinophil peroxidase caused a sustained increase in both the expression of epidermal growth factor-2 (HER2) and its phosphorylation at tyrosine 1248, with the consequent activation of extracellular-regulated kinase 1\\/2. This, in turn, promoted a focal adhesion kinase-dependent egress of the cyclin-dependent kinase inhibitor p27(kip) from the nucleus to the cytoplasm. Eosinophil peroxidase induced a HER2-dependent up-regulation of cell proliferation, indicated by an up-regulation of the nuclear proliferation marker Ki67. This study identifies HER2 as a novel mediator of eosinophil peroxidase signaling. The results show that eosinophil peroxidase, at noncytotoxic levels, can drive cell-cycle progression and proliferation, and contribute to tissue remodeling and cell turnover in airway disease. Because eosinophils are a feature of many cancers, these findings also suggest a role for eosinophils in tumorigenesis.

  1. Effect of epidermal growth factor against radiotherapy-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Lee, Sang-wook; Jung, Kwon Il; Kim, Yeun Wha B.S.; Jung, Heun Don; Kim, Hyun Sook; Hong, Joon Pio

    2007-01-01

    Purpose: We tested the efficacy of oral recombinant human epidermal growth factor (rhEGF) against radiation-induced oral mucositis in a rat model. Methods and Materials: Each of 35 Sprague-Dawley rats, 7 to 8 weeks of age and weighing 178 ± 5 grams, was irradiated once in the head region with 25 Gy, using a 4-MV therapeutic linear accelerator at a rate of 2 Gy/min. The irradiated rats were randomly divided into four groups: those receiving no treatment (Group 1), those treated with vehicle only three times per day (Group 2), and those treated with 50 μg/mL (Group 3), or 100 μg/mL (Group 4) rhEGF three times per day. Results: Rats were monitored for survival rate and daily activity, including hair loss, sensitivity, and anorexia. We found that survival rate and oral intake were significantly increased and histologic changes were significantly decreased in the rhEGF-treated rats. There was no difference, however, between rats treated with 50 μg/mL or 100 μg/mL rhEGF. Conclusion: These findings suggest that orally administered rhEGF decreased radiation-induced oral mucositis in rats

  2. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  3. Chronic systemic treatment with epidermal growth factor induces hypergastrinaemia in Goettingen minipigs

    DEFF Research Database (Denmark)

    Vinter-Jensen, Lars; Juhl, C O; Rehfeld, J F

    1995-01-01

    Epidermal growth factor (EGF) is an inhibitor of gastric acid secretion. The impact of chronic systemic treatment with EGF on intragastric pH and serum gastrin concentrations has not been investigated previously.......Epidermal growth factor (EGF) is an inhibitor of gastric acid secretion. The impact of chronic systemic treatment with EGF on intragastric pH and serum gastrin concentrations has not been investigated previously....

  4. On the physics of laser-induced selective photothermolysis of hair follicles: Influence of wavelength, pulse duration, and epidermal cooling.

    Science.gov (United States)

    Svaasand, Lars O; Nelson, J Stuart

    2004-01-01

    The physical basis for optimization of wavelength, pulse duration, and cooling for laser-induced selective photothermolysis of hair follicles in human skin is discussed. The results indicate that the most important optimization parameter is the cooling efficiency of the technique utilized for epidermal protection. The optical penetration is approximately the same for lasers at 694, 755, and 800 nm. The penetration of radiation from Nd:yttrium-aluminum-garnet lasers at 1064 nm is, however, somewhat larger. Photothermal damage to the follicle is shown to be almost independent of laser pulse duration up to 100 ms. The results reveal that epidermal cooling by a 30-80-ms-long cryogen spurt immediately before laser exposure is the only efficient technique for laser pulse durations less than 10 ms. For longer pulse durations in the 30-100 ms range, protection can be done efficiently by skin cooling during laser exposure. For laser pulses of 100 ms, an extended precooling period, e.g., by bringing a cold object into good thermal contact with the skin for about 1 s, can be of value. Thermal quenching of laser induced epidermal temperature rise after pulsed exposure can most efficiently be done with a 20 ms cryogen spurt applied immediately after irradiation. (c) 2004 Society of Photo-Optical Instrumentation Engineers.

  5. Effects of kinesiologic taping on epidermal-dermal distance, pain, edema and inflammation after experimentally induced soft tissue trauma.

    Science.gov (United States)

    Kafa, Nihan; Citaker, Seyit; Omeroglu, Suna; Peker, Tuncay; Coskun, Neslihan; Diker, Seyda

    2015-01-01

    In sports medicine, the use of kinesiologic tape has recently gained popularity. Although widely used, there is no study examining the effects of kinesiologic tape on soft tissue after a contusion injury. The aim of this study was to examine the effects of kinesiologic taping on epidermal-dermal distance, edema, pain and inflammation after experimentally induced contusion injury. Twelve adult female Wistar albino rats were divided into two groups: (1) 30 min group: n = 6, weight range: 182.0-199.4 g; and (2) 6 h group: n = 6, weight range: 186.9-200.8 g. After soft-tissue trauma, tape was applied to the right sides of each rat. In one group, tape was applied for 30 min while 6 h in the other. To assess the epidermal-dermal distance and edematous area, tissue sections were stained with hematoxylin and eosin and examined. Tissue sections were stained with nerve growth factor (NGF) and B-cell lymphoma 2 (Bcl-2) immunohistochemically to evaluate the effect of taping on pain and inflammation respectively. Epidermal-dermal distances were found to be significantly higher than controls' in both groups (p pain, edema and inflammation. For better, faster and comfortable tissue healing with protection of soft-tissue integrity, kinesiologic taping may be a valuable treatment after contusion injury. However, these results should be supported by clinical studies.

  6. Hollow silicon microneedle array based trans-epidermal antiemetic patch for efficient management of chemotherapy induced nausea and vomiting

    Science.gov (United States)

    Kharbikar, Bhushan N.; Kumar S., Harish; Kr., Sindhu; Srivastava, Rohit

    2015-12-01

    Chemotherapy Induced Nausea and Vomiting (CINV) is a serious health concern in the treatment of cancer patients. Conventional routes for administering anti-emetics (i.e. oral and parenteral) have several drawbacks such as painful injections, poor patient compliance, dependence on skilled personnel, non-affordability to majority of population (parenteral), lack of programmability and suboptimal bioavailability (oral). Hence, we have developed a trans-epidermal antiemetic drug delivery patch using out-of-plane hollow silicon microneedle array. Microneedles are pointed micron-scale structures that pierce the epidermal layer of skin to reach dermal blood vessels and can directly release the drug in their vicinity. They are painless by virtue of avoiding significant contact with dermal sensory nerve endings. This alternate approach gives same pharmacodynamic effects as par- enteral route at a sparse drug-dose requirement, hence negligible side-effects and improved patient compliance. Microneedle design attributes were derived by systematic study of human skin anatomy, natural micron-size structures like wasp-sting and cactus-spine and multi-physics simulations. We used deep reactive ion etching with Bosch process and optimized recipe of gases to fabricate high-aspect-ratio hollow silicon microneedle array. Finally, microneedle array and polydimethylsiloxane drug reservoir were assembled to make finished anti-emetic patch. We assessed microneedles mechanical stability, physico-chemical properties and performed in-vitro, ex- vivo and in-vivo studies. These studies established functional efficacy of the device in trans-epidermal delivery of anti-emetics, its programmability, ease of use and biosafety. Thus, out-of-plane hollow silicon microneedle array trans-epidermal antiemetic patch is a promising strategy for painless and effective management of CINV at low cost in mainstream healthcare.

  7. Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.

    NARCIS (Netherlands)

    Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der

    2003-01-01

    The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol

  8. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained......, and satisfactory amounts of high-quality RNA were obtained. Hybridization to Affymetrix HG_U133A 2.0 GeneChips showed that ammonium thiocyanate incubation had a minute effect on gene expression resulting in only one significantly downregulated gene (cystatin E/M). We conclude that epidermis can be reproducibly...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  9. Tissue remodeling induced by hypersecreted epidermal growth factor and amphiregulin in the airway after an acute asthma attack.

    Science.gov (United States)

    Enomoto, Yukinori; Orihara, Kanami; Takamasu, Tetsuya; Matsuda, Akio; Gon, Yasuhiro; Saito, Hirohisa; Ra, Chisei; Okayama, Yoshimichi

    2009-11-01

    Epidermal growth factor receptor ligands, such as epidermal growth factor (EGF) and amphiregulin, may play key roles in tissue remodeling in asthma. However, the kinetics of EGF and amphiregulin secretion in the airway after an acute asthma attack and the effect of prolonged airway exposure to these ligands on airway remodeling are unknown. To measure the EGF and amphiregulin concentrations in sputa obtained from patients with asthma under various conditions, and to examine the effects of EGF and amphiregulin on the proliferation or differentiation of airway structural cells. Epidermal growth factor and amphiregulin levels were measured by ELISA in sputum specimens collected from 14 hospitalized children with asthma during an acute asthma attack, 13 stable outpatients with asthma, 8 healthy control children, and 7 children with respiratory tract infections. The effects of EGF and amphiregulin on the proliferation and/or differentiation of normal human bronchial epithelial cells (NHBE), bronchial smooth muscle cells (BSMC), and normal human lung fibroblasts (NHLF) were examined. The sputum levels of EGF were significantly higher for about a week after an acute asthma attack compared with the levels in stable subjects with asthma and control subjects. In contrast, upregulation of amphiregulin in the sputa of patients with asthma was observed only during the acute attack. EGF caused proliferation of NHBE, BSMC, and NHLF, whereas amphiregulin induced proliferation of only NHBE. Prolonged exposure of NHBE to EGF and amphiregulin induced mucous cell metaplasia in an IL-13-independent manner. Acute asthma attacks are associated with hypersecretion of EGF and amphiregulin in the airway. Recurrent acute attacks may aggravate airway remodeling.

  10. Role of inositol (1,4,5)trisphosphate in epidermal growth factor-induced Ca2+ signaling in A431 cells

    DEFF Research Database (Denmark)

    Hughes, A R; Bird, G S; Obie, J F

    1991-01-01

    The effects of epidermal growth factor on Ca2+ signaling in A431 cells were investigated. Epidermal growth factor induced a transient Ca2+ signal in the absence of external Ca2+ and a sustained response in the presence of extracellular Ca2+, indicating an ability to mobilize intracellular Ca2...... to thapsigargin. In nominally Ca(2+)-free medium, the addition of bradykinin to A431 cells rapidly but transiently increased inositol 1,4,5-trisphosphate and, in parallel fashion, transiently increased cytosolic Ca2+. Unexpectedly, under these experimental conditions, epidermal growth factor elicited a small...... inositol 1,4,5-trisphosphate formation in bradykinin-treated cells. Furthermore, the Ca2+ signals elicited by both bradykinin and epidermal growth factor were blocked in cells microinjected with the inositol 1,4,5-trisphosphate receptor antagonist heparin, whereas the intracellular Ca(2+)-ATPase inhibitor...

  11. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  12. Cholera toxin, a potent inducer of epidermal hyperplasia but with no tumor promoting activity in mouse skin carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Kuroki, T.; Chida, K.; Munakata, K.; Murakami, Y.

    1986-05-29

    Intracutaneous injection of cholera toxin into mice induced epidermal hyperplasia to a greater extent than 12-O-tetra-decanoylphorbol-13-acetate. It also induced adenylate cyclase and through weakly, ornithine decarboxylase of the epidermis. Cholera toxin, however, showed no tumor promoting activity in mouse skin carcinogenesis. In the single stage promotion, cholera toxin (50 ng) was injected once a week for 10 weeks into the skin of SENCAR mice initiated with 25 ..mu..g 7,12-dimethyl-benz(a)anthracene, but no tumors developed. In the two-stage promotion test, cholera toxin (10-100 ng) was injected for one or two weeks into the initiated skin and then mezerein (4 ..mu..g) was applied twice a week for 18 weeks, but the toxin did not increase incidence or numbers of papillomas.

  13. Pretreatment of epidermal growth factor promotes primary hair recovery via the dystrophic anagen pathway after chemotherapy-induced alopecia.

    Science.gov (United States)

    Paik, Seung Hwan; Yoon, Ji-Seon; Ryu, Hyeong Ho; Lee, Ji Yeon; Shin, Chang Yup; Min, Kyung Hyun; Jo, Seong Jin; Kim, Kyu Han; Kwon, Ohsang

    2013-07-01

    Epidermal growth factor (EGF) is not only a cell growth stimulant but also has a catagen-inducing effect. Because chemotherapeutic agents primarily damage anagen hair follicles, it would be important to investigate whether catagen inducers have beneficial effects in chemotherapy-induced alopecia (CIA). We pretreated hair follicles with topical EGF-liposomal solution in the C57BL/6 mouse model of cyclophosphamide-induced alopecia and observed the catagen-inducing property and damage response pathway after CIA. We confirmed that topical EGF application induced a catagen-like stage and found that these catagen-like hairs were protected from chemotherapy-mediated damage. Moreover, our results showed that EGF treatment favoured primary hair recovery via the dystrophic anagen pathway after CIA. Given that hair follicles subjected to less severe chemotherapeutic insult enter the dystrophic anagen pathway followed by primary recovery, the results of this study suggest that catagen inducers could be useful as a new alopecia-protection strategy, especially in the context of CIA. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Experimentally Induced Gluten Enteropathy and Protective Effect of Epidermal Growth Factor in Artificially Fed Neonatal Rats

    Czech Academy of Sciences Publication Activity Database

    Štěpánková, Renata; Kofroňová, Olga; Tučková, Ludmila; Kozáková, Hana; Cebra, J. J.; Tlaskalová, Helena

    2003-01-01

    Roč. 36, - (2003), s. 96-104 ISSN 0277-2116 R&D Projects: GA ČR GA303/00/1370; GA ČR GA310/00/1373; GA ČR GA303/01/1380; GA ČR GA310/01/0933; GA AV ČR IAA5020210; GA AV ČR IBS5020203; GA AV ČR IAA5020101 Institutional research plan: CEZ:AV0Z5020903 Keywords : epidermal growth factor * celiac disease Subject RIV: EE - Microbiology, Virology Impact factor: 1.402, year: 2003

  15. STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT

    Directory of Open Access Journals (Sweden)

    V.F. Zhernosek

    2011-01-01

    Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.

  16. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  17. Potential involvement of oxygen intermediates and glutathione depletion in UV-induced epidermal cell injury in vitro

    International Nuclear Information System (INIS)

    Hsieh, G.C.; Acosta, D.

    1991-01-01

    Generation of reactive oxygen species (ROS) and depletion of glutathione (GSH) are suggested as the cytotoxic mechanisms for UVB-induced cellular damage. Primary monolayer cultures of epidermal keratinocytes (KCs) prepared from the skin of neonatal rats were irradiated with UVB at levels of 0.25-3.0 J/cm 2 . Cytotoxicity was measured at 3, 6, and 12 hr after UVB radiation. Exposure of KCs to UVB resulted in time- and dose-related toxic responses as determined by plasma membrane integrity, lysosomal function and mitochondrial metabolic activity. Irradiated KCs generated superoxide in a dose-dependent manner when compared to sham-irradiated cells. Superoxide formation, which occurred before and concomitant with cell injury, was decreased by superoxide dismutase (SOD). Cell injury was also significantly prevented by ROS scavengers, SOD and catalase. Pretreatment of cells with endocytosis inhibitors, cytochalasin B and methylamine, suppressed the ability of SOD and catalase to protect keratinocytes from UVB-induced toxicity. Irradiation of cells with UVB caused rapid depletion of GSH to about 30% of unirradiated levels within 15 min. UVB-irradiation led to a rapid transient increase in GSH peroxidase activity, concomitant with a marked decrease in the GSH/GSSG ratio. After 1 hr., while the GSH/GSSG ratio remained low, the GSH peroxidase activity declined below the control levels in UVB-treated epidermal cells. Following extensive GSH depletion in cells preincubated with 0.1 mM buthiomine sulfoximine, KCs became strongly sensitized to the cytotoxic action of UVB. These results indicate that UVB-induced cell injury in cultured KCs may be mediated by ROs and that endogenous GSH may play an important protective role against the cytotoxic action of UVB

  18. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice.

    Directory of Open Access Journals (Sweden)

    Junko Okano

    Full Text Available Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyperglycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/without insulin therapy. The results showed that dye leakages were prominent, and transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of the protein associated with the tight junction structure, tight junction protein-1 (ZO-1, was characterized by diffuse and significantly wider expression in the diabetic mice compared to that in the control mice. In turn, epidermal cell number was significantly reduced and basal cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the number of corneocytes, namely, denucleated and terminally differentiated keratinocytes significantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic mice. We found that cell proliferation was significantly decreased, while apoptotic cells were comparable in the skin of diabetic mice, compared to those in the control mice. In the epidermis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were ectopically induced in diabetic mice. These data suggest that hyperglycemia altered keratinocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the proliferation/differentiation process could be the underlying mechanisms for impaired skin barrier functions in diabetic mice.

  19. Fermented milk containing Lactobacillus GG alleviated DSS-induced colitis in mice and activated epidermal growth factor receptor and Akt signaling in intestinal epithelial cells

    Directory of Open Access Journals (Sweden)

    Kazutoyo Yoda

    2012-06-01

    Full Text Available Lactobacillus rhamnosus GG was assessed for its ability to alleviate DSS-induced colitis in mice and activate epidermal growth factor receptor and Akt signaling in intestinal epithelial cells. In this study mice were treated with DSS to induce colitis and they were given Lactobacillus GG fermented milk to assess the effect of probiotic on colitis. Lactobacillus GG fermented milk significantly reduced the colitis associated changes suggesting a protective effect against DSS induced colitis.

  20. Altered epidermal lipid layers induced by long-term exposure to suberythemal-dose ultraviolet.

    Science.gov (United States)

    Bak, Hana; Hong, Seung-Phil; Jeong, Se-Kyoo; Choi, Eung-Ho; Lee, Sang E; Lee, Seung-Hun; Ahn, Sung-Ku

    2011-07-01

    Although several studies have reported on the biological effects of ultraviolet (UV) radiation, there have been only a few reports on the changes in epidermal lipids following long-term UV irradiation at suberythemal dose (SED), to which people are usually exposed during their lifetime. To investigate the changes of epidermal lipid properties after long-term UV radiation with SED. Hairless mice were irradiated three times weekly for 15 weeks at an SED of UV (UVB: 20 mJ/cm(2) ; UVA: 14 J/cm(2) ). Every three weeks, transepidermal water loss (TEWL) was measured by a Tewameter. The morphological alterations of stratum corneum (SC) lipid lamellae were examined by electron microscopy (EM). Activities of three key enzymes for mRNA of serine palmitoyl transferase, fatty acid synthase, and HMG CoA reductase were analyzed with real time reverse transcriptase-polymerase chain reaction. We also measured the amount of ceramide, cholesterol sulfate, and free fatty acid in the SC by high-performance thin-layer chromatography with exposed times. The SED UV-irradiated group showed increased TEWL after 12 weeks. Following the irradiation period, EM revealed incomplete and separated lamellae at SC intercellular space. mRNA of three key enzymes was increased until six weeks of UV irradiation and decreased thereafter. However, three major lipid amounts gradually decreased throughout the exposed period, with a notable decrease in ceramide. Long-term UV irradiation even with SED influences skin barrier function and structure with prominent ceramide decrease in SC intercellular lipid. © 2011 The International Society of Dermatology.

  1. The Effect of Recombinant Human Epidermal Growth Factor on Cisplatin and Radiotherapy Induced Oral Mucositis in Mice

    International Nuclear Information System (INIS)

    Na, Jae Boem; Kim, Hye Jung; Chai, Gyu Young

    2007-01-01

    Purpose: To study the effect of recombinant human epidermal growth factor (rhEGF) on oral mucositis induced by cisplatin and radiotherapy in a mouse model. Materials and Methods: Twenty-four ICR mice were divided into three groups. the normal control group, the no rhEGF group (treatment with cisplatin and radiation) and the rhEGF group (treatment with cisplatin, radiation and rhEGF). A model of mucositis induced by cisplatin and radiotherapy was established by injecting mice with cisplatin (10 mg/kg) on day 1 and with radiation exposure (5 Gy/day) to the head and neck on days 1∼5. rhEGF was administered subcutaneously on days -1 to 0 (1 mg/kg/day) and on days 3 to 5 (1 mg/kg/day). Evaluation included body weight, oral intake, and histology. Results: For the comparison of the change of body weight between the rhEGF group and the no rhEGF group, a statistically significant difference was observed in the rhEGF group for the 5 days after day 3 of the experiment. The rhEGF group and no rhEGF group had reduced food intake until day 5 of the experiment, and then the mice demonstrated increased food intake after day 13 of the of experiment. When the histological examination was conducted on day 7 after treatment with cisplatin and radiation, the rhEGF group showed a focal cellular reaction in the epidermal layer of the mucosa, while the no rhEGF group did not show inflammation of the oral mucosa. Conclusion: These findings suggest that rhEGF has a potential to reduce the oral mucositis burden in mice after treatment with cisplatin and radiation. The optimal dose, number and timing of the administration of rhEGF require further investigation

  2. The Effect of Recombinant Human Epidermal Growth Factor on Cisplatin and Radiotherapy Induced Oral Mucositis in Mice

    Energy Technology Data Exchange (ETDEWEB)

    Na, Jae Boem; Kim, Hye Jung; Chai, Gyu Young [Gyeongsang National University School of Medicine, Jinju (Korea, Republic of)

    2007-12-15

    Purpose: To study the effect of recombinant human epidermal growth factor (rhEGF) on oral mucositis induced by cisplatin and radiotherapy in a mouse model. Materials and Methods: Twenty-four ICR mice were divided into three groups. the normal control group, the no rhEGF group (treatment with cisplatin and radiation) and the rhEGF group (treatment with cisplatin, radiation and rhEGF). A model of mucositis induced by cisplatin and radiotherapy was established by injecting mice with cisplatin (10 mg/kg) on day 1 and with radiation exposure (5 Gy/day) to the head and neck on days 1{approx}5. rhEGF was administered subcutaneously on days -1 to 0 (1 mg/kg/day) and on days 3 to 5 (1 mg/kg/day). Evaluation included body weight, oral intake, and histology. Results: For the comparison of the change of body weight between the rhEGF group and the no rhEGF group, a statistically significant difference was observed in the rhEGF group for the 5 days after day 3 of the experiment. The rhEGF group and no rhEGF group had reduced food intake until day 5 of the experiment, and then the mice demonstrated increased food intake after day 13 of the of experiment. When the histological examination was conducted on day 7 after treatment with cisplatin and radiation, the rhEGF group showed a focal cellular reaction in the epidermal layer of the mucosa, while the no rhEGF group did not show inflammation of the oral mucosa. Conclusion: These findings suggest that rhEGF has a potential to reduce the oral mucositis burden in mice after treatment with cisplatin and radiation. The optimal dose, number and timing of the administration of rhEGF require further investigation.

  3. Genetically induced cell death in bulge stem cells reveals their redundancy for hair and epidermal regeneration.

    Science.gov (United States)

    Driskell, Iwona; Oeztuerk-Winder, Feride; Humphreys, Peter; Frye, Michaela

    2015-03-01

    Adult mammalian epidermis contains multiple stem cell populations in which quiescent and more proliferative stem and progenitor populations coexist. However, the precise interrelation of these populations in homeostasis remains unclear. Here, we blocked the contribution of quiescent keratin 19 (K19)-expressing bulge stem cells to hair follicle formation through genetic ablation of the essential histone methyltransferase Setd8 that is required for the maintenance of adult skin. Deletion of Setd8 eliminated the contribution of bulge cells to hair follicle regeneration through inhibition of cell division and induction of cell death, but the growth and morphology of hair follicles were unaffected. Furthermore, ablation of Setd8 in the hair follicle bulge blocked the contribution of K19-postive stem cells to wounded epidermis, but the wound healing process was unaltered. Our data indicate that quiescent bulge stem cells are dispensable for hair follicle regeneration and epidermal injury in the short term and support the hypothesis that quiescent and cycling stem cell populations are equipotent. © 2014 AlphaMed Press.

  4. Conditioning pain stimulation does not affect itch induced by intra-epidermal histamine pricks but aggravates neurogenic inflammation in healthy volunteers.

    Science.gov (United States)

    Andersen, H H; Imai, Y; Petersen, K K; Koenig, J; Elberling, J; Arendt-Nielsen, L

    2016-03-01

    This study investigated whether itch induced by intra-epidermal histamine is subjected to modulation by a standardized conditioned pain modulation (CPM) paradigm in 24 healthy volunteers. CPM was induced by computer-controlled cuff pressure algometry and histamine was introduced to the volar forearm by skin prick test punctures. Moreover, neurogenic inflammation and wheal reactions induced by histamine and autonomic nervous system responses (heart rate variability and skin conductance) were monitored. CPM did not modulate the intensity of histamine-induced itch suggesting that pruriceptive signaling is not inhibited by pain-recruited endogenous modulation, however, CPM was found to aggravate histamine-induced neurogenic inflammation, likely facilitated by efferent sympathetic fibers.

  5. Conditioning pain stimulation does not affect itch induced by intra-epidermal histamine pricks but aggravates neurogenic inflammation in healthy volunteers

    DEFF Research Database (Denmark)

    Andersen, Hjalte Holm; Imai, Yosuke; Petersen, Kristian Kjær

    2016-01-01

    This study investigated whether itch induced by intra-epidermal histamine is subjected to modulation by a standardized conditioned pain modulation (CPM) paradigm in 24 healthy volunteers. CPM was induced by computer-controlled cuff pressure algometry and histamine was introduced to the volar...... forearm by skin prick test punctures. Moreover, neurogenic inflammation and wheal reactions induced by histamine and autonomic nervous system responses (heart rate variability and skin conductance) were monitored. CPM did not modulate the intensity of histamine-induced itch suggesting that pruriceptive...... signaling is not inhibited by pain-recruited endogenous modulation, however, CPM was found to aggravate histamine-induced neurogenic inflammation, likely facilitated by efferent sympathetic fibers....

  6. Deletion of epidermal Rac1 inhibits HPV-8 induced skin papilloma formation and facilitates HPV-8- and UV-light induced skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo

    2016-09-06

    Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.

  7. A convenient fluorometric method to study sulfur mustard-induced apoptosis in human epidermal keratinocytes monolayer microplate culture.

    Science.gov (United States)

    Ray, Radharaman; Hauck, Stephanie; Kramer, Rachel; Benton, Betty

    2005-01-01

    Sulfur mustard [SM; bis-(2-chloroethyl) sulfide], which causes skin blistering or vesication [(1991). Histo- and cytopathology of acute epithelial lesions. In: Papirmeister, B., Feister, A. J., Robinson, S. I., Ford, R. D., eds. Medical Defense Against Mustard Gas: Toxic Mechanisms and Pharmacological Implications. Boca Raton: CRC Press, pp. 43-78.], is a chemical warfare agent as well as a potential terrorism agent. SM-induced skin blistering is believed to be due to epidermal-dermal detachment as a result of epidermal basal cell death via apoptosis and/or necrosis. Regarding the role of apoptosis in SM pathology in animal skin, the results obtained in several laboratories, including ours, suggest the following: 1) cell death due to SM begins via apoptosis that proceeds to necrosis via an apoptotic-necrotic continuum and 2) inhibiting apoptosis decreases SM-induced microvesication in vivo. To study the mechanisms of SM-induced apoptosis and its prevention in vitro, we have established a convenient fluorometric apoptosis assay using monolayer human epidermal keratinocytes (HEK) adaptable for multiwell plates (24-, 96-, or 384-well) and high-throughput applications. This assay allows replication and multiple types of experimental manipulation in sister cultures so that the apoptotic mechanisms and the effects of test compounds can be compared statistically. SM affects diverse cellular mechanisms, including endoplasmic reticulum (ER) Ca2+ homeostasis, mitochondrial functions, energy metabolism, and death receptors, each of which can independently trigger apoptosis. However, the biochemical pathway in any of these apoptotic mechanisms is characterized by a pathway-specific sequence of caspases, among which caspase-3 is a key member. Therefore, we exposed 80-90% confluent HEK cultures to SM and monitored apoptosis by measuring the fluorescence generated due to hydrolysis of a fluorogenic caspase-3 substrate (acetyl- or benzyl oxycarbonyl

  8. RhoB protects human keratinocytes from UVB-induced apoptosis through epidermal growth factor receptor signaling.

    Science.gov (United States)

    Canguilhem, Bruno; Pradines, Anne; Baudouin, Caroline; Boby, Céline; Lajoie-Mazenc, Isabelle; Charveron, Marie; Favre, Gilles

    2005-12-30

    Exposure of the skin to UVB light results in the formation of DNA photolesions that can give rise to cell death, mutations, and the onset of carcinogenic events. Specific proteins are activated by UVB and then trigger signal transduction pathways that lead to cellular responses. An alteration of these signaling molecules is thought to be a fundamental event in tumor promotion by UVB irradiation. RhoB, encoding a small GTPase has been identified as a DNA damage-inducible gene. RhoB is involved in epidermal growth factor (EGF) receptor trafficking, cytoskeletal organization, cell transformation, and survival. We have analyzed the regulation of RhoB and elucidated its role in the cellular response of HaCaT keratinocytes to relevant environmental UVB irradiation. We report here that the activated GTP-bound form of RhoB is increased rapidly within 5 min of exposure to UVB, and then RhoB protein levels increased concomitantly with EGF receptor (EGFR) activation. Inhibition of UVB-induced EGFR activation prevents RhoB protein expression and AKT phosphorylation but not the early activation of RhoB. Blocking UVB-induced RhoB expression with specific small interfering RNAs inhibits AKT and glycogen synthase kinase-3beta phosphorylation through inhibition of EGFR expression. Moreover, down-regulation of RhoB potentiates UVB-induced cell apoptosis. In contrast, RhoB overexpression protects keratinocytes against UVB-induced apoptosis. These results indicated that RhoB is regulated upon UVB exposure by a two-step process consisting of an early EGFR-independent RhoB activation followed by an EGFR-dependent induction of RhoB expression. Moreover, we have demonstrated that RhoB is essential in regulating keratinocyte cell survival after UVB exposure, suggesting its potential role in photocarcinogenesis.

  9. Degradation of Epidermal Growth Factor Receptor Mediates Dasatinib-Induced Apoptosis in Head and Neck Squamous Cell Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Yu-Chin Lin

    2012-06-01

    Full Text Available Epidermal growth factor receptor (EGFR is an important oncoprotein that promotes cell growth and proliferation. Dasatinib, a bcr-abl inhibitor, has been approved clinically for the treatment of chronic myeloid leukemia and demonstrated to be effective against solid tumors in vitro through Src inhibition. Here, we disclose that EGFR degradation mediated dasatinib-induced apoptosis in head and neck squamous cell carcinoma (HNSCC cells. HNSCC cells, including Ca9-22, FaDu, HSC3, SAS, SCC-25, and UMSCC1, were treated with dasatinib, and cell viability, apoptosis, and underlying signal transduction were evaluated. Dasatinib exhibited differential sensitivities against HNSCC cells. Growth inhibition and apoptosis were correlated with its inhibition on Akt, Erk, and Bcl-2, irrespective of Src inhibition. Accordingly, we found that down-regulation of EGFR was a determinant of dasatinib sensitivity. Lysosome inhibitor reversed dasatinib-induced EGFR down-regulation, and c-cbl activity was increased by dasatinib, indicating that dasatinib-induced EGFR down-regulation might be through c-cbl-mediated lysosome degradation. Increased EGFR activation by ligand administration rescued cells from dasatinib-induced apoptosis, whereas inhibition of EGFR enhanced its apoptotic effect. Estrogen receptor α (ERα was demonstrated to play a role in Bcl-2 expression, and dasatinib inhibited ERα at the pretranslational level. ERα was associated with EGFR in dasatinib-treated HNSCC cells. Furthermore, the xenograft model showed that dasatinib inhibited HSC3 tumor growth through in vivo down-regulation of EGFR and ERα. In conclusion, degradation of EGFR is a novel mechanism responsible for dasatinib-induced apoptosis in HNSCC cells.

  10. Gene silencing for epidermal growth factor receptor variant III induces cell-specific cytotoxicity.

    Science.gov (United States)

    Yamoutpour, Farnaz; Bodempudi, Vidya; Park, Shay E; Pan, Weihong; Mauzy, Mary Jean; Kratzke, Robert A; Dudek, Arkadiusz; Potter, David A; Woo, Richard A; O'Rourke, Donald M; Tindall, Donald J; Farassati, Faris

    2008-11-01

    Epidermal growth factor receptor variant III (EGFRvIII) is a constitutively active mutant form of EGFR that is expressed in 40% to 50% of gliomas and several other malignancies. Here, we describe the therapeutic effects of silencing EGFRvIII on glioma cell lines in vitro and in vivo. A small interfering RNA molecule against EGFRvIII was introduced into EGFRvIII-expressing glioma cells (U87Delta) by electroporation resulting in complete inhibition of expression of EGFRvIII as early as 48 h post-treatment. During EGFRvIII silencing, a decrease in the proliferation and invasiveness of U87Delta cells was accompanied by an increase in apoptosis (P < 0.05). Notably, EGFRvIII silencing inhibited the signal transduction machinery downstream of EGFRvIII as evidenced by decreases in the activated levels of Ras and extracellular signal-regulated kinase. A lentivirus capable of expressing anti-EGFRvIII short hairpin RNA was also able to achieve progressive silencing of EGFRvIII in U87Delta cells in addition to inhibiting cell proliferation, invasiveness, and colony formation in a significant manner (P < 0.05). Silencing EGFRvIII in U87Delta cultures with this virus reduced the expression of factors involved in epithelial-mesenchymal transition including N-cadherin, beta-catenin, Snail, Slug, and paxillin but not E-cadherin. The anti-EGFRvIII lentivirus also affected the cell cycle progression of U87Delta cells with a decrease in G(1) and increase in S and G(2) fractions. In an in vivo model, tumor growth was completely inhibited in severe combined immunodeficient mice (n = 10) injected s.c. with U87Delta cells treated with the anti-EGFRvIII lentivirus (P = 0.005). We conclude that gene specific silencing of EGFRvIII is a promising strategy for treating cancers that contain this mutated receptor.

  11. Calcium-calmodulin signalling is involved in light-induced acidification by epidermal leaf cells of pea, Pisum sativum L.

    NARCIS (Netherlands)

    Elzenga, JTM; Staal, M; Prins, HBA

    1997-01-01

    Pathways of signal transduction of red and blue light-dependent acidification by leaf epidermal cells were studied using epidermal strips of the Argenteum mutant of Pisum sativum. In these preparations the contribution of guard cells to the acidification is minimal. The hydroxypyridine nifedipine, a

  12. Japanese Cedar (Cryptomeria japonica) pollen allergen induces elevation of intracellular calcium in human keratinocytes and impairs epidermal barrier function of human skin ex vivo.

