Vaccine-induced toxic epidermal necrolysis: A case and systematic review.

Science.gov (United States)

Chahal, Dev; Aleshin, Maria; Turegano, Mamina; Chiu, Melvin; Worswick, Scott

2018-01-15

Erythema multiforme (EM), Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are cutaneous hypersensitivityreactions that develop in response to specific triggers such as medications and certain infections. Vaccines, which undergo rigorous safety testing prior to use in humans, are a rare cause of SJS/TEN and little is known about the frequency of such events and corresponding pathogenesis. Herein, we discuss a case of suspected TEN in a 19-year-old woman who received the meningococcal B vaccine (the first report of such an association) and conduct a systematic review of the associated literature. We also discuss management of this patient with a single dose of etanercept. Relevant literature was searched using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) method. A total of 29 articles reporting EM, SJS, or TEN following vaccination were included from >5 countries. Of the 29, 22 articles reported EM, 6/29 reported SJS, and 4/29 reported TEN (3 articlesreported cases of both EM and SJS/TEN). We suggest consideration of vaccines as an etiology for cases of SJS or TEN that begin with an EM-like presentation, and provide further evidence for the use of etanercept as a viable treatment for TEN.

Griseofulvin and/or Terbinafine Induced Toxic Epidermal Necrolysis in an Adult Female Patient - A Case Report.

Science.gov (United States)

Jadeja, Dharamvirsinh; Jaiswal, Chandra S; Panchasra, Ashwin; Tripathi, Chandrabhanu B

2016-01-01

An 18 years old female patient, who was taking treatment for tinea cruris developed Toxic Epidermal Necrolysis (TEN) due to therapeutic dose of griseofulvin with concomitant use of terbinafine. Both the drugs were stopped; patient's condition was gradually improved after starting the treatment. As per WHO-UMC causality assessment criteria, association between reaction and drug was possible (for both griseofulvin and terbinafine). Griseofulvin and terbinafine, both are widely used as an oral antifungal agent to treat fungal infections, careful monitoring is required in the initial periods of the treatment to prevent such type of serious adverse drug reaction. We report a case of TEN possibly caused by griseofulvin with concomitant use of terbinafine resulting in diagnostic difficulty.

Toxic Epidermal Necrolysis-Like Lesions and Systemic Lupus Erythematosus Possibly Triggered by Sulfasalazine

DEFF Research Database (Denmark)

Krabbe, Simon; Gül, Cigdem; Andersen, Bjarne

2016-01-01

elevated ferritin, and muscle wasting. A diagnosis of systemic lupus erythematosus was made, and mycophenolate mofetil and systemic glucocorticoids brought this severe disease under control. Toxic epidermal necrolysis-like lesions and hemophagocytic syndrome have been reported as manifestations of systemic...... lupus erythematosus. This patient possibly had spondyloarthritis or an undifferentiated connective tissue disease at presentation, and we suggest, based on the timing of events, that sulfasalazine may have acted as a trigger of the severe disease manifestations....

Perforated Sigmoid Diverticulitis in the Presence of Toxic Epidermal Necrolysis

Directory of Open Access Journals (Sweden)

P. Heye

2014-02-01

Full Text Available Even though the incidence of toxic epidermal necrolysis (TEN is low, it is also associated with a high mortality rate. The condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. We present a case of perforated sigmoid diverticulitis in the presence of TEN. The patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of TEN. Characteristic abdominal symptoms, however, were missing. Gastrointestinal involvement in TEN appears to be a poor prognostic factor; medical staff must therefore be alert to patients with TEN who complain of abdominal discomfort. The exact pathogenesis, however, remains unclear.

A review of toxic epidermal necrolysis management in Japan

Directory of Open Access Journals (Sweden)

Yuri Kinoshita

2017-01-01

Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

Collagen sheet dressings for cutaneous lesions of toxic epidermal necrolysis

Directory of Open Access Journals (Sweden)

S Bhattacharya

2011-01-01

Full Text Available Toxic epidermal necrolysis (TEN is associated with a significant mortality of 30-50% and long-term sequelae. Treatment includes early admission to a burn unit, where management with precise fluid, electrolyte, protein, and energy supplementation, moderate mechanical ventilation, and expert wound care can be provided. Specific treatment with immunosuppressive drugs or immunoglobulins did not show an improved outcome in most studies and remains controversial. We have treated the cutaneous lesions of seven patients of TEN with collagen sheet dressings and have found a significant reduction in morbidity. The sheets are a one-time dressing, easy to apply and they reduce fluid loss, prevent infection, reduce pain, avoid repeated dressings and gradually peal off as the underlying lesions heal.

Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN): could retinoids play a causative role?

Science.gov (United States)

Mawson, Anthony R; Eriator, Ike; Karre, Sridhar

2015-01-12

Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.

Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

Directory of Open Access Journals (Sweden)

Wen-Hung Chung

2010-01-01

Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

Directory of Open Access Journals (Sweden)

Yung-Yi Lee

2013-06-01

Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

Granulocyte colony-stimulating factor in toxic epidermal necrolysis (TEN) and Chelsea & Westminster TEN management protocol [corrected].

Science.gov (United States)

de Sica-Chapman, A; Williams, G; Soni, N; Bunker, C B

2010-04-01

Toxic epidermal necrolysis (TEN) is a rare but life-threatening, allergic drug reaction. Skin blistering with epidermal and mucosal necrolysis with subsequent detachment from an inflamed underlying dermis is a hallmark of the condition. The pathogenesis of TEN is not well understood, accounting for controversies about its management and significant delay in initiating potentially beneficial therapy. There are no management protocols based on a robust evidence base. Prompt recognition of the diagnosis and consensus on early management initiatives are necessary in order to improve outcomes and survival in TEN. To date, TEN management has been directed at arresting the allergic reaction and treating the complications. We have identified a need for specific medical interventions to accelerate wound regeneration. This approach has not previously been adopted in the management of TEN. We observed that in two cases of severe TEN, dramatic re-epithelialization and recovery coincided with the introduction of granulocyte colony-stimulating factor (G-CSF) for neutropenia. We explain how addition of the G-CSF promotes recovery from TEN by enhanced bioregeneration of the damaged tissues through accelerated re-epithelialization. G-CSF has been used for severe neutropenia in TEN, but we recommend and explain why, as in our Chelsea and Westminster protocol, G-CSF should be considered in treating severe TEN irrespective of the severity of neutropenia.

A Case of Microstomia Subsequent to Toxic Epidermal Necrolysis Surgically Treated by Simple Technique

Directory of Open Access Journals (Sweden)

Takanobu Mashiko, MD

2013-06-01

Full Text Available Summary: Toxic epidermal necrolysis (TEN is a rare but severe adverse dermatitis that is an autoimmune reaction to drugs such as nonsteroidal anti-inflammatory drugs. TEN most severely affects the mucous membranes including the mouth and could develop into microstomia; however, microstomia in relation to TEN has rarely been reported in the literature. We describe an adult female patient who developed microstomia due to scar contracture of the bilateral oral commissures subsequent to TEN and was successfully treated by a simple surgical technique consisting solely of transverse incision of the commissure and longitudinal closure.

Don’t live in a town where there are no doctors: toxic epidermal necrolysis initially misdiagnosed as oral thrush

Science.gov (United States)

Wani, Abdul Majid; Hussain, Waleed Mohd; Fatani, Mohamad Ibrahim; Ali, Khaled Shawkat; Khoujah, Amer Mohd; Akhtar, Mubeena; Maimani, Ghassan Adnan Al; Raja, Sadeya Hanif; Basraheel, Ashraf; Fareed, Khurram

2009-01-01

Toxic epidermal necrolysis (TEN) is a rare but life threatening skin disease that is most commonly drug induced. The exact pathogenesis of TEN is still unknown and many drugs, including prednisolone, cyclosporin and intravenous immunoglobulin (IVIG), have been used in an attempt to halt the disease process. The use of IVIG in particular is controversial. Recently, the US Food and Drug Administration (FDA) has made a labelling change to the drug information for carbamazepine. Owing to recent data implicating the HLA allele B*1502 as a marker for carbamazepine induced Stevens–Johnson syndrome and TEN in Han Chinese, the FDA recommends genotyping all Asians for the allele. We present an interesting case of carbamazepine induced TEN which was confused with oral thrush, had no skin lesions on presentation, and had an excellent response to a 5 day course of methylprednisolone and high dose IVIG in combination. PMID:22207871

Linear immunoglobulin A dermatosis mimicking toxic epidermal necrolysis: a case report of etanercept treatment.

Science.gov (United States)

Prieto-Barrios, M; Velasco-Tamariz, V; Tous-Romero, F; Burillo-Martinez, S; Zarco-Olivo, C; Rodriguez-Peralto, J L; Ortiz-Romero, P L

2018-03-01

A 65-year-old pluripathological woman attended our hospital with a cutaneous eruption of sudden appearance after vancomycin treatment. She presented targetoid lesions affecting approximately 25-30% of her body surface, large erosions with mucosal lesions and positive Nikolsky sign. Under the initial clinical suspicion of toxic epidermal necrolysis (TEN), and considering the recent literature of successful use of etanercept in these cases, she was treated with a single dose of this antitumour necrosis factor (anti-TNF) agent. Subsequently, the exanthema progression stopped and resolution of the lesions happened in a few days. Later on, histopathology revealed a subepidermal blister with dense neutrophilic infiltrate and linear deposits of immunoglobulin A (IgA) on the dermoepidermal junction, allowing us to establish the diagnosis of drug-induced linear IgA dermatosis mimicking TEN. Linear IgA dermatosis can have severe clinical manifestations, even mimicking TEN, and can have high mortality, especially in drug-induced cases. We have not found any other report of linear IgA dermatosis treated with etanercept in the English literature. Anti-TNF medications could represent useful therapeutic alternatives in this dermatosis. © 2017 British Association of Dermatologists.

Toxic epidermal necrolysis associated with deflazacort therapy with nephrotic syndrome

Directory of Open Access Journals (Sweden)

Eun Chae Lee

2014-12-01

Full Text Available Toxic epidermal necrolysis (TEN is a drug-related fatal disease. Extensive necrosis of the epidermis can lead to serious complications. This report describes two cases of TEN, associated with deflazacort (DFZ, in two boys, aged 4 years and 14 years, with nephrotic syndrome (NS. The 14-year-old male teenager received DFZ following NS relapse. After 17 days, pruritic papules appeared on the lower extremities. Another case involved a 4-year-old boy receiving DFZ and enalapril. After a 41-day DFZ treatment period, erythematous papules appeared on the palms and soles. Within 3 days, both boys developed widespread skin lesions (>50% and were admitted to the intensive care unit for resuscitative and supportive treatment. The patients showed improvement after intravenous immunoglobulin-G therapy. Owing to the rapid, fatal course of TEN, clinicians need to be aware of the adverse effects of this drug when treating cases of NS.

Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis and Treatment With a Biologic: A Case Report.

Science.gov (United States)

Chong, Ian; Chao, Alice

2017-01-01

One of the most dangerous dermatologic emergencies is Stevens-Johnson Syndrome (SJS)/toxic epidermal necrolysis (TEN). Although a rare disease, it can often lead to significant mortality. In this case report, we present a 77-year-old man who developed a sloughing rash that was secondary to a nonsteroidal anti-inflammatory drug. In addition to the recommended supportive care, the patient was treated with etanercept, a new, less commonly used intervention. We provide a brief review of SJS/TEN. Nonsteroidal anti-inflammatory drugs are a rare cause of SJS/TEN, and additionally, the use of biologics is a novel treatment modality for SJS/TEN.

Fatal toxic epidermal necrolysis associated with minoxidil.

Science.gov (United States)

Karaoui, Lamis R; Chahine-Chakhtoura, Corinne

2009-04-01

Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this

Intensive Care in a Patient with Toxic Epidermal Necrolysis

Directory of Open Access Journals (Sweden)

J. Wallenborn

2017-01-01

Full Text Available Toxic epidermal necrolysis (TEN is a serious adverse drug reaction with high lethality, which usually requires intensive-medical care. A 44-year-old man developed generalized exanthema with increasing exfoliation and mucosal involvement after taking allopurinol, ibuprofen, and etoricoxib. The clinical diagnosis of TEN was histologically confirmed. Prednisolone therapy with 3 mg/kg body weight (BW was not able to prevent further progress to finally 80% of the body surface, and infliximab 5 mg/kg BW was given as a single dose. This prevented further progression of the TEN. Despite marked improvement in skin findings, the ICU stay was prolonged by a complex analgosedation, transient kidney failure, volume management, positioning therapy, and vegetatively impeded weaning. Moreover, there was colonization with multiresistant bacteria (MRSA and VRE. Nonetheless, the patient could be restored to health and was released after four weeks. Infliximab seems to be effective in the treatment of TEN, especially in cases of rapid progression. Moreover, patients with TEN are difficult to handle in intensive-medical care, whereby attention should especially be paid to sufficient pain therapy, and the positioning of the patient is a particular challenge.

Warfarin-induced toxic epidermal necrolysis in combination therapy of Henoch-Schönlein purpura nephritis: a case report.

Science.gov (United States)

Kasahara, Katsuaki; Gotoh, Yoshimitsu; Kuroyanagi, Yoshiyuki; Nagano, China

2017-07-14

Toxic epidermal necrolysis (TEN) is a rare life-threatening condition almost exclusively attributed to drugs. The main etiologic factors for TEN are sulphonamides, anticonvulsants, and antibiotics; however, there are no published reports of warfarin causing TEN. We present the case of a 3-year-old patient who developed TEN while receiving treatment for Henoch-Schönlein purpura nephritis (HSPN). With multiple-drug therapy comprising prednisolone, mizoribine, dipyridamole, and warfarin, it is difficult to detect which drug is the causative agent. While in most cases, diagnosis of the causative drug is based on clinical history without a lymphocyte transformation test (LTT), we performed the test three times and identified the causative drug as warfarin at the late phase. We continued HSPN treatment without warfarin, and results showed good renal function without life-threatening complications. To our knowledge, this is the first report about TEN caused by warfarin. Repeated LTTs could be useful for identifying TEN-causative drugs even in the late phase.

Topical Treatment for Stevens - Johnson Syndrome and Toxic Epidermal Necrolysis: A Review

Directory of Open Access Journals (Sweden)

Schandra Purnamawati

2016-08-01

Full Text Available Background: Stevens - Johnson syndrome (SJS and Toxic Epidermal Necrolysis (TEN are currently regarded to be same disease entity which differs only in the extent and severity of epidermal sloughing. Both are potentially life-threatening mucocutaneous immunologic reaction, which are most frequently induced by drug consumption. The epithelial destruction of skin and mucosal membrane can cause both acute as well as chronic/ long term outcomes in term of  late sequelae during the course of the disease. Sequelae often occur during the late phase of SJS/TEN and become a significant problem due its chronicity and severe degree of impairment, which leads to deterioration of quality of life for the patients. This may prevented or decreased in terms of intensity if the patient’s received prompt and sufficient topical therapy, particularly in managing lesions on the mucosa of the eye, oral, and genital. Objective : This review underlines topical therapies which could be delivered for management of mucocutaneous lesions from SJS/ TEN, aimed to prevent late sequelae due to SJS – TEN in order to improve the life quality of SJS – TEN survivors. Conclusion: SJS/ TEN frequently lead to late sequeale which includes skin, ocular, oral, and genital involvement. These sequelaes are often severe and chonic. Thus, may cause significant decrease in quality of life of SJS/TEN survivors. It is therefore most important to detect them early in order to manage them adequately. To date, we still have an impression that the specific sequelae of SJS – TEN are often late diagnosed and insufficiently treated. Finally, we want to emphasize that for mucosal involvement in particular, such as ocular, genital and oral involvement, a careful topical treatment have to be taken into special consideration in order to prevent severe late sequelae. 

Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A Concise Review with a Comprehensive Summary of Therapeutic Interventions Emphasizing Supportive Measures

OpenAIRE

Schneider, Jeremy A.; Cohen, Philip R.

2017-01-01

Introduction Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are two of the most severe dermatologic conditions occurring in the inpatient setting. There is a lack of consensus regarding appropriate management of SJS and TEN. Purpose The scientific literature pertaining to SJS and TEN (subsequently referred to as SJS/TEN) is summarized and assessed. In addition, an interventional approach for the clinician is provided. Methods PubMed was searched with the key words: cortic...

Tumor necrosis factor alpha inhibitors in the treatment of toxic epidermal necrolysis.

Science.gov (United States)

Woolridge, Katelyn F; Boler, Patrick L; Lee, Brian D

2018-01-01

Toxic epidermal necrolysis (TEN) is a rare, life-threatening adverse drug reaction for which there is no standardized or consistently effective treatment. Due to a greater understanding of disease pathogenesis and the identification of tumor necrosis factor (TNF) α as a mediator of keratinocyte death, TNF-α antagonists have been used in the treatment of TEN. Specifically, infliximab and etanercept have been shown to be effective at halting disease progression. The objective of this study is to review published case reports and case series using anti-TNF-α medications in the treatment of TEN. Results of many of the articles reviewed support the use of TNF-α inhibitors in TEN in both adult and pediatric populations; however, the risks caused by these potent immunosuppressants must be weighed, and if administered, patients must be closely monitored for infections. Additional studies are needed to further characterize the role of TNF-α inhibition in the treatment of TEN.

A case of toxic epidermal necrolysis initially affecting the skin site of radiation therapy for an intra-cranial post-transplantation lymphoma

International Nuclear Information System (INIS)

Tanoue, Toshihide; Egawa, Kiyofumi; Fukushima, Satoshi; Wakasugi, Syoji; Ono, Tomomichi; Yoshida, Shinsuke; Kouchi, Masato; Nishi, Kazuhiko

2006-01-01

We report a case of post-transplantation lymphoma (intra-cranial EBV-related malignant lymphoma) who developed toxic epidermal necrolysis (TEN) during concomitant phenobarbital administration and radiotherapy. The erythema exsudativum multiforme-like eruption first appeared on the site of radiation and extended to approximately 35% of the body surface. After stopping radiation therapy and all medications, including immunosuppressant, anticonvulsant, and diuretic drugs, treatment was successfully administered by systemic corticosteroids including semi-pulse therapy (500 mg of methylpredonisolone sodium succinate for 3 days). (author)

Toxic epidermal necrolysis and its impact on physiotherapy management: a case report

Directory of Open Access Journals (Sweden)

J. Schneiderman

2010-01-01

Full Text Available The purpose of this paper is to report on the modified physiotherapy intervention  for  toxic  epidermal  necrolysis  (TEN  in  a 31 year old pregnant human immunodeficiency virus (HIV seropositive woman  on antiretroviral  therapy.  Physiotherapy  intervention  consisted  of  nebulisation  and  the  active  cycle  of  breathing  technique  in  order to  clear  secretions.  To restore  lung  volumes,  the  active  cycle  of  breath-ing  technique  was  utilized  in  addition  to  positive  expiratory  pressure,  incentive  spirometry  and  positioning. Passive  and  active  exercises and  stretches  were  employed  to  maintain  and  regain  range  of  motion in  affected  limbs.  Following  intervention, positive  changes  were  noted  in  outcome  measures  such  as  secretion clearance, breath sounds and general function. It is concluded that physiotherapy intervention has a role to play in the rehabilitation of patients with TEN.

Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A Concise Review with a Comprehensive Summary of Therapeutic Interventions Emphasizing Supportive Measures.

Science.gov (United States)

Schneider, Jeremy A; Cohen, Philip R

2017-06-01

Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are two of the most severe dermatologic conditions occurring in the inpatient setting. There is a lack of consensus regarding appropriate management of SJS and TEN. The scientific literature pertaining to SJS and TEN (subsequently referred to as SJS/TEN) is summarized and assessed. In addition, an interventional approach for the clinician is provided. PubMed was searched with the key words: corticosteroids, cyclosporine, etanercept, intravenous immunoglobulin, Stevens-Johnson syndrome, and toxic epidermal necrolysis. The papers generated by the search, and their references, were reviewed. Supportive care is the most universally accepted intervention for SJS/TEN. Specific guidelines differ from the care required for patients with thermal burns. Adjuvant therapies are utilized in most severe cases, but the data are thus far underwhelming and underpowered. Using systemic corticosteroids as sole therapy is not supported. A consensus regarding combined corticosteroids and intravenous immunoglobulin (IVIG) has not been reached. Data regarding IVIG, currently the standard of care for most referral centers, is conflicting. Newer studies regarding cyclosporine and tumor necrosis factor inhibitors are promising, but not powered to provide definitive evidence of efficacy. Data regarding plasmapheresis is equivocal. Thalidomide increases mortality. Clinicians who manage SJS/TEN should seek to employ interventions with the greatest impact on their patients' condition. While supportive care measures may seem an obvious aspect of SJS/TEN patient care, providers should understand that these interventions are imperative and that they differ from the care recommended for other critically ill or burn patients. While adjuvant therapies are frequently discussed and debated for hospitalized patients with SJS/TEN, a standardized management approach is not yet clear based on the current data. Therefore, until further data

Clinical Features and Treatment Outcomes among Children with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A 20-Year Study in a Tertiary Referral Hospital

OpenAIRE

Susheera Chatproedprai; Vanvara Wutticharoenwong; Therdpong Tempark; Siriwan Wananukul

2018-01-01

Aim. To determine the probable causative factors, clinical features, and treatment outcomes of Stevens-Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), and SJS-TEN overlap in children. Methods. A 20-year database review of all children diagnosed with SJS/TEN/SJS-TEN overlap at the King Chulalongkorn Memorial Hospital, Thailand. Results. 36 patients (M : F, 16 : 20) with the mean age of 9.2±4.0 years were identified. There were 20 cases of SJS, 4 cases of SJS-TEN overlap, and 12 cases...

Stevens-Johnson syndrome and toxic epidermal necrolysis in childhood-onset systemic lupus erythematosus patients: a multicenter study

Directory of Open Access Journals (Sweden)

Ana Paula Sakamoto

2017-07-01

Full Text Available Objective: To assess Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN in a large population of childhood-onset systemic lupus erythematosus (cSLE patients. Methods: Multicenter study including 852 cSLE patients followed in Pediatric Rheumatology centers in São Paulo, Brazil. SJS was defined as epidermal detachment below 10% of body surface area (BSA, overlap SJS-TEN 10-30% and TEN greater than 30% of BSA. Results: SJS and TEN was observed in 5/852 (0.6% cSLE female patients, three patients were classified as SJS and two patients were classified as overlap SJS-TEN; TEN was not observed. The mean duration of SJS and overlap SJS-TEN was 15 days (range 7-22 and antibiotics induced four cases. Regarding extra-cutaneous manifestations, hepatomegaly was observed in two cSLE patients, nephritis in two and neuropsychiatric involvement and conjunctivitis were observed respectively in one patient. Hematological involvement included lymphopenia in four, leucopenia in three and thrombocytopenia in two patients. The mean SLEDAI-2K score was 14.8 (range 6-30. Laboratory analysis showed low C3, C4 and/or CH50 in two patients and the presence of anti-dsDNA autoantibody in two patients. One patient had lupus anticoagulant and another one had anticardiolipin IgG. All patients were treated with steroids and four needed additional treatment such as intravenous immunoglobulin in two patients, hydroxychloroquine and azathioprine in two and intravenous cyclophosphamide in one patient. Sepsis was observed in three cSLE patients. Two patients required intensive care and death was observed in one patient. Conclusion: Our study identified SJS and overlap SJS-TEN as rare manifestations of active cSLE associated with severe multisystemic disease, with potentially lethal outcome.

The Epidemiology of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in China

Directory of Open Access Journals (Sweden)

Shang-Chen Yang

2018-01-01

Full Text Available Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN are life-threatening disease. However, there are only few epidemiologic studies of SJS/TEN from China. To analyze the clinical characteristics, causality, and outcome of treatment for SJS/TEN in China, we reviewed case reports of patients with SJS/TEN from the China National Knowledge Infrastructure (CNKI and Wanfang database from 2006 to 2016 and patients with SJS/TEN who were admitted to the First Affiliated Hospital of Fujian Medical University during the same period. There were 166 patients enrolled, including 70 SJS, 2 SJS/TEN overlap, and 94 TEN. The most common offending drugs were antibiotics (29.5% and anticonvulsants (24.1%. Carbamazepine, allopurinol, and penicillins were the most common single offending drugs (17.5%, 9.6%, and 7.2%. Chinese patent medicines accounted for 5.4%. There were 76 (45.8% patients receiving systemic steroid and intravenous immunoglobulin (IVIG in combination therapy, especially for TEN (80.3%, and others were treated with systemic steroids alone. Mortality rate of combination treatment comparing with steroid alone in TEN patients had no statistical significance. In conclusion, carbamazepine and allopurinol were the leading causative drugs for SJS/TEN in China. Combination of IVIG and steroids is a common treatment for TEN, but its efficacy in improving mortality needs further investigation.

Stevens Johnson syndrome, toxic epidermal necrolysis and SJS-TEN overlap: A retrospective study of causative drugs and clinical outcome

Directory of Open Access Journals (Sweden)

Sharma Vinod

2008-01-01

Full Text Available Background and Aims: Stevens Johnson syndrome (SJS, toxic epidermal necrolysis (TEN and SJS-TEN overlap are serious adverse cutaneous drug reactions. Drugs are often implicated in these reactions. Methods: A retrospective analysis of inpatients′ data with these dermatological diagnoses were carried out for three years, to study the causative drugs, clinical outcome, and mortality in these conditions. Results: Thirty patients (15 TEN, nine SJS-TEN overlap, and six SJS were admitted. In 21 cases, multiple drugs were implicated whereas single drugs were responsible in nine. Anticonvulsants (35.08% were the most commonly implicated drugs followed by antibiotics (33.33% and NSAIDS (24.56%. Twenty-five patients recovered whereas five died (four TEN, one SJS-TEN overlap. Conclusion: Anticonvulsants, antibiotics and NSAIDs were the most frequently implicated drugs. TEN causes higher mortality than both SJS and SJS-TEN overlap.

Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis--A Comprehensive Review and Guide to Therapy. I. Systemic Disease.

Science.gov (United States)

Kohanim, Sahar; Palioura, Sotiria; Saeed, Hajirah N; Akpek, Esen K; Amescua, Guillermo; Basu, Sayan; Blomquist, Preston H; Bouchard, Charles S; Dart, John K; Gai, Xiaowu; Gomes, José A P; Gregory, Darren G; Iyer, Geetha; Jacobs, Deborah S; Johnson, Anthony J; Kinoshita, Shigeru; Mantagos, Iason S; Mehta, Jodhbir S; Perez, Victor L; Pflugfelder, Stephen C; Sangwan, Virender S; Sippel, Kimberly C; Sotozono, Chie; Srinivasan, Bhaskar; Tan, Donald T H; Tandon, Radhika; Tseng, Scheffer C G; Ueta, Mayumi; Chodosh, James

2016-01-01

The intent of this review is to comprehensively appraise the state of the art with regard to Stevens Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN), with particular attention to the ocular surface complications and their management. SJS and TEN represent two ends of a spectrum of immune-mediated, dermatobullous disease, characterized in the acute phase by a febrile illness followed by skin and mucous membrane necrosis and detachment. The widespread keratinocyte death seen in SJS/TEN is rapid and irreversible, and even with early and aggressive intervention, morbidity is severe and mortality not uncommon. We have divided this review into two parts. Part I summarizes the epidemiology and immunopathogenesis of SJS/TEN and discusses systemic therapy and its possible benefits. We hope this review will help the ophthalmologist better understand the mechanisms of disease in SJS/TEN and enhance their care of patients with this complex and often debilitating disease. Part II (April 2016 issue) will focus on ophthalmic manifestations. Copyright © 2016 Elsevier Inc. All rights reserved.

Nine years of a single referral center management of Stevens-Johnson syndrome and toxic epidermal necrolysis (Lyell's syndrome).

Science.gov (United States)

Monteiro, Diana; Egipto, Paula; Barbosa, Julia; Horta, Ricardo; Amarante, Jose; Silva, Pedro; Silva, Alvaro

2017-06-01

Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) corresponds to a rare and acute life-threatening mucocutaneous reactions characterized by extensive necrosis and epidermal detachment. There are no efficacious pharmaceutical interventions proven through large clinical trials. We sought to study clinical cases admitted in our institution in order to determine which drugs and medical comorbidities or treatments impacted the mortality. In a retrospective study over 9 years we evaluated all patients presenting biopsy-proven SJS or TEN for age, gender, total body surface area involved, causing agents, SCORTEN score, blood transfusion, steroid administration, intubation, length of intensive care stay and death rate. Statistical analysis was done using SPSS statistical software. The highest incidence of SJS and TEN was in age group of 71-80 years. Of the 30 patients, 30% died from SJS/TEN, mainly due sepsis. For each subgroup SJS/TEN overlap had the highest mortality. The highest mortality was from antibiotic treatment as causing agent. Step-wise regression analysis identified mechanical ventilation requirement and age over 65 years as mortality high-risk factors. The most crucial interventions are discontinuation of the offending drug and prompt referral to a burn unit, which helps in early diagnosis and decrease mortality in these diseases. When SJS/TEN is caused by antibiotics suspicion of developing fatal sepsis should be high, independently of patients' medical condition.

Severe idiosyncratic drug reactions with epidermal necrolysis: A 5-year study

Directory of Open Access Journals (Sweden)

I O Fadeyibi

2011-01-01

Full Text Available Introduction: Idiosyncratic drug reactions (IDRs are unexpected responses to a drug. The spectrums of severe cutaneous reactions include Stevens-Johnson Syndrome (SJS, SJS/Lyell Syndrome and Toxic Epidermal Necrolysis (TEN. The conditions are associated with high mortality. This study was designed to determine the causal agents, patterns of presentations, review the management and make recommendations to reduce the incidence and mortality of this class of drug reactions. Materials and Methods: A retrospective study was made of patients seen with IDR in the Lagos State University Teaching Hospital, LASUTH, between January, 2004 and December, 2008. They were cases admitted with bullous skin eruptions with associated systemic symptoms. Results: Sixty-seven patients were seen, with 45 (67.2% satisfying the inclusion criteria. Fifteen males and 30 females were involved, giving a male to female (M:F ratio of 1:2. Their ages ranged from 7 to 79 years (mean, 40.02 ± 17.89 years. Peak incidences occurred among the 20-24 and 30-34 year age groups. The causal agents were antibiotics (48.89%, sulphonamides (24.44%, herbal preparations (17.78% and artemisinin drugs (8.89%. Conclusions: The age groups with the peak incidence are the most likely to indulge more in drug abuse in environments with poor drug control. Diagnosis of SJS, SJS/TEN and TEN were missed in many patients at first contact due to the progressive nature of the conditions. Patients needed reviews at regular intervals when IDR was suspected. Health education to prevent drug abuse is important and herbal preparations should be scientifically studied to determine the efficacy and side-effects.

Improving mortality outcomes of Stevens Johnson syndrome/toxic epidermal necrolysis: A regional burns centre experience.

Science.gov (United States)

Nizamoglu, M; Ward, J A; Frew, Q; Gerrish, H; Martin, N; Shaw, A; Barnes, D; Shelly, O; Philp, B; El-Muttardi, N; Dziewulski, P

2018-05-01

Stevens Johnson Syndrome/toxic epidermal necrolysis (SJS/TEN) are rare, potentially fatal desquamative disorders characterised by large areas of partial thickness skin and mucosal loss. The degree of epidermal detachment that occurs has led to SJS/TEN being described as a burn-like condition. These patients benefit from judicious critical care, early debridement and meticulous wound care. This is best undertaken within a multidisciplinary setting led by clinicians experienced in the management of massive skin loss and its sequelae. In this study, we examined the clinical outcomes of SJS/TEN overlap & TEN patients managed by our regional burns service over a 12-year period. We present our treatment model for other burn centres treating SJS/TEN patients. A retrospective case review was performed for all patients with a clinical diagnosis of TEN or SJS/TEN overlap admitted to our paediatric and adult burns centre between June 2004 and December 2016. Patient demographics, percentage total body surface area (%TBSA), mucosal involvement, causation, severity of illness score (SCORTEN), length of stay and survival were appraised with appropriate statistical analysis performed using Graph Pad Prism 7.02 Software. During the study period, 42 patients (M26; F: 16) with TEN (n=32) and SJS/TEN overlap (n=10) were managed within our burns service. Mean %TBSA of cutaneous involvement was 57% (range 10-100%) and mean length of stay (LOS) was 27 days (range 1-144 days). We observed 4 deaths in our series compared to 16 predicted by SCORTEN giving a standardised mortality ratio (SMR) of 24%. Management in our burns service with an aggressive wound care protocol involving debridement of blistered epidermis and wound closure with synthetic and biological dressings seems to have produced benefits in mortality when compared to predicted outcomes. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

Stevens-Johnson syndrome and toxic epidermal necrolysis due to anticonvulsants share certain clinical and laboratory features with drug-induced hypersensitivity syndrome, despite differences in cutaneous presentations.

Science.gov (United States)

Teraki, Y; Shibuya, M; Izaki, S

2010-10-01

Drug-induced hypersensitivity syndrome (DIHS)/drug rash with eosinophilia and systemic symptoms (DRESS) syndrome is characterized by late disease onset, fever, rash, hepatic dysfunction, haematological abnormalities, lymphadenopathy and often, human herpesvirus (HHV) reactivation. The diagnosis of DIHS is based on the combined presence of these findings. Anticonvulsants are a major cause of DIHS and may also cause Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). We examined whether SJS/TEN due to anticonvulsants display similar clinical and laboratory features seen in DIHS. Patients diagnosed with SJS or TEN due to anticonvulsants (n = 8) were examined and their clinical features and laboratory findings were compared with patients with anticonvulsant-related DIHS (n = 6). Seven of the eight patients with SJS/TEN developed symptoms > 3 weeks after starting anticonvulsants. Hepatic dysfunction was present in six patients with SJS/TEN and five patients with DIHS. Leucocytosis and/or eosinophilia was noted in seven patients with SJS/TEN and four patients with DIHS. Only one patient in the SJS/TEN group had atypical lymphocytosis; this was present in four patients with DIHS. Reactivation of HHV-6 was detected in one of the four patients tested in the SJS/TEN group, although it was seen in five of the six patients with DIHS. TSJS/TEN due to anticonvulsants may exhibit some clinical and laboratory features of DIHS. The nature of the cutaneous involvement should be emphasized in the diagnosis of DIHS. © 2009 The Author(s). Journal compilation © 2009 British Association of Dermatologists.

Stevens Johnsons syndrom og toksisk epidermal nekrolyse

DEFF Research Database (Denmark)

Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

2013-01-01

Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

Effect of N-acetylcysteine combined with infliximab on toxic epidermal necrolysis. A proof-of-concept study.

Science.gov (United States)

Paquet, Philippe; Jennes, Serge; Rousseau, Anne Françoise; Libon, Florence; Delvenne, Philippe; Piérard, Gérald E

2014-12-01

The pathophysiology of toxic epidermal necrolysis (TEN) is thought to be related to a drug-induced oxidative stress combined with TNFα overexpression by keratinocytes. None of the current treatments for TEN including systemic corticosteroids, cyclosporine and intravenous administration of immunoglobulins has proven superior over supportive care only. A total of 10 TEN patients were enrolled to be treated at admission in burn units with the antioxidant N-acetylcysteine [NAC, 150mg/kg in a 20-h intravenous (IV) administration], or the combination of the same IV NAC perfusion with the anti-TNFα antibody infliximab (Remicade(®)), administered at a 5mg/kg dosage as a single 2-h IV administration. TEN was confirmed by a skin biopsy taken from a bullous lesion. At entry in the trial and 48h later, the illness auxiliary score (IAS) of clinical severity was determined and the extent in altered skin area (erythema and blisters) was assessed as a relative body area. Skin biopsies of both clinically uninvolved and erythematous areas were collected and immunohistochemistry was performed for assessing the density of inflammatory cells (CD8+ T cells, CD68+ macrophages) and keratinocytes enriched in intracellular calcium (Ca(++)) identified by the Mac387 anti-calprotectin antibody. No unexpected drug-induced adverse event was noticed. After 48h of both treatment modalities, improvements were not observed in the extent of skin involvement and in IAS. Immunohistopathology showed the absence of reduction in the amount of intraepidermal inflammatory cells. An increased intracellular Ca(++) load in clinically uninvolved keratinocytes and in erythematous epidermis was noticed. This latter finding suggested the progression in the way of the apoptotic process. On burn unit discharge, the survival in each modality of treatment was not improved compared to the expected outcomes determined from the IAS at admission. In this proof-to-concept attempt, NAC treatment or its combination with

STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT

Directory of Open Access Journals (Sweden)

V.F. Zhernosek

2011-01-01

Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.

Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

African Journals Online (AJOL)

REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.

HLA-A*3101 and carbamazepine-induced hypersensitivity reactions in Europeans.

LENUS (Irish Health Repository)

McCormack, Mark

2011-03-24

Carbamazepine causes various forms of hypersensitivity reactions, ranging from maculopapular exanthema to severe blistering reactions. The HLA-B*1502 allele has been shown to be strongly correlated with carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS-TEN) in the Han Chinese and other Asian populations but not in European populations.

Cost-effectiveness analysis of HLA-B*58: 01 genetic testing before initiation of allopurinol therapy to prevent allopurinol-induced Stevens-Johnson syndrome/toxic epidermal necrolysis in a Malaysian population.

Science.gov (United States)

Chong, Huey Yi; Lim, Yi Heng; Prawjaeng, Juthamas; Tassaneeyakul, Wichittra; Mohamed, Zahurin; Chaiyakunapruk, Nathorn

2018-02-01

Studies found a strong association between allopurinol-induced Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) and the HLA-B*58:01 allele. HLA-B*58:01 screening-guided therapy may mitigate the risk of allopurinol-induced SJS/TEN. This study aimed to evaluate the cost-effectiveness of HLA-B*58:01 screening before allopurinol therapy initiation compared with the current practice of no screening for Malaysian patients with chronic gout in whom a hypouricemic agent is indicated. This cost-effectiveness analysis adopted a societal perspective with a lifetime horizon. A decision tree model coupled with Markov models were developed to estimate the costs and outcomes, represented by quality-adjusted life years (QALYs) gained, of three treatment strategies: (a) current practice (allopurinol initiation without HLA-B*58:01 screening); (b) HLA-B*58:01 screening before allopurinol initiation; and (c) alternative treatment (probenecid) without HLA-B*58:01 screening. The model was populated with data from literature review, meta-analysis, and published government documents. Cost values were adjusted for the year 2016, with costs and health outcomes discounted at 3% per annum. A series of sensitivity analysis including probabilistic sensitivity analysis were carried out to determine the robustness of the findings. Both HLA-B*58:01 screening and probenecid prescribing were dominated by current practice. Compared with current practice, HLA-B*58:01 screening resulted in 0.252 QALYs loss per patient at an additional cost of USD 322, whereas probenecid prescribing resulted in 1.928 QALYs loss per patient at an additional cost of USD 2203. One SJS/TEN case would be avoided for every 556 patients screened. At the cost-effectiveness threshold of USD 8695 per QALY, the probability of current practice being the best choice is 99.9%, in contrast with 0.1 and 0% in HLA-B*58:01 screening and probenecid prescribing, respectively. This is because of the low incidence of

Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis

Science.gov (United States)

... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...

A six-month prospective study to find out the treatment outcome, prognosis and offending drugs in toxic epidermal necrolysis from an urban institution in Kolkata

Directory of Open Access Journals (Sweden)

Sudip Das

2013-01-01

Full Text Available Toxic epidermal necrolysis is the life-threatening dermatological emergency, most often an adverse cutaneous drug reaction with high mortality. A 6-month prospective study was conducted in our institution to find out the offending drugs, to assess the prognosis on admission using SCORTEN: Severity of illness score and to find out the treatment outcome. Anticonvulsants, NSAIDs and sulphonamides are the common offending agents; but in our study, 2 were due to homeopathic medicines. Out of 20 patients, on the date of admission SCORTEN prognostic score was 2 in 11 patients, 3 in 8 patients and 4 in 1 patient. Eighteen patients were treated with dexamethasone intramuscular injection and 2 patients got intravenous immunoglobulin (IVIG. All patients survived without any mortality. Though improvement was slightly faster with IVIG, early administration of corticosteroids was also of encouraging efficacy and should be considered in developing countries due to low cost. No mortality in our study suggests need to validate the SCORTEN index in our country in a large number of patients.

Clinical evaluation comparing the efficacy of aquacel Ag with vaseline gauze versus 1% silver sulfadiazine cream in toxic epidermal necrolysis.

Science.gov (United States)

Huang, Shu-Hung; Lin, Cen-Hung; Chang, Kao-Ping; Wu, Sheng-Hua; Lin, Sin-Daw; Lai, Chung-Sheng; Ou, Su-Fei; Lee, Su-Shin

2014-05-01

The purpose of this study was to determine whether using Aquacel Ag (ConvaTec, Skillman, New Jersey) with Vaseline (Unilever, London, England) gauze instead of silver sulfadiazine cream (SSD) as the wound care protocol to treat toxic epidermal necrolysis (TEN) can improve wound healing, pain control, and reduction of labor costs. A retrospective chart review. A burn center with 2 plastic surgeons and 11 nursing staff. A pathologist diagnosed TEN in 35 patients admitted to the burn center from 1995 to 2009. Parameters included the patient's profile, dressing choice, severity-of-illness score for TEN, time to 95% re-epithelialization, visual analog scale pain scores before second dressing change, and labor cost. The exclusion criterion was wound care with neither Aquacel Ag with Vaseline nor SSD exclusively. Twenty patients were enrolled in this study. In the group using Aquacel Ag with Vaseline gauze, the visual analog scale score was significantly less than that of the SSD group (P = .02). Labor costs were significantly lower in the Aquacel Ag with Vaseline gauze group (P < .01). Commencement of specific dressing to 95% re-epithelialization (P = .09) and time spent in the second dressing change (P = .05) had no statistical significance between the 2 groups. This study showed that Aquacel Ag with Vaseline gauze decreased pain and labor costs but did not shorten wound healing time. Thus, Aquacel Ag with Vaseline gauze can be an efficient method for treating TEN wounds.

In Silico Risk Assessment of HLA-A*02:06-Associated Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis Caused by Cold Medicine Ingredients

Directory of Open Access Journals (Sweden)

Hideto Isogai

2013-01-01

Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are severe drug hypersensitivities with high mortality. Typical over-the-counter drugs of cold medicines are suggested to be causative. As multiple ingredients are generally contained in cold medicines, it is of particular interest to investigate which ingredients are responsible for SJS/TEN. However, experimental examination of causal relationships between SJS/TEN and a particular drug molecule is not straightforward. Significant association between HLA-A*02:06 and SJS/TEN with severe ocular surface complications has been observed in the Japanese. In the present study, we have undertaken in silico docking simulations between various ingredients contained in cold medicines available in Japan and the HLA-A*02:06 molecule. We use the composite risk index (CRI that is the absolute value of the binding affinity multiplied by the daily dose to assess the potential risk of the adverse reactions. The drugs which have been recognized as causative drugs of SJS/TEN in Japan have revealed relatively high CRI, and the association between SJS/TEN and HLA-A*02:06 has been qualitatively verified. The results have also shown that some drugs whose links to SJS/TEN have not been clinically recognized in Japan show the high CRI and suggested that attention should be paid to their adverse drug reactions.

Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis Standard Reporting and Evaluation Guidelines: Results of a National Institutes of Health Working Group.

Science.gov (United States)

Maverakis, Emanual; Wang, Elizabeth A; Shinkai, Kanade; Mahasirimongkol, Surakameth; Margolis, David J; Avigan, Mark; Chung, Wen-Hung; Goldman, Jennifer; La Grenade, Lois; Pirmohamed, Munir; Shear, Neil H; Tassaeeyakul, Wichittra; Hoetzenecker, Wolfram; Klaewsongkram, Jettanong; Rerkpattanapipat, Ticha; Manuyakorn, Wiparat; Yasuda, Sally Usdin; Sharon, Victoria R; Sukhov, Andrea; Micheletti, Robert; Struewing, Jeff; French, Lars E; Cheng, Michelle Y

2017-06-01

Toxic epidermal necrolysis (TEN) and Stevens-Johnson Syndrome (SJS) are rare, acute, life-threatening dermatologic disorders involving the skin and mucous membranes. Research into these conditions is hampered by a lack of standardization of case reporting and data collection. To establish a standardized case report form to facilitate comparisons and maintain data quality based on an international panel of SJS/TEN experts who performed a Delphi consensus-building exercise. The elements presented for committee scrutiny were adapted from previous case report forms and from PubMed literature searches of highly cited manuscripts pertaining to SJS/TEN. The expert opinions and experience of the members of the consensus group were included in the discussion. Overall, 21 out of 29 experts who were invited to participate in the online Delphi exercise agreed to participate. Surveys at each stage were administered via an online survery software tool. For the first 2 Delphi rounds, results were analyzed using the Interpercentile Range Adjusted for Symmetry method and statements that passed consensus formulated a new case report form. For the third Delphi round, the case report form was presented to the committee, who agreed that it was "appropriate and useful" for documenting cases of SJS/TEN, making it more reliable and valuable for future research endeavors. With the consensus of international experts, a case report form for SJS/TEN has been created to help standardize the collection of patient information in future studies and the documentation of individual cases.

Survey of Nonprescription Medication and Antibiotic Use in Patients with Stevens-Johnson Syndrome, Toxic Epidermal Necrolysis, and Overlap Syndrome

Directory of Open Access Journals (Sweden)

Katherine J. Sullivan

2018-02-01

Full Text Available Stevens-Johnson syndrome (SJS, toxic epidermal necrolysis (TEN, and overlap syndrome (SJS-TEN are rare, serious skin and mucosa break-down conditions frequently associated with antibiotic use. The role of nonprescription medications alone, or in combination with antibiotics in triggering SJS/TEN, is largely unknown. This study summarized data collected from patient surveys about nonprescription and antibiotic use prior to a SJS/TEN diagnosis. The survey was administered online to members of the U.S. SJS Foundation who had been diagnosed with SJS/TEN or were the parent of a child who had been diagnosed with SJS/TEN. Respondents were asked about nonprescription medications taken within the year before diagnosis, and the approximate point in time before diagnosis that they had taken them. They were also asked about specific prescription medications, including antibiotics, that they took before diagnosis. An estimated 4500 patients received an invitation to complete the survey. 251 patients completed it, resulting in a response rate of 5.6%. The mean age of respondents was 43 years (SD (standard deviation = 17.3 and 70% were female. 32.3% of respondents indicated that a prescription antibiotic triggered their reaction. 14.1% indicated a nonprescription medication had triggered their SJS/TEN, and 18.1% said a nonprescription medication may have triggered their SJS/TEN. 85.5% of respondents said they took a nonprescription medication within three months of their SJS/TEN diagnosis. Of those respondents who reported that an antibiotic triggered their SJS/TEN, 35.2% reported taking a nonprescription medication within the three months prior to their diagnosis. This survey captured valuable information about nonprescription and antibiotic use in SJS/TEN patients. It is important for future studies to estimate the impact of antibiotics on SJS/TEN, and account for nonprescription medication use in that relationship.

UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

International Nuclear Information System (INIS)

Olsen, W.M.; Elgjo, K.

1990-01-01

A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

Science.gov (United States)

Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

2017-05-01

Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

Investigation of Monnose-Binding Lectin gene Polymorphism in Patients with Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome

Directory of Open Access Journals (Sweden)

Sevil Toka

2012-09-01

Full Text Available Objective: Monnose-Binding lectin (MBL appears to play an important role in the immune system. The genetic polymorphisms in the MBL2 gene can result in a reduction of serum levels, leading to a predisposition to recurrent infection. The aim of this study is to investigate the influence of a polymorphism in codon 54 of the MBL2 gene on the susceptibility to Erythema Multiforme, Stevens-Johnson Syndrome and Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Overlap Syndrome (EM, SJS and SJS/TEN overlap syndrome. Material and Methods: Our study included 64 patients who were clinically and/or histopathologically diagnosed with EM, SJS, and SJS/TEN overlap syndrome and 66 healthy control subjects who were genotyped for the MBL2 gene codon 54 polymorphism using the PCR-RFLP method. For all statistical analyses, the level of significance was set at p<0.05. Results: The prevalence of the B allele was 18% in the EM, SJS and SJS/TEN patient groups and 13% in the control group. No significant differences in allele frequencies of any polymorphism were observed between the patient and control groups, although the B allele was more frequent in the patient groups (p=0.328.Conclusion: Our results provide no evidence of a relationship between MBL2 gene codon 54 polymorphism and the susceptibility to EM, SJS and SJS/TEN overlap syndrome. However, these findings should be confirmed in studies with a larger sample size.

Clinical Features and Treatment Outcomes among Children with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis: A 20-Year Study in a Tertiary Referral Hospital

Directory of Open Access Journals (Sweden)

Susheera Chatproedprai

2018-01-01

Full Text Available Aim. To determine the probable causative factors, clinical features, and treatment outcomes of Stevens-Johnson syndrome (SJS, toxic epidermal necrolysis (TEN, and SJS-TEN overlap in children. Methods. A 20-year database review of all children diagnosed with SJS/TEN/SJS-TEN overlap at the King Chulalongkorn Memorial Hospital, Thailand. Results. 36 patients (M : F, 16 : 20 with the mean age of 9.2±4.0 years were identified. There were 20 cases of SJS, 4 cases of SJS-TEN overlap, and 12 cases of TEN. Drugs were the leading cause for the diseases (72.3%; antiepileptics were the most common culprits (36.1%. Cutaneous morphology at presentation was morbilliform rash (83.3%, blister (38.9%, targetoid lesions (25.0%, and purpuric macules (2.8%. Oral mucosa (97.2% and eye (83.3% were the 2 most common mucosal involvements. Majority of the cases (77.8% were treated with systemic corticosteroids, intravenous immunoglobulin, or both. Treatment outcomes between those who received systemic therapy and those who received only supportive care were comparable. Skin and eye were the principal sites of short-term and long-term complications. Conclusions. SJS/TEN are not common but are serious diseases which lead to significant morbidities in children. Early withdrawal of suspicious causes and meticulous supportive care are very important. This study found that the systemic therapy was not superior to supportive care because the treatment outcomes for both groups were comparable.

Docetaxel induced Lyell′s syndrome: A rare life threatening cause of dermatitis medicamentosas

Directory of Open Access Journals (Sweden)

Faheem Arshad

2014-01-01

Full Text Available Lyell′s syndrome or toxic epidermal necrolysis (TEN is a life threatening complication mostly caused by medications, characterized by desquamative lesions of the skin and mucous membranes with 30 percent or more epidermal involvement along with mucus membrane. We report a rare case of toxic epidermal necrolysis following administration of docetaxel, a semi-synthetic taxane. A female diagnosed as having metastatic breast carcinoma received chemotherapy in form of docetaxel after being exposed to adjuvant chemotherapy, developed severe involvement of skin and mucus membrane. Diagnosis of TEN was made and she was managed with steroids, antibiotics, intravenous fluids and antiseptic dressings. Common toxicities reported with this drug include myelosuppression, alopecia, nail damage, erythema multiforme major and neuropathy. We believe this is the first case report of Lyell′s syndrome following docetaxel. Main aim of this case is to make physicians aware of the severe skin reactions with docetaxel, measures to avoid them, early recognition and prompt treatment.

CYP2C19*2 status in patients with Stevens-Johnson syndrome and toxic epidermal necrolysis

Directory of Open Access Journals (Sweden)

Laska AJ

2017-05-01

Full Text Available Amanda J Laska,1 Marie J Han,1 Josh A Lospinoso,2 Patrick J Brown,1 Thomas M Beachkofsky1 1Department of Dermatology, San Antonio Uniformed Services Health Education Consortium, San Antonio, TX, 2780th Military Intelligence Brigade, Ft Meade, MD, USA Purpose: Genetic polymorphisms have been linked to an increased predisposition to developing certain diseases. For example, patients of Han-Chinese descent carrying the HLA-B*1502 allele are at an increased risk of developing Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN if given carbamazepine. Given the complexity of in vivo drug metabolism, it is plausible that the activity of enzyme systems unrelated to specific drug metabolism may be important. Although multiple biomarkers have been identified in unique ethnic groups, there has yet to be a study investigating the presence of the slow metabolizing allele of CYP2C19, denoted CYP2C19*2, in diverse groups and the risk of developing SJS/TEN. Patients and methods: This study looked into the carrier status of CYP2C19*2, a poor metabolizing variant of CYP2C19, in patients diagnosed with SJS/TEN. We looked at its status in our series as a whole and when patients were divided by ethnicity. Genomic DNA was extracted from formalin-fixed paraffin-embedded tissue of patients with biopsy-proven SJS/TEN and real-time polymerase chain reaction was used to assess for the presence of CYP2C19*2. Results: CYP2C19*2 status was determined in 47 patients. Twenty-nine of these 47 patients had a single medication implicated as causing their disease, and eight of these patients were heterozygous or homozygous for CYP2C19*2. There was insufficient evidence to conclude that the presence of CYP2C19*2 is an independent predictor of risk for developing SJS/TEN in our series as a whole. This analysis also confirmed that the frequency of the CYP2C19*2 polymorphism within the different ethnicities in our series did not vary statistically from reported ethnic

Stevens Johnson Syndrome and Toxic Epidermal Necrolysis: Maternal and Foetal Outcomes in Twenty-Two Consecutive Pregnant HIV Infected Women.

Directory of Open Access Journals (Sweden)

Lauren Knight

Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN form a spectrum of a rare and life-threatening cutaneous drug reaction. SJS/TEN in pregnancy poses largely unknown risk factors and outcomes for both the mother and foetus compared to the general population.We conducted a study of consecutive pregnant women admitted to single tertiary referral centre in South Africa with SJS/TEN over a 3 year period. They were all managed by the same medical team using the same protocols. We evaluated their underlying illnesses, offending drugs and the course of pregnancy and outcomes to determine factors influencing maternal and foetal outcomes.We identified twenty-two women who developed SJS/TEN while pregnant, all of them HIV-infected. Their median age was 29 years. The majority 16/22 (73% had SJS, the milder variant of the disease affecting < 10% body surface area. Nevirapine was the offending drug in 21/22 (95% cases. All 22 of the mothers survived with 3/22 (14% developing postpartum sepsis. Pregnancy outcomes were known in 18/22 women and 9/18 (50% babies were delivered by caesarean section. There were 2 foetal deaths at 21 and 31 weeks respectively and both were associated with post-partum sepsis. Postnatal complications occurred in 5 cases, 3 involving the respiratory system and the other two being low birth weight deliveries. Eight placentae and one foetus were sent for histology and none showed macroscopic or microscopic features of SJS/TEN. On follow-up, only 12/20 children were tested for HIV at 6 weeks post-delivery and none of them were HIV-infected. All had received prophylactic ARVs including nevirapine.TEN, the severe form of the disease, was associated with poorer foetal outcomes. SJS/TEN-associated mortality is not increased in HIV-infected pregnant women. Maternal SJS/TEN does not seem to commonly manifest in the foetus.

Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells

International Nuclear Information System (INIS)

Ronald Sluyter; Kylie S Yuen; Gary M Halliday

2001-01-01

There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc

Uncommon vancomycin: induced side effects

Directory of Open Access Journals (Sweden)

Rocha Jaime Luís Lopes

2002-01-01

Full Text Available Vancomycin has been used with increased frequency during the past 15 years and the most common toxicity with this drug is the "red man syndrome". Other adverse effects include neutropenia, fever, phlebitis, nephrotoxicity, ototoxicity, thrombocytopenia, interstitial nephritis, lacrimation, linear IgA bullous dermatosis, necrotizing cutaneous vasculitis and toxic epidermal necrolysis. Only two cases of vancomycin-induced Stevens-Johnson syndrome and one case of pancytopenia have been reported in the medical literature. The treatment for both situations is based on cessation of the vancomycin therapy; in cases of Stevens-Johnson syndrome, antihistamine and/or steroid agents can be used. This article reports a case of pancytopenia and a case of erythema major associated with neutropenia.

Racial disparities in the risk of Stevens-Johnson Syndrome and toxic epidermal necrolysis as urate-lowering drug adverse events in the United States.

Science.gov (United States)

Lu, Na; Rai, Sharan K; Terkeltaub, Robert; Kim, Seoyoung C; Menendez, Mariano E; Choi, Hyon K

2016-10-01

HLA-B*5801 allele carriage (a strong determinant of allopurinol hypersensitivity syndrome) varies substantially among races, which may lead to racial disparities in the risk of Stevens-Johnson Syndrome (SJS) and toxic epidermal necrolysis (TEN) in the context of urate-lowering drug adverse events (ULDAEs). We examined this hypothesis in a large, racially diverse, and generalizable setting. Using a database representative of US hospitalizations (2009-2013), we investigated the racial distribution of hospitalized SJS/TEN (principal discharge diagnosis) as ULDAEs (ICD-9-CM Classification of External Causes). Our reference groups included the US Census population, US allopurinol users, and ULDAE hospitalizations without SJS/TEN. We identified 606 cases hospitalized for SJS/TEN as ULDAEs (mean age = 68 years; 44% male), among which there was an overrepresentation of Asians (27%) and Blacks (26%), and an underrepresentation of Whites (29%) and Hispanics (% too-low-to-report), compared with the US Census population (5%, 12%, 67%, and 15%, respectively). The hospitalization rate ratios for SJS/TEN among Asians, Blacks, and Whites were 11.9, 5.0, and 1.0 (referent), respectively. These associations persisted using other national referents. According to the NHANES 2009-2012, allopurinol constituted 96.8% of urate-lowering drug use, followed by probenecid (2.1%). These national data indicate that Asians and Blacks have a substantially higher risk of SJS/TEN as ULDAEs than Whites (or Hispanics), correlating well with corresponding frequencies of HLA-B*5801 in the US population (i.e., 7.4%, 4%, 1%, and 1%, respectively). Given its market dominance and established association with SJS/TEN, our findings support the use of vigilance in these minorities when considering allopurinol. Copyright © 2016 Elsevier Inc. All rights reserved.

Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour

International Nuclear Information System (INIS)

Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.

1996-01-01

Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)

Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity

International Nuclear Information System (INIS)

Lowe, N.J.; Breeding, J.

1982-01-01

Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study

Association of HLA-BFNx011502 allele and carbamazepine-induced Stevens-Johnson syndrome among Indians

Directory of Open Access Journals (Sweden)

Mehta Timir

2009-01-01

Full Text Available Background: Stevens-Johnson Syndrome (SJS and toxic epidermal necrolysis are severe cutaneous reactions caused by certain drugs, including antiepileptic carbamazepine. A strong association has been reported between human leucocyte antigen (HLA-BFNx011502 and carbamazepine-induced SJS in Han Chinese patients. European studies suggested that HLA-BFNx011502 is not a universal marker but is ethnicity-specific for Asians. Aim: To study the association between HLA-BFNx011502 and carbamazepine-induced SJS in Indian patients. Methods: Eight individuals who fulfilled the diagnostic criteria of SJS induced by carbamazepine were identified and HLA-B molecular typing was performed. HLA-B genotyping was carried out by polymerase chain reaction using sequence-specific primers. Results: Out of eight patients studied for genotype, six patients were found to have the HLA-BFNx011502 allele. Conclusion: This study suggests an association between HLA-BFNx011502 and carbamazepine-induced SJS in Indian patients.

Stevens-Johnson syndrome in a patient with rheumatoid arthritis during long-term etanercept therapy.

Science.gov (United States)

Owczarczyk-Saczonek, Agnieszka; Zdanowska, Natalia; Znajewska-Pander, Aleksandra; Placek, Waldemar

2016-03-31

Etanercept and other anti-TNF-alpha agents have been indicated as a therapeutic option in severe drug reactions, including Stevens-Johnson syndrome and toxic epidermal necrolysis. Etanercept has been shown to quickly reduce the detachment of the epidermis and shorten healing time. Cases of etanercept-induced severe adverse drug reactions were also described. A 27-year-old woman with a 4-year history of etanercept and sulfasalazine treatment for rheumatoid arthritis was admitted with Stevens-Johnson syndrome. The patient received one dose of an OTC drug containing acetaminophen, phenylephrine and pheniramine two days prior to developing fist mucocutaneous symptoms. The most probable causative agent was paracetamol. Throughout the successful routine therapy of Stevens-Johnson syndrome etanercept therapy was continued. Sulfosalazin administration was stopped and administered again after recovery with no recurrence of the skin and mucosal symptoms. This case indicates that there is no justification for discontinuation of long-term anti-TNF-alpha treatment in patients who develop Stevens- Johnson syndrome / toxic epidermal necrolysis.

Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase

NARCIS (Netherlands)

Spaargaren, M.; Defize, L. H.; Boonstra, J.; de Laat, S. W.

1991-01-01

The relationship between epidermal growth factor receptor (EGF-R) protein tyrosine kinase activation and ligand-induced receptor dimerization was investigated using several bivalent anti-EGF-R antibodies directed against various receptor epitopes. In A431 membrane preparations and permeabilized

UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

International Nuclear Information System (INIS)

Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

1996-01-01

UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

Dermatological Emergencies: Current Trends in Management

African Journals Online (AJOL)

opsig

clinical. In TEN, the disease is more severe with epidermal detachment ... causative agent and referral to a burns unit improves ... antigen on keratinocyte cell membranes, production .... Toxic Epidermal Necrolysis – a retrospective study.

Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

Science.gov (United States)

Kappus, H; Reinhold, C

1994-04-01

Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

Lamotrigine Induced Whole Body Tics: A Case Report and Literature Review.

Science.gov (United States)

Centorino, Michael B; Catalano, Glenn; Catalano, Maria C

2016-01-01

Lamotrigine is an anticonvulsant medication that also has utility in the treatment of bipolar disorder. It has been associated with many side effects, including rashes that can progress to Stevens-Johnson syndrome or toxic epidermal necrolysis. It has also been associated with the development of motor tics, most commonly in the head, neck, and shoulders. We will now present the case of a 45-year-old woman who developed tics that involved the entire left side of her body after her dose of lamotrigine was increased from 200 mg daily (2.0 mg/kg/day) to 225 mg daily (2.3 mg/kg/day). We will review the prior cases of lamotrigine induced tics, and compare them to the circumstances surrounding our patient. We will also discuss the neurobiology of tics and make suggestions to improve the tics, based on the reported cases.

HLA Association with Drug-Induced Adverse Reactions

Directory of Open Access Journals (Sweden)

Wen-Lang Fan

2017-01-01

Full Text Available Adverse drug reactions (ADRs remain a common and major problem in healthcare. Severe cutaneous adverse drug reactions (SCARs, such as Stevens–Johnson syndrome (SJS/toxic epidermal necrolysis (TEN with mortality rate ranges from 10% to more than 30%, can be life threatening. A number of recent studies demonstrated that ADRs possess strong genetic predisposition. ADRs induced by several drugs have been shown to have significant associations with specific alleles of human leukocyte antigen (HLA genes. For example, hypersensitivity to abacavir, a drug used for treating of human immunodeficiency virus (HIV infection, has been proposed to be associated with allele 57:01 of HLA-B gene (terms HLA-B∗57:01. The incidences of abacavir hypersensitivity are much higher in Caucasians compared to other populations due to various allele frequencies in different ethnic populations. The antithyroid drug- (ATDs- induced agranulocytosis are strongly associated with two alleles: HLA-B∗38:02 and HLA-DRB1∗08:03. In addition, HLA-B∗15:02 allele was reported to be related to carbamazepine-induced SJS/TEN, and HLA-B∗57:01 in abacavir hypersensitivity and flucloxacillin induced drug-induced liver injury (DILI. In this review, we summarized the alleles of HLA genes which have been proposed to have association with ADRs caused by different drugs.

Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.

Science.gov (United States)

Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F

2005-09-15

Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.

[Current movements of four serious adverse events induced by medicinal drugs based on spontaneous reports in Japan].

Science.gov (United States)

Sudo, Chie; Azuma, Yu-ichiro; Maekawa, Keiko; Kaniwa, Nahoko; Sai, Kimie; Saito, Yoshiro

2011-01-01

Spontaneous reports on suspected serious adverse events caused by medicines from manufacturing/distributing pharmaceutical companies or medical institutions/pharmacies are regulated by the Pharmaceutical Affairs Law of Japan, and this system is important for post-marketing safety features. Although causal relationship between the medicine and the adverse event is not evaluated, and one incidence may be redundantly reported, this information would be useful to roughly grasp the current movements of drug-related serious adverse events, We searched open-source data of the spontaneous reports publicized by Pharmaceutical and Medical Devices Agency for 4 serious adverse events (interstitial lung disease, rhabdomyolysis, anaphylaxis, and Stevens-Johnson syndrome/toxic epidermal necrolysis) from 2004 to 2010 fiscal year (for 2010, from April 1 st to January 31th). Major drug-classes suspected to the adverse events were antineoplastics for interstitial lung disease, hyperlipidemia agents and psychotropics for rhabdomyolysis, antibiotics/chemotherapeutics, antineoplastics and intracorporeal diagnostic agents for anaphylaxis (anaphylactic shock, anaphylactic reactions, anaphylactoid shock and anaphylactoid reactions), and antibiotics/chemotherapeutics, antipyretics and analgesics, anti-inflammatory agents/common cold drugs, and antiepileptics for Stevens-Johnson syndrome/toxic epidermal necrolysis. These results would help understanding of current situations of the 4 drug-related serious adverse events in Japan.

[Terbinafine : Drug-induced lupus erythematodes and triggering of psoriatic skin lesions].

Science.gov (United States)

Mayser, P

2016-09-01

Based on the technical information that oral terbinafine must be used with caution in patients with pre-existing psoriasis or lupus erythematosus, the literature was summarized. Terbinafine belongs to the drugs able to induce subcutaneous lupus erythematosus (SCLE)-with a relatively high risk. The clinical picture of terbinafine-induced SCLE may be highly variable and can also include erythema exsudativum multiforme-like or bullous lesions. Thus, differentiation of terbinafine-induced Stevens-Johnson syndrome or toxic epidermal necrolysis may be difficult. Therefore, terbinafine should be prescribed with caution in patients who show light sensitivity, arthralgias, positive antinuclear antibodies or have a history of SLE or SCLE. Case reports include wide-spread, but mostly nonlife-threatening courses, which did not require systemic therapy with steroids or antimalarials in every case. Terbinafine is also able to induce or to aggravate psoriasis. The latency period seems to be rather short (Terbinafine therefore is not first choice if a systemic therapy with antimycotics is indicated in a patient with psoriasis or psoriatic diathesis. Azole derivatives according to the guidelines may be used as an alternative.

Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

International Nuclear Information System (INIS)

Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

2011-01-01

Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

Epidermal growth factor in the rat prostate

DEFF Research Database (Denmark)

Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

1998-01-01

Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

NARCIS (Netherlands)

Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

2003-01-01

Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

DEFF Research Database (Denmark)

Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

2009-01-01

To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

Chronic administration of epidermal growth factor to pigs induces growth, especially of the urinary tract with accumulation of epithelial glycoconjugates

DEFF Research Database (Denmark)

Vinter-Jensen, Lars; Juhl, C O; Poulsen, Steen Seier

1995-01-01

Epidermal growth factor (EGF) receptor hyperstimulation induced by systemically administered EGF or by the development of transgenic mice overexpressing transforming growth factor alpha (TGF alpha) or other EGF-related ligands is known to induce various effects, such as acceleration of developmen...

Herbal medicines that benefit epidermal permeability barrier function

Directory of Open Access Journals (Sweden)

Lizhi Hu

2015-06-01

Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

Retinoic Acid-Induced Epidermal Transdifferentiation in Skin

Directory of Open Access Journals (Sweden)

Yoshihiro Akimoto

2014-06-01

Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.

Browse Title Index

African Journals Online (AJOL)

Items 101 - 145 of 145 ... Vol 22, No 1 (2014), Prevalence of traumadc dental Injuries .... to the management toxic epidermal necrolysis syndrome (TENS) – a ... and dental fluorosis in low, moderate and high fluoride areas of Udaipur district, India.

The role of epidermal cytokines in the generation of cutaneous immune reactions and ultraviolet radiation-induced immune suppression

International Nuclear Information System (INIS)

Ullrich, S.E.

1995-01-01

The immune suppression generated by UV exposure is a major risk factor for skin cancer patients. This finding has fuelled efforts to understand the mechanisms involved in the immune suppression induced by exposure to UV radiation. This article reviews the recent findings on the role of epidermal cytokines in the generation of an immune response and their role in the induction of immune suppression induced by UV exposure. (UK)

On the physics of laser-induced selective photothermolysis of hair follicles: Influence of wavelength, pulse duration, and epidermal cooling.

Science.gov (United States)

Svaasand, Lars O; Nelson, J Stuart

2004-01-01

The physical basis for optimization of wavelength, pulse duration, and cooling for laser-induced selective photothermolysis of hair follicles in human skin is discussed. The results indicate that the most important optimization parameter is the cooling efficiency of the technique utilized for epidermal protection. The optical penetration is approximately the same for lasers at 694, 755, and 800 nm. The penetration of radiation from Nd:yttrium-aluminum-garnet lasers at 1064 nm is, however, somewhat larger. Photothermal damage to the follicle is shown to be almost independent of laser pulse duration up to 100 ms. The results reveal that epidermal cooling by a 30-80-ms-long cryogen spurt immediately before laser exposure is the only efficient technique for laser pulse durations less than 10 ms. For longer pulse durations in the 30-100 ms range, protection can be done efficiently by skin cooling during laser exposure. For laser pulses of 100 ms, an extended precooling period, e.g., by bringing a cold object into good thermal contact with the skin for about 1 s, can be of value. Thermal quenching of laser induced epidermal temperature rise after pulsed exposure can most efficiently be done with a 20 ms cryogen spurt applied immediately after irradiation. (c) 2004 Society of Photo-Optical Instrumentation Engineers.

Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

Directory of Open Access Journals (Sweden)

Kazuhiko Arima

2015-01-01

Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

Directory of Open Access Journals (Sweden)

Santosh K Katiyar

Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

MicroRNA and gene signature of severe cutaneous drug ...

African Journals Online (AJOL)

Purpose: To build a microRNA and gene signature of severe cutaneous adverse drug reactions (SCAR), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Methods: MicroRNA expression profiles were downloaded from miRNA expression profile of patients' skin suffering from TEN using an ...

Drug eruptions from phenylbutazone in Jamu.

Science.gov (United States)

Giam, Y C; Tham, S N; Tan, T; Lim, A

1986-01-01

Drug eruptions from indeginous medicine is often difficult to diagnosis and confirm. It is known that a number of these now supplied by bomohs and Chinese sinsehs contain known drugs and are dispensed as tablets and capsules. We report 3 cases of adverse drug eruption to "Jamu", a Malay herb. A particular brand, "Jamu Indonesia, Toko Air Pancur", from Johor Bahru, Malaysia, is especially recommended for "sakit pinggang" or backache. The cases occurred between January and February 1985, and all had taken brown kidney shaped tablets. The adverse reactions were moderately severe. Two had erythroderma with hepatitis, and one, Steven Johnson Syndrome. Analysis of this jamu for analgesics led to the discovery of adulteration with phenylbutazone and diazepam. Records from local cases from 1974-1984 showed that 8 other patients, all Chinese had adverse cutaneous eruptions from phenylbutazone, oxybutazone and propyphenazone. The skin manifestations were erythroderma (2 cases), vasculitis (2 cases) and toxic epidermal necrolysis (4 cases). Those with toxic epidermal necrolysis had 100% mortality.

Epidermal growth factor receptor signaling mediates aldosterone-induced profibrotic responses in kidney

Energy Technology Data Exchange (ETDEWEB)

Sheng, Lili; Yang, Min; Ding, Wei [Department of Nephrology, Shanghai Fifth People' s Hospital, Fudan University, Shanghai 200240 (China); Zhang, Minmin [Department of Nephrology, Shanghai Huashan Hospital, Fudan University, Shanghai 200240 (China); Niu, Jianying [Department of Nephrology, Shanghai Fifth People' s Hospital, Fudan University, Shanghai 200240 (China); Qiao, Zhongdong [School of Life Science and Biotechnology, Shanghai Jiaotong University, Shanghai 200240 (China); Gu, Yong, E-mail: yonggu@vip.163.com [Department of Nephrology, Shanghai Fifth People' s Hospital, Fudan University, Shanghai 200240 (China); Department of Nephrology, Shanghai Huashan Hospital, Fudan University, Shanghai 200240 (China)

2016-08-01

Aldosterone has been recognized as a risk factor for the development of chronic kidney disease (CKD). Studies have indicated that enhanced activation of epidermal growth factor receptor (EGFR) is associated with the development and progression of renal fibrosis. But if EGFR is involved in aldosterone-induced renal fibrosis is less investigated. In the present study, we examined the effect of erlotinib, an inhibitor of EGFR tyrosine kinase activity, on the progression of aldosterone-induced renal profibrotic responses in a murine model underwent uninephrectomy. Erlotinib-treated rats exhibited relieved structural lesion comparing with rats treated with aldosterone alone, as characterized by glomerular hypertrophy, mesangial cell proliferation and expansion. Also, erlotinib inhibited the expression of TGF-β, α-SMA and mesangial matrix proteins such as collagen Ⅳ and fibronectin. In cultured mesangial cells, inhibition of EGFR also abrogated aldosterone-induced expression of extracellular matrix proteins, cell proliferation and migration. We also demonstrated that aldosterone induced the phosphorylation of EGFR through generation of ROS. And the activation of EGFR resulted in the phosphorylation of ERK1/2, leading to the activation of profibrotic pathways. Taken together, we concluded that aldosterone-mediated tissue fibrosis relies on ROS induced EGFR/ERK activation, highlighting EGFR as a potential therapeutic target for modulating renal fibrosis. - Highlights: • EGFR was involved in aldosterone-induced renal profibrotic responses. • Aldosterone-induced EGFR activation was mediated by MR-dependent ROS generation. • EGFR activated the MAPK/ERK1/2 signaling to promote renal fibrosis.

Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice

Energy Technology Data Exchange (ETDEWEB)

Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)

2011-06-15

We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.

Deletion of epidermal Rac1 inhibits HPV-8 induced skin papilloma formation and facilitates HPV-8- and UV-light induced skin carcinogenesis.

Science.gov (United States)

Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo

2016-09-06

Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.

Tight junction regulates epidermal calcium ion gradient and differentiation

International Nuclear Information System (INIS)

Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

2011-01-01

Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

Tissue remodeling induced by hypersecreted epidermal growth factor and amphiregulin in the airway after an acute asthma attack.

Science.gov (United States)

Enomoto, Yukinori; Orihara, Kanami; Takamasu, Tetsuya; Matsuda, Akio; Gon, Yasuhiro; Saito, Hirohisa; Ra, Chisei; Okayama, Yoshimichi

2009-11-01

Epidermal growth factor receptor ligands, such as epidermal growth factor (EGF) and amphiregulin, may play key roles in tissue remodeling in asthma. However, the kinetics of EGF and amphiregulin secretion in the airway after an acute asthma attack and the effect of prolonged airway exposure to these ligands on airway remodeling are unknown. To measure the EGF and amphiregulin concentrations in sputa obtained from patients with asthma under various conditions, and to examine the effects of EGF and amphiregulin on the proliferation or differentiation of airway structural cells. Epidermal growth factor and amphiregulin levels were measured by ELISA in sputum specimens collected from 14 hospitalized children with asthma during an acute asthma attack, 13 stable outpatients with asthma, 8 healthy control children, and 7 children with respiratory tract infections. The effects of EGF and amphiregulin on the proliferation and/or differentiation of normal human bronchial epithelial cells (NHBE), bronchial smooth muscle cells (BSMC), and normal human lung fibroblasts (NHLF) were examined. The sputum levels of EGF were significantly higher for about a week after an acute asthma attack compared with the levels in stable subjects with asthma and control subjects. In contrast, upregulation of amphiregulin in the sputa of patients with asthma was observed only during the acute attack. EGF caused proliferation of NHBE, BSMC, and NHLF, whereas amphiregulin induced proliferation of only NHBE. Prolonged exposure of NHBE to EGF and amphiregulin induced mucous cell metaplasia in an IL-13-independent manner. Acute asthma attacks are associated with hypersecretion of EGF and amphiregulin in the airway. Recurrent acute attacks may aggravate airway remodeling.

Adverse cutaneous reactions induced by TNF-alpha antagonist therapy.

Science.gov (United States)

Borrás-Blasco, Joaquín; Navarro-Ruiz, Andrés; Borrás, Consuelo; Casterá, Elvira

2009-11-01

To review adverse cutaneous drug reactions induced by tumor necrosis factor alpha (TNF-alpha) antagonist therapy. A literature search was performed using PubMed (1996-March 2009), EMBASE, and selected MEDLINE Ovid bibliography searches. All language clinical trial data, case reports, letters, and review articles identified from the data sources were used. Since the introduction of TNF-alpha antagonist, the incidence of adverse cutaneous drug reactions has increased significantly. A wide range of different skin lesions might occur during TNF-alpha antagonist treatment. New onset or exacerbation of psoriasis has been reported in patients treated with TNF-alpha antagonists for a variety of rheumatologic conditions. TNF-alpha antagonist therapy has been associated with a lupus-like syndrome; most of these case reports occurred in patients receiving either etanercept or infliximab. Serious skin reactions such as erythema multiforme, Stevens-Johnson syndrome, and toxic epidermal necrolysis have been reported rarely with the use of TNF-alpha antagonists. As the use of TNF-alpha antagonists continues to increase, the diagnosis and management of cutaneous side effects will become an increasingly important challenge. In patients receiving TNF-alpha antagonist treatment, skin disease should be considered, and clinicians need to be aware of the adverse reactions of these drugs.

Conditioning pain stimulation does not affect itch induced by intra-epidermal histamine pricks but aggravates neurogenic inflammation in healthy volunteers

DEFF Research Database (Denmark)

Andersen, Hjalte Holm; Imai, Yosuke; Petersen, Kristian Kjær

2016-01-01

This study investigated whether itch induced by intra-epidermal histamine is subjected to modulation by a standardized conditioned pain modulation (CPM) paradigm in 24 healthy volunteers. CPM was induced by computer-controlled cuff pressure algometry and histamine was introduced to the volar...... forearm by skin prick test punctures. Moreover, neurogenic inflammation and wheal reactions induced by histamine and autonomic nervous system responses (heart rate variability and skin conductance) were monitored. CPM did not modulate the intensity of histamine-induced itch suggesting that pruriceptive...... signaling is not inhibited by pain-recruited endogenous modulation, however, CPM was found to aggravate histamine-induced neurogenic inflammation, likely facilitated by efferent sympathetic fibers....

Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

Science.gov (United States)

Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

2016-10-01

In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

International Nuclear Information System (INIS)

Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

1997-01-01

Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

Directory of Open Access Journals (Sweden)

Philpott Michael P

2010-02-01

Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

Potential involvement of oxygen intermediates and glutathione depletion in UV-induced epidermal cell injury in vitro

International Nuclear Information System (INIS)

Hsieh, G.C.; Acosta, D.