    Science.gov (United States)

    Kumamoto, Junichi; Tsutsumi, Moe; Goto, Makiko; Nagayama, Masaharu; Denda, Mitsuhiro

    2016-01-01

    Cry j1 is the major peptide allergen of Japanese cedar (Sugi), Cryptomeria japonica. Since some allergens disrupt epidermal permeability barrier homeostasis, we hypothesized that Cry j1 might have a similar effect. Intracellular calcium level in cultured human keratinocytes was measured with a ratiometric fluorescent probe, Fura-2 AM. Application of Cry j1 significantly increased the intracellular calcium level of keratinocytes, and this increase was inhibited by trypsin inhibitor or a protease-activated receptor 2 (PAR-2) antagonist. We found that Cry j1 itself did not show protease activity, but application of Cry j1 to cultured keratinocytes induced a rapid (within 30 s) and transient increase of protease activity in the medium. This transient increase was blocked by trypsin inhibitor or PAR-2 antagonist. The effect of Cry j1 on transepidermal water loss (TEWL) of cultured human skin was measured in the presence and absence of a trypsin inhibitor and PAR-2 antagonist. Cry j1 significantly impaired the barrier function of human skin ex vivo, and this action was blocked by co-application of trypsin inhibitor or PAR-2 antagonist. Our results suggested that interaction of Cry j1 with epidermal keratinocytes leads to the activation of PAR-2, which induces elevation of intracellular calcium and disruption of barrier function. Blocking the interaction of Cry j1 with epidermal keratinocytes might ameliorate allergic reaction and prevent disruption of epidermal permeability barrier homeostasis.

  13. Randomization of cortical microtubules in root epidermal cells induces root hair initiation in lettuce (Lactuca sativa L.) seedlings.

    Science.gov (United States)

    Takahashi, Hidenori; Hirota, Kayoko; Kawahara, Aiko; Hayakawa, Erika; Inoue, Yasunori

    2003-03-01

    Root hair formation is induced when lettuce seedlings are transferred from liquid medium at pH 6.0 to fresh medium at pH 4.0. If seedlings are transferred to pH 6.0, no root hairs are formed. We investigated the role of microtubules in this low pH-induced root hair initiation in lettuce. At the hair-forming zone in root epidermal cells, microtubules were perpendicular to the longitudinal axis of the cell just after pre-culture. This arrangement became disordered as early as 5 min after transfer to pH 4.0, and became random by 30 min later. At pH 4.0, the randomization extended to the entire hair-forming zone of seedlings; at pH 6.0, however, randomization did not occur and transverse microtubules were maintained. When seedlings at pH 6.0 were treated with microtubule-depolymerizing drugs, root hairs were formed. In contrast, when a microtubule-stabilizing drug, taxol, was added to the medium, no root hairs formed, even at pH 4.0. These results suggest that the transverse cortical microtubules inhibit root hair formation, and that their destruction is necessary for initiation. Furthermore, the microfilament-disrupting drugs cytochalasin B and latrunculin B inhibited root hair initiation, suggesting that actin filaments are necessary for root hair initiation.

  14. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  15. Occurrence of mutations in the epidermal growth factor receptor gene in X-ray-induced rat lung tumors

    International Nuclear Information System (INIS)

    Kitahashi, Tsukasa; Takahashi, Mami; Yamada, Yutaka

    2008-01-01

    Epidermal growth factor receptor (EGFR) gene alterations have been found in human lung cancers. However, there is no information on the factors inducing EGFR mutations. In rodents, K-ras mutations are frequently found in many lung carcinogenesis models, but hitherto, Egfr mutations have not been reported. Their presence was therefore investigated in representative lung carcinogenesis models with 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), N-nitrosobis(2-hydroxypropyl)amine (BHP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MelQx) and ethyl carbamate (urethane), as well as X-ray irradiation. With the chemical carcinogenesis models, no mutations were detected in Egfr, which is in clear contrast to the high rates observed in either codon 12 or 61 of K-ras (21/23 of the lung tumors induced with NNK, 4/5 with MelQx, 1/4 with urethane and 7/18 with BHP). However, in the X-ray-induced lung tumors, Egfr mutations with amino acid substitution were observed in exons 18 and 21 (4/12, 33%), but no activating mutation of K-ras was detected. In addition, one and four silent mutations were identified in K-ras (exon 1) and Egfr (exons 18, 20 and 21), respectively. Most mutations in both Egfr and K-ras were G/C→A/T transitions (7/8, 88% and 31/34, 91%, respectively). Although, the mutational patterns in equivalent human lesions were not completely coincident, this first report of Egfr mutations in an experimental lung tumor model suggests that X-rays or other factors producing oxygen radicals could cause EGFR mutations in some proportion of lung cancers in humans. (author)

  16. Expression of hypoxia-inducible factor-1 by trophectoderm cells in response to hypoxia and epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Wooyoung [Department of Animal Resources Science, Dankook University, Cheonan (Korea, Republic of); Bazer, Fuller W. [Center for Animal Biotechnology and Genomics and Department of Animal Science, Texas A& M University, College Station, TX (United States); Song, Gwonhwa, E-mail: ghsong@korea.ac.kr [Department of Biotechnology, College of Life Sciences and Biotechnology, Korea University, Seoul (Korea, Republic of); Kim, Jinyoung, E-mail: jinyoungkim@dankook.ac.kr [Department of Animal Resources Science, Dankook University, Cheonan (Korea, Republic of)

    2016-01-08

    The low oxygen environment in the uterine environment requires pre-implantation embryos to adapt to oxygen deficiency. Hypoxia-inducible factor (HIF)-1 is a master regulator whereby cells adapt to changes in oxygen concentrations. In addition to hypoxic conditions, non-hypoxic stimuli such as growth factors also activate expression of HIF-1. In this study, the mechanisms underlying low oxygen-dependent and epidermal growth factor (EGF)-dependent expression of HIF-1α were explored using porcine trophectoderm (pTr) cells. The results indicated that expression of HIF-1α and HIF-1β mRNAs was not affected by low concentrations of oxygen; however, hypoxic conditions markedly increased the abundance of HIF-1α protein, especially in nuclei of pTr cells. Even under normoxic conditions, the abundance of HIF-1α protein increased in response to EGF. This EGF-mediated increase in HIF-1α protein was blocked through inhibition of translation by cycloheximide. The inhibitors LY294002 (PI3K-AKT inhibitor), U0126 (inhibitor of ERK1/2) and rapamycin (mTOR inhibitor) also blocked the ability of EGF to increase HIF-1α protein and to phosphorylate AKT, ERK1/2 and mTOR proteins. Both hypoxia and EGF induced proliferation of pTr cells. This ability of EGF to stimulate proliferation of pTr cells was suppressed by EGFR siRNA, but not HIF-1α siRNA, but a significant decrease in EGF-induced HIF-1α protein occurred when pTr cells were transfected with HIF-1α siRNA. The results of the present study suggest that pTr cells adapt to oxygen deficiency and proliferate in response to an oxygen-dependent HIF-1 system, and that EGF at maternal–conceptus interface can increase the abundance of HIF-1α protein via translational regulation through AKT, ERK1/2 and mTOR signaling cascades. - Highlights: • HIF-1α expression is up-regulated in pTr cells under low oxygen concentrations. • EGF induces HIF-1α accumulation in pTr cells. • EGF-induced HIF-1α accumulation is blocked by de

  17. Expression of hypoxia-inducible factor-1 by trophectoderm cells in response to hypoxia and epidermal growth factor

    International Nuclear Information System (INIS)

    Jeong, Wooyoung; Bazer, Fuller W.; Song, Gwonhwa; Kim, Jinyoung

    2016-01-01

    The low oxygen environment in the uterine environment requires pre-implantation embryos to adapt to oxygen deficiency. Hypoxia-inducible factor (HIF)-1 is a master regulator whereby cells adapt to changes in oxygen concentrations. In addition to hypoxic conditions, non-hypoxic stimuli such as growth factors also activate expression of HIF-1. In this study, the mechanisms underlying low oxygen-dependent and epidermal growth factor (EGF)-dependent expression of HIF-1α were explored using porcine trophectoderm (pTr) cells. The results indicated that expression of HIF-1α and HIF-1β mRNAs was not affected by low concentrations of oxygen; however, hypoxic conditions markedly increased the abundance of HIF-1α protein, especially in nuclei of pTr cells. Even under normoxic conditions, the abundance of HIF-1α protein increased in response to EGF. This EGF-mediated increase in HIF-1α protein was blocked through inhibition of translation by cycloheximide. The inhibitors LY294002 (PI3K-AKT inhibitor), U0126 (inhibitor of ERK1/2) and rapamycin (mTOR inhibitor) also blocked the ability of EGF to increase HIF-1α protein and to phosphorylate AKT, ERK1/2 and mTOR proteins. Both hypoxia and EGF induced proliferation of pTr cells. This ability of EGF to stimulate proliferation of pTr cells was suppressed by EGFR siRNA, but not HIF-1α siRNA, but a significant decrease in EGF-induced HIF-1α protein occurred when pTr cells were transfected with HIF-1α siRNA. The results of the present study suggest that pTr cells adapt to oxygen deficiency and proliferate in response to an oxygen-dependent HIF-1 system, and that EGF at maternal–conceptus interface can increase the abundance of HIF-1α protein via translational regulation through AKT, ERK1/2 and mTOR signaling cascades. - Highlights: • HIF-1α expression is up-regulated in pTr cells under low oxygen concentrations. • EGF induces HIF-1α accumulation in pTr cells. • EGF-induced HIF-1α accumulation is blocked by de

  18. Inhibitory effects of omega-3 fatty acids on injury-induced epidermal growth factor receptor transactivation contribute to delayed wound healing

    OpenAIRE

    Turk, Harmony F.; Monk, Jennifer M.; Fan, Yang-Yi; Callaway, Evelyn S.; Weeks, Brad; Chapkin, Robert S.

    2013-01-01

    Epidermal growth factor receptor (EGFR)-mediated signaling is required for optimal intestinal wound healing. Since n-3 polyunsaturated fatty acids (PUFA), specifically docosahexaenoic acid (DHA), alter EGFR signaling and suppress downstream activation of key signaling pathways, we hypothesized that DHA would be detrimental to the process of intestinal wound healing. Using a mouse immortalized colonocyte model, DHA uniquely reduced EGFR ligand-induced receptor activation, whereas DHA and its m...

  19. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... clustering has a functional significance. Our results ar in accordance with previous findings from in vitro studies, and suggest that Fas is activated in vivo in human epidermis after UVB exposure....

  20. Parathyroid-specific epidermal growth factor-receptor inactivation prevents uremia-induced parathyroid hyperplasia in mice.

    Science.gov (United States)

    Arcidiacono, Maria Vittoria; Yang, Jing; Fernandez, Elvira; Dusso, Adriana

    2015-03-01

    In chronic kidney disease (CKD), parathyroid hyperplasia contributes to high serum parathyroid hormone (PTH) and also to an impaired suppression of secondary hyperparathyroidism by calcium, vitamin D and fibroblast growth factor 23 (FGF23). In rats, systemic inhibition of epidermal growth factor receptor (EGFR) activation markedly attenuated uremia-induced parathyroid hyperplasia and vitamin D receptor (VDR) loss, hence restoring the response to vitamin D. Therefore, we propose that parathyroid-specific EGFR inactivation should prevent CKD-induced parathyroid hyperplasia. A dominant-negative human EGFR mutant, which forms non-functional heterodimers with full-length endogenous EGFR, was successfully targeted to the parathyroid glands (PTGs) of FVB/N mice, using the 5' regulatory sequence of the PTH promoter. The parathyroid phenotype and serum chemistries of wild-type (WT) and transgenic mice were examined after 14 weeks of either sham operation or 75% renal mass reduction (NX). Both genotypes had similar morphology and body weight, and NX-induction enhanced similarly serum blood urea nitrogen compared with sham-operated controls. However, despite similar serum calcium, phosphate and FGF23 levels in NX mice of both genotypes, parathyroid EGFR inactivation sufficed to completely prevent the marked increases in PTG enlargement, serum PTH and in parathyroid levels of transforming growth factor-α, a powerful EGFR-activator, and the VDR reductions observed in WT mice. In CKD, parathyroid EGFR activation is essential for parathyroid hyperplasia and VDR loss, rendering this transgenic mouse a unique tool to scrutinize the pathogenesis of parathyroid and multiple organ dysfunction of CKD progression unrelated to parathyroid hyperplasia. © The Author 2014. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  1. Parathyroid-specific epidermal growth factor-receptor inactivation prevents uremia-induced parathyroid hyperplasia in mice

    Science.gov (United States)

    Arcidiacono, Maria Vittoria; Yang, Jing; Fernandez, Elvira; Dusso, Adriana

    2015-01-01

    Background In chronic kidney disease (CKD), parathyroid hyperplasia contributes to high serum parathyroid hormone (PTH) and also to an impaired suppression of secondary hyperparathyroidism by calcium, vitamin D and fibroblast growth factor 23 (FGF23). In rats, systemic inhibition of epidermal growth factor receptor (EGFR) activation markedly attenuated uremia-induced parathyroid hyperplasia and vitamin D receptor (VDR) loss, hence restoring the response to vitamin D. Therefore, we propose that parathyroid-specific EGFR inactivation should prevent CKD-induced parathyroid hyperplasia. Methods A dominant-negative human EGFR mutant, which forms non-functional heterodimers with full-length endogenous EGFR, was successfully targeted to the parathyroid glands (PTGs) of FVB/N mice, using the 5′ regulatory sequence of the PTH promoter. The parathyroid phenotype and serum chemistries of wild-type (WT) and transgenic mice were examined after 14 weeks of either sham operation or 75% renal mass reduction (NX). Results Both genotypes had similar morphology and body weight, and NX-induction enhanced similarly serum blood urea nitrogen compared with sham-operated controls. However, despite similar serum calcium, phosphate and FGF23 levels in NX mice of both genotypes, parathyroid EGFR inactivation sufficed to completely prevent the marked increases in PTG enlargement, serum PTH and in parathyroid levels of transforming growth factor-α, a powerful EGFR-activator, and the VDR reductions observed in WT mice. Conclusion In CKD, parathyroid EGFR activation is essential for parathyroid hyperplasia and VDR loss, rendering this transgenic mouse a unique tool to scrutinize the pathogenesis of parathyroid and multiple organ dysfunction of CKD progression unrelated to parathyroid hyperplasia. PMID:25324357

  2. Tacrolimus Reverses UVB Irradiation-Induced Epidermal Langerhans Cell Reduction by Inhibiting TNF-α Secretion in Keratinocytes via Regulation of NF-κB/p65

    Directory of Open Access Journals (Sweden)

    JiaLi Xu

    2018-02-01

    Full Text Available Background: Topical calcineurin inhibitors including tacrolimus and pimecrolimus are used in the treatment of many inflammatory skin diseases mainly via blocking T-cell proliferation. Our previous studies found that pimecrolimus 1% cream could reverse high-dose ultraviolet B (UVB irradiation-induced epidermal Langerhans cell (LC reduction via inhibition of LC migration. We conducted this study to investigate the effects of topical tacrolimus 0.03% ointment on high-dose UVB-irradiated human epidermal LCs.Methods: Twenty fresh human foreskin tissues were randomly divided into four groups as follows: Control, Tacrolimus (0.03%, UVB (180 mJ/cm2, and UVB (180 mJ/cm2 + Tacrolimus (0.03%. Four time points were set as follows: 0, 18, 24, and 48 h. We collected culture medium and tissues at each time point. The percentage of CD1a+ cells in the medium was detected by means of flow cytometry. Each tissue was prepared for immunohistochemistry, real-time quantitative PCR, and western blot. HaCaT cells were cultured and divided into four groups: Control, Tacrolimus (1 μg/ml, UVB (30 mJ/cm2, and UVB (30 mJ/cm2 + Tacrolimus (1 μg/ml. The cells were incubated for 24 h and prepared for real-time quantitative PCR and western blot.Results: Topical tacrolimus significantly reversed high-dose UVB irradiation-induced epidermal LC reduction and CD1a+ cell increment in culture medium. Tacrolimus significantly inhibited UVB irradiation-induced tumor necrosis factor-α (TNF-α and nuclear factor kappa B (NF-κB/p65 mRNA and protein expression in HaCaT cells. Tacrolimus also significantly inhibited high-dose UVB irradiation-induced TNF-α expression in cultured tissues. Finally, TNF-α antagonist (recombinant human TNF-α receptor II: IgG Fc fusion protein could significantly reverse UVB irradiation-induced epidermal LC reduction.Conclusion: Topical tacrolimus 0.03% could reverse UVB irradiation-induced epidermal LC reduction by inhibiting TNF-α secretion in

  3. Lactobacillus reuteri Protects Epidermal Keratinocytes from Staphylococcus aureus-Induced Cell Death by Competitive Exclusion

    Science.gov (United States)

    Prince, Tessa; McBain, Andrew J.

    2012-01-01

    Recent studies have suggested that the topical application of probiotic bacteria can improve skin health or combat disease. We have utilized a primary human keratinocyte culture model to investigate whether probiotic bacteria can inhibit Staphylococcus aureus infection. Evaluation of the candidate probiotics Lactobacillus reuteri ATCC 55730, Lactobacillus rhamnosus AC413, and Lactobacillus salivarius UCC118 demonstrated that both L. reuteri and L. rhamnosus, but not L. salivarius, reduced S. aureus-induced keratinocyte cell death in both undifferentiated and differentiated keratinocytes. Keratinocyte survival was significantly higher if the probiotic was applied prior to (P 0.05). The protective effect of L. reuteri was not dependent on the elaboration of inhibitory substances such as lactic acid. L. reuteri inhibited adherence of S. aureus to keratinocytes by competitive exclusion (P = 0.026). L. salivarius UCC118, however, did not inhibit S. aureus from adhering to keratinocytes (P > 0.05) and did not protect keratinocyte viability. S. aureus utilizes the α5β1 integrin to adhere to keratinocytes, and blocking of this integrin resulted in a protective effect similar to that observed with probiotics (P = 0.03). This suggests that the protective mechanism for L. reuteri-mediated protection of keratinocytes was by competitive exclusion of the pathogen from its binding sites on the cells. Our results suggest that use of a topical probiotic prophylactically could inhibit the colonization of skin by S. aureus and thus aid in the prevention of infection. PMID:22582077

  4. Gefitinib induces epidermal growth factor receptor dimers which alters the interaction characteristics with ¹²⁵I-EGF.

    Directory of Open Access Journals (Sweden)

    Hanna Björkelund

    Full Text Available The tyrosine kinase inhibitor gefitinib inhibits growth in some tumor types by targeting the epidermal growth factor receptor (EGFR. Previous studies show that the affinity of the EGF-EGFR interaction varies between hosting cell line, and that gefitinib increases the affinity for some cell lines. In this paper, we investigate possible mechanisms behind these observations. Real-time interaction analysis in LigandTracer® Grey revealed that the HER2 dimerization preventing antibody pertuzumab clearly modified the binding of ¹²⁵I-EGF to EGFR on HER2 overexpressing SKOV3 cells in the presence of gefitinib. Pertuzumab did not affect the binding on A431 cells, which express low levels of HER2. Cross-linking measurements showed that gefitinib increased the amount of EGFR dimers 3.0-3.8 times in A431 cells in the absence of EGF. In EGF stimulated SKOV3 cells the amount of EGFR dimers increased 1.8-2.2 times by gefitinib, but this effect was cancelled by pertuzumab. Gefitinib treatment did not alter the number of EGFR or HER2 expressed in tumor cell lines A431, U343, SKOV3 and SKBR3. Real-time binding traces were further analyzed in a novel tool, Interaction Map, which deciphered the different components of the measured interaction and supports EGF binding to multiple binding sites. EGFR and HER2 expression affect the levels of EGFR monomers, homodimers and heterodimers and EGF binds to the various monomeric/dimeric forms of EGFR with unique binding properties. Taken together, we conclude that dimerization explains the varying affinity of EGF-EGFR in different cells, and we propose that gefitinib induces EGFR dimmers, which alters the interaction characteristics with ¹²⁵I-EGF.

  5. Milk fat globule-epidermal growth factor-factor VIII attenuates sepsis-induced acute kidney injury.

    Science.gov (United States)

    Cen, Cindy; Aziz, Monowar; Yang, Weng-Lang; Zhou, Mian; Nicastro, Jeffrey M; Coppa, Gene F; Wang, Ping

    2017-06-01

    Acute kidney injury (AKI) is most commonly caused by sepsis in critically ill patients, and it is associated with high morbidity and mortality. The pathophysiology of sepsis-induced AKI is generally accepted to include direct inflammatory injury, endothelial cell dysfunction, and apoptosis. Milk fat globule-epidermal growth factor-factor VIII (MFG-E8) is a secretory glycoprotein with a known role in the enhancement of apoptotic cell clearance and regulation of inflammation. We hypothesize that administration of recombinant mouse MFG-E8 (rmMFG-E8) can protect mice from kidney injuries caused by sepsis. Sepsis was induced in 8-wk-old male C57BL/6 mice by cecal ligation and puncture (CLP). rmMFG-E8 or phosphate-buffered saline (vehicle) was injected intravenously at a dosage of 20 μg/kg body weight at time of CLP (n = 5-8 mice per group). After 20 h, serum and renal tissue were harvested for various analyses. The renal injury markers blood urea nitrogen (BUN) and creatinine were determined by enzymatic and chemical reactions, respectively. The gene expression analysis was carried out by real-time quantitative polymerase chain reaction. At 20 h after CLP, serum levels of BUN and creatinine were both significantly increased in the vehicle group compared with the sham group, whereas the mice treated with rmMFG-E8 had a significant reduction in BUN and creatinine levels by 28% and 24.1%, respectively (BUN: 197.7 ± 23.6 versus 142.3 ± 20.7 mg/dL; creatinine: 0.83 ± 0.12 versus 0.63 ± 0.06 mg/dL; P sepsis through inhibiting the production of proinflammatory cytokines and chemokine, as well as through the activation of endothelial cells. Thus, MFG-E8 may have a therapeutic potential for treating AKI induced by sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Association of HLA-BFNx011502 allele and carbamazepine-induced Stevens-Johnson syndrome among Indians

    Directory of Open Access Journals (Sweden)

    Mehta Timir

    2009-01-01

    Full Text Available Background: Stevens-Johnson Syndrome (SJS and toxic epidermal necrolysis are severe cutaneous reactions caused by certain drugs, including antiepileptic carbamazepine. A strong association has been reported between human leucocyte antigen (HLA-BFNx011502 and carbamazepine-induced SJS in Han Chinese patients. European studies suggested that HLA-BFNx011502 is not a universal marker but is ethnicity-specific for Asians. Aim: To study the association between HLA-BFNx011502 and carbamazepine-induced SJS in Indian patients. Methods: Eight individuals who fulfilled the diagnostic criteria of SJS induced by carbamazepine were identified and HLA-B molecular typing was performed. HLA-B genotyping was carried out by polymerase chain reaction using sequence-specific primers. Results: Out of eight patients studied for genotype, six patients were found to have the HLA-BFNx011502 allele. Conclusion: This study suggests an association between HLA-BFNx011502 and carbamazepine-induced SJS in Indian patients.

  7. Effects of the expression level of epidermal growth factor receptor on the ligand-induced restructuring of focal adhesions: a QCM-D study.

    Science.gov (United States)

    Garcia, Marcela P; Shahid, Ammar; Chen, Jennifer Y; Xi, Jun

    2013-02-01

    Epidermal growth factor receptor (EGFR) plays a major role in cell migration and invasion and is considered to be the primary source of activation of various malignant tumors. To gain insight into how elevated levels of EGFR influence cellular function, particularly cell motility, we used a quartz crystal microbalance with dissipation monitoring (QCM-D) to examine restructuring of focal adhesions in MCF-10A cells induced by epidermal growth factor. Engineered cells that overexpress epidermal growth factor receptor (EGFR) exhibited a very different kinetic profile from wildtype MCF-10A cells that have a lower level of EGFR with a higher rate for the initial disassembly of focal adhesion and a much lower rate for the later reassembly of focal adhesions. It is conceivable that these effects exhibited by EGFR-overexpressing cells may promote the initiation and maintenance of a more favorable adhesion state for cell migration. This study has demonstrated the capability of the dissipation monitoring function of the QCM-D to quantitatively assess kinetic aspects of cellular processes with a high temporal resolution and sensitivity.

  8. Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

    NARCIS (Netherlands)

    Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

    2000-01-01

    Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

  9. Antibody-induced activation of the epidermal growth factor receptor tyrosine kinase requires the presence of detergent

    NARCIS (Netherlands)

    Spaargaren, M.; Defize, L. H.; de Laat, S. W.; Boonstra, J.

    1990-01-01

    Activation of the epidermal growth factor receptor (EGF-R) tyrosine kinase was investigated in membrane preparations as well as intact A431 cells, using anti-EGF-R antibodies directed against extra- and intracellular receptor domains. In vitro assay conditions were mimicked on whole cells by a mild

  10. Are steroids effective in toxic epidermal necrolysis and Stevens-Johnson syndrome?

    Directory of Open Access Journals (Sweden)

    Rodrigo Meza

    2017-06-01

    Full Text Available Resumen La necrólisis epidérmica tóxica y el síndrome de Stevens-Johnson son reacciones cutáneas adversas graves a medicamentos e infecciones. Los corticoides se describen como una alternativa terapéutica, sin embargo, su uso es aún controvertido. Utilizando la base de datos Epistemonikos, la cual es mantenida mediante búsquedas en múltiples bases de datos, identificamos cuatro revisiones sistemáticas que en conjunto incluyen once estudios primarios que responden la pregunta de interés. Extrajimos los datos y preparamos una tabla de resumen de los resultados utilizando el método GRADE. Concluimos que no está claro si los corticoides disminuyen la mortalidad o la estadía hospitalaria en la necrólisis epidérmica tóxica y el síndrome de Stevens-Johnson porque la certeza de la evidencia es muy baja.

  11. Neural cell adhesion molecule-180-mediated homophilic binding induces epidermal growth factor receptor (EGFR) down-regulation and uncouples the inhibitory function of EGFR in neurite outgrowth

    DEFF Research Database (Denmark)

    Povlsen, Gro Klitgaard; Berezin, Vladimir; Bock, Elisabeth

    2008-01-01

    The neural cell adhesion molecule (NCAM) plays important roles in neuronal development, regeneration, and synaptic plasticity. NCAM homophilic binding mediates cell adhesion and induces intracellular signals, in which the fibroblast growth factor receptor plays a prominent role. Recent studies...... on axon guidance in Drosophila suggest that NCAM also regulates the epidermal growth factor receptor (EGFR) (Molecular and Cellular Neuroscience, 28, 2005, 141). A possible interaction between NCAM and EGFR in mammalian cells has not been investigated. The present study demonstrates for the first time...

  12. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  13. Selective Killing Effects of Cold Atmospheric Pressure Plasma with NO Induced Dysfunction of Epidermal Growth Factor Receptor in Oral Squamous Cell Carcinoma.

    Directory of Open Access Journals (Sweden)

    Jung-Hwan Lee

    Full Text Available The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP-induced radicals on the epidermal growth factor receptor (EGFR, which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.

  14. Dapsone-induced severe cutaneous adverse drug reactions are strongly linked with HLA-B*13: 01 allele in the Thai population.

    Science.gov (United States)

    Tempark, Therdpong; Satapornpong, Patompong; Rerknimitr, Pawinee; Nakkam, Nontaya; Saksit, Niwat; Wattanakrai, Penpun; Jantararoungtong, Thawinee; Koomdee, Napatrupron; Mahakkanukrauh, Ajanee; Tassaneeyakul, Wichittra; Suttisai, Sumitra; Pratoomwun, Jirawat; Klaewsongkram, Jettanong; Rerkpattanapipat, Ticha; Sukasem, Chonlaphat

    2017-12-01

    A previous publication in Chinese leprosy patients showed that the HLA-B*13:01 allele is a strong genetic marker for dapsone-induced drug hypersensitivity reactions, however there are no data describing whether HLA-B*13:01 is a valid marker for prediction of dapsone-induced drug hypersensitivity reactions in other ethnicities or nonleprosy patients. The aim of this study is to investigate whether there is an association between HLA genotypes and dapsone-induced severe cutaneous adverse reactions (SCARs) in Thai nonleprosy patients. HLA-B genotypes of 15 patients with dapsone-induced SCARs (11 drug reaction with eosinophilia and systemic symptoms, 4 Stevens-Johnson syndrome/toxic epidermal necrolysis), 29 control patients, and 986 subjects from the general Thai population were determined by the reverse PCR sequence-specific oligonucleotides probe. The HLA-B*13:01 allele was significantly associated with dapsone-induced SCARs compared with dapsone-tolerant controls (odds ratio: 54.00, 95% confidence interval: 7.96-366.16, P=0.0001) and the general population (odds ratio: 26.11, 95% confidence interval: 7.27-93.75, P=0.0001). In addition, HLA-B*13:01 associated with dapsone-induced SJS-TEN (OR: 40.50, 95% confidence interval: 2.78-591.01, P=0.0070) and DRESS (OR: 60.75, 95% confidence interval: 7.44-496.18, P=0.0001). This study demonstrated an association between HLA-B*13:01 and dapsone-induced SCARs including Stevens-Johnson syndrome/toxic epidermal necrolysis and drug reaction with eosinophilia and systemic symptoms in nonleprosy patients. Moreover, these results suggest that the HLA-B*13:01 allele may be a useful genetic marker for prediction of dapsone-induced SCARs in Thai and Han-Chinese populations.

  15. The role of peroxisome proliferator-activated receptor-β/δ in epidermal growth factor-induced HaCaT cell proliferation

    International Nuclear Information System (INIS)

    Liang Pengfei; Jiang Bimei; Yang Xinghua; Xiao Xianzhong; Huang Xu; Long Jianhong; Zhang Pihong; Zhang Minghua; Xiao Muzhang; Xie Tinghong; Huang Xiaoyuan

    2008-01-01

    Epidermal growth factor (EGF) has been shown to be a potent mitogen for epidermal cells both in vitro and in vivo, thus contributing to the development of an organism. It has recently become clear that peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) expression and activation is involved in the cell proliferation. However, little is known about the role of PPARβ/δ in EGF-induced proliferation of HaCaT keratinocytes. In this study, HaCaT cells were cultured in the presence and absence of EGF and we identified that EGF induced an increase of PPARβ/δ mRNA and protein level expression in time-dependent and dose-dependent manner, and AG1487, an EGF receptor (EGFR) special inhibitor, caused attenuation of PPARβ/δ protein expression. Electrophoretic mobility shift assay (EMSA) revealed that EGF significantly increased PPARβ/δ binding activity in HaCaT keratinocytes. Antisense phosphorothioate oligonucleotides (asODNs) against PPARβ/δ caused selectively inhibition of PPARβ/δ protein content induced by EGF and significantly attenuated EGF-mediated cell proliferation. Treatment of the cells with L165041, a specific synthetic ligand for PPARβ/δ, significantly enhanced EGF-mediated cell proliferation. Finally, c-Jun ablation inhibited PPARβ/δ up-regulation induced by EGF, and chromatin immunoprecipitation (ChIP) showed that c-Jun bound to the PPARβ/δ promoter and the binding increased in EGF-stimulated cells. These results demonstrate that EGF induces PPARβ/δ expression in a c-Jun-dependent manner and PPARβ/δ plays a vital role in EGF-stimulated proliferation of HaCaT cells

  16. Mitigation of epidermal growth factor receptor inhibitor-induced side effects utilizing melanin and vascular-specific lasers: A case report series.

    Science.gov (United States)

    Kuo, Karen Y; Kwong, Bernice; Rahman, Zakia

    2017-10-01

    The advent of targeted chemotherapy has led to the emergence of new dermatologic toxicities. We sought to use lasers and light devices to treat recalcitrant cutaneous adverse effects related to cancer treatment. Three stage III or IV cancer patients with cutaneous complications due to epidermal growth factor receptor (EGFR) inhibitors were treated with melanin and vascular-specific laser and light technologies. Two patients reported reduction in papulopustular eruption following pulse dye laser (PDL) treatment. Two patients noted reduction in hair growth following intense pulsed light (IPL) and/or Alexandrite laser treatments. One patient was treated with both the PDL and IPL and reported improvement of both EGFR-induced hypertrichosis and papulopustular eruption. Laser and light devices targeting melanin and hemoglobin can be utilized to mitigate the cutaneous adverse effects associated with EGFR inhibitors in patients who have failed traditional therapies. This represents a new option for the cancer patient who is suffering from chemotherapy-induced side effects.

  17. Altered secretion and processing of epidermal growth factor in adrenergic-induced growth of the rat submandibular gland

    DEFF Research Database (Denmark)

    Thulesen, Jesper; Bor, Mustafa Vakur; Thulesen, Stina

    2002-01-01

    The granular convoluted tubule (GCT) cells of the submandibular glands represent a major production site for epidermal growth factor (EGF). This study investigates EGF production in the submandibular glands in relation to beta-adrenergic stimulation. Rats were treated with isoproterenol (beta......-immunoreactive cells. Concomitantly, the glandular contents of 6-kDa EGF decreased from 12.86+/-3.42 nmol/gland (mean+/-S.E.M.) in controls to 0.26+/-0.03 nmol/gland. EGF mRNA levels, expressed relative to total RNA levels, only tended to be reduced after 3 weeks as judged from RT-PCR and in situ hybridization (ISH...

  18. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  19. Proteomic assessment of sulfur mustard-induced protein adducts and other protein modifications in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Mol, Marijke A.E.; Berg, Roland M. van den; Benschop, Henk P.

    2008-01-01

    Although some toxicological mechanisms of sulfur mustard (HD) have been uncovered, new knowledge will allow for advanced insight in the pathways that lead towards epidermal-dermal separation in skin. In the present investigation, we aimed to survey events that occur at the protein level in human epidermal keratinocytes (HEK) during 24 h after exposure to HD. By using radiolabeled 14 C-HD, it was found that proteins in cultured HEK are significant targets for alkylation by HD. HD-adducted proteins were visualized by two-dimensional gel electrophoresis and analyzed by mass spectrometry. Several type I and II cytokeratins, actin, stratifin (14-3-3σ) and galectin-7 were identified. These proteins are involved in the maintenance of the cellular cytoskeleton. Their alkylation may cause changes in the cellular architecture and, in direct line with that, be determinative for the onset of vesication. Furthermore, differential proteomic analysis was applied to search for novel features of the cellular response to HD. Partial breakdown of type I cytokeratins K14, K16 and K17 as well as the emergence of new charge variants of the proteins heat shock protein 27 and ribosomal protein P0 were observed. Studies with caspase inhibitors showed that caspase-6 is probably responsible for the breakdown of type I cytokeratins in HEK. The significance of the results is discussed in terms of toxicological relevance and possible clues for therapeutic intervention

  20. Drug-induced Liver Injury is Frequently Associated with Severe Cutaneous Adverse Drug Reactions: Experience from Two Australian Tertiary Hospitals.