1991-01-01

Generation of reactive oxygen species (ROS) and depletion of glutathione (GSH) are suggested as the cytotoxic mechanisms for UVB-induced cellular damage. Primary monolayer cultures of epidermal keratinocytes (KCs) prepared from the skin of neonatal rats were irradiated with UVB at levels of 0.25-3.0 J/cm 2 . Cytotoxicity was measured at 3, 6, and 12 hr after UVB radiation. Exposure of KCs to UVB resulted in time- and dose-related toxic responses as determined by plasma membrane integrity, lysosomal function and mitochondrial metabolic activity. Irradiated KCs generated superoxide in a dose-dependent manner when compared to sham-irradiated cells. Superoxide formation, which occurred before and concomitant with cell injury, was decreased by superoxide dismutase (SOD). Cell injury was also significantly prevented by ROS scavengers, SOD and catalase. Pretreatment of cells with endocytosis inhibitors, cytochalasin B and methylamine, suppressed the ability of SOD and catalase to protect keratinocytes from UVB-induced toxicity. Irradiation of cells with UVB caused rapid depletion of GSH to about 30% of unirradiated levels within 15 min. UVB-irradiation led to a rapid transient increase in GSH peroxidase activity, concomitant with a marked decrease in the GSH/GSSG ratio. After 1 hr., while the GSH/GSSG ratio remained low, the GSH peroxidase activity declined below the control levels in UVB-treated epidermal cells. Following extensive GSH depletion in cells preincubated with 0.1 mM buthiomine sulfoximine, KCs became strongly sensitized to the cytotoxic action of UVB. These results indicate that UVB-induced cell injury in cultured KCs may be mediated by ROs and that endogenous GSH may play an important protective role against the cytotoxic action of UVB

Exploiting the igloo principle and greenhouse effect to regulate humidity and temperature

Directory of Open Access Journals (Sweden)

Prabhu Karthick

2006-01-01

Full Text Available Background: Toxic epidermal necrolysis can be fatal and nursing care with careful monitoring of temperature and humidity can improve survival rate. We adapted the greenhouse and igloo principle using a common hood to monitor the temperature and humidity. Methods: A small heater with a regulator was placed in a mini hood and temperature was recorded inside the uncovered hood and hood covered with green cloth and aluminium foil separately. The regular hood was placed over a volunteer and the temperature was measured inside the open hood and hood covered with green cloth and aluminium foil separately. The relative humidity was also monitored using Zeal mercury dry - wet bulb hygrometer. Results: Temperature increase was most marked in the foil-covered hood followed by cloth-covered hood, both with the heater and the volunteer. Similarly, in the volunteer study, the humidity was best maintained inside the aluminium foil-covered hood. Conclusion: We recommend the use of regular hood with suitable cover to monitor the humidity and temperature of patients with toxic epidermal necrolysis.

Hollow silicon microneedle array based trans-epidermal antiemetic patch for efficient management of chemotherapy induced nausea and vomiting

Science.gov (United States)

Kharbikar, Bhushan N.; Kumar S., Harish; Kr., Sindhu; Srivastava, Rohit

2015-12-01

Chemotherapy Induced Nausea and Vomiting (CINV) is a serious health concern in the treatment of cancer patients. Conventional routes for administering anti-emetics (i.e. oral and parenteral) have several drawbacks such as painful injections, poor patient compliance, dependence on skilled personnel, non-affordability to majority of population (parenteral), lack of programmability and suboptimal bioavailability (oral). Hence, we have developed a trans-epidermal antiemetic drug delivery patch using out-of-plane hollow silicon microneedle array. Microneedles are pointed micron-scale structures that pierce the epidermal layer of skin to reach dermal blood vessels and can directly release the drug in their vicinity. They are painless by virtue of avoiding significant contact with dermal sensory nerve endings. This alternate approach gives same pharmacodynamic effects as par- enteral route at a sparse drug-dose requirement, hence negligible side-effects and improved patient compliance. Microneedle design attributes were derived by systematic study of human skin anatomy, natural micron-size structures like wasp-sting and cactus-spine and multi-physics simulations. We used deep reactive ion etching with Bosch process and optimized recipe of gases to fabricate high-aspect-ratio hollow silicon microneedle array. Finally, microneedle array and polydimethylsiloxane drug reservoir were assembled to make finished anti-emetic patch. We assessed microneedles mechanical stability, physico-chemical properties and performed in-vitro, ex- vivo and in-vivo studies. These studies established functional efficacy of the device in trans-epidermal delivery of anti-emetics, its programmability, ease of use and biosafety. Thus, out-of-plane hollow silicon microneedle array trans-epidermal antiemetic patch is a promising strategy for painless and effective management of CINV at low cost in mainstream healthcare.

Chronic treatment with epidermal growth factor induces growth of the rat ventral prostate

DEFF Research Database (Denmark)

Tørring, N; Jensen, L V; Wen, J G

2001-01-01

the hyperplastic growth phase of the prostate in newborn rats.MATERIAL AND METHODS: Newborn rats were treated for 8 weeks with EGF (150 microg/kg body weight per day), administered as daily subcutaneous injections. Sections of the prostate tissue were examined by a stereological technique to determine tissue......OBJECTIVE: The epidermal growth factor (EGF) system is expressed in the rat prostate, and growth factors from this system induce proliferation in prostate epithelial and stromal cell cultures. The aim of the study was to investigate the possible growth-promoting effects of the system during...... of the prostate epithelium, the stroma and the lumen following EGF treatment, in a pattern resembling physiological growth of the ventral prostate. A significant correlation (r = 0.78, p

Toxicidade induzida pela terapêutica intermitente com Rifampicina: Análise de um caso clínico

Directory of Open Access Journals (Sweden)

Pilar Azevedo

1997-01-01

Full Text Available RESUMO: Descrevese o quadro clíoico de uma doente que desenvolveu uma reacção sistémica de hipersensibilidade grave a Rifampicina, objectivada por síndrome pseudo-gripal, anemia hemolítica, insuficiência renal aguda, choque e epidermólise bolhosa necrosante. Além da evolução clínica, salientase a dificuldade na formulação do diagnóstico e o apoio dado pelo laboratório na sua confirmação. SUMMARY: We repport the case of a patient who developed a severe drug-induced hypersensitivity sistemic reaction to Rifampicin, that included a flulike syndrome, severe hemolytic anaemia, renal failure, shock and toxic epidermal necrolysis.Besides the clinical evolution we consider the difficulties in clinical diagnosis and the role of the in vitro laboratory assays. Palavras-chave: Rifampicina, Efeitos ad versos, Imunologia, Toxicidade, Key-words: Rífampicin;Adverse effects, Immunology, Toxicity

Effect of epidermal growth factor against radiotherapy-induced oral mucositis in rats

International Nuclear Information System (INIS)

Lee, Sang-wook; Jung, Kwon Il; Kim, Yeun Wha B.S.; Jung, Heun Don; Kim, Hyun Sook; Hong, Joon Pio

2007-01-01

Purpose: We tested the efficacy of oral recombinant human epidermal growth factor (rhEGF) against radiation-induced oral mucositis in a rat model. Methods and Materials: Each of 35 Sprague-Dawley rats, 7 to 8 weeks of age and weighing 178 ± 5 grams, was irradiated once in the head region with 25 Gy, using a 4-MV therapeutic linear accelerator at a rate of 2 Gy/min. The irradiated rats were randomly divided into four groups: those receiving no treatment (Group 1), those treated with vehicle only three times per day (Group 2), and those treated with 50 μg/mL (Group 3), or 100 μg/mL (Group 4) rhEGF three times per day. Results: Rats were monitored for survival rate and daily activity, including hair loss, sensitivity, and anorexia. We found that survival rate and oral intake were significantly increased and histologic changes were significantly decreased in the rhEGF-treated rats. There was no difference, however, between rats treated with 50 μg/mL or 100 μg/mL rhEGF. Conclusion: These findings suggest that orally administered rhEGF decreased radiation-induced oral mucositis in rats

Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

Science.gov (United States)

Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

2017-01-01

Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

Science.gov (United States)

Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

2017-03-09

Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism

International Nuclear Information System (INIS)

He, D.; Lim, H.W.

1991-01-01

This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes

Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

Science.gov (United States)

Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

2016-02-01

Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

Science.gov (United States)

Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

2018-01-01

Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation

Energy Technology Data Exchange (ETDEWEB)

Nagata, Yosuke, E-mail: cynagata@mail.ecc.u-tokyo.ac.jp; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi

2014-08-01

Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its

Sphingosine-1-phosphate mediates epidermal growth factor-induced muscle satellite cell activation

International Nuclear Information System (INIS)

Nagata, Yosuke; Ohashi, Kazuya; Wada, Eiji; Yuasa, Yuki; Shiozuka, Masataka; Nonomura, Yoshiaki; Matsuda, Ryoichi

2014-01-01

Skeletal muscle can regenerate repeatedly due to the presence of resident stem cells, called satellite cells. Because satellite cells are usually quiescent, they must be activated before participating in muscle regeneration in response to stimuli such as injury, overloading, and stretch. Although satellite cell activation is a crucial step in muscle regeneration, little is known of the molecular mechanisms controlling this process. Recent work showed that the bioactive lipid sphingosine-1-phosphate (S1P) plays crucial roles in the activation, proliferation, and differentiation of muscle satellite cells. We investigated the role of growth factors in S1P-mediated satellite cell activation. We found that epidermal growth factor (EGF) in combination with insulin induced proliferation of quiescent undifferentiated mouse myoblast C2C12 cells, which are also known as reserve cells, in serum-free conditions. Sphingosine kinase activity increased when reserve cells were stimulated with EGF. Treatment of reserve cells with the D-erythro-N,N-dimethylsphingosine, Sphingosine Kinase Inhibitor, or siRNA duplexes specific for sphingosine kinase 1, suppressed EGF-induced C2C12 activation. We also present the evidence showing the S1P receptor S1P2 is involved in EGF-induced reserve cell activation. Moreover, we demonstrated a combination of insulin and EGF promoted activation of satellite cells on single myofibers in a manner dependent on SPHK and S1P2. Taken together, our observations show that EGF-induced satellite cell activation is mediated by S1P and its receptor. - Highlights: • EGF in combination with insulin induces proliferation of quiescent C2C12 cells. • Sphingosine kinase activity increases when reserve cells are stimulated with EGF. • EGF-induced activation of reserve cells is dependent on sphingosine kinase and ERK. • The S1P receptor S1P2 is involved in EGF-induced reserve cell activation. • EGF-induced reserve cell activation is mediated by S1P and its

Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

African Journals Online (AJOL)

illness until research found that morbidity can result from a ... for the widespread keratinocyte necrosis in SJS and TEN.⁷. Granulysin is the most ... Clinical presentation. SJS and ... Burns Intensive Care Unit may be one of the most important.

Inhibitory effects of omega-3 fatty acids on injury-induced epidermal growth factor receptor transactivation contribute to delayed wound healing

OpenAIRE

Turk, Harmony F.; Monk, Jennifer M.; Fan, Yang-Yi; Callaway, Evelyn S.; Weeks, Brad; Chapkin, Robert S.

2013-01-01

Epidermal growth factor receptor (EGFR)-mediated signaling is required for optimal intestinal wound healing. Since n-3 polyunsaturated fatty acids (PUFA), specifically docosahexaenoic acid (DHA), alter EGFR signaling and suppress downstream activation of key signaling pathways, we hypothesized that DHA would be detrimental to the process of intestinal wound healing. Using a mouse immortalized colonocyte model, DHA uniquely reduced EGFR ligand-induced receptor activation, whereas DHA and its m...

[Progress in epidermal stem cells].

Science.gov (United States)

Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

2010-03-01

Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

Tegafur/gimeracil/oteracil (TS-1 induced Stevens–Johnson syndrome: Case report

Directory of Open Access Journals (Sweden)

Satoko Minakawa

2013-09-01

Full Text Available TS-1 is an oral fluoropyrimidine anticancer drug that contains tegafur, gimeracil, and oteracil. A 78-year-old Japanese male who was diagnosed with carcinoma of the oral floor (rT4aN0M0 was prescribed a standard dose of TS-1 (80 mg/day. On Day 8 after administration of TS-1, an eruption developed. There was erythema, along with vesicles and erosions involving the lip, face, neck, trunk, limbs, and genitals. The drug-induced lymphocyte stimulation test (DLST for TS-1 was negative on the 23rd day, but positive on the 43rd day (20 days after discontinuing prednisolone. The condition was diagnosed as Stevens–Johnson syndrome due to TS-1 because of the clinical course and laboratory results. This case and 24 cases previously reported in the literature were analyzed. The types of drug eruption were drug-related lupus (9 cases, acral erythema (7 cases, scleroderma-like skin lesion (2 cases, Stevens–Johnson syndrome (2 cases, lichenoid eruption (1 case, purpura (1 case, lichen planus (1 case, erythema multiforme (1 case, hypopigmentation (1 case and toxic epidermal necrolysis (1 case, respectively. In view of the increasing usage of TS-1 in several common cancers, clinicians should be aware of drug eruptions due to TS-1.

Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

International Nuclear Information System (INIS)

Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

2006-01-01

Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

Science.gov (United States)

Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

2013-06-01

In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

Directory of Open Access Journals (Sweden)

Justin D Mallet

Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

Epidemiology of lymphocystis, epidermal papilloma and skin ulcers in common dab Limanda limanda along the west coast of Denmark

DEFF Research Database (Denmark)

Mellergaard, Stig; Nielsen, Else

1997-01-01

and the disease prevalence in the present case, the disease pattern showed evident similarities with formerly described oxygen deficiency-induced outbreaks of lymphocystis and epidermal papilloma in dab in the Kattegat. In 1988, the prevalence of lymphocystis and epidermal papilloma increased significantly...

Interaction of epidermal growth factor receptors with the cytoskeleton is related to receptor clustering

NARCIS (Netherlands)

van Belzen, N.; Spaargaren, M.; Verkleij, A. J.; Boonstra, J.

1990-01-01

Recently it has been established that cytoskeleton-associated epidermal growth factor (EGF) receptors are predominantly of the high-affinity class and that EGF induces a recruitment of low-affinity receptors to the cytoskeleton. The nature of this EGF-induced receptor-cytoskeleton interaction,

Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice

Directory of Open Access Journals (Sweden)

Azahara Rodríguez-Luna

2017-12-01

Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.

Eosinophil peroxidase signals via epidermal growth factor-2 to induce cell proliferation.

LENUS (Irish Health Repository)

Walsh, Marie-Therese

2011-11-01

Eosinophils exert many of their inflammatory effects in allergic disorders through the degranulation and release of intracellular mediators, including a set of cationic granule proteins that include eosinophil peroxidase. Studies suggest that eosinophils are involved in remodeling. In previous studies, we showed that eosinophil granule proteins activate mitogen-activated protein kinase signaling. In this study, we investigated the receptor mediating eosinophil peroxidase-induced signaling and downstream effects. Human cholinergic neuroblastoma IMR32 and murine melanoma B16.F10 cultures, real-time polymerase chain reaction, immunoprecipitations, and Western blotting were used in the study. We showed that eosinophil peroxidase caused a sustained increase in both the expression of epidermal growth factor-2 (HER2) and its phosphorylation at tyrosine 1248, with the consequent activation of extracellular-regulated kinase 1\\/2. This, in turn, promoted a focal adhesion kinase-dependent egress of the cyclin-dependent kinase inhibitor p27(kip) from the nucleus to the cytoplasm. Eosinophil peroxidase induced a HER2-dependent up-regulation of cell proliferation, indicated by an up-regulation of the nuclear proliferation marker Ki67. This study identifies HER2 as a novel mediator of eosinophil peroxidase signaling. The results show that eosinophil peroxidase, at noncytotoxic levels, can drive cell-cycle progression and proliferation, and contribute to tissue remodeling and cell turnover in airway disease. Because eosinophils are a feature of many cancers, these findings also suggest a role for eosinophils in tumorigenesis.

Neonatal hyperthyroidism impairs epinephrine-provoked secretion of nerve growth factor and epidermal growth factor in mouse saliva.

Science.gov (United States)

Lakshmanan, J; Landel, C P

1986-07-01

We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.

In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

DEFF Research Database (Denmark)

Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

2003-01-01

In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

An immunologic approach to induction of epidermal growth factor deficiency

DEFF Research Database (Denmark)

Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier

1995-01-01

Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....

Epidermal growth factor receptor expression in radiation-induced dog lung tumors by immunocytochemical localization

Energy Technology Data Exchange (ETDEWEB)

Leung, F.L.; Park, J.F.; Dagle, G.E.

1993-06-01

In studies to determine the role of growth factors in radiation-induced lung cancer, epidermal growth factor (EGFR) expression was examined by immunocytochemistry in 51 lung tumors from beagle dogs exposed to inhaled plutonium; 21 of 51 (41%) tumors were positive for EGFR. The traction of tumors positive for EGFR and the histological type of EGFR-positive tumors in the plutonium-exposed dogs were not different from spontaneous dog lung tumors, In which 36% were positive for EGFR. EGFR involvement in Pu-induced lung tumors appeared to be similar to that in spontaneous lung tumors. However, EGFR-positive staining was observed in only 1 of 16 tumors at the three lowest Pu exposure levels, compared to 20 of 35 tumors staining positive at the two highest Pu exposure levels. The results in dogs were in good agreement with the expression of EGFR reported in human non-small cell carcinoma of the lung, suggesting that Pu-induced lung tumors in the dog may be a suitable animal model to investigate the role of EGFR expression in lung carcinogenesis. In humans, EGFR expression in lung tumors has been primarily related to histological tumor types. In individual dogs with multiple primary lung tumors, the tumors were either all EGFR positive or EGFR negative, suggesting that EGFR expression may be related to the response of the individual dog as well as to the histological type of tumor.

Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

Directory of Open Access Journals (Sweden)

Victor Paromov

2011-01-01

Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

Epidermal Inclusion Cysts of The Breast

Directory of Open Access Journals (Sweden)

Amir R. Motabar

2009-02-01

Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

DEFF Research Database (Denmark)

Bor, M V; Sørensen, B S; Vinter-Jensen, L

2000-01-01

BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

Higher Expression of Epidermal Growth Factor Receptor Is Associated with Extracellular Matrix Metalloprotease Inducer in Colorectal Adenocarcinoma: Tissue Microarray Analysis of Immunostaining Score with Clinicopathological Parameters

Directory of Open Access Journals (Sweden)

Jong-Shiaw Jin

2006-01-01

Full Text Available Aim: Extracellular matrix metalloprotease inducer (EMMPRIN expression was demonstrated in several cancers, but its expression profile in colorectal cancers remains unclear. Epidermal growth factor receptor (EGFR was reported to regulate EMMPRIN expression in human epithelial cancers. Our purpose was to determine EMMPRIN expression and its relationship with EGFR in colorectal cancers.

Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

International Nuclear Information System (INIS)

Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

1975-01-01

Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

Two cases of acute generalized exanthematous pustulosis related to oral terbinafine and an analysis of the clinical reaction pattern.

Science.gov (United States)

Eyler, Jennifer T; Squires, Stephen; Fraga, Garth R; Liu, Deede; Kestenbaum, Thelda

2012-11-15

Acute generalized exanthematous pustulosis (AGEP) is a clinical reaction pattern characterized by the rapid appearance of widespread sterile, nonfollicular pustules arising within edematous erythematous skin. This aseptic pustular eruption is commonly accompanied by leukocytosis and fever and usually follows recent administration of oral or parenteral drugs. We report two cases of terbinafine-induced AGEP in male patients. Both patients developed a generalized erythroderma with scaling and pruritic pustules 7 and 14 days following initiation of oral terbinafine. With immediate discontinuation of terbinafine and various treatment protocols, both patients demonstrated recovery followed by skin desquamation during the subsequent weeks. Terbinafine is the most frequently used systemic antimycotic and antifungal medication, reflecting its superior efficacy for dermatophyte infections. Despite the appealing drug profile, an awareness of terbinafine-induced AGEP is important given the 5 percent mortality associated with AGEP. Additionally, distinguishing the characteristics of AGEP from those associated with toxic epidermal necrolysis, Stevens-Johnson syndrome, and generalized pustular psoriasis allows for prompt dermatologic evaluation, accurate diagnosis, and appropriate treatment.

Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

Directory of Open Access Journals (Sweden)

Michelle T Juarez

2011-12-01

Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

Directory of Open Access Journals (Sweden)

Daniela GUZMÁN-URIBE

Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis

Directory of Open Access Journals (Sweden)

Hugo Nodarse-Cuní

2013-03-01

Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.

Selective Killing Effects of Cold Atmospheric Pressure Plasma with NO Induced Dysfunction of Epidermal Growth Factor Receptor in Oral Squamous Cell Carcinoma.

Directory of Open Access Journals (Sweden)

Jung-Hwan Lee

Full Text Available The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP-induced radicals on the epidermal growth factor receptor (EGFR, which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.

Selective Killing Effects of Cold Atmospheric Pressure Plasma with NO Induced Dysfunction of Epidermal Growth Factor Receptor in Oral Squamous Cell Carcinoma.

Science.gov (United States)

Lee, Jung-Hwan; Om, Ji-Yeon; Kim, Yong-Hee; Kim, Kwang-Mahn; Choi, Eun-Ha; Kim, Kyoung-Nam

2016-01-01

The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP)-induced radicals on the epidermal growth factor receptor (EGFR), which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.

Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.

NARCIS (Netherlands)

Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der

2003-01-01

The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol

Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

Science.gov (United States)

Crawford, Melissa; Dagnino, Lina

2017-10-02

The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

Epidermal growth factor induces HCCR expression via PI3K/Akt/mTOR signaling in PANC-1 pancreatic cancer cells

International Nuclear Information System (INIS)

Xu, Zekuan; Zhang, Guoxin; Zhang, Yi; Jiang, Jiakai; Yang, Yang; Shi, Ruihua; Hao, Bo; Zhang, Zhihong; Huang, Zuhu; Kim, Jin W

2010-01-01

Human cervical cancer oncoprotein 1 (HCCR-1), reported as a negative regulator of p53, is over-expressed in a variety of human cancers. However, it is yet unknown whether HCCR-1 plays any role in pancreatic cancer development. The aim of this study was to investigate the effect of epidermal growth factor on the expression of HCCR in pancreatic cancer cells, and to explore if PI3K/Akt/mTOR signaling pathway mediated this expression. A polyclonal antibody against HCCR protein was raised by immunizing Balb/c mice with the purified recombinant protein pMBPc-HCCR. Tissue samples were constructed on a tissue chip, and the expression of HCCR was investigated by immunohistochemistry assay and Western blotting. Pancreatic cell line, PANC-1 cells were stably transfected with plasmids containing sense-HCCR-1 fragment and HCCR siRNA fragment. MTT and transwell assay were used to investigate the proliferation and invasion of stable tansfectants. The specific inhibitor of PI3K and mTOR was used to see if PI3K/mTOR signal transduction was involved in the induction of HCCR gene expression. A Luciferase assay was used to see if Akt can enhance the HCCR promoter activity. HCCR was up-regulated in pancreatic tumor tissues (mean Allred score 4.51 ± 1.549 vs. 2.87 ± 2.193, P < 0.01), especially with high expression in poorly differentiated pancreatic cancer. The growth of cells decreased in HCCR-1 siRNA transfected cells compared with vector transfectants. The number of invasion cells was significantly lower in HCCR-1 siRNA transfected cells (24.4 ± 9.9) than that in vector transfectants (49.1 ± 15.4). Treatment of PANC-1 cells with epidermal growth factor increased HCCR protein level in a dose- and time-dependent manner. However, application of LY294002 and rapamycin caused a dramatic reduction of epidermal growth factor-induced HCCR expression. Over-expression of exogenous constitutively active Akt increased the HCCR promoter activity; in contrast, dominant negative Akt decreased

Immunohistochemical detection of epidermal growth factor receptor in radiation-induced lung tumors in Beagle dogs

Energy Technology Data Exchange (ETDEWEB)

Gillett, N A; Haley, P J; Hahn, F F

1988-12-01

Increased levels of epidermal growth factor receptor have been reported in a variety of tumors, including pulmonary squamous cell carcinomas in man. The purpose of this study was to determine if increased levels of epidermal growth factor (EGFR) were present in lung tumors from Beagle dogs that had been exposed to {sup 239}PuO{sub 2}- Using immunohistochemical techniques, sections from 17 lung tumors were examined for the presence of EGFR. Seven of the tumors were strongly positive for EGFR; the remainder of the tumors and the normal lung sections were negative. The positive immunostaining could not be correlated with the histologic phenotype of the tumors. Work is in progress to determine the level of EGFR in preneoplastic, proliferative epithelial foci in the Iung. (author)

Induction of suppression of delayed type hypersensitivity to herpes simplex virus by epidermal cells exposed to UV-irradiated urocanic acid in vivo

International Nuclear Information System (INIS)

Ross, J.A.; Howie, S.E.; Norval, M.; Maingay, J.P.

1987-01-01

Urocanic acid (UCA), the putative photoreceptor for ultraviolet radiation (UV)-induced suppression, undergoes a UV-dependent trans to cis isomerisation. Epidermal cells from mice painted with UCA, containing a known proportion of the cis-isomer, generate suppression of the delayed type hypersensitivity response to herpes simplex virus type 1 (HSV-1) when transferred to naive syngeneic recipients at the same time and site as infection with HSV-1. One T suppressor cell subset, of phenotype (Thy1+, L3T4+, Ly2-), is induced by the cis-UCA modified epidermal cell transfer. Flow cytometric analysis of the epidermal cells from skin treated with UV or cis-UCA indicates an overall reduction from normal in the number of cells expressing MHC Class II antigens, but no alteration in the number expressing I-J antigens

Epidermal stem cells response to radiative genotoxic stress

International Nuclear Information System (INIS)

Marie, Melanie

2013-01-01

Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

DEFF Research Database (Denmark)

Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

2003-01-01

a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

Science.gov (United States)

Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

2018-03-15

Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

Gromwell (Lithospermum erythrorhizon) Supplementation Enhances Epidermal Levels of Ceramides, Glucosylceramides, β-Glucocerebrosidase, and Acidic Sphingomyelinase in NC/Nga Mice

OpenAIRE

Kim, Jungmin; Cho, Yunhi

2013-01-01

We have previously reported that dietary gromwell (Lithospermum erythrorhizon; LE) prevents the development of atopic dermatitis (AD) with increased epidermal levels of total ceramide (Cer), the major lipid maintaining epidermal barrier. In this study, we investigated whether the increased level of total Cer induced by dietary LE would be related to the altered metabolism of glucosylceramide (GlcCer) and sphingomyelin (SM), two major precursor lipids in Cer generation. NC/Nga mice, an animal ...

Degradation of Epidermal Growth Factor Receptor Mediates Dasatinib-Induced Apoptosis in Head and Neck Squamous Cell Carcinoma Cells

Directory of Open Access Journals (Sweden)

Yu-Chin Lin

2012-06-01

Full Text Available Epidermal growth factor receptor (EGFR is an important oncoprotein that promotes cell growth and proliferation. Dasatinib, a bcr-abl inhibitor, has been approved clinically for the treatment of chronic myeloid leukemia and demonstrated to be effective against solid tumors in vitro through Src inhibition. Here, we disclose that EGFR degradation mediated dasatinib-induced apoptosis in head and neck squamous cell carcinoma (HNSCC cells. HNSCC cells, including Ca9-22, FaDu, HSC3, SAS, SCC-25, and UMSCC1, were treated with dasatinib, and cell viability, apoptosis, and underlying signal transduction were evaluated. Dasatinib exhibited differential sensitivities against HNSCC cells. Growth inhibition and apoptosis were correlated with its inhibition on Akt, Erk, and Bcl-2, irrespective of Src inhibition. Accordingly, we found that down-regulation of EGFR was a determinant of dasatinib sensitivity. Lysosome inhibitor reversed dasatinib-induced EGFR down-regulation, and c-cbl activity was increased by dasatinib, indicating that dasatinib-induced EGFR down-regulation might be through c-cbl-mediated lysosome degradation. Increased EGFR activation by ligand administration rescued cells from dasatinib-induced apoptosis, whereas inhibition of EGFR enhanced its apoptotic effect. Estrogen receptor α (ERα was demonstrated to play a role in Bcl-2 expression, and dasatinib inhibited ERα at the pretranslational level. ERα was associated with EGFR in dasatinib-treated HNSCC cells. Furthermore, the xenograft model showed that dasatinib inhibited HSC3 tumor growth through in vivo down-regulation of EGFR and ERα. In conclusion, degradation of EGFR is a novel mechanism responsible for dasatinib-induced apoptosis in HNSCC cells.

BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

International Nuclear Information System (INIS)

Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

2010-01-01

Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

[Drug eruptions caused by noncorticoid anti-inflammatory agents].

Science.gov (United States)

Roujeau, J C; Guillaume, J C; Revuz, J; Touraine, R

1984-01-01

Non-steroidal anti-inflammatory drugs (NSAI) may elicit various kinds of cutaneous side effects. The commonest ones are non-specific erythematous eruptions, sometimes with a phototoxic distribution, and urticaria. Vasculitis and severe bullous eruptions (Stevens-Johnson's syndrome and Toxic Epidermal Necrolysis) are rare but may have severe outcomes. The overall incidence of cutaneous reactions is about the same for all NSAI, 1 to 3 p. 100, during the clinical studies performed before marketing the drug, but this increases afterwards (up to 45 p. 100 for Benoxaprofen). Drugs with long half-lives may carry a higher risk for severe cutaneous reactions. NSAI are now the main cause of drug induced TEN. Urticarial reactions seem related to pharmacological phenomena while the pathogenic events leading to other kinds of skin reactions remain unknown. An hypersensitivity reaction is postulated. The therapeutic value of corticosteroids for the severe cutaneous side effects of drugs is still controversial.

Expression of transforming growth factor alpha and epidermal growth factor receptor in rat lung neoplasms induced by plutonium-239

International Nuclear Information System (INIS)

Stegelmeier, B.L.; Gillett, N.A.; Hahn, F.F.; Kelly, G.; Rebar, A.H.

1994-01-01

Ninety-two rat lung proliferative lesions and neoplasms induced by inhaled 239 PuO 2 were evaluated for aberrant expression of transforming growth factor alpha (TGF-α) and epidermal growth factor receptor (EGFR). Expression of TGF-α protein, measured by immunohistochemistry, was higher in 94% of the squamous cell carcinomas and 87% of the foci of alveolar epithelial squamous metaplasia than that exhibited by the normal-appearing, adjacent lung parenchyma. In contrast, only 20% of adenocarcinomas and foci of epithelial hyperplasia expressed elevated levels of TGF-α. Many neoplasms expressing TGF-α also expressed excessive levels of EGFR mRNA. Southern and DNA slot blot analyses showed that the elevated EGFR expression was not due to amplification of the EGFR gene. These data suggest that increased amounts of TGF-α were early alterations in the progression of plutonium-induced squamous cell carcinoma, and these increases may occur in parallel with overexpression of the receptor for this growth factor. Together, these alterations create a potential autocrine loop for sustaining clonal expansion of cells initiated by high-LET radiation. 44 refs., 4 figs., 1 tab

Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

Science.gov (United States)

Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

2017-05-01

High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

Epidermal stem cells: location, potential and contribution to cancer.

Science.gov (United States)

Ambler, C A; Määttä, A

2009-01-01

Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

A homolog of Drosophila grainy head is essential for epidermal integrity in mice.

Science.gov (United States)

Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M

2005-04-15

The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.

Role of epidermal growth factor receptor and endoplasmic reticulum stress in vascular remodeling induced by angiotensin II.

Science.gov (United States)

Takayanagi, Takehiko; Kawai, Tatsuo; Forrester, Steven J; Obama, Takashi; Tsuji, Toshiyuki; Fukuda, Yamato; Elliott, Katherine J; Tilley, Douglas G; Davisson, Robin L; Park, Joon-Young; Eguchi, Satoru

2015-06-01

The mechanisms by which angiotensin II (AngII) elevates blood pressure and enhances end-organ damage seem to be distinct. However, the signal transduction cascade by which AngII specifically mediates vascular remodeling such as medial hypertrophy and perivascular fibrosis remains incomplete. We have previously shown that AngII-induced epidermal growth factor receptor (EGFR) transactivation is mediated by disintegrin and metalloproteinase domain 17 (ADAM17), and that this signaling is required for vascular smooth muscle cell hypertrophy but not for contractile signaling in response to AngII. Recent studies have implicated endoplasmic reticulum (ER) stress in hypertension. Interestingly, EGFR is capable of inducing ER stress. The aim of this study was to test the hypothesis that activation of EGFR and ER stress are critical components required for vascular remodeling but not hypertension induced by AngII. Mice were infused with AngII for 2 weeks with or without treatment of EGFR inhibitor, erlotinib, or ER chaperone, 4-phenylbutyrate. AngII infusion induced vascular medial hypertrophy in the heart, kidney and aorta, and perivascular fibrosis in heart and kidney, cardiac hypertrophy, and hypertension. Treatment with erlotinib as well as 4-phenylbutyrate attenuated vascular remodeling and cardiac hypertrophy but not hypertension. In addition, AngII infusion enhanced ADAM17 expression, EGFR activation, and ER/oxidative stress in the vasculature, which were diminished in both erlotinib-treated and 4-phenylbutyrate-treated mice. ADAM17 induction and EGFR activation by AngII in vascular cells were also prevented by inhibition of EGFR or ER stress. In conclusion, AngII induces vascular remodeling by EGFR activation and ER stress via a signaling mechanism involving ADAM17 induction independent of hypertension. © 2015 American Heart Association, Inc.

Simple preparation of plant epidermal tissue for laser microdissection and downstream quantitative proteome and carbohydrate analysis

Directory of Open Access Journals (Sweden)

Christian eFalter

2015-03-01

Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.

M2 macrophages induce ovarian cancer cell proliferation via a heparin binding epidermal growth factor/matrix metalloproteinase 9 intercellular feedback loop.

Science.gov (United States)

Carroll, Molly J; Kapur, Arvinder; Felder, Mildred; Patankar, Manish S; Kreeger, Pamela K

2016-12-27

In ovarian cancer, a high ratio of anti-inflammatory M2 to pro-inflammatory M1 macrophages correlates with poor patient prognosis. The mechanisms driving poor tumor outcome as a result of the presence of M2 macrophages in the tumor microenvironment remain unclear and are challenging to study with current techniques. Therefore, in this study we utilized a micro-culture device previously developed by our lab to model concentrated paracrine signaling in order to address our hypothesis that interactions between M2 macrophages and ovarian cancer cells induce tumor cell proliferation. Using the micro-culture device, we determined that co-culture with M2-differentiated primary macrophages or THP-1 increased OVCA433 proliferation by 10-12%. This effect was eliminated with epidermal growth factor receptor (EGFR) or heparin-bound epidermal growth factor (HB-EGF) neutralizing antibodies and HBEGF expression in peripheral blood mononuclear cells from ovarian cancer patients was 9-fold higher than healthy individuals, suggesting a role for HB-EGF in tumor progression. However, addition of HB-EGF at levels secreted by macrophages or macrophage-conditioned media did not induce proliferation to the same extent, indicating a role for other factors in this process. Matrix metalloproteinase-9, MMP-9, which cleaves membrane-bound HB-EGF, was elevated in co-culture and its inhibition decreased proliferation. Utilizing inhibitors and siRNA against MMP9 in each population, we determined that macrophage-secreted MMP-9 released HB-EGF from macrophages, which increased MMP9 in OVCA433, resulting in a positive feedback loop to drive HB-EGF release and increase proliferation in co-culture. Identification of multi-cellular interactions such as this may provide insight into how to most effectively control ovarian cancer progression.

Epidermal growth factor receptor inhibition reduces angiogenesis via hypoxia-inducible factor-1α and Notch1 in head neck squamous cell carcinoma.

Directory of Open Access Journals (Sweden)

Wei-Ming Wang

Full Text Available Angiogenesis, a marker of cancer development, affects response to radiotherapy sensibility. This preclinical study aims to understand the receptor tyrosine kinase-mediated angiogenesis in head neck squamous cell carcinoma (HNSCC. The receptor tyrosine kinase activity in a transgenic mouse model of HNSCC was assessed. The anti-tumorigenetic and anti-angiogenetic effects of cetuximab-induced epidermal growth factor receptor (EGFR inhibition were investigated in xenograft and transgenic mouse models of HNSCC. The signaling transduction of Notch1 and hypoxia-inducible factor-1α (HIF-1α was also analyzed. EGFR was overexpressed and activated in the Tgfbr1/Pten deletion (2cKO mouse model of HNSCC. Cetuximab significantly delayed tumor onset by reducing tumor angiogenesis. This drug exerted similar effects on heterotopic xenograft tumors. In the human HNSCC tissue array, increased EGFR expression correlated with increased HIF-1α and micro vessel density. Cetuximab inhibited tumor-induced angiogenesis in vitro and in vivo by significantly downregulating HIF-1α and Notch1. EGFR is involved in the tumor angiogenesis of HNSCC via the HIF-1α and Notch1 pathways. Therefore, targeting EGFR by suppressing hypoxia- and Notch-induced angiogenesis may benefit HNSCC therapy.

Systemic treatment with epidermal growth factor in pigs induces ductal proliferations in the pancreas

DEFF Research Database (Denmark)

Vinter-Jensen, Lars; Juhl, C O; Teglbjaerg, P S

1997-01-01

Epidermal growth factor (EGF), transforming growth factor alpha (TGF-alpha), and the EGF receptor are often overexpressed in chronic pancreatitis and in malignant pancreatic growth. Transgenic mice overexpressing TGF-alpha develop tissue changes in the pancrease resembling changes found in chronic...... pancreatitis. The effects of systemic treatment with EGF on the porcine pancrease were investigated in this study....

Milk fat globule-epidermal growth factor-factor VIII attenuates sepsis-induced acute kidney injury.

Science.gov (United States)

Cen, Cindy; Aziz, Monowar; Yang, Weng-Lang; Zhou, Mian; Nicastro, Jeffrey M; Coppa, Gene F; Wang, Ping

2017-06-01

Acute kidney injury (AKI) is most commonly caused by sepsis in critically ill patients, and it is associated with high morbidity and mortality. The pathophysiology of sepsis-induced AKI is generally accepted to include direct inflammatory injury, endothelial cell dysfunction, and apoptosis. Milk fat globule-epidermal growth factor-factor VIII (MFG-E8) is a secretory glycoprotein with a known role in the enhancement of apoptotic cell clearance and regulation of inflammation. We hypothesize that administration of recombinant mouse MFG-E8 (rmMFG-E8) can protect mice from kidney injuries caused by sepsis. Sepsis was induced in 8-wk-old male C57BL/6 mice by cecal ligation and puncture (CLP). rmMFG-E8 or phosphate-buffered saline (vehicle) was injected intravenously at a dosage of 20 μg/kg body weight at time of CLP (n = 5-8 mice per group). After 20 h, serum and renal tissue were harvested for various analyses. The renal injury markers blood urea nitrogen (BUN) and creatinine were determined by enzymatic and chemical reactions, respectively. The gene expression analysis was carried out by real-time quantitative polymerase chain reaction. At 20 h after CLP, serum levels of BUN and creatinine were both significantly increased in the vehicle group compared with the sham group, whereas the mice treated with rmMFG-E8 had a significant reduction in BUN and creatinine levels by 28% and 24.1%, respectively (BUN: 197.7 ± 23.6 versus 142.3 ± 20.7 mg/dL; creatinine: 0.83 ± 0.12 versus 0.63 ± 0.06 mg/dL; P sepsis through inhibiting the production of proinflammatory cytokines and chemokine, as well as through the activation of endothelial cells. Thus, MFG-E8 may have a therapeutic potential for treating AKI induced by sepsis. Copyright © 2017 Elsevier Inc. All rights reserved.

Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

International Nuclear Information System (INIS)

Graem, N.

1986-01-01

Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

Directory of Open Access Journals (Sweden)

Qian Zhao

2015-12-01

Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

Directory of Open Access Journals (Sweden)

You Mie Lee

Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling.

Science.gov (United States)

Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B

2013-08-20

At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.

Epidermal growth factor protects squamous cell carcinoma against cisplatin-induced cytotoxicity through increased interleukin-1β expression.

Directory of Open Access Journals (Sweden)

Shian-Chin Ko

Full Text Available The expression of cytokines, such as IL-1β, and the activation of the epidermal growth factor receptor (EGFR are crucial regulators in the process of carcinogenesis. The correlation between growth factor and activated cytokine signals in the control of tumor development is a critical issue to be clarified. In our study, we found that the IL-1β gene and protein expression were induced by EGF in squamous cell carcinoma. To clarify the mechanism involved in EGF-regulated IL-1β expression, we examined the transcriptional activity and mRNA stability of IL-1β in EGF-treated cells. We found that EGF induced the expression of IL-1β and was mediated through transcriptional activation, but not through mRNA stability. The involvement of Akt and NF-κB signaling pathways in the EGF-induced IL-1β gene expression was confirmed by knockdown of RelA and Akt in cells or treating cells with Akt and NF-κB inhibitors, LY294002 and parthenolide, respectively. The expression of dominant negative IκB also repressed the activation of NF-κB and inhibited EGF-induced IL-1β expression. Using immunofluorescence staining assay, the EGF-stimulated nuclear translocation of NF-κB (p65 was inhibited by pre-treating cells with LY294002 and parthenolide. Furthermore, EGF increased the binding of NF-κB to the NF-κB binding site of the IL-1β promoter through the activation of the Akt/NF-κB pathway, which resulted in activating IL-1β promoter activity. The expression and secretion of IL-1β induced by EGF considerably reduced chemotherapeutic drug cisplatin-induced cell death. These results showed that EGF enhanced the expression of IL-1β, which was mediated by the Akt/NF-κB pathway. The activation of EGF signaling and increase of IL-1β contributed to chemotherapeutic resistance of cancer cells, suggesting that the expression of IL-1β may be used as a biomarker to evaluate successful cancer treatment.

Induction of tolerance to topically applied INCB using TNP-conjugated ultraviolet light-irradiated epidermal cells

International Nuclear Information System (INIS)

Sauder, D.N.; Tamaki, K.; Moshell, A.N.; Fujiwara, H.; Katz, S.I.

1981-01-01

Ultraviolet (uv) radiation has profound effects on the immune system both in vitro and in vivo. Recent studies, utilizing uv irradiation of intact animals, have focused on the suppressive effect of uv irradiation on the generation of allergic contact sensitization (ACS). To explore the mechanism(s) by which uv affects ACS, we used a recently described technique of sensitizing mice with the subcutaneous (s.c.) injection of haptenated epidermal cells. uv-treated or untreated mouse epidermal cells (EC) were conjugated with 1 mM trinitrobenzene sulfonate and injected s.c. into syngeneic recipients. Six days later the ear was challenged with 20 μl of 1% trinitrochlorobenzene (TNCB), and 24 h later ear thickness was measured. Our studies indicate that uv irradiation of EC prior to haptenation not only abrogates their capability of inducing ACS but also induces a state of specific immunologic tolerance. These studies indicate that the s.c. injection of trinitrophenyl conjugated (TNP) uv-irradiated (TNP-uv) EC induces a state of specific immunologic hyporesponsiveness, and passive transfer studies showed that this hyporesponsiveness is in part due to the generation of suppressor T-cells

BLIMP1 Is Required for Postnatal Epidermal Homeostasis but Does Not Define a Sebaceous Gland Progenitor under Steady-State Conditions

Directory of Open Access Journals (Sweden)

Kai Kretzschmar

2014-10-01

Full Text Available B-lymphocyte-induced nuclear maturation protein 1 (BLIMP1 was previously reported to define a sebaceous gland (SG progenitor population in the epidermis. However, the recent identification of multiple stem cell populations in the hair follicle junctional zone has led us to re-evaluate its function. We show, in agreement with previous studies, that BLIMP1 is expressed by postmitotic, terminally differentiated epidermal cells within the SG, interfollicular epidermis, and hair follicle. Epidermal overexpression of c-Myc results in loss of BLIMP1+ cells, an effect modulated by androgen signaling. Epidermal-specific deletion of Blimp1 causes multiple differentiation defects in the epidermis in addition to SG enlargement. In culture, BLIMP1+ sebocytes have no greater clonogenic potential than BLIMP1− sebocytes. Finally, lineage-tracing experiments reveal that, under steady-state conditions, BLIMP1-expressing cells do not divide. Thus, rather than defining a sebocyte progenitor population, BLIMP1 functions in terminally differentiated cells to maintain homeostasis in multiple epidermal compartments.

Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

International Nuclear Information System (INIS)

Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

1994-01-01

Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

Directory of Open Access Journals (Sweden)

Shadmehr Demehri

2008-05-01

Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

A retrospective investigation of HLA-B*5801 in hyperuricemia patients in a Han population of China.

Science.gov (United States)

Cheng, Heng; Yan, Dewen; Zuo, Xin; Liu, Junying; Liu, Wenlan; Zhang, Youming

2018-05-01

Hyperuricemia and gout have become increasingly prevalent in China. Allopurinol is an effective urate-lowering therapy, but it has severe side effects. HLA-B*5801 is highly associated with the allopurinol-induced toxic epidermal necrolysis and Stevens-Johnson syndrome. In this retrospective report, we had genotyped HLA-B*5801 in 253 cases of hyperuricemia and gout patients in a Han population in Shenzhen and analyzed the clinical management of medications. We found 30 carriers of the HLA-B*5801 allele in 253 cases of hyperuricemia or gout patients in the population (11.9%). Allopurinol was prescribed in both HLA-B*5801-positive and HLA-B*5801-negative groups. The evaluation of four models with or without genetic screening and management of allopurinol or febuxostat indicated that the HLA-B*5801 screening had significant cost benefit for clinical management. For appropriate management and cost-effectiveness, the HLA-B*5801 allele should be screened in all patients with hyperuricemia and gout in the Chinese population.

Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

International Nuclear Information System (INIS)

Ayyagari, R.R.; Khan-Dawood, F.S.

1987-01-01

Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

Rapid and dynamic subcellular reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics responses to fungal and oomycete attack

Directory of Open Access Journals (Sweden)

Takemoto Daigo

2008-06-01

Full Text Available Abstract Background Plant cells respond to the presence of potential fungal or oomycete pathogens by mounting a basal defence response that involves aggregation of cytoplasm, reorganization of cytoskeletal, endomembrane and other cell components and development of cell wall appositions beneath the infection site. This response is induced by non-adapted, avirulent and virulent pathogens alike, and in the majority of cases achieves penetration resistance against the microorganism on the plant surface. To explore the nature of signals that trigger this subcellular response and to determine the timing of its induction, we have monitored the reorganization of GFP-tagged actin, microtubules, endoplasmic reticulum (ER and peroxisomes in Arabidopsis plants – after touching the epidermal surface with a microneedle. Results Within 3 to 5 minutes of touching the surface of Arabidopsis cotyledon epidermal cells with fine glass or tungsten needles, actin microfilaments, ER and peroxisomes began to accumulate beneath the point of contact with the needle. Formation of a dense patch of actin was followed by focusing of actin cables on the site of contact. Touching the cell surface induced localized depolymerization of microtubules to form a microtubule-depleted zone surrounding a dense patch of GFP-tubulin beneath the needle tip. The concentration of actin, GFP-tubulin, ER and peroxisomes remained focused on the contact site as the needle moved across the cell surface and quickly dispersed when the needle was removed. Conclusion Our results show that plant cells can detect the gentle pressure of a microneedle on the epidermal cell surface and respond by reorganizing subcellular components in a manner similar to that induced during attack by potential fungal or oomycete pathogens. The results of our study indicate that during plant-pathogen interactions, the basal defence response may be induced by the plant's perception of the physical force exerted by the

Are steroids effective in toxic epidermal necrolysis and Stevens-Johnson syndrome?

Directory of Open Access Journals (Sweden)

Rodrigo Meza

2017-06-01

Full Text Available Resumen La necrólisis epidérmica tóxica y el síndrome de Stevens-Johnson son reacciones cutáneas adversas graves a medicamentos e infecciones. Los corticoides se describen como una alternativa terapéutica, sin embargo, su uso es aún controvertido. Utilizando la base de datos Epistemonikos, la cual es mantenida mediante búsquedas en múltiples bases de datos, identificamos cuatro revisiones sistemáticas que en conjunto incluyen once estudios primarios que responden la pregunta de interés. Extrajimos los datos y preparamos una tabla de resumen de los resultados utilizando el método GRADE. Concluimos que no está claro si los corticoides disminuyen la mortalidad o la estadía hospitalaria en la necrólisis epidérmica tóxica y el síndrome de Stevens-Johnson porque la certeza de la evidencia es muy baja.

Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

Directory of Open Access Journals (Sweden)

Raj Victor

2011-08-01

Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.

Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

Science.gov (United States)

2011-01-01

Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061

Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

DEFF Research Database (Denmark)

Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

2013-01-01

The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

Epidermal growth factor in alkali-burned corneal epithelial wound healing.

Science.gov (United States)

Singh, G; Foster, C S

1987-06-15

We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

Science.gov (United States)

Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

2014-01-01

Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

Severe Acneiform Eruption Induced by Cetuximab (Erbitux?)

OpenAIRE

Lee, Jung Eun; Lee, Sang Ju; Lee, Hee Jung; Lee, Ju Hee; Lee, Kwang Hoon

2008-01-01

Epidermal growth factor has an important role in the regulation of proliferation and differentiation in epidermal keratinocytes, as well as in the survival, angiogenesis and metastasis of cancer cells. Cetuximab is a chimeric monoclonal antibody selective for the epidermal growth factor receptor that induces a broad range of cellular responses that enhance tumor sensitivity to radiotherapy and chemotherapeutic agents. However, it can cause adverse events in the patient including acneiform eru...

Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

Science.gov (United States)

Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

2018-05-01

The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

NARCIS (Netherlands)

Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

2000-01-01

Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

Effect of head-irradiation upon epidermal mitotic activity during wound healing in the adrenalectomized mice

International Nuclear Information System (INIS)

Kobayashi, Koshi

1977-01-01

Epidermal mitotic activity during wound healing was estimated both in the adrenalectomized, head-irradiated mice and in the adrenalectomized, non-irradiated mice, and was compared with those obtained previously from the unoperated, head-irradiated mice. It was found that head-irradiation caused a mitotic depression to a much smaller extent in the adrenalectomized mice than it did in the unoperated mice, though adrenalectomy itself had exerted a great inhibitory effect upon the mitosis induced by an injury. Whether this abscopal effect of head-irradiation upon the mitotic activity was mediated via the adrenals, and whether in the adrenalectomized mice the head-irradiation acted to increase epidermal response to injury, making the mitotic pattern of adrenalectomized mice to come near that of control mice were discussed. (auth.)

Epidermal growth factor receptor (EGFR) and EGFR mutations, function and possible role in clinical trials

DEFF Research Database (Denmark)

Voldborg, B R; Damstrup, L; Spang-Thomsen, M

1997-01-01

The epidermal growth factor receptor (EGFR) is a growth factor receptor that induces cell differentiation and proliferation upon activation through the binding of one of its ligands. The receptor is located at the cell surface, where the binding of a ligand activates a tyrosine kinase in the intr...... aspects of therapeutic targeting of EGFR....

Occurrence of mutations in the epidermal growth factor receptor gene in X-ray-induced rat lung tumors

International Nuclear Information System (INIS)

Kitahashi, Tsukasa; Takahashi, Mami; Yamada, Yutaka

2008-01-01

Epidermal growth factor receptor (EGFR) gene alterations have been found in human lung cancers. However, there is no information on the factors inducing EGFR mutations. In rodents, K-ras mutations are frequently found in many lung carcinogenesis models, but hitherto, Egfr mutations have not been reported. Their presence was therefore investigated in representative lung carcinogenesis models with 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), N-nitrosobis(2-hydroxypropyl)amine (BHP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MelQx) and ethyl carbamate (urethane), as well as X-ray irradiation. With the chemical carcinogenesis models, no mutations were detected in Egfr, which is in clear contrast to the high rates observed in either codon 12 or 61 of K-ras (21/23 of the lung tumors induced with NNK, 4/5 with MelQx, 1/4 with urethane and 7/18 with BHP). However, in the X-ray-induced lung tumors, Egfr mutations with amino acid substitution were observed in exons 18 and 21 (4/12, 33%), but no activating mutation of K-ras was detected. In addition, one and four silent mutations were identified in K-ras (exon 1) and Egfr (exons 18, 20 and 21), respectively. Most mutations in both Egfr and K-ras were G/C→A/T transitions (7/8, 88% and 31/34, 91%, respectively). Although, the mutational patterns in equivalent human lesions were not completely coincident, this first report of Egfr mutations in an experimental lung tumor model suggests that X-rays or other factors producing oxygen radicals could cause EGFR mutations in some proportion of lung cancers in humans. (author)

c-Jun/AP-1 pathway-mediated cyclin D1 expression participates in low dose arsenite-induced transformation in mouse epidermal JB6 Cl41 cells

International Nuclear Information System (INIS)

Zhang Dongyun; Li Jingxia; Gao Jimin; Huang Chuanshu

2009-01-01

Arsenic is a well-documented human carcinogen associated with skin carcinogenesis. Our previous work reveals that arsenite exposure is able to induce cell transformation in mouse epidermal cell JB6 Cl41 through the activation of ERK, rather than JNK pathway. Our current studies further evaluate downstream pathway in low dose arsenite-induced cell transformation in JB6 Cl41 cells. Our results showed that treatment of cells with low dose arsenite induced activation of c-Jun/AP-1 pathway, and ectopic expression of dominant negative mutant of c-Jun (TAM67) blocked arsenite-induced transformation. Furthermore, our data indicated that cyclin D1 was an important downstream molecule involved in c-Jun/AP-1-mediated cell transformation upon low dose arsenite exposure, because inhibition of cyclin D1 expression by its specific siRNA in the JB6 Cl41 cells resulted in impairment of anchorage-independent growth of cells induced by low dose arsenite. Collectively, our results demonstrate that c-Jun/AP-1-mediated cyclin D1 expression is at least one of the key events implicated in cell transformation upon low dose arsenite exposure

Relationship between the ability of sunscreens containing 2-ethylhexyl-4'-methoxycinnamate to protect against UVR-induced inflammation, depletion of epidermal Langerhans (Ia+) cells and suppression of alloactivating capacity of murine skin in vivo.

Science.gov (United States)

Walker, S L; Morris, J; Chu, A C; Young, A R

1994-01-01

The UVB sunscreen 2-ethylhexyl-4'-methoxycinnamate was evaluated in hairless albino mouse skin for its ability to inhibit UVR-induced (i) oedema, (ii) epidermal Langerhans cell (Ia+) depletion and (iii) suppression of the alloactivating capacity of epidermal cells (mixed epidermal cell-lymphocyte reaction, MECLR). The sunscreen, prepared at 9% in ethanol or a cosmetic lotion, was applied prior to UVB/UVA irradiation. In some experiments there was a second application halfway through the irradiation. Single applications in both vehicles gave varying degrees of protection from oedema and Langerhans cell depletion but afforded no protection from suppression of MECLR. When the sunscreens were applied twice there was improved protection from oedema and Langerhans cell depletion and complete protection was afforded from suppression of MECLR. There was a clear linear relationship between Langerhans cell numbers and oedema with and without sunscreen application. The relationship between Langerhans cell numbers and MECLR was more complex. These data confirm published discrepancies between protection from oedema (a model for human erythema) and endpoints with immunological significance, but show that 2-ethylhexyl-4'-methoxycinnamate can afford complete immunoprotection, although protection is dependent on the application rate and vehicle.

Antibody-induced activation of the epidermal growth factor receptor tyrosine kinase requires the presence of detergent

NARCIS (Netherlands)

Spaargaren, M.; Defize, L. H.; de Laat, S. W.; Boonstra, J.

1990-01-01

Activation of the epidermal growth factor receptor (EGF-R) tyrosine kinase was investigated in membrane preparations as well as intact A431 cells, using anti-EGF-R antibodies directed against extra- and intracellular receptor domains. In vitro assay conditions were mimicked on whole cells by a mild

Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

Science.gov (United States)

Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

2010-07-20

The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.

Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

International Nuclear Information System (INIS)

Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

2011-01-01

Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

Genetic analysis of Ras genes in epidermal development and tumorigenesis

Science.gov (United States)

Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

2013-01-01

Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

International Nuclear Information System (INIS)

Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

2006-01-01

Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

Induction of a chloracne phenotype in an epidermal equivalent model by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is dependent on aryl hydrocarbon receptor activation and is not reproduced by aryl hydrocarbon receptor knock down.

Science.gov (United States)

Forrester, Alison R; Elias, Martina S; Woodward, Emma L; Graham, Mark; Williams, Faith M; Reynolds, Nick J

2014-01-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a potent activator of the aryl hydrocarbon receptor (AhR) and causes chloracne in humans. The pathogenesis and role of AhR in chloracne remains incompletely understood. To elucidate the mechanisms contributing to the development of the chloracne-like phenotype in a human epidermal equivalent model and identify potential biomarkers. Using primary normal human epidermal keratinocytes (NHEK), we studied AhR activation by XRE-luciferase, AhR degradation and CYP1A1 induction. We treated epidermal equivalents with high affinity TCDD or two non-chloracnegens: β-naphthoflavone (β-NF) and 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE). Using Western blotting and immunochemistry for filaggrin (FLG), involucrin (INV) and transglutaminase-1 (TGM-1), we compared the effects of the ligands on keratinocyte differentiation and development of the chloracne-like phenotype by H&E. In NHEKs, activation of an XRE-luciferase and CYP1A1 protein induction correlated with ligand binding affinity: TCDD>β-NF>ITE. AhR degradation was induced by all ligands. In epidermal equivalents, TCDD induced a chloracne-like phenotype, whereas β-NF or ITE did not. All three ligands induced involucrin and TGM-1 protein expression in epidermal equivalents whereas FLG protein expression decreased following treatment with TCDD and β-NF. Inhibition of AhR by α-NF blocked TCDD-induced AhR activation in NHEKs and blocked phenotypic changes in epidermal equivalents; however, AhR knock down did not reproduce the phenotype. Ligand-induced CYP1A1 and AhR degradation did not correlate with their chloracnegenic potential, indicating that neither CYP1A1 nor AhR are suitable biomarkers. Mechanistic studies showed that the TCDD-induced chloracne-like phenotype depends on AhR activation whereas AhR knock down did not appear sufficient to induce the phenotype. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier

Altered secretion and processing of epidermal growth factor in adrenergic-induced growth of the rat submandibular gland

DEFF Research Database (Denmark)

Thulesen, Jesper; Bor, Mustafa Vakur; Thulesen, Stina

2002-01-01

The granular convoluted tubule (GCT) cells of the submandibular glands represent a major production site for epidermal growth factor (EGF). This study investigates EGF production in the submandibular glands in relation to beta-adrenergic stimulation. Rats were treated with isoproterenol (beta...

Immune sensitization against epidermal antigens in polymorphous light eruption

International Nuclear Information System (INIS)

Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

1991-01-01

To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

African Journals Online (AJOL)

Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

"Cut-and-paste" manufacture of multiparametric epidermal electronic systems

Science.gov (United States)

Lu, Nanshu; Yang, Shixuan; Wang, Pulin

2016-05-01

Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

Conformational stability of the epidermal growth factor (EGF) receptor as influenced by glycosylation, dimerization and EGF hormone binding.

Science.gov (United States)

Taylor, Eric S; Pol-Fachin, Laercio; Lins, Roberto D; Lower, Steven K

2017-04-01

The epidermal growth factor receptor (EGFR) is an important transmembrane glycoprotein kinase involved the initiation or perpetuation of signal transduction cascades within cells. These processes occur after EGFR binds to a ligand [epidermal growth factor (EGF)], thus inducing its dimerization and tyrosine autophosphorylation. Previous publications have highlighted the importance of glycosylation and dimerization for promoting proper function of the receptor and conformation in membranes; however, the effects of these associations on the protein conformational stability have not yet been described. Molecular dynamics simulations were performed to characterize the conformational preferences of the monomeric and dimeric forms of the EGFR extracellular domain upon binding to EGF in the presence and absence of N-glycan moieties. Structural stability analyses revealed that EGF provides the most conformational stability to EGFR, followed by glycosylation and dimerization, respectively. The findings also support that EGF-EGFR binding takes place through a large-scale induced-fitting mechanism. Proteins 2017; 85:561-570. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Foliar Epidermal Studies of Plants in Euphorbiaceae

Directory of Open Access Journals (Sweden)

H. A. Thakur

2014-03-01

Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

Science.gov (United States)

Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

2011-09-01

Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

Phospholipase D2 Enhances Epidermal Growth Factor-Induced Akt Activation in EL4 Lymphoma Cells

Directory of Open Access Journals (Sweden)

Manpreet S. Chahal

2010-07-01

Full Text Available Phospholipase D2 (PLD2 generates phosphatidic acid through hydrolysis of phosphatidylcholine. PLD2 has been shown to play a role in enhancing tumorigenesis. The epidermal growth factor receptor (EGFR can both activate and interact with PLD2. Murine lymphoma EL4 cells lacking endogenous PLD2 present a unique model to elucidate the role of PLD2 in signal transduction. In the current study, we investigated effects of PLD2 on EGF response. Western blotting and RT-PCR were used to establish that both parental cells and PLD2 transfectants express endogenous EGFR. Levels of EGFR protein are increased in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. EGF stimulates proliferation of EL4 cells transfected with active PLD2, but not parental cells or cells transfected with inactive PLD2. EGF-mediated proliferation in cells expressing active PLD2 is dependent on the activities of both the EGFR and the PI3K/Akt pathway, as demonstrated by studies using protein kinase inhibitors. EGF-induced invasion through a synthetic extracellular matrix is enhanced in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. Taken together, the data suggest that PLD2 acts in concert with EGFR to enhance mitogenesis and invasion in lymphoma cells.

Phospholipase D2 Enhances Epidermal Growth Factor-Induced Akt Activation in EL4 Lymphoma Cells.

Science.gov (United States)

Chahal, Manpreet S; Brauner, Daniel J; Meier, Kathryn E

2010-07-02

Phospholipase D2 (PLD2) generates phosphatidic acid through hydrolysis of phosphatidylcholine. PLD2 has been shown to play a role in enhancing tumorigenesis. The epidermal growth factor receptor (EGFR) can both activate and interact with PLD2. Murine lymphoma EL4 cells lacking endogenous PLD2 present a unique model to elucidate the role of PLD2 in signal transduction. In the current study, we investigated effects of PLD2 on EGF response. Western blotting and RT-PCR were used to establish that both parental cells and PLD2 transfectants express endogenous EGFR. Levels of EGFR protein are increased in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. EGF stimulates proliferation of EL4 cells transfected with active PLD2, but not parental cells or cells transfected with inactive PLD2. EGF-mediated proliferation in cells expressing active PLD2 is dependent on the activities of both the EGFR and the PI3K/Akt pathway, as demonstrated by studies using protein kinase inhibitors. EGF-induced invasion through a synthetic extracellular matrix is enhanced in cells expressing active PLD2, as compared to parental cells or cells expressing inactive PLD2. Taken together, the data suggest that PLD2 acts in concert with EGFR to enhance mitogenesis and invasion in lymphoma cells.

Dasatinib blocks cetuximab- and radiation-induced nuclear translocation of the epidermal growth factor receptor in head and neck squamous cell carcinoma

International Nuclear Information System (INIS)

Li Chunrong; Iida, Mari; Dunn, Emily F.; Wheeler, Deric L.

2010-01-01

Background and purpose: The aberrant expression of epidermal growth factor receptor (EGFR) has been linked to the etiology of head and neck squamous cell carcinoma (HNSCC). The first major phase III trial combining cetuximab with radiation confirmed a strong survival advantage. However, both cetuximab and radiation can promote EGFR translocation to the nucleus where it enhances resistance to both of these modalities. In this report we sought to determine how to block cetuximab- and radiation-induced translocation of EGFR to the nucleus in HNSCC cell lines. Material and methods: We utilized three established HNSCC cell lines, SCC1, SCC6 and SCC1483 and measured nuclear translocation of EGFR after treatment with cetuximab or radiation. We then utilized dasatinib (BMS-354825), a potent, orally bioavailable inhibitor of several tyrosine kinases, including the Src family kinases, to determine if SFKs blockade could abrogate cetuximab- and radiation-induced nuclear EGFR translocation. Results: Cetuximab and radiation treatment of all three HNSCC lines lead to translocation of the EGFR to the nucleus. Blockade of SFKs abrogated cetuximab- and radiation-induced EGFR translocation to the nucleus. Conclusions: The data presented in this report suggest that both cetuximab and radiation can promote EGFR translocation to the nucleus and dasatinib can inhibit this process. Collectively these findings may suggest that dasatinib can limit EGFR translocation to the nucleus and may enhance radiotherapy plus cetuximab in HNSCC.

Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

Science.gov (United States)

Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

2018-03-27

Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

International Nuclear Information System (INIS)

Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

1997-01-01

Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

The organization of human epidermis: functional epidermal units and phi proportionality.

Science.gov (United States)

Hoath, Steven B; Leahy, D G

2003-12-01

The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

Expression of hypoxia-inducible factor-1 by trophectoderm cells in response to hypoxia and epidermal growth factor

International Nuclear Information System (INIS)

Jeong, Wooyoung; Bazer, Fuller W.; Song, Gwonhwa; Kim, Jinyoung

2016-01-01

The low oxygen environment in the uterine environment requires pre-implantation embryos to adapt to oxygen deficiency. Hypoxia-inducible factor (HIF)-1 is a master regulator whereby cells adapt to changes in oxygen concentrations. In addition to hypoxic conditions, non-hypoxic stimuli such as growth factors also activate expression of HIF-1. In this study, the mechanisms underlying low oxygen-dependent and epidermal growth factor (EGF)-dependent expression of HIF-1α were explored using porcine trophectoderm (pTr) cells. The results indicated that expression of HIF-1α and HIF-1β mRNAs was not affected by low concentrations of oxygen; however, hypoxic conditions markedly increased the abundance of HIF-1α protein, especially in nuclei of pTr cells. Even under normoxic conditions, the abundance of HIF-1α protein increased in response to EGF. This EGF-mediated increase in HIF-1α protein was blocked through inhibition of translation by cycloheximide. The inhibitors LY294002 (PI3K-AKT inhibitor), U0126 (inhibitor of ERK1/2) and rapamycin (mTOR inhibitor) also blocked the ability of EGF to increase HIF-1α protein and to phosphorylate AKT, ERK1/2 and mTOR proteins. Both hypoxia and EGF induced proliferation of pTr cells. This ability of EGF to stimulate proliferation of pTr cells was suppressed by EGFR siRNA, but not HIF-1α siRNA, but a significant decrease in EGF-induced HIF-1α protein occurred when pTr cells were transfected with HIF-1α siRNA. The results of the present study suggest that pTr cells adapt to oxygen deficiency and proliferate in response to an oxygen-dependent HIF-1 system, and that EGF at maternal–conceptus interface can increase the abundance of HIF-1α protein via translational regulation through AKT, ERK1/2 and mTOR signaling cascades. - Highlights: • HIF-1α expression is up-regulated in pTr cells under low oxygen concentrations. • EGF induces HIF-1α accumulation in pTr cells. • EGF-induced HIF-1α accumulation is blocked by de

Expression of hypoxia-inducible factor-1 by trophectoderm cells in response to hypoxia and epidermal growth factor

Energy Technology Data Exchange (ETDEWEB)

Jeong, Wooyoung [Department of Animal Resources Science, Dankook University, Cheonan (Korea, Republic of); Bazer, Fuller W. [Center for Animal Biotechnology and Genomics and Department of Animal Science, Texas A& M University, College Station, TX (United States); Song, Gwonhwa, E-mail: ghsong@korea.ac.kr [Department of Biotechnology, College of Life Sciences and Biotechnology, Korea University, Seoul (Korea, Republic of); Kim, Jinyoung, E-mail: jinyoungkim@dankook.ac.kr [Department of Animal Resources Science, Dankook University, Cheonan (Korea, Republic of)

2016-01-08

The low oxygen environment in the uterine environment requires pre-implantation embryos to adapt to oxygen deficiency. Hypoxia-inducible factor (HIF)-1 is a master regulator whereby cells adapt to changes in oxygen concentrations. In addition to hypoxic conditions, non-hypoxic stimuli such as growth factors also activate expression of HIF-1. In this study, the mechanisms underlying low oxygen-dependent and epidermal growth factor (EGF)-dependent expression of HIF-1α were explored using porcine trophectoderm (pTr) cells. The results indicated that expression of HIF-1α and HIF-1β mRNAs was not affected by low concentrations of oxygen; however, hypoxic conditions markedly increased the abundance of HIF-1α protein, especially in nuclei of pTr cells. Even under normoxic conditions, the abundance of HIF-1α protein increased in response to EGF. This EGF-mediated increase in HIF-1α protein was blocked through inhibition of translation by cycloheximide. The inhibitors LY294002 (PI3K-AKT inhibitor), U0126 (inhibitor of ERK1/2) and rapamycin (mTOR inhibitor) also blocked the ability of EGF to increase HIF-1α protein and to phosphorylate AKT, ERK1/2 and mTOR proteins. Both hypoxia and EGF induced proliferation of pTr cells. This ability of EGF to stimulate proliferation of pTr cells was suppressed by EGFR siRNA, but not HIF-1α siRNA, but a significant decrease in EGF-induced HIF-1α protein occurred when pTr cells were transfected with HIF-1α siRNA. The results of the present study suggest that pTr cells adapt to oxygen deficiency and proliferate in response to an oxygen-dependent HIF-1 system, and that EGF at maternal–conceptus interface can increase the abundance of HIF-1α protein via translational regulation through AKT, ERK1/2 and mTOR signaling cascades. - Highlights: • HIF-1α expression is up-regulated in pTr cells under low oxygen concentrations. • EGF induces HIF-1α accumulation in pTr cells. • EGF-induced HIF-1α accumulation is blocked by de

GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

Directory of Open Access Journals (Sweden)

ZhenZhen Hu

Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

Epidermal growth factor induction of front–rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2

Science.gov (United States)

Ho, Ernest; Dagnino, Lina

2012-01-01

Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front–rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front–rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front–rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front–rear polarity and forward movement. PMID:22160594

Epidermal growth factor induction of front-rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2.

Science.gov (United States)

Ho, Ernest; Dagnino, Lina

2012-02-01

Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front-rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front-rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front-rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front-rear polarity and forward movement.

Making Epidermal Bladder Cells Bigger: Developmental- and Salinity-Induced Endopolyploidy in a Model Halophyte.

Science.gov (United States)

Barkla, Bronwyn J; Rhodes, Timothy; Tran, Kieu-Nga T; Wijesinghege, Chathura; Larkin, John C; Dassanayake, Maheshi

2018-06-01

Endopolyploidy occurs when DNA replication takes place without subsequent mitotic nuclear division, resulting in cell-specific ploidy levels within tissues. In plants, endopolyploidy plays an important role in sustaining growth and development, but only a few studies have demonstrated a role in abiotic stress response. In this study, we investigated the function of ploidy level and nuclear and cell size in leaf expansion throughout development and tracked cell type-specific ploidy in the halophyte Mesembryanthemum crystallinum In addition to developmental endopolyploidy, we examined the effects of salinity stress on ploidy level. We focused specifically on epidermal bladder cells (EBC), which are modified balloon-like trichomes, due to their large size and role in salt accumulation. Our results demonstrate that ploidy increases as the leaves expand in a similar manner for each leaf type, and ploidy levels up to 512C were recorded for nuclei in EBC of leaves of adult plants. Salt treatment led to a significant increase in ploidy levels in the EBC, and these cells showed spatially related differences in their ploidy and nuclear and cell size depending on the positions on the leaf and stem surface. Transcriptome analysis highlighted salinity-induced changes in genes involved in DNA replication, cell cycle, endoreduplication, and trichome development in EBC. The increase in cell size and ploidy observed in M. crystallinum under salinity stress may contribute to salt tolerance by increasing the storage capacity for sodium sequestration brought about by higher metabolic activity driving rapid cell enlargement in the leaf tissue and EBC. © 2018 American Society of Plant Biologists. All rights reserved.

Fisetin inhibits epidermal growth factor-induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression.

Science.gov (United States)

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa

2017-01-01

Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.

Biochemistry of epidermal stem cells.

Science.gov (United States)

Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

2013-02-01

The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

Biochemistry of epidermal stem cells☆

Science.gov (United States)

Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

2014-01-01

Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

Evolution of dinosaur epidermal structures.

Science.gov (United States)

Barrett, Paul M; Evans, David C; Campione, Nicolás E

2015-06-01

Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

International Nuclear Information System (INIS)

Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

2008-01-01

The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

Infantile inflammatory pseudotumor of the facial nerve as a complication of epidermal nevus syndrome with cholesteatoma.

Science.gov (United States)

Hato, Naohito; Tsujimura, Mika; Takagi, Taro; Okada, Masahiro; Gyo, Kiyofumi; Tohyama, Mikiko; Tauchi, Hisamichi

2013-12-01

The first reported case of facial paralysis due to an inflammatory pseudotumor (IPT) of the facial nerve as a complication of epidermal nevus syndrome (ENS) is herein presented. A 10-month-old female patient was diagnosed with ENS at 3 months of age. She was referred to us because of moderate left facial paralysis. Epidermal nevi of her left auricle extended deep into the external ear canal. Otoscopy revealed polypous nevi and cholesteatoma debris filling the left ear. Computed tomography showed a soft mass filling the ear canal, including the middle ear, and an enormously enlarged facial nerve. Surgical exploration revealed numerous polypous nevi, external ear cholesteatoma, and tumorous swelling of the facial nerve. The middle ear ossicles were completely lost. The facial paralysis was improved after decompression surgery, but recurred 5 months later. A second operation was conducted 10 months after the first. During this operation, facial nerve decompression was completed from the geniculate ganglion to near the stylomastoid foramen. Histological diagnosis of the facial nerve tumor was IPT probably caused by chronic external ear inflammation induced by epidermal nevi. The facial paralysis gradually improved to House-Blackmann grade III 5 years after the second operation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Combined inhibition of EMMPRIN and epidermal growth factor receptor prevents the growth and migration of head and neck squamous cell carcinoma cells.

Science.gov (United States)

Suzuki, Shinsuke; Ishikawa, Kazuo

2014-03-01

It has been reported that the epidermal growth factor receptor (EGFR) expression is associated with the extracellular matrix metalloproteinase inducer (EMMPRIN) in some solid tumors; however, the relationship of EMMPRIN with EGFR in head and neck cancers is not fully understood. To determine the relationship between EMMPRIN and EGFR in head and neck squamous cell carcinoma (HNSCC), HNSCC cells were stimulated with epidermal growth factor (EGF), a ligand of EGFR. EMMPRIN expression in HNSCC cells was upregulated by EGF. In addition, EGF stimulation induced HNSCC cell invasion and MMP-9 expression. This increase in invasion and MMP-9 expression was abrogated by downmodulation of EMMPRIN. Furthermore, to determine the effects of combined EMMPRIN and EGFR targeting in HNSCC, HNSCC cells were treated with an EMMPRIN function-blocking antibody and the EGFR inhibitor AG1478. This combined treatment resulted in greater inhibition of HNSCC cell proliferation and migration compared with the individual agents alone. These results suggest that EMMPRIN mediates EGFR-induced tumorigenicity and that combined targeting of EMMPRIN and EGFR may be an efficacious treatment approach.

Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

Science.gov (United States)

Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

2018-01-01

Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.

Science.gov (United States)

Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un

2008-09-01

Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.

Fisetin inhibits epidermal growth factor–induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression

Science.gov (United States)

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen

2017-01-01

Purpose Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)–induced cell migration and the underlying mechanisms remain unclear. Methods Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription–PCR (RT–PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Results Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Conclusions Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1–dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases. PMID:29296070

Epidermal growth factor receptor-induced activato protein 1 activity controls density-dependent growht inhibition in normal rat kidney fibroblasts.

NARCIS (Netherlands)

Hornberg, J.J.; Dekker, H.; Peters, P.H.J.; Langerak, P.; Westerhoff, H.V.; Lankelma, J.; Zoelen, E.J.J.

2006-01-01

Density-dependent growth inhibition secures tissue homeostasis. Dysfunction of the mechanisms, which regulate this type of growth control is a major cause of neoplasia. In confluent normal rat kidney (NRK) fibroblasts, epidermal growth factor (EGF) receptor levels decline, ultimately rendering these

Cost-effectiveness analysis of HLA-B*5801 testing in preventing allopurinol-induced SJS/TEN in Thai population.

Directory of Open Access Journals (Sweden)

Surasak Saokaew

Full Text Available BACKGROUND: Stevens-Johnson syndrome (SJS and Toxic Epidermal Necrolysis (TEN, caused by allopurinol therapy, are strongly associated with the human leukocyte antigen (HLA, HLA-B*5801. Identification of HLA-B*5801 genotype before prescribing allopurinol offers the possibility of avoiding allopurinol-induced SJS/TEN. As there is a paucity of evidence about economic value of such testing, this study aims to determine the cost-effectiveness of HLA-B*5801 testing compared with usual care (no genetic testing before allopurinol administration in Thailand. METHODS AND FINDING: A decision analytical and Markov model was used to estimate life time costs and outcomes represented as quality adjusted life years (QALYs gained. The model was populated with relevant information of the association between gene and allopurinol-induced SJS/TEN, test characteristics, costs, and epidemiologic data for Thailand from a societal perspective. Input data were obtained from the literature and a retrospective database analysis. The results were expressed as incremental cost per QALY gained. A base-case analysis was performed for patients at age 30. A series of sensitivity analyses including scenario, one-way, and probabilistic sensitivity analyses were constructed to explore the robustness of the findings. Based on a hypothetical cohort of 1,000 patients, the incremental total cost was 923,919 THB (USD 29,804 and incremental QALY was 5.89 with an ICER of 156,937.04 THB (USD 5,062 per QALY gained. The cost of gout management, incidence of SJS/TEN, case fatality rate of SJS/TEN, and cost of genetic testing are considered very influential parameters on the cost-effectiveness value of HLA-B*5801 testing. CONCLUSIONS: The genetic testing for HLA-B*5801 before allopurinol administration is considered a highly potential cost-effective intervention in Thailand. The findings are sensitive to a number of factors. In addition to cost-effectiveness findings, consideration of other

UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

International Nuclear Information System (INIS)

Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

1996-01-01

Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

An Epidermal Biosensor for Carcinoembryonic Antigen

National Research Council Canada - National Science Library

Schwartz, Pauline

2001-01-01

...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

Epidermal Growth Factor Receptor in Pancreatic Cancer

International Nuclear Information System (INIS)

Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

2011-01-01

Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis

Science.gov (United States)

Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin

2016-01-01

Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054

Compartmentalized Epidermal Activation of β-Catenin Differentially Affects Lineage Reprogramming and Underlies Tumor Heterogeneity

Directory of Open Access Journals (Sweden)

Kai Kretzschmar

2016-01-01

Full Text Available Wnt/β-catenin activation in adult epidermis can induce new hair follicle formation and tumor development. We used lineage tracing to uncover the relative contribution of different stem cell populations. LGR6+ and LRIG1+ stem cells contributed to ectopic hair follicles formed in the sebaceous gland upon β-catenin activation, whereas LGR5+ cells did not. Lgr6, but not Lrig1 or Lgr5, was expressed in a subpopulation of interfollicular epidermal cells that were competent to form new hair follicles. Oncogenic β-catenin expression in LGR5+ cells led to formation of pilomatricomas, while LRIG1+ cells formed trichoadenomas and LGR6+ cells formed dermatofibromas. Tumor formation was always accompanied by a local increase in dermal fibroblast density and transient extracellular matrix remodeling. However, each tumor had a distinct stromal signature in terms of immune cell infiltrate and expression of CD26 and CD44. We conclude that compartmentalization of epidermal stem cells underlies different responses to β-catenin and skin tumor heterogeneity.