    Science.gov (United States)

    Fang, Wendy C; Adler, Nikki R; Graudins, Linda V; Goldblatt, Caitlin; Goh, Michelle Sy; Roberts, Stuart K; Trubiano, Jason A; Aung, Ar Kar

    2018-01-08

    Drug-induced liver injury can be associated with certain cutaneous adverse drug reactions. We aim to demonstrate the prevalence of drug-induced liver injury in patients with cutaneous adverse drug reactions. Severity and patterns of liver injury, risk factors, causal medications and outcomes are also examined. A retrospective cohort study of patients with cutaneous adverse drug reactions was conducted across two hospitals in Australia. Patients were identified through cross-linkage of multiple databases. 104 patients with cutaneous adverse drug reactions were identified. Of these, 33 (31.7%) had liver injury, representing 50% of patients with drug reaction with eosinophilia and systemic symptoms, and 30.2% of patients with Stevens-Johnson syndrome/toxic epidermal necrolysis. Most cases of liver injury (69.7%) were of a cholestatic/mixed pattern with severe disease in 18.2%. No significant risk factors for development of liver injury were noted, but peripheral lymphocytosis may represent a risk in patients with Stevens-Johnson syndrome (OR=6.0, 95% CI:1.8-19.7, p=0.003). Antimicrobials were the most common class to be implicated in drug-induced liver injury. The median length of inpatient stay was longer in patients with liver injury compared to those without (19 vs. 11 days, p=0.002). The mortality rate in those with liver injury was 15.2% and 9.9% in those without. No patients required liver transplantation. Drug-induced liver injury commonly occurs in patients with cutaneous adverse drug reactions and is associated with longer inpatient stay. Patients with Stevens-Johnson/toxic epidermal necrolysis and peripheral lymphocytosis appear to be at higher risk for developing associated liver injury. This article is protected by copyright. All rights reserved.

  1. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  2. Early Onset Dapsone-induced Photosensitive Dermatitis: A Rare Side Effect of a Common Drug.

    Science.gov (United States)

    Karjigi, S; Murthy, S C; Kallappa, H; Kusuma, M R; Reddy, Y N K

    2015-01-01

    Dapsone, a potent anti-inflammatory compound, is mainly used in the treatment of leprosy, dermatitis herpetiformis, erythema elevatum diutinum and other dermatoses. Cutaneous adverse reactions range from acneiform eruptions to toxic epidermal necrolysis. A 30-year-old, married women who was treated with paucibacillary multi drug therapy, developed itchy skin lesions over the both forearms, 'V ' area of the neck and upper back after one week of the drug administration which worsened on exposure to sunlights. A clinical diagnosis of dapsone-induced photosensitive dermatitis was confirmed by histopathology and recurrence of symptoms and signs after re-exposure to the drug. Photosensitivity due to dapsone is rare and very few reports are available in the literature. Our patient had an unusually early onset compared to the previously reported cases.

  3. Lamotrigine Induced Whole Body Tics: A Case Report and Literature Review.

    Science.gov (United States)

    Centorino, Michael B; Catalano, Glenn; Catalano, Maria C

    2016-01-01

    Lamotrigine is an anticonvulsant medication that also has utility in the treatment of bipolar disorder. It has been associated with many side effects, including rashes that can progress to Stevens-Johnson syndrome or toxic epidermal necrolysis. It has also been associated with the development of motor tics, most commonly in the head, neck, and shoulders. We will now present the case of a 45-year-old woman who developed tics that involved the entire left side of her body after her dose of lamotrigine was increased from 200 mg daily (2.0 mg/kg/day) to 225 mg daily (2.3 mg/kg/day). We will review the prior cases of lamotrigine induced tics, and compare them to the circumstances surrounding our patient. We will also discuss the neurobiology of tics and make suggestions to improve the tics, based on the reported cases.

  4. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  5. Substance P restores normal skin architecture and reduces epidermal infiltration of sensory nerve fiber in TNCB-induced atopic dermatitis-like lesions in NC/Nga mice.

    Science.gov (United States)

    Choi, Hyeongwon; Kim, Dong-Jin; Nam, Seungwoo; Lim, Sunki; Hwang, Jae-Sung; Park, Ki Sook; Hong, Hyun Sook; Won, Younsun; Shin, Min Kyung; Chung, Eunkyung; Son, Youngsook

    2018-03-01

    Atopic dermatitis (AD) is a chronic inflammatory skin disorder characterized by intense pruritus and eczematous lesion. Substance P (SP) is an 11-amino-acid endogenous neuropeptide that belongs to the tachykinin family and several reports recently have supported the anti-inflammatory and tissue repairing roles of SP. In this study, we investigated whether SP can improve AD symptoms, especially the impaired skin barrier function, in 2, 4, 6-trinitrochlorobenzene (TNCB)-induced chronic dermatitis of NC/Nga mice or not. AD-like dermatitis was induced in NC/Nga mice by repeated sensitization with TNCB for 5 weeks. The experimental group designations and topical treatments were as follows: vehicle group (AD-VE); SP group (AD-SP); and SP with NK1R antagonist CP99994 (AD-SP-A) group. Histological analysis was performed to evaluate epidermal differentiation, dermal integrity, and epidermal nerve innervation in AD-like lesions. The skin barrier functions and pruritus of NC/Nga mice were evaluated by measuring transepidermal water loss (TEWL) and scratching behavior, respectively. Topical SP treatment resulted in significant down-regulation of Ki67 and the abnormal-type keratins (K) K6, K16, and K17, restoration of filaggrin and claudin-1, marked reduction of TEWL, and restoration of basement membrane and dermal collagen deposition, even under continuous sensitization of low dose TNCB. In addition, SP significantly reduced innervation of itch-evoking nerve fibers, gelatinase activity and nerve growth factor (NGF) expression in the epidermis but upregulated semaphorin-3A (Sema3A) expression in the epidermis, along with reduced scratching behavior in TNCB-treated NC/Nga mice. All of these effects were completely reversed by co-treatment with the NK1R antagonist CP99994. In cultured human keratinocytes, SP treatment reduced expression of TGF-α, but upregulated TGF-β and Sema3A. Topically administered SP can restore normal skin barrier function, reduce epidermal infiltration

  6. M2 macrophages induce ovarian cancer cell proliferation via a heparin binding epidermal growth factor/matrix metalloproteinase 9 intercellular feedback loop.

    Science.gov (United States)

    Carroll, Molly J; Kapur, Arvinder; Felder, Mildred; Patankar, Manish S; Kreeger, Pamela K

    2016-12-27

    In ovarian cancer, a high ratio of anti-inflammatory M2 to pro-inflammatory M1 macrophages correlates with poor patient prognosis. The mechanisms driving poor tumor outcome as a result of the presence of M2 macrophages in the tumor microenvironment remain unclear and are challenging to study with current techniques. Therefore, in this study we utilized a micro-culture device previously developed by our lab to model concentrated paracrine signaling in order to address our hypothesis that interactions between M2 macrophages and ovarian cancer cells induce tumor cell proliferation. Using the micro-culture device, we determined that co-culture with M2-differentiated primary macrophages or THP-1 increased OVCA433 proliferation by 10-12%. This effect was eliminated with epidermal growth factor receptor (EGFR) or heparin-bound epidermal growth factor (HB-EGF) neutralizing antibodies and HBEGF expression in peripheral blood mononuclear cells from ovarian cancer patients was 9-fold higher than healthy individuals, suggesting a role for HB-EGF in tumor progression. However, addition of HB-EGF at levels secreted by macrophages or macrophage-conditioned media did not induce proliferation to the same extent, indicating a role for other factors in this process. Matrix metalloproteinase-9, MMP-9, which cleaves membrane-bound HB-EGF, was elevated in co-culture and its inhibition decreased proliferation. Utilizing inhibitors and siRNA against MMP9 in each population, we determined that macrophage-secreted MMP-9 released HB-EGF from macrophages, which increased MMP9 in OVCA433, resulting in a positive feedback loop to drive HB-EGF release and increase proliferation in co-culture. Identification of multi-cellular interactions such as this may provide insight into how to most effectively control ovarian cancer progression.

  7. Lactobacillus GG-fermented milk prevents DSS-induced colitis and regulates intestinal epithelial homeostasis through activation of epidermal growth factor receptor

    Science.gov (United States)

    Yoda, Kazutoyo; Miyazawa, Kenji; Hosoda, Masataka; Hiramatsu, Masaru; Yan, Fang; He, Fang

    2014-01-01

    Background Fermented milk is considered one of the best sources for efficient consumption of probiotic strains by hosts to promote good health. The purpose of this study was to investigate the effects of orally administering LGG-fermented milk (LGG milk) on intestinal inflammation and injury and to study the mechanisms of LGG milk's action. Methods LGG milk and non-LGG-fermented milk (non-LGG milk) were administered through gavage to mice before and during dextran sodium sulfate (DSS)-induced intestinal injury and colitis. Inflammatory/injury score and colon length were assessed. Intestinal epithelial cells were treated with the soluble fraction of LGG milk to detect its effects on the epidermal growth factor receptor (EGFR) and its down stream target, Akt activation, cytokine-induced apoptosis, and hydrogen peroxide (H2O2)-induced disruption of tight junctions. Results LGG milk treatment significantly reduced DSS-induced colonic inflammation and injury, and colon shortening in mice, compared to that in non-LGG milk-treated and untreated mice. The soluble fraction of LGG milk, but not non-LGG milk, stimulated activation of EGFR and Akt in a concentration-dependent manner, suppressed cytokine-induced apoptosis, and attenuated H2O2-induced disruption of tight junction complex in the intestinal epithelial cells. These effects of LGG milk were blocked by the EGFR kinase inhibitor. LGG milk, but not non-LGG milk, contained two soluble proteins, p40 and p75, which have been reported to promote survival and growth of intestinal epithelial cells through activation of EGFR. Depletion of p40 and p75 from LGG milk abolished the effects of LGG milk on prevention of cytokine-induced apoptosis and H2O2-induced disruption of tight junctions. Conclusions These results suggest that LGG milk may regulate intestinal epithelial homeostasis and potentially prevent intestinal inflammatory diseases through activation of EGFR by LGG-derived proteins. PMID:23468308

  8. Lactobacillus GG-fermented milk prevents DSS-induced colitis and regulates intestinal epithelial homeostasis through activation of epidermal growth factor receptor.

    Science.gov (United States)

    Yoda, Kazutoyo; Miyazawa, Kenji; Hosoda, Masataka; Hiramatsu, Masaru; Yan, Fang; He, Fang

    2014-02-01

    Fermented milk is considered one of the best sources for efficient consumption of probiotic strains by hosts to promote good health. The purpose of this study was to investigate the effects of orally administering LGG-fermented milk (LGG milk) on intestinal inflammation and injury and to study the mechanisms of LGG milk's action. LGG milk and non-LGG-fermented milk (non-LGG milk) were administered through gavage to mice before and during dextran sodium sulfate (DSS)-induced intestinal injury and colitis. Inflammatory/injury score and colon length were assessed. Intestinal epithelial cells were treated with the soluble fraction of LGG milk to detect its effects on the epidermal growth factor receptor (EGFR) and its downstream target, Akt activation, cytokine-induced apoptosis, and hydrogen peroxide (H2O2)-induced disruption of tight junctions. LGG milk treatment significantly reduced DSS-induced colonic inflammation and injury, and colon shortening in mice, compared to that in non-LGG milk-treated and -untreated mice. The soluble fraction of LGG milk, but not non-LGG milk, stimulated the activation of EGFR and Akt in a concentration-dependent manner, suppressed cytokine-induced apoptosis, and attenuated H2O2-induced disruption of tight junction complex in the intestinal epithelial cells. These effects of LGG milk were blocked by the EGFR kinase inhibitor. LGG milk, but not non-LGG milk, contained two soluble proteins, p40 and p75, that have been reported to promote survival and growth of intestinal epithelial cells through the activation of EGFR. Depletion of p40 and p75 from LGG milk abolished the effects of LGG milk on prevention of cytokine-induced apoptosis and H2O2-induced disruption of tight junctions. These results suggest that LGG milk may regulate intestinal epithelial homeostasis and potentially prevent intestinal inflammatory diseases through activation of EGFR by LGG-derived proteins.

  9. Epidermal growth factor receptor inhibition reduces angiogenesis via hypoxia-inducible factor-1α and Notch1 in head neck squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Wei-Ming Wang

    Full Text Available Angiogenesis, a marker of cancer development, affects response to radiotherapy sensibility. This preclinical study aims to understand the receptor tyrosine kinase-mediated angiogenesis in head neck squamous cell carcinoma (HNSCC. The receptor tyrosine kinase activity in a transgenic mouse model of HNSCC was assessed. The anti-tumorigenetic and anti-angiogenetic effects of cetuximab-induced epidermal growth factor receptor (EGFR inhibition were investigated in xenograft and transgenic mouse models of HNSCC. The signaling transduction of Notch1 and hypoxia-inducible factor-1α (HIF-1α was also analyzed. EGFR was overexpressed and activated in the Tgfbr1/Pten deletion (2cKO mouse model of HNSCC. Cetuximab significantly delayed tumor onset by reducing tumor angiogenesis. This drug exerted similar effects on heterotopic xenograft tumors. In the human HNSCC tissue array, increased EGFR expression correlated with increased HIF-1α and micro vessel density. Cetuximab inhibited tumor-induced angiogenesis in vitro and in vivo by significantly downregulating HIF-1α and Notch1. EGFR is involved in the tumor angiogenesis of HNSCC via the HIF-1α and Notch1 pathways. Therefore, targeting EGFR by suppressing hypoxia- and Notch-induced angiogenesis may benefit HNSCC therapy.

  10. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  11. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration.

    Science.gov (United States)

    Hinitt, C A M; Wood, J; Lee, S S; Williams, A C; Howarth, J L; Glover, C P; Uney, J B; Hague, A

    2010-08-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion. Copyright 2010 Elsevier Inc. All rights reserved.

  12. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  13. Noise Stress Induces an Epidermal Growth Factor Receptor/Xeroderma Pigmentosum-A Response in the Auditory Nerve.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-03-01

    In response to toxic stressors, cancer cells defend themselves by mobilizing one or more epidermal growth factor receptor (EGFR) cascades that employ xeroderma pigmentosum-A (XPA) to repair damaged genes. Recent experiments discovered that neurons within the auditory nerve exhibit basal levels of EGFR+XPA co-expression. This finding implied that auditory neurons in particular or neurons in general have the capacity to mobilize an EGFR+XPA defense. Therefore, the current study tested the hypothesis that noise stress would alter the expression pattern of EGFR/XPA within the auditory nerve. Design-based stereology was used to quantify the proportion of neurons that expressed EGFR, XPA, and EGFR+XPA with and without noise stress. The results revealed an intricate neuronal response that is suggestive of alterations to both co-expression and individual expression of EGFR and XPA. In both the apical and middle cochlear coils, the noise stress depleted EGFR+XPA expression. Furthermore, there was a reduction in the proportion of neurons that expressed XPA-alone in the middle coils. However, the noise stress caused a significant increase in the proportion of neurons that expressed EGFR-alone in the middle coils. The basal cochlear coils failed to mobilize a significant response to the noise stress. These results suggest that EGFR and XPA might be part of the molecular defense repertoire of the auditory nerve.

  14. Noise Stress Induces an Epidermal Growth Factor Receptor/Xeroderma Pigmentosum–A Response in the Auditory Nerve

    Science.gov (United States)

    Guthrie, O’neil W.

    2017-01-01

    In response to toxic stressors, cancer cells defend themselves by mobilizing one or more epidermal growth factor receptor (EGFR) cascades that employ xeroderma pigmentosum–A (XPA) to repair damaged genes. Recent experiments discovered that neurons within the auditory nerve exhibit basal levels of EGFR+XPA co-expression. This finding implied that auditory neurons in particular or neurons in general have the capacity to mobilize an EGFR+XPA defense. Therefore, the current study tested the hypothesis that noise stress would alter the expression pattern of EGFR/XPA within the auditory nerve. Design-based stereology was used to quantify the proportion of neurons that expressed EGFR, XPA, and EGFR+XPA with and without noise stress. The results revealed an intricate neuronal response that is suggestive of alterations to both co-expression and individual expression of EGFR and XPA. In both the apical and middle cochlear coils, the noise stress depleted EGFR+XPA expression. Furthermore, there was a reduction in the proportion of neurons that expressed XPA-alone in the middle coils. However, the noise stress caused a significant increase in the proportion of neurons that expressed EGFR-alone in the middle coils. The basal cochlear coils failed to mobilize a significant response to the noise stress. These results suggest that EGFR and XPA might be part of the molecular defense repertoire of the auditory nerve. PMID:28056182

  15. ROLE OF THE EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR) IN THE ACTIVATION OF MEK INDUCED BY ZN EXPOSURE

    Science.gov (United States)

    Zn is a ubiquitous ambient air pollutant typically found associated with particulate matter. Divalent Zn inhibits tyrosine phosphatases and induces EGFR- and MAPK- dependent signaling in human airway epithelial cells. To further characterize Zn-induced intracellular signaling, ...

  16. Outcome in advanced non-small cell lung cancer patients with successful rechallenge after recovery from epidermal growth factor receptor tyrosine kinase inhibitor-induced interstitial lung disease.

    Science.gov (United States)

    Kashiwabara, Kosuke; Semba, Hiroshi; Fujii, Shinji; Tsumura, Shinsuke

    2017-04-01

    Several non-small cell lung cancer (NSCLC) cases of successful rechallenge with epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) after recovery from gefitinib or erlotinib-induced interstitial lung disease (ILD) have been reported, but it is not clear whether the rechallenge affects the outcome. We retrospectively evaluated the difference in the outcome between advanced NCLC patients with active EGFR mutations who received EGFR-TKI rechallenge after recovery from EGFR-TKI-induced ILD and those who did not. EGFR-TKI-induced ILD occurred in 11 (10%) of 110 patients receiving gefitinib, five (7%) of 73 patients receiving erlotinib and one (8%) of 13 patients receiving afatinib. Diffuse alveolar damage pattern ILD was observed in six cases, four of which had chemotherapy-related death. Five of 13 patients who had recovered from ILD received EGFR-TKI rechallenge with concurrent oral administration of prednisolone 0.5 mg/kg after the strict informed consent of the risk for the recurrence of severe ILD. All of the five patients achieved a partial response. The median overall survival from the occurrence of EGFR-TKI-induced ILD was longer in patients with EGFR-TKI rechallenge than that in patients without (15.5 vs. 3.5 months, p = 0.029). The adverse events of EGFR-TKI rechallenge were tolerable, but one case receiving EGFR-TKI rechallenge with the suspected drug exhibited the recurrence of grade 3 ILD after the discontinuation of prednisolone. EGFR-TKI rechallenge with concurrent prednisolone therapy might be salvage therapy in advanced NSCLC patients with active EGFR mutations after recovery from EGFR-TKI-induced ILD.

  17. Evaluating Inhibition of the Epidermal Growth Factor (EGF)-Induced Response of Mutant MCF10A Cells with an Acoustic Sensor.

    Science.gov (United States)

    Garcia, Marcela P; Shahid, Ammar; Chen, Jennifer Y; Xi, Jun

    2012-11-13

    Many cancer treatments rely on inhibition of epidermal growth factor (EGF)-induced cellular responses. Evaluating drug effects on such responses becomes critical to the development of new cancer therapeutics. In this report, we have employed a label-free acoustic sensor, the quartz crystal microbalance with dissipation monitoring (QCM-D), to track the EGF-induced response of mutant MCF10A cells under various inhibitory conditions. We have identified a complex cell de-adhesion process, which can be distinctly altered by inhibitors of signaling pathways and cytoskeleton formation in a dose-dependent manner. The dose dependencies of the inhibitors provide IC50 values which are in strong agreement with the values reported in the literature, demonstrating the sensitivity and reliability of the QCM-D as a screening tool. Using immunofluorescence imaging, we have also verified the quantitative relationship between the ΔD-response (change in energy dissipation factor) and the level of focal adhesions quantified with the areal density of immunostained vinculin under those inhibitory conditions. Such a correlation suggests that the dynamic restructuring of focal adhesions can be assessed based on the time-dependent change in ΔD-response. Overall, this report has shown that the QCM-D has the potential to become an effective sensing platform for screening therapeutic agents that target signaling and cytoskeletal proteins.

  18. Evaluating Inhibition of the Epidermal Growth Factor (EGF-Induced Response of Mutant MCF10A Cells with an Acoustic Sensor

    Directory of Open Access Journals (Sweden)

    Jun Xi

    2012-11-01

    Full Text Available Many cancer treatments rely on inhibition of epidermal growth factor (EGF-induced cellular responses. Evaluating drug effects on such responses becomes critical to the development of new cancer therapeutics. In this report, we have employed a label-free acoustic sensor, the quartz crystal microbalance with dissipation monitoring (QCM-D, to track the EGF-induced response of mutant MCF10A cells under various inhibitory conditions. We have identified a complex cell de-adhesion process, which can be distinctly altered by inhibitors of signaling pathways and cytoskeleton formation in a dose-dependent manner. The dose dependencies of the inhibitors provide IC50 values which are in strong agreement with the values reported in the literature, demonstrating the sensitivity and reliability of the QCM-D as a screening tool. Using immunofluorescence imaging, we have also verified the quantitative relationship between the ΔD-response (change in energy dissipation factor and the level of focal adhesions quantified with the areal density of immunostained vinculin under those inhibitory conditions. Such a correlation suggests that the dynamic restructuring of focal adhesions can be assessed based on the time-dependent change in ΔD-response. Overall, this report has shown that the QCM-D has the potential to become an effective sensing platform for screening therapeutic agents that target signaling and cytoskeletal proteins.

  19. Evaluating Inhibition of the Epidermal Growth Factor (EGF)-Induced Response of Mutant MCF10A Cells with an Acoustic Sensor

    Science.gov (United States)

    Garcia, Marcela P.; Shahid, Ammar; Chen, Jennifer Y.; Xi, Jun

    2012-01-01

    Many cancer treatments rely on inhibition of epidermal growth factor (EGF)-induced cellular responses. Evaluating drug effects on such responses becomes critical to the development of new cancer therapeutics. In this report, we have employed a label-free acoustic sensor, the quartz crystal microbalance with dissipation monitoring (QCM-D), to track the EGF-induced response of mutant MCF10A cells under various inhibitory conditions. We have identified a complex cell de-adhesion process, which can be distinctly altered by inhibitors of signaling pathways and cytoskeleton formation in a dose-dependent manner. The dose dependencies of the inhibitors provide IC50 values which are in strong agreement with the values reported in the literature, demonstrating the sensitivity and reliability of the QCM-D as a screening tool. Using immunofluorescence imaging, we have also verified the quantitative relationship between the ΔD-response (change in energy dissipation factor) and the level of focal adhesions quantified with the areal density of immunostained vinculin under those inhibitory conditions. Such a correlation suggests that the dynamic restructuring of focal adhesions can be assessed based on the time-dependent change in ΔD-response. Overall, this report has shown that the QCM-D has the potential to become an effective sensing platform for screening therapeutic agents that target signaling and cytoskeletal proteins. PMID:25586035

  20. The HLA-B*15:02 allele in a Spanish Romani patient with carbamazepine-induced Stevens-Johnson syndrome.

    Science.gov (United States)

    Bellón, Teresa; Ramírez, Elena; Borobia, Alberto M; Lerma, Victoria; Moreno-Hidalgo, Miguel A; Laosa, Olga; Aramburu, José A; González-Herrada, Carlos; de Abajo, Francisco J

    2016-04-01

    The HLA-B*15:02 allele is a risk factor for carbamazepine (CBZ)-induced Stevens-Johnson syndrome/toxic epidermal necrolysis in populations where the allele is prevalent. Han Chinese and Thai patients are advised to take a genetic test before introducing CBZ. Such testing is not recommended for patients of European descent. We report the case of a Spanish Romani patient who developed Stevens-Johnson syndrome upon treatment with CBZ. In vitro assays confirmed CBZ as the culprit drug. HLA typing showed that the patient carried the HLA-B*15:02 allele. A public database search revealed that 2% of Spanish Romani people likely carry the risk variant HLA-B*15:02 and therefore may be included in the population to be tested prior to beginning treatment with CBZ.

  1. Genetics Home Reference: epidermal nevus

    Science.gov (United States)

    ... Epidermal Nevus Disease InfoSearch: Epidermal nevus Foundation for Ichthyosis and Related Skin Types (FIRST): Epidermal Nevus Fact ... Support and Advocacy Resources (3 links) Foundation for Ichthyosis and Related Skin Types (FIRST) National Organization for ...

  2. Epidermal Growth Factor Receptor Kinase Inhibitors Synergize with TCDD to Induce CYP1A1/1A2 in Human Breast Epithelial MCF10A Cells.

    Science.gov (United States)

    Joiakim, Aby; Mathieu, Patricia A; Shelp, Catherine; Boerner, Julie; Reiners, John J

    2016-05-01

    CYP1A1 and CYP1A2 are transcriptionally activated in the human normal breast epithelial cell line MCF10A following exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Shifting MCF10A cultures to medium deficient in serum and epidermal growth factor (EGF) caused rapid reductions in the activated (i.e., phosphorylated) forms of extracellular regulated kinases (ERKs) and the epidermal growth factor receptor (EGFR). Shifting to serum/EGF-deficient medium also enhanced TCDD-mediated induction of cytochrome P450 (CYP)1A1 Treatment of cells cultured in complete medium with the EGFR inhibitors gefitinib (Iressa), AG1478, and CI-1033 resulted in concentration-dependent reductions of active EGFR and ERKs, and increased CYP1A1 mRNA content ∼3- to 18-fold above basal level. EGFR inhibitors synergized with TCDD and resulted in transient CYP1A1 and CYP1A2 mRNA accumulations ∼8-fold greater (maximum at 5 hours) than that achieved with only TCDD. AG1478, gefitinib, and TCDD individually induced small increases (∼1.2- to 2.5-fold) in CYP1A1 protein content but did not cause additive or synergistic accumulations of CYP1A1 protein when used in combination. The mitogen-activated protein kinase kinase inhibitor PD184352 inhibited ERK and EGFR activation in a concentration-dependent fashion without causing CYP1A1 mRNA accumulation. However, cotreatment with PD184352 potentiated TCDD-mediated CYP1A1 induction. TCDD-mediated induction of CYP1A1 in MCF7-TET on-EGFR cells, a MCF7 variant in which EGFR expression can be controlled, was not affected by the activity status of EGFR or ERKs. Hence, EGFR signaling mutes both basal and ligand-induced expression of two aryl hydrocarbon receptor-responsive P450s in MCF10A cultures. However, these effects are cell context-dependent. Furthermore, CYP1A1 mRNA and protein abundance are not closely coupled in MCF10A cultures. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  3. Intermittent hypoxia induces the proliferation of rat vascular smooth muscle cell with the increases in epidermal growth factor family and erbB2 receptor

    Energy Technology Data Exchange (ETDEWEB)

    Kyotani, Yoji, E-mail: cd147@naramed-u.ac.jp [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Ota, Hiroyo [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Itaya-Hironaka, Asako; Yamauchi, Akiyo; Sakuramoto-Tsuchida, Sumiyo [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Zhao, Jing; Ozawa, Kentaro; Nagayama, Kosuke; Ito, Satoyasu [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Takasawa, Shin [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Kimura, Hiroshi [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Uno, Masayuki [Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Yoshizumi, Masanori [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan)

    2013-11-15

    Obstructive sleep apnea is characterized by intermittent hypoxia (IH), and associated with cardiovascular diseases, such as stroke and heart failure. These cardiovascular diseases have a relation to atherosclerosis marked by the proliferation of vascular smooth muscle cells (VSMCs). In this study, we investigated the influence of IH on cultured rat aortic smooth muscle cell (RASMC). The proliferation of RASMC was significantly increased by IH without changing the level of apoptosis. In order to see what induces RASMC proliferation, we investigated the influence of normoxia (N)-, IH- and sustained hypoxia (SH)-treated cell conditioned media on RASMC proliferation. IH-treated cell conditioned medium significantly increased RASMC proliferation compared with N-treated cell conditioned medium, but SH-treated cell conditioned medium did not. We next investigated the epidermal growth factor (EGF) family as autocrine growth factors. Among the EGF family, we found significant increases in mRNAs for epiregulin (ER), amphiregulin (AR) and neuregulin-1 (NRG1) in IH-treated cells and mature ER in IH-treated cell conditioned medium. We next investigated the changes in erbB family receptors that are receptors for ER, AR and NRG1, and found that erbB2 receptor mRNA and protein expressions were increased by IH, but not by SH. Phosphorylation of erbB2 receptor at Tyr-1248 that mediates intracellular signaling for several physiological effects including cell proliferation was increased by IH, but not by SH. In addition, inhibitor for erbB2 receptor suppressed IH-induced cell proliferation. These results provide the first demonstration that IH induces VSMC proliferation, and suggest that EGF family, such as ER, AR and NRG1, and erbB2 receptor could be involved in the IH-induced VSMC proliferation. - Highlights: ●In vitro system for intermittent hypoxia (IH) and sustained hypoxia (SH). ●IH, but not SH, induces the proliferation of rat vascular smooth muscle cell. ●Epiregulin m

  4. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo

    2014-01-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  5. Tissue kallikrein induces SH-SY5Y cell proliferation via epidermal growth factor receptor and extracellular signal-regulated kinase1/2 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Zhengyu [Department of Neurology, Huashan Hospital, State Key Laboratory of Medical Neurobiology, Fudan University, Shanghai 200040 (China); Department of Neurology, Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 200437 (China); Yang, Qi; Cui, Mei; Liu, Yanping [Department of Neurology, Huashan Hospital, State Key Laboratory of Medical Neurobiology, Fudan University, Shanghai 200040 (China); Wang, Tao; Zhao, Hong [Department of Neurology, Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 200437 (China); Dong, Qiang, E-mail: qiang_dong163@163.com [Department of Neurology, Huashan Hospital, State Key Laboratory of Medical Neurobiology, Fudan University, Shanghai 200040 (China)

    2014-03-28

    Highlights: • TK promotes EGFR phosphorylation in SH-SY5Y cells. • TK activates ERK1/2 and p38 phosphorylation in SH-SY5Y cells. • TK mediates SH-SY5Y cell proliferation via EGFR and ERK1/2 pathway. - Abstract: Tissue kallikrein (TK) is well known to take most of its biological functions through bradykinin receptors. In the present study, we found a novel signaling pathway mediated by TK through epidermal growth factor receptor (EGFR) in human SH-SY5Y cells. We discovered that TK facilitated the activation of EGFR, extracellular signal-regulated kinase (ERK) 1/2 and p38 cascade. Interestingly, not p38 but ERK1/2 phosphorylation was severely compromised in cells depleted of EGFR. Nevertheless, impairment of signaling of ERK1/2 seemed not to be restricted to EGFR phosphorylation. We also observed that TK stimulation could induce SH-SY5Y cell proliferation, which was reduced by EGFR down-regulation or ERK1/2 inhibitor. Overall, our findings provided convincing evidence that TK could mediate cell proliferation via EGFR and ERK1/2 pathway in vitro.

  6. Role of inositol (1,4,5)trisphosphate in epidermal growth factor-induced Ca2+ signaling in A431 cells

    DEFF Research Database (Denmark)

    Hughes, A R; Bird, G S; Obie, J F

    1991-01-01

    to thapsigargin. In nominally Ca(2+)-free medium, the addition of bradykinin to A431 cells rapidly but transiently increased inositol 1,4,5-trisphosphate and, in parallel fashion, transiently increased cytosolic Ca2+. Unexpectedly, under these experimental conditions, epidermal growth factor elicited a small...... but significant Ca2+ signal after the addition of bradykinin. Experiments were designed to determine whether the Ca2+ response to epidermal growth factor after bradykinin results from mobilization of Ca2+ by an inositol 1,4,5-trisphosphate-independent mechanism. Epidermal growth factor stimulated additional...... inositol 1,4,5-trisphosphate formation in bradykinin-treated cells. Furthermore, the Ca2+ signals elicited by both bradykinin and epidermal growth factor were blocked in cells microinjected with the inositol 1,4,5-trisphosphate receptor antagonist heparin, whereas the intracellular Ca(2+)-ATPase inhibitor...

  7. Epidermal growth factor receptor is a preferred target for treating Amyloid-β–induced memory loss

    OpenAIRE

    Wang, Lei; Chiang, Hsueh-Cheng; Wu, Wenjuan; Liang, Bin; Xie, Zuolei; Yao, Xinsheng; Ma, Weiwei; Du, Shuwen; Zhong, Yi

    2012-01-01

    Current understanding of amyloid-β (Aβ) metabolism and toxicity provides an extensive list of potential targets for developing drugs for treating Alzheimer’s disease. We took two independent approaches, including synaptic-plasticity–based analysis and behavioral screening of synthetic compounds, for identifying single compounds that are capable of rescuing the Aβ-induced memory loss in both transgenic fruit fly and transgenic mouse models. Two clinically available drugs and three synthetic co...

  8. Inhibitory effects of omega-3 fatty acids on injury-induced epidermal growth factor receptor transactivation contribute to delayed wound healing.

    Science.gov (United States)

    Turk, Harmony F; Monk, Jennifer M; Fan, Yang-Yi; Callaway, Evelyn S; Weeks, Brad; Chapkin, Robert S

    2013-05-01

    Epidermal growth factor receptor (EGFR)-mediated signaling is required for optimal intestinal wound healing. Since n-3 polyunsaturated fatty acids (PUFA), specifically docosahexaenoic acid (DHA), alter EGFR signaling and suppress downstream activation of key signaling pathways, we hypothesized that DHA would be detrimental to the process of intestinal wound healing. Using a mouse immortalized colonocyte model, DHA uniquely reduced EGFR ligand-induced receptor activation, whereas DHA and its metabolic precursor eicosapentaenoic acid (EPA) reduced wound-induced EGFR transactivation compared with control (no fatty acid or linoleic acid). Under wounding conditions, the suppression of EGFR activation was associated with a reduction in downstream activation of cytoskeletal remodeling proteins (PLCγ1, Rac1, and Cdc42). Subsequently, DHA and EPA reduced cell migration in response to wounding. Mice were fed a corn oil-, DHA-, or EPA-enriched diet prior to intestinal wounding (2.5% dextran sodium sulfate for 5 days followed by termination after 0, 3, or 6 days of recovery). Mortality was increased in EPA-fed mice and colonic histological injury scores were increased in EPA- and DHA-fed mice compared with corn oil-fed (control) mice. Although kinetics of colonic EGFR activation and downstream signaling (PLCγ1, Rac1, and Cdc42) were delayed by both n-3 PUFA, colonic repair was increased in EPA- relative to DHA-fed mice. These results indicate that, during the early response to intestinal wounding, DHA and EPA uniquely delay the activation of key wound-healing processes in the colon. This effect is mediated, at least in part, via suppression of EGFR-mediated signaling and downstream cytoskeletal remodeling.