Optimal allocation of leaf epidermal area for gas exchange

OpenAIRE

de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.

2016-01-01

Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...

The effect of epidermal growth factor and IGF-I infusion on hepatic and renal expression of the IGF-system in adult female rats

NARCIS (Netherlands)

J.W. van Neck (Han); E.M. Berghout; L. Vinter-Jensen; C.A.H. Groffen; V. Cingel-Ristic; N.F. Dits (Natasja); S.L.S. Drop (Stenvert); A. Flyvbjerg (Allan)

2000-01-01

textabstractSystemic administration of epidermal growth factor (EGF) in neonatal rats results in reduced body weight gain and decreased circulating levels of IGF-I, suggesting its involvement in EGF-induced growth retardation. We investigated the effect of EGF and/or IGF-I

An Epidermal Biosensor for Carcinoembryonic Antigen

National Research Council Canada - National Science Library

Schwartz, Pauline

2003-01-01

...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

Epidermal growth in the bottlenose dolphin, Tursiops truncatus

International Nuclear Information System (INIS)

Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

1985-01-01

Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

Epidermal growth in the bottlenose dolphin, Tursiops truncatus

Energy Technology Data Exchange (ETDEWEB)

Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

1985-07-01

Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

Reduced epidermal thickness, nerve degeneration and increased pain-related behavior in rats with diabetes type 1 and 2.

Science.gov (United States)

Boric, Matija; Skopljanac, Ivan; Ferhatovic, Lejla; Jelicic Kadic, Antonia; Banozic, Adriana; Puljak, Livia

2013-11-01

To examine the mechanisms contributing to pain genesis in diabetic neuropathy, we investigated epidermal thickness and number of intraepidermal nerve fibers in rat foot pad of the animal model of diabetes type 1 and type 2 in relation to pain-related behavior. Male Sprague-Dawley rats were used. Diabetes type 1 was induced with intraperitoneal injection of streptozotocin (STZ) and diabetes type 2 was induced with a combination of STZ and high-fat diet. Control group for diabetes type 1 was fed with regular laboratory chow, while control group for diabetes type 2 received high-fat diet. Body weights and blood glucose levels were monitored to confirm induction of diabetes. Pain-related behavior was analyzed using thermal (hot, cold) and mechanical stimuli (von Frey fibers, number of hyperalgesic responses). Two months after induction of diabetes, glabrous skin samples from plantar surface of the both hind paws were collected. Epidermal thickness was evaluated with hematoxylin and eosin staining. Intraepidermal nerve fibers quantification was performed after staining skin with polyclonal antiserum against protein gene product 9.5. We found that induction of diabetes type 1 and type 2 causes significant epidermal thinning and loss of intraepidermal nerve fibers in a rat model, and both changes were more pronounced in diabetes type 1 model. Significant increase of pain-related behavior two months after induction of diabetes was observed only in a model of diabetes type 1. In conclusion, animal models of diabetes type 1 and diabetes type 2 could be used in pharmacological studies, where cutaneous changes could be used as outcome measures for predegenerative markers of neuropathies. Copyright © 2013 Elsevier B.V. All rights reserved.

Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

Science.gov (United States)

Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

2014-01-01

Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

Directory of Open Access Journals (Sweden)

Sarah Papiorek

Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

Directory of Open Access Journals (Sweden)

Kyounghwan Lee

2015-04-01

Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

[Fatal toxic respiratory epitheliolysis. Subacute tracheo-bronchial desquamation in Stevens-Johnson syndrome].

Science.gov (United States)

Martin, L; Hazouard, E; Michalak-Provost, S; Maurage, C; Machet, L

2001-09-01

Acute bronchial mucosal sloughing related to Toxic Epidermal Necrolysis (Lyell syndrome) is widely reported in literature. On the contrary severe respiratory involvement is rare in post-infectious or toxic Epitheliolysis (Stevens-Johnson syndrome). There is no well-known predictive sign of bronchial epithelium involvement. An 18-year-old patient was admitted for Stevens-Johnson syndrome related to sulfasalazine (salazosulfapyridine). There were no respiratory signs. An acute respiratory failure occurred 36 hours after from admission due to an obstructive and desquamative necrosis of the tracheobronchial epithelium. We purpose that a fiberoptic laryngoscopy should be performed even in non-dyspneic patients suffering from Stevens-Johnson syndrome if hypersecretion is present. Fiberoptic bronchoscopy can be helpful in these cases.

Drug eruptions presenting at sites of prior radiation damage (sunlight and electron beam)

International Nuclear Information System (INIS)

Shelley, W.B.; Shelley, E.D.; Campbell, A.C.; Weigensberg, I.J.

1984-01-01

Two patients are described in whom sunburn and electron beam radiodermatitis, respectively, were critical determinants in localizing the initial presentation of drug eruptions. In the first instance, a severe sunburn of the back and thighs was followed 7 months later by the appearance of a toxic epidermal necrolysis drug reaction to trimethoprim-sulfamethoxazole in the exact sites of the previous bullous sunburn reaction. In the second patient, a radiodermatitis of the left upper arm due to electron beam therapy for metastatic breast cancer was followed 7 weeks later by a codeine drug reaction confined to the area of the radiodermatitis. In both instances, oral rechallenge with the offending drug reproduced the eruption

Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

Science.gov (United States)

Denda, Mitsuhiro; Tsutsumi, Moe

2014-04-01

Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

Experimentally Induced Gluten Enteropathy and Protective Effect of Epidermal Growth Factor in Artificially Fed Neonatal Rats

Czech Academy of Sciences Publication Activity Database

Štěpánková, Renata; Kofroňová, Olga; Tučková, Ludmila; Kozáková, Hana; Cebra, J. J.; Tlaskalová, Helena

2003-01-01

Roč. 36, - (2003), s. 96-104 ISSN 0277-2116 R&D Projects: GA ČR GA303/00/1370; GA ČR GA310/00/1373; GA ČR GA303/01/1380; GA ČR GA310/01/0933; GA AV ČR IAA5020210; GA AV ČR IBS5020203; GA AV ČR IAA5020101 Institutional research plan: CEZ:AV0Z5020903 Keywords : epidermal growth factor * celiac disease Subject RIV: EE - Microbiology, Virology Impact factor: 1.402, year: 2003

Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

International Nuclear Information System (INIS)

Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

2008-01-01

Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

DEFF Research Database (Denmark)

Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

2014-01-01

The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

Science.gov (United States)

Rastogi, Anshu; Pospísil, Pavel

2010-08-01

All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

[Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

Science.gov (United States)

Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

1992-07-01

Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

Epidermal Growth Factor and Intestinal Barrier Function

Directory of Open Access Journals (Sweden)

Xiaopeng Tang

2016-01-01

Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks

Directory of Open Access Journals (Sweden)

Sang Wha Kim

2014-03-01

Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.

The effects of chronic administration of epidermal growth factor (EGF) to rats on the levels of endogenous EGF in the submandibular glands and kidneys

DEFF Research Database (Denmark)

Vinter-Jensen, Lars; Jøgensen, P E; Poulsen, Steen Seier

1996-01-01

Epidermal growth factor (EGF) is mainly produced in the submandibular glands (SMG) and in the kidneys. It has recently been reported that EGF-related ligands may induce their own biosynthesis (autoinduction) in vitro. In the present paper, we investigated whether chronic systemic treatment with E...

Neutralization of IL-8 prevents the induction of dermatologic adverse events associated with the inhibition of epidermal growth factor receptor

DEFF Research Database (Denmark)

Bangsgaard, Nannie; Houtkamp, Mischa; Schuurhuis, Danita H

2012-01-01

Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance to treatm......Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance......, characterized by acute follicular neutrophil-rich hair follicle inflammation, and thus mimicked adverse events induced by systemic administration of EGFR inhibitors. In this model, we tested the hypothesis that neutrophils, attracted by IL-8, play a central role in the observed rash. Indeed, concomitant local...

Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

Science.gov (United States)

Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

2016-09-01

Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

Science.gov (United States)

Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

2016-02-01

Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

Directory of Open Access Journals (Sweden)

Zobiri O

2012-02-01

Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

Inhibition of epidermal cell proliferation by borderline rays

Energy Technology Data Exchange (ETDEWEB)

Born, W [Freiburg Univ.; Daikeler, G

1976-08-01

Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

Effect of glucocorticoids and gamma radiation on epidermal Langerhans cells

International Nuclear Information System (INIS)

Belsito, D.V.; Baer, R.L.; Thorbecke, G.J.; Gigli, I.

1984-01-01

The effect of 750 rads of gamma radiation on the rate of return of epidermal Langerhans cells (LC) following suppressive doses of topical glucorticoids was studied in guinea pigs. Gamma radiation alone had no effect on the LC as assessed by staining for cell membrane ATPase activity and Ia antigen. It did, however, delay the expected return of Ia but not ATPase surface markers on the LC after perturbation with glucocorticoids. The delayed return of surface Ia antigen is possibly related to a radiation-induced defect in the production of a required lymphokine and/or in intracellular Ia transport. Although our data do not rule out a cytolytic effect of steroids on the LC, they do strongly suggest that, at least in part, glucocorticoids act on the LC by altering cell surface characteristics

Giant epidermal inclusion cyst in the male breast: A case report

Energy Technology Data Exchange (ETDEWEB)

KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)

2017-03-15

Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.

Fractional sunburn threshold UVR doses generate equivalent vitamin D and DNA damage in skin types I-VI, but with epidermal DNA damage gradient correlated to skin darkness.

Science.gov (United States)

Shih, Barbara B; Farrar, Mark D; Cooke, Marcus S; Osman, Joanne; Langton, Abigail K; Kift, Richard; Webb, Ann R; Berry, Jacqueline L; Watson, Rachel E B; Vail, Andy; de Gruijl, Frank R; Rhodes, Lesley E

2018-05-03

Public health guidance recommends limiting sun-exposure to sub-sunburn levels, but it's unknown whether these can gain vitamin D (for musculoskeletal health) whilst avoiding epidermal DNA damage (initiates skin cancer). Well-characterised healthy humans of all skin types (I-VI; lightest to darkest skin) were exposed to a low dose-series of solar simulated UVR of 20-80% their individual sunburn threshold dose (minimal erythemal dose, MED). Significant UVR dose-responses were seen for serum 25(OH)D and whole epidermal CPD, with as little as 0.2 MED concurrently producing 25(OH)D and CPD. Notably, fractional MEDs generated equivalent levels of whole epidermal CPD and 25(OH)D across all skin types. Crucially, we demonstrated an epidermal gradient of CPD formation strongly correlated with skin darkness (r=0.74; Pskin types, ranging from darkest skin, where high CPD levels occurred superficially with none in the germinative basal layer, through to lightest skin where CPD were induced evenly across the epidermal depth. Darker skin people can be encouraged to utilise sub-sunburn UVR-exposure to enhance their vitamin D. In lighter skin people, basal cell damage occurs concurrent with vitamin D synthesis at exquisitely low UVR levels, providing an explanation for their high skin cancer incidence; greater caution is required. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

DEFF Research Database (Denmark)

Kamstrup, M.; Faurschou, A.; Gniadecki, R.

2008-01-01

In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

Carbon dioxide laser versus erbium:YAG laser in treatment of epidermal verrucous nevus: a comparative randomized clinical study.

Science.gov (United States)

Osman, Mai Abdel Raouf; Kassab, Ahmed Nazmi

2017-08-01

A verrucous epidermal nevus (VEN) is a skin disorder that has been treated using different treatment modalities with varying results. Ablative lasers such as carbon dioxide laser (CO 2 ) and erbium:yttrium-aluminum-garnet (Er:YAG) laser have been considered as the gold standard for the treatment of epidermal nevi. To evaluate and compare the efficacy, postoperative wound healing and side effects of pulsed CO 2 laser and Er:YAG laser for the treatment of verrucous epidermal nevi. Twenty patients with localized VEN were randomly divided into two groups. Group 1 was administered CO 2 laser and group 2 underwent Er:YAG laser treatment. A blinded physician evaluated the photographs and dermoscopic photomicrographs for the efficacy and possible side effects. All patients received one treatment session and were followed up over a 6-month period. Both lasers induced noticeable clinical improvement, but there were no significant differences between two lasers in treatment response, patient satisfaction, duration of erythema and side effects. The average time to re-epithelialization was 13.5 days with CO 2 and 7.9 days with Er:YAG laser (plaser group and no lesional recurrence was detected in CO 2 laser group since treatment. Apart from re-epithelialization, both lasers showed equivalent outcomes with respect to treatment response, patient satisfaction, side effects and complications.

EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

African Journals Online (AJOL)

Administrator

stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

Epidermal CYP2 family cytochromes P450

International Nuclear Information System (INIS)

Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

2004-01-01

Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

Science.gov (United States)

Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

1989-10-15

The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

An Updated Review of the Molecular Mechanisms in Drug Hypersensitivity

Directory of Open Access Journals (Sweden)

Chun-Bing Chen

2018-01-01

Full Text Available Drug hypersensitivity may manifest ranging from milder skin reactions (e.g., maculopapular exanthema and urticaria to severe systemic reactions, such as anaphylaxis, drug reactions with eosinophilia and systemic symptoms (DRESS/drug-induced hypersensitivity syndrome (DIHS, or Stevens–Johnson syndrome (SJS/toxic epidermal necrolysis (TEN. Current pharmacogenomic studies have made important strides in the prevention of some drug hypersensitivity through the identification of relevant genetic variants, particularly for genes encoding drug-metabolizing enzymes and human leukocyte antigens (HLAs. The associations identified by these studies are usually drug, phenotype, and ethnic specific. The drug presentation models that explain how small drug antigens might interact with HLA and T cell receptor (TCR molecules in drug hypersensitivity include the hapten theory, the p-i concept, the altered peptide repertoire model, and the altered TCR repertoire model. The broad spectrum of clinical manifestations of drug hypersensitivity involving different drugs, as well as the various pathomechanisms involved, makes the diagnosis and management of it more challenging. This review highlights recent advances in our understanding of the predisposing factors, immune mechanisms, pathogenesis, diagnostic tools, and therapeutic approaches for drug hypersensitivity.

An Updated Review of the Molecular Mechanisms in Drug Hypersensitivity

Science.gov (United States)

Abe, Riichiro; Pan, Ren-You; Wang, Chuang-Wei

2018-01-01

Drug hypersensitivity may manifest ranging from milder skin reactions (e.g., maculopapular exanthema and urticaria) to severe systemic reactions, such as anaphylaxis, drug reactions with eosinophilia and systemic symptoms (DRESS)/drug-induced hypersensitivity syndrome (DIHS), or Stevens–Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN). Current pharmacogenomic studies have made important strides in the prevention of some drug hypersensitivity through the identification of relevant genetic variants, particularly for genes encoding drug-metabolizing enzymes and human leukocyte antigens (HLAs). The associations identified by these studies are usually drug, phenotype, and ethnic specific. The drug presentation models that explain how small drug antigens might interact with HLA and T cell receptor (TCR) molecules in drug hypersensitivity include the hapten theory, the p-i concept, the altered peptide repertoire model, and the altered TCR repertoire model. The broad spectrum of clinical manifestations of drug hypersensitivity involving different drugs, as well as the various pathomechanisms involved, makes the diagnosis and management of it more challenging. This review highlights recent advances in our understanding of the predisposing factors, immune mechanisms, pathogenesis, diagnostic tools, and therapeutic approaches for drug hypersensitivity. PMID:29651444

Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

Directory of Open Access Journals (Sweden)

Sabita N. Saldanha

2015-12-01

Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

Tc-99m-MDP scintigraphy in the evaluation of epidermal nevus syndrome

International Nuclear Information System (INIS)

Barbosa, M.N.S.; Cunha, M.O.; Severiche, A.F.A.; Ramos, C.D.; Etchebehere, E.C.S.C.; Belangero, W.; Camargo, E.E.

1997-01-01

Full text: Epidermal nevus syndrome has been described as a congenital neurocutaneous disorder in which epidermal nevi are associated with malformations of other organs, commonly the skeleton and central nervous system. Ocular, cardiac, and genitourinary system abnormalities, as well as other skin lesions, may also be seen. A 19 year old patient with epidermal nevus syndrome, presenting congenital facial epidermal nevi and bone deformity of the lower limbs (shortening of the left leg, left thigh varum, bilateral genu valgum, and multiple pathological fractures), as referred to the nuclear medicine laboratory to evaluate involvement of other sites of the skeleton. Whole body bone scintigraphy performed with MDP-Tc-99m showed multiple small focal areas of increased uptake in the skeleton, mainly in the upper and lower limbs, posterior ribs, right acetabulum, right sacroiliac joint, and right greater trochanter, interpreted as pathological fractures at different stages of remodeling. The range of skeletal findings in this condition is quite diverse. Many of these findings can be attributed to local tissue overgrowth with deformities and advanced bone age, associate with pathological fractures

Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

Energy Technology Data Exchange (ETDEWEB)

Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran [Uijongbu St. Mary' s Hospital, Catholic University College of Medicine, Seoul (Korea, Republic of)

2007-08-15

We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation.

Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

International Nuclear Information System (INIS)

Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran

2007-01-01

We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation

Epidermal growth factor in mammary glands and milk from rats

DEFF Research Database (Denmark)

Thulesen, J; Raaberg, Lasse; Nexø, Ebba

1993-01-01

Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

Irradiated fields spared Stevens-Johnson syndrome in a patient undergoing radiotherapy for bone metastases

International Nuclear Information System (INIS)

Musio, D.; Parisi, E.; Dionisi, F.

2009-01-01

Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are two of the most severe, rare, and life-threatening adverse reactions to medications. Their incidence is approximately two patients per million population per year. Several cases have been reported in the literature in which SJS and TEN have occurred in patients with a neoplasm undergoing radiation therapy and who are taking an anticonvulsant. We report a case of SJS-TEN that developed in a 51-year-old woman with nonresectable non-small-cell lung cancer during treatment with phenobarbital plus radiation therapy for bone metastases but in whom the irradiated areas did not exhibit the SJS skin reaction. To our knowledge, no similar cases have been reported in the literature. (author)

Immunological aspects of nonimmediate reactions to beta-lactam antibiotics.

Science.gov (United States)

Rodilla, Esther Morena; González, Ignacio Dávila; Yges, Elena Laffond; Bellido, Francisco Javier Múñoz; Bara, María Teresa Gracia; Toledano, Félix Lorente

2010-09-01

beta-lactam antibiotics are the agents most frequently implied in immune drug adverse reactions. These can be classified as immediate or nonimmediate according to the time interval between the last drug administration and their onset. Mechanisms of immediate IgE-mediated reactions are widely studied and are therefore better understood. Nonimmediate reactions include a broad number of clinical entities like mild maculopapular exanthemas, the most common, and other less frequent but more severe reactions such as Stevens-Johnson syndrome, toxic epidermal necrolysis, acute exanthematic pustulosis or cytopenias. These nonimmediate reactions are mainly mediated by T cells but the precise underlying mechanisms are not well elucidated. This fact complicates the allergological evaluation of patients with this type of reaction and available tests have demonstrated poor sensitivity and specificity.

Inhibitory effects of omega-3 fatty acids on injury-induced epidermal growth factor receptor transactivation contribute to delayed wound healing.

Science.gov (United States)

Turk, Harmony F; Monk, Jennifer M; Fan, Yang-Yi; Callaway, Evelyn S; Weeks, Brad; Chapkin, Robert S

2013-05-01

Epidermal growth factor receptor (EGFR)-mediated signaling is required for optimal intestinal wound healing. Since n-3 polyunsaturated fatty acids (PUFA), specifically docosahexaenoic acid (DHA), alter EGFR signaling and suppress downstream activation of key signaling pathways, we hypothesized that DHA would be detrimental to the process of intestinal wound healing. Using a mouse immortalized colonocyte model, DHA uniquely reduced EGFR ligand-induced receptor activation, whereas DHA and its metabolic precursor eicosapentaenoic acid (EPA) reduced wound-induced EGFR transactivation compared with control (no fatty acid or linoleic acid). Under wounding conditions, the suppression of EGFR activation was associated with a reduction in downstream activation of cytoskeletal remodeling proteins (PLCγ1, Rac1, and Cdc42). Subsequently, DHA and EPA reduced cell migration in response to wounding. Mice were fed a corn oil-, DHA-, or EPA-enriched diet prior to intestinal wounding (2.5% dextran sodium sulfate for 5 days followed by termination after 0, 3, or 6 days of recovery). Mortality was increased in EPA-fed mice and colonic histological injury scores were increased in EPA- and DHA-fed mice compared with corn oil-fed (control) mice. Although kinetics of colonic EGFR activation and downstream signaling (PLCγ1, Rac1, and Cdc42) were delayed by both n-3 PUFA, colonic repair was increased in EPA- relative to DHA-fed mice. These results indicate that, during the early response to intestinal wounding, DHA and EPA uniquely delay the activation of key wound-healing processes in the colon. This effect is mediated, at least in part, via suppression of EGFR-mediated signaling and downstream cytoskeletal remodeling.

TNP-specific Lyt-2+ cytolytic T cell clones preferentially respond to TNP-conjugated epidermal cells

International Nuclear Information System (INIS)

Shimada, S.; Katz, S.I.

1985-01-01

A most effective method for the induction of hapten-specific allergic contact sensitivity (CS) is via epicutaneous application of the hapten. Another effective method is by the administration of haptenated epidermal cells (EC) subcutaneously. The latter method induces more intense and longer lasting CS than does the subcutaneous administration of haptenated spleen cells (SC). Thus, there may be something unique about EC which, when haptenated, allows them to generate effector cells more effectively than do SC. The authors therefore, attempted to generate T cell clones that were both hapten- and epidermal-specific. Four days after painting mice with 7% trinitrochlorobenzene, draining lymph node cells were obtained and T cells were purified. These cells were co-cultured with trinitrophenylated (TNP) Langerhans cell-enriched EC. After 4 days, cells were harvested and rested on non-TNP-conjugated EC. The cells were restimulated and rested three times, and were then cloned by limiting dilution with added interleukin 2, which was then continually added. Proliferation of T cells was assessed by [ 3 H]-thymidine incorporation. Cytotoxicity assays utilized TNP-conjugated concanavalin A SC blasts or EC as targets. Clones A-2 and E-4 are Thy-1+, Lyt-2+, and L3T4-, and TNP-specific. In contrast to noncloned TNP-specific T cells, the clones proliferate preferentially in response to TNP-EC rather than TNP-SC. Also in contrast to noncloned T cells, the clones were preferentially cytotoxic for TNP-EC; compared to TNP-SC, there was an eight- to 32-fold increase in killing when TNP-EC were used as targets. Clones A-2 and E-4 therefore exhibit hapten and epidermal specificity

An evaluation of the effects of epidermal growth factor on irradiation lip mucosa damage in mice

International Nuclear Information System (INIS)

Feng Yan

1994-01-01

The effect of epidermal growth factor (EGF) on lip mucosa damage by irradiation was explored in mice. EGF was administered in doses of 100 μg/kg/day using different schedules. Mucosal damage was assessed. The metaphase arrest method with vinblastine was used to evaluate the diurnal rhythm of mitosis. EGF in regimens employed did not protect the mouse lip epithelial cells from irradiation induced damage, but it has a demonstrable stimulatory effect on cell proliferation in lip mucosa which is dependent on the schedules of administration. The reasons and mechanisms are discussed

Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

Science.gov (United States)

Staiano-Coico, L; Steinberg, M; Higgins, P J

1990-10-15

Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

Epidermal cell death in frogs with chytridiomycosis

Directory of Open Access Journals (Sweden)

Laura A. Brannelly

2017-02-01

Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

Science.gov (United States)

Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

2004-12-03

The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

African Journals Online (AJOL)

Administrator

alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

Directory of Open Access Journals (Sweden)

Magdalena Boer

2016-02-01

Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

The intestinotrophic peptide, GLP-2, counteracts the gastrointestinal atrophy in mice induced by the epidermal growth factor receptor inhibitor, erlotinib, and cisplatin

DEFF Research Database (Denmark)

Rasmussen, Andreas Rosén; Viby, Niels-Erik; Hare, Kristine Juul

2010-01-01

Erlotinib, an epidermal-growth-factor receptor inhibitor, belongs to a new generation of targeted cancer therapeutics. Gastrointestinal side-effects are common and have been markedly aggravated when erlotinib is combined with cytostatics. We examined the effects of erlotinib alone and combined wi...

Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography.

Science.gov (United States)

Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique

2014-10-01

While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment

Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

Directory of Open Access Journals (Sweden)

David Judah

Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

Science.gov (United States)

Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

2012-01-01

Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

Standardized method to obtain dermo-epidermal junction samples from bovine hoof

Directory of Open Access Journals (Sweden)

H.M.F. Mendes

2015-04-01

Full Text Available As afecções podais em bovinos causam importante impacto econômico negativo na bovinocultura. Pesquisas têm sido realizadas com o objetivo de avançar no entendimento dos processos ocorridos na junção derme-epiderme do casco de bovinos com laminite e nos demais tecidos moles durante as lesões infecciosas. Apesar disso, não foram encontrados na literatura consultada estudos que descrevessem um método padronizado para a obtenção de amostras do tecido laminar do casco. Nesse contexto, foi necessário criar e estabelecer um método viável para a colheita de amostras da junção derme-epiderme, de modo a viabilizar o estudo de pós-graduação que originou esta comunicação. O objetivo é relatar um método padronizado, testado e bem-sucedido para obtenção de amostras da junção derme-epiderme do casco de bovinos em suas regiões solear, axial e dorsal. Foram obtidos fragmentos transversais das unhas de vacas abatidas em frigorífico. A espessura desses fragmentos foi de 1,5cm, aproximadamente, e contemplava as regiões solear, axial e dorsal do casco. De forma sistematizada, amostras da junção derme-epiderme de cada uma dessas regiões foram removidas, fixadas em formol, processadas e incluídas em parafina. A análise usando microscopia de luz demonstrou cortes histológicos íntegros e sem artefatos, que permitiram ampla avaliação das estruturas tanto da derme quanto da epiderme. Concluiu-se que o método proposto viabiliza a obtenção de amostras de padrão e qualidade adequados ao estudo do tecido laminar do casco bovino.

Improvement of arbutin trans-epidermal delivery using ...

African Journals Online (AJOL)

Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...

Epidermal characters of Tamarix L. (Tamaricaceae from Northwest China and their taxonomic and palaeogeographic implications

Directory of Open Access Journals (Sweden)

Jian-Wei Zhang

2018-04-01

Full Text Available The taxonomical position of species of the genus Tamarix (Tamaricaceae has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves, and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to the studies, the leaf epidermal features, together with the character of the flower, are taxonomically clearly distinct. The establishment of Tamarix albiflonum is consolidated. Tamarix korolkowi and Tamarix ramosissima have minimal differences in epidermal characters, and the former is suggested to be a junior synonym. Tamarix ramosissima, Tamarix tarimensis, Tamarix arceuthoides and Tamarix hohenackeri are most similar with respect to their leaf epidermis; considering the common morphological features, habit, distribution and especially the hybridization, it is suggested that these four species are closely genetically related and that the variations among them are probably intraspecific. The new taxonomical evidence indicates the occurrence of 13 species and four variants in China. Presently, Tamarix is a typical plant of arid and semi-arid regions, but its Eocene ancestors lived in warm and humid climates in the coastal areas of the ancient Mediterranean Sea. Thus, the papillae or epidermal hairs, which are outgrowths of the outer epidermal cells facilitating the leaf to respond to water stress and commonly seen in the plants growing in arid or semi-arid areas rather than the plants in warm and humid climates, are of relatively recent origin in Tamarix. The primitive species lack papillae or epidermal hairs, while in evolved species these structures are abundant. Based on the ecological adaptations of the epidermal features, the palaeogeographic

Hybrid Enhanced Epidermal SpaceSuit Design Approaches

Science.gov (United States)

Jessup, Joseph M.

A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

Grhl3 and Lmo4 play coordinate roles in epidermal migration.

Science.gov (United States)

Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M

2008-09-01

In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.

The tryptophan-derived endogenous arylhydrocarbon receptor ligand 6-formylindolo[3,2-b]carbazole (FICZ) is a nanomolar UVA-photosensitizer in epidermal keratinocytes

Science.gov (United States)

Williams, Joshua D.; Cabello, Christopher M.; Qiao, Shuxi; Wondrak, Georg T.

2014-01-01

Endogenous UVA-chromophores may act as sensitizers of oxidative stress underlying cutaneous photoaging and photocarcinogenesis, but the molecular identity of non-DNA key chromophores displaying UVA-driven photodyamic activity in human skin remains largely undefined. Here we report that 6-formylindolo[3,2-b]carbazole (FICZ), a tryptophan photoproduct and endogenous high affinity aryl hydrocarbon receptor (AhR) agonist, acts as a nanomolar photosensitizer potentiating UVA-induced oxidative stress irrespective of AhR ligand activity. In human HaCaT and primary epidermal keratinocytes, photodynamic induction of apoptosis was elicited by the combined action of solar simulated UVA and FICZ, whereas exposure to the isolated action of UVA or FICZ did not impair viability. In a human epidermal tissue reconstruct, FICZ/UVA-cotreatment caused pronounced phototoxicity inducing keratinocyte cell death, and FICZ photodynamic activity was also substantiated in a murine skin exposure model. Array analysis revealed pronounced potentiation of cellular heat shock, ER stress, and oxidative stress response gene expression observed only upon FICZ/UVA-cotreatment. FICZ photosensitization caused intracellular oxidative stress, and comet analysis revealed introduction of formamidopyrimidine-DNA glycosylase (FPG)-sensitive oxidative DNA lesions suppressible by antioxidant cotreatment. Taken together, our data demonstrate that the endogenous AhR ligand FICZ displays nanomolar photodynamic activity representing a molecular mechanism of UVA-induced photooxidative stress potentially operative in human skin. PMID:25431849

Intermittent hypoxia induces the proliferation of rat vascular smooth muscle cell with the increases in epidermal growth factor family and erbB2 receptor

International Nuclear Information System (INIS)

Kyotani, Yoji; Ota, Hiroyo; Itaya-Hironaka, Asako; Yamauchi, Akiyo; Sakuramoto-Tsuchida, Sumiyo; Zhao, Jing; Ozawa, Kentaro; Nagayama, Kosuke; Ito, Satoyasu; Takasawa, Shin; Kimura, Hiroshi; Uno, Masayuki; Yoshizumi, Masanori

2013-01-01

Obstructive sleep apnea is characterized by intermittent hypoxia (IH), and associated with cardiovascular diseases, such as stroke and heart failure. These cardiovascular diseases have a relation to atherosclerosis marked by the proliferation of vascular smooth muscle cells (VSMCs). In this study, we investigated the influence of IH on cultured rat aortic smooth muscle cell (RASMC). The proliferation of RASMC was significantly increased by IH without changing the level of apoptosis. In order to see what induces RASMC proliferation, we investigated the influence of normoxia (N)-, IH- and sustained hypoxia (SH)-treated cell conditioned media on RASMC proliferation. IH-treated cell conditioned medium significantly increased RASMC proliferation compared with N-treated cell conditioned medium, but SH-treated cell conditioned medium did not. We next investigated the epidermal growth factor (EGF) family as autocrine growth factors. Among the EGF family, we found significant increases in mRNAs for epiregulin (ER), amphiregulin (AR) and neuregulin-1 (NRG1) in IH-treated cells and mature ER in IH-treated cell conditioned medium. We next investigated the changes in erbB family receptors that are receptors for ER, AR and NRG1, and found that erbB2 receptor mRNA and protein expressions were increased by IH, but not by SH. Phosphorylation of erbB2 receptor at Tyr-1248 that mediates intracellular signaling for several physiological effects including cell proliferation was increased by IH, but not by SH. In addition, inhibitor for erbB2 receptor suppressed IH-induced cell proliferation. These results provide the first demonstration that IH induces VSMC proliferation, and suggest that EGF family, such as ER, AR and NRG1, and erbB2 receptor could be involved in the IH-induced VSMC proliferation. - Highlights: ●In vitro system for intermittent hypoxia (IH) and sustained hypoxia (SH). ●IH, but not SH, induces the proliferation of rat vascular smooth muscle cell. ●Epiregulin m

Intermittent hypoxia induces the proliferation of rat vascular smooth muscle cell with the increases in epidermal growth factor family and erbB2 receptor

Energy Technology Data Exchange (ETDEWEB)

Kyotani, Yoji, E-mail: cd147@naramed-u.ac.jp [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Ota, Hiroyo [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Itaya-Hironaka, Asako; Yamauchi, Akiyo; Sakuramoto-Tsuchida, Sumiyo [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Zhao, Jing; Ozawa, Kentaro; Nagayama, Kosuke; Ito, Satoyasu [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Takasawa, Shin [Department of Biochemistry, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan); Kimura, Hiroshi [Second Department of Internal Medicine, Nara Medical University School of Medicine, Kashihara 634-8522 (Japan); Uno, Masayuki [Department of Pharmacy, Nara Medical University Hospital, Kashihara 634-8522 (Japan); Yoshizumi, Masanori [Department of Pharmacology, Nara Medical University School of Medicine, Kashihara 634-8521 (Japan)

2013-11-15

Obstructive sleep apnea is characterized by intermittent hypoxia (IH), and associated with cardiovascular diseases, such as stroke and heart failure. These cardiovascular diseases have a relation to atherosclerosis marked by the proliferation of vascular smooth muscle cells (VSMCs). In this study, we investigated the influence of IH on cultured rat aortic smooth muscle cell (RASMC). The proliferation of RASMC was significantly increased by IH without changing the level of apoptosis. In order to see what induces RASMC proliferation, we investigated the influence of normoxia (N)-, IH- and sustained hypoxia (SH)-treated cell conditioned media on RASMC proliferation. IH-treated cell conditioned medium significantly increased RASMC proliferation compared with N-treated cell conditioned medium, but SH-treated cell conditioned medium did not. We next investigated the epidermal growth factor (EGF) family as autocrine growth factors. Among the EGF family, we found significant increases in mRNAs for epiregulin (ER), amphiregulin (AR) and neuregulin-1 (NRG1) in IH-treated cells and mature ER in IH-treated cell conditioned medium. We next investigated the changes in erbB family receptors that are receptors for ER, AR and NRG1, and found that erbB2 receptor mRNA and protein expressions were increased by IH, but not by SH. Phosphorylation of erbB2 receptor at Tyr-1248 that mediates intracellular signaling for several physiological effects including cell proliferation was increased by IH, but not by SH. In addition, inhibitor for erbB2 receptor suppressed IH-induced cell proliferation. These results provide the first demonstration that IH induces VSMC proliferation, and suggest that EGF family, such as ER, AR and NRG1, and erbB2 receptor could be involved in the IH-induced VSMC proliferation. - Highlights: ●In vitro system for intermittent hypoxia (IH) and sustained hypoxia (SH). ●IH, but not SH, induces the proliferation of rat vascular smooth muscle cell. ●Epiregulin m

Ultraviolet Type B-Radiation-Induced Hyperplasia and Seborrheic Keratosis is Reduced by Application of Commercial Sunscreens

Directory of Open Access Journals (Sweden)

Azad K Saeed1*, Snur MA Hassan1 and Nali A Maaruf2

2016-11-01

Full Text Available Fifty-six mice were classified into four groups; Group A (control group, n=8, Group B (exposure group, n=16, Group C (n=16 treated with sunscreen 15 minutes before UVB irradiations and group D (n=16 sunscreen treated 60 minutes before UVB exposure. Mice were irradiated 30 minutes 5days/week (12 weeks, and group C-D treated five days/week (12 weeks. Skin samples were taken in the mid and end of the experiment. The result of this study revealed that, epidermal thickness in group A was 7.155µm. At the mid-period of the experiment, severe epidermal hyperplasia was observed in group B with epidermal thickness 118.712µm, while in group C and D mild to moderate epidermal hyperplasia were noted with decreasing epidermal thickness to 64.154 and 90.042µm respectively. At the end of the experiment in Group B epidermal thickness reached to 281.35µm with seborrheic keratosis development, whereas in group C and D totally inhibited the development of seborrheic keratosis and epidermal thickness decreased again into 42.347 and 55.915µm. In conclusion, chronic UVB radiation-led to epidermal hyperplasia and seborrheic keratosis, sunscreen prevented the development of seborrheic keratosis and decreased the UVB-induced epidermal hyperplasia.

Nevo da epidermólise bolhosa: caso clínico e revisão da literatura Epidermolysis bullosa nevus: case report and literature review

Directory of Open Access Journals (Sweden)

Carolina Porto Cotrim

2011-08-01

Full Text Available Lesões melanocíticas adquiridas assemelhando-se à melanoma têm sido descritas nos principais grupos da Epidermólise bolhosa, e referidas como "Nevos da Epidermólise bolhosa''. Induzem facilmente ao erro diagnóstico, apesar de nenhuma transformação maligna ter sido descrita. Relatamos o desenvolvimento de um nevo melanocítico adquirido grande no local de bolhas recorrentes em uma criança de 5 anos portadora de Epidermólise bolhosa simples. O padrão dermatoscópico global foi sugestivo de benignidade, e os achados histopatológicos foram compatíveis com um nevo melanocítico composto. Este é o primeiro caso de um Nevo da Epidermólise bolhosa publicado na literatura brasileiraAcquired melanocytic lesions resembling malignant melanoma have been described in all major categories of Epidermolysis bullosa and referred to as "Epidermolysis bullosa nevi''. They easily induce to diagnostic error, although no malignant transformation has been reported. We report the development of a large acquired melanocytic nevus at a site of recurrent blisters in a 5-year-old child with Epidermolysis bullosa simplex. The global dermoscopic pattern was suggestive of benignity, and the histopathological findings were compatible with a compound melanocytic nevus. This is the first published case of Epidermolysis bullosa nevi in Brazilian literature. Despite their benign behavior, we emphasize the importance of regular clinical and dermoscopic monitoring, since a malignant course still cannot be totally excluded

EGFR Activation and Ultraviolet Light‐Induced Skin Carcinogenesis

Directory of Open Access Journals (Sweden)

Taghrid B. El-Abaseri

2007-01-01

Full Text Available The epidermal growth factor receptor (EGFR regulates the proliferation of keratinocytes through multiple mechanisms that differ depending on the localization of the cell within the skin. Ultraviolet (UV irradiation, the main etiologic factor in the development of skin cancer, also activates the receptor. In this review, we discuss how the UV-induced activation of EGFR regulates the response of the skin to UV. UV-induced EGFR activation increases keratinocyte proliferation, suppresses apoptosis, and augments and accelerates epidermal hyperplasia in response to UV. Pharmacological inhibition of the UV-induced activation of EGFR in a genetically initiated mouse skin tumorigenesis model suppresses tumorigenesis and the activation of mitogen-activated protein (MAP kinases and phosphatidyl inositol-3-kinase (PI3K/AKT signaling pathways. EGFR has pleiotropic, complex, and cell-type-specific functions in cutaneous keratinocytes; suggesting that the receptor is an appropriate target for the development of molecularly targeted therapies for skin cancer and other pathologies.

Epidermal characters of Tamarix L. (Tamaricaceae) from Northwest China and their taxonomic and palaeogeographic implications

OpenAIRE

Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan

2018-01-01

The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...