  9. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  10. Relationship of p53 Mutations to Epidermal Cell Proliferation and Apoptosis in Human UV-Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Janine G. Einspahr

    1999-11-01

    Full Text Available Human skin is continually subjected to UV-irradiation with the p53 gene playing a pivotal role in repair of UV-induced DNA damage and apoptosis. Consequently, p53 alterations are early events in human UV-induced skin carcinogenesis. We studied 13 squamous cell carcinomas (SCC, 16 actinic keratoses (AK, 13 samples adjacent to an AK (chronically sun-damaged, and 14 normal-appearing skin samples for p53 mutation, p53 immunostaining (IHC, apoptosis (in situ TUNEL and morphology, and proliferation (PCNA. The frequency of p53 mutation increased from 14% in normal skin, to 38.5% in sun-damaged skin, 63% in AK, and 54% in SCC. p53 IHC increased similarly. Apoptosis (TUNEL increased from 0.06 ± 0.02%, to 0.1 ± 0.2, 0.3 ± 0.3, and 0.4 ± 0.3 in normal skin, sun-damaged skin, AK, and SCC, respectively. Apoptosis was strongly correlated with proliferation (i.e., TUNEL and PCNA, r = 0.7, P < 0.0001, and proliferation was significantly increased in the progression from normal skin to SCC. Bax was significantly increased in SCC compared to AK. These data imply that apoptosis in samples with a high frequency of p53 mutation may not necessarily be p53-dependent. We suggest that there is a mechanism for apoptosis in response to increased cellular proliferation that is p53-independent.

  11. Docetaxel induced Lyell′s syndrome: A rare life threatening cause of dermatitis medicamentosas

    Directory of Open Access Journals (Sweden)

    Faheem Arshad

    2014-01-01

    Full Text Available Lyell′s syndrome or toxic epidermal necrolysis (TEN is a life threatening complication mostly caused by medications, characterized by desquamative lesions of the skin and mucous membranes with 30 percent or more epidermal involvement along with mucus membrane. We report a rare case of toxic epidermal necrolysis following administration of docetaxel, a semi-synthetic taxane. A female diagnosed as having metastatic breast carcinoma received chemotherapy in form of docetaxel after being exposed to adjuvant chemotherapy, developed severe involvement of skin and mucus membrane. Diagnosis of TEN was made and she was managed with steroids, antibiotics, intravenous fluids and antiseptic dressings. Common toxicities reported with this drug include myelosuppression, alopecia, nail damage, erythema multiforme major and neuropathy. We believe this is the first case report of Lyell′s syndrome following docetaxel. Main aim of this case is to make physicians aware of the severe skin reactions with docetaxel, measures to avoid them, early recognition and prompt treatment.

  12. Abnormal epidermal barrier in the pathogenesis of psoriasis.

    Science.gov (United States)

    Wolf, Ronni; Orion, Edith; Ruocco, Eleonora; Ruocco, Vincenzo

    2012-01-01

    Almost 2 decades ago, Williams and Elias suggested a unifying concept for the pathogenesis of disorders of cornification, according to which the integrity of the epidermal barrier and its effective function is an important factor in the regulation of epidermal DNA synthesis. Interference with the barrier integrity or function will result in epidermal hyperplasia and may be the primary event leading to hyperproliferative skin diseases, such as psoriasis. We have analyzed alterations to several structures of the epidermal barrier that might be responsible for barrier dysfunction and thus lead to hyperproliferation of the epidermis in an attempt to repair the barrier and, as a result, might be inducers of psoriasis. There are several convincing reports indicating that inhibiting of epidermal transglutaminase may lead to epidermal hyperproliferation and that this stimulus might trigger psoriasis among genetically predisposed patients. Disturbance of epidermal barrier function caused by derangement of lipid or cholesterol or ceramide synthesis leads to increased DNA synthesis and epidermal hyperplasia and as a result might be an inducer of psoriasis. We could find little evidence to show that defective defense of the epidermis or an abnormal response of it to bacteria plays a role in the pathogenesis of psoriasis. Accumulating data indicate that there is an association of psoriasis and mutations of genes within the epidermal differentiation complex, which are crucial for the development, maturation, cornification, cross-linking, and terminal differentiation of the epidermis, called psoriasis susceptibility locus 4. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. MAPK phosphatase AP2C3 induces ectopic proliferation of epidermal cells leading to stomata development in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Julija Umbrasaite

    2010-12-01

    Full Text Available In plant post-embryonic epidermis mitogen-activated protein kinase (MAPK signaling promotes differentiation of pavement cells and inhibits initiation of stomata. Stomata are cells specialized to modulate gas exchange and water loss. Arabidopsis MAPKs MPK3 and MPK6 are at the core of the signaling cascade; however, it is not well understood how the activity of these pleiotropic MAPKs is constrained spatially so that pavement cell differentiation is promoted only outside the stomata lineage. Here we identified a PP2C-type phosphatase termed AP2C3 (Arabidopsis protein phosphatase 2C that is expressed distinctively during stomata development as well as interacts and inactivates MPK3, MPK4 and MPK6. AP2C3 co-localizes with MAPKs within the nucleus and this localization depends on its N-terminal extension. We show that other closely related phosphatases AP2C2 and AP2C4 are also MAPK phosphatases acting on MPK6, but have a distinct expression pattern from AP2C3. In accordance with this, only AP2C3 ectopic expression is able to stimulate cell proliferation leading to excess stomata development. This function of AP2C3 relies on the domains required for MAPK docking and intracellular localization. Concomitantly, the constitutive and inducible AP2C3 expression deregulates E2F-RB pathway, promotes the abundance and activity of CDKA, as well as changes of CDKB1;1 forms. We suggest that AP2C3 downregulates the MAPK signaling activity to help maintain the balance between differentiation of stomata and pavement cells.

  14. HLA Association with Drug-Induced Adverse Reactions

    Directory of Open Access Journals (Sweden)

    Wen-Lang Fan

    2017-01-01

    Full Text Available Adverse drug reactions (ADRs remain a common and major problem in healthcare. Severe cutaneous adverse drug reactions (SCARs, such as Stevens–Johnson syndrome (SJS/toxic epidermal necrolysis (TEN with mortality rate ranges from 10% to more than 30%, can be life threatening. A number of recent studies demonstrated that ADRs possess strong genetic predisposition. ADRs induced by several drugs have been shown to have significant associations with specific alleles of human leukocyte antigen (HLA genes. For example, hypersensitivity to abacavir, a drug used for treating of human immunodeficiency virus (HIV infection, has been proposed to be associated with allele 57:01 of HLA-B gene (terms HLA-B∗57:01. The incidences of abacavir hypersensitivity are much higher in Caucasians compared to other populations due to various allele frequencies in different ethnic populations. The antithyroid drug- (ATDs- induced agranulocytosis are strongly associated with two alleles: HLA-B∗38:02 and HLA-DRB1∗08:03. In addition, HLA-B∗15:02 allele was reported to be related to carbamazepine-induced SJS/TEN, and HLA-B∗57:01 in abacavir hypersensitivity and flucloxacillin induced drug-induced liver injury (DILI. In this review, we summarized the alleles of HLA genes which have been proposed to have association with ADRs caused by different drugs.

  15. Radiation-Induced Esophagitis In Vivo and In Vitro Reveals That Epidermal Growth Factor Is a Potential Candidate for Therapeutic Intervention Strategy

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyung Su [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Jeon, Seong-Uk; Lee, Chan-Ju; Kim, Young-Eun; Bok, Seoyeon; Hong, Beom-Ju; Park, Dong-Young [Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang, Gyeongbuk (Korea, Republic of); Ahn, G-One, E-mail: goneahn@postech.ac.kr [Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang, Gyeongbuk (Korea, Republic of); Kim, Hak Jae, E-mail: khjae@snu.ac.kr [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2016-07-01

    Purpose: To establish and characterize radiation-induced esophagitis (RIE) in vivo and in vitro. Methods and Materials: Fractionated thoracic irradiation at 0, 8, 12, or 15 Gy was given daily for 5 days to Balb/c or C57Bl/6 mice. Changes in body weight gain and daily food intake were assessed. At the end of the study, we removed the esophagus and examined histology by hematoxylin and eosin staining, immune cell infiltration and apoptosis by fluorescence-activated cell sorting, and gene expression changes by quantitative real-time polymerase chain reaction. Het-1A human esophageal epithelial cells were irradiated at 6 Gy, treated with recombinant human growth factors, and examined for gene expression changes, apoptosis, proliferation, and signal transduction pathways. Results: We observed that irradiation at 12 Gy or 15 Gy per fraction produced significant reduction in body weight and decreased food intake in Balb/c mice but not as much in C57Bl/6 mice. Further analyses of Balb/c mice irradiated at 12 Gy/fraction revealed attenuated epithelium, inflamed mucosa, and increased numbers of infiltrating CD4+ helper T cells and apoptotic cells. Moreover, we found that expression of tissue inhibitor for metalloproteinase-1, plasminogen activator inhibitor-1, granulocyte macrophage-colony stimulating factor, vascular endothelial growth factor, and stromal-derived factor-1 were increased, whereas epidermal growth factor (EGF) was decreased. Irradiated Het-1A cells similarly showed a significant decrease in expression of EGF and connective tissue growth factor (CTGF). Treatment of EGF but not CTGF partially protected Het-1A cells from radiation-induced apoptosis and revealed phosphorylation of EGFR, AKT, and ERK signaling pathways. Conclusions: We established a mouse model of RIE in Balb/c mice with 12 Gy × 5 fractions, which showed reduced body weight gain, food intake, and histopathologic features similar to those of human esophagitis. Decreased EGF expression

  16. leaf epidermal members of the epidermal structures and stomata ...

    African Journals Online (AJOL)

    Administrator

    ch was to study the leaf epidermal structures and stomata ontogeny family Lamiaceae. The species used in this study were Vitex grandis. Leaf epidermal structures, stomata types, siz lopment were examined and to estimate stomata frequency, stoma uated. The epidermal cells were polygonal in Gmelina ular in Vitex ...

  17. Extracorporeal Membrane Oxygenation in a Patient With Refractory Acute Respiratory Distress Syndrome Secondary to Toxic Epidermal Necrolysis.

    Science.gov (United States)

    2014-12-01

    treatment in adults with swine flu (H1N1)3 and publication of the CESAR (conventional ventilation or ECMO for severe adult respiratory failure) trial,4...ing lactate. Prone positioning was considered but not offered because of the low likelihood of success, given her underlying lung pathology...which consisted primarily of silver nitrate dress- ings that require fewer dressing changes than other therapies. Lung -protective ventilator

  18. Penile Epidermal Inclusion Cyst

    Directory of Open Access Journals (Sweden)

    M. El-Shazly

    2012-01-01

    Full Text Available We report a case of epidermal inclusion cyst in a 32-year-old male. This was a complication of circumcision that was neglected over years to form stones and urethrocutaneous fistula. Complete excision of the cyst and repair of the fistula were performed successfully. Histopathological examination confirmed our diagnosis.

  19. Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

    Directory of Open Access Journals (Sweden)

    You Mie Lee

    Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

  20. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  1. The intestinotrophic peptide, GLP-2, counteracts the gastrointestinal atrophy in mice induced by the epidermal growth factor receptor inhibitor, erlotinib, and cisplatin

    DEFF Research Database (Denmark)

    Rasmussen, Andreas Rosén; Viby, Niels-Erik; Hare, Kristine Juul

    2010-01-01

    Erlotinib, an epidermal-growth-factor receptor inhibitor, belongs to a new generation of targeted cancer therapeutics. Gastrointestinal side-effects are common and have been markedly aggravated when erlotinib is combined with cytostatics. We examined the effects of erlotinib alone and combined wi...... with the cytostatic, cisplatin, on the gastrointestinal tract and examined whether glucagon-like peptide-2 (GLP-2), an intestinal hormone with potent intestinotrophic properties, might counteract the possible damaging effects of the treatments....

  2. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...... wounds in vivo and in cultured keratinocytes after exposure to supernatant from stimulated mononuclear cells. In contrast, the epidermal expression of complement components was downregulated in ex vivo injured skin lacking the stimulation from infiltrating inflammatory cells but with intact injury......-induced epidermal growth factor receptor (EGFR)-mediated growth factor response. In cultured primary keratinocytes, stimulation with the potent EGFR ligand, TGF-α, yielded a significant downregulation of complement component expression. Indeed, EGFR inhibition significantly enhanced the induction of complement...

  3. Phenytoin induced Steven–Johnson syndrome and bronchiolitis obliterans – case report and review of literature

    OpenAIRE

    Pannu, Bibek S.; Egan, Ashley M.; Iyer, Vivek N.

    2016-01-01

    Stevens–Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are both rare but serious idiosyncratic drug reactions characterized by diffuse muco-epidermoid injury and high mortality. Keratinocytes in both skin and mucous membranes (including eyes, mouth and genitalia) are injured resulting in a diffuse maculopapular rash, blistering lesions and epithelial detachment with minimal force (Nikolsky's sign). SJS is typically diagnosed when less than 10% of the skin surface is involved and ...

  4. Photoprotection against the UVB-induced oxidative stress and epidermal damage in mice using leaves of three different varieties of Lepidium meyenii (maca).

    Science.gov (United States)

    Gonzales-Castañeda, Cynthia; Rivera, Valery; Chirinos, Ana Lucía; Evelson, Pablo; Gonzales, Gustavo Francisco

    2011-08-01

    Skin exposure to ultraviolet (UV) B radiation leads to epidermal damage and generation of reactive oxygen species. The photoprotective effect of extracts of three varieties of leaves (red, yellow, and black) from maca (Lepidium meyenii), a plant from the Peruvian highlands, was assessed in mouse skin exposed to UVB radiation. The hydroalcoholic extracts of three varieties of maca leaves were applied topically to the dorsal skin of young-adult male mice prior to exposition to UVB radiation. The three varieties had UVA/UVB absorptive properties and presented antioxidant activity, being highest with red maca, followed by black and yellow maca. The three varieties of maca leaves prevented the development of sunburn cells, epidermal hyperplasia, leukocytic infiltration, and other alterations produced by UVB radiation. Mice treated with black maca showed the highest superoxide dismutase levels, and mice treated with black and yellow maca showed higher catalase levels in skin, whereas red maca protected the skin and liver against significant increases in the lipid peroxidation activity observed in the unprotected animals. The presence of significant antioxidant activity and the inhibition of lipid peroxidation suggest that the observed protection could be partly attributable to this mechanism. © 2011 The International Society of Dermatology.

  5. Abnormal epidermal changes after argon laser treatment

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, R.A.; Knobler, R.M.; Aberer, E.; Klein, W.; Kocsis, F.; Ott, E. (Univ. of Vienna (Austria))

    1991-02-01

    A 26-year-old woman with a congenital port-wine stain on the forehead was treated three times at 2-month intervals with an argon laser. Six months after the last treatment, moderate blanching and mild scaling confined to the treated area was observed. A biopsy specimen of the treated area revealed a significant decrease in ectatic vessels. However, epidermal changes similar to those of actinic keratosis with disorganized cell layers and marked cytologic abnormalities were seen. Analysis of peripheral blood lymphocytes for a defect in DNA repair was negative. Multiple, argon laser-induced photothermal effects may be responsible for the changes observed in our case and may lead to premalignant epidermal transformation.

  6. Sweet's syndrome complicated by Kikuchi's disease and hemophagocytic syndrome which presented with retinoic acid-inducible gene-I in both the skin epidermal basal layer and the cervical lymph nodes.

    Science.gov (United States)

    Koga, Tomohiro; Takano, Kanako; Horai, Yoshiro; Yamasaki, Satoshi; Nakamura, Hideki; Mizokami, Akinari; Ohshima, Koichi; Kawakami, Atsushi

    2013-01-01

    A 21-year-old man was admitted to our hospital with a fever, erythema, cervical lymphadenopathy and pancytopenia. A diagnosis of Sweet's syndrome (SS) with Kikuchi's disease (KD) and hemophagocytic syndrome (HPS) was made based on the results of a bone marrow aspiration along with the results from biopsy specimens of the brachial skin and a cervical lymph node. The expression of retinoic acid-inducible gene-I (RIG-I) in the skin epidermal basal layer as well as in a cervical lymph node was revealed through immunohistochemistry. He successfully entered remission through treatment with prednisolone. This findings of this case indicate that when SS with KD presents as HPS, it may suggest an association with an RIG-I-related innate immunity.

  7. [Effects of hypoxia inducible factor-1α on P311 and its influence on the migration of murine epidermal stem cells].

    Science.gov (United States)

    Xu, Z D; Li, H S; Wang, S; He, W F; Wu, J; Luo, G X

    2017-05-20

    Objective: To explore the effects of hypoxia inducible factor-1α (HIF-1α) on P311 and its influence on the migration of murine epidermal stem cells (ESCs) under hypoxia in vitro. Methods: Two kinds of murine ESCs were isolated and obtained from 15 neonatal wild-type C57BL/6J mice and 5 congeneric source P311 gene knock-out mice, respectively. The first passage of cells were used in the following experiments after morphologic observation and detection of expression of cell surface markers CD71 and CD49f with flow cytometer. (1) After cell scratch assay, according to the random number table (the same dividing method below), ESCs of P311 gene knock-out mice were divided into normoxia group (cells were cultured with complete medium in normoxic carbon dioxide incubator, and the subsequent normoxic treatments were the same) and hypoxia group (cells were cultured in hypoxic carbon dioxide incubator containing 1% oxygen, and the subsequent hypoxic treatments were the same), with 12 inserts in each group. ESCs of wild-type mice were divided into normoxia group, pure hypoxia group, dimethyl sulfoxide (DMSO) control group (2 μL DMSO solvent was added for 1 h of normoxia treatment before hypoxia treatment), HIF-1α inhibitor group (cells were treated with 11 μmol/L HIF-1 inhibitor of 2 μL under normoxia condition for 1 h before hypoxia treatment), HIF-1α stabilizer group (the cells were treated with 2 μmol/L FG-4592 of 2 μL under normoxia condition for 1 h before hypoxia treatment), with 12 inserts in each group. Three inserts of each time point in each group were adopted respectively to measure the residual width of scratch under inverted phase contrast microscope at post scratch hour (PSH) 0 (immediately), 12, 24, and 48. (2) After hypoxia treatment, the protein level of HIF-1α in ESCs of wild-type mice was detected by Western blotting at post hypoxia hour (PHH) 0, 12, 24, and 48. (3) ESCs of wild-type mice were divided into pure hypoxia group, DMSO control group

  8. Direct evidence for the critical role of NFAT3 in benzo[a]pyrene diol-epoxide-induced cell transformation through mediation of inflammatory cytokine TNF induction in mouse epidermal Cl41 cells.

    Science.gov (United States)

    Ouyang, Weiming; Hu, Yu; Li, Jingxia; Ding, Min; Lu, Yongju; Zhang, Dongyun; Yan, Yan; Song, Lun; Qu, Qingshan; Desai, Dhimant; Amin, Shantu; Huang, Chuanshu

    2007-10-01

    Nuclear factor of activated T cell (NFAT)-3 is a member of the transcription factor NFAT family, which has been demonstrated to be responsible for the up-regulation of the pro-inflammatory cytokine tumor necrosis factor (TNF) in the immune system. Our most recent studies have also shown that TNF is able to induce cell transformation in mouse epidermal Cl41 cells by induction of cyclooxygenase-2 (COX-2) expression. To provide direct evidence for NFAT3 in the environmental carcinogen-caused carcinogenic effect, (+/-)-benzo[a]pyrene-7,8-diol-9,10-epoxide (B[a]PDE), an ultimate environmental carcinogen metabolized from benzo[a]pyrene, was utilized. We found that exposure of Cl41 cells to B[a]PDE was able to induce cell transformation in Cl41 cells, while specific knock-down of NFAT3 resulted in the dramatic inhibition of this cell transformation. The tumorigenicity of B[a]PDE-caused transformed cells was confirmed in nude mice, whereas the tumor formation of B[a]PDE-treated NFAT3 small interference RNA (siRNA) knock-down cells was significantly reduced. Further studies showed that the role of NFAT3 in B[a]PDE-caused cell transformation was mediated by up-regulation of its downstream targeted gene TNF. This conclusion was based on the findings that inhibition of NFAT3 activation by either FK506 or NFAT3 siRNA dramatically down-regulated the TNF induction upon B[a]PDE exposure, and that knock-down of TNF by its specific siRNA also led to abrogation of B[a]PDE-induced cell transformation in Cl41 cells and their tumorigenicity in nude mice. Collectively, these results provide direct evidence for the important role of NFAT3 activation in B[a]PDE-induced cell transformation by up-regulation of TNF expression in mouse epidermal Cl41 cells, further suggesting that B[a]PDE may exert its tumor promotion effect on skin carcinogenesis, at least partially, by inducing TNF expression.

  9. Enhancement of Candida albicans killing activity of separated human epidermal cells by ultraviolet radiation

    International Nuclear Information System (INIS)

    Csato, M.; Kenderessy, A.S.; Dobozy, A.

    1987-01-01

    Ultraviolet irradiation enhanced the Candida albicans killing activity of freshly separated human epidermal cells in vitro. The simulation was dose-dependent and was not due to soluble extracellular factors acting on non-irradiated epidermal cells. The enhancement of the killing activity remained unchanged when epidermal cells were depleted of Langerhans cells. Protein synthesis inhibitors and prostaglandin antagonists inhibited the ultraviolet-induced augmentation of killing activity. (author)

  10. Epidermal growth factor induces cyclin D1 in human pancreatic carcinoma: evidence for a cyclin D1-dependent cell cycle progression.

    Science.gov (United States)

    Poch, B; Gansauge, F; Schwarz, A; Seufferlein, T; Schnelldorfer, T; Ramadani, M; Beger, H G; Gansauge, S

    2001-10-01

    We recently showed that cyclin D1 is overexpressed in human pancreatic carcinoma cells, and that this overexpression correlates significantly with a poor prognosis. To assess the interrelations of epidermal growth factor (EGF), EGF receptor (EGFR), and cyclin D1 in human pancreatic carcinoma. In pancreatic carcinoma cell lines (BxPC-3, AsPC-1), cell cycle analysis revealed an increase in cells in the S/G1 phase between 18 and 30 hours after stimulation with 50 ng/mL EGF. Cyclin D1 mRNA increased after 2 hours, corresponding to an increase in cyclin D1 protein, with the maximum level between 7.5 and 10 hours after stimulation, as demonstrated by Western blot analysis. We performed immunohistochemical analysis on 61 adenocarcinoma tissues for the expression of EGF, EGFR, and cyclin D1 and demonstrated an overexpression in the tumor cells in 51%, 54%, and 62.3%, respectively, whereas normal human pancreas stained negative for all of the three factors. Interestingly, EGF and EGFR expression correlated significantly with the cyclin D1 expression in human pancreatic tumor cells (p < 0.001 and p < 0.01, respectively). These results demonstrate that cyclin D1 overexpression in the tumor cells of pancreatic carcinoma tissue is at least partly dependent on the mitogenic effects of EGF signaling through the EGFR.

  11. Iron Stress-Induced Changes in Root Epidermal Cell Fate Are Regulated Independently from Physiological Responses to Low Iron Availability1

    Science.gov (United States)

    Schikora, Adam; Schmidt, Wolfgang

    2001-01-01

    Iron-overaccumulating mutants were investigated with respect to changes in epidermal cell patterning and root reductase activity in response to iron starvation. In all mutants under investigation, ferric chelate reductase activity was up-regulated both in the presence and absence of iron in the growth medium. The induction of transfer cells in the rhizodermis appeared to be iron regulated in the pea (Pisum sativum L. cv Dippes Gelbe Viktoria and cv Sparkle) mutants bronze and degenerated leaflets, but not in roots of the tomato (Lycopersicon esculentum Mill. cv Bonner Beste) mutant chloronerva, suggesting that in chloronerva iron cannot be recognized by putative sensor proteins. Experiments with split-root plants supports the hypothesis that Fe(III) chelate reductase is regulated by a shoot-borne signal molecule, communicating the iron status of the shoot to the roots. In contrast, the formation of transfer cells was dependent on the local concentration of iron, implying that this shoot signal does not affect their formation. Different repression curves of the two responses imply that the induction of transfer cells occurs after the enhancement of electron transfer across the plasma membrane rather than being causally linked. Similar to transfer cells, the formation of extra root hairs in the Arabidopsis mutant man1 was regulated by the iron concentration of the growth medium and was unaffected by interorgan signaling. PMID:11299349

  12. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  13. Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Kazuhiko Arima

    2015-01-01

    Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

  14. Phenytoin induced Steven-Johnson syndrome and bronchiolitis obliterans - case report and review of literature.

    Science.gov (United States)

    Pannu, Bibek S; Egan, Ashley M; Iyer, Vivek N

    2016-01-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are both rare but serious idiosyncratic drug reactions characterized by diffuse muco-epidermoid injury and high mortality. Keratinocytes in both skin and mucous membranes (including eyes, mouth and genitalia) are injured resulting in a diffuse maculopapular rash, blistering lesions and epithelial detachment with minimal force (Nikolsky's sign). SJS is typically diagnosed when less than 10% of the skin surface is involved and the term TEN is used in cases with more than 30% involvement. Respiratory involvement in SJS-TEN is common with 30-50% of cases demonstrating respiratory epithelial sloughing with severe short and long term complications. Patients who survive SJS-TEN are often left with impaired respiratory function and bronchiolitis obliterans. Cases of bronchiolitis obliterans with SJS/TEN have been very rarely reported. We report a case of phenytoin induced SJS/TEN followed by severe bronchiolitis obliterans in an adult patient. The presentation, pathophysiology and management of SJS/TEN related bronchiolitis obliterans is also reviewed.

  15. Phenytoin induced Steven–Johnson syndrome and bronchiolitis obliterans – case report and review of literature

    Directory of Open Access Journals (Sweden)

    Bibek S. Pannu

    2016-01-01

    Full Text Available Stevens–Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are both rare but serious idiosyncratic drug reactions characterized by diffuse muco-epidermoid injury and high mortality. Keratinocytes in both skin and mucous membranes (including eyes, mouth and genitalia are injured resulting in a diffuse maculopapular rash, blistering lesions and epithelial detachment with minimal force (Nikolsky's sign. SJS is typically diagnosed when less than 10% of the skin surface is involved and the term TEN is used in cases with more than 30% involvement. Respiratory involvement in SJS-TEN is common with 30–50% of cases demonstrating respiratory epithelial sloughing with severe short and long term complications. Patients who survive SJS-TEN are often left with impaired respiratory function and bronchiolitis obliterans. Cases of bronchiolitis obliterans with SJS/TEN have been very rarely reported. We report a case of phenytoin induced SJS/TEN followed by severe bronchiolitis obliterans in an adult patient. The presentation, pathophysiology and management of SJS/TEN related bronchiolitis obliterans is also reviewed.

  16. Tegafur/gimeracil/oteracil (TS-1 induced Stevens–Johnson syndrome: Case report

    Directory of Open Access Journals (Sweden)

    Satoko Minakawa

    2013-09-01

    Full Text Available TS-1 is an oral fluoropyrimidine anticancer drug that contains tegafur, gimeracil, and oteracil. A 78-year-old Japanese male who was diagnosed with carcinoma of the oral floor (rT4aN0M0 was prescribed a standard dose of TS-1 (80 mg/day. On Day 8 after administration of TS-1, an eruption developed. There was erythema, along with vesicles and erosions involving the lip, face, neck, trunk, limbs, and genitals. The drug-induced lymphocyte stimulation test (DLST for TS-1 was negative on the 23rd day, but positive on the 43rd day (20 days after discontinuing prednisolone. The condition was diagnosed as Stevens–Johnson syndrome due to TS-1 because of the clinical course and laboratory results. This case and 24 cases previously reported in the literature were analyzed. The types of drug eruption were drug-related lupus (9 cases, acral erythema (7 cases, scleroderma-like skin lesion (2 cases, Stevens–Johnson syndrome (2 cases, lichenoid eruption (1 case, purpura (1 case, lichen planus (1 case, erythema multiforme (1 case, hypopigmentation (1 case and toxic epidermal necrolysis (1 case, respectively. In view of the increasing usage of TS-1 in several common cancers, clinicians should be aware of drug eruptions due to TS-1.

  17. An immunologic approach to induction of epidermal growth factor deficiency

    DEFF Research Database (Denmark)

    Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....

  18. Anterior Gradient 2 (AGR2) Induced Epidermal Growth Factor Receptor (EGFR) Signaling Is Essential for Murine Pancreatitis-Associated Tissue Regeneration

    Science.gov (United States)

    Wodziak, Dariusz; Dong, Aiwen; Basin, Michael F.; Lowe, Anson W.

    2016-01-01

    A recently published study identified Anterior Gradient 2 (AGR2) as a regulator of EGFR signaling by promoting receptor presentation from the endoplasmic reticulum to the cell surface. AGR2 also promotes tissue regeneration in amphibians and fish. Whether AGR2-induced EGFR signaling is essential for tissue regeneration in higher vertebrates was evaluated using a well-characterized murine model for pancreatitis. The impact of AGR2 expression and EGFR signaling on tissue regeneration was evaluated using the caerulein-induced pancreatitis mouse model. EGFR signaling and cell proliferation were examined in the context of the AGR2-/- null mouse or with the EGFR-specific tyrosine kinase inhibitor, AG1478. In addition, the Hippo signaling coactivator YAP1 was evaluated in the context of AGR2 expression during pancreatitis. Pancreatitis-induced AGR2 expression enabled EGFR translocation to the plasma membrane, the initiation of cell signaling, and cell proliferation. EGFR signaling and tissue regeneration were partially inhibited by the tyrosine kinase inhibitor AG1478, but absent in the AGR2-/- null mouse. AG1478-treated and AGR2-/- null mice with pancreatitis died whereas all wild-type controls recovered. YAP1 activation was also dependent on pancreatitis-induced AGR2 expression. AGR2-induced EGFR signaling was essential for tissue regeneration and recovery from pancreatitis. The results establish tissue regeneration as a major function of AGR2-induced EGFR signaling in adult higher vertebrates. Enhanced AGR2 expression and EGFR signaling are also universally present in human pancreatic cancer, which support a linkage between tissue injury, regeneration, and cancer pathogenesis. PMID:27764193

  19. Anterior Gradient 2 (AGR2) Induced Epidermal Growth Factor Receptor (EGFR) Signaling Is Essential for Murine Pancreatitis-Associated Tissue Regeneration.

    Science.gov (United States)

    Wodziak, Dariusz; Dong, Aiwen; Basin, Michael F; Lowe, Anson W

    2016-01-01

    A recently published study identified Anterior Gradient 2 (AGR2) as a regulator of EGFR signaling by promoting receptor presentation from the endoplasmic reticulum to the cell surface. AGR2 also promotes tissue regeneration in amphibians and fish. Whether AGR2-induced EGFR signaling is essential for tissue regeneration in higher vertebrates was evaluated using a well-characterized murine model for pancreatitis. The impact of AGR2 expression and EGFR signaling on tissue regeneration was evaluated using the caerulein-induced pancreatitis mouse model. EGFR signaling and cell proliferation were examined in the context of the AGR2-/- null mouse or with the EGFR-specific tyrosine kinase inhibitor, AG1478. In addition, the Hippo signaling coactivator YAP1 was evaluated in the context of AGR2 expression during pancreatitis. Pancreatitis-induced AGR2 expression enabled EGFR translocation to the plasma membrane, the initiation of cell signaling, and cell proliferation. EGFR signaling and tissue regeneration were partially inhibited by the tyrosine kinase inhibitor AG1478, but absent in the AGR2-/- null mouse. AG1478-treated and AGR2-/- null mice with pancreatitis died whereas all wild-type controls recovered. YAP1 activation was also dependent on pancreatitis-induced AGR2 expression. AGR2-induced EGFR signaling was essential for tissue regeneration and recovery from pancreatitis. The results establish tissue regeneration as a major function of AGR2-induced EGFR signaling in adult higher vertebrates. Enhanced AGR2 expression and EGFR signaling are also universally present in human pancreatic cancer, which support a linkage between tissue injury, regeneration, and cancer pathogenesis.

  20. Role of hypoxia-related proteins in invasion of ameloblastoma cells: crosstalk between NOTCH1, hypoxia-inducible factor 1α, a disintegrin and metalloproteinase 12, and heparin-binding epidermal growth factor.

    Science.gov (United States)

    da Costa, Natacha Malu Miranda; Fialho, Amanda Dalla Vechia; Proietti, Carolina Carmine; da Silva Kataoka, Maria Sueli; Jaeger, Ruy Gastaldoni; de Alves-Júnior, Sérgio Melo; de Jesus Viana Pinheiro, João

    2016-07-01

    Ameloblastoma AME is a benign tumour characterized by local invasiveness, high recurrence rates, and diverse histological patterns. The oxygen concentration is reduced in specific areas of the tumour microenvironment, which leads to intratumoral hypoxia. Crosstalk between NOTCH1, a disintegrin and metalloproteinase 12 (ADAM-12), hypoxia-inducible factor 1α (HIF-1α) and heparin-binding epidermal growth factor (HB-EGF) under hypoxic conditions has been implicated in invadopodia formation, tumour invasiveness, and metastasis development. The aim of this study was to analyse the expression of these proteins, in order to further elucidate the mechanisms underlying AME invasiveness. Twenty cases of AME, eight calcifying cystic odontogenic tumours CCOTs and 10 samples of dental follicle were used to investigate the expression of these proteins by immunohistochemistry with the primary antibodies anti-NOTCH1, anti-ADAM-12, anti-HIF-1α, and anti-HB-EGF. Immunostaining results were expressed as the percentage of stained area in images acquired in an AxioScope microscope equipped with an AxioCamHRc camera and a × 40 objective. The results showed that immunoexpression of all proteins was higher in the AME samples than in the CCOT and dental follicle samples (P < 0.05). AME showed an increased presence of proteins associated with tumour invasiveness, which indicates a possible role of these proteins in the biological behaviour of this tumour. © 2015 John Wiley & Sons Ltd.

  1. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  2. Induced accessibility and inaccessibility to ¤Blumeria graminis¤ f.sp. ¤hordei¤ in barley epidermal cells attacked by a compatible isolate

    DEFF Research Database (Denmark)

    Lyngkjær, M.F.; Carver, T.L.W.

    1999-01-01

    First leaves of the barley line Riso-5678S were subjected to a double inoculation procedure ('inducer' followed by 'challenger') with conidia of a genetically compatible isolate of Blumeria graminis (DC.) Speer (Syn. Erysiphe graminis DC.). In control leaves, attacked by appressoria from a single...

  3. Topical Recombinant Human Epidermal Growth Factor for Oral Mucositis Induced by Intensive Chemotherapy with Hematopoietic Stem Cell Transplantation: Final Analysis of a Randomized, Double-Blind, Placebo-Controlled, Phase 2 Trial.

    Directory of Open Access Journals (Sweden)

    Ji-Won Kim

    Full Text Available The aim of this study was to evaluate the efficacy and safety of recombinant human epidermal growth factor (rhEGF oral spray for oral mucositis (OM induced by intensive chemotherapy with hematopoietic stem cell transplantation. In this phase 2 study, patients were randomized to either rhEGF (50 microg/mL or placebo in a 1:1 ratio. The primary endpoint was incidence of National Cancer Institute (NCI grade ≥2 OM. A total of 138 patients were enrolled in this study. In the intention-to-treat analysis, rhEGF did not reduce the incidence of NCI grade ≥2 OM (p = 0.717 nor reduce its duration (p = 0.725. Secondary endpoints including the day of onset and duration of NCI grade ≥2 OM, the incidence of NCI grade ≥3 OM and its duration, and patient-reported quality of life were also similar between the two groups. In the per-protocol analysis, however, the duration of opioid analgesic use was shorter in the rhEGF group (p = 0.036, and recipients in the rhEGF group required a lower cumulative dose of opioid analgesics than those in the placebo group (p = 0.046, among patients with NCI grade ≥2 OM. Adverse events were mild and transient. This study found no evidence to suggest that rhEGF oral spray reduces the incidence of OM. However, further studies are needed to investigate the effect of rhEGF on OM-induced pain reduction after intensive chemotherapy.

  4. Stereospecificity of ginsenoside Rg2 epimers in the protective response against UV-B radiation-induced oxidative stress in human epidermal keratinocytes.

    Science.gov (United States)

    Kang, Hyun-Ji; Huang, Yu-Hua; Lim, Hye-Won; Shin, Daehyun; Jang, Kyounghee; Lee, Yoonjin; Kim, Kyunghoon; Lim, Chang-Jin

    2016-12-01

    Ginseng, referring to the dried roots of Panax ginseng C.A. Meyer, has been known as a famous traditional folkloric medicine in East Asian countries for a long time. In recent years, it has been gaining a worldwide popularity as a dietary herbal supplement. Ginsenosides are bioactive ingredients that are responsible for most pharmacological efficacies of ginseng. Ginsenoside Rg2 (Rg2), one of minor protopanaxatriol (PPT)-type ginsenosides, exists in two epimeric forms, 20(S)-ginsenoside Rg2 [20(S)-Rg2] and 20(R)-ginsenoside Rg2 [20(R)-Rg2]. This work was undertaken to assess and compare their skin anti-photoaging properties. When they were applied to HaCaT keratinocytes prior to the irradiation, 20(S)-Rg2 only could attenuate the UV-B-induced intracellular reactive oxygen species (ROS) elevation, which were detected using three fluorescent ROS dyes, such as 2',7'-dichlorodihydrofluorescein diacetate, dihydroethidium and dihydrorhodamine 123. 20(S)-Rg2 but not 20(R)-Rg2 significantly attenuated the UV-B-induced promatrix metalloproteinase-2 (proMMP-2) gelatinolytic activity and protein levels. Likewise, 20(S)-Rg2 only augmented the UV-B-reduced total glutathione (GSH) and superoxide dismutase (SOD) activity levels in a concentration-dependent manner. Neither of the two Rg2 epimers was cytotoxic to HaCaT keratinocytes, regardless of UV-B irradiation. Taken together, of the two Rg2 epimers, 20(S)-Rg2 only possesses the stereospecific protective properties against the UV-B-induced skin photoaging in HaCaT keratinocytes. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Anti-skin-aging effect of epigallocatechin gallate by regulating epidermal growth factor receptor pathway on aging mouse model induced by d-Galactose.

    Science.gov (United States)

    Chen, Jiming; Li, Yifan; Zhu, Qiangqiang; Li, Tong; Lu, Hao; Wei, Nan; Huang, Yewei; Shi, Ruoyu; Ma, Xiao; Wang, Xuanjun; Sheng, Jun

    2017-06-01

    Epigallocatechin gallate(EGCG) is a monomer separated from tea catechins, as an well-known antioxidant, which helps fight wrinkles and rejuvenate skin cells. In this study, we investigated the anti-aging effect of EGCG, and to clarify underlying mechanism of skin aging in a d-galactose-induced aging mouse model. Forty-five male mice were divided into 5 groups and treated with different dose of EGCG, Vitamin C (VitC) to mice as a positive control. All groups except vehicle were established aging model induced by d-galactose (200mg/kg/day) that was subcutaneously injected to mice for 8 weeks. Two weeks after injection of d-galactose, EGCG and Vit C groups were simultaneously administered once a day by subcutaneously inject after 5h for injecting d-galactose. The results show that EGCG can be absorbed by the skin. Overall, the conditions of the skin of EGCG-treatment groups were improved, the whole structure of skin were better than control groups, and the levels of oxidative stress and the expression of relate with EGFR proteins were significantly higher than control group after EGCG treatment. All these findings suggest that EGCG can resist skin senility effectively. And the EGFR with relate of downstream proteins are implicated in the skin aging. Copyright © 2017. Published by Elsevier B.V.

  6. Blocking Epidermal Growth Factor Receptor Signaling in HTR-8/SVneo First Trimester Trophoblast Cells Results in Dephosphorylation of PKBα/AKT and Induces Apoptosis

    Directory of Open Access Journals (Sweden)

    J. Bolnick

    2011-01-01

    Full Text Available We identified a major peptide signaling target of EGF/EGFR pathway and explored the consequences of blocking or activating this pathway in the first trimester extravillous trophoblast cells, HTR-8/SVneo. A global analysis of protein phosphorylation was undertaken using novel technology (Kinexus Kinetworks that utilizes SDS-polyacrylamide minigel electrophoresis and multi-lane immunoblotting to permit specific and semiquantitative detection of multiple phosphoproteins. Forty-seven protein phosphorylation sites were queried, and the results reported based on relative phosphorylation at each site. EGF- and Iressa-(gefitinib, ZD1839, an inhibitor of EGFR treated HTR-8/SVneo cells were subjected to immunoblotting and flow cytometry to confirm the phosphoprotein screen and to assess the effects of EGF versus Iressa on cell cycle and apoptosis. EGFR mediates the phosphorylation of important signaling proteins, including PKBα/AKT. This pathway is likely to be central to EGFR-mediated trophoblast survival. Furthermore, EGF treatment induces proliferation and inhibits apoptosis, while Iressa induces apoptosis.

  7. Photoprotective properties of 20(S)-protopanaxatriol, an aglycone of ginseng saponins: Protection from ultraviolet-B radiation-induced oxidative stress in human epidermal keratinocytes.

    Science.gov (United States)

    Oh, Sun-Joo; Kim, Kyunghoon; Lim, Chang-Jin

    2016-09-01

    Ginsenosides are responsible for diverse pharmacological properties ascribed to ginseng, a plant used in traditional medicine. Ginsenosides are classified into three categories: Protopanaxadiol, protopanaxatriol (PPT) and oleanolic acid. As an aglycone of PPT-type ginsenosides, PPT exists in two stereoisomeric forms, 20(S)-PPT and 20(R)‑PPT. The 20(S)‑PPT stereoisomer is a major metabolic product of PPT‑type ginsenosides produced in the gastrointestinal tract. In the present study, 20(S)-PPT suppressed the elevation of reactive oxygen species in HaCaT cells following irradiation with ultraviolet (UV)‑B. In addition, 20(S)‑PPT inhibited UV‑B‑induced gelatinase activities of matrix metalloproteinase-2 and -9 in HaCaT cells, and suppressed UV‑B‑induced expression and secretion of these proteins. Accordingly, 20(S)‑PPT restored the total glutathione levels in UV‑B‑irradiated keratinocytes. Taken together, these data indicated that 20(S)‑PPT may possess photoprotective properties that combat the effects of UV‑B radiation.

  8. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  9. Post Herpes Zoster dermatome/s – a therapeutic ground for cutaneous T-cell lymphoma (CTCL & Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN

    Directory of Open Access Journals (Sweden)

    Ajith P. Kannangara

    2015-01-01

    Full Text Available The term isotopic response was coined by Wolf et al. in 1995 to describe the occurrence of a new skin disease at the site of a previous, unrelated and already healed cutaneous disorder [1]. Dermatome/s that have been infected by herpes zoster virus become breading sites for a subsequent development of heterogeneous skin disorders, the occurrence of which generate the well-defined ‘Wolf’s post-herpetic isotopic response’ [2,3].

  10. [Epidermal growth factor, innovation and safety].

    Science.gov (United States)

    Esquirol Caussa, Jordi; Herrero Vila, Elisabeth

    2015-10-05

    Bioidentical recombinant human epidermal growth factor (rhEGF) is available in concentrations and purity suitable for therapeutic use in long time stable formulations. Beneficial effects in several skin pathologies and lesions have been reported (traumatic and surgical wound healing, laser induced wounds, abnormal scars, keloids, radiation or chemotherapy induced dermatitis, post inflammatory hyperpigmentation or for skin aging damage repairing) and also may be considered for the treatment of several oropharingeal and high gastroesophageal tract mucosa diseases (mouth sores, pharyngeal fistulas, ulcers), and several corneal or conjunctive mucosa lesions. rhEGF has not shown any important side or collateral effects in humans or in laboratory experimentation animals, showing optimal tolerability and safety with continuous use for months. Compounding gives advantages of versatility, individualization, personalization, molecular stability, safety and effectiveness in ideal conditions, showing good tissue penetration, both on intact skin and skin lesions that expose the lower planes to the surface. rhEGF compounds can be considered for prevention or as a treatment of diverse skin and mucosa diseases and conditions through compounding preparations. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

  11. Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)

    2011-06-15

    We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.

  12. Interaction of epidermal growth factor receptors with the cytoskeleton is related to receptor clustering

    NARCIS (Netherlands)

    van Belzen, N.; Spaargaren, M.; Verkleij, A. J.; Boonstra, J.

    1990-01-01

    Recently it has been established that cytoskeleton-associated epidermal growth factor (EGF) receptors are predominantly of the high-affinity class and that EGF induces a recruitment of low-affinity receptors to the cytoskeleton. The nature of this EGF-induced receptor-cytoskeleton interaction,

  13. Epidermal electronic systems for sensing and therapy

    Science.gov (United States)

    Lu, Nanshu; Ameri, Shideh K.; Ha, Taewoo; Nicolini, Luke; Stier, Andrew; Wang, Pulin

    2017-04-01

    Epidermal electronic system is a class of hair thin, skin soft, stretchable sensors and electronics capable of continuous and long-term physiological sensing and clinical therapy when applied on human skin. The high cost of manpower, materials, and photolithographic facilities associated with its manufacture limit the availability of disposable epidermal electronics. We have invented a cost and time effective, completely dry, benchtop "cut-and-paste" method for the green, freeform and portable manufacture of epidermal electronics within minutes. We have applied the "cut-and-paste" method to manufacture epidermal electrodes, hydration and temperature sensors, conformable power-efficient heaters, as well as cuffless continuous blood pressure monitors out of metal thin films, two-dimensional (2D) materials, and piezoelectric polymer sheets. For demonstration purpose, we will discuss three examples of "cut-and-pasted" epidermal electronic systems in this paper. The first will be submicron thick, transparent epidermal graphene electrodes that can be directly transferred to human skin like a temporary transfer tattoo and can measure electrocardiogram (ECG) with signal-to-noise ratio and motion artifacts on par with conventional gel electrodes. The second will be a chest patch which houses both electrodes and pressure sensors for the synchronous measurements of ECG and seismocardiogram (SCG) such that beat-to-beat blood pressure can be inferred from the time interval between the R peak of the ECG and the AC peak of the SCG. The last example will be a highly conformable, low power consumption epidermal heater for thermal therapy.

  14. Epidermal growth factor receptor signaling in tissue

    Energy Technology Data Exchange (ETDEWEB)

    Shvartsman, Stanislav; Wiley, H. S.; Lauffenburger, Douglas A.

    2004-08-01

    Abstract: A peptide purified from the salivary gland of a mouse was shown few years ago to accelerate incisor eruption and eyelid opening in newborn mice, and was named epidermal growth factor (EGF). The members of this family of peptide growth factors had been identified in numerous physiological and pathological contexts. EGF binds to a cell surface EGF receptor, which induces a biochemical modification (phosphorylation) of the receptor's cytoplasmic tail. There is a growing consensus in the research community that, in addition to cellular and molecular studies, the dynamics of the EGFR network and its operation must be examined in tissues. A key challenge is to integrate the existing molecular and cellular information into a system-level description of the EGFR network at the tissue and organism level. In this paper, the two examples of EGFR signaling in tissues are described, and the recent efforts to model EGFR autocrine loops, which is a predominant mode of EGFR activation in vivo, are summarized.

  15. Active G protein-coupled receptors (GPCR), matrix metalloproteinases 2/9 (MMP2/9), heparin-binding epidermal growth factor (hbEGF), epidermal growth factor receptor (EGFR), erbB2, and insulin-like growth factor 1 receptor (IGF-1R) are necessary for trenbolone acetate-induced alterations in protein turnover rate of fused bovine satellite cell cultures.

    Science.gov (United States)

    Thornton, K J; Kamanga-Sollo, E; White, M E; Dayton, W R

    2016-06-01

    Trenbolone acetate (TBA), a testosterone analog, increases protein synthesis and decreases protein degradation in fused bovine satellite cell (BSC) cultures. However, the mechanism through which TBA alters these processes remains unknown. Recent studies indicate that androgens improve rate and extent of muscle growth through a nongenomic mechanism involving G protein-coupled receptors (GPCR), matrix metalloproteinases (MMP), heparin-binding epidermal growth factor (hbEGF), the epidermal growth factor receptor (EGFR), erbB2, and the insulin-like growth factor-1 receptor (IGF-1R). We hypothesized that TBA activates GPCR, resulting in activation of MMP2/9 that releases hbEGF, which activates the EGFR and/or erbB2. To determine whether the proposed nongenomic pathway is involved in TBA-mediated alterations in protein turnover, fused BSC cultures were treated with TBA in the presence or absence of inhibitors for GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R, and resultant protein synthesis and degradation rates were analyzed. Assays were replicated at least 9 times for each inhibitor experiment utilizing BSC cultures obtained from at least 3 different steers that had no previous exposure to steroid compounds. As expected, fused BSC cultures treated with 10 n TBA exhibited increased ( GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R suppressed ( GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R in the presence of 10 n TBA each had no ( > 0.05) effect on TBA-mediated decreases in protein degradation. However, inhibition of both EGFR and erbB2 in the presence of 10 n TBA resulted in decreased ( GPCR, MMP2/9, hbEGF, EGFR, erbB2, and IGF-1R. However, the mechanism through which TBA mediates changes in protein degradation is different and appears to involve only the EGFR and erbB2. Furthermore, it appears the protein kinase B pathway is involved in TBA's effects on fused BSC cultures.

  16. Rejuvenating Hydrator: Restoring Epidermal Hyaluronic Acid Homeostasis With Instant Benefits.

    Science.gov (United States)

    Narurkar, Vic A; Fabi, Sabrina G; Bucay, Vivian W; Tedaldi, Ruth; Downie, Jeanine B; Zeichner, Joshua A; Butterwick, Kimberly; Taub, Amy; Kadoya, Kuniko; Makino, Elizabeth T; Mehta, Rahul C; Vega, Virginia L

    2016-01-01

    Skin aging is a combination of multifactorial mechanisms that are not fully understood. Intrinsic and extrinsic factors modulate skin aging, activating distinctive processes that share similar molecular pathways. One of the main characteristics of youthful skin is its large capacity to retain water, and this decreases significantly as we age. A key molecule involved in maintaining skin hydration is hyaluronic acid (HA). Concentration of HA in the skin is determined by the complex balance between its synthesis, deposition, association with cellular structures, and degradation. HA bio-equivalency and bio-compatibility have been fundamental in keeping this macromolecule as the favorite of the skincare industry for decades. Scientific evidence now shows that topically applied HA is unable to penetrate the skin and is rapidly degraded on the skin surface. SkinMedica's HA5 Rejuvenating Hydrator (SkinMedica Inc., an Allergan company, Irvine, CA) promotes restoration of endogenous epidermal HA homeostasis and provides instant smoothing and hydration of the skin. These dual benefits are accomplished through the combination of 2 breakthrough technologies: 1) a unique blend of actives powered by SkinMedica proprietary flower-derived stem cell extract that restores the endogenous production of HA; and 2) a proprietary mix of 5 HA forms that plump the skin, decreasing the appearance of fine lines/wrinkles. Pre-clinical studies demonstrated that HA5 induces expression of key epidermal differentiation and barrier markers as well as epidermal HA synthases. A decrease expression of hyaluronidases was also observed upon HA5 application. Initial clinical studies showed that within 15 minutes of application, HA5 instantly improves the appearance of fine lines/wrinkles and skin hydration. Subjects that continue using HA5 (for 8 weeks) demonstrated significant improvements in fine lines/wrinkles, tactile roughness, and skin hydration. In summary, the blend of these 2 key technologies

  17. JACKDAW controls epidermal patterning in the Arabidopsis root meristem through a non-cell-autonomous mechanism.

    Science.gov (United States)

    Hassan, Hala; Scheres, Ben; Blilou, Ikram

    2010-05-01

    In Arabidopsis, specification of the hair and non-hair epidermal cell types is position dependent, in that hair cells arise over clefts in the underlying cortical cell layer. Epidermal patterning is determined by a network of transcriptional regulators that respond to an as yet unknown cue from underlying tissues. Previously, we showed that JACKDAW (JKD), a zinc finger protein, localizes in the quiescent centre and the ground tissue, and regulates tissue boundaries and asymmetric cell division by delimiting SHORT-ROOT movement. Here, we provide evidence that JKD controls position-dependent signals that regulate epidermal-cell-type patterning. JKD is required for appropriately patterned expression of the epidermal cell fate regulators GLABRA2, CAPRICE and WEREWOLF. Genetic interaction studies indicate that JKD operates upstream of the epidermal patterning network in a SCRAMBLED (SCM)-dependent fashion after embryogenesis, but acts independent of SCM in embryogenesis. Tissue-specific induction experiments indicate non-cell-autonomous action of JKD from the underlying cortex cell layer to specify epidermal cell fate. Our findings are consistent with a model where JKD induces a signal in every cortex cell that is more abundant in the hair cell position owing to the larger surface contact of cells located over a cleft.

  18. The increasing role of epidermal grafting utilizing a novel harvesting system in chronic wounds.

    Science.gov (United States)

    Serena, Thomas E

    2015-02-01

    Skin grafting techniques range from harvesting full-thickness to split-thickness grafts to grafts containing only epidermis. All of these autologous tissues have their place on the reconstructive ladder. However, the use of full-thickness and split-thickness grafts as coverage over chronic wounds remains limited by a number of factors, including the need for anesthesia, a surgically trained physician, and an operating room in which to perform the procedure; pain and damage associated with the donor site; and severe patient comorbidities. Epidermal grafting offers an option for autografts and uses only a minimal amount of superficial epidermis from the donor site. Although successful use of epidermal grafting has been reported in pigmentation disorders, as well as burns and chronic wounds, previous harvesting methods have been described as cumbersome and time consuming. An automated epidermal harvesting system is now commercially available and involves a tool that applies both heat and suction concurrently to normal skin to induce epidermal micrograft formation. The new tool allows quick harvest and transfer of the epidermal micrografts at the bedside without anesthesia, with minimal donor site healing time and patient discomfort. The use of epidermal grafts in chronic wounds and the harvesting technique are reviewed here.

  19. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  20. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  1. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  2. Sofosbuvir induced steven Johnson Syndrome in a patient with hepatitis C virus-related cirrhosis.

    Science.gov (United States)

    Verma, Nipun; Singh, Shreya; Sawatkar, Gitesh; Singh, Virendra

    2018-01-01

    Sofosbuvir is an imperative drug used in treatment regimens for hepatitis C virus (HCV). It is considered relatively safe with fewer adverse effects than other treatments. Here, we report a rare and potentially serious, dermatologic, adverse effect following the use of sofosbuvir. A 35-year-old man with genotype 3-related HCV cirrhosis presented with decompensated ascites and jaundice following 7 weeks of therapy with peginterferon alpha-2a and oral ribavirin. After peginterferon withdrawal and stabilization, oral sofosbuvir and ribavirin were started; 10 days later, he developed itching over the trunk and legs, followed by multiple papules and vesicles over an erythematous base. Over the next 15 days, the rash progressed with the formation of blisters and peeling skin. Simultaneously, the oral mucosa and lips developed crusting and painful erosions. Considering drug-induced Steven John Syndrome (SJS), sofosbuvir and ribavirin were withdrawn and the patient was treated with topical emollients, steroids, and supportive care. The lesions improved over the next 4 weeks, with some residual hyperpigmentation. Rechallenge with sofosbuvir alone at one eighth the dose resulted in similar skin and mucosal lesions after 2 months; these lesions also improved after sofosbuvir withdrawal. The Algorithm of Drug Causality for Epidermal Necrolysis score was 7, which suggested sofosbuvir as the very probable drug resulting in SJS in our patient. Conclusion: The appearance of SJS following sofosbuvir use is an important and potentially fatal complication from a drug that serves as the backbone of several HCV treatment regimens. Treating physicians must use sofosbuvir with caution and consider withholding or discontinuing this drug in patients with such severe dermatologic manifestations. ( Hepatology Communications 2018;2:16-20).

  3. Real-world efficiency of pharmacogenetic screening for carbamazepine-induced severe cutaneous adverse reactions.

    Directory of Open Access Journals (Sweden)

    Zhibin Chen

    Full Text Available OBJECTIVES: We evaluated the cost and efficiency of routine HLA-B*15 ∶ 02 screening to prevent carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis (CBZ-SJS/TEN in Hong Kong. METHODS: Data were extracted from patients who commenced CBZ as the first-ever AED treatment or tested for HLA-B*15 ∶ 02 allele in three years before policy implementation (pre-policy: 16 September 2005 to 15 September 2008 and three years after (post-policy: 16 September 2008 to 15 September 2011. Using published unit costs, we estimated the cost of screening by comparing the costs to prevent and treat CBZ-SJS/TEN. We compared the number of person-tests needed and the cost to prevent resultant death with cancer screening programs. RESULTS: The number of screening tests needed to prevent one case of CBZ-SJS/TEN was 442, and to prevent one resultant death was 1,474 to 8,840. The screening cost was $332 per person, of which 42% was attributed to an additional consultation to review result and prescribe appropriate medication. HLA-B*15 ∶ 02 screening expended $146,749 to prevent a case of CBZ-SJS/TEN, and $489,386- $2,934,986 to prevent a resultant death. The corresponding numbers of tests and costs for mammography and Pap smear to prevent death due to breast and cervical cancers were 7,150 and 7,000, and $614,900 and $273,000, respectively. Comparing to the SJS/TEN treatment cost, HLA-B*15 ∶ 02 screening would become cost saving if a point-of-care test of less than $37 was available. CONCLUSIONS: HLA-B*15 ∶ 02 screening is as efficient as mammography and Pap smear in preventing death. Development of point-of-care testing will vastly improve efficiency.

  4. Epidermal β-catenin activation remodels the dermis via paracrine signalling to distinct fibroblast lineages

    Science.gov (United States)

    Lichtenberger, Beate M.; Mastrogiannaki, Maria; Watt, Fiona M.

    2016-01-01

    Sustained epidermal Wnt/β-catenin signalling expands the stem cell compartment and induces ectopic hair follicles (EFs). This is accompanied by extensive fibroblast proliferation and extracellular matrix (ECM) remodelling in the underlying dermis. Here we show that epidermal Hedgehog (Hh) and Transforming growth factor-beta (TGF-β) signalling mediate the dermal changes. Pharmacological inhibition or genetic deletion of these pathways prevents β-catenin-induced dermal reprogramming and EF formation. Epidermal Shh stimulates proliferation of the papillary fibroblast lineage, whereas TGF-β2 controls proliferation, differentiation and ECM production by reticular fibroblasts. Hh inhibitors do not affect TGF-β target gene expression in reticular fibroblasts, and TGF-β inhibition does not prevent Hh target gene induction in papillary fibroblasts. However, when Hh signalling is inhibited the reticular dermis does not respond to epidermal β-catenin activation. We conclude that the dermal response to epidermal Wnt/β-catenin signalling depends on distinct fibroblast lineages responding to different paracrine signals. PMID:26837596

  5. Ofloxacin Induced Cutaneous Reactions in Children.

    Science.gov (United States)

    Ramani, Yerramalli Roja; Mishra, Sailen Kumar; Rath, Bandana; Rath, Saroj Sekhar

    2015-06-01

    Cutaneous adverse effects to antimicrobials are a major health problem. Though majority of them are mild and self-limiting, severe variants like Steven Johnson Syndrome (SJS), toxic epidermal necrolysis (TEN) are not uncommon. Ofloxacin, a fluoroquinolone widely used for the treatment of urinary tract infections, acute bacterial diarrheas, enteric fever, STDs and other soft tissue infections either as a single drug or in combination with other drugs. Earlier a case of mucocutaneous maculopapular rash with oral ofloxacin and was reported in an adult. In the present hospital set up there were few reports of such reactions to adults. Here we report three different variants of reactions associated with oral ofloxacin in chlidren. Early detection of cutaneous lesions and immediate withdrawal of the offending drug can prevent progression of such reactions to their severe variants as well as morbidity and mortality.

  6. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  7. Epidermal leaf characters of the Winteraceae

    NARCIS (Netherlands)

    Bongers, J.M.

    1973-01-01

    Leaf epidermal features (mostly studied in cuticular macerations) of 146 specimens, belonging to c. 33 species of all the 6 genera of the Winteraceae are described in detail. Typical for most representatives is the occurrence of alveolar material of cutinaceous nature overlying the cuticle proper,

  8. FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

    African Journals Online (AJOL)

    Administrator

    alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

  9. EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

    African Journals Online (AJOL)

    Administrator

    ABSTRACT. A study of the micro-morphology of 53 accessions of West African. Okra was undertaken using light microscopy techniques. Results showed that epidermal cells are polygonal, isodiametric and irregularly shaped with different anticlinal cell wall patterns. Stomata type is 100% paracytic and 100% amphistomatic ...

  10. Taxonomic significance of leaf epidermal anatomy of selected ...

    African Journals Online (AJOL)

    Leaf epidermal anatomy of selected Persicaria Mill. species of the family Polygonaceae revealed variation in size and shape of epidermal cells, stomata, glandular and non glandular trichomes. This study proves to be taxonomically important tool in the delimitation of taxa. Epidermal cell shapes are variable but mostly ...

  11. Angiopoietin-like 4 regulates epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Mintu Pal

    Full Text Available The nuclear hormone receptor PPARβ/δ is integral to efficient wound re-epithelialization and implicated in epidermal maturation. However, the mechanism underlying the latter process of epidermal differentiation remains unclear. We showed that ligand-activated PPARβ/δ indirectly stimulated keratinocyte differentiation, requiring de novo gene transcription and protein translation. Using organotypic skin cultures constructed from PPARβ/δ- and angiopoietin-like 4 (ANGPTL4-knockdown human keratinocytes, we showed that the expression of ANGPTL4, a PPARβ/δ target gene, is essential for the receptor mediated epidermal differentiation. The pro-differentiation effect of PPARβ/δ agonist GW501516 was also abolished when keratinocytes were co-treated with PPARβ/δ antagonist GSK0660 and similarly in organotypic skin culture incubated with blocking ANGPTL4 monoclonal antibody targeted against the C-terminal fibrinogen-like domain. Our focused real-time PCR gene expression analysis comparing the skin biopsies from wildtype and ANGPTL4-knockout mice confirmed a consistent down-regulation of numerous genes involved in epidermal differentiation and proliferation in the ANGPTL4-knockout skin. We further showed that the deficiency of ANGPTL4 in human keratinocytes and mice skin have diminished expression of various protein kinase C isotypes and phosphorylated transcriptional factor activator protein-1, which are well-established for their roles in keratinocyte differentiation. Chromatin immunoprecipitation confirmed that ANGPTL4 stimulated the activation and binding of JUNB and c-JUN to the promoter region of human involucrin and transglutaminase type 1 genes, respectively. Taken together, we showed that PPARβ/δ regulates epidermal maturation via ANGPTL4-mediated signalling pathway.

  12. Dual oxidase 2 generated reactive oxygen species selectively mediate the induction of mucins by epidermal growth factor in enterocytes.

    Science.gov (United States)

    Damiano, Simona; Morano, Annalisa; Ucci, Valentina; Accetta, Roberta; Mondola, Paolo; Paternò, Roberto; Avvedimento, V Enrico; Santillo, Mariarosaria

    2015-03-01

    Dual oxidase 2 enzyme is a member of the reactive oxygen species-generating cell membrane NADPH oxidases involved in mucosal innate immunity. It is not known if the biological activity of dual oxidase 2 is mediated by direct bacterial killing by reactive oxygen species produced by the enzyme or by the same reactive oxygen species acting as second messengers that stimulate novel gene expression. To uncover the role of reactive oxygen species and dual oxidases as signaling molecules, we have dissected the pathway triggered by epidermal growth factor to induce mucins, the principal protective components of gastrointestinal mucus. We show that dual oxidase 2 is essential for selective epidermal growth factor induction of the transmembrane MUC3 and the secreted gel-forming MUC5AC mucins. Reactive oxygen species generated by dual oxidase 2 stabilize tyrosine phosphorylation of epidermal growth factor receptor and induce MUC3 and MUC5AC through persistent activation of extracellular signal-regulated kinases 1/2-protein kinase C. Knocking down dual oxidase 2 by selective RNA targeting (siRNA) reduced epidermal growth factor receptor phosphorylation, and MUC3 and MUC5AC gene expression. Extracellular reactive oxygen species produced by dual oxidase 2, upon stimulation by epidermal growth factor, stabilize epidermal growth factor receptor phosphorylation and activate extracellular signal-regulated kinases 1/2-protein kinase C which induce MUC5AC and MUC3. Extracellular reactive oxygen species produced by dual oxidase 2 that are known to directly kill bacteria, also contribute to the maintenance of the epidermal growth factor-amplification loop, which induces mucins. These data suggest a new function of dual oxidase 2 protein in the luminal protection of the gastrointestinal tract through the induction of mucin expression by growth factors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Cicatrizing Conjunctivitis in a Patient Diagnosed With Drug Reaction With Eosinophilia and Systemic Symptoms/Drug-Induced Hypersensitivity Syndrome but With Features of Stevens-Johnson Syndrome.

    Science.gov (United States)

    Bohm, Kelley J; Ciralsky, Jessica B; Harp, Joanna L; Bajaj, Shirin; Sippel, Kimberly C

    2016-06-01

    Severe cutaneous adverse reactions to drugs (SCARs) such as Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) and drug reaction with eosinophilia and systemic symptoms/drug-induced hypersensitivity syndrome (DRESS/DIHS) serve as one of the main reasons for inpatient ophthalmic consultation. Although it is well-recognized that SJS/TEN is associated with severe ocular mucosal inflammation and cicatrizing, potentially blinding, sequelae, this association has not been described in relation to other SCARs. We present a patient fulfilling the diagnostic criteria for probable DRESS/DIHS but not for SJS/TEN, yet exhibiting the severe ocular surface involvement characteristic of SJS/TEN. Case report. A 64-year-old man presented with bilateral pseudomembranous conjunctivitis and conjunctival denudation (sloughing) in the setting of a maculopapular rash, fever, liver dysfunction, and hematologic abnormalities 1 month after initiating several medications. A skin biopsy was not consistent with SJS/TEN. The patient was diagnosed with probable DRESS/DIHS and treated with high-dose systemic corticosteroids. The ocular surface inflammation was addressed with intensive topical corticosteroid ointment. The pseudomembranes resolved over a 6-week period, but the patient exhibited residual conjunctival scarring of all palpebral surfaces. The development of severe ocular surface mucosal inflammation and denudation with cicatrizing sequelae in a patient carrying a diagnosis of DRESS/DIHS has diagnostic and therapeutic implications for the ophthalmologist. Careful ophthalmic assessment is indicated in any SCAR patient with ophthalmic symptoms, regardless of formal diagnosis. Furthermore, the early therapeutic interventions recently recommended in SJS/TEN to limit the ophthalmic cicatricial sequelae, such as systemic or topical corticosteroids, may be indicated.

  14. Downregulation of interferon-γ-induced protein 10 in the tears of patients with Stevens-Johnson syndrome with severe ocular complications in the chronic stage.

    Science.gov (United States)

    Ueta, Mayumi; Nishigaki, Hiromi; Sotozono, Chie; Kinoshita, Shigeru

    2017-01-01

    Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are acute inflammatory vesiculobullous reactions of the skin and mucosa such as the ocular surface, oral cavity and genitals. Severe ocular complications (SOC) arise in some patients with SJS/TEN diagnosed by dermatologists. To investigate the pathophysiology of ocular surface inflammation in SJS/TEN with SOC in the chronic stage, we examined cytokines in the tears of patients with ocular surface diseases and healthy controls. SJS/TEN eyes in the chronic stage (n>30), healthy eyes (n>20, controls) and eyes (n>20) from patients with atopic keratoconjunctivitis representing different ocular surface inflammatory disorders. Tear samples were collected on Schirmer's measurement strips. To measure the level of various cytokines in the tears we used BD CBA Flex sets. An observational study (case-control study). We recorded the level of interleukin (IL)-6, IL-8, eotaxin, macrophage inflammatory protein (MIP)-1β, RANTES (regulated on activation, normal T cell expressed and secreted), interferon gamma (IFN)-γ, monocyte chemoattractant protein-1, IFN-γ-induced protein 10 (IP-10) and total IgE. We found that compared with the controls, in SJS/TEN with SOC, IL-6, IL-8, eotaxin and MIP-1β were significantly upregulated while IP-10 was significantly downregulated. Compared with atopic keratoconjunctivitis, IP-10 was significantly downregulated in SJS/TEN with SOC; on the other hand, total IgE was significantly upregulated in atopic keratoconjunctivitis compared with SJS/TEN with SOC. IP-10 in tears may be a biomarker to distinguish between chronic SJS/TEN with SOC and other ocular inflammatory disorders such as atopic keratoconjunctivitis.

  15. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  16. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

    1975-12-01

    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin.

  17. Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Hugo Nodarse-Cuní

    2013-03-01

    Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.

  18. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  19. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  20. Impact of the HLA-B(*)58:01 Allele and Renal Impairment on Allopurinol-Induced Cutaneous Adverse Reactions.