Epidermal growth factor receptor: an independent predictor of survival in astrocytic tumors given definitive irradiation

International Nuclear Information System (INIS)

An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.

1996-01-01

Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas

Effects of epidermal growth factor on bone formation and resorption in vivo

International Nuclear Information System (INIS)

Marie, P.J.; Hott, M.; Perheentupa, J.

1990-01-01

The effects of mouse epidermal growth factor (EGF) on bone formation and resorption were examined in male mice. EGF administration (2-200 ng.g-1.day-1 ip for 7 days) induced a dose-dependent rise in plasma EGF levels that remained within physiological range. Histomorphometric analysis of caudal vertebrae showed that EGF (20 and 200 ng.g-1.day-1) reduced the endosteal matrix and mineral appositional rates after 5 days of treatment as measured by double [3H]proline labeling and double tetracycline labeling, respectively. This effect was transitory and was not observed after 7 days of EGF administration. EGF administered for 7 days induced a dose-dependent increase in the periosteal osteoblastic and tetracycline double-labeled surfaces. At high dosage (200 ng.g-1.day-1) EGF administration increased the osteoclastic surface and the number of acid phosphatase-stained osteoclasts, although plasma calcium remained normal. The results show that EGF administration at physiological doses induces distinct effects on endosteal and periosteal bone formation and that the effects are dependent on EGF dosage and duration of treatment. This study indicates that EGF at physiological dosage stimulates periosteal bone formation and increases endosteal bone resorption in the growing mouse

Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

International Nuclear Information System (INIS)

Han, S.R.

1988-01-01

The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

Fatal Metastatic Cutaneous Squamous Cell Carcinoma Evolving from a Localized Verrucous Epidermal Nevus

Directory of Open Access Journals (Sweden)

Hassan Riad

2013-10-01

Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.

Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

International Nuclear Information System (INIS)

Mosca, Rodrigo Crespo

2014-01-01

The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

Inhibitory effect of cucurbitacin B on imiquimod-induced skin inflammation

Energy Technology Data Exchange (ETDEWEB)

Li, Zheng Jun; Shin, Jung-Min; Choi, Dae-Kyoung; Lim, Seul Ki [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju (Korea, Republic of); Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Sohn, Kyung-Cheol; Im, Myung; Lee, Young; Seo, Young-Joon; Kim, Chang Deok [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Lee, Jeung-Hoon, E-mail: jhoon@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Skin Med Company, Daejeon (Korea, Republic of)

2015-04-17

Psoriasis is a common skin disease, of which pathogenesis involves the increase of inflammatory reaction in epidermal cells. In an attempt to find therapeutics for psoriasis, we found that cucurbitacin B has an inhibitory potential on imiquimod-induced inflammation of keratinocytes. Cucurbitacin B significantly inhibited imiquimod-induced expression of crucial psoriatic cytokines, such as IL-8 and CCL20, via down-regulation of NF-κB and STAT3 signaling pathway in human keratinocytes. In addition, keratinocyte proliferation was markedly inhibited by cucurbitacin B. The potential beneficial effect of cucurbitacin B on psoriasis was further validated in imiquimod-induced psoriasiform dermatitis of experimental animal. Topical application of cucurbitacin B resulted in significant reduction of epidermal hyperplasia and inflammatory cytokines production, and ameliorated the psoriatic symptom. Taken together, these results suggest that cucurbitacin B may be a potential candidate for the treatment of psoriasis. - Highlights: • Cucurbitacin B has a potential for inhibiting the growth of keratinocytes. • Cucurbitacin B inhibits imiquimod-induced inflammatory reaction in keratinocytes. • Cucurbitacin B inhibits imiquimod-induced psoriasiform dermatitis in experimental animal.

Inhibitory effect of cucurbitacin B on imiquimod-induced skin inflammation

International Nuclear Information System (INIS)

Li, Zheng Jun; Shin, Jung-Min; Choi, Dae-Kyoung; Lim, Seul Ki; Yoon, Tae-Jin; Lee, Young Ho; Sohn, Kyung-Cheol; Im, Myung; Lee, Young; Seo, Young-Joon; Kim, Chang Deok; Lee, Jeung-Hoon

2015-01-01

Psoriasis is a common skin disease, of which pathogenesis involves the increase of inflammatory reaction in epidermal cells. In an attempt to find therapeutics for psoriasis, we found that cucurbitacin B has an inhibitory potential on imiquimod-induced inflammation of keratinocytes. Cucurbitacin B significantly inhibited imiquimod-induced expression of crucial psoriatic cytokines, such as IL-8 and CCL20, via down-regulation of NF-κB and STAT3 signaling pathway in human keratinocytes. In addition, keratinocyte proliferation was markedly inhibited by cucurbitacin B. The potential beneficial effect of cucurbitacin B on psoriasis was further validated in imiquimod-induced psoriasiform dermatitis of experimental animal. Topical application of cucurbitacin B resulted in significant reduction of epidermal hyperplasia and inflammatory cytokines production, and ameliorated the psoriatic symptom. Taken together, these results suggest that cucurbitacin B may be a potential candidate for the treatment of psoriasis. - Highlights: • Cucurbitacin B has a potential for inhibiting the growth of keratinocytes. • Cucurbitacin B inhibits imiquimod-induced inflammatory reaction in keratinocytes. • Cucurbitacin B inhibits imiquimod-induced psoriasiform dermatitis in experimental animal

Culture technique of rabbit primary epidermal keratinocytes

Directory of Open Access Journals (Sweden)

Marini M

2012-10-01

Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

NARCIS (Netherlands)

Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

1988-01-01

In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

Science.gov (United States)

Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

2003-12-01

Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

Optimal allocation of leaf epidermal area for gas exchange.

Science.gov (United States)

de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J

2016-06-01

A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.

Phenobarbital indirectly activates the constitutive active androstane receptor (CAR) by inhibition of epidermal growth factor receptor signaling.

Science.gov (United States)

Mutoh, Shingo; Sobhany, Mack; Moore, Rick; Perera, Lalith; Pedersen, Lee; Sueyoshi, Tatsuya; Negishi, Masahiko

2013-05-07

Phenobarbital is a central nervous system depressant that also indirectly activates nuclear receptor constitutive active androstane receptor (CAR), which promotes drug and energy metabolism, as well as cell growth (and death), in the liver. We found that phenobarbital activated CAR by inhibiting epidermal growth factor receptor (EGFR) signaling. Phenobarbital bound to EGFR and potently inhibited the binding of EGF, which prevented the activation of EGFR. This abrogation of EGFR signaling induced the dephosphorylation of receptor for activated C kinase 1 (RACK1) at Tyr(52), which then promoted the dephosphorylation of CAR at Thr(38) by the catalytic core subunit of protein phosphatase 2A. The findings demonstrated that the phenobarbital-induced mechanism of CAR dephosphorylation and activation is mediated through its direct interaction with and inhibition of EGFR.

Staphylococcal scalded skin syndrome in a 4-year-old child: a case report.

Science.gov (United States)

Haasnoot, P J; De Vries, A

2018-01-29

Staphylococcal scalded skin syndrome is an exfoliating skin disease which primarily affects children. Differential diagnosis includes toxic epidermal necrolysis, staphylococcal scalded skin syndrome, epidermolysis bullosa, and Stevens-Johnson syndrome. Staphylococcal scalded skin syndrome primarily affects children and can cause serious morbidity. In this case report we highlight the case of a 4-year-old Caucasian boy. Diagnostic and therapeutic challenges are discussed. Differential diagnoses are considered and therapy is described and discussed. The latest treatment options are used and described. Successful results are achieved in this case due to timely and correct management. Some therapeutic options are widely used without thorough research bases. This case report highlights staphylococcal scalded skin syndrome and its treatment, and future challenges. Further research is warranted and this case report aims to further research in exfoliating skin disorders.

Sulforaphane induces phase II detoxication enzymes in mouse skin and prevents mutagenesis induced by a mustard gas analog

Energy Technology Data Exchange (ETDEWEB)

Abel, E.L. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States); Boulware, S. [Division of Pharmacy and Toxicology, College of Pharmacy, The University of Texas at Austin, Dell Pediatric Research Institute, 1400 Barbara Jordan Blvd., Austin, TX 78723 (United States); Fields, T.; McIvor, E.; Powell, K.L. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States); DiGiovanni, J.; Vasquez, K.M. [Division of Pharmacy and Toxicology, College of Pharmacy, The University of Texas at Austin, Dell Pediatric Research Institute, 1400 Barbara Jordan Blvd., Austin, TX 78723 (United States); MacLeod, M.C., E-mail: mcmacleod@mdanderson.org [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States)

2013-02-01

Mustard gas, used in chemical warfare since 1917, is a mutagenic and carcinogenic agent that produces severe dermal lesions for which there are no effective therapeutics; it is currently seen as a potential terrorist threat to civilian populations. Sulforaphane, found in cruciferous vegetables, is known to induce enzymes that detoxify compounds such as the sulfur mustards that react through electrophilic intermediates. Here, we observe that a single topical treatment with sulforaphane induces mouse epidermal levels of the regulatory subunit of glutamate-cysteine ligase, the rate-limiting enzyme in glutathione biosynthesis, and also increases epidermal levels of reduced glutathione. Furthermore, a glutathione S-transferase, GSTA4, is also induced in mouse skin by sulforaphane. In an in vivo model in which mice are given a single mutagenic application of the sulfur mustard analog 2-(chloroethyl) ethyl sulfide (CEES), we now show that therapeutic treatment with sulforaphane abolishes the CEES-induced increase in mutation frequency in the skin, measured four days after exposure. Sulforaphane, a natural product currently in clinical trials, shows promise as an effective therapeutic against mustard gas. -- Highlights: ► Sulforaphane induces increased levels of glutathione in mouse skin. ► Sulforaphane induces increased levels of GSTA4 in mouse skin. ► Sulforaphane, applied after CEES-treatment, completely abolishes CEES-mutagenesis. ► The therapeutic effect may suggest a long biological half-life for CEES in vivo.

Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

Science.gov (United States)

Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

2013-01-01

Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

Internalization mechanisms of the epidermal growth factor receptor after activation with different ligands.

Directory of Open Access Journals (Sweden)

Lasse Henriksen

Full Text Available The epidermal growth factor receptor (EGFR regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF and transforming growth factor-α (TGF-α. For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF or betacellulin (BTC was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown.

Internalization Mechanisms of the Epidermal Growth Factor Receptor after Activation with Different Ligands

Science.gov (United States)

Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther

2013-01-01

The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148

Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

Directory of Open Access Journals (Sweden)

Jinyang Wang

2018-05-01

Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

Inflammatory linear verrucous epidermal naevus: Report of three ...

African Journals Online (AJOL)

Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

Steroid hormone and epidermal growth factor receptors in meningiomas.

Science.gov (United States)

Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R

1989-11-01

A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.

Assessment of the Developmental Toxicity of Epidermal Growth ...

African Journals Online (AJOL)

Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

Science.gov (United States)

Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

2015-09-01

Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

Science.gov (United States)

Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

2018-01-01

The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

The epidermal biosynthesis of cholecalciferol (vitamin D3)

International Nuclear Information System (INIS)

Beadle, P.C.

1977-01-01

An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

Comparative SEM and LM foliar epidermal and palyno-morphological studies of Amaranthaceae and its taxonomic implications.

Science.gov (United States)

Hussain, Amara Noor; Zafar, Muhammad; Ahmad, Mushtaq; Khan, Raees; Yaseen, Ghulam; Khan, Muhammad Saleem; Nazir, Abdul; Khan, Amir Muhammad; Shaheen, Shabnum

2018-05-01

Palynological features as well as comparative foliar epidermal using light and scanning electron microscope (SEM) of 17 species (10genera) of Amaranthaceae have been studied for its taxonomic significance. Different foliar and palynological micro-morphological characters were examined to explain their value in resolving the difficulty in identification. All species were amphistomatic but stomata on abaxial surface were more abundant. Taxonomically significant epidermal character including stomata type, trichomes (unicellular, multicellular, and capitate) and epidermal cells shapes (polygonal and irregular) were also observed. Pollens of this family are Polypantoporate, pores large, spheroidal, mesoporous region is sparsely to scabrate, densely psilate, and spinulose. All these characters can be active at species level for identification purpose. This study indicates that at different taxonomic levels, LM and SEM pollen and epidermal morphology is explanatory and significant to identify species and genera. © 2018 Wiley Periodicals, Inc.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae

Directory of Open Access Journals (Sweden)

René Hans-Jürgen Heim

2015-12-01

Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.

Adrenergic effects on renal secretion of epidermal growth factor in the rat

DEFF Research Database (Denmark)

Poulsen, Steen Seier; Nexø, Ebba

1985-01-01

Urinary epidermal growth factor (EGF) has been demonstrated recently to originate from the kidneys. The present study was undertaken to investigate the adrenergic and cholinergic influence on secretion of renal EGF. beta-Adrenergic agonists increased the level of urinary EGF, while propranolol......, a beta-adrenergic blocking agent, decreased basal and beta-adrenergic stimulated total output of urinary EGF. Acetylcholine and the anticholinergic agent atropine had no effect on the output of EGF in urine. Also chemical sympathectomy induced by 6-hydroxydopamine reduced the urinary output of EGF. None...... of the experimental groups had a median serum concentration above the detection limit of the assay. The present study shows that secretion of renal EGF is under the influence of the sympathetic nervous system and release of EGF is stimulated by activation of beta-adrenergic receptors in the kidneys....

Does epidermal growth factor play a role in the action of sucralfate?

DEFF Research Database (Denmark)

Nexø, Ebba; Poulsen, Steen Seier

1987-01-01

Epidermal growth factor (EGF) is a mitogenic peptide synthesized in the submandibular glands and released in saliva. EGF is able to prevent the development of gastrointestinal ulcers in the rat and to accelerate their healing. The present work was undertaken to examine whether Sucralfate acts via...... the effector system of EGF. We conclude that Sucralfate does not change the binding of EGF to its receptor, but it is able to bind EGF in a pH dependent manner and at pH below 4.5 virtually all EGF is bound to Sucralfate. In vivo studies in rats with acid-induced gastric ulcers show that sucralfate carries EGF...... to the ulcer, and that EGF is available for a longer period of time (3 hours) when EGF and Sucralfate are is given together than when EGF is given alone....

Clinical Studies on conformal radiotherapy combined with epidermal ...

African Journals Online (AJOL)

Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

Fatty acids are required for epidermal permeability barrier function.

Science.gov (United States)

Mao-Qiang, M; Elias, P M; Feingold, K R

1993-08-01

The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

Epidermal growth factor receptor expression in urinary bladder cancer

Directory of Open Access Journals (Sweden)

Dayalu S.L. Naik

2011-01-01

Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

Predicting human epidermal melanin concentrations for different skin tones

CSIR Research Space (South Africa)

Smit, Jacoba E

2011-07-01

Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma

Directory of Open Access Journals (Sweden)

J Gordon Millichap

2013-01-01

Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.

Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...

African Journals Online (AJOL)

ADOWIE PERE

ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...

TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.

Science.gov (United States)

Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina

2012-10-01

Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.

Autodegradation of 125I-labeled human epidermal cell surface proteins

International Nuclear Information System (INIS)

Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

1982-01-01

Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

DEFF Research Database (Denmark)

Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

2003-01-01

alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

International Nuclear Information System (INIS)

Hanson, D.; DeLeo, V.

1990-01-01

Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

Ultrathin epidermal strain sensor based on an elastomer nanosheet with an inkjet-printed conductive polymer

Science.gov (United States)

Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori

2017-08-01

To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.

Pigmented epidermal cyst with dense collection of melanin: A rare entity - Report of a case with review of the literature.

Science.gov (United States)

Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald

2012-05-01

Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.

Stimulation of allogeneic lymphocytes by skin epidermal cells in the rat

International Nuclear Information System (INIS)

Tanaka, S.; Sakai, A.

1979-01-01

The ability of skin epidermal cells to induce allogeneic lymphocytes into proliferation was examined in mixed skin cell-lymphocyte culture reaction (MSLR). The stimulatng capacity of skin cells was reduced significantly by trypsin digestion, although the damage was repaired by incubation at 37 C for 3 hr. The optimal concentration of mitomycin C for treatment of stimulating cells in the MSLR differed from that in mixed lymphocyte culture reaction (MLR). Irradiation rendered them three to four times more stimulatory than did mitomycin C. Removal of adherent cells from responding cells by passage through a nylon-wool column gave a substantial elevation of the MSLR. The lymphocytes cocultured with skin cells in the primary MSLR incorporated 3 H-thymidine, with the peak at the 6th day of culture. If the lymphocytes primed in the MSLR were restimulated with skin cells from the same stimulating strain, the primed lymphocytes responded promptly and in great magnitude

Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

International Nuclear Information System (INIS)

Wakshull, E.; Kraemer, P.M.; Wharton, W.

1985-01-01

Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

Directory of Open Access Journals (Sweden)

Yira Bermudez

Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

Radiologic Findings of Epidermal Cysts in the Trunk

International Nuclear Information System (INIS)

Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi

2005-01-01

To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan

Analysis of Epidermal Growth Factor Receptor Related Gene Expression Changes in a Cellular and Animal Model of Parkinson’s Disease

Directory of Open Access Journals (Sweden)

In-Su Kim

2017-02-01

Full Text Available We employed transcriptome analysis of epidermal growth factor receptor related gene expression changes in cellular and animal models of Parkinson’s disease (PD. We used a well-known Parkinsonian toxin 1-methyl-4-phenylpyridine (MPP+ to induce neuronal apoptosis in the human neuroblastoma SH-SY5Y cell line. The MPP+-treatment of SH-SY5Y cells was capable of inducing neuro-apoptosis, but it remains unclear what kinds of transcriptional genes are affected by MPP+ toxicity. Therefore the pathways that were significantly perturbed in MPP+ treated human neuroblastoma SH-SY5Y cells were identified based on genome-wide gene expression data at two time points (24 and 48 h. We found that the Epidermal Growth Factor Receptor (EGFR pathway-related genes showed significantly differential expression at all time points. The EGFR pathway has been linked to diverse cellular events such as proliferation, differentiation, and apoptosis. Further, to evaluate the functional significance of the altered EGFR related gene expression observed in MPP+-treated SH-SY5Y cells, the EGFR related GJB2 (Cx26 gene expression was analyzed in an MPP+-intoxicated animal PD model. Our findings identify that the EGFR signaling pathway and its related genes, such as Cx26, might play a significant role in dopaminergic (DAergic neuronal cell death during the process of neuro-apoptosis and therefore can be focused on as potential targets for therapeutic intervention.

Identification of grazed grasses using epidermal characters | R ...

African Journals Online (AJOL)

The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...

Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.

Science.gov (United States)

Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi

2005-02-25

Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.

Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

Directory of Open Access Journals (Sweden)

Naser Tayyebi Meibodi

2011-01-01

Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

Growth of melanocytes in human epidermal cell cultures

International Nuclear Information System (INIS)

Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

1990-01-01

Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

Inhibition of Neoplastic Transformation and Chemically-Induced Skin Hyperplasia in Mice by Traditional Chinese Medicinal Formula Si-Wu-Tang

Directory of Open Access Journals (Sweden)

Mandy M. Liu

2017-03-01

Full Text Available Exploring traditional medicines may lead to the development of low-cost and non-toxic cancer preventive agents. Si-Wu-Tang (SWT, comprising the combination of four herbs, Rehmanniae, Angelica, Chuanxiong, and Paeoniae, is one of the most popular traditional Chinese medicines for women’s diseases. In our previous studies, the antioxidant Nrf2 pathways were strongly induced by SWT in vitro and in vivo. Since Nrf2 activation has been associated with anticarcinogenic effects, the purpose of this study is to evaluate SWT’s activity of cancer prevention. In the Ames test, SWT demonstrated an antimutagenic activity against mutagenicity induced by the chemical carcinogen 7,12-dimethylbenz(aanthracene (DMBA. In JB6 P+ cells, a non-cancerous murine epidermal model for studying tumor promotion, SWT inhibited epidermal growth factor (EGF-induced neoplastic transformation. The luciferase reporter gene assays demonstrated that SWT suppressed EGF-induced AP-1 and TNF-α-induced NF-κB activation, which are essential factors involved in skin carcinogenesis. In a DMBA-induced skin hyperplasia assay in ‘Sensitivity to Carcinogenesis’ (SENCAR mice, both topical and oral SWT inhibited DMBA-induced epidermal hyperplasia, expression of the proliferation marker Proliferating cell nuclear antigen (PCNA, and H-ras mutations. These findings demonstrate, for the first time, that SWT prevents tumor promoter and chemical-induced carcinogenesis in vitro and in vivo, partly by inhibiting DNA damage and blocking the activation of AP-1 and NF-κB.

Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

Science.gov (United States)

Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

2018-02-01

Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Epidermal growth factor and active caspase-3 expression in the levator ani muscle of dogs with and without perineal hernia.

Science.gov (United States)

Pérez-Gutiérrez, J F; Argüelles, J C; Iglesias-Núñez, M; Oliveira, K S; De La Muela, M Sánchez

2011-07-01

To perform a histological and immunohistochemical study of epidermal growth factor, transforming growth factor-alpha and their receptor, as well as the apoptotic signal active caspase-3 in the levator ani muscle of dogs with and without perineal hernia. Biopsy specimens of the levator ani muscle were obtained from 25 dogs with perineal hernia and 4 non-affected dogs and were processed for Masson and immunohistochemical staining. The affected dogs exhibited myopathological features, internalised nuclei, destruction and abnormal size of muscle fibres, which were replaced by collagen. The immunohistochemical study revealed active caspase-3, epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor in the levator ani. Compared to the healthy muscle, transforming growth factor-alpha staining intensity was lower in the affected muscle, whereas epidermal growth factor receptor and active caspase-3 staining were higher. Pelvic diaphragm muscle weakening is the leading cause of perineal hernia in the dog. Survival and death signals expressed in these muscles may contribute to the pathogenesis of this disease. This study reports epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor immunohistochemical expression in the skeletal muscle and suggests that perineal hernia in the dog is accompanied by levator ani muscle atrophy, increased expression of epidermal growth factor receptor, caspase-3 activation, and decreased expression of transforming growth factor-alpha. © 2011 British Small Animal Veterinary Association.

Morphometric analysis of epidermal differentiation in primary roots of Zea mays

Science.gov (United States)

Moore, R.; Smith, H. S.

1990-01-01

Epidermal differentiation in primary roots of Zea mays was divided into six cell types based on cellular shape and cytoplasmic appearance. These six cell types are: 1) apical protoderm, located at the tip of the root pole and characterized by periclinally flattened cells; 2) cuboidal protoderm, located approximately 230 microns from the root pole and characterized by cuboidal cells; 3) tabular epidermis, located approximately 450 microns from the root pole and characterized by anticlinally flattened cells; 4) cuboidal epidermis, located approximately 900 microns from the root pole and characterized by cuboidal cells having numerous small vacuoles; 5) vacuolate cuboidal epidermis, located approximately 1,500 microns from the root pole and characterized by cuboidal cells containing several large vacuoles; and 6) columnar epidermis, located approximately 2,200 microns from the root pole (i.e., at the beginning of the zone of elongation) and characterized by elongated cells. We also used stereology to quantify the cellular changes associated with epidermal differentiation. The quiescent center and the apical protoderm have significantly different ultrastructures. The relative volume of dictyosomes increases dramatically during the early stages of epidermal differentiation. This increase correlates inversely with the amount of coverage provided by the root cap and mucilage.

Identification and comparative analysis of the epidermal differentiation complex in snakes

Science.gov (United States)

Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

2017-01-01

The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630

Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

Science.gov (United States)

Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

2013-02-01

Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

Pattern of hormone receptors and human epidermal growth factor ...

African Journals Online (AJOL)

Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

Epidermal growth factor regulation of glutathione S-transferase gene expression in the rat is mediated by class Pi glutathione S-transferase enhancer I.

OpenAIRE

Matsumoto, M; Imagawa, M; Aoki, Y

2000-01-01

Using chloramphenicol acetyltransferase assays we showed that epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha), and 3,3',4,4',5-pentachlorobiphenyl (PenCB) induce class Pi glutathione S-transferase (GSTP1) in primary cultured rat liver parenchymal cells. GSTP1 enhancer I (GPEI), which is required for the stimulation of GSTP1 expression by PenCB, also mediates EGF and TGF alpha stimulation of GSTP1 gene expression. However, hepatocyte growth factor and insulin did no...

Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

KAUST Repository

Cai, Yichen

2017-06-16

Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

KAUST Repository

Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

2017-01-01

Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations.

Directory of Open Access Journals (Sweden)

Béatrice Marquèze-Pouey

Full Text Available Signaling mediated by the epidermal growth factor (EGF is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer. In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations.

Science.gov (United States)

Marquèze-Pouey, Béatrice; Mailfert, Sébastien; Rouger, Vincent; Goaillard, Jean-Marc; Marguet, Didier

2014-01-01

Signaling mediated by the epidermal growth factor (EGF) is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer). In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar) concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

Innate sensing of microbial products promotes wound-induced skin cancer

Science.gov (United States)

Hoste, Esther; Arwert, Esther N.; Lal, Rohit; South, Andrew P.; Salas-Alanis, Julio C.; Murrell, Dedee F.; Donati, Giacomo; Watt, Fiona M.

2015-01-01

The association between tissue damage, chronic inflammation and cancer is well known. However, the underlying mechanisms are unclear. Here we characterize a mouse model in which constitutive epidermal extracellular-signal-regulated kinase-MAP-kinase signalling results in epidermal inflammation, and skin wounding induces tumours. We show that tumour incidence correlates with wound size and inflammatory infiltrate. Ablation of tumour necrosis factor receptor (TNFR)-1/-2, Myeloid Differentiation primary response gene 88 or Toll-like receptor (TLR)-5, the bacterial flagellin receptor, but not other innate immune sensors, in radiosensitive leukocytes protects against tumour formation. Antibiotic treatment inhibits, whereas injection of flagellin induces, tumours in a TLR-5-dependent manner. TLR-5 is also involved in chemical-induced skin carcinogenesis in wild-type mice. Leukocytic TLR-5 signalling mediates upregulation of the alarmin HMGB1 (High Mobility Group Box 1) in wound-induced papillomas. HMGB1 is elevated in tumours of patients with Recessive Dystrophic Epidermolysis Bullosa, a disease characterized by chronic skin damage. We conclude that in our experimental model the combination of bacteria, chronic inflammation and wounding cooperate to trigger skin cancer. PMID:25575023

Photoprotection against the UVB-induced oxidative stress and epidermal damage in mice using leaves of three different varieties of Lepidium meyenii (maca).

Science.gov (United States)

Gonzales-Castañeda, Cynthia; Rivera, Valery; Chirinos, Ana Lucía; Evelson, Pablo; Gonzales, Gustavo Francisco

2011-08-01

Skin exposure to ultraviolet (UV) B radiation leads to epidermal damage and generation of reactive oxygen species. The photoprotective effect of extracts of three varieties of leaves (red, yellow, and black) from maca (Lepidium meyenii), a plant from the Peruvian highlands, was assessed in mouse skin exposed to UVB radiation. The hydroalcoholic extracts of three varieties of maca leaves were applied topically to the dorsal skin of young-adult male mice prior to exposition to UVB radiation. The three varieties had UVA/UVB absorptive properties and presented antioxidant activity, being highest with red maca, followed by black and yellow maca. The three varieties of maca leaves prevented the development of sunburn cells, epidermal hyperplasia, leukocytic infiltration, and other alterations produced by UVB radiation. Mice treated with black maca showed the highest superoxide dismutase levels, and mice treated with black and yellow maca showed higher catalase levels in skin, whereas red maca protected the skin and liver against significant increases in the lipid peroxidation activity observed in the unprotected animals. The presence of significant antioxidant activity and the inhibition of lipid peroxidation suggest that the observed protection could be partly attributable to this mechanism. © 2011 The International Society of Dermatology.

Hesperetin induces melanin production in adult human epidermal melanocytes.

Science.gov (United States)

Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

2015-06-01

One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

Epidermal response of rainbow trout to Ichthyobodo necator

DEFF Research Database (Denmark)

Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar

2014-01-01

Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...

Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

DEFF Research Database (Denmark)

Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

2009-01-01

BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

Effect of photo-immobilization of epidermal growth factor on the cellular behaviors

International Nuclear Information System (INIS)

Ogiwara, Kazutaka; Nagaoka, Masato; Cho, Chong-Su; Akaike, Toshihiro

2006-01-01

We constructed photo-reactive epidermal growth factor (EGF) bearing p-azido phenylalanine at the C-terminal (HEGFP) by genetic engineering to investigate the possibility of immobilized EGF as a novel artificial extracellular matrix (ECM). The constructed recombinant protein was immobilized to glass surface by ultraviolet irradiation. A431 cells adhered both to HEGFP-immobilized and collagen-coated surfaces. Interaction between immobilized HEGFP and EGF receptors in the A431 cells was independent of Mg 2+ although integrin-mediated cell adhesion to natural ECMs is dependent on Mg 2+ . Phosphorylation of EGF receptors in A431 cells was induced by immobilized HEGFP as same as soluble EGF. DNA uptake of hepatocytes decreased by immobilized HEGFP whereas it increased by soluble EGF. Liver-specific functions of hepatocytes were maintained for 3 days by immobilized HEGFP whereas they were not maintained by soluble EGF, indicating that immobilized HEGFP follows different signal transduction pathway from soluble EGF

Bacteriological examination of inflamed epidermal cysts: a survey between 2008 and 2009 at a hospital in southern Taiwan

Directory of Open Access Journals (Sweden)

Yen-Hsi Liu

2010-09-01

Conclusions: Both aerobic and anaerobic microorganisms were present in the inflamed epidermal cysts, although the anaerobic bacteria, specifically, Propionibacterium spp and Peptostreptococcus spp, were isolated slightly more frequently. Antibiotics directed against anaerobes may be considered in the treatment regimen for inflamed epidermal cysts.

Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

Science.gov (United States)

Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

2006-08-01

Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

Science.gov (United States)

Bolívar-Flores, Y J; Kuri-Harcuch, W

1999-08-01

Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

Science.gov (United States)

Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

2015-06-01

Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

Grafting of human epidermal cells, presence and perspectives

Czech Academy of Sciences Publication Activity Database

Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

2001-01-01

Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

Tumores dermóides e epidermóides intra-espinhas

Directory of Open Access Journals (Sweden)

Oscar Fontenelle Filho

1971-03-01

Full Text Available São relatados dois casos de tumores epidermóides e um de tumor dermóide, todos intrarraquianos. Este último era de localização epidural ao nível da coluna torácica (caso 3; os dois tumores epidermóides situavam-se na coluna tóraco-lombar (caso 1 e lombar (caso 2, respectivamente, sendo o primeiro intramedular e o segundo intradural. Em dois casos (casos 2 e 3 os tumores associavam-se a fístula dérmica congênita. Um paciente (caso 3 foi operado aos dois meses de idade; a descoberta do tumor deveu-se à realização da raquimanometria que revelou bloqueio, apesar do paciente não apresentar qualquer sinal neurológico de compressão medular. Os autores são de opinião que, em presença de fístula dérmica congênita ao nível da coluna vertebral, principalmente quando localizada acima do segmento lombosacro, deve-se sempre suspeitar da possibilidade do tumor epidermóide ou dermóide intrarraquiano, mesmo na ausência de sinais neurológicos. A combinação de sintomas neurológicos de longa duração, a evidência radiológica de erosão e alargamento do canal raquiano e a história de fístula dérmica congênita proporcionaram o diagnóstico pré-operatório correto no caso 2.

Role of submandibular saliva and epidermal growth factor in gastric cytoprotection

DEFF Research Database (Denmark)

Poulsen, Steen Seier

1984-01-01

without submandibular glands. Exogenous EGF and saliva with a high but still physiological concentration of EGF significantly reduced the median area in the stomach displaying ulcers and ulcerations, whereas saliva without EGF had no effect. Although EGF is a known inhibitor of gastric acid secretion......The role of submandibular epidermal growth factor in protection of the gastric mucosa was investigated in rats. Removal of the submandibular glands and thereby submandibular epidermal growth factor (EGF) caused rats to develop gastric lesions (ulcerations and ulcers) after administration......, the dose used in the present study had no effect on gastric acid secretion in chronic gastric fistula rats; removal of the submandibular glands also did not have any such effect. We conclude that exocrine secretion of submandibular EGF has a cytoprotective function in the stomach, an effect that may...

Radiator-induced erythema ab igne in 8-year-old girl.

Science.gov (United States)

Brzezinski, Piotr; Ismail, Samir; Chiriac, Anca

2014-04-01

The cutaneous lesion of erythema ab Igne are characterized by a reticulate erythema, hyperpigmentation, fine scaling, epidermal atrophy and telangiectasias, and reticulated erythema. We report a case of erythema ab igne on the hands of a 8-year-old girl, induced by classic homemade radiator.

Epidermal Expression and Regulation of Interleukin-33 during Homeostasis and Inflammation: Strong Species Differences.

Science.gov (United States)

Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis

2015-07-01

IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.

Epidermal hydration levels in rosacea patients improve after minocycline therapy.

LENUS (Irish Health Repository)

Ní Raghallaigh, S

2013-12-06

Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.

TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

Directory of Open Access Journals (Sweden)

Aurélie Hayez

Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants

International Nuclear Information System (INIS)

Nishida, K.; Roksandic, Z.; Osmond, B.

1981-01-01

The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon

Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

Science.gov (United States)

Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

2016-01-01

To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

Epidermal protection with cryogen spray cooling during high fluence pulsed dye laser irradiation: an ex vivo study.

Science.gov (United States)

Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B

2000-01-01

Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.

Intercellular Communication between Keratinocytes and Fibroblasts Induces Local Osteoclast Differentiation: a Mechanism Underlying Cholesteatoma-Induced Bone Destruction.

Science.gov (United States)

Iwamoto, Yoriko; Nishikawa, Keizo; Imai, Ryusuke; Furuya, Masayuki; Uenaka, Maki; Ohta, Yumi; Morihana, Tetsuo; Itoi-Ochi, Saori; Penninger, Josef M; Katayama, Ichiro; Inohara, Hidenori; Ishii, Masaru

2016-06-01

Bone homeostasis is maintained by a balance in activity between bone-resorbing osteoclasts and bone-forming osteoblasts. Shifting the balance toward bone resorption causes osteolytic bone diseases such as rheumatoid arthritis and periodontitis. Osteoclast differentiation is regulated by receptor activator of nuclear factor κB ligand (RANKL), which, under some pathological conditions, is produced by T and B lymphocytes and synoviocytes. However, the mechanism underlying bone destruction in other diseases is little understood. Bone destruction caused by cholesteatoma, an epidermal cyst in the middle ear resulting from hyperproliferation of keratinizing squamous epithelium, can lead to lethal complications. In this study, we succeeded in generating a model for cholesteatoma, epidermal cyst-like tissue, which has the potential for inducing osteoclastogenesis in mice. Furthermore, an in vitro coculture system composed of keratinocytes, fibroblasts, and osteoclast precursors was used to demonstrate that keratinocytes stimulate osteoclast differentiation through the induction of RANKL in fibroblasts. Thus, this study demonstrates that intercellular communication between keratinocytes and fibroblasts is involved in the differentiation and function of osteoclasts, which may provide the molecular basis of a new therapeutic strategy for cholesteatoma-induced bone destruction. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

NARCIS (Netherlands)

M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

1997-01-01

textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

Metabolic epidermal necrosis in two dogs with different underlying diseases.

Science.gov (United States)

Bond, R; McNeil, P E; Evans, H; Srebernik, N

1995-05-06

Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.

The immigration delay disease: adermatoglyphia-inherited absence of epidermal ridges.

Science.gov (United States)

Burger, Bettina; Fuchs, Dana; Sprecher, Eli; Itin, Peter

2011-05-01

In the digital age, personal identification by fingerprints (epidermal ridges) has become more frequent and is often required for biometric passports. The more fingerprints are analyzed, the more variants in their formation are documented. Individuals completely missing fingerprints as an isolated finding are extremely rare. Only 4 kindreds have been described to date, with additional clinical features in most cases. We describe a female patient with missing epidermal ridges on the fingers, palms, toes, and soles as an isolated feature. Absent fingerprints, or adermatoglyphia, were inherited over 4 generations of her family in an autosomal dominant fashion. We present the clinical features of the index patient, and compare the case with previous reports in the literature. Because of problems in personal identification, this embryologic malformation caused the patient significant difficulties when traveling to other countries, which is why we name it the immigration delay disease. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

Immunohistochemical localization of epidermal growth factor in rat and man

DEFF Research Database (Denmark)

Poulsen, Steen Seier; Nexø, Ebba

1986-01-01

Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

Conformable liquid metal printed epidermal electronics for smart physiological monitoring and simulation treatment

Science.gov (United States)

Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing

2018-03-01

Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.

A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

Science.gov (United States)

Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

2016-10-01

Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

International Nuclear Information System (INIS)

Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

1997-01-01

This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

Science.gov (United States)

Laporta, Robert F.; Taichman, Lorne B.

1982-06-01

Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

Epidermal nevus syndrome associated with unusual neurological, ocular, and skeletal features

Directory of Open Access Journals (Sweden)

Reena Sharma

2012-01-01

Full Text Available Epidermal nevus syndrome (ENS is a rare disease, the pathogenesis of which is largely elusive. We, hereby, report an exclusive case of a 20-year-old man with verrucous ENS presented with dark colored papules and plaques along the Blaschko′s lines present over the head and neck area along with fleshy growth in both eyes since birth. Limb length discrepancy and kyphoscoliosis were remarkable. Skin biopsy was compatible with verrucous epidermal nevus while the biopsy of the ocular lesion confirmed complex choristoma. MRI brain revealed calcification in the right temporal lobe. Bilateral arachnoid cyst in the middle cranial fossa, scleral osteoma in the posterior part of the right eyeball, and deformed calvarium were evident on CECT skull and orbit. The present illustration emphasizes the importance of a punctilious work up of the case.

99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.

Science.gov (United States)

Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad

2017-04-01

Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.

Preparation of epidermal growth factor (EGF) conjugated iron oxide nanoparticles and their internalization into colon cancer cells

International Nuclear Information System (INIS)

Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos

2010-01-01

Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.

Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

DEFF Research Database (Denmark)

Boone, Marc; Draye, Jean Pierre; Verween, Gunther

2014-01-01

While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...

Genetically induced cell death in bulge stem cells reveals their redundancy for hair and epidermal regeneration.

Science.gov (United States)

Driskell, Iwona; Oeztuerk-Winder, Feride; Humphreys, Peter; Frye, Michaela

2015-03-01

Adult mammalian epidermis contains multiple stem cell populations in which quiescent and more proliferative stem and progenitor populations coexist. However, the precise interrelation of these populations in homeostasis remains unclear. Here, we blocked the contribution of quiescent keratin 19 (K19)-expressing bulge stem cells to hair follicle formation through genetic ablation of the essential histone methyltransferase Setd8 that is required for the maintenance of adult skin. Deletion of Setd8 eliminated the contribution of bulge cells to hair follicle regeneration through inhibition of cell division and induction of cell death, but the growth and morphology of hair follicles were unaffected. Furthermore, ablation of Setd8 in the hair follicle bulge blocked the contribution of K19-postive stem cells to wounded epidermis, but the wound healing process was unaltered. Our data indicate that quiescent bulge stem cells are dispensable for hair follicle regeneration and epidermal injury in the short term and support the hypothesis that quiescent and cycling stem cell populations are equipotent. © 2014 AlphaMed Press.

Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

Energy Technology Data Exchange (ETDEWEB)

Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

2017-02-01

Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

Gastric luminal epidermal growth factor is affected by diet | Iputo ...

African Journals Online (AJOL)

Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...

Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.