    Science.gov (United States)

    Ng, Chau Yee; Yeh, Yu-Ting; Wang, Chuang-Wei; Hung, Shuen-Iu; Yang, Chih-Hsun; Chang, Ya-Ching; Chang, Wan-Chun; Lin, Yu-Jr; Chang, Chee-Jen; Su, Shih-Chi; Fan, Wen-Lang; Chen, Der-Yuan; Wu, Yeong-Jian Jan; Tian, Ya-Chung; Hui, Rosaline Chung-Yee; Chung, Wen-Hung

    2016-07-01

    Allopurinol, a common drug for treating hyperuricemia, is associated with cutaneous adverse drug reactions ranging from mild maculopapular exanthema to life-threatening severe cutaneous adverse reactions, including drug reaction with eosinophilia and systemic symptoms, Stevens-Johnson syndrome, and toxic epidermal necrolysis. We have previously reported that HLA-B*58:01 is strongly associated with allopurinol-induced severe cutaneous adverse reactions in Han Chinese, but the associations of the HLA-B*58:01 genotype in an allopurinol-induced hypersensitivity phenotype remain unclear. To investigate the comprehensive associations of HLA-B*58:01, we enrolled 146 patients with allopurinol-induced cutaneous adverse drug reactions (severe cutaneous adverse reactions, n = 106; maculopapular exanthema, n = 40) and 285 allopurinol-tolerant control subjects. Among these allopurinol-induced cutaneous adverse drug reactions, HLA-B*58:01 was strongly associated with severe cutaneous adverse reactions (odds ratio [OR] = 44.0; 95% confidence interval = 21.5-90.3; P = 2.6 × 10(-41)), and the association was correlated with disease severity (OR = 44.0 for severe cutaneous adverse reactions, OR = 8.5 for maculopapular exanthema). The gene dosage effect of HLA-B*58:01 also influenced the development of allopurinol-induced cutaneous adverse drug reactions (OR = 15.25 for HLA-B*58:01 heterozygotes and OR = 72.45 for homozygotes). Furthermore, coexistence of HLA-B*58:01 and renal impairment increased the risk and predictive accuracy of allopurinol-induced cutaneous adverse drug reactions (heterozygous HLA-B*58:01 and normal renal function: OR = 15.25, specificity = 82%; homozygous HLA-B*58:01 and severe renal impairment: OR = 1269.45, specificity = 100%). This HLA-B*58:01 correlation study suggests that patients with coexisting HLA-B*58:01 and renal impairment (especially estimated glomerular filtration rate < 30ml/minute/1.73 m(2)) should be cautious and avoid using

  1. Mechanistic Evaluation of Hydration Effects on the Human Epidermal Permeation of Salicylate Esters.

    Science.gov (United States)

    Yousef, Shereen; Mohammed, Yousuf; Namjoshi, Sarika; Grice, Jeffrey; Sakran, Wedad; Roberts, Michael

    2017-01-01

    We sought to understand when and how hydration enhances the percutaneous absorption of salicylate esters. Human epidermal membrane fluxes and stratum corneum solubilities of neat and diluted solutions of three esters were determined under hydrated and dehydrated conditions. Hydration doubled the human epidermal flux seen for methyl and ethyl salicylate under dehydrated conditions and increased the flux of neat glycol salicylate 10-fold. Mechanistic analyses showed that this hydration-induced enhancement arises mainly from an increase in the stratum corneum diffusivity of the three esters. Further, we showed that unlike methyl and ethyl salicylate, glycol salicylate is hygroscopic and the ∼10-fold hydration-induced flux enhancement seen with neat glycol salicylate may be due to its ability to hydrate the stratum corneum to a greater extent. The hydration-induced enhancements in in vitro epidermal flux seen here for glycol and ethyl salicylate were similar to those reported for their percutaneous absorption rates in a comparable in vivo study, whilst somewhat higher enhancement was seen for methyl salicylate in vivo. This may be explained by a physiologically induced self enhancement of neat methyl salicylate absorption in vivo which is not applicable in vitro.

  2. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy; Modelo de radionecrose cutanea induzida em camundongos Nude (Nu/Nu) para desenvolvimento de terapias regenerativas baseadas em substitutos dermo-epidermicos humanos

    Energy Technology Data Exchange (ETDEWEB)

    Mosca, Rodrigo Crespo

    2014-07-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  3. Late onset epidermal nevus with hypertrichosis and facial hemihypertrophy

    Directory of Open Access Journals (Sweden)

    M Saritha

    2014-01-01

    Full Text Available Epidermal nevus syndromes are rare conditions, characterized by different types of keratinocytic or organoid epidermal nevi in association with ocular, neurological, and skeletal manifestations. We present a case of late onset epidermal nevus with hypertrichosis and hemihypertrophy of face. Genetic analysis did not reveal presence of FGFR3 or PIK3CA mutations. The patient has features that cannot be categorized into the present well-known syndromes.

  4. Late onset epidermal nevus with hypertrichosis and facial hemihypertrophy.

    Science.gov (United States)

    Saritha, M; Chandrashekar, Laxmisha; Thappa, Devinder Mohan; Ramesh, A; Basu, Debdatta

    2014-03-01

    Epidermal nevus syndromes are rare conditions, characterized by different types of keratinocytic or organoid epidermal nevi in association with ocular, neurological, and skeletal manifestations. We present a case of late onset epidermal nevus with hypertrichosis and hemihypertrophy of face. Genetic analysis did not reveal presence of FGFR3 or PIK3CA mutations. The patient has features that cannot be categorized into the present well-known syndromes.

  5. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  6. Fetal effects of epidermal growth factor deficiency induced in rats by autoantibodies against epidermal growth factor

    DEFF Research Database (Denmark)

    Raaberg, Lasse; Nexø, Ebba; Jørgensen, P E

    1995-01-01

    and a lower birth weight. The weight of the lungs was particularly low in the offspring of EGF-immunized rats, and morphologically the lungs from the surviving pups seemed atelectatic and had alveolar duct dilatation, which indicates mild respiratory distress syndrome. Judged from immunohistochemical studies......, the amount of surfactant protein-A was decreased, suggesting a delayed lung maturation. The offspring of EGF-immunized rats had dry and wrinkled skin. The skin was thin and the hair follicles were immature. This suggests a role for EGF in the growth and development of the skin. The liver/body weight ratio...... was lower in pups from EGF-immunized rats. This difference was, however, not significant (p = 0.07), but flow cytometric analyses showed a significantly lower proportion of the liver cells from newborn EGF-deficient pups to be in S-phase and indicated that these cells were larger than liver cells from...

  7. Giant epidermal cyst of the tarsal plate

    Directory of Open Access Journals (Sweden)

    Mohana Majumdar

    2012-01-01

    Full Text Available A 35-year-old male patient presented with a right upper eyelid mass with mechanical ptosis. The patient gave no history of trauma or surgery. On examination, there was a huge cystic mass fixed to the tarsal plate. Excisional biopsy with tarsectomy was done. Histopathology sections demonstrated a keratin-filled cyst arising from the tarsus. A thorough Pubmed search did not reveal an epidermal cyst of the tarsal plate of this size which was successfully managed. The incision was made in such a way that postoperative ptosis would be avoided. Excess skin was removed during the surgery.

  8. Ras activation by insulin and epidermal growth factor through enhanced exchange of guanine nucleotides on p21ras

    NARCIS (Netherlands)

    Medema, R.H.; Vries-Smits, A.M. de; Zon, G.C.M. van der; Maassen, J.A.; Bos, J.L.

    1993-01-01

    A number of growth factors, including insulin and epidermal growth factor (EGF), induce accumulation of the GTP-bound form of p21ras. This accumulation could be caused either by an increase in guanine nucleotide exchange on p21ras or by a decrease in the GTPase activity of p21ras. To investigate

  9. Cultured epidermal stem cells in regenerative medicine.

    Science.gov (United States)

    Jackson, Catherine J; Tønseth, Kim Alexander; Utheim, Tor Paaske

    2017-07-04

    Transplantation of cultured epidermal cell sheets (CES) has long been used to treat patients with burns, chronic wounds, and stable vitiligo. In patients with large area burns this can be a life-saving procedure. The ultimate goal, however, is to restore all normal functions of the skin and prevent scar formation. Increased focus on the incorporation of epidermal stem cells (EpiSCs) within CES transplants may ultimately prove to be key to achieving this. Transplanted EpiSCs contribute to restoring the complete epidermis and provide long-term renewal.Maintenance of the regenerative potential of EpiSCs is anchorage-dependent. The extracellular matrix (ECM) provides physical cues that are interpreted by EpiSCs and reciprocal signaling between cells and ECM are integrated to determine cell fate. Thus, the carrier scaffold chosen for culture and transplant influences maintenance of EpiSC phenotype and may enhance or detract from regenerative healing following transfer.Long-term effectiveness and safety of genetically modified EpiSCs to correct the severe skin blistering disease epidermolysis bullosa has been shown clinically. Furthermore, skin is gaining interest as an easily accessible source of adult epithelial stem cells potentially useful for restoration of other types of epithelia. This review highlights the role of EpiSCs in the current treatment of skin injury and disease, as well as their potential in novel regenerative medicine applications involving other epithelia.

  10. Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice

    Directory of Open Access Journals (Sweden)

    Azahara Rodríguez-Luna

    2017-12-01

    Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.

  11. Role of Epidermal Growth Factor Receptors and Their Ligands in Normal Mammary Epithelial and Breast Cancer Cells

    Science.gov (United States)

    1997-07-01

    Birkedal-Hansen H 1993 Interleukin-1 3 and transforming growth factor-u,/epidermal growth factor induce expression of 56 Darcy, Kathleen M. Mr 95,000...Ellis I 0, Blamey R W 1994 Epidermal growth factor receptor expression in breast cancer: association with response to endocrine therapy. Breast Cancer...Distribution Statement 2. Point of contact for this request is Ms. Judy Pawlus at DSN 343-7322 or email: judy pawlus@ftdetrck-ccmail.army.mil. FOR THE COMMANDER: PHYLTS AM.RINEHART Deputy Chief of Staff for Information Management

  12. Iontophoresis and sonophoresis stimulate epidermal cytokine expression at energies that do not provoke a barrier abnormality: lamellar body secretion and cytokine expression are linked to altered epidermal calcium levels.

    Science.gov (United States)

    Choi, Eung Ho; Kim, Min Jung; Yeh, Byung-Il; Ahn, Sung Ku; Lee, Seung Hun

    2003-11-01

    We performed this study to identify whether the expression of epidermal cytokines is altered by changes in epidermal calcium content, independent of skin barrier disruption. Iontophoresis and sonophoresis with the energies that do not disrupt the skin barrier, but induce changes in the epidermal calcium gradient, were applied to the skin of hairless mice. Immediately after iontophoresis and sonophoresis, immersion in a solution containing calcium was carried out, and iontophoresis in either high- or low-calcium solutions was performed. The biopsy specimens were taken for real-time quantitative RT-PCR to detect changes in mRNA level of interleukin-1alpha (IL-1alpha), tumor necrosis factor-alpha (TNF-alpha), and transforming growth factor-beta in the epidermis and for immunohistochemical stain with primary antibodies to IL-1alpha and TNF-alpha. The expression of each cytokine mRNA increased in the epidermis treated with iontophoresis and sonophoresis compared to a nontreated control as well as in tape-stripped skin used as a positive control and was lower after immersion in a high-calcium solution than in low-calcium solution. IL-1alpha and TNF-alpha immunohistochemical protein staining increased with iontophoresis at low calcium. These studies suggest that changes in epidermal calcium can directly signal expression of epidermal cytokines in vivo, independent of changes in barrier function.

  13. Pulmonary Proteases in the Cystic Fibrosis Lung Induce Interleukin 8 Expression from Bronchial Epithelial Cells via a Heme/Meprin/Epidermal Growth Factor Receptor/Toll-like Receptor Pathway.

    LENUS (Irish Health Repository)

    Cosgrove, Sonya

    2011-03-04

    A high intrapulmonary protease burden is characteristic of cystic fibrosis (CF), and the resulting dysregulation of the protease\\/anti-protease balance has serious implications for inflammation in the CF lung. Because of this inflammation, micro-bleeds can occur releasing hemoglobin into the lung. The aim of this study was to investigate the effect of the protease-rich environment of the CF lung on human hemoglobin and to assess the proinflammatory effect of heme on CF bronchial epithelium. Here, we show that the Pseudomonas proteases (Pseudomonas elastase and alkaline protease) and the neutrophil proteases (neutrophil elastase (NE) and proteinase-3) are capable of almost complete degradation of hemoglobin in vitro but that NE is the predominant protease that cleaves hemoglobin in vivo in CF bronchoalveolar lavage fluid. One of the effects of this is the release of heme, and in this study we show that heme stimulates IL-8 and IL-10 protein production from ΔF508 CFBE41o(-) bronchial epithelial cells. In addition, heme-induced IL-8 expression utilizes a novel pathway involving meprin, EGF receptor, and MyD88. Meprin levels are elevated in CF cell lines and bronchial brushings, thus adding to the proinflammatory milieu. Interestingly, α(1)-antitrypsin, in addition to its ability to neutralize NE and protease-3, can also bind heme and neutralize heme-induced IL-8 from CFBE41o(-) cells. This study illustrates the proinflammatory effects of micro-bleeds in the CF lung, the process by which this occurs, and a potential therapeutic intervention.

  14. Pulmonary proteases in the cystic fibrosis lung induce interleukin 8 expression from bronchial epithelial cells via a heme/meprin/epidermal growth factor receptor/Toll-like receptor pathway.

    LENUS (Irish Health Repository)

    Cosgrove, Sonya

    2012-02-01

    A high intrapulmonary protease burden is characteristic of cystic fibrosis (CF), and the resulting dysregulation of the protease\\/anti-protease balance has serious implications for inflammation in the CF lung. Because of this inflammation, micro-bleeds can occur releasing hemoglobin into the lung. The aim of this study was to investigate the effect of the protease-rich environment of the CF lung on human hemoglobin and to assess the proinflammatory effect of heme on CF bronchial epithelium. Here, we show that the Pseudomonas proteases (Pseudomonas elastase and alkaline protease) and the neutrophil proteases (neutrophil elastase (NE) and proteinase-3) are capable of almost complete degradation of hemoglobin in vitro but that NE is the predominant protease that cleaves hemoglobin in vivo in CF bronchoalveolar lavage fluid. One of the effects of this is the release of heme, and in this study we show that heme stimulates IL-8 and IL-10 protein production from DeltaF508 CFBE41o(-) bronchial epithelial cells. In addition, heme-induced IL-8 expression utilizes a novel pathway involving meprin, EGF receptor, and MyD88. Meprin levels are elevated in CF cell lines and bronchial brushings, thus adding to the proinflammatory milieu. Interestingly, alpha(1)-antitrypsin, in addition to its ability to neutralize NE and protease-3, can also bind heme and neutralize heme-induced IL-8 from CFBE41o(-) cells. This study illustrates the proinflammatory effects of micro-bleeds in the CF lung, the process by which this occurs, and a potential therapeutic intervention.

  15. Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

    Directory of Open Access Journals (Sweden)

    Michelle T Juarez

    2011-12-01

    Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

  16. Epidermal Inclusion Cyst after Breast Reconstruction with TRAM Flaps

    International Nuclear Information System (INIS)

    Kang, Eun Ju; Lee, Jin Hwa; Kown, Hee jin; Ha, Dong Ho; Nam, Kyeong Jin; Jung, Jin Sook; Kim, Eun Kyeong; Park, Young Mi

    2010-01-01

    We report our experience about a case of an epidermal inclusion cyst in a 50-year-old female who underwent a total mastectomy and breast reconstruction with TRAM (transverse rectus abdominis myocutaneous) flaps for the breast cancer. We also discussed the radiologic possibilities of the epidermal inclusion cyst after having undergone reconstruction surgery

  17. Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

    African Journals Online (AJOL)

    Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

  18. An Outbreak of Exudative Epidermitis in Baconers in Zimbabwe ...

    African Journals Online (AJOL)

    ... there was pyoderma, lichenification and focal necrosis with numerous colonies of gram positive cocci in the epidermis and dermis. Pseudocarcinomas hyperplasia was prominent. A diagnosis of exudative epidermitis was made. This confirms the existence of exudative epidermitis in Zimbabwe. The Kenya Veterinarian Vol ...

  19. ZNF750 is expressed in differentiated keratinocytes and regulates epidermal late differentiation genes.

    Directory of Open Access Journals (Sweden)

    Idan Cohen

    Full Text Available Disrupted skin barrier due to altered keratinocyte differentiation is common in pathologic conditions such as atopic dermatitis, ichthyosis and psoriasis. However, the molecular cascades governing keratinocyte terminal differentiation are poorly understood. We have previously demonstrated that a dominant mutation in ZNF750 leads to a clinical phenotype reminiscent of psoriasis and seborrheic dermatitis. Here we show that ZNF750 is a nuclear protein bearing a functional C-terminal nuclear localization signal. ZNF750 was specifically expressed in the epidermal suprabasal layers and its expression was augmented during differentiation, both in human skin and in-vitro, peaking in the granular layer. Silencing of ZNF750 in Ca2+-induced HaCaT keratinocytes led to morphologically apparent arrest in the progression of late differentiation, as well as diminished apoptosis and sustained proliferation. ZNF750 knockdown cells presented with markedly reduced expression of epidermal late differentiation markers, including gene subsets of epidermal differentiation complex and skin barrier formation such as FLG, LOR, SPINK5, ALOX12B and DSG1, known to be mutated in various human skin diseases. Furthermore, overexpression of ZNF750 in undifferentiated cells induced terminal differentiation genes. Thus, ZNF750 is a regulator of keratinocyte terminal differentiation and with its downstream targets can serve in future elucidation of therapeutics for common diseases of skin barrier.

  20. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  1. Diagnosis and management of drug-induced stevens-johnson syndrome: Report of two cases

    Directory of Open Access Journals (Sweden)

    M Venkateshwarlu

    2011-01-01

    Full Text Available Erythema multiforme (EM is a typically mild, self-limiting and recurring mucocutaneous reaction characterized by target or iris lesions of the skin and mucous membranes. It is most often a recurring phenomenon with great variability in the interval between episodes. It is much more common in persons under 40 years of age. In contrast, Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are less common and more severe conditions that typically occur in adults. SJS and TEN are severe variants of EM usually caused by a drug exposure. We report two cases of Stevens-Johnsons syndrome following drug intake. There is an increased incidence of SJS and TEN in the HIV-infected population. 1 Herewith, we report two cases of Stevens-Johnson syndrome in one patient following drug intake and other in a HIV-infected patient.

  2. Stimulation of epidermal calcium gradient loss increases the expression of hyaluronan and CD44 in mouse skin.

    Science.gov (United States)

    Lee, S-E; Jun, J-E; Choi, E-H; Ahn, S-K; Lee, S-H

    2010-08-01

    Hyaluronan (HA), a major extracellular matrix component in epidermis, has been found to accumulate in the epidermis after disruption of the epidermal barrier; however, the precise mechanisms underlying this process are not yet clear. Alterations in the epidermal calcium gradient are an important signal for permeability-barrier homeostasis. Thus, we hypothesized that epidermal calcium-ions might regulate HA expression. To investigate whether changes in the epidermal calcium gradient and subsequent induction of cytokines regulate HA, HA synthase (HAS) and HA receptor (CD44) expression in mouse epidermis, and to clarify the mechanisms of HA induction. Sonophoresis of 1.5 mmol/L Ca(2+)-containing gel or Ca(2+)-free gel was performed to manipulate the epidermal Ca(2+) content without disrupting the permeability barrier. We also manipulated the Ca(2+) gradient by tape-stripping with or without 2 h immersion in 1.2 mmol/L Ca(2+)-containing solutions. Next we inhibited cytokine activity using tumour necrosis factor (TNF)-alpha or interleukin (IL)-1 inhibitors before sonophoresis. Six hours after each treatment, the expression of HA, HAS and CD44 were analysed using reverse transcription PCR and immunohistochemical stains. Sonophoresis of Ca(2+)-free gel significantly increased HA, HAS3 and CD44 expression in epidermis and in tape-stripped skin. However, the inhibition of Ca(2+) decrease in the upper epidermis by sonophoresis of Ca(2+)-containing gel or immersion of barrier-disrupted skin into a Ca(2+)-containing solution attenuated these inductions. Specific inhibitors of TNF-alpha and IL-1 specific inhibitors also abolished the sonophoresis-induced expression of HA, HAS3 and CD44. These results suggest that modulations in epidermal calcium regulate HA and CD44 expression directly or via induction of cytokines.

  3. Epidermal collagenase activity and its induction by 20-hydroxyecdysone in the fiddler crab Uca pugilator

    Directory of Open Access Journals (Sweden)

    Erin A. TOUPS

    2009-02-01

    Full Text Available The epidermal collagenase activity and its induction by 20-hydroxyecdysone in Uca pugilator were investigated. Zymographic electrophoresis showed four bands of collagenase activity, 16, 19, 22 and 29 kDa in molecular weight, with the former two accounting for 60% and 36%, respectively, of the total collagenase activity. The collagenase activity varies during the molting cycle. Among the molt stages tested, Premolt Stage D0 exhibited the highest epidermal collagenase activity for both the 16 and 19 kDa isoenzymes and, as the molt stage proceeded, the enzymatic activity of these two isoenzymes decreased, with the lowest activity for both found in Premolt Stage D3–4. Injection of 20-hydroxyecdysone significantly induced the activity of the 16 kDa collagenase in the epidermis of Uca pugilator, suggesting that the activity of this isoenzyme is under molting hormone control. Although 20-hydroxyecdysone injection did not result in a statistically significant increase in the activity of the 19 kDa isoenzyme, a tendency of the induction was nonetheless demonstrated. This is the first report on epidermal collagenase activity and its induction by the molting hormone in a crustacean [Current Zoology 55(1: 75–80, 2009].

  4. Histamine exerts multiple effects on expression of genes associated with epidermal barrier function.

    Science.gov (United States)

    Gutowska-Owsiak, D; Salimi, M; Selvakumar, T A; Wang, X; Taylor, S; Ogg, G S

    2014-01-01

    The role of epidermal barrier genes in the pathogenesis of atopic skin inflammation has recently been highlighted. Cytokines that are abundant in the skin during inflammation have been shown to exert various effects on the expression of barrier genes, although the role of histamine in this area of skin biology is not yet fully understood. To assess the effect of stimulation with histamine on keratinocytes by analysis of the pathways involved in epidermal barrier integrity. We performed a gene expression analysis of histamine-stimulated keratinocytes. Functional changes were tested using the dye penetration assay. Differential changes in filaggrin and the filaggrin-processing enzyme bleomycin hydrolase (BLMH) were validated at the protein level, and expression was also assessed in filaggrin knock-down keratinocytes. Histamine altered expression of multiple barrier genes. Expression of filaggrin was downregulated, as was that of other markers, thus suggesting the presence of delayed/aberrant keratinocyte differentiation. Expression of genes involved in cellular adhesiveness and genes of protease expression was dysregulated, but expression of protease inhibitors was increased. BLMH was upregulated in keratinocytes subjected to histamine and filaggrin knockdown. Histamine exerts a dual effect on epidermal barrier genes; it suppresses keratinocyte differentiation and dysregulates genes of cellular adhesiveness, although it induces genes contributing to stratum corneum function. Upregulation of BLMH and protease inhibitors could support maintenance of the permeability barrier by enhanced generation of moisturizing compounds and suppressed desquamation. In contrast, in the case of stratum corneum damage, histamine could enhance transcutaneous sensitization.

  5. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

    Science.gov (United States)

    Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

    2017-05-01

    High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

  6. Imaging sulfur mustard lesions in human epidermal tissues and keratinocytes by confocal and multiphoton microscopy

    Science.gov (United States)

    Werrlein, Robert; Madren-Whalley, Janna S.

    2002-06-01

    Topical exposure to sulfur mustard (HD), a known theat agent, produces persistent and debilitating cutaneous blisters. The blisters occur at the dermal-epidermal junction following a dose-dependent latent period of 8-24 h, however, the primary lesions causing vesication remain uncertain. Immunofluorescent images reveal that a 5-min exposure to 400 (mu) M HD disrupts molecules that are also disrupted by epidermolysis bullosa-type blistering diseases of the skin. Using keratinocyte cultures and fluorochomes conjugated to two different keratin-14 (K14) antibodies (clones CKB1 and LL002), results have shown a statistically significant (p<0.1) 1-h decrease of 29.2% in expression of the CKB1 epitope, a nearly complete loss of CKB1 expression within 2 h, and progressive cytoskeletal (K14) collapse without loss in expression of the LL002 epitope. With human epidermal tissues, multi-photon images of (alpha) 6 integrin and laminin 5 showed disruptive changes in the cell-surface organization and integrity of these adhesion molecules. At 1 H postexposure, analyses showed a statistically significant (p<0.1) decrease of 27.3% in (alpha) 6 integrin emissions, and a 32% decrease in laminin 5 volume. Multi-photon imaging indicates that molecules essential for epidermal-dermal attachment are early targets in the alkylating events leading to HD-induced vesication.

  7. Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

    Science.gov (United States)

    Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

    2014-01-01

    Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

  8. Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2013-01-01

    Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.

  9. Gastric luminal epidermal growth factor is affected by diet

    African Journals Online (AJOL)

    , L Mapele, K 0 Awotedu ... This study looked at the associations between intragastric epidermal growth factor level, diet and ... Department of Surgery, Gloucestershire Royal Hospital, UK. AM Sammon MD, FRCS. December 2004, Vol. 94, No.

  10. Giant epidermal cyst of the foot

    Directory of Open Access Journals (Sweden)

    Malkoc Melih

    2014-01-01

    Full Text Available Introduction. Epidermoid inclusion cysts are usually composed of epidermal elements implanted into the dermal layers. Patients are seen in the outpatient clinics with a mass. Most of the complaints are mechanical and cosmetic problems. Case Outline. A 34-year-old female patient was admitted to our clinic because of swelling and pain in her right foot. A palpable mass was detected in the first web. On the x-rays of the foot no osseous lesion was detected. There was a soft tissue mass in the first web according to MRI report. Soft tissue mass was excised and sent to pathology. According to pathology report the mass was an epidermoid cyst 5Ч2Ч1.5 cm in size. There were no problems during follow-up of the patient for 6 months after surgery. The patient had no swelling in the foot and had no additional complaints on checkup. Conclusion. In the differential diagnosis, we should take into consideration epidermoid cyst of large soft tissue masses of the foot. Surgical excision should be done within the appropriate limits.

  11. Epidermal Inorganic Optoelectronics for Blood Oxygen Measurement.

    Science.gov (United States)

    Li, Haicheng; Xu, Yun; Li, Xiaomin; Chen, Ying; Jiang, Yu; Zhang, Changxing; Lu, Bingwei; Wang, Jian; Ma, Yinji; Chen, Yihao; Huang, Yin; Ding, Minquang; Su, Honghong; Song, Guofeng; Luo, Yi; Feng, X

    2017-05-01

    Flexible and stretchable optoelectronics, built-in inorganic semiconductor materials, offer a wide range of unprecedented opportunities and will redefine the conventional rigid optoelectronics in biological application and medical measurement. However, a significant bottleneck lies in the brittleness nature of rigid semiconductor materials and the performance's extreme sensitivity to the light intensity variation due to human skin deformation while measuring physical parameters. In this study, the authors demonstrate a systematic strategy to design an epidermal inorganic optoelectronic device by using specific strain-isolation design, nanodiamond thinning, and hybrid transfer printing. The authors propose all-in-one suspension structure to achieve the stretchability and conformability for surrounding environment, and they propose a two-step transfer printing method for hybrid integrating III-V group emitting elements, Si-based photodetector, and interconnects. Owing to the excellent flexibility and stretchability, such device is totally conformal to skin and keeps the constant light transmission between emitting element and photodetector as well as the signal stability due to skin deformation. This method opens a route for traditional inorganic optoelectronics to achieve flexibility and stretchability and improve the performance of optoelectronics for biomedical application. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Radioreceptor assay for epidermal growth factor

    International Nuclear Information System (INIS)

    Ladda, R.L.; Bullock, L.P.; Gianopoulos, T.; McCormick, L.

    1979-01-01

    An established cell line of human lung fibroblasts with a high number of surface receptors for mouse epidermal growth factor (mEGF) was used to deveop a simple and highly sensitive radioreceptor assay for EGF. 125 I-Labeled mEGF competed mole for mole with unlabeled mEGF for specific receptors. Optimal range for discriminating EGF concentrations in body fluids and tissue extracts by a competitive binding assay was between 5 and 100 ng/ml. Interassay correlation of variation was 8.47% and the recovery of highly purified mEGF added to serum and urine samples was greater than 95%. Human serum and amniotic fluids contained about 24 and 4 ng/ml, respectively, of mEGF equivalents. Concentrations of mEGF in mouse urine and serum were highly variable and were 2- to 10-fold greater than that previously detected by radioimmune assay. Hypophysectomy nearly abolished submaxillary mEGF content in both male and female mice, but testosterone treatment of hypophysectomized animals restored normal concentrations of mEGF to the glands. mEGF added to culture medium disappeared with time as a function of the number of cellular EGF receptors indicating cellular degradation of the growth factor. The radioreceptor assay for EGF is based on the close biologic relationship between the cell receptor site and the native hormone and should prove to be a useful complementary tool to characterize the physiological role of EGF

  13. Giant epidermal inclusion cyst masquerading as a soft tissue sarcoma

    Directory of Open Access Journals (Sweden)

    Hunter Phillips

    2018-02-01

    Full Text Available Epidermal inclusion cysts (EIC are common lesions formed by the invagination and cystic expansion of the epidermis or hair follicle. We present an unusual case of an epidermal inclusion cyst masquerading as a soft tissue sarcoma based on initial clinical presentation and radiographic findings. Mischaracterization of this type of lesion may lead to unnecessary diagnostic modalities or invasive, overly-aggressive surgery.

  14. Autologous epidermal cell suspension: A promising treatment for chronic wounds.

    Science.gov (United States)

    Zhao, Hongliang; Chen, Yan; Zhang, Cuiping; Fu, Xiaobing

    2016-02-01

    Chronic wounds have become an increasing medical and economic problem of aging societies because they are difficult to manage. Skin grafting is an important treatment method for chronic wounds, which are refractory to conservative therapy. The technique involving epidermal cell suspensions was invented to enable the possibility of treating larger wounds with only a small piece of donor skin. Both uncultured and cultured autologous epidermal cell suspensions can be prepared and survive permanently on the wound bed. A systematic search was conducted of EMBASE, Cochrane Library, PubMed and web of science by using Boolean search terms, from the establishment of the database until May 31, 2014. The bibliographies of all retrieved articles in English were searched. The search terms were: (epithelial cell suspension OR keratinocyte suspension) and chronic and wound. From the included, 6 studies are descriptive interventions and discussed the use of autologous keratinocyte suspension to treat 61 patients' chronic wound. The various methods of preparation of epidermal cell suspension are described. The advantages and shortcomings of different carriers for epidermal cell suspensions are also summarised. Both uncultured and cultured autologous epidermal cell suspensions have been used to treat chronic wounds. Although the limitations of these studies include the small number of patient populations with chronic wounds and many important problems that remain to be solved, autologous epidermal cell suspension is a promising treatment for chronic wounds. Copyright © 2015 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  15. Temporal dynamics of epidermal responses of guppies Poecilia reticulata to a sublethal range of waterborne zinc concentrations.

    Science.gov (United States)

    Gheorghiu, C; Marcogliese, D J; Scott, M E

    2009-12-01

    This study assessed the histological changes in the epidermis of guppies Poecilia reticulata induced by waterborne zinc (Zn). Laboratory-reared P. reticulata fry were maintained individually in separate vessels containing artificial water (8 microg l(-1) Zn) to which 0, 15, 30, 60 or 120 microg l(-1) Zn was added. Their epidermal response to Zn was monitored regularly over 4 weeks. Compared with controls, mucus was rapidly released and mucous cell numbers decreased at all concentrations. Thereafter mucous release, epidermal thickness, numbers and size of mucous cells fluctuated at a rate that varied with Zn concentration, but fluctuations declined after day 18. Results clearly highlight the dynamic nature of the epidermal response to sublethal concentrations of waterborne Zn. In general, low concentrations of Zn induced a rapid response with reduced numbers and size of mucous cells and shift in mucin composition, and a subsequent thickening of the epidermis. Epidermal thickness and mucous cell area fluctuated over time but were normal after a month of exposure to low Zn concentrations. The number of mucous cells, however, remained low. Virtually all mucous cells from fish maintained in 15 and 60 microg l(-1) Zn contained acidic mucins throughout the month, whereas fish maintained at 30 microg l(-1) Zn responded by production of neutral mucins during the first 12 days followed by a mixture of neutral and acidic mucins. At 120 microg l(-1) Zn, the most dramatic effects were the gradual but sustained decrease in numbers and area of mucous cells, and the shift to acidic mucins in these cells. Thus, as concentration of Zn increased, the epidermal responses indicated a disturbed host response (dramatic decline in mucous cell numbers, with mixed composition of mucins), which may have been less effective in preventing Zn uptake across the epithelium.

  16. Induction of suppression of delayed type hypersensitivity to herpes simplex virus by epidermal cells exposed to UV-irradiated urocanic acid in vivo

    International Nuclear Information System (INIS)

    Ross, J.A.; Howie, S.E.; Norval, M.; Maingay, J.P.

    1987-01-01

    Urocanic acid (UCA), the putative photoreceptor for ultraviolet radiation (UV)-induced suppression, undergoes a UV-dependent trans to cis isomerisation. Epidermal cells from mice painted with UCA, containing a known proportion of the cis-isomer, generate suppression of the delayed type hypersensitivity response to herpes simplex virus type 1 (HSV-1) when transferred to naive syngeneic recipients at the same time and site as infection with HSV-1. One T suppressor cell subset, of phenotype (Thy1+, L3T4+, Ly2-), is induced by the cis-UCA modified epidermal cell transfer. Flow cytometric analysis of the epidermal cells from skin treated with UV or cis-UCA indicates an overall reduction from normal in the number of cells expressing MHC Class II antigens, but no alteration in the number expressing I-J antigens

  17. Chronic treatment with epidermal growth factor causes esophageal epithelial hyperplasia in pigs and rats

    DEFF Research Database (Denmark)

    Juhl, C O; Vinter-Jensen, Lars; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) is an important factor for maintaining the esophageal functional integrity. Goettingen minipigs were treated with either placebo or subcutaneous EGF (30 micrograms/kg/day) for four weeks. Wistar rats were treated with either placebo or subcutaneous EGF (150 micrograms....... Subcutaneously administered EGF was visualized on cells located basally in the esophageal epithelium. In rats, EGF-treatment increased the esophageal volume of the epithelium, the lamina propria of the mucosa, and the submucosa. In conclusion, systemic EGF challenge induces growth of the esophageal epithelium...

  18. Differential gene expression in individual papilla-resistant and powdery mildew-infected barley epidermal cells

    DEFF Research Database (Denmark)

    Gjetting, T.; Carver, Timothy L. W.; Skøt, Leif

    2004-01-01

    leading to papilla deposition and reinforcement of their cell wall. This conveys a race-nonspecific form of resistance. However, this defense is not complete, and a proportion of penetration attempts succeed in infection. The resultant mixture of infected and uninfected leaf cells makes it impossible...... separately. Contents of single epidermal cells (resistant, infected, and unattacked controls) were collected, and after cDNA synthesis and PCR amplification, the resulting sample was hybridized to dot-blots spotted with genes, including some previously reported to be induced upon pathogen attack. Transcripts...

  19. Fluorescence lifetime to image epidermal ionic concentrations

    Science.gov (United States)

    Behne, Martin J.; Barry, Nicholas P.; Moll, Ingrid; Gratton, Enrico; Mauro, Theodora M.