Science.gov (United States)

Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira

2012-03-01

As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.

Sunscreen protection against ultraviolet radiation-induced pyrimidine dimers in mouse epidermal DNA

International Nuclear Information System (INIS)

Ley, R.D.

1997-01-01

Solar ultraviolet radiation (UVR) induces a number of pathologic conditions of mammalian skin including erythema, oedema, hyperplasia, sunburn cell formation and skin cancer. Consequently, UVR-induced DNA damage has been implicated as one of the photochemical events that results in the formation of these pathological changes. The ability of sunscreens to protect against UVR-induced DNA damage has not been well characterized especially with UVA (320-400 nm) wavelengths and UVA absorbers. In this paper we present results of a study aimed at determining the efficacy of two sunscreens at preventing the induction of pyrmidine dimers in basal cell DNA of mice exposed to solar-simulated UVR (SSUV) wavelengths (290-400 nm) or to UVA (320-400 nm). (author)

Sunscreen protection against ultraviolet radiation-induced pyrimidine dimers in mouse epidermal DNA

Energy Technology Data Exchange (ETDEWEB)

Ley, R.D. [The Lovelace Institutes, Albuqeurque, NM (United States). Photomdecine Program; Fourtanier, A. [L`Oreal, Advanced Research, Clichy (France)

1997-06-01

Solar ultraviolet radiation (UVR) induces a number of pathologic conditions of mammalian skin including erythema, oedema, hyperplasia, sunburn cell formation and skin cancer. Consequently, UVR-induced DNA damage has been implicated as one of the photochemical events that results in the formation of these pathological changes. The ability of sunscreens to protect against UVR-induced DNA damage has not been well characterized especially with UVA (320-400 nm) wavelengths and UVA absorbers. In this paper we present results of a study aimed at determining the efficacy of two sunscreens at preventing the induction of pyrmidine dimers in basal cell DNA of mice exposed to solar-simulated UVR (SSUV) wavelengths (290-400 nm) or to UVA (320-400 nm). (author).

Expression and analysis of exogenous proteins in epidermal cells.

Science.gov (United States)

Dagnino, Lina; Ho, Ernest; Chang, Wing Y

2010-01-01

In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

"Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.

Science.gov (United States)

Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu

2015-11-04

Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Proton extrusion is an essential signalling component in the HR of epidermal single cells in the barley-powdery mildew interaction

DEFF Research Database (Denmark)

Zhou, F.S.; Andersen, C.H.; Burhenne, K.

2000-01-01

We propose a model for activation of the epidermal cell hypersensitive response (HR) in the barley/powdery mildew interaction. The model suggests that the plasma membrane proton pump (H+-ATPase) of epidermal cells is activated following penetration by an avirulent powdery mildew fungus...... in the incompatible interaction; (4) race-specific proton extrusion is observed underneath epidermal tissue detached from leaves inoculated 15 h earlier; and (5) treatment of leaves with fusicoccin, an activator of the plasma membrane H+-ATPase, increases the number of HR-cells in the compatible interaction........ This will cause an acidification of the apoplast towards the mesophyll cells, thereby activating generation of H2O2 from the mesophyll, which subsequently triggers the epidermal cell to undergo HR. The model is supported by the following data: (1) the earliest HR-related H2O2 is found in the attachment zones...

Immunohistochemical differentiation between inflammatory linear verrucous epidermal nevus (ILVEN) and psoriasis.

NARCIS (Netherlands)

Vissers, W.H.P.M.; Muys, L.; Erp, P.E.J. van; Jong, E.M.G.J. de; Kerkhof, P.C.M. van de

2004-01-01

Inflammatory linear verrucous epidermal nevus (ILVEN) is a rare skin disorder with a clinical and histological resemblance to psoriasis. In the past clinical and histological criteria have been defined. However, there remains a discussion as to whether ILVEN is a disease entity distinct from linear

Amplification of epidermal growth factor receptor gene in renal cell carcinoma

DEFF Research Database (Denmark)

El-Hariry, Iman; Powles, Thomas; Lau, Mike R

2010-01-01

Expression of epidermal growth factor receptor (EGFR) may be of prognostic value in renal cell cancer (RCC). Gene amplification of EGFR was investigated in a cohort of 315 patients with advanced RCC from a previously reported randomised study. Using fluorescent in situ hybridisation, only 2...

Epidermal growth factor inhibits rat pancreatic cell proliferation, causes acinar cell hypertrophy, and prevents caerulein-induced desensitization of amylase release.

Science.gov (United States)

Morisset, J; Larose, L; Korc, M

1989-06-01

The in vivo effects of epidermal growth factor (EGF) on pancreatic growth and digestive enzyme concentrations were compared with the actions of the pancreatic secretagogue caerulein in the adult rat. EGF (10 micrograms/kg BW) did not alter pancreatic weight or protein content. However, this concentration of EGF inhibited [3H]thymidine incorporation into DNA by 44%, decreased DNA content by 20%, and increased the concentrations of amylase, chymotrypsinogen, and protein by 106%, 232%, and 42%, respectively. Pancreatic acini prepared from EGF-treated rats exhibited a characteristic secretory response to caerulein that was superimposable to that obtained in acini from saline-treated rats. In both groups of acini half-maximal and maximal stimulation of amylase release occurred at approximately 5 pM and 50 pM caerulein, respectively. In contrast to EGF, caerulein (1 microgram/kg BW) increased pancreatic weight by 29% and protein content by 59%, and enhanced [3H]thymidine incorporation into DNA by 70%. Although caerulein increased the concentrations of pancreatic amylase and chymotrypsinogen by 38% and 297%, respectively, pancreatic acini prepared from caerulein-treated rats were less sensitive to the actions of caerulein in vitro when compared with acini from control rats. Indeed, the EC50 was shift from 4.8 pM to 9.8 pM after 4 days of treatment. EGF potentiated the actions of caerulein on pancreatic weight, protein content, and chymotrypsinogen concentration, and prevented the caerulein-induced alteration in the secretory responsiveness of the acinar cell. Conversely, caerulein reversed the inhibitory effect of EGF on thymidine incorporation. These findings suggest that EGF may modulate the trophic effects of certain gastrointestinal hormones, and may participate in the regulation of pancreatic exocrine function in vivo.

Trastuzumab-induced pulmonaryfibrosis: A case report and review of literature

OpenAIRE

Tamojit Chaudhuri; Saurabh Karmakar

2012-01-01

Optimal treatment for human epidermal growth factor receptor 2 (HER2)/neu-positive, node-positive early breast cancer should include the monoclonal antibody trastuzumab. This relatively new targeted agent has shown very limited pulmonary toxicity. We report a case of Trastuzumab-induced pulmonary fibrosis in a 41-year-old female that occurred 4 months after starting adjuvant trastuzumab. To the best of our knowledge, this is the first ever report of trastuzumab-induced pulmonary fibrosis in t...

Effect of vasoactive intestinal polypeptide and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands

DEFF Research Database (Denmark)

Poulsen, Steen Seier

1984-01-01

The effect of VIP and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands was investigated in the rat. Vasoactive intestinal polypeptide infused in doses of 10 and 100 ng/kg/h significantly increased epidermal growth factor and bicarbonate output......, but the concentrations did not change. Somatostatin infused at doses of 1, 10, 100 and 1000 ng/kg/h against a background of VIP 100 ng/kg/h inhibited in dose-dependent fashion the stimulated epidermal growth factor and bicarbonate outputs from rat Brunner's gland pouches. Also basal secretion was inhibited...... growth factor and bicarbonate from Brunner's glands, an effect which is inhibited by somatostatin. A possible role for somatostatin in the control of Brunner's gland secretion is suggested....

Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

Science.gov (United States)

Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

Radiation-Induced Esophagitis In Vivo and In Vitro Reveals That Epidermal Growth Factor Is a Potential Candidate for Therapeutic Intervention Strategy

Energy Technology Data Exchange (ETDEWEB)

Kim, Kyung Su [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Jeon, Seong-Uk; Lee, Chan-Ju; Kim, Young-Eun; Bok, Seoyeon; Hong, Beom-Ju; Park, Dong-Young [Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang, Gyeongbuk (Korea, Republic of); Ahn, G-One, E-mail: goneahn@postech.ac.kr [Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology, Pohang, Gyeongbuk (Korea, Republic of); Kim, Hak Jae, E-mail: khjae@snu.ac.kr [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of)

2016-07-01

Purpose: To establish and characterize radiation-induced esophagitis (RIE) in vivo and in vitro. Methods and Materials: Fractionated thoracic irradiation at 0, 8, 12, or 15 Gy was given daily for 5 days to Balb/c or C57Bl/6 mice. Changes in body weight gain and daily food intake were assessed. At the end of the study, we removed the esophagus and examined histology by hematoxylin and eosin staining, immune cell infiltration and apoptosis by fluorescence-activated cell sorting, and gene expression changes by quantitative real-time polymerase chain reaction. Het-1A human esophageal epithelial cells were irradiated at 6 Gy, treated with recombinant human growth factors, and examined for gene expression changes, apoptosis, proliferation, and signal transduction pathways. Results: We observed that irradiation at 12 Gy or 15 Gy per fraction produced significant reduction in body weight and decreased food intake in Balb/c mice but not as much in C57Bl/6 mice. Further analyses of Balb/c mice irradiated at 12 Gy/fraction revealed attenuated epithelium, inflamed mucosa, and increased numbers of infiltrating CD4+ helper T cells and apoptotic cells. Moreover, we found that expression of tissue inhibitor for metalloproteinase-1, plasminogen activator inhibitor-1, granulocyte macrophage-colony stimulating factor, vascular endothelial growth factor, and stromal-derived factor-1 were increased, whereas epidermal growth factor (EGF) was decreased. Irradiated Het-1A cells similarly showed a significant decrease in expression of EGF and connective tissue growth factor (CTGF). Treatment of EGF but not CTGF partially protected Het-1A cells from radiation-induced apoptosis and revealed phosphorylation of EGFR, AKT, and ERK signaling pathways. Conclusions: We established a mouse model of RIE in Balb/c mice with 12 Gy × 5 fractions, which showed reduced body weight gain, food intake, and histopathologic features similar to those of human esophagitis. Decreased EGF expression

Sulindac metabolites inhibit epidermal growth factor receptor activation and expression

Directory of Open Access Journals (Sweden)

Ahnen Dennis

2005-01-01

Full Text Available Abstract Background Regular use of nonsteroidal anti-inflammatory drugs (NSAIDs is associated with a decreased mortality from colorectal cancer (CRC. NSAIDs induce apoptotic cell death in colon cancer cells in vitro and inhibit growth of neoplastic colonic mucosa in vivo however, the biochemical mechanisms required for these growth inhibitory effects are not well defined. We previously reported that metabolites of the NSAID sulindac downregulate extracellular-signal regulated kinase 1/2 (ERK1/2 signaling and that this effect is both necessary and sufficient for the apoptotic effects of these drugs. The goal of this project was to specifically test the hypothesis that sulindac metabolites block activation and/or expression of the epidermal growth factor (EGF receptor (EGFR. Methods HT29 human colon cancer cells were treated with EGF, alone, or in the presence of sulindac sulfide or sulindac sulfone. Cells lysates were assayed by immunoblotting for phosphorylated EGFR (pEGFR, pY1068, total EGFR, phosphorylated ERK1/2 (pERK1/2, total ERK1/2, activated caspase-3, and α-tubulin. Results EGF treatment rapidly induced phosphorylation of both EGFR and ERK1/2 in HT29 colon cancer cells. Pretreatment with sulindac metabolites for 24 h blocked EGF-induced phosphorylation of both EGFR and ERK1/2 and decreased total EGFR protein expression. Under basal conditions, downregulation of pEGFR and total EGFR was detected as early as 12 h following sulindac sulfide treatment and persisted through at least 48 h. Sulindac sulfone induced downregulation of pEGFR and total EGFR was detected as early as 1 h and 24 h, respectively, following drug treatment, and persisted through at least 72 h. EGFR downregulation by sulindac metabolites was observed in three different CRC cell lines, occurred prior to the observed downregulation of pERK1/2 and induction of apoptosis by these drugs, and was not dependent of caspase activation. Conclusion These results suggest that

Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

Science.gov (United States)

von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

2017-11-06

The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

Energy Technology Data Exchange (ETDEWEB)

Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

1988-03-01

The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

Science.gov (United States)

Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

1999-01-01

Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

Dialkoxyquinazolines: Screening Epidermal Growth Factor ReceptorTyrosine Kinase Inhibitors for Potential Tumor Imaging Probes

Energy Technology Data Exchange (ETDEWEB)

VanBrocklin, Henry F.; Lim, John K.; Coffing, Stephanie L.; Hom,Darren L.; Negash, Kitaw; Ono, Michele Y.; Hanrahan, Stephen M.; Taylor,Scott E.; Vanderpoel, Jennifer L.; Slavik, Sarah M.; Morris, Andrew B.; Riese II, David J.

2005-09-01

The epidermal growth factor receptor (EGFR), a long-standingdrug development target, is also a desirable target for imaging. Sixteendialkoxyquinazoline analogs, suitable for labeling with positron-emittingisotopes, have been synthesized and evaluated in a battery of in vitroassays to ascertain their chemical and biological properties. Thesecharacteristics provided the basis for the adoption of a selection schemato identify lead molecules for labeling and in vivo evaluation. A newEGFR tyrosine kinase radiometric binding assay revealed that all of thecompounds possessed suitable affinity (IC50 = 0.4 - 51 nM) for the EGFRtyrosine kinase. All of the analogs inhibited ligand-induced EGFRtyrosine phosphorylation (IC50 = 0.8 - 20 nM). The HPLC-estimatedoctanol/water partition coefficients ranged from 2.0-5.5. Four compounds,4-(2'-fluoroanilino)- and 4-(3'-fluoroanilino)-6,7-diethoxyquinazoline aswell as 4-(3'-chloroanilino)- and4-(3'-bromoanilino)-6,7-dimethoxyquinazoline, possess the bestcombination of characteristics that warrant radioisotope labeling andfurther evaluation in tumor-bearing mice.

Epidermal electronics with advanced capabilities in near-field communication.

Science.gov (United States)

Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A

2015-02-25

Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

Science.gov (United States)

Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

2005-01-01

The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

Induction of PDGF-B in TCA-treated epidermal keratinocytes.

Science.gov (United States)

Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

2007-11-01

Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

International Nuclear Information System (INIS)

Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

2013-01-01

High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

Markedly diminished epidermal keratinocyte expression of intercellular adhesion molecule-1 (ICAM-1) in Sezary syndrome

Energy Technology Data Exchange (ETDEWEB)

Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))

1989-04-21

In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.

Chinese Medicine Treatment for Afatinib-Induced Paronychia

Directory of Open Access Journals (Sweden)

Pei-Yuu Yang

2017-01-01

Full Text Available Afatinib (Gilotrif™ is widely used to treat patients with mutant activating epidermal growth factor receptor- (EGFR- dependent lung adenocarcinoma; however, it has various adverse side effects. Here, we report a patient with afatinib-induced paronychia. After Chinese medicine treatment with the well-known anticancer Chinese herbs, Jen-Ren-Hwo-Minq-Saan, and decoction of Ban-Zhi-Lian (Scutellaria barbata with Bai-Hua-She-She-Cao (Hedyotis diffusa Willd, patient’s condition was significantly improved. This shows that these Chinese medicines can not only be used in cancer treatment but also be used in the afatinib-induced paronychia.

Turnover of pigment granules: cyclic catabolism and anabolism of ommochromes within epidermal cells.

Science.gov (United States)

Insausti, T C; Casas, J

2009-12-01

Ommochromes are end products of the tryptophan metabolism in arthropods. While the anabolism of ommochromes has been well studied, the catabolism is totally unknown. In order to study it, we used the crab-spider Misumena vatia, which is able to change color reversibly in a few days, from yellow to white and back. Ommochromes is the only pigment class responsible for the body coloration in this animal. The aim of this study was to analyze the fine structure of the epidermal cells in bleaching spiders, in an attempt to correlate morphological changes with the fate of the pigment granules. Central to the process of bleaching is the lysis of the ommochrome granules. In the same cell, intact granules and granules in different degradation stages are found. The degradation begins with granule autolysis. Some components are extruded in the extracellular space and others are recycled via autophagy. Abundant glycogen appears associated to granulolysis. In a later stage of bleaching, ommochrome progranules, typical of white spiders, appear in the distal zone of the same epidermal cell. Catabolism and anabolism of pigment granules thus take place simultaneously in spider epidermal cells. A cyclic pathway of pigment granules formation and degradation, throughout a complete cycle of color change is proposed, together with an explanation for this turnover, involving photoprotection against UV by ommochromes metabolites. The presence of this turnover for melanins is discussed.

Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

Directory of Open Access Journals (Sweden)

Aleksandra Piwko-Czuchra

Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

[Prostatic granulomas revealing a peripheral T-cell lymphoma].

Science.gov (United States)

Foguem, C; Curlier, E; Rouamba, M-M; Regent, A; Philippe, P

2009-02-01

The presence of granulomas on tissue biopsie has been reported in a wide range of disorders. The clinical presentation and the diagnostic work-up of granulomatosis can be difficult as it is illustrated in the following report. A 59-year-old patient was referred in 2002 for a granulomatous prostatitis. Physical examination was normal. Except for the increase of prostate-specific antigen (which motivated a biopsy), the laboratory results were normal. Thoracic CT-scan disclosed mediastinal lymph nodes. A minor salivary gland biopsy was consistent with the diagnosis of sarcoidosis. In 2004, the patient presented an epidermal necrolysis, and in 2005 the deterioration of general status raised suspicion of a lymphoproliferative disorder. Liver and bone marrow biopsies revealed a granulomatous process. Despite steroid therapy, the patient died. Autopsy discloses a anaplasic T cell lymphoma. This report illustrates the relationship between sarcoidosis and lymphoma as a mode of presentation, a complication, or an accidental but misleading association? The association between anaplastic lymphoma and sarcoidosis is exceptional.

Churg-strauss syndrome

Directory of Open Access Journals (Sweden)

Subhasish Ghosh

2011-01-01

Full Text Available Churg-Strauss syndrome (CSS is a rare granulomatous necrotizing small vessel vasculitis characterized by the presence of asthma, sinusitis, and hypereosinophilia. The cause of this allergic angiitis and granulomatosis is unknown. Other common manifestations are pulmonary infiltrates, skin, gastrointestinal, and cardiovascular involvement. No data have been reported regarding the role of immune complexes or cell mediated mechanisms in this disease, although autoimmunity is evident with the presence hypergammaglobulinemia, increased levels of IgE and Antineutrophil cytoplasmic antibody (positive in 40%. We report the case of a 27-year-old lady presenting with painful swelling of predominantly lower limbs with extensive vesicles and ecchymotic patches and fever shortly after stopping systemic steroids taken for a prolonged duration (2002--2010. The aim of this case report is to point to the possibility of CSS in patients presenting with extensive skin lesions masquerading as Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Syndrome (SJS/TENS.

CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

Science.gov (United States)

Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

2017-09-19

Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

Association of epidermal growth factor and epidermal growth factor receptor polymorphisms with the risk of hepatitis B virus-related hepatocellular carcinoma in the population of North China.

Science.gov (United States)

Wu, Jia; Zhang, Wei; Xu, Aiqiang; Zhang, Li; Yan, Tao; Li, Zhuo; Wu, Xiaopan; Zhu, Xilin; Ma, Juan; Li, Ke; Li, Hui; Liu, Ying

2013-08-01

Hepatocellular carcinoma (HCC) is a common solid malignant tumor occurring worldwide that leads to the third largest cause of death compared to other cancers. Genetic and environmental factors are involved in the pathogenesis of HCC. Epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) can stimulate the proliferation of epidermal and epithelial cells. The EGF signal pathway has a relationship with the growth of the embryo, tissue repairing, and tumorigenesis. In this study, 416 patients with hepatitis B virus infection (HBV)-related HCC and 645 individuals who had never been infected with HBV of the Chinese Han population were enrolled. Eight single-nucleotide polymorphisms (SNPs), whose minor allele frequency >20% in the EGF and EGFR genes, were genotyped to examine their associations with hepatocarcinogenesis. Genotyping experiments were carried out using TaqMan. There were significant differences in genotype distributions (p=0.005) and allele frequencies (p=0.001, odds ratio [OR]=1.43, 95% confidence interval [CI]=1.15-1.79) of rs11569017 in the EGF gene between the HCC and control groups. After binary logistic regression to determine independent factors for susceptibility to HCC under an additive model, rs11569017 was still independently associated with the susceptibility to HCC (p=0.021, OR=1.48, 95% CI=1.06-2.07), but no significant differences in other SNPs were found. Additionally, the haplotype T-G constructed by rs11569017 and rs4444903 of the EGF gene might increase the risk of HBV-related HCC (p=0.002, OR=1.44, 95% CI=1.15-1.82). The rs11569017 T allele was associated with susceptibility to HBV-related HCC.

Ichthyosis hystrix disease or verrucous epidermal nevus (a retrospective analysis of 20-year observation

Directory of Open Access Journals (Sweden)

V. D. El'kin

2017-01-01

Full Text Available We present a  clinical case of ichthyosis hystrix, a rare genetic ichthyosiform dermatosis. Specifics of the disease are related to the complexity of differential diagnosis and verification of the diagnosis, because clinical manifestation of ichthyosis hystrix is similar with that of verrucous epidermal nevus. Clinical particulars of both nosologies are characterized by bizarre and widespread skin lesions of spicular hyperkeratotic growth, located along Blaschko lines. The exclusive feature of the clinical case described is a  long-term (20 years clinical and laboratory monitoring of the patient. The literature review provides brief information on etiology, pathogenesis, clinical features, differential diagnosis, and pathomorphology of ichthyosis hystrix and verrucous epidermal nevus.

Influence of epidermal hydration on the friction of human skin against textiles

OpenAIRE

Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

2008-01-01

Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

Effects of juvenile hormone analogue on ecdysis prevention induced by precocene in Rhodnius prolixus (Hemiptera: Reduviidae

Directory of Open Access Journals (Sweden)

Patricia de Azambuja

1984-12-01

Full Text Available Precocene II, added to the meal of fourth-instar larvae of Rhodnius prolixus (25 mug/ml of blood, induced an in crease in the duration of the molting cycle. This effect was related to the decrease of both the nuclear area of the prothoracic gland cells and the mitotic activity in epidermal cellS. juvenile hormone analogue applied topically (60 mug/insect together with Precocene II treatment avoided atrophy of the prothoracic glands and induced a higher number of epidermal mitosis accelerating the time of subsequent ecdysis. A possible relationship between juvenile hormone and production of ecdysone is discussed.Adicionado ao sangue alimentar na dose de 25 mug/ml o precoceno II causou um aumento no período de intermuda em ninfas de 4o. estadio de Rhodnius prolixus. Este atraso da muda foi relacionado com a diminuição da área dos núcleos das celulas das glandulas protoracicas e com a queda da atividade mitotica das células da epiderme do inseto. Um análogo de hormônio juvenil aplicado topicamente (60 mug/inseto junto com o tratamento oral com precoceno II preveniu a atrofia das glândulas protorácicas e induziu um aumento no número de mitoses nas células da epiderme, diminuindo o período de intermuda nestes insetos.A possivel relação entre a ação do hormônio juvenil e a producao de ecdisona pelas glândulas protorácicas e discutida.

Epidermal inclusion cyst in male breast: mammographic and ultrasonographic findings in three cases

International Nuclear Information System (INIS)

Cubells, M.; Gil de Ramales, V.; Bulto, J. A.; Morcillo, E.; Celma, J.

2000-01-01

Three cases of histologically diagnosed epidermal inclusion cysts in male breast are presented. This is a very uncommon condition that results from the inclusion of epidermal remnants beneath the skin, which form a keratin-filled cystic cavity. The clinical presentation is that of palpable breast masses showing medium-to-high density in mammography. They are well defined and do not present calcifications. Ultrasound discloses their cystic form, with moderate posterior reinforcement, although they do not appear as anechoic cysts. Characteristically, echoes are detected in the interior that correspond to the degeneration keratin. The differential diagnosis should include cysts complicated by infection or hemorrhage, fibroadenomas with low echogenicity and even tumors of neoplastic origin. Color Doppler ultrasound disclosed the absence of internal vascularisation, a circumstance that indicated the benignity of the lesion. (Author) 9 refs

Effects of ultraviolet radiation on the production of epidermal derived thymocyte-activating factor/interleukin-1

International Nuclear Information System (INIS)

Gahring, L.C.

1986-01-01

The effect of both a single exposure and multiple exposures to ultraviolet radiation (UVR) on the production and/or release of epidermal cell derived thymocyte activating factor/interleukin-1 (ETAF/IL-1) were investigated. A single exposure to UVR enhances the release of ETAF/IL-1 both in vitro and in vivo. This conclusion was based on the observation that: (1) in vitro UV-irradiation of the keratinocyte cell line elevated the release of ETAF/IL-1 on a per cell basis; (2) exposure of animals to UVR stimulated a number of in vivo biologic responses which are known to be mediated by ETAF/IL-1; and (3) ETAF/IL-1 could be detected in the serum of UVR exposed but not normal animals. Exposure of mice to UV-irradiation on a daily basis induced a desensitized state in which animals were found to be refractory to further stimulation with this inflammatory agent. A similar desensitization or tolerance was also shown to be induced by multiple intraperitoneal injections of bacterial lipopolysaccharide (LPS). Desensitization, induced by either LPS or UVR, was found to be regulated at the site of interaction between the cells capable of ETAF/IL-1 production and the exogenous inflammatory stimulus. The results indicate that the regulatory mechanisms for ETAF/IL-1 production which are employed by the keratinocyte are distinct from those regulating ETAF/Il-1 production by the macrophage

Antimicrobial susceptibility of Staphylococcus hyicus Isolated from exudative epidermitis in pigs

DEFF Research Database (Denmark)

Wegener, Henrik Caspar; Watts, J.L.; Salmon, S.A.

1994-01-01

for their activities against 100 S. hyicus strains isolated from pigs with exudative epidermitis. Novobiocin was the most active compound tested, with an MIC for 90% of the strains tested (MIC(90)) of less than or equal to 0.06 mu g/ml. Enrofloxacin, ampicillin, and ceftiofur were the next most active compounds...

Examination of tetrachlorosalicylanilide (TCSA) photoallergy using in vitro photohapten-modified Langerhans cell-enriched epidermal cells

International Nuclear Information System (INIS)

Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.

1991-01-01

Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent

Renal origin of rat urinary epidermal growth factor

DEFF Research Database (Denmark)

Nexø, Ebba; Poulsen, Steen Seier

1984-01-01

The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...

The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin.

Science.gov (United States)

Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M

1999-09-27

Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost

[Quantity research on epidermal growth factor in saliva and epidermal growth factor receptor in biopsy samples of recurrent aphthous ulcer patients].

Science.gov (United States)

Gu, Yang; Zhang, Gang; Lin, Mei

2008-02-01

To examine the change of epidermal growth factor (EGF) concentration in saliva of recurrent aphthous ulcer (RAU) patients during the ulcerous and interval period and epidermal growth factor receptor (EGFR) in ulcer biopsy samples. ECF data of the samples, which were 27 saliva samples from RAU gained not only in the ulcerous period but also in interval period and 33 ones from normal persons, were acquired through enzyme linked immunosorhent assay (ELISA) and EGF standard curve. ECFR-RNA date of RAU biopsies, which were 31 biopsy samples from RAU got during the ulcerous period and 35 ones from normal persons, were surveyed by QF-RT-PCR. All RAU samples were obtained under the same level, which were the whole patients were minor aphthous ulcers and their ulcers occurred not over the first four days. All patients and normal persons were selected seriously under the rule of physical situations without any other diseases and histories of using medicines. The EGF concentration of saliva in RAU group at ulcer occurrence was higher than that in the interval period and the normal control with a significant test (F = 3.24, P ulcer occurrence was higher than the normal control with a significant test (t = 3.15, P ulcer occasion of RAU patients could be related with the decreasing of EGF in saliva during interval period, and that the ulcer sell-cure of RAU patients would be contributed to

Using scale and feather traits for module construction provides a functional approach to chicken epidermal development.

Science.gov (United States)

Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H

2017-11-01

Gene co-expression network analysis has been a research method widely used in systematically exploring gene function and interaction. Using the Weighted Gene Co-expression Network Analysis (WGCNA) approach to construct a gene co-expression network using data from a customized 44K microarray transcriptome of chicken epidermal embryogenesis, we have identified two distinct modules that are highly correlated with scale or feather development traits. Signaling pathways related to feather development were enriched in the traditional KEGG pathway analysis and functional terms relating specifically to embryonic epidermal development were also enriched in the Gene Ontology analysis. Significant enrichment annotations were discovered from customized enrichment tools such as Modular Single-Set Enrichment Test (MSET) and Medical Subject Headings (MeSH). Hub genes in both trait-correlated modules showed strong specific functional enrichment toward epidermal development. Also, regulatory elements, such as transcription factors and miRNAs, were targeted in the significant enrichment result. This work highlights the advantage of this methodology for functional prediction of genes not previously associated with scale- and feather trait-related modules.

Influence of epidermal hydration on the friction of human skin against textile

NARCIS (Netherlands)

Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

2008-01-01

Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

Epidermal growth factor treatment decreases mortality and is associated with improved gut integrity in sepsis.

Science.gov (United States)

Clark, Jessica A; Clark, Andrew T; Hotchkiss, Richard S; Buchman, Timothy G; Coopersmith, Craig M

2008-07-01

Epidermal growth factor (EGF) is a cytoprotective peptide that has healing effects on the intestinal mucosa. We sought to determine whether systemic administration of EGF after the onset of sepsis improved intestinal integrity and decreased mortality. FVB/N mice were subjected to either sham laparotomy or 2 x 23 cecal ligation and puncture (CLP). Septic mice were further randomized to receive injection of either 150 microg kg(-1) d(-1) (i.p.) EGF or 0.9% saline (i.p.). Circulating EGF levels were decreased after CLP compared with sham animals but were unaffected by giving exogenous EGF treatment. In contrast, intestinal EGF levels increased after CLP and were further augmented by exogenous EGF treatment. Intestinal EGF receptor was increased after CLP, whether assayed by immunohistochemistry, real-time polymerase chain reaction, or Western blot, and exogenous EGF treatment decreased intestinal EGF receptor. Villus length decreased 2-fold between sham and septic animals, and EGF treatment resulted in near total restitution of villus length. Sepsis decreased intestinal proliferation and increased intestinal apoptosis. This was accompanied by increased expression of the proapoptotic proteins Bid and Fas-associated death domain, as well as the cyclin-dependent kinase inhibitor p21 cip1/waf Epidermal growth factor treatment after the onset of sepsis restored both proliferation and apoptosis to levels seen in sham animals and normalized expression of Bid, Fas-associated death domain, and p21 cip1/waf . To determine whether improvements in gut homeostasis were associated with a decrease in sepsis-induced mortality, septic mice with or without EGF treatment after CLP were followed 7 days for survival. Mortality decreased from 60% to 30% in mice treated with EGF after the onset of sepsis (P < 0.05). Thus, EGF may be a potential therapeutic agent for the treatment of sepsis in part due to its ability to protect intestinal integrity.

The epidermal cell kinetic response to ultraviolet B irradiation combines regenerative proliferation and carcinogen associated cell cycle delay

Energy Technology Data Exchange (ETDEWEB)

Olsen, W.M.; Kirkhus, B. (Oslo Univ. (Norway))

1989-09-01

The cell cycle traverse of epidermal basal cells 24 h after in vivo exposure of ultraviolet B (UVB) irradiation was studied by immunochemical staining of incorporated bromodeoxyuridine (BrdU) and bivariate BrdU/DNA flow cytometric analysis. The results were compared with the cell kinetic patterns following topical application of the skin carcinogen methylnitrosourea (MNU) as well as the skin irritant cantharidin. The cell cycle traverse in hairless mouse epidermis 24 h after in vivo exposure to UVB seemed to be a combination of the cell kinetic effects following chemical skin carcinogens and skin irritants. UVB irradiation induced both a delay in transit time through S phase, probably due to DNA damage and subsequent repair, as well as a reduction in the total cell cycle time consistent with rapid regenerative proliferation. (author).

Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

Science.gov (United States)

Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar

2012-09-01

Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Self-phosphorylation of epidermal growth factor receptor: evidence for a model of intermolecular allosteric activation

International Nuclear Information System (INIS)

Yarden, Y.; Schlessinger, J.

1987-01-01

The membrane receptor for epidermal growth factor (EGF) is a 170,000 dalton glycoprotein composed of an extracellular EGF-binding domain and a cytoplasmic kinase domain connected by a stretch of 23 amino acids traversing the plasma membrane. The binding of EGF to the extracellular domain activates the cytoplasmic kinase function even in highly purified preparations of EGF receptor, suggesting that the activation occurs exclusively within the EGF receptor moiety. Conceivably, kinase activation may require the transfer of a conformational change through the single transmembrane region from the ligand binding domain to the cytoplasmic kinase region. Alternatively, ligand-induced receptor-receptor interactions may activate the kinase and thus bypass this requirement. Both mechanisms were contrasted by employing independent experimental approaches. On the basis of these results, an allosteric aggregation model is formulated for the activation of the cytoplasmic kinase function of the receptor by EGF. This model may be relevant to the mechanism by which the mitogenic signal of EGF is transferred across the membrane

An epidermal equivalent assay for identification and ranking potency of contact sensitizers

NARCIS (Netherlands)

Gibbs, S.; Corsini, E.; Spiekstra, S.W.; Galbiati, V.; Fuchs, H.W.; Degeorge, G.; Troese, M.; Hayden, P.; Deng, W.; Roggen, E.

2013-01-01

The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low

Immunohistochemical localisation and developmental aspects of epidermal growth factor in the rat

DEFF Research Database (Denmark)

Raaberg, L; Nexø, E; Damsgaard Mikkelsen, J

1988-01-01

The tissue localisation and time of first appearance of Epidermal Growth Factor (EGF) in the developing rat were investigated by means of immunohistochemistry, radioimmunoassay and radioreceptor assay. In this study we were able to show, that EGF appears prenatally in the lung and the kidney from...

Does epidermal growth factor play a role in the action of sucralfate?

DEFF Research Database (Denmark)

Nexø, Ebba; Poulsen, Steen Seier

1987-01-01

Epidermal growth factor (EGF) is a mitogenic peptide synthesized in the submandibular glands and released in saliva. EGF is able to prevent the development of gastrointestinal ulcers in the rat and to accelerate their healing. The present work was undertaken to examine whether Sucralfate acts via...

Epidermal transmittance and phenolic composition in leaves of atrazine-tolerant and atrazine-sensitive cultivars of Brassica napus grown under enhanced UV-B radiation

International Nuclear Information System (INIS)

Olsson, L.C.; Veit, M.; Bornman, J.F.

1999-01-01

Experiments were conducted on the atrazine-tolerant mutant Stallion and the atrazine-sensitive cv. Paroll of Brassica napus L., which were grown under either visible light or with the addition of UV-B radiation (280–320 nm) for 15 days. The mutant has been shown to be sensitive to high levels of visible light as compared to the atrazine-sensitive cultivar and therefore we wished to determine plant response to UV-B radiation with respect to potential pigment changes, certain anatomical features, radiation penetration and partial photosynthesis. With regard to pigment changes, we were particularly interested in whether the compositional shift in flavonol pigments under enhanced UV-B radiation, previously suggested to favour increased antioxidant activity, is confined to the adaxial epidermis, which generally receives most UV-B radiation or whether the pigment shift is also inducible in the abaxial epidermis.As was to be expected, the penetration of UV-B radiation (310 nm) was lower in the UV-B-exposed plants, which was correlated with an increased amount of UV-screening pigments in the adaxial and abaxial epidermal layers. The main flavonoid glycosides showed the largest shift from kaempferol to quercetin as aglycone moiety in the adaxial epidermal layer. However, in the abaxial epidermal layer the hydroxycinnamic acid (HCA) derivatives and kaempferol glycosides were predominant. Penetration of 430 nm light was higher after UV-B exposure, and probably contributed to the fact that photosynthetic efficiency of photosystem II was unchanged or higher after UV-B exposure. UV-B radiation decreased leaf area in the atrazine-tolerant mutant only. Both cultivars showed an increased leaf thickness after UV-B exposure due to cell elongation mainly of the palisade tissue. This was especially evident in the mutant

Anti-epidermal growth factor receptor skin toxicity: a matter of topical hydration.

Science.gov (United States)

Ferrari, Daris; Codecà, Carla; Bocci, Barbara; Crepaldi, Francesca; Violati, Martina; Viale, Giulia; Careri, Carmela; Caldiera, Sarah; Bordin, Veronica; Luciani, Andrea; Zonato, Sabrina; Cassinelli, Gabriela; Foa, Paolo

2016-02-01

Skin toxicity is a frequent complication of anti-epidermal growth factor receptor therapy, which can be an obstacle in maintaining the dose intensity and may negatively impact on the clinical outcome of cancer patients. Skin lesions depend on the disruption of the keratinocyte development pathways and no treatment is clearly effective in resolving the cutaneous alterations frequently found during anti-epidermal growth factor receptor therapy. Among systemic treatments, oral tetracycline proved to be useful in preventing skin manifestations. We describe the case of a patient affected by metastatic colorectal cancer, for whom a combination of chemotherapy and cetuximab was used as second-line treatment. The patient developed a symptomatic papulopustular skin rash that disappeared completely after a twice-daily application of a hydrating and moisturizing cream, mainly consisting of a mixture of paraffin, silicone compounds, and macrogol. The marked cutaneous amelioration allowed the patient to continue cetuximab without any further symptoms and was associated with a partial radiological response.

A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.

Science.gov (United States)

Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi

2016-04-01

Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.

The Epidermal Growth Factor Receptor Responsive miR-125a Represses Mesenchymal Morphology in Ovarian Cancer Cells

Directory of Open Access Journals (Sweden)

Karen D. Cowden Dahl

2009-11-01

Full Text Available The epithelial-to-mesenchymal transition (EMT that occurs during embryonic development is recapitulated during tumor metastasis. Important regulators of this process include growth factors, transcription factors, and adhesion molecules. New evidence suggests that microRNA (miRNA activity contributes to metastatic progression and EMT; however, the mechanisms leading to altered miRNA expression during cancer progression remain poorly understood. Importantly, overexpression of the epidermal growth factor receptor (EGFR in ovarian cancer correlates with poor disease outcome and induces EMT in ovarian cancer cells. We report that EGFR signaling leads to transcriptional repression of the miRNA miR-125a through the ETS family transcription factor PEA3. Overexpression of miR-125a induces conversion of highly invasive ovarian cancer cells from a mesenchymal to an epithelial morphology, suggesting miR-125a is a negative regulator of EMT. We identify AT-rich interactive domain 3B (ARID3B as a target of miR-125a and demonstrate that ARID3B is overexpressed in human ovarian cancer. Repression of miR-125a through growth factor signaling represents a novel mechanism for regulating ovarian cancer invasive behavior.

Effects of in Utero Exposure of C57BL/6J Mice to 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Epidermal Permeability Barrier Development and Function

Science.gov (United States)

Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.

2014-01-01

Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982

Modulation of Regorafenib effects on HCC cell lines by epidermal growth factor.

Science.gov (United States)

D'Alessandro, Rosalba; Refolo, Maria Grazia; Lippolis, Catia; Carella, Nicola; Messa, Caterina; Cavallini, Aldo; Carr, Brian Irving

2015-06-01

Blood platelet numbers are correlated to growth and aggressiveness of several tumor types, including hepatocellular carcinoma (HCC). We previously found that platelet lysates (hPLs) also stimulated growth and migration, and antagonized the growth-inhibitory and apoptotic effects of both Sorafenib and Regorafenib, two multikinase inhibitors, on three HCC cell lines. In this study, in vitro function of human epidermal growth factor (EGF) with and without Sorafenib or Regorafenib was investigated. An ELISA kit was used to evaluate the EGF concentrations in hPLs. In vitro function of EGF was assessed with proliferation MTT test. Apoptosis assay, scratch assays, and Transwell assays were performed for apoptosis, invasion, and migration, respectively. MAPK Activation Kit was used to explore MAPK phosphorylation. EGF antagonized the growth inhibition of Regorafenib on three HCC cell lines. Regorafenib-mediated growth inhibition was blocked by 70 % when the cells were pre-treated with EGF. EGF also blocked Regorafenib-induced apoptosis, as well as Regorafenib-induced decreases in cell migration and invasion. The EGF effects were in turn antagonized by concomitant addition to the cultures of EGF receptor antagonist Erlotinib, showing that the EGF receptor was involved in the mechanisms of EGF-mediated blocking of Regorafenib effects. Erlotinib also partially blocked the effects of hPLs in antagonizing Regorafenib-mediated growth inhibition, showing that EGF was an important component of hPL actions. All these results show that EGF antagonized Regorafenib-mediated growth and migration inhibition and apoptosis induction in HCC cells and reinforce the idea that microenvironment can influence cancer drug actions.

Dynein and EFF-1 control dendrite morphology by regulating the localization pattern of SAX-7 in epidermal cells.

Science.gov (United States)

Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang

2017-12-01

Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.

Hierarchical classification strategy for Phenotype extraction from epidermal growth factor receptor endocytosis screening

NARCIS (Netherlands)

L. Cao (Lu); M. Graauw (Marjo de); K. Yan (Kuan); L.C.J. Winkel (Leah C.J.); F.J. Verbeek (Fons)

2016-01-01

textabstractBackground: Endocytosis is regarded as a mechanism of attenuating the epidermal growth factor receptor (EGFR) signaling and of receptor degradation. There is increasing evidence becoming available showing that breast cancer progression is associated with a defect in EGFR endocytosis. In

Epidermal growth factor treatment of A431 cells alters the binding capacity and electrophoretic mobility of the cytoskeletally associated epidermal growth factor receptor

International Nuclear Information System (INIS)

Roy, L.M.; Gittinger, C.K.; Landreth, G.E.

1991-01-01

Epidermal growth factor receptor interacts with structural elements of A431 cells and remains associated with the cytoskeleton following extraction with nonionic detergents. Extraction of cells with 0.15% Triton X-100 resulted in detection of only approximately 40% of the EGF binding sites on the cytoskeleton. If the cells were exposed to EGF prior to extraction, approximately twofold higher levels of low-affinity EGF binding sites were detected. The difference in number of EGF binding sites was not a consequence of differences in numbers of EGF receptors associated with the cytoskeleton; equal amounts of 35S-labeled receptor were immunoprecipitated from the cytoskeletons of both control and EGF-treated cells. The effect of EGF pretreatment on binding activity was coincident with a change in the mobility of the receptor from a doublet of Mr approximately 160-180 kDa to a single sharp band at 180 kDa. The alteration in receptor mobility was not a simple consequence of receptor phosphorylation in that the alteration was not reversed by alkaline phosphatase treatment, nor was the shift produced by treatment of the cells with phorbol ester. The two EGF receptor species demonstrated differential susceptibility to V8 proteinase digestion. The EGF-induced 180 kDa species was preferentially digested by the proteinase relative to the 160 kDa species, indicating that EGF binding results in a conformational change in the receptor. The EGF-mediated preservation of binding activity and altered conformation may be related to receptor oligomerization

Horse hooves and bird feathers: Two model systems for studying the structure and development of highly adapted integumentary accessory organs--the role of the dermo-epidermal interface for the micro-architecture of complex epidermal structures.

Science.gov (United States)

Bragulla, Hermann; Hirschberg, Ruth M

2003-08-15

Accessory organs of the integument are locally modified parts of the potentially feather-bearing skin in birds (e.g., the rhamphotheca, claws, or scales), and of the potentially hairy skin in mammals (e.g., the rhinarium, nails, claws, or hooves). These special parts of the integument are characterised by a modified structure of their epidermal, dermal and subcutaneous layers. The developmental processes of these various integumentary structures in birds and mammals show both similarities and differences. For example, the development of the specialised epidermal structures of both feathers and the hoof capsule is influenced by the local three-dimensional configuration of the dermis. However, in feathers, in contrast to hooves, the arrangement of the corneous cells is only partially a direct result of the particular arrangement and shape of the dermal surface of the papillary body. Whereas the diameter of the feather papilla, as well as the number, length, and width of dermal ridges on the surface of the feather papilla influence the three-dimensional architecture of the feather rami, there is no apparent direct correlation between the dermo-epidermal interface and the development of the highly ordered architecture of the radii and hamuli in the feather vane. In order to elucidate this morphogenic problem and the problem of locally different processes of keratinisation and cornification, the structure and development of feathers in birds are compared to those of the hoof capsule in horses. The equine hoof is the most complex mammalian integumentary structure, which is determined directly by the dermal surface of the papillary body. Perspectives for further research on the development of modified integumentary structures, such as the role of the dermal microangioarchitecture and the selective adhesion and various differentiation pathways of epidermal cells, are discussed. Copyright 2003 Wiley-Liss, Inc.

Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

Science.gov (United States)

Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

2012-01-01

Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

Radiosensitivity of normal human epidermal cells in culture

International Nuclear Information System (INIS)

Dover, R.; Potten, C.S.

1983-01-01

Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

Transforming growth factor alpha and epidermal growth factor in laryngeal carcinomas demonstrated by immunohistochemistry

DEFF Research Database (Denmark)

Christensen, M E; Therkildsen, M H; Poulsen, Steen Seier

1993-01-01

the basal cell layer. The present investigation and our previous results confirm the existence of EGF receptors, TGF-alpha and EGF in laryngeal carcinomas. In addition, we conclude that the conditions do exist for growth factors to act through an autocrine system in poorly differentiated tumours and through......Fifteen laryngeal squamous cell carcinomas were investigated for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF) using immunohistochemical methods. In a recent study the same material was characterized for epidermal growth factor receptors (EGF...... receptors) which were confined predominantly to the undifferentiated cells. The expression of this growth factor system in malignant cells may play a role in carcinogenesis and/or tumour growth. All carcinomas were positive for TGF-alpha and 12 were positive for EGF. In moderately-to-well differentiated...

A novel role of RASSF9 in maintaining epidermal homeostasis.

Directory of Open Access Journals (Sweden)

Chiou-Mei Lee

Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

Dialkoxyquinazolines: Screening Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors for Potential Tumor Imaging Probes

International Nuclear Information System (INIS)

VanBrocklin, Henry F.; Lim, John K.; Coffing, Stephanie L.; Hom, Darren L.; Negash, Kitaw; Ono, Michele Y.; Hanrahan, Stephen M.; Taylor, Scott E.; Vanderpoel, Jennifer L.; Slavik, Sarah M.; Morris, Andrew B.; Riese II, David J.

2005-01-01

The epidermal growth factor receptor (EGFR), a long-standing drug development target, is also a desirable target for imaging. Sixteen dialkoxyquinazoline analogs, suitable for labeling with positron-emitting isotopes, have been synthesized and evaluated in a battery of in vitro assays to ascertain their chemical and biological properties. These characteristics provided the basis for the adoption of a selection schema to identify lead molecules for labeling and in vivo evaluation. A newEGFR tyrosine kinase radiometric binding assay revealed that all of the compounds possessed suitable affinity (IC50 = 0.4 - 51 nM) for the EGFR tyrosine kinase. All of the analogs inhibited ligand-induced EGFR tyrosine phosphorylation (IC50 = 0.8 - 20 nM). The HPLC-estimated octanol/water partition coefficients ranged from 2.0-5.5. Four compounds,4-(2'-fluoroanilino)- and 4-(3'-fluoroanilino)-6,7-diethoxyquinazoline as well as 4-(3'-chloroanilino)- and4-(3'-bromoanilino)-6,7-dimethoxyquinazoline, possess the best combination of characteristics that warrant radioisotope labeling and further evaluation in tumor-bearing mice

Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

International Nuclear Information System (INIS)

Hirata, Y.; Orth, D.N.

1981-01-01

Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

Directory of Open Access Journals (Sweden)

Lakshmana K Yerneni

2007-01-01

Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed

Lamotrigine rechallenge after a skin rash. A combined study of open cases and a meta-analysis.

Science.gov (United States)

Serrani Azcurra, Daniel J L

2013-01-01

To determine the safety of lamotrigine rechallenge after a first episode of skin rash in bipolar patients. An open cases prospective study was conducted with patients who, developed a skin rash when first treated with lamotrigine, were refractory to other treatments, and were offered lamotrigine rechallenge using a different dose titration. Additionally a review was performed on previous skin rash management strategies and lamotrigine rechallenge reports. Every 3 out of 10 lamotrigine rechallenge patients required drug interruption due to persistent rash. One of them was potentially serious and resolved by stopping the lamotrigine. The review of available literature identified several lamotrigine rechallenge studies with rates of positive results varying between 70% and 87% depending on the study. No patient developed Stevens-Johnson syndrome or toxic epidermal necrolysis after rechallenge. The rate of rash was higher when rechallenge began between 4 weeks from initial rash (19% vs. 7%, P=.001) and decreased when first rash showed no potentially serious signs (0% vs.19%, P=.01). Rechallenge is a viable option after a benign lamotrigine-induced rash, and can even be rechallenged after rash with greater precautions when there exists one or two potentially serious signs. In cases of more serious rash there are no reliable data available on rechallenge safety and it may pose a significant risk. In those cases rechallenge should better be avoided between 4 weeks from first rash. Copyright © 2011 SEP y SEPB. Published by Elsevier Espana. All rights reserved.

Randomized, controlled trial of TNF-α antagonist in CTL-mediated severe cutaneous adverse reactions.

Science.gov (United States)

Wang, Chuang-Wei; Yang, Lan-Yan; Chen, Chun-Bing; Ho, Hsin-Chun; Hung, Shuen-Iu; Yang, Chih-Hsun; Chang, Chee-Jen; Su, Shih-Chi; Hui, Rosaline Chung-Yee; Chin, See-Wen; Huang, Li-Fang; Lin, Yang Yu-Wei; Chang, Wei-Yang; Fan, Wen-Lang; Yang, Chin-Yi; Ho, Ji-Chen; Chang, Ya-Ching; Lu, Chun-Wei; Chung, Wen-Hung

2018-03-01

Cytotoxic T lymphocyte-mediated (CTL-mediated) severe cutaneous adverse reactions (SCARs), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN), are rare but life-threatening adverse reactions commonly induced by drugs. Although high levels of CTL-associated cytokines, chemokines, or cytotoxic proteins, including TNF-α and granulysin, were observed in SJS-TEN patients in recent studies, the optimal treatment for these diseases remains controversial. We aimed to evaluate the efficacy, safety, and therapeutic mechanism of a TNF-α antagonist in CTL-mediated SCARs. We enrolled 96 patients with SJS-TEN in a randomized trial to compare the effects of the TNF-α antagonist etanercept versus traditional corticosteroids. Etanercept improved clinical outcomes in patients with SJS-TEN. Etanercept decreased the SCORTEN-based predicted mortality rate (predicted and observed rates, 17.7% and 8.3%, respectively). Compared with corticosteroids, etanercept further reduced the skin-healing time in moderate-to-severe SJS-TEN patients (median time for skin healing was 14 and 19 days for etanercept and corticosteroids, respectively; P = 0.010), with a lower incidence of gastrointestinal hemorrhage in all SJS-TEN patients (2.6% for etanercept and 18.2% for corticosteroids; P = 0.03). In the therapeutic mechanism study, etanercept decreased the TNF-α and granulysin secretions in blister fluids and plasma (45.7%-62.5% decrease after treatment; all P etanercept serves as an effective alternative for the treatment of CTL-mediated SCARs. ClinicalTrials.gov NCT01276314. Ministry of Science and Technology of Taiwan.

Isolation and In Vitro Characterization of Epidermal Stem Cells

DEFF Research Database (Denmark)

Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

2017-01-01

flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

Técnica para o estudo da anatomia da epiderme foliar de batata A technique for the anatomical study of potato leaf epidermis

Directory of Open Access Journals (Sweden)

Fernanda Bastos Segatto

2004-10-01

Full Text Available Embora a batata (Solanum tuberosum seja uma espécie de grande valor econômico, são poucas as informações disponíveis sobre a anatomia foliar, principalmente de características estruturais da epiderme. O estudo da anatomia foliar assume grande importância básica, para a ecologia e fisiologia, e aplicada para a fitopatologia e o melhoramento genético. Este trabalho teve por objetivo identificar uma técnica histológica que permite a confecção de lâminas semipermanentes para avaliar a epiderme foliar, em vista frontal, de um grande número de plantas de batata em um curto período de tempo. O corte paradérmico a mão livre, o método de Jeffrey e as técnicas de hidróxido de potássio e de impressão da epiderme foram avaliados. Lâminas semipermanentes foram confeccionadas da secção frontal da epiderme de folíolos principais do terço médio de plantas de batata. A impressão da epiderme em lâmina foi a única técnica que possibilitou a avaliação adequada de todos os clones de batata utilizados. A impressão da epiderme é uma técnica muito rápida, de baixo custo e de fácil execução, que atende os requisitos necessários para a identificação e seleção de características anatômicas de um grande número de plantas em um programa de melhoramento genético de batata.Even though potato (Solanum tuberosum is an economically important crop, information about leaf characteristics of anatomical structure has not been well studied. Studies of leaf epidermis have significance for basic fields as ecology and physiology and for applied fields as plant pathology and breeding. The objective of this research was to identify a fast and easy technique to prepare semi-permanent slides for studying the anatomy of potato leaf epidermis. Para dermal free hand cut, Jeffrey method, potassium hydroxide and epidermal fingerprint on glass slide techniques were evaluated. Semi-permanent slides were prepared from the longitudinal section of

Noise Stress Induces an Epidermal Growth Factor Receptor/Xeroderma Pigmentosum-A Response in the Auditory Nerve.

Science.gov (United States)

Guthrie, O'neil W

2017-03-01

In response to toxic stressors, cancer cells defend themselves by mobilizing one or more epidermal growth factor receptor (EGFR) cascades that employ xeroderma pigmentosum-A (XPA) to repair damaged genes. Recent experiments discovered that neurons within the auditory nerve exhibit basal levels of EGFR+XPA co-expression. This finding implied that auditory neurons in particular or neurons in general have the capacity to mobilize an EGFR+XPA defense. Therefore, the current study tested the hypothesis that noise stress would alter the expression pattern of EGFR/XPA within the auditory nerve. Design-based stereology was used to quantify the proportion of neurons that expressed EGFR, XPA, and EGFR+XPA with and without noise stress. The results revealed an intricate neuronal response that is suggestive of alterations to both co-expression and individual expression of EGFR and XPA. In both the apical and middle cochlear coils, the noise stress depleted EGFR+XPA expression. Furthermore, there was a reduction in the proportion of neurons that expressed XPA-alone in the middle coils. However, the noise stress caused a significant increase in the proportion of neurons that expressed EGFR-alone in the middle coils. The basal cochlear coils failed to mobilize a significant response to the noise stress. These results suggest that EGFR and XPA might be part of the molecular defense repertoire of the auditory nerve.

Noise Stress Induces an Epidermal Growth Factor Receptor/Xeroderma Pigmentosum–A Response in the Auditory Nerve

Science.gov (United States)

Guthrie, O’neil W.

2017-01-01

In response to toxic stressors, cancer cells defend themselves by mobilizing one or more epidermal growth factor receptor (EGFR) cascades that employ xeroderma pigmentosum–A (XPA) to repair damaged genes. Recent experiments discovered that neurons within the auditory nerve exhibit basal levels of EGFR+XPA co-expression. This finding implied that auditory neurons in particular or neurons in general have the capacity to mobilize an EGFR+XPA defense. Therefore, the current study tested the hypothesis that noise stress would alter the expression pattern of EGFR/XPA within the auditory nerve. Design-based stereology was used to quantify the proportion of neurons that expressed EGFR, XPA, and EGFR+XPA with and without noise stress. The results revealed an intricate neuronal response that is suggestive of alterations to both co-expression and individual expression of EGFR and XPA. In both the apical and middle cochlear coils, the noise stress depleted EGFR+XPA expression. Furthermore, there was a reduction in the proportion of neurons that expressed XPA-alone in the middle coils. However, the noise stress caused a significant increase in the proportion of neurons that expressed EGFR-alone in the middle coils. The basal cochlear coils failed to mobilize a significant response to the noise stress. These results suggest that EGFR and XPA might be part of the molecular defense repertoire of the auditory nerve. PMID:28056182

Development of epidermal growth factor receptor targeted therapy in pancreatic cancer.

Science.gov (United States)

Qing, Liu; Qing, Wang

2018-02-01

The epidermal growth factor receptor (EGFR) family are a series of important cancer therapeutic targets involved in cancer biology. These genes play an important role in tumor biological characteristics including angiogenesis, cell survival, invasion and glucose metabolism. In recent years, progresses have been achieved upon the cellular and molecular biological characteristics of EGFR and its role in cancer development based on the study of tumor specimens and experimental animal model. EGFR(HER1/ErbB) is overexpressed in over sixty percent of triple-negative breast cancers and occurs in pancreatic, bladder, lung and head-and-neck cancers. Up to now, EGFR inhibitors have been applied in various of cancer, such as lung, breast, bladder and head and neck cancers etc., in which the combination of EGFR inhibitors plus chemotherapeutic agents is now seen as the standard of care for advanced/metastatic pancreatic cancer. For these reasons, EGFR inhibitors and their therapeutic effect for pancreatic cancer is becoming the focus in Laboratory and clinical research. In this paper, research progress of the development of epidermal growth factor receptor targeted therapy in pancreatic cancer is introduced.

Effect of X-ray irradiation on morphophysiological reactions of epidermal melanophor cells in the larvae of Rana temporaria L

International Nuclear Information System (INIS)

Popov, D.V.; Kalistratova, E.N.; Kaluzhina, A.V.

1982-01-01

Dynamics of physiological reactions of epidermal melanophors of larvae Rana temporaria L.. adapted to white and black backgrounds and irradiated with a dose of 700 R has been investigated. Ouring the first day after irradiation no day changes of melanophor index characteristic of intact tadpoles were discovered in whitebackground animals; melanophors preserve the aggregation state. Comparison of black background irradiated and control larvae didn't show confident differences in changes of their melanophor indices. Irradiation affects differently epidermal melanophors in the state of pigment dispersion and aggregation. It is suggested that pigment dispersion and aggregation in melanophor is realized at the expense of different cellular structures. It is shown that by the end of the experiment (21-st day) the amount of epidermal melanophor per surface unit is two times larger in black-ground larvae. General biological signaficance of revealed facts from the point of view of ontogenesis evolution is discussed

Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.

Science.gov (United States)

Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali

2016-03-01

Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dependence of EGF-Induced Increases in Corneal Epithelial Proliferation and Migration on GSK-3 Inactivation

Science.gov (United States)

2009-10-01

during epidermal growth factor-stimulated actin nucleation in breast cancer cells. J Biol Chem. 2000;275:3741–3744. 27. Jope RS, Johnson GV. The...injury-induced corneal epi- thelial wound closure.1,2 This cytokine induces increases in cell proliferation and migration through activation of its cog ...occurs between the PI3-K and the ERK pathways in colon cancer cell lines.12 Without a cytokine, GSK-3 is dephosphorylated and constitutively active

THE PROSPECTIVE OBSERVATIONAL STUDY ON CUTANEOUS ADVERSE DRUG REACTIONS TO CHEMOTHERAPY

Directory of Open Access Journals (Sweden)

Prakash Mani

2016-07-01

Full Text Available INTRODUCTION There are a wide spectrum of adverse cutaneous drug reactions (ACDRs varying from transient maculopapular rash to fatal toxic epidermal necrolysis (TEN. With the advent of newer and targeted therapy in the field of dermatology, the pattern of cutaneous adverse drug eruptions and the drugs responsible for them keep changing every year. Hence, this study was undertaken to ascertain the clinical spectrum of ACDRs and the causative drugs, in a tertiary care centre in South India. MATERIALS AND METHODS This study was a prospective, observational study conducted in Department of Medical Oncology, Government Rajaji Hospital, Madurai Medical College, Madurai during the period of March 2015 - August 2015 (6 months. Severity of the reaction was assessed using CTCAE (Common Terminology Criteria for Adverse Events scale version 4.1. Causality of the drug was assessed using Naranjo Causality Assessment Scale. The scale was calculated first for the regimen and then for individual drugs separately. The adverse events with score of 6 or more (probable and definite adverse events were taken for the study. RESULTS AND CONCLUSION The overall incidence of ACDRs found in this study was 85%. Alopecia was the commonest ACDR occurring in 51.6% of patients. Nail pigmentation and supravenous pigmentation were the next common ACDRs, recorded in 35% and 16% of patients respectively. Imatinib caused generalised hypopigmentation in 40% of patients. Bleomycin induced, flagellate erythema and pigmentation in 17% of patients and stomatitis was seen in 11% of patients. Acneiform eruptions were recorded with erlotinib and gefitinib therapy. Supravenous pigmentation was common with 5-fluorouracil and docetaxel, occurring in 53% & 48% respectively. Newer targeted therapies like EGFR (Epidermal growth factor receptor inhibitors recorded low incidence of ACDRs like alopecia as against conventional antineoplastic agents. The cancer chemotherapeutic drugs are associated

Dermal matrix proteins initiate re-epithelialization but are not sufficient for coordinated epidermal outgrowth in a new fish skin culture model.

Science.gov (United States)

Matsumoto, Reiko; Sugimoto, Masazumi

2007-02-01

We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.

Comparison of 30% salicylic acid with jessner's solution for superficial chemical peeling in epidermal melasma

International Nuclear Information System (INIS)

Ejaz, A.; Raza, N.; Iftikhar, N.; Muzzafar, F.

2008-01-01

To compare the efficacy and safety of Jessner's solution with 30% salicylic acid as superficial chemical peeling agents in treating epidermal melasma in Asian skin. Sixty consenting patients with epidermal melasma were randomly divided into two groups. Group A was treated with Jessner's solution and Group B with 30% salicylic acid. Baseline Melasma Area Severity Index (MASI) score was noted and peeling started at 2-weekly intervals. Sunscreen in morning and moisturizer at night were prescribed in all patients. MASI score and adverse effects were recorded biweekly. Treatment was stopped at 12 weeks and patients were followed-up at 4 weekly intervals for further 12 weeks. Final MASI score and adverse effects were noted at the end of follow-up period. Mean MASI scores were compared using paired sample t-test and one-way ANOVA. Difference in baseline, treatment end and follow-up end MASI scores was not statistically significant between the two groups (p=0.54, 0.26, and 0.55 respectively). On the other hand, within group analysis of difference between pre and posttreatment MASI score was highly significant in both groups (p < 0.0001). Adverse effects were mild and comparable in both groups. Jessner's solution and 30% salicylic acid are equally effective and safe peeling agents for use in epidermal melasma in Asian skin. (author)

Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

Science.gov (United States)

Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

2017-01-01

Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

Directory of Open Access Journals (Sweden)

Andreas Bayer

2017-01-01

Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

Therapeutic potential of a non-steroidal bifunctional anti-inflammatory and anti-cholinergic agent against skin injury induced by sulfur mustard

Energy Technology Data Exchange (ETDEWEB)

Chang, Yoke-Chen; Wang, James D.; Hahn, Rita A.; Gordon, Marion K.; Joseph, Laurie B. [Department of Pharmacology and Toxicology, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Department of Environmental Science, New York Medical College, Valhalla, NY (United States); Heindel, Ned D. [Department of Chemistry, Lehigh University, Bethlehem, PA (United States); Young, Sherri C. [Department of Chemistry, Muhlenberg College, Allentown, PA (United States); Sinko, Patrick J. [Department of Pharmaceutics, Rutgers University, Piscataway, NJ (United States); Casillas, Robert P. [MRIGlobal, Kansas City, MO (United States); Laskin, Jeffrey D. [Environmental and Occupational Medicine, Robert Wood Johnson Medical School, Rutgers University, Piscataway, NJ (United States); Laskin, Debra L. [Department of Pharmacology and Toxicology, Rutgers University, Piscataway, NJ (United States); Gerecke, Donald R., E-mail: gerecke@eohsi.rutgers.edu [Department of Pharmacology and Toxicology, Rutgers University, Piscataway, NJ (United States)

2014-10-15

Sulfur mustard (bis(2-chloroethyl) sulfide, SM) is a highly reactive bifunctional alkylating agent inducing edema, inflammation, and the formation of fluid-filled blisters in the skin. Medical countermeasures against SM-induced cutaneous injury have yet to be established. In the present studies, we tested a novel, bifunctional anti-inflammatory prodrug (NDH 4338) designed to target cyclooxygenase 2 (COX2), an enzyme that generates inflammatory eicosanoids, and acetylcholinesterase, an enzyme mediating activation of cholinergic inflammatory pathways in a model of SM-induced skin injury. Adult SKH-1 hairless male mice were exposed to SM using a dorsal skin vapor cup model. NDH 4338 was applied topically to the skin 24, 48, and 72 h post-SM exposure. After 96 h, SM was found to induce skin injury characterized by edema, epidermal hyperplasia, loss of the differentiation marker, keratin 10 (K10), upregulation of the skin wound marker keratin 6 (K6), disruption of the basement membrane anchoring protein laminin 322, and increased expression of epidermal COX2. NDH 4338 post-treatment reduced SM-induced dermal edema and enhanced skin re-epithelialization. This was associated with a reduction in COX2 expression, increased K10 expression in the suprabasal epidermis, and reduced expression of K6. NDH 4338 also restored basement membrane integrity, as evidenced by continuous expression of laminin 332 at the dermal–epidermal junction. Taken together, these data indicate that a bifunctional anti-inflammatory prodrug stimulates repair of SM induced skin injury and may be useful as a medical countermeasure. - Highlights: • Bifunctional anti-inflammatory prodrug (NDH4338) tested on SM exposed mouse skin • The prodrug NDH4338 was designed to target COX2 and acetylcholinesterase. • The application of NDH4338 improved cutaneous wound repair after SM induced injury. • NDH4338 treatment demonstrated a reduction in COX2 expression on SM injured skin. • Changes of skin repair

IDENTIFICATION AND AUTHENTICATION OF DRY SAMPLES OF SOME MEDICINAL PLANTS USING LEAF EPIDERMAL FEATURES AS MARKER

Directory of Open Access Journals (Sweden)

Abdullahi Alanamu ABDULRAHAMAN

2016-06-01

Full Text Available Herbal medicine is the oldest and still the most widely used system of medicine in the world today and they are made exclusively from plants. However, most of these medicines or drugs are adulterated due to lack of proper identification of the plant samples. Method of checking adulteration of drug plants is the main focus of this study. The identification and authentication of dry samples of some medicinal plants were carried out using anatomical features. Twenty-five (25 plants materials were collected in Ibadan and Ilorin, Nigeria. The plants studied include Azardiracta indica, Newboudia leavis, Polyalthia longifolia, Cymbopogon citratus, Anarcardium occidentalis, Nicotiana tobbaccum, Jatropha curcas, Chromoleana odorata, Mangifera indica, Terminalia catappa, Ocimum gratisimum, Morus messosygia, Morinda lucida, Psidium guajava, Vitellaria paradoxa, Annona senegalensis, Vernonia amygdalina, Gliricidium sepium, Ravoulvia vomitora, Telferia occindentalis Citrus aurantifolia, C. limon, C. paradisi and C. sinensis. Leaf epidermal anatomy of these selected plants showed no major variations in stomatal complex types, frequency, size and shape of stomatal cells, epidermal cell wall and trichomes between fresh and dry samples. The variations that occur were between different species but not within species. Leaf epidermal anatomy, therefore, proved to be a significant tool for resolution of taxonomic confusion of dried samples of these plants.

Epidermal growth factor regulation of glutathione S-transferase gene expression in the rat is mediated by class Pi glutathione S-transferase enhancer I.

Science.gov (United States)

Matsumoto, M; Imagawa, M; Aoki, Y

2000-07-01

Using chloramphenicol acetyltransferase assays we showed that epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha), and 3,3',4,4',5-pentachlorobiphenyl (PenCB) induce class Pi glutathione S-transferase (GSTP1) in primary cultured rat liver parenchymal cells. GSTP1 enhancer I (GPEI), which is required for the stimulation of GSTP1 expression by PenCB, also mediates EGF and TGF alpha stimulation of GSTP1 gene expression. However, hepatocyte growth factor and insulin did not stimulate GPEI-mediated gene expression. On the other hand, the antioxidant reagents butylhydroxyanisole and t-butylhydroquinone, stimulated GPEI-mediated gene expression, but the level of GSTP1 mRNA was not elevated. Our observations suggest that EGF and TGF alpha induce GSTP1 by the same signal transduction pathway as PenCB. Since the sequence of GPEI is similar to that of the antioxidant responsive element (ARE), some factors which bind to ARE might play a role in GPEI-mediated gene expression.

Comparative Genomics Identifies Epidermal Proteins Associated with the Evolution of the Turtle Shell.

Science.gov (United States)

Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

2016-03-01

The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

In vitro transformation of primary cultures of neonatal BALB/c mouse epidermal cells with ultraviolet-B radiation

International Nuclear Information System (INIS)

Ananthaswamy, H.N.; Kripke, M.L.

1981-01-01

Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients

Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

Directory of Open Access Journals (Sweden)

Yasuaki Kobayashi

Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

Combined Stimulation with the Tumor Necrosis Factor α and the Epidermal Growth Factor Promotes the Proliferation of Hepatocytes in Rat Liver Cultured Slices

Directory of Open Access Journals (Sweden)

Francis Finot

2012-01-01

Full Text Available The culture liver slices are mainly used to investigate drug metabolism and xenobiotic-mediated liver injuries while apoptosis and proliferation remain unexplored in this culture model. Here, we show a transient increase in LDH release and caspase activities indicating an ischemic injury during the slicing procedure. Then, caspase activities decrease and remain low in cultured slices demonstrating a low level of apoptosis. The slicing procedure is also associated with the G0/G1 transition of hepatocytes demonstrated by the activation of stress and proliferation signalling pathways including the ERK1/2 and JNK1/2/3 MAPKinases and the transient upregulation of c-fos. The cells further progress up to mid-G1 phase as indicated by the sequential induction of c-myc and p53 mRNA levels after the slicing procedure and at 24 h of culture, respectively. The stimulation by epidermal growth factor induces the ERK1/2 phosphorylation but fails to activate expression of late G1 and S phase markers such as cyclin D1 and Cdk1 indicating that hepatocytes are arrested in mid-G1 phase of the cell cycle. However, we found that combined stimulation by the proinflammatory cytokine tumor necrosis factor α and the epidermal growth factor promotes the commitment to DNA replication as observed in vivo during the liver regeneration.

Time-dependent effect of orchidectomy on vascular nitric oxide and thromboxane A2 release. Functional implications to control cell proliferation through activation of the epidermal growth factor receptor.

Directory of Open Access Journals (Sweden)

Marta del Campo

Full Text Available This study analyzes whether the release of nitric oxide (NO and thromboxane A2 (TXA2 depends on the time lapsed since gonadal function is lost, and their correlation with the proliferation of vascular smooth muscle cells (VSMC mediated by the epidermal growth factor receptor (EGFR. For this purpose, aortic and mesenteric artery segments from control and 6-weeks or 5-months orchidectomized rats were used to measure NO and TXA2 release. The results showed that the basal and acetylcholine (ACh-induced NO release were decreased 6 weeks post-orchidectomy both in aorta and mesenteric artery, but were recovered 5 months thereafter up to levels similar to those found in arteries from control rats. The basal and ACh-induced TXA2 release increased in aorta and mesenteric artery 6 weeks post-orchidectomy, and was maintained at high levels 5 months thereafter. Since we previously observed that orchidectomy, which decreased testosterone level, enlarged the muscular layer of mesenteric arteries, the effect of testosterone on VSMC proliferation was analyzed. The results showed that treatment of cultured VSMC with testosterone downregulated mitogenic signaling pathways initiated by the ligand-dependent activation of the EGFR. In contrast, the EGFR pathways were constitutively active in mesenteric arteries of long-term orchidectomized rats. Thus, the exposure of mesenteric arteries from control rats to epidermal growth factor (EGF induced the activation of EGFR signaling pathways. However, the addition of EGF to arteries from orchidectomized rats failed to induce a further activation of these pathways. In conclusion, this study shows that the release of NO depends on the time lapsed since the gonadal function is lost, while the release of TXA2 is already increased after short periods post-orchidectomy. The alterations in these signaling molecules could contribute to the constitutive activation of the EGFR and its downstream signaling pathways after long period

Chronic treatment with epidermal growth factor causes esophageal epithelial hyperplasia in pigs and rats

DEFF Research Database (Denmark)

Juhl, C O; Vinter-Jensen, Lars; Poulsen, Steen Seier

1995-01-01

Epidermal growth factor (EGF) is an important factor for maintaining the esophageal functional integrity. Goettingen minipigs were treated with either placebo or subcutaneous EGF (30 micrograms/kg/day) for four weeks. Wistar rats were treated with either placebo or subcutaneous EGF (150 microgram...

Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

NARCIS (Netherlands)

Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.

2015-01-01

Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis

Transient expression of P-type ATPases in tobacco epidermal cells

DEFF Research Database (Denmark)

Pedas, Lisbeth Rosager; Palmgren, Michael Broberg; Lopez Marques, Rosa Laura

2016-01-01

Transient expression in tobacco cells is a convenient method for several purposes such as analysis of protein-protein interactions and the subcellular localization of plant proteins. A suspension of Agrobacterium tumefaciens cells carrying the plasmid of interest is injected into the intracellula...... for example protein-protein interaction studies. In this chapter, we describe the procedure to transiently express P-type ATPases in tobacco epidermal cells, with focus on subcellular localization of the protein complexes formed by P4-ATPases and their β-subunits....

Serum and mucosal immune responses to an inactivated influenza virus vaccine induced by epidermal powder immunization.

Science.gov (United States)

Chen, D; Periwal, S B; Larrivee, K; Zuleger, C; Erickson, C A; Endres, R L; Payne, L G

2001-09-01

Both circulating and mucosal antibodies are considered important for protection against infection by influenza virus in humans and animals. However, current inactivated vaccines administered by intramuscular injection using a syringe and needle elicit primarily circulating antibodies. In this study, we report that epidermal powder immunization (EPI) via a unique powder delivery system elicits both serum and mucosal antibodies to an inactivated influenza virus vaccine. Serum antibody responses to influenza vaccine following EPI were enhanced by codelivery of cholera toxin (CT), a synthetic oligodeoxynucleotide containing immunostimulatory CpG motifs (CpG DNA), or the combination of these two adjuvants. In addition, secretory immunoglobulin A (sIgA) antibodies were detected in the saliva and mucosal lavages of the small intestine, trachea, and vaginal tract, although the titers were much lower than the IgG titers. The local origin of the sIgA antibodies was further shown by measuring antibodies released from cultured tracheal and small intestinal fragments and by detecting antigen-specific IgA-secreting cells in the lamina propria using ELISPOT assays. EPI with a single dose of influenza vaccine containing CT or CT and CpG DNA conferred complete protection against lethal challenges with an influenza virus isolated 30 years ago, whereas a prime and boost immunizations were required for protection in the absence of an adjuvant. The ability to elicit augmented circulating antibody and mucosal antibody responses makes EPI a promising alternative to needle injection for administering vaccines against influenza and other diseases.

Enterocyte-specific epidermal growth factor prevents barrier dysfunction and improves mortality in murine peritonitis.

Science.gov (United States)

Clark, Jessica A; Gan, Heng; Samocha, Alexandr J; Fox, Amy C; Buchman, Timothy G; Coopersmith, Craig M

2009-09-01

Systemic administration of epidermal growth factor (EGF) decreases mortality in a murine model of septic peritonitis. Although EGF can have direct healing effects on the intestinal mucosa, it is unknown whether the benefits of systemic EGF in peritonitis are mediated through the intestine. Here, we demonstrate that enterocyte-specific overexpression of EGF is sufficient to prevent intestinal barrier dysfunction and improve survival in peritonitis. Transgenic FVB/N mice that overexpress EGF exclusively in enterocytes (IFABP-EGF) and wild-type (WT) mice were subjected to either sham laparotomy or cecal ligation and puncture (CLP). Intestinal permeability, expression of the tight junction proteins claudins-1, -2, -3, -4, -5, -7, and -8, occludin, and zonula occludens-1; villus length; intestinal epithelial proliferation; and epithelial apoptosis were evaluated. A separate cohort of mice was followed for survival. Peritonitis induced a threefold increase in intestinal permeability in WT mice. This was associated with increased claudin-2 expression and a change in subcellular localization. Permeability decreased to basal levels in IFABP-EGF septic mice, and claudin-2 expression and localization were similar to those of sham animals. Claudin-4 expression was decreased following CLP but was not different between WT septic mice and IFABP-EGF septic mice. Peritonitis-induced decreases in villus length and proliferation and increases in apoptosis seen in WT septic mice did not occur in IFABP-EGF septic mice. IFABP-EGF mice had improved 7-day mortality compared with WT septic mice (6% vs. 64%). Since enterocyte-specific overexpression of EGF is sufficient to prevent peritonitis-induced intestinal barrier dysfunction and confers a survival advantage, the protective effects of systemic EGF in septic peritonitis appear to be mediated in an intestine-specific fashion.

Epidermal growth factor improves survival and prevents intestinal injury in a murine model of pseudomonas aeruginosa pneumonia.

Science.gov (United States)

Dominguez, Jessica A; Vithayathil, Paul J; Khailova, Ludmila; Lawrance, Christopher P; Samocha, Alexandr J; Jung, Enjae; Leathersich, Ann M; Dunne, W Michael; Coopersmith, Craig M

2011-10-01

Mortality from pneumonia is mediated, in part, through extrapulmonary causes. Epidermal growth factor (EGF) has broad cytoprotective effects, including potent restorative properties in the injured intestine. The purpose of this study was to determine the efficacy of EGF treatment following Pseudomonas aeruginosa pneumonia. FVB/N mice underwent intratracheal injection of either P. aeruginosa or saline and were then randomized to receive either systemic EGF or vehicle beginning immediately or 24 h after the onset of pneumonia. Systemic EGF decreased 7-day mortality from 65% to 10% when initiated immediately after the onset of pneumonia and to 27% when initiated 24 h after the onset of pneumonia. Even though injury in pneumonia is initiated in the lungs, the survival advantage conferred by EGF was not associated with improvements in pulmonary pathology. In contrast, EGF prevented intestinal injury by reversing pneumonia-induced increases in intestinal epithelial apoptosis and decreases in intestinal proliferation and villus length. Systemic cytokines and kidney and liver function were unaffected by EGF therapy, although EGF decreased pneumonia-induced splenocyte apoptosis. To determine whether the intestine was sufficient to account for extrapulmonary effects induced by EGF, a separate set of experiments was done using transgenic mice with enterocyte-specific overexpression of EGF (IFABP-EGF [intestinal fatty acid-binding protein linked to mouse EGF] mice), which were compared with wild-type mice subjected to pneumonia. IFABP-EGF mice had improved survival compared with wild-type mice following pneumonia (50% vs. 28%, respectively, P < 0.05) and were protected from pneumonia-induced intestinal injury. Thus, EGF may be a potential adjunctive therapy for pneumonia, mediated in part by its effects on the intestine.