    2004-09-01

    Measurements of ionic concentrations in skin have traditionally been performed with an array of methods which either did not reveal detailed localization information, or only provided qualitative, not quantitative information. FLIM combines a number of advantages into a method ideally suited to visualize concentrations of ions such as H+ in intact, unperturbed epidermis and stratum corneum (SC). Fluorescence lifetime is dye concentration-independent, the method requires only low light intensities and is therefore not prone to photobleaching or phototoxic artifacts, and because multiphoton lasers of IR wavelength are used, light penetrates deep into intact tissue. The standard method to measure SC pH is the flat pH electrode, which provides reliable information only about surface pH changes, without further vertical or subcellular spatial resolution; i.e., specific microdomains such as the corneocyte interstices are not resolved, and the deeper SC is inaccessible without resorting to inherently disruptive stripping methods. Furthermore, the concept of a gradient of pH through the SC stems from such stripping experiments, but other confirmation for this concept is lacking. Our investigations into the SC pH distribution so far have revealed the crucial role of the Sodium/Hydrogen Antiporter NHE1 in generation of SC acidity, the colocalization of enzymatic lipid processing activity in the SC with acidic domains of the SC, and the timing and localization of emerging acidity in the SC of newborns. Together, these results have led to an improved understanding of the SC pH, its distribution, origin, and regulation. Future uses for this method include measurements of other ions important for epidermal processes, such as Ca2+, and a quantitative approach to topical drug penetration.

  20. Epidermal growth factor and growth in vivo

    International Nuclear Information System (INIS)

    Rhodes, J.A.

    1986-01-01

    Epidermal growth factor (EGF) causes a dose-dependent thickening of the epidermis in suckling mice. The cellular mechanisms underlying this thickening were analyzed by measuring the effect of EGF on the cell-cycle. Neonatal mice were given daily injections of either 2ug EGF/g body weight/day or an equivalent volume of saline, and on the seventh day received a single injection of 3 H-thymidine. At various times the mice were perfused with fixative; 1um sections of skin were stained with a modification of Harris' hematoxylin and were autoradiographed. The sections were analyzed using three methods based on the dependence on time after injection of 3 H-thymidine of: frequency of labelled mitoses, labelling index, and reciprocal grains/nucleus. It was found that EGF caused a two-fold increase in the cell production rate. The effect of exogenous EGF on the morphology of gastric mucosa and incisors of suckling mice was also studied. The gastric mucosa appeared thicker in EGF-treated animals, but the effect was not statistically significant. In contrast to its effect on epidermis and gastric mucosa, EGF caused a significant, dose-dependent decrease in the size of the incisors. Because the mouse submandibular salivary gland is the major source of EGF the effect of sialoadenectomy on female reproductive functions was examined. Ablation of the submandibular gland had no effect on: length of estrus cycle, ability of the female to produce litters, length of the gestation period, litter size, and weight of the litter at birth. There was also no effect on survival of the offspring or on age at which the eyelids separated

  1. Overexpression of hedgehog signaling is associated with epidermal tumor formation in vitamin D receptor-null mice.

    Science.gov (United States)

    Teichert, Arnaud E; Elalieh, Hashem; Elias, Peter M; Welsh, JoEllen; Bikle, Daniel D

    2011-11-01

    The vitamin D receptor (VDR) ligand, 1,25 dihydroxyvitamin D(3) (1,25(OH)(2)D(3)), reduces proliferation and enhances differentiation, and thus has been investigated for a role in preventing or treating cancer. Mice deficient for the VDR display a hyperproliferative response in the hair follicle and epidermis and decreased epidermal differentiation. Unlike their wild-type littermates, when treated with 7,12 dimethylbenzanthracene (DMBA) or UVB, they develop skin tumors, including some characteristic of overexpression of the hedgehog (Hh) pathway. Both the epidermis and utricles of the VDR-null animals overexpress elements of the Hh pathway (sonic hedgehog (Shh) 2.02-fold, patched1 1.58-fold, smoothened 3.54-fold, glioma-associated oncogene homolog (Gli)1 1.17-fold, and Gli2 1.66-fold). This overexpression occurs at an age (11 weeks) at which epidermal hyperproliferation is most visible and is spatially controlled in the epidermis. DMBA- or UVB-induced tumors in the VDR-null mice also overexpress elements of this pathway. Moreover, 1,25(OH)(2)D(3) downregulates the expression of some members of the Hh pathway in an epidermal explants culture system, suggesting a direct regulation by 1,25(OH)(2)D(3). Our results suggest that increased expression of Shh in the keratinocytes of the VDR-null animal activates the Hh pathway, predisposing the skin to the development of both malignant and benign epidermal neoplasms.

  2. Short communication: Effects of Lactobacillus helveticus-fermented milk on the differentiation of cultured normal human epidermal keratinocytes.

    Science.gov (United States)

    Baba, H; Masuyama, A; Takano, T

    2006-06-01

    Effects of Lactobacillus helveticus-fermented milk whey on the differentiation of normal human epidermal keratinocytes were studied. Analysis using real-time reverse transcription-polymerase chain reaction revealed that addition of Lactobacillus helveticus-fermented milk whey to the culture medium enhanced mRNA expression of keratin 10, an early differentiation marker, as well as involucrin, a late differentiation marker. Whey of artificially acidified milk, prepared by the addition of dl-lactic acid to milk instead of fermentation, also promoted expression of both markers, but Lactobacillus helveticus-fermented milk whey was more effective in increasing expression of those markers. These results indicate that milk whey has the potential to induce multiple stages of keratinocyte differentiation and that fermentation with Lactobacillus helveticus increases that activity. Furthermore, we examined the expression of profilaggrin, which increases with epidermal terminal differentiation, and found that Lactobacillus helveticus-fermented milk whey enhanced expression of profilaggrin mRNA in a dose-dependent manner. Expression also occurred to a greater extent than with artificially acidified milk whey or other whey samples prepared with several lactic acid bacterial species. Because the proteolytically processed form of profilaggrin, filaggrin, is very important for normal epidermal hydration and flexibility, our results indicate that Lactobacillus helveticus-fermented milk whey has the potential to enhance the production of filaggrin-related natural moisturizing factor, because of its effect on the induction of epidermal differentiation, and is expected to be a useful skin moisturizing agent.

  3. [PENS (papular epidermal nevus with "skyline" basal cell layer)].

    Science.gov (United States)

    Pernet, C; Munoz, J; Bessis, D

    2015-01-01

    PENS is a rare neuro-cutaneous syndrome that has been recently described. It involves one or more congenital epidermal hamartomas of the papular epidermal nevus with "skyline" basal cell layer type (PENS) as well as non-specific neurological anomalies. Herein, we describe an original case in which the epidermal hamartomas are associated with autism spectrum disorder (ASD). A 6-year-old boy with a previous history of severe ASD was referred to us for asymptomatic pigmented congenital plaques on the forehead and occipital region. Clinical examination revealed a light brown verrucous mediofrontal plaque in the form of an inverted comma with a flat striated surface comprising coalescent polygonal papules, and a clinically similar round occipital plaque. Repeated biopsies revealed the presence of acanthotic epidermis covered with orthokeratotic hyperkeratosis with occasionally broadened epidermal crests and basal hyperpigmentation, pointing towards an anatomoclinical diagnosis of PENS. A diagnosis of PENS hamartoma was made on the basis of the clinical characteristics and histopathological analysis of the skin lesions. This condition is defined clinically as coalescent polygonal papules with a flat or rough surface, a round or comma-like shape and light brown coloring. Histopathological examination showed the presence of a regular palisade "skyline" arrangement of basal cell epidermal nuclei which, while apparently pathognomonic, is neither a constant feature nor essential for diagnosis. Association of a PENS hamartoma and neurological disorders allows classification of PENS as a new keratinocytic epidermal hamartoma syndrome. The early neurological signs, of varying severity, are non-specific and include psychomotor retardation, learning difficulties, dyslexia, hyperactivity, attention deficit disorder and epilepsy. There have been no reports hitherto of the presence of ASD as observed in the case we present. This new case report of PENS confirms the autonomous nature

  4. Cost-effectiveness analysis of HLA-B*5801 testing in preventing allopurinol-induced SJS/TEN in Thai population.

    Directory of Open Access Journals (Sweden)

    Surasak Saokaew

    Full Text Available BACKGROUND: Stevens-Johnson syndrome (SJS and Toxic Epidermal Necrolysis (TEN, caused by allopurinol therapy, are strongly associated with the human leukocyte antigen (HLA, HLA-B*5801. Identification of HLA-B*5801 genotype before prescribing allopurinol offers the possibility of avoiding allopurinol-induced SJS/TEN. As there is a paucity of evidence about economic value of such testing, this study aims to determine the cost-effectiveness of HLA-B*5801 testing compared with usual care (no genetic testing before allopurinol administration in Thailand. METHODS AND FINDING: A decision analytical and Markov model was used to estimate life time costs and outcomes represented as quality adjusted life years (QALYs gained. The model was populated with relevant information of the association between gene and allopurinol-induced SJS/TEN, test characteristics, costs, and epidemiologic data for Thailand from a societal perspective. Input data were obtained from the literature and a retrospective database analysis. The results were expressed as incremental cost per QALY gained. A base-case analysis was performed for patients at age 30. A series of sensitivity analyses including scenario, one-way, and probabilistic sensitivity analyses were constructed to explore the robustness of the findings. Based on a hypothetical cohort of 1,000 patients, the incremental total cost was 923,919 THB (USD 29,804 and incremental QALY was 5.89 with an ICER of 156,937.04 THB (USD 5,062 per QALY gained. The cost of gout management, incidence of SJS/TEN, case fatality rate of SJS/TEN, and cost of genetic testing are considered very influential parameters on the cost-effectiveness value of HLA-B*5801 testing. CONCLUSIONS: The genetic testing for HLA-B*5801 before allopurinol administration is considered a highly potential cost-effective intervention in Thailand. The findings are sensitive to a number of factors. In addition to cost-effectiveness findings, consideration of other

  5. Alterações morfológicas induzidas por butirato, propionato e lactato sobre a mucosa ruminal e a epiderme de bezerros: I Aspectos histológicos Lactate, propionate and, butyrate induced morphological alterations on calf ruminal mucosa and epidermis: I Histologycals aspects

    Directory of Open Access Journals (Sweden)

    S.F. Costa

    2008-02-01

    Full Text Available Dezessete bezerros foram utilizados para avaliar o efeito de ácidos graxos voláteis (AGV sobre a morfologia ruminal, a epiderme do plano nasolabial, a epicera e o perioplum, e para validar a execução de biópsias tegumentares como indicadores de alterações da mucosa ruminal. Os animais receberam infusões intra-ruminal de butirato, propionato, lactato ou salina (controle durante 37 dias. A insulina sorológica foi dosada no 22º dia experimental nos tempos de 0, 90, 180 e 360 minutos em relação à infusão diária da manhã. No 89º dia de vida, após o abate, foram coletados fragmentos ruminais e epidérmicos. Todos os AGV induziram aumento proporcionalmente maior no peso do ruminorretículo que no peso do omaso, sendo o butirato aparentemente mais estimulador da massa do estômago aglandular. Embora o butirato tenha sido mais estimulador da secreção de insulina, os AGV foram incapazes de induzir ganho nas dimensões papilares. Os AGV aumentaram a proliferação celular nos epitélios do rúmen e do perioplum traseiro, contrariamente ao efeito sobre o plano nasolabial e a epicera. Os efeitos dos AGV sobre a morfologia da mucosa ruminal e de outros tecidos queratinizados sugerem que danos morfológicos no rúmen e cascos podem ter causa comum. Biópsias tegumentares podem ter utilidade como indicadores de alterações morfológicas da mucosa ruminal.The effect of butyrate, propionate, and lactate on ruminal wall, epidermis of nasolabial surface, perioplum, and epicera of 17 neonatal calves was evaluated. The experiment also aimed to validate the procedure and interpretation of tegument biopsies as indicators of ruminal mucosa alterations. Serum insulin was sampled on the 22nd day from the beginning of treatments, at 0, 90, 180, and 360 minutes after the morning infusion. After slaughtering, samples were collected from ruminal wall, nasolabial surface, epicera, and perioplum from face and hindquarters. All volatile fatty acids (VFA

  6. Rapid and dynamic subcellular reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics responses to fungal and oomycete attack

    Directory of Open Access Journals (Sweden)

    Takemoto Daigo

    2008-06-01

    Full Text Available Abstract Background Plant cells respond to the presence of potential fungal or oomycete pathogens by mounting a basal defence response that involves aggregation of cytoplasm, reorganization of cytoskeletal, endomembrane and other cell components and development of cell wall appositions beneath the infection site. This response is induced by non-adapted, avirulent and virulent pathogens alike, and in the majority of cases achieves penetration resistance against the microorganism on the plant surface. To explore the nature of signals that trigger this subcellular response and to determine the timing of its induction, we have monitored the reorganization of GFP-tagged actin, microtubules, endoplasmic reticulum (ER and peroxisomes in Arabidopsis plants – after touching the epidermal surface with a microneedle. Results Within 3 to 5 minutes of touching the surface of Arabidopsis cotyledon epidermal cells with fine glass or tungsten needles, actin microfilaments, ER and peroxisomes began to accumulate beneath the point of contact with the needle. Formation of a dense patch of actin was followed by focusing of actin cables on the site of contact. Touching the cell surface induced localized depolymerization of microtubules to form a microtubule-depleted zone surrounding a dense patch of GFP-tubulin beneath the needle tip. The concentration of actin, GFP-tubulin, ER and peroxisomes remained focused on the contact site as the needle moved across the cell surface and quickly dispersed when the needle was removed. Conclusion Our results show that plant cells can detect the gentle pressure of a microneedle on the epidermal cell surface and respond by reorganizing subcellular components in a manner similar to that induced during attack by potential fungal or oomycete pathogens. The results of our study indicate that during plant-pathogen interactions, the basal defence response may be induced by the plant's perception of the physical force exerted by the

  7. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Science.gov (United States)

    GUZMÁN-URIBE, Daniela; ALVARADO-ESTRADA, Keila Neri; PIERDANT-PÉREZ, Mauricio; TORRES-ÁLVAREZ, Bertha; SÁNCHEZ-AGUILAR, Jesus Martin; ROSALES-IBÁÑEZ, Raúl

    2017-01-01

    Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%), meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group). Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues. PMID:28403359

  8. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  9. Immune sensitization against epidermal antigens in polymorphous light eruption

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B. (Univ. of San Luis Potosi (Mexico))

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption.

  10. Do epidermal lens cells facilitate the absorptance of diffuse light?

    Science.gov (United States)

    Brodersen, Craig R; Vogelmann, Thomas C

    2007-07-01

    Many understory plants rely on diffuse light for photosynthesis because direct light is usually scattered by upper canopy layers before it strikes the forest floor. There is a considerable gap in the literature concerning the interaction of direct and diffuse light with leaves. Some understory plants have well-developed lens-shaped epidermal cells, which have long been thought to increase the absorption of diffuse light. To assess the role of epidermal cell shape in capturing direct vs. diffuse light, we measured leaf reflectance and transmittance with an integrating sphere system using leaves with flat (Begonia erythrophylla, Citrus reticulata, and Ficus benjamina) and lens-shaped epidermal cells (B. bowerae, Colocasia esculenta, and Impatiens velvetea). In all species examined, more light was absorbed when leaves were irradiated with direct as opposed to diffuse light. When leaves were irradiated with diffuse light, more light was transmitted and more was reflected in both leaf types, resulting in absorptance values 2-3% lower than in leaves irradiated with direct light. These data suggest that lens-shaped epidermal cells do not aid the capture of diffuse light. Palisade and mesophyll cell anatomy and leaf thickness appear to have more influence in the capture and absorption of light than does epidermal cell shape.

  11. The effects of chronic administration of epidermal growth factor (EGF) to rats on the levels of endogenous EGF in the submandibular glands and kidneys

    DEFF Research Database (Denmark)

    Vinter-Jensen, Lars; Jøgensen, P E; Poulsen, Steen Seier

    1996-01-01

    Epidermal growth factor (EGF) is mainly produced in the submandibular glands (SMG) and in the kidneys. It has recently been reported that EGF-related ligands may induce their own biosynthesis (autoinduction) in vitro. In the present paper, we investigated whether chronic systemic treatment with EGF...

  12. Epidermal growth factor-receptor interaction in rat pheochromocytoma (PC12) and human epidermoid A431 cells: Biochemical and ultrastructural studies

    NARCIS (Netherlands)

    Laat, S.W. de; Boonstra, J.; Mummery, C.L.; Defize, L.; Leunissen, J.; Verkleij, A.J.

    1984-01-01

    Pheochromocytoma cells (clone PC12) have specific plasmamembrane receptors for both epidermal growth factor (EGF) and nerve growth factor (NGF). These growth factors have however, opposite biological effects in PC12 cells; EGF acts mitogenically, while NGF induces differentiation and causes

  13. Systemic treatment with epidermal growth factor but not insulin-like growth factor I decreases the involution of the prostate in castrated rats

    DEFF Research Database (Denmark)

    Tørring, N; Vinter-Jensen, L; Sørensen, Flemming Brandt

    2000-01-01

    Epidermal growth factor (EGF) and insulin-like growth factor I (IGF-I) are strong inducers of proliferation to prostate cells cultured in serum-free medium. Accordingly we wanted to study the growth of the prostate gland in castrated rats after treatment with EGF, IGF-I and testosterone. Castrated...

  14. Epidermal growth factor in mammary glands and milk from rats

    DEFF Research Database (Denmark)

    Thulesen, J; Raaberg, Lasse; Nexø, Ebba

    1993-01-01

    Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

  15. Inhibition of epidermal growth factor receptor by ferulic acid and 4-vinylguaiacol in human breast cancer cells.

    Science.gov (United States)

    Sudhagar, S; Sathya, S; Anuradha, R; Gokulapriya, G; Geetharani, Y; Lakshmi, B S

    2018-02-01

    To examine the potential of ferulic acid and 4-vinylguaiacol for inhibiting epidermal growth factor receptor (EGFR) in human breast cancer cells in vitro. Ferulic acid and 4-vinylguaiacol limit the EGF (epidermal growth factor)-induced breast cancer proliferation and new DNA synthesis. Western blot analysis revealed both ferulic acid and 4-vinylguaiacol exhibit sustained inhibition of EGFR activation through down-regulation of Tyr 1068 autophosphorylation. Molecular docking analysis shows ferulic acid forming hydrogen bond interaction with Lys 745 and Met 793 whereas, 4-vinylguaiacol forms two hydrogen bonds with Phe 856 and exhibits stronger hydrophobic interactions with multiple amino acid residues at the EGFR kinase domain. Ferulic acid and 4-vinylguaiacol could serve as a potential structure for the development of new small molecule therapeutics against EGFR.

  16. The involvement of polyphenols and peroxidase activities in heavy-metal accumulation by epidermal glands of the waterlily (Nymphaeaceae).

    Science.gov (United States)

    Lavid, N; Schwartz, A; Yarden, O; Tel-Or, E

    2001-02-01

    Co-localization of polyphenols and peroxidase activity was demonstrated in epidermal glands of the waterlily (Nymphaea) by histochemistry. Total phenols, tannins and peroxidase activity were determined quantitatively in plant extracts. Polyphenols were partially identified and were found to consist mainly of hydrolyzable tannins, gallic and tannic acid derivatives. Nymphaea polyphenols were shown to chelate Cr, Hg, and Pb in vitro, and Cd-binding by polymerized polyphenols was demonstrated in leaves exposed to Cd in vivo. Both polyphenols and peroxidases were found at very high constitutive levels, which were not induced or altered by external conditions, such as light and heavy-metal stress. It is suggested that the polymerization of polyphenols by peroxidases, enhanced after heavy-metal uptake and detoxification, is responsible for the binding of heavy metals in Nymphaea epidermal glands.

  17. Neutralization of IL-8 prevents the induction of dermatologic adverse events associated with the inhibition of epidermal growth factor receptor

    DEFF Research Database (Denmark)

    Bangsgaard, Nannie; Houtkamp, Mischa; Schuurhuis, Danita H

    2012-01-01

    Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance to treatm......Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance...... repeat dose treatment with HuMab-10F8, a neutralizing human antibody against IL-8, reduced the rash. Inhibition of IL-8 can therefore ameliorate dermatological adverse events induced by treatment with EGFR inhibitors....

  18. Epidermal growth factor receptor and cancer: control of oncogenic signalling by endocytosis

    DEFF Research Database (Denmark)

    Grandal, Michael Vibo; Madshus, I.H.

    2008-01-01

    The epidermal growth factor receptor (EGFR) and other members of the EGFR/ErbB receptor family of receptor tyrosine kinases (RTKs) are important regulators of proliferation, angiogenesis, migration, tumorigenesis and metastasis. Overexpression, mutations, deletions and production of autocrine...... has been described, lysosomal degradation upon ligand-induced endocytosis seems to play the major role in EGFR down-regulation. Preclinical and clinical data have demonstrated that EGFR is a central player in cancer, especially in carcinomas, some brain tumours and in non-small cell lung cancer....... Such studies have further validated EGFR as an important molecular target in cancer treatment. This review focuses on mechanisms involved in ligand-induced EGFR activation and endocytic down-regulation. A better understanding of EGFR biology should allow development of more tumour-selective therapeutic...

  19. Clinical Studies on conformal radiotherapy combined with epidermal ...

    African Journals Online (AJOL)

    Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

  20. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  1. Foliar epidermal anatomy and its systematic implication within the ...

    African Journals Online (AJOL)

    Micro morphological investigations of the foliar epidermal anatomy, particularly the diversity and distribution of glandular and eglandular trichomes on leaves of Sida alba L., S. alii S. Abedin var. alii, S. cordata (Burm. F.) Brss, S. mysorensis Wight and Arn, S. ovata Forssk. S. spinosa L and S.yunnanensis S.Y.Hu have been ...

  2. Epidermal hydration levels in rosacea patients improve after minocycline therapy.

    LENUS (Irish Health Repository)

    Ní Raghallaigh, S

    2013-12-06

    Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.

  3. Gastric luminal epidermal growth factor is affected by diet | Iputo ...

    African Journals Online (AJOL)

    Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...

  4. The epidermal growth factor receptor pathway in chronic kidney diseases

    NARCIS (Netherlands)

    Harskamp, Laura R.; Gansevoort, Ron T.; Goor, van Harry; Meijer, Esther

    The epidermal growth factor receptor (EGFR) pathway has a critical role in renal development, tissue repair and electrolyte handling. Numerous studies have reported an association between dysregulation of this pathway and the initiation and progression of various chronic kidney diseases such as

  5. Assessment of the Developmental Toxicity of Epidermal Growth ...

    African Journals Online (AJOL)

    Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

  6. Taxonomic significance of leaf epidermal anatomy of selected ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... Taxonomic significance of leaf epidermal anatomy of selected Persicaria Mill. species of family ... characters are comparable over a wide taxonomic range and quite reliable. Comprehensive foliar anatomy .... characteristics of the plants growing in humid conditions. (Stace, 1965; Ayodele and Olwokudejo, ...

  7. Inflammatory linear verrucous epidermal naevus: Report of three ...

    African Journals Online (AJOL)

    Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

  8. Epidermal morphology of west african okra Abelmoschus caillei (A ...

    African Journals Online (AJOL)

    A study of the micro-morphology of 53 accessions of West African Okra was undertaken using light microscopy techniques. Results showed that epidermal cells are polygonal, isodiametric and irregularly shaped with different anticlinal cell wall patterns. Stomata type is 100% paracytic and 100% amphistomatic in distribution ...

  9. Foliar epidermal study of some species of Aglaonema Schott ...

    African Journals Online (AJOL)

    The adaxial and abaxial epidermal surfaces of six species of Aglaonema Schott were studied in order to document characters of taxonomic importance among them. The species are Aglaonema brevispathum Schott (Engl.) Engl., Aglaonema commutatum Schott, Aglaonema costatum Schott, Aglaonema crispum Schott, ...

  10. evaluation of the prognostic value of the expression of epidermal ...

    African Journals Online (AJOL)

    Objectives To evaluate the role and prognostic value of the expression of epidermal growth factor receptors (EGFR) in serum and urine for the detection of human bladder cancer. Patients and Methods The study comprised 30 patients with newly diagnosed transitional cell carcinoma of the bladder and 10 normal volunteers ...

  11. Epidermal characteristics of some Nigerian species of Corchorus ...

    African Journals Online (AJOL)

    The three species of Corchorus used in this study were collected from Ife and Port Harcourt. The comparative study of the species were done using light microscope. The observations recorded on the epidermal architecture, stomata types, stomata distribution and frequency and the trichomes have been discussed in line ...

  12. Identification of grazed grasses using epidermal characters | R ...

    African Journals Online (AJOL)

    The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...

  13. Epidermal growth factor receptor: Target for delivery and silencing

    NARCIS (Netherlands)

    Santos Oliveira, S.|info:eu-repo/dai/nl/304841455

    2008-01-01

    Epidermal growth factor receptor in cancer therapy Recently, cancer research has been able to identify molecular targets that are specific for (or highly expressed by) cancer cells. These molecular targets serve as models for the development of rationally designed anticancer drugs that target

  14. Improvement of arbutin trans-epidermal delivery using ...

    African Journals Online (AJOL)

    Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...

  15. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  16. Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

    Directory of Open Access Journals (Sweden)

    Kyounghwan Lee

    2015-04-01

    Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

  17. Studies on the foliar epidermal tissues of three species of Digitaria ...

    African Journals Online (AJOL)

    Foliar epidermal studies were carried out on Digitaria iburua Stapf, Digitaria exilis Stapf and Digitaria barbinodis Henr. with the aim of determining the patterns of variation in their epidermal characteristics and assessing the value of leaf epidermal characters in the identification of these culturally important species.

  18. Basis for the gain and subsequent dilution of epidermal pigmentation during human evolution: The barrier and metabolic conservation hypotheses revisited.

    Science.gov (United States)

    Elias, Peter M; Williams, Mary L

    2016-10-01

    The evolution of human skin pigmentation must address both the initial evolution of intense epidermal pigmentation in hominins, and its subsequent dilution in modern humans. While many authorities believe that epidermal pigmentation evolved to protect against either ultraviolet B (UV-B) irradiation-induced mutagenesis or folic acid photolysis, we hypothesize that pigmentation augmented the epidermal barriers by shifting the UV-B dose-response curve from toxic to beneficial. Whereas erythemogenic UV-B doses produce apoptosis and cell death, suberythemogenic doses benefit permeability and antimicrobial function. Heavily melanized melanocytes acidify the outer epidermis and emit paracrine signals that augment barrier competence. Modern humans, residing in the cooler, wetter climes of south-central Europe and Asia, initially retained substantial pigmentation. While their outdoor lifestyles still permitted sufficient cutaneous vitamin D3 (VD3) synthesis, their marginal nutritional status, coupled with cold-induced caloric needs, selected for moderate pigment reductions that diverted limited nutritional resources towards more urgent priorities (=metabolic conservation). The further pigment-dilution that evolved as humans reached north-central Europe (i.e., northern France, Germany), likely facilitated cutaneous VD3 synthesis, while also supporting ongoing, nutritional requirements. But at still higher European latitudes where little UV-B breaches the atmosphere (i.e., present-day UK, Scandinavia, Baltic States), pigment dilution alone could not suffice. There, other nonpigment-related mutations evolved to facilitate VD3 production; for example, in the epidermal protein, filaggrin, resulting in reduced levels of its distal metabolite, trans-urocanic acid, a potent UV-B chromophore. Thus, changes in human pigmentation reflect a complex interplay between latitude, climate, diet, lifestyle, and shifting metabolic priorities. © 2016 Wiley Periodicals, Inc.

  19. Internalization Mechanisms of the Epidermal Growth Factor Receptor after Activation with Different Ligands

    Science.gov (United States)

    Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther

    2013-01-01

    The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148

  20. Epidermal wound repair is regulated by the planar cell polarity signaling pathway

    Science.gov (United States)

    Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B.; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A.; Murdoch, Jennifer N.; Humbert, Patrick O.; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M.; Jane, Stephen M.

    2010-01-01

    SUMMARY The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3−/− mice, we identified RhoGEF19, a homologue of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerisation, cellular polarity and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling, and broadly implicate this pathway in epidermal repair. PMID:20643356

  1. Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis

    Science.gov (United States)

    Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin

    2016-01-01

    Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054

  2. Internalization mechanisms of the epidermal growth factor receptor after activation with different ligands.

    Directory of Open Access Journals (Sweden)

    Lasse Henriksen

    Full Text Available The epidermal growth factor receptor (EGFR regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF and transforming growth factor-α (TGF-α. For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF or betacellulin (BTC was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown.

  3. GATA3 Expression Is Decreased in Psoriasis and during Epidermal Regeneration; Induction by Narrow-Band UVB and IL-4

    Science.gov (United States)

    Kant, Marius; Baerveldt, Ewout M.; Florencia, Edwin; Mourits, Sabine; de Ridder, Dick; Laman, Jon D.; van der Fits, Leslie; Prens, Errol P.

    2011-01-01

    Psoriasis is characterized by hyperproliferation of keratinocytes and by infiltration of activated Th1 and Th17 cells in the (epi)dermis. By expression microarray, we previously found the GATA3 transcription factor significantly downregulated in lesional psoriatic skin. Since GATA3 serves as a key switch in both epidermal and T helper cell differentiation, we investigated its function in psoriasis. Because psoriatic skin inflammation shares many characteristics of epidermal regeneration during wound healing, we also studied GATA3 expression under such conditions. Psoriatic lesional skin showed decreased GATA3 mRNA and protein expression compared to non-lesional skin. GATA3 expression was also markedly decreased in inflamed skin of mice with a psoriasiform dermatitis induced with imiquimod. Tape-stripping of non-lesional skin of patients with psoriasis, a standardized psoriasis-triggering and skin regeneration-inducing technique, reduced the expression of GATA3. In wounded skin of mice, low GATA3 mRNA and protein expression was detected. Taken together, GATA3 expression is downregulated under regenerative and inflammatory hyperproliferative skin conditions. GATA3 expression could be re-induced by successful narrow-band UVB treatment of both human psoriasis and imiquimod-induced psoriasiform dermatitis in mice. The prototypic Th2 cytokine IL-4 was the only cytokine capable of inducing GATA3 in skin explants from healthy donors. Based on these findings we argue that GATA3 serves as a key regulator in psoriatic inflammation, keratinocyte hyperproliferation and skin barrier dysfunction. PMID:21611195

  4. Effects of radiation on the epidermal growth factor receptor pathway in the heart.

    Science.gov (United States)

    Sridharan, Vijayalakshmi; Sharma, Sunil K; Moros, Eduardo G; Corry, Peter M; Tripathi, Preeti; Lieblong, Benjamin J; Guha, Chandan; Hauer-Jensen, Martin; Boerma, Marjan

    2013-07-01

    Radiation-induced heart disease (RIHD) is a serious side-effect of thoracic radiotherapy. The epidermal growth factor receptor (EGFR) pathway is essential for the function and survival of cardiomyocytes. Hence, agents that target the EGFR pathway are cardiotoxic. Tocotrienols protect from radiation injury, but may also enhance the therapeutic effects of EGFR pathway inhibitors in cancer treatment. This study investigated the effects of local irradiation on the EGFR pathway in the heart and tests whether tocotrienols may modify radiation-induced changes in this pathway. Male Sprague-Dawley rats received image-guided localized heart irradiation with 21 Gy. Twenty four hours before irradiation, rats received a single dose of tocotrienol-enriched formulation or vehicle by oral gavage. At time points from 2 h to 9 months after irradiation, left ventricular expression of EGFR pathway mediators was studied. Irradiation caused a decrease in the expression of epidermal growth factor (EGF) and neuregulin-1 (Nrg-1) mRNA from 6 h up to 10 weeks, followed by an upregulation of these ligands and the receptor erythroblastic leukemia viral oncogene homolog (ErbB)4 at 6 months. In addition, the upregulation of Nrg-1 was statistically significant up to 9 months after irradiation. A long-term upregulation of ErbB2 protein did not coincide with changes in transcription or post-translational interaction with the chaperone heat shock protein 90 (HSP90). Pretreatment with tocotrienols prevented radiation-induced changes at 2 weeks. Local heart irradiation causes long-term changes in the EGFR pathway. Studies have to address how radiation may interact with cardiotoxic effects of EGFR inhibitors.

  5. Exfoliation of the epidermal cells and defecation by amphibian larvae in response to coelomic fluid and lysenin from the earthworm Eisenia foetida.

    Science.gov (United States)

    Kobayashi, Hideshi; Suzuki, Hirohumi; Ohta, Naoshi

    2006-08-01

    Coelomic fluid (CF) and lysenin from the earthworm Eisenia foetida induced heavy epidermal exfoliation in the larvae of Bufo japonicus formosus at developmental stages from hatching (stage 22) to operculum completion (stage 34). In experiments with Xenopus laevis, we observed that exfoliated cells were not stained by trypan blue. Thus, it appeared that these cells were still alive. It is likely, therefore, that both CF and lysenin might disrupt the adhesion between epidermal cells of larvae prior to stage 34. Since it is known that lysenin exerts its toxic effects through its specific binding to sphingomyelin (SM), SM might be involved in such adhesion. This hypothesis was supported by the observations that CF and lysenin which had been incubated with SM-liposomes lost their exfoliative activity. In larvae after stage 34, the mechanism of adhesion between epidermal cells seemed to change and the adhesion was no longer disrupted by CF and lysenin. In larvae at around stage 34, a collagen layer started to form beneath the basement membrane of the epidermis. Furthermore, larvae at around this stage started to eat solid food. The developing collagen layer and food intake might be related indirectly to the chemical change in epidermal adhesion. The induction of exfoliation by CF and lysenin was also observed in other amphibian species. In Bufo larvae, defecation was induced both by CF and by lysenin but this effect was independent of exfoliation.

  6. Carbon dioxide laser versus erbium:YAG laser in treatment of epidermal verrucous nevus: a comparative randomized clinical study.

    Science.gov (United States)

    Osman, Mai Abdel Raouf; Kassab, Ahmed Nazmi

    2017-08-01

    A verrucous epidermal nevus (VEN) is a skin disorder that has been treated using different treatment modalities with varying results. Ablative lasers such as carbon dioxide laser (CO 2 ) and erbium:yttrium-aluminum-garnet (Er:YAG) laser have been considered as the gold standard for the treatment of epidermal nevi. To evaluate and compare the efficacy, postoperative wound healing and side effects of pulsed CO 2 laser and Er:YAG laser for the treatment of verrucous epidermal nevi. Twenty patients with localized VEN were randomly divided into two groups. Group 1 was administered CO 2 laser and group 2 underwent Er:YAG laser treatment. A blinded physician evaluated the photographs and dermoscopic photomicrographs for the efficacy and possible side effects. All patients received one treatment session and were followed up over a 6-month period. Both lasers induced noticeable clinical improvement, but there were no significant differences between two lasers in treatment response, patient satisfaction, duration of erythema and side effects. The average time to re-epithelialization was 13.5 days with CO 2 and 7.9 days with Er:YAG laser (plaser group and no lesional recurrence was detected in CO 2 laser group since treatment. Apart from re-epithelialization, both lasers showed equivalent outcomes with respect to treatment response, patient satisfaction, side effects and complications.

  7. Epidermal and cortical roles of NFP and DMI3 in coordinating early steps of nodulation in Medicago truncatula.

    Science.gov (United States)

    Rival, Pauline; de Billy, Françoise; Bono, Jean-Jacques; Gough, Clare; Rosenberg, Charles; Bensmihen, Sandra

    2012-09-01

    Legumes have evolved the capacity to form a root nodule symbiosis with soil bacteria called rhizobia. The establishment of this symbiosis involves specific developmental events occurring both in the root epidermis (notably bacterial entry) and at a distance in the underlying root cortical cells (notably cell divisions leading to nodule organogenesis). The processes of bacterial entry and nodule organogenesis are tightly linked and both depend on rhizobial production of lipo-chitooligosaccharide molecules called Nod factors. However, how these events are coordinated remains poorly understood. Here, we have addressed the roles of two key symbiotic genes of Medicago truncatula, the lysin motif (LysM) domain-receptor like kinase gene NFP and the calcium- and calmodulin-dependent protein kinase gene DMI3, in the control of both nodule organogenesis and bacterial entry. By complementing mutant plants with corresponding genes expressed either in the epidermis or in the cortex, we have shown that epidermal DMI3, but not NFP, is sufficient for infection thread formation in root hairs. Epidermal NFP is sufficient to induce cortical cell divisions leading to nodule primordia formation, whereas DMI3 is required in both cell layers for these processes. Our results therefore suggest that a signal, produced in the epidermis under the control of NFP and DMI3, is responsible for activating DMI3 in the cortex to trigger nodule organogenesis. We integrate these data to propose a new model for epidermal/cortical crosstalk during early steps of nodulation.

  8. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.

    1986-01-01

    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  9. Epidermal Micrografts Produced via an Automated and Minimally Invasive Tool Form at the Dermal/Epidermal Junction and Contain Proliferative Cells That Secrete Wound Healing Growth Factors

    Science.gov (United States)

    Osborne, Sandra N.; Schmidt, Marisa A.; Derrick, Kathleen; Harper, John R.

    2015-01-01

    ABSTRACT OBJECTIVE: The aim of this scientific study was to assess epidermal micrografts for formation at the dermal-epidermal (DE) junction, cellular outgrowth, and growth factor secretion. Epidermal harvesting is an autologous option that removes only the superficial epidermal layer of the skin, considerably limiting donor site damage and scarring. Use of epidermal grafting in wound healing has been limited because of tedious, time-consuming, and inconsistent methodologies. Recently, a simplified, automated epidermal harvesting tool (CelluTome Epidermal Harvesting System; Kinetic Concepts Inc, San Antonio, Texas) that applies heat and suction concurrently to produce epidermal micrografts has become commercially available. The new technique of epidermal harvesting was shown to create viable micrografts with minimal patient discomfort and no donor-site scarring. DESIGN: This study was a prospective institutional review board–approved healthy human study. SETTING: This study was conducted at the multispecialty research facility, Clinical Trials of Texas, Inc, in San Antonio, Texas. PATIENTS: The participants were 15 healthy human volunteers. RESULTS: Epidermal micrografts formed at the DE junction, and migratory basal layer keratinocytes and melanocytes were proliferative in culture. Basement membrane–specific collagen type IV was also found to be present in the grafts, suggesting that the combination of heat and vacuum might cause partial delamination of the basement membrane. Viable basal cells actively secreted key growth factors important for modulating wound healing responses, including vascular endothelial growth factor, hepatocyte growth factor, granulocyte colony-stimulating factor, platelet-derived growth factor, and transforming growth factor α. CONCLUSIONS: Harvested epidermal micrografts retained their original keratinocyte structure, which is critical for potential re-epithelialization and repigmentation of a wound environment. PMID:26258460

  10. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.

    2007-01-01

    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  11. Microtubules CLASP to Adherens Junctions in epidermal progenitor cells

    DEFF Research Database (Denmark)

    Shahbazi, Marta N; Perez-Moreno, Mirna

    2014-01-01

    Cadherin-mediated cell adhesion at Adherens Junctions (AJs) and its dynamic connections with the microtubule (MT) cytoskeleton are important regulators of cellular architecture. However, the functional relevance of these interactions and the molecular players involved in different cellular contexts...... and cellular compartments are still not completely understood. Here, we comment on our recent findings showing that the MT plus-end binding protein CLASP2 interacts with the AJ component p120-catenin (p120) specifically in progenitor epidermal cells. Absence of either protein leads to alterations in MT...... dynamics and AJ functionality. These findings represent a novel mechanism of MT targeting to AJs that may be relevant for the maintenance of proper epidermal progenitor cell homeostasis. We also discuss the potential implication of other MT binding proteins previously associated to AJs in the wider context...

  12. Staphylococcus hyicus virulence in relation to exudative epidermitis in pigs

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Andresen, Lars Ole; Bille-Hansen, Vivi

    1993-01-01

    Staphylococcus hyicus strains with different phage types, plasmid profiles, and antibiotic resistance patterns were isolated from piglets with exudative epidermitis. The strains could be divided into virulent strains, producing exudative epidermitis, and avirulent strains, producing no dermal...... changes when injected in experimental piglets. The results showed that both virulent and avirulent strains were present simultaneously on diseased piglets. This constitutes a diagnostic problem. Concentrated culture supernatants from nine virulent strains injected in the skin of healthy piglets produced...... a crusting reaction in all piglets. Acanthosis was observed in the histopathological examination of the crustaceous skin. Concentrated culture supernatants from nine avirulent strains produced no macroscopic or microscopic skin changes. Protein profiles from all virulent strains and seven out of nine...

  13. The epidermal biosynthesis of cholecalciferol (vitamin D3)

    International Nuclear Information System (INIS)

    Beadle, P.C.

    1977-01-01

    An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

  14. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  15. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  16. Epidermal electronics with advanced capabilities in near-field communication.

    Science.gov (United States)

    Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A

    2015-02-25

    Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Carbamazepine

    Science.gov (United States)

    ... Carbamazepine may cause life-threatening allergic reactions called Stevens-Johnson syndrome (SJS) or toxic epidermal necrolysis (TEN). These allergic ... or a fever during your treatment with carbamazepine.Stevens-Johnson syndrome or toxic epidermal necrolysis usually occurs during the ...

  18. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  19. Optimal allocation of leaf epidermal area for gas exchange.

    Science.gov (United States)

    de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J

    2016-06-01

    A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.

  20. Epidermal growth factor receptor expression in urinary bladder cancer

    Directory of Open Access Journals (Sweden)

    Dayalu S.L. Naik

    2011-01-01

    Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

  1. Adrenergic effects on renal secretion of epidermal growth factor in the rat

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1985-01-01

    Urinary epidermal growth factor (EGF) has been demonstrated recently to originate from the kidneys. The present study was undertaken to investigate the adrenergic and cholinergic influence on secretion of renal EGF. beta-Adrenergic agonists increased the level of urinary EGF, while propranolol......, a beta-adrenergic blocking agent, decreased basal and beta-adrenergic stimulated total output of urinary EGF. Acetylcholine and the anticholinergic agent atropine had no effect on the output of EGF in urine. Also chemical sympathectomy induced by 6-hydroxydopamine reduced the urinary output of EGF. None...... of the experimental groups had a median serum concentration above the detection limit of the assay. The present study shows that secretion of renal EGF is under the influence of the sympathetic nervous system and release of EGF is stimulated by activation of beta-adrenergic receptors in the kidneys....

  2. Stimulation of allogeneic lymphocytes by skin epidermal cells in the rat

    International Nuclear Information System (INIS)

    Tanaka, S.; Sakai, A.

    1979-01-01

    The ability of skin epidermal cells to induce allogeneic lymphocytes into proliferation was examined in mixed skin cell-lymphocyte culture reaction (MSLR). The stimulatng capacity of skin cells was reduced significantly by trypsin digestion, although the damage was repaired by incubation at 37 C for 3 hr. The optimal concentration of mitomycin C for treatment of stimulating cells in the MSLR differed from that in mixed lymphocyte culture reaction (MLR). Irradiation rendered them three to four times more stimulatory than did mitomycin C. Removal of adherent cells from responding cells by passage through a nylon-wool column gave a substantial elevation of the MSLR. The lymphocytes cocultured with skin cells in the primary MSLR incorporated 3 H-thymidine, with the peak at the 6th day of culture. If the lymphocytes primed in the MSLR were restimulated with skin cells from the same stimulating strain, the primed lymphocytes responded promptly and in great magnitude

  3. Exocrine secretion of epidermal growth factor from Brunner's glands. Stimulation by VIP and acetylcholine

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier

    1983-01-01

    Brunner's glands of the duodenum are innervated by cholinergic and VIP-ergic nerves, and the glands have been shown to contain epidermal growth factor (EGF). In this study the effect of VIP and acetylcholine (Ach) on secretion of EGF from Brunner's glands was investigated in the rat. Intravenous...... infusion of VIP stimulated the flow rate of duodenal secretion, an effect which was inhibited by atropine. Ach alone did not significantly increase flow rate, and combined infusion of VIP and Ach induced the same flow as VIP alone. Concentration of EGF in duodenal secretion was increased by infusion of Ach......, and this effect was potentiated by VIP. Infusion of VIP alone did not influence EGF concentration. EGF output from Brunner's glands was significantly stimulated by i.v. infusion of VIP and of Ach and combined infusion further increased EGF output. The study has demonstrated exocrine secretion of EGF from Brunner...

  4. Decreased level of epidermal growth factor in milk from diabetic rats

    DEFF Research Database (Denmark)

    Thulesen, J; Nexø, Ebba; Raaberg, Lasse

    1994-01-01

    Experimental diabetes was induced in rats with streptozocin before mating, and the influence of diabetes on epidermal growth factor (EGF) in milk and on other milk components was studied. Throughout the lactation period, a significant decrease was found both in the production of milk...... and in the concentration of EGF in milk from untreated diabetic rats compared with an insulin-treated diabetic group and a control group. Thus, the total output of EGF in milk from diabetic rats was considerably decreased. The concentrations of total protein and haptocorrin, a cobalamin (vitamin B12)-binding protein......, and the content of fat, however, were unaltered by diabetes. Therefore, the decrease in milk EGF seemed to be selective compared with total protein in milk. The pups of diabetic dams had reduced body weights within 1 wk of lactation and reduced body lengths on d 16 of lactation compared with control pups...

  5. BMP and Delta/Notch signaling control the development of amphioxus epidermal sensory neurons: insights into the evolution of the peripheral sensory system.

    Science.gov (United States)

    Lu, Tsai-Ming; Luo, Yi-Jyun; Yu, Jr-Kai

    2012-06-01

    The evolution of the nervous system has been a topic of great interest. To gain more insight into the evolution of the peripheral sensory system, we used the cephalochordate amphioxus. Amphioxus is a basal chordate that has a dorsal central nervous system (CNS) and a peripheral nervous system (PNS) comprising several types of epidermal sensory neurons (ESNs). Here, we show that a proneural basic helix-loop-helix gene (Ash) is co-expressed with the Delta ligand in ESN progenitor cells. Using pharmacological treatments, we demonstrate that Delta/Notch signaling is likely to be involved in the specification of amphioxus ESNs from their neighboring epidermal cells. We also show that BMP signaling functions upstream of Delta/Notch signaling to induce a ventral neurogenic domain. This patterning mechanism is highly similar to that of the peripheral sensory neurons in the protostome and vertebrate model animals, suggesting that they might share the same ancestry. Interestingly, when BMP signaling is globally elevated in amphioxus embryos, the distribution of ESNs expands to the entire epidermal ectoderm. These results suggest that by manipulating BMP signaling levels, a conserved neurogenesis circuit can be initiated at various locations in the epidermal ectoderm to generate peripheral sensory neurons in amphioxus embryos. We hypothesize that during chordate evolution, PNS progenitors might have been polarized to different positions in various chordate lineages owing to differential regulation of BMP signaling in the ectoderm.

  6. Althaea rosea Cavanil and Plantago major L. suppress neoplastic cell transformation through the inhibition of epidermal growth factor receptor kinase.

    Science.gov (United States)

    Choi, Eun-Sun; Cho, Sung-Dae; Shin, Ji-Ae; Kwon, Ki Han; Cho, Nam-Pyo; Shim, Jung-Hyun

    2012-10-01

    For thousands of years in Asia, Althaea rosea Cavanil (ARC) and Plantago major L. (PML) have been used as powerful non-toxic therapeutic agents that inhibit inflammation. However, the anticancer mechanisms and molecular targets of ARC and PML are poorly understood, particularly in epidermal growth factor (EGF)-induced neoplastic cell transformation. The aim of this study was to evaluate the chemopreventive effects and mechanisms of the methanol extracts from ARC (MARC) and PML (MPML) in EGF-induced neoplastic cell transformation of JB6 P+ mouse epidermal cells using an MTS assay, anchorage-independent cell transformation assay and western blotting. Our results showed that MARC and MPML significantly suppressed neoplastic cell transformation by inhibiting the kinase activity of the EGF receptor (EGFR). The activation of EGFR by EGF was suppressed by MARC and MPML treatment in EGFR(+/+) cells, but not in EGFR(-/-) cells. In addition, MARC and MPML inhibited EGF-induced cell proliferation in EGFR-expressing murine embryonic fibroblasts (EGFR(+/+)). These results strongly indicate that EGFR targeting by MARC and MPML may be a good strategy for chemopreventive or chemotherapeutic applications.

  7. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  8. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.

    Science.gov (United States)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi

    2005-02-25

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.

  9. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

    Science.gov (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

    2003-12-01

    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  10. IL-1β-Dependent Activation of Dendritic Epidermal T Cells in Contact Hypersensitivity

    DEFF Research Database (Denmark)

    Nielsen, Morten M; Lovato, Paola; Macleod, Amanda S

    2014-01-01

    Substances that penetrate the skin surface can act as allergens and induce a T cell-mediated inflammatory skin disease called contact hypersensitivity (CHS). IL-17 is a key cytokine in CHS and was originally thought to be produced solely by CD4(+) T cells. However, it is now known that several cell...... types, including γδ T cells, can produce IL-17. In this study, we determine the role of γδ T cells, especially dendritic epidermal T cells (DETCs), in CHS. Using a well-established model for CHS in which 2,4-dinitrofluorobenzene (DNFB) is used as allergen, we found that γδ T cells are important players...... in CHS. Thus, more IL-17-producing DETCs appear in the skin following exposure to DNFB in wild-type mice, and DNFB-induced ear swelling is reduced by ∼50% in TCRδ(-/-) mice compared with wild-type mice. In accordance, DNFB-induced ear swelling was reduced by ∼50% in IL-17(-/-) mice. We show that DNFB...

  11. Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations.

    Directory of Open Access Journals (Sweden)

    Béatrice Marquèze-Pouey

    Full Text Available Signaling mediated by the epidermal growth factor (EGF is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer. In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

  12. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    by a substantial cellular heterogeneity. Analysis of bulk populations of cells by colony-forming assays can consequently be convoluted by a number of factors that are not controlled for in population wide studies. It is therefore advantageous to refine in vitro growth assays by sub-fractionation of cells using...... flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail...

  13. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  14. Renal origin of rat urinary epidermal growth factor

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1984-01-01

    Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF......The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...

  15. Astrocyte Mitogen Inhibitor Related to Epidermal Growth Factor Receptor

    Science.gov (United States)

    Nieto-Sampedro, Manuel

    1988-06-01

    Epidermal growth factor (EGF) is a well-characterized polypeptide hormone with diverse biological activities, including stimulation of astrocyte division. A soluble astrocyte mitogen inhibitor, immunologically related to the EGF receptor, is present in rat brain. Injury to the brain causes a time-dependent reduction in the levels of this inhibitor and the concomitant appearance of EGF receptor on the astrocyte surface. Intracerebral injection of antibody capable of binding the inhibitor caused the appearance of numerous reactive astrocytes. EGF receptor-related inhibitors may play a key role in the control of glial cell division in both normal and injured brain.

  16. Epidermal growth factor treatment decreases mortality and is associated with improved gut integrity in sepsis.

    Science.gov (United States)

    Clark, Jessica A; Clark, Andrew T; Hotchkiss, Richard S; Buchman, Timothy G; Coopersmith, Craig M

    2008-07-01

    Epidermal growth factor (EGF) is a cytoprotective peptide that has healing effects on the intestinal mucosa. We sought to determine whether systemic administration of EGF after the onset of sepsis improved intestinal integrity and decreased mortality. FVB/N mice were subjected to either sham laparotomy or 2 x 23 cecal ligation and puncture (CLP). Septic mice were further randomized to receive injection of either 150 microg kg(-1) d(-1) (i.p.) EGF or 0.9% saline (i.p.). Circulating EGF levels were decreased after CLP compared with sham animals but were unaffected by giving exogenous EGF treatment. In contrast, intestinal EGF levels increased after CLP and were further augmented by exogenous EGF treatment. Intestinal EGF receptor was increased after CLP, whether assayed by immunohistochemistry, real-time polymerase chain reaction, or Western blot, and exogenous EGF treatment decreased intestinal EGF receptor. Villus length decreased 2-fold between sham and septic animals, and EGF treatment resulted in near total restitution of villus length. Sepsis decreased intestinal proliferation and increased intestinal apoptosis. This was accompanied by increased expression of the proapoptotic proteins Bid and Fas-associated death domain, as well as the cyclin-dependent kinase inhibitor p21 cip1/waf Epidermal growth factor treatment after the onset of sepsis restored both proliferation and apoptosis to levels seen in sham animals and normalized expression of Bid, Fas-associated death domain, and p21 cip1/waf . To determine whether improvements in gut homeostasis were associated with a decrease in sepsis-induced mortality, septic mice with or without EGF treatment after CLP were followed 7 days for survival. Mortality decreased from 60% to 30% in mice treated with EGF after the onset of sepsis (P < 0.05). Thus, EGF may be a potential therapeutic agent for the treatment of sepsis in part due to its ability to protect intestinal integrity.

  17. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  18. Epidermal changes associated with symptomatic resolution of dandruff: biomarkers of scalp health.

    Science.gov (United States)

    Kerr, Kathy; Darcy, Trevor; Henry, James; Mizoguchi, Haruko; Schwartz, James R; Morrall, Stephen; Filloon, Thomas; Wimalasena, Rohan; Fadayel, Gina; Mills, Kevin J

    2011-01-01

    Dandruff is a common scalp condition characterized by flakes, pruritus and sometimes mild erythema. These symptoms reflect underlying histopathologic and biochemical events that must be reversed if treatment is to be effective. This study aimed to better characterize the state of the epidermis in dandruff and to determine how a defined set of skin surface biomarkers of this state change during a successful course of treatment with a potentiated zinc pyrithione (ZPT) shampoo. A population of dandruff sufferers was treated for 3 weeks with a commercial ZPT shampoo or a non-medicated product, and the effect of treatment on adherent scalp flake (ASF) scores was evaluated. Biopsies were taken from lesional sites at baseline and at the end of the study for histomorphometric and histopathologic analysis. Stratum corneum (SC) samples were likewise obtained for evaluation of biochemical markers of inflammation (IL-1α, IL-1RA, IL-8) and barrier integrity (keratin 1, 10, 11; involucrin; SC lipids; human serum albumin). The biomarker profile was evaluated first by comparison with that in non-dandruff subjects at baseline, and then to determine whether any treatment-induced changes were correlated with reductions in flaking in dandruff sufferers. Taken together, our studies showed that treatment with the ZPT shampoo led to an improvement in the overall scalp condition as assessed by the resolution of flaking, reduction in epidermal thickness and inflammatory biomarkers, and a dramatic improvement in biomarkers of epidermal barrier integrity. The combination of biomarkers examined appears to be a good overall descriptor of the health of the scalp in dandruff, and changes in these biomarkers track with tissue-level events that underlie clinical efficacy in the treatment of dandruff by ZPT shampoo. For the first time, we demonstrate a set of tools that extend beyond flaking scores to provide insight into specific biological changes occurring on the scalp to enable an objective

  19. [Severe cutaneous drug reactions to misused griseofulvin: 2 cases].

    Science.gov (United States)

    Le Guern, A; Kerrad, I; Oehler, E

    2016-03-01

    Griseofulvin is an antifungal drug known to cause drug rash. However, it is widely prescribed outside its classic indications. Herein, we describe 2 cases in which griseofulvin was prescribed for off-label indications. Case No. 1. A 51-year-old woman was referred to the department of internal medicine for management of Stevens-Johnson Syndrome (SJS). The symptoms appeared 17 days after she had taken griseofulvin for inguinal intertrigo. Case No. 2. A 19-year-old female patient consulted for toxic epidermal necrolysis (TEN) affecting 30% of her body surface, with a positive Nikolsky sign and severe mucosal lesions. These symptoms appeared 9 days after she began taking griseofulvin, which had initially been prescribed for her husband for mycosis. Toxic epidermal necrolysis, a condition chiefly of drug-related origin, is a severe mucocutaneous syndrome characterized by massive keratinocytic apoptosis. Although there are few scientific publications referring to griseofulvin-induced drug eruption, they deserve to be mentioned since this drug is widely used for purposes other than the approved indications and can cause life-threatening reactions. We report two cases of toxic epidermal necrolysis related to the misuse of griseofulvin. It is important to bear in mind the precautions for use of oral antifungal drugs, which are strictly reserved for use against resistant or diffuse forms of mucocutaneous fungal infections. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  20. Epidermal patterning genes are active during embryogenesis in Arabidopsis.

    Science.gov (United States)

    Costa, Silvia; Dolan, Liam

    2003-07-01

    Epidermal cells in the root of Arabidopsis seedling differentiate either as hair or non-hair cells, while in the hypocotyl they become either stomatal or elongated cells. WEREWOLF (WER) and GLABRA2 (GL2) are positive regulators of non-hair and elongated cell development. CAPRICE (CPC) is a positive regulator of hair cell development in the root. We show that WER, GL2 and CPC are expressed and active during the stages of embryogenesis when the pattern of cells in the epidermis of the root-hypocotyl axis forms. GL2 is first expressed in the future epidermis in the heart stage embryo and its expression is progressively restricted to those cells that will acquire a non-hair identity in the transition between torpedo and mature stage. The expression of GL2 at the heart stage requires WER function. WER and CPC are transiently expressed throughout the root epidermal layer in the torpedo stage embryo when the cell-specific pattern of GL2 expression is being established in the epidermis. We also show that WER positively regulates CPC transcription and GL2 negatively regulates WER transcription in the mature embryo. We propose that the restriction of GL2 to the future non-hair cells in the root epidermis can be correlated with the activities of WER and CPC during torpedo stage. In the embryonic hypocotyl we show that WER controls GL2 expression. We also provide evidence indicating that CPC may also regulate GL2 expression in the hypocotyl.

  1. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen

    2017-06-16

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  2. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  3. Upregulation of epidermal growth factor receptor 4 in oral leukoplakia

    Science.gov (United States)

    Kobayashi, Hiroshi; Kumagai, Kenichi; Gotoh, Akito; Eguchi, Takanori; Yamada, Hiroyuki; Hamada, Yoshiki; Suzuki, Satsuki; Suzuki, Ryuji

    2013-01-01

    In the present study, we investigate the expression profile of the epidermal growth factor receptor family, which comprises EGFR/ErbB1, HER2/ErbB2, HER3/ErbB3 and HER4/ErbB4 in oral leukoplakia (LP). The expression of four epidermal growth factor receptor (EGFR) family genes and their ligands were measured in LP tissues from 14 patients and compared with levels in 10 patients with oral lichen planus (OLP) and normal oral mucosa (NOM) from 14 healthy donors by real-time polymerase chain reaction (PCR) and immunohistochemistry. Synchronous mRNA coexpression of ErbB1, ErbB2, ErbB3 and ErbB4 was detected in LP lesions. Out of the receptors, only ErbB4 mRNA and protein was more highly expressed in LP compared with NOM tissues. These were strongly expressed by epithelial keratinocytes in LP lesions, as shown by immunohistochemistry. Regarding the ligands, the mRNA of Neuregulin2 and 4 were more highly expressed in OLP compared with NOM tissues. Therefore, enhanced ErbB4 on the keratinocytes and synchronous modulation of EGFR family genes may contribute to the pathogenesis and carcinogenesis of LP. PMID:23492901

  4. Transforming growth factor alpha and epidermal growth factor in laryngeal carcinomas demonstrated by immunohistochemistry

    DEFF Research Database (Denmark)

    Christensen, M E; Therkildsen, M H; Poulsen, Steen Seier

    1993-01-01

    Fifteen laryngeal squamous cell carcinomas were investigated for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF) using immunohistochemical methods. In a recent study the same material was characterized for epidermal growth factor receptors (EGF recep...

  5. An Automated and Minimally Invasive Tool for Generating Autologous Viable Epidermal Micrografts

    Science.gov (United States)

    Osborne, Sandra N.; Schmidt, Marisa A.; Harper, John R.

    2016-01-01

    ABSTRACT OBJECTIVE: A new epidermal harvesting tool (CelluTome; Kinetic Concepts, Inc, San Antonio, Texas) created epidermal micrografts with minimal donor site damage, increased expansion ratios, and did not require the use of an operating room. The tool, which applies both heat and suction concurrently to normal skin, was used to produce epidermal micrografts that were assessed for uniform viability, donor-site healing, and discomfort during and after the epidermal harvesting procedure. DESIGN: This study was a prospective, noncomparative institutional review board–approved healthy human study to assess epidermal graft viability, donor-site morbidity, and patient experience. SETTING: These studies were conducted at the multispecialty research facility, Clinical Trials of Texas, Inc, San Antonio. PATIENTS: The participants were 15 healthy human volunteers. RESULTS: The average viability of epidermal micrografts was 99.5%. Skin assessment determined that 76% to 100% of the area of all donor sites was the same in appearance as the surrounding skin within 14 days after epidermal harvest. A mean pain of 1.3 (on a scale of 1 to 5) was reported throughout the harvesting process. CONCLUSIONS: Use of this automated, minimally invasive harvesting system provided a simple, low-cost method of producing uniformly viable autologous epidermal micrografts with minimal patient discomfort and superficial donor-site wound healing within 2 weeks. PMID:26765157

  6. An Automated and Minimally Invasive Tool for Generating Autologous Viable Epidermal Micrografts.

    Science.gov (United States)

    Osborne, Sandra N; Schmidt, Marisa A; Harper, John R

    2016-02-01

    A new epidermal harvesting tool (CelluTome; Kinetic Concepts, Inc, San Antonio, Texas) created epidermal micrografts with minimal donor site damage, increased expansion ratios, and did not require the use of an operating room. The tool, which applies both heat and suction concurrently to normal skin, was used to produce epidermal micrografts that were assessed for uniform viability, donor-site healing, and discomfort during and after the epidermal harvesting procedure. This study was a prospective, noncomparative institutional review board-approved healthy human study to assess epidermal graft viability, donor-site morbidity, and patient experience. These studies were conducted at the multispecialty research facility, Clinical Trials of Texas, Inc, San Antonio. The participants were 15 healthy human volunteers. The average viability of epidermal micrografts was 99.5%. Skin assessment determined that 76% to 100% of the area of all donor sites was the same in appearance as the surrounding skin within 14 days after epidermal harvest. A mean pain of 1.3 (on a scale of 1 to 5) was reported throughout the harvesting process. Use of this automated, minimally invasive harvesting system provided a simple, low-cost method of producing uniformly viable autologous epidermal micrografts with minimal patient discomfort and superficial donor-site wound healing within 2 weeks.

  7. The epidermal melanocyte system in individuals of Scandinavian origin, determined by DOPA-staining and TEM

    DEFF Research Database (Denmark)

    Drzewiecki, K T; Piltz-Drzewiecka, J

    1979-01-01

    The quantitative evaluation of DOPA-positive epidermal melanocytes in 16 patients of Scandinavian origin showed both individual and regional differences in the melanocyte count. Our data is in agreement with other published studies. The distribution in the number of melanocytes varies significant...... concerning the presence of the epidermal melanin unit....

  8. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  9. Andrographolide regulates epidermal growth factor receptor and transferrin receptor trafficking in epidermoid carcinoma (A-431) cells

    Science.gov (United States)

    Tan, Y; Chiow, KH; Huang, D; Wong, SH

    2010-01-01

    Background and purpose: Andrographolide is the active component of Andrographis paniculata, a plant used in both Indian and Chinese traditional medicine, and it has been demonstrated to induce apoptosis in different cancer cell lines. However, not much is known about how it may affect the key receptors implicated in cancer. Knowledge of how andrographolide affects receptor trafficking will allow us to better understand new mechanisms by which andrographolide may cause death in cancer cells. Experimental approach: We utilized the well-characterized epidermal growth factor receptor (EGFR) and transferrin receptor (TfR) expressed in epidermoid carcinoma (A-431) cells as a model to study the effect of andrographolide on receptor trafficking. Receptor distribution, the total number of receptors and surface receptors were analysed by immunofluorescence, Western blot as well as flow-cytometry respectively. Key results: Andrographolide treatment inhibited cell growth, down-regulated EGFRs on the cell surface and affected the degradation of EGFRs and TfRs. The EGFR was internalized into the cell at an increased rate, and accumulated in a compartment that co-localizes with the lysosomal-associated membrane protein in the late endosomes. Conclusion and implications: This study sheds light on how andrographolide may affect receptor trafficking by inhibiting receptor movement from the late endosomes to lysosomes. The down-regulation of EGFR from the cell surface also indicates a new mechanism by which andrographolide may induce cancer cell death. PMID:20233216

  10. Mechanism for activation of mutated epidermal growth factor receptors in lung cancer.

    Science.gov (United States)

    Red Brewer, Monica; Yun, Cai-Hong; Lai, Darson; Lemmon, Mark A; Eck, Michael J; Pao, William

    2013-09-17

    The initiation of epidermal growth factor receptor (EGFR) kinase activity proceeds via an asymmetric dimerization mechanism in which a "donor" tyrosine kinase domain (TKD) contacts an "acceptor" TKD, leading to its activation. In the context of a ligand-induced dimer, identical wild-type EGFR TKDs are thought to assume the donor or acceptor roles in a random manner. Here, we present biochemical reconstitution data demonstrating that activated EGFR mutants found in lung cancer preferentially assume the acceptor role when coexpressed with WT EGFR. Mutated EGFRs show enhanced association with WT EGFR, leading to hyperphosphorylation of the WT counterpart. Mutated EGFRs also hyperphosphorylate the related erythroblastic leukemia viral oncogene (ErbB) family member, ErbB-2, in a similar manner. This directional "superacceptor activity" is particularly pronounced in the drug-resistant L834R/T766M mutant. A 4-Å crystal structure of this mutant in the active conformation reveals an asymmetric dimer interface that is essentially the same as that in WT EGFR. Asymmetric dimer formation induces an allosteric conformational change in the acceptor subunit. Thus, superacceptor activity likely arises simply from a lower energetic cost associated with this conformational change in the mutant EGFR compared with WT, rather than from any structural alteration that impairs the donor role of the mutant. Collectively, these findings define a previously unrecognized mode of mutant-specific intermolecular regulation for ErbB receptors, knowledge of which could potentially be exploited for therapeutic benefit.

  11. Regulation of integrin adhesions by varying the density of substrate-bound epidermal growth factor.

    Science.gov (United States)

    Shahal, Tamar; Geiger, Benjamin; Dunlop, Iain E; Spatz, Joachim P

    2012-12-01

    Substrates coated with specific bioactive ligands are important for tissue engineering, enabling the local presentation of extracellular stimulants at controlled positions and densities. In this study, we examined the cross-talk between integrin and epidermal growth factor (EGF) receptors following their interaction with surface-immobilized Arg-Gly-Asp (RGD) and EGF ligands, respectively. Surfaces of glass coverslips, modified with biotinylated silane-polyethylene glycol, were functionalized by either biotinylated RGD or EGF (or both) via the biotin-NeutrAvidin interaction. Fluorescent labeling of the adhering A431 epidermoid carcinoma cells for zyxin or actin indicated that EGF had a dual effect on focal adhesions (FA) and stress fibers: at low concentrations (0.1; 1 ng/ml), it stimulated their growth; whereas at higher concentrations, on surfaces with low to intermediate RGD densities, it induced their disassembly, leading to cell detachment. The EGF-dependent dissociation of FAs was, however, attenuated on higher RGD density surfaces. Simultaneous stimulation by both immobilized RGD and EGF suggest a strong synergy between integrin and EGFR signaling, in FA induction and cell spreading. A critical threshold level of EGF was required to induce significant variation in cell adhesion; beyond this critical density, the immobilized molecule had a considerably stronger effect on cell adhesion than did soluble EGF. The mechanisms underlying this synergy between the adhesion ligand and EGF are discussed.

  12. Andrographolide regulates epidermal growth factor receptor and transferrin receptor trafficking in epidermoid carcinoma (A-431) cells.

    Science.gov (United States)

    Tan, Y; Chiow, K H; Huang, D; Wong, S H

    2010-04-01

    Andrographolide is the active component of Andrographis paniculata, a plant used in both Indian and Chinese traditional medicine, and it has been demonstrated to induce apoptosis in different cancer cell lines. However, not much is known about how it may affect the key receptors implicated in cancer. Knowledge of how andrographolide affects receptor trafficking will allow us to better understand new mechanisms by which andrographolide may cause death in cancer cells. We utilized the well-characterized epidermal growth factor receptor (EGFR) and transferrin receptor (TfR) expressed in epidermoid carcinoma (A-431) cells as a model to study the effect of andrographolide on receptor trafficking. Receptor distribution, the total number of receptors and surface receptors were analysed by immunofluorescence, Western blot as well as flow-cytometry respectively. Andrographolide treatment inhibited cell growth, down-regulated EGFRs on the cell surface and affected the degradation of EGFRs and TfRs. The EGFR was internalized into the cell at an increased rate, and accumulated in a compartment that co-localizes with the lysosomal-associated membrane protein in the late endosomes. This study sheds light on how andrographolide may affect receptor trafficking by inhibiting receptor movement from the late endosomes to lysosomes. The down-regulation of EGFR from the cell surface also indicates a new mechanism by which andrographolide may induce cancer cell death.

  13. Epidermal growth factor enhances osteogenic differentiation of dental pulp stem cells in vitro.

    Science.gov (United States)

    Del Angel-Mosqueda, Casiano; Gutiérrez-Puente, Yolanda; López-Lozano, Ada Pricila; Romero-Zavaleta, Ricardo Emmanuel; Mendiola-Jiménez, Andrés; Medina-De la Garza, Carlos Eduardo; Márquez-M, Marcela; De la Garza-Ramos, Myriam Angélica

    2015-09-03

    Epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) play an important role in extracellular matrix mineralization, a complex process required for proper bone regeneration, one of the biggest challenges in dentistry. The purpose of this study was to evaluate the osteogenic potential of EGF and bFGF on dental pulp stem cells (DPSCs). Human DPSCs were isolated using CD105 magnetic microbeads and characterized by flow cytometry. To induce osteoblast differentiation, the cells were cultured in osteogenic medium supplemented with EGF or bFGF at a low concentration. Cell morphology and expression of CD146 and CD10 surface markers were analyzed using fluorescence microscopy. To measure mineralization, an alizarin red S assay was performed and typical markers of osteoblastic phenotype were evaluated by RT-PCR. EGF treatment induced morphological changes and suppression of CD146 and CD10 markers. Additionally, the cells were capable of producing calcium deposits and increasing the mRNA expression to alkaline phosphatase (ALP) and osteocalcin (OCN) in relation to control groups (p stem cell-based therapy for bone tissue engineering applications in periodontics and oral implantology.

  14. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitr