WorldWideScience

Sample records for epidermal keratinocytes hacat

  1. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  2. Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells

    Science.gov (United States)

    Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan

    2016-01-01

    Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify keratinocyte differentiation, we performed western blots using a specific antibody for involucrin, which is a precursor protein of the keratinocyte cornified envelope and a marker for keratinocyte terminal differentiation. We also performed quantitative polymerase chain reaction. We examined whether LDR induces changes in involucrin messenger RNA (mRNA) and protein levels in calcium-induced keratinocyte differentiation. Results Exposure of HaCaT cells to LDR (0.1 Gy) induced p21 expression. p21 is a key regulator that induces growth arrest and represses stemness, which accelerates keratinocyte differentiation. We correlated involucrin expression with keratinocyte differentiation, and examined the effects of LDR on involucrin levels and keratinocyte development. LDR significantly increased involucrin mRNA and protein levels during calcium-induced keratinocyte differentiation. Conclusion These studies provide new evidence for the biological role of LDR, and identify the potential to utilize LDR to regulate or induce keratinocyte differentiation. PMID:27489424

  3. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  4. Enhanced expression of IL-8 in normal human keratinocytes and human keratinocyte cell line HaCaT in vitro after stimulation with contact sensitizers, tolerogens and irritants.

    Science.gov (United States)

    Mohamadzadeh, M; Müller, M; Hultsch, T; Enk, A; Saloga, J; Knop, J

    1994-12-01

    To investigate the interleukin-8 production of keratinocytes after stimulation in vitro we have used various agents: (i) contact sensitizer (2,4-dinitrofluorobenzene, 3-n-pentadecylcatechol); (ii) tolerogen (5-methyl-3-n-pentadecylcatechol); (iii) irritant (sodium lauryl sulfate). Interleukin-8 gene expression was assessed by northern blot hybridization of the total cytoplasmic RNA extracted from subconfluent normal human keratinocyte cultures and the keratinocyte cell line HaCaT using a radiolabeled DNA probe specific for human interleukin-8. Interleukin-8 gene expression was markedly increased upon in vitro stimulation after 1-6 h with contact sensitizers, tolerogen and the irritant. In contrast, interleukin-8 production was not detectable in unstimulated normal human keratinocytes or the HaCaT keratinocyte cell line. These results suggest that the induction and production of interleukin-8 is a response to nonspecific stimuli and may play a critical role in the early response to immunogenic or inflammatory signals in man.

  5. Cobalt toxicity: Chemical and radiological combined effects on HaCaT keratinocyte cell line

    International Nuclear Information System (INIS)

    Sandre, C.; Moulin, C.; Bresson, C.; Gault, N.; Poncy, J. L.; Lefaix, J. L.

    2010-01-01

    Cobalt (Co) is an essential trace element well known as a constituent of vitamin B 12 , but different compounds of Co are also described as highly toxic and/or radio-toxic for individuals or the environment. In nuclear power plants, 58 Co and 60 Co are radioactive isotopes of cobalt present as activation products of stable Co and Ni used in alloys. Skin exposure is a current occupational risk in the hard metal and nuclear industries. As biochemical and molecular cobalt-induced toxicological mechanisms are not fully identified, we investigated cobalt toxicity in a model human keratinocyte cell line, HaCaT. In this study, we propose a model to determine the in vitro chemical impact on cell viability of a soluble form of cobalt (CoCl 2 ) with or without gamma-ray doses to mimic contamination by 60 Co, to elucidate the mechanisms of cobalt intracellular chemical and radiological toxicity. Intracellular cobalt concentration was determined after HaCaT cell contamination and chemical toxicity was evaluated in terms of cellular viability and clonogenic survival. We investigated damage to DNA in HaCaT cells by combined treatment with chemical cobalt and a moderate gamma-ray dose. Additive effects of cobalt and irradiation were demonstrated. The underlying mechanism of cobalt toxicity is not clearly established, but our results seem to indicate that the toxicity of Co(II) and of irradiation arises from production of reactive oxygen species. (authors)

  6. Cobalt toxicity: Chemical and radiological combined effects on HaCaT keratinocyte cell line

    Energy Technology Data Exchange (ETDEWEB)

    Gault, N. [CEA Fontenay aux Roses, DSV/IRCM/SCSR/LRTS, 92265 Fontenay aux Rose (France); Sandre, C.; Moulin, B.; Bresson, C. [CEA, DEN, SECR, Laboratoire de Speciation des Radionucleides et des Molecules, F-91191 Gif-sur-Yvette (France); Poncy, J.L. [CEA Bruyeres Le Chatel, DSV/IRCM/SREIT/LRT, 91680 Bruyeres Le Chatel (France); Lefaix, J.L. [CEA Caen, DSV/IRCM/SRO/LARIA, 14070 Caen (France)

    2010-07-01

    Cobalt (Co) is an essential trace element well known as a constituent of vitamin B12, but different compounds of Co are also described as highly toxic and/or radio-toxic for individuals or the environment. In nuclear power plants, {sup 58}Co and {sup 60}Co are radioactive isotopes of cobalt present as activation products of stable Co and Ni used in alloys. Skin exposure is a current occupational risk in the hard metal and nuclear industries. As biochemical and molecular cobalt-induced toxicological mechanisms are not fully identified, we investigated cobalt toxicity in a model human keratinocyte cell line, HaCaT. In this study, we propose a model to determine the in vitro chemical impact on cell viability of a soluble form of cobalt (CoCl{sub 2}) with or without {gamma}-ray doses to mimic contamination by {sup 60}Co, to elucidate the mechanisms of cobalt intracellular chemical and radiological toxicity. Intracellular cobalt concentration was determined after HaCaT cell contamination and chemical toxicity was evaluated in terms of cellular viability and clonogenic survival. We investigated damage to DNA in HaCaT cells by combined treatment with chemical cobalt and a moderate {gamma}-ray dose. Additive effects of cobalt and irradiation were demonstrated. The underlying mechanism of cobalt toxicity is not clearly established, but our results seem to indicate that the toxicity of Co(II) and of irradiation arises from production of reactive oxygen species. (authors)

  7. Cobalt toxicity: Chemical and radiological combined effects on HaCaT keratinocyte cell line

    Energy Technology Data Exchange (ETDEWEB)

    Sandre, C.; Moulin, C.; Bresson, C. [CEA Saclay, DEN, SECR, Lab Speciat Radionucleides and Mol, F-91191 Gif Sur Yvette (France); Gault, N. [CEA Fontenay Roses, DSV IRCM SCSR LRTS, F-92265 Fontenay Aux Roses (France); Poncy, J. L. [CEA Bruyeres Le Chatel, DSV IRCM SREIT LRT, F-91680 Bruyeres Le Chatel (France); Lefaix, J. L. [CEA Caen, DSV IRCM SRO LARIA, F-14070 Caen (France)

    2010-07-01

    Cobalt (Co) is an essential trace element well known as a constituent of vitamin B{sub 12}, but different compounds of Co are also described as highly toxic and/or radio-toxic for individuals or the environment. In nuclear power plants, {sup 58}Co and {sup 60}Co are radioactive isotopes of cobalt present as activation products of stable Co and Ni used in alloys. Skin exposure is a current occupational risk in the hard metal and nuclear industries. As biochemical and molecular cobalt-induced toxicological mechanisms are not fully identified, we investigated cobalt toxicity in a model human keratinocyte cell line, HaCaT. In this study, we propose a model to determine the in vitro chemical impact on cell viability of a soluble form of cobalt (CoCl{sub 2}) with or without gamma-ray doses to mimic contamination by {sup 60}Co, to elucidate the mechanisms of cobalt intracellular chemical and radiological toxicity. Intracellular cobalt concentration was determined after HaCaT cell contamination and chemical toxicity was evaluated in terms of cellular viability and clonogenic survival. We investigated damage to DNA in HaCaT cells by combined treatment with chemical cobalt and a moderate gamma-ray dose. Additive effects of cobalt and irradiation were demonstrated. The underlying mechanism of cobalt toxicity is not clearly established, but our results seem to indicate that the toxicity of Co(II) and of irradiation arises from production of reactive oxygen species. (authors)

  8. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. 5-fluorouracil Toxicity Mechanism Determination in Human Keratinocytes: in vitro Study on HaCaT

    Directory of Open Access Journals (Sweden)

    Jan Hartinger

    2018-01-01

    Full Text Available 5-fluorouracil (5-FU and capecitabine therapy is often accompanied by palmar-plantar erythrodysesthesia (PPE which is manifestation of 5-FU toxicity in keratinocytes. The main mechanisms of 5-FU action are thymidylate synthase (TS inhibition which can be abrogated by thymidine and strengthened by calciumfolinate (CF and incorporation of fluorouridinetriphosphate into RNA which can be abrogated by uridine. For proper PPE treatment 5-FU mechanism of action in keratinocytes needs to be elucidated. We used the 5-FU toxicity modulators uridine, thymidine and CF to discover the mechanism of 5-FU action in human keratinocyte cell line HaCaT. To measure the cellular viability, we used MTT test and RTCA test. CF did not augment 5-FU toxicity and 5-FU toxicity was weakened by uridine. Therefore, the primary mechanism of 5-FU toxicity in keratinocytes is 5-FU incorporation into RNA. The uridine protective effect cannot fully develop in the presence of CF. Thymidine addition to 5-FU and uridine treated cells not only prevents the toxicity-augmenting CF effect but it also prolongs the 5-FU treated cells survival in comparison to uridine only. Therefore, it can be assumed that in the presence of uridine the 5-FU toxicity mechanism is switched from RNA incorporation to TS inhibition. Although particular 5-FU toxicity mechanisms were previously described in various cell types, this is the first time when various combinations of pyrimidine nucleosides and CF were used for 5-FU toxicity mechanism elucidation in human keratinocytes. We suggest that for PPE treatment ointment containing uridine and thymidine should be further clinically tested.

  10. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress

    Science.gov (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  11. Glyphosate-induced stiffening of HaCaT keratinocytes, a Peak Force Tapping study on living cells.

    Science.gov (United States)

    Heu, Celine; Berquand, Alexandre; Elie-Caille, Celine; Nicod, Laurence

    2012-04-01

    The skin is the first physiological barrier, with a complex constitution, that provides defensive functions against multiple physical and chemical aggressions. Glyphosate is an extensively used herbicide that has been shown to increase the risk of cancer. Moreover there is increasing evidence suggesting that the mechanical phenotype plays an important role in malignant transformation. Atomic force microscopy (AFM) has emerged within the last decade as a powerful tool for providing a nanometer-scale resolution imaging of biological samples. Peak Force Tapping (PFT) is a newly released AFM-based investigation technique allowing extraction of chemical and mechanical properties from a wide range of samples at a relatively high speed and a high resolution. The present work uses the PFT technology to investigate HaCaT keratinocytes, a human epidermal cell line, and offers an original approach to study chemically-induced changes in the cellular mechanical properties under near-physiological conditions. These experiments indicate glyphosate induces cell membrane stiffening, and the appearance of cytoskeleton structures at a subcellular level, for low cytotoxic concentrations whereas cells exposed to IC50 (inhibitory concentration 50%) treatment exhibit control-like mechanical behavior despite obvious membrane damages. Quercetin, a well-known antioxidant, reverses the glyphosate-induced mechanical phenotype. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. The impact of extracellular syntaxin4 on HaCaT keratinocyte behavior

    International Nuclear Information System (INIS)

    Kadono, Nanako; Miyazaki, Takafumi; Okugawa, Yoji; Nakajima, Kiichiro; Hirai, Yohei

    2012-01-01

    Highlights: ► A subpopulation of syntaxin4 localizes extracellularly in the keratinocytes. ► Epimorphin and syntaxin4 confer the resistance to the oxidative stress. ► Epimorphin suppresses and syntaxin4 accelerates the CCE formation. ► The antagonistic peptide to syntaxin4 blocks the syntaxin4-dependent CCE formation. -- Abstract: Syntaxin4 belongs to t-SNARE protein family and functions as a vesicular fusion mediator in the plasma membrane in a wide variety of cell types. This protein resembles another family member, epimorphin, a subpopulation of which has been shown to be secreted extracellularly in order to exert signaling functions. Here, we demonstrate the secretion of syntaxin4 via a non-classical pathway and its extracellular functions by using the functionally normal keratinocyte HaCaT. Extracellularly presented syntaxin4 appeared to elicit many cell responses similar to epimorphin with an important exception: it clearly facilitated keratinocyte cornification. The circularized peptide ST4n1 was synthesized from the putative functional core of syntaxin4 (a.a. 103–108), which is equivalent to the previously generated antagonist of epimorphin, and neutralized this contradictory effect. Intriguingly, an epimorphin mutant (EP4M) in which the functional core was replaced by that of syntaxin4 behaved like epimorphin, which was again antagonized by ST4n1. Electrophoresis-based analyses demonstrated the distinct structure of syntaxin4 compared to epimorphin or EP4M. These results revealed, for the first time, the extracellular role of syntaxin4 and shed light on the division of the extracellular effects exerted by epimorphin and syntaxin4 on keratinocyte cornification.

  13. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  14. Metabolic activation of pyrrolizidine alkaloids leading to phototoxicity and photogenotoxicity in human HaCaT keratinocytes.

    Science.gov (United States)

    Wang, Chia-Chi; Xia, Qingsu; Li, Meng; Wang, Shuguang; Zhao, Yuewei; Tolleson, William H; Yin, Jun-Jie; Fu, Peter P

    2014-01-01

    Pyrrolizidine alkaloids, produced by a large number of poisonous plants with wide global distribution, are associated with genotoxicity, tumorigenicity, and hepatotoxicity in animals and humans. Mammalian metabolism converts pyrrolizidine alkaloids to reactive pyrrolic metabolites (dehydropyrrolizidine alkaloids) that form covalent protein and DNA adducts. Although a mechanistic understanding is currently unclear, pyrrolizidine alkaloids can cause secondary (hepatogenous) photosensitization and induce skin cancer. In this study, the phototoxicity of monocrotaline, riddelliine, dehydromonocrotaline, dehydroriddelliine, and dehydroretronecine (DHR) in human HaCaT keratinocytes under ultraviolet A (UVA) irradiation was determined. UVA irradiation of HaCaT cells treated with dehydromonocrotaline, dehydroriddelline, and DHR resulted in increased release of lactate dehydrogenase and enhanced photocytotoxicity proportional to the UVA doses. UVA-induced photochemical DNA damage also increased proportionally with dehydromonocrotaline and dehydroriddelline. UVA treatment potentiated the formation of 8-hydroxy-2'-deoxyguanosine DNA adducts induced by dehydromonocrotaline in HaCaT skin keratinocytes. Using electron spin resistance trapping, we found that UVA irradiation of dehydromonocrotaline and dehydroriddelliine generates reactive oxygen species (ROS), including hydroxyl radical, singlet oxygen, and superoxide, and electron transfer reactions, indicating that cytotoxicity and genotoxicity of these compounds could be mediated by ROS. Our results suggest that dehydropyrrolizidine alkaloids formed or delivered to the skin cause pyrrolizidine alkaloid-induced secondary photosensitization and possible skin cancer.

  15. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  16. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  17. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  18. Effects of Wannachawee Recipe with Antipsoriatic Activity on Suppressing Inflammatory Cytokine Production in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mingkwan Na Takuathung

    2017-01-01

    Full Text Available Psoriasis is a chronic inflammatory and immune-mediated skin disease. The pathogenesis involves T cells activation via the IL-23/Th17 axis. Conventional treatments of psoriasis have adverse events influencing patients’ adherence. Wannachawee Recipe (WCR has been effectively used as Thai folk remedy for psoriasis patients; however, preclinical evidence defining how WCR works is still lacking. This study defined mechanisms for its antiproliferation and anti-inflammatory effects in HaCaT cells. The cytotoxicity and antiproliferation results from SRB and CCK-8 assays showed that WCR inhibited the growth and viability of HaCaT cells in a concentration-dependent manner. The distribution of cell cycle phases determined by flow cytometry showed that WCR did not interrupt cell cycle progression. Interestingly, RT-qPCR revealed that WCR significantly decreased the mRNA expression of IL-1β, IL-6, IL-8, IL-17A, IL-22, IL-23, and TNF-α but induced IL-10 expression in TNF-α- and IFN-γ-induced HaCaT cells. At the protein level determined by ELISA, WCR significantly reduced the secretion of IL-17A, IL-22, and IL-23. The WCR at low concentrations was proved to possess anti-inflammatory effect without cytotoxicity and it did not interfere with cell cycle of keratinocytes. This is the first study to provide convincing evidence that WCR is a potential candidate for development of effective psoriasis therapies.

  19. Incoming human papillomavirus 16 genome is lost in PML protein-deficient HaCaT keratinocytes.

    Science.gov (United States)

    Bienkowska-Haba, Malgorzata; Luszczek, Wioleta; Keiffer, Timothy R; Guion, Lucile G M; DiGiuseppe, Stephen; Scott, Rona S; Sapp, Martin

    2017-05-01

    Human papillomaviruses (HPVs) target promyelocytic leukemia (PML) nuclear bodies (NBs) during infectious entry and PML protein is important for efficient transcription of incoming viral genome. However, the transcriptional down regulation was shown to be promoter-independent in that heterologous promoters delivered by papillomavirus particles were also affected. To further investigate the role of PML protein in HPV entry, we used small hairpin RNA to knockdown PML protein in HaCaT keratinocytes. Confirming previous findings, PML knockdown in HaCaT cells reduced HPV16 transcript levels significantly following infectious entry without impairing binding and trafficking. However, when we quantified steady-state levels of pseudogenomes in interphase cells, we found strongly reduced genome levels compared with parental HaCaT cells. Because nuclear delivery was comparable in both cell lines, we conclude that viral pseudogenome must be removed after successful nuclear delivery. Transcriptome analysis by gene array revealed that PML knockdown in clonal HaCaT cells was associated with a constitutive interferon response. Abrogation of JAK1/2 signaling prevented genome loss, however, did not restore viral transcription. In contrast, knockdown of PML protein in HeLa cells did not affect HPV genome delivery and transcription. HeLa cells are transformed by HPV18 oncogenes E6 and E7, which have been shown to interfere with the JAK/Stat signaling pathway. Our data imply that PML NBs protect incoming HPV genomes. Furthermore, they provide evidence that PML NBs are key regulators of the innate immune response in keratinocytes. Promyelocytic leukemia nuclear bodies (PML NBs) are important for antiviral defense. Many DNA viruses target these subnuclear structures and reorganize them. Reorganization of PML NBs by viral proteins is important for establishment of infection. In contrast, HPVs require the presence of PML protein for efficient transcription of incoming viral genome. Our

  20. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  1. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  2. Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells

    OpenAIRE

    Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan; Ahn, Kyu Joong

    2016-01-01

    Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify kera...

  3. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  4. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  5. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  6. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  7. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  8. The Hsp90 inhibitor 17-AAG represses calcium-induced cytokeratin 1 and 10 expression in HaCaT keratinocytes.

    Science.gov (United States)

    Miyoshi, Sadanori; Yamazaki, Shota; Uchiumi, Asato; Katagata, Yohtaro

    2012-01-01

    Hsp90 is essential for maintaining the activity of numerous signaling factors, and plays a key role in cellular signal transduction networks. 17-Allylamino-17-demethoxygeldanamycin (17-AAG) is an ansamycin antibiotic that binds to Hsp90 and inhibits its function. HaCaT human keratinocytes were used to investigate the cellular and molecular functions of Hsp90 in keratinocyte differentiation. Inhibition of Hsp90 by 17-AAG leads to downregulation of the differentiation markers cytokeratin 1 and cytokeratin 10 at the protein and mRNA levels.

  9. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells

    International Nuclear Information System (INIS)

    Kim, Hyeon Ho; Lee, Youngae; Eun, Hee Chul; Chung, Jin Ho

    2008-01-01

    Eicosapentaenoic acid (EPA) is an omega-3 (ω-3) polyunsaturated fatty acid (PUFA), which has anti-inflammatory and anti-cancer properties. Some reports have demonstrated that EPA inhibits NF-κB activation induced by tumor necrosis factor (TNF)-α or lipopolysaccharide (LPS) in various cells. However, its detailed mode of action is unclear. In this report, we investigated whether EPA inhibits the expression of TNF-α-induced matrix metalloproteinases (MMP)-9 in human immortalized keratinocytes (HaCaT). TNF-α induced MMP-9 expression by NF-κB-dependent pathway. Pretreatment of EPA inhibited TNF-α-induced MMP-9 expression and p65 phosphorylation. However, EPA could not affect IκB-α phosphorylation, nuclear translocation of p65, and DNA binding activity of NF-κB. EPA inhibited TNF-α-induced p65 phosphorylation through p38 and Akt inhibition and this inhibition was IKKα-dependent event. Taken together, we demonstrate that EPA inhibits TNF-α-induced MMP-9 expression through inhibition of p38 and Akt activation

  10. Eupafolin nanoparticles protect HaCaT keratinocytes from particulate matter-induced inflammation and oxidative stress

    Science.gov (United States)

    Lin, Zih-Chan; Lee, Chiang-Wen; Tsai, Ming-Horng; Ko, Horng-Huey; Fang, Jia-You; Chiang, Yao-Chang; Liang, Chan-Jung; Hsu, Lee-Fen; Hu, Stephen Chu-Sung; Yen, Feng-Lin

    2016-01-01

    Exposure to particulate matter (PM), a major form of air pollution, can induce oxidative stress and inflammation and may lead to many diseases in various organ systems including the skin. Eupafolin, a flavonoid compound derived from Phyla nodiflora, has been previously shown to exhibit various pharmacological activities, including antioxidant and anti-inflammatory effects. Unfortunately, eupafolin is characterized by poor water solubility and skin penetration, which limits its clinical applications. To address these issues, we successfully synthesized a eupafolin nanoparticle delivery system (ENDS). Our findings showed that ENDS could overcome the physicochemical drawbacks of raw eupafolin with respect to water solubility and skin penetration, through reduction of particle size and formation of an amorphous state with hydrogen bonding. Moreover, ENDS was superior to raw eupafolin in attenuating PM-induced oxidative stress and inflammation in HaCaT keratinocytes, by mediating the antioxidant pathway (decreased reactive oxygen species production and nicotinamide adenine dinucleotide phosphate oxidase activity) and anti-inflammation pathway (decreased cyclooxygenase-2 expression and prostaglandin E2 production through downregulation of mitogen-activated protein kinase and nuclear factor-κB signaling). In summary, ENDS shows better antioxidant and anti-inflammatory activities than raw eupafolin through improvement of water solubility and skin penetration. Therefore, ENDS may potentially be used as a medicinal drug and/or cosmeceutical product to prevent PM-induced skin inflammation. PMID:27570454

  11. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  12. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  13. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    International Nuclear Information System (INIS)

    Mera, Kentaro; Kawahara, Ko-ichi; Tada, Ko-ichi; Kawai, Kazuhiro; Hashiguchi, Teruto; Maruyama, Ikuro; Kanekura, Takuro

    2010-01-01

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-Lα, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm 2 irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm 2 UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  14. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  15. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  16. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  17. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  19. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

  20. Protective effect of indole-3-pyruvate against ultraviolet b-induced damage to cultured HaCaT keratinocytes and the skin of hairless mice.

    Directory of Open Access Journals (Sweden)

    Reiji Aoki

    Full Text Available Previous investigations demonstrated that pyruvate protects human keratinocytes against cell damage stemming from exposure to ultraviolet B (UVB radiation. This study endeavoured to elucidate the protective capacity of aromatic pyruvates (e.g., phenylpyruvate (PPyr, 4-hydroxyphenylpyruvate (HPPyr, and indole-3-pyruvate (IPyr against UVB-induced injury to skin cells, both in vitro and in vivo. Cultured human HaCaT keratinocytes were irradiated with UVB light (60 mJ/cm2 and maintained with or without test compounds (1-25 mM.In addition, the dorsal skin of hairless mice (HR-1 was treated with test compounds (10 μmol and exposed to UVB light (1 J/cm2 twice [corrected]. The ability of the test compounds to ameliorate UVB-induced cytotoxicity and inflammation was then assessed. Aromatic pyruvates reduced cytotoxicity in UVB-irradiated HaCaT keratinocytes, and also diminished the expression of interleukin 1β (IL-1β and interleukin 6 (IL-6. IPyr was more efficacious than either PPyr or HPPyr. Furthermore, only IPyr inhibited cyclooxygenase-2 (Cox-2 expression at both the mRNA and the protein level in UVB-treated keratinocytes. Topical application of IPyr to the dorsal skin of hairless mice reduced the severity of UVB-induced skin lesions, the augmentation of dermal thickness, and transepithelial water loss. Overproduction of IL-1β and IL-6 in response to UVB radiation was also suppressed in vivo by the topical administration of IPyr. These data strongly suggest that IPyr might find utility as a UVB-blocking reagent in therapeutic strategies to lessen UVB-induced inflammatory skin damage.

  1. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  2. Modulation of mitochondrial activity in HaCaT keratinocytes by the cell penetrating peptide Z-Gly-RGD(DPhe)-mitoparan.

    Science.gov (United States)

    Richardson, Adam; Muir, Lewis; Mousdell, Sasha; Sexton, Darren; Jones, Sarah; Howl, John; Ross, Kehinde

    2018-01-30

    Biologically active cell penetrating peptides (CPPs) are an emerging class of therapeutic agent. The wasp venom peptide mastoparan is an established CPP that modulates mitochondrial activity and triggers caspase-dependent apoptosis in cancer cells, as does the mastoparan analogue mitoparan (mitP). Mitochondrial depolarisation and activation of the caspase cascade also underpins the action of dithranol, a topical agent for treatment of psoriasis. The effects of a potent mitP analogue on mitochondrial activity were therefore examined to assess its potential as a novel approach for targeting mitochondria for the treatment of psoriasis. In HaCaT keratinocytes treated with the mitP analogue Z-Gly-RGD(DPhe)-mitP for 24 h, a dose-dependent loss of mitochondrial activity was observed using the methyl-thiazolyl-tetrazolium (MTT) assay. At 10 μmol L -1 , MTT activity was less than 30% that observed in untreated cells. Staining with the cationic dye JC-1 suggested that Z-Gly-RGD(DPhe)-mitP also dissipated the mitochondrial membrane potential, with a threefold increase in mitochondrial depolarisation levels. However, caspase activity appeared to be reduced by 24 h exposure to Z-Gly-RGD(DPhe)-mitP treatment. Furthermore, Z-Gly-RGD(DPhe)-mitP treatment had little effect on overall cell viability. Our findings suggest Z-Gly-RGD(DPhe)-mitP promotes the loss of mitochondrial activity but does not appear to evoke apoptosis in HaCaT keratinocytes.

  3. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  4. Barium promotes anchorage-independent growth and invasion of human HaCaT keratinocytes via activation of c-SRC kinase.

    Science.gov (United States)

    Thang, Nguyen Dinh; Yajima, Ichiro; Kumasaka, Mayuko Y; Ohnuma, Shoko; Yanagishita, Takeshi; Hayashi, Rumiko; Shekhar, Hossain U; Watanabe, Daisuke; Kato, Masashi

    2011-01-01

    Explosive increases in skin cancers have been reported in more than 36 million patients with arsenicosis caused by drinking arsenic-polluted well water. This study and previous studies showed high levels of barium as well as arsenic in the well water. However, there have been no reports showing a correlation between barium and cancer. In this study, we examined whether barium (BaCl(2)) may independently have cancer-related effects on human precancerous keratinocytes (HaCaT). Barium (5-50 µM) biologically promoted anchorage-independent growth and invasion of HaCaT cells in vitro. Barium (5 µM) biochemically enhanced activities of c-SRC, FAK, ERK and MT1-MMP molecules, which regulate anchorage-independent growth and/or invasion. A SRC kinase specific inhibitor, protein phosphatase 2 (PP2), blocked barium-mediated promotion of anchorage-independent growth and invasion with decreased c-SRC kinase activity. Barium (2.5-5 µM) also promoted anchorage-independent growth and invasion of fibroblasts (NIH3T3) and immortalized nontumorigenic melanocytes (melan-a), but not transformed cutaneous squamous cell carcinoma (HSC5 and A431) and malignant melanoma (Mel-ret) cells, with activation of c-SRC kinase. Taken together, our biological and biochemical findings newly suggest that the levels of barium shown in drinking well water independently has the cancer-promoting effects on precancerous keratinocytes, fibroblast and melanocytes in vitro.

  5. Eupafolin nanoparticles protect HaCaT keratinocytes from particulate matter-induced inflammation and oxidative stress

    Directory of Open Access Journals (Sweden)

    Lin ZC

    2016-08-01

    applications. To address these issues, we successfully synthesized a eupafolin nanoparticle delivery system (ENDS. Our findings showed that ENDS could overcome the physicochemical drawbacks of raw eupafolin with respect to water solubility and skin penetration, through reduction of particle size and formation of an amorphous state with hydrogen bonding. Moreover, ENDS was superior to raw eupafolin in attenuating PM-induced oxidative stress and inflammation in HaCaT keratinocytes, by mediating the antioxidant pathway (decreased reactive oxygen species production and nicotinamide adenine dinucleotide phosphate oxidase activity and anti-inflammation pathway (decreased cyclooxygenase-2 expression and prostaglandin E2 production through downregulation of mitogen-activated protein kinase and nuclear factor-κB signaling. In summary, ENDS shows better antioxidant and anti-inflammatory activities than raw eupafolin through improvement of water solubility and skin penetration. Therefore, ENDS may potentially be used as a medicinal drug and/or cosmeceutical product to prevent PM-induced skin inflammation. Keywords: eupafolin, nanoparticles, particulate matter, oxidative stress, cyclooxygenase-2, keratinocytes

  6. The tryptophan-derived endogenous arylhydrocarbon receptor ligand 6-formylindolo[3,2-b]carbazole (FICZ) is a nanomolar UVA-photosensitizer in epidermal keratinocytes

    Science.gov (United States)

    Williams, Joshua D.; Cabello, Christopher M.; Qiao, Shuxi; Wondrak, Georg T.

    2014-01-01

    Endogenous UVA-chromophores may act as sensitizers of oxidative stress underlying cutaneous photoaging and photocarcinogenesis, but the molecular identity of non-DNA key chromophores displaying UVA-driven photodyamic activity in human skin remains largely undefined. Here we report that 6-formylindolo[3,2-b]carbazole (FICZ), a tryptophan photoproduct and endogenous high affinity aryl hydrocarbon receptor (AhR) agonist, acts as a nanomolar photosensitizer potentiating UVA-induced oxidative stress irrespective of AhR ligand activity. In human HaCaT and primary epidermal keratinocytes, photodynamic induction of apoptosis was elicited by the combined action of solar simulated UVA and FICZ, whereas exposure to the isolated action of UVA or FICZ did not impair viability. In a human epidermal tissue reconstruct, FICZ/UVA-cotreatment caused pronounced phototoxicity inducing keratinocyte cell death, and FICZ photodynamic activity was also substantiated in a murine skin exposure model. Array analysis revealed pronounced potentiation of cellular heat shock, ER stress, and oxidative stress response gene expression observed only upon FICZ/UVA-cotreatment. FICZ photosensitization caused intracellular oxidative stress, and comet analysis revealed introduction of formamidopyrimidine-DNA glycosylase (FPG)-sensitive oxidative DNA lesions suppressible by antioxidant cotreatment. Taken together, our data demonstrate that the endogenous AhR ligand FICZ displays nanomolar photodynamic activity representing a molecular mechanism of UVA-induced photooxidative stress potentially operative in human skin. PMID:25431849

  7. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  8. Inhibition of Connexin 26/43 and Extracellular-Regulated Kinase Protein Plays a Critical Role in Melatonin Facilitated Gap Junctional Intercellular Communication in Hydrogen Peroxide-Treated HaCaT Keratinocyte Cells

    Directory of Open Access Journals (Sweden)

    Hyo-Jung Lee

    2012-01-01

    Full Text Available Though melatonin was known to regulate gap junctional intercellular communication (GJIC in chick astrocytes and mouse hepatocytes, the underlying mechanism by melatonin was not elucidated in hydrogen peroxide- (H2O2- treated HaCaT keratinocyte cells until now. In the current study, though melatonin at 2 mM and hydrogen peroxide (H2O2 at 300 μM showed weak cytotoxicity in HaCaT keratinocyte cells, melatonin significantly suppressed the formation of reactive oxygen species (ROS in H2O2-treated HaCaT cells compared to untreated controls. Also, the scrape-loading dye-transfer assay revealed that melatonin enhances the intercellular communication by introducing Lucifer Yellow into H2O2-treated cells. Furthermore, melatonin significantly enhanced the expression of connexin 26 (Cx26 and connexin 43 (Cx43 at mRNA and protein levels, but not that of connexin 30 (Cx30 in H2O2-treated HaCaT cells. Of note, melatonin attenuated the phosphorylation of extracellular signal-regulated protein kinases (ERKs more than p38 MAPK or JNK in H2O2-treated HaCaT cells. Conversely, ERK inhibitor PD98059 promoted the intercellular communication in H2O2-treated HaCaT cells. Furthermore, combined treatment of melatonin (200 μM and vitamin C (10 μg/mL significantly reduced ROS production in H2O2-treated HaCaT cells. Overall, these findings support the scientific evidences that melatonin facilitates gap junctional intercellular communication in H2O2-treated HaCaT keratinocyte cells via inhibition of connexin 26/43 and ERK as a potent chemopreventive agent.

  9. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Protective effect of 3,4-dihydroxybenzoic acid isolated from Cladophora wrightiana Harvey against ultraviolet B radiation-induced cell damage in human HaCaT keratinocytes.

    Science.gov (United States)

    Cha, Ji Won; Piao, Mei Jing; Kim, Ki Cheon; Zheng, Jian; Yao, Cheng Wen; Hyun, Chang Lim; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Ko, Mi Hee; Hyun, Jin Won

    2014-03-01

    The aim of the present study was to elucidate the protective properties of 3,4-dihydroxybenzoic acid (DBA) isolated from Cladophora wrightiana Harvey (a green alga) against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. DBA exhibited scavenging actions against the 1,1-diphenyl-2-picrylhydrazyl radical, the superoxide anion, and the hydroxyl radical. Furthermore, DBA decreased the levels of intracellular reactive oxygen species generated by hydrogen peroxide or UVB treatment of the cells. DBA also decreased the UVB-augmented levels of phospho-histone H2A.X and the extent of comet tail formation, which are both indications of DNA damage. In addition, the compound safeguarded keratinocytes from UVB-induced injury by reversing the production of apoptotic bodies, overturning the disruption of mitochondrial membrane potential, increasing the expression of the anti-apoptotic protein, B-cell lymphoma 2, and decreasing the expression of the pro-apoptotic proteins, Bcl-2-associated X and cleaved caspase-3. Taken together, these results demonstrate that DBA isolated from a green alga protects human keratinocytes against UVB-induced oxidative stress and apoptosis.

  11. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  12. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  13. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  14. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  15. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  16. Inhibition of Genotoxic Effects of UVC Radiation on Human Keratinocyte HaCaT Cells by Echinacea Purpurea (L.) Moench Herbal Extract

    International Nuclear Information System (INIS)

    Kosalec, I.; Segvic Klaric, M.; Kopjar, N.; Milic, M.

    2013-01-01

    Exposure of skin to ultraviolet (UV) radiation might provoke acute and chronic inflammation and oxidative stress which might cause DNA damage leading to skin photoaging and photocarcinogenesis. Previously we showed that Echinacea purpurea (L.) Moench (EH) extract, rich in phenolic acids, has protective effect on human blood lymphocytes exposed to UVC radiation. In this study we checked whether the pre-treatment of human keratinocyte HaCaT cells with lyophilisate of EH (1 and 10 mg/mL) could reduce or prevent primary DNA damage induced by UVC radiation (253.7 nm) in laboratory conditions. Prior to that experiment we examined cell viability using MTT test upon exposure to EH and UVC (30 and 60 min) alone and in combination. Primary DNA damage in HaCaT cells was studied using the alkaline comet assay. Exposure of cells to EH and UVC alone or EH in combination with UV radiation did not reduce cell viability. Opposite to that UV radiation (30 and 60 min) caused a significant increase in the level of primary DNA damage (P < 0.001). Pre-treatment of cells with both concentrations of EH was not genotoxic to HaCaT cells. Only concentration of 1 mg/mL EH successfully protected the cells against the effects of 30 min exposure to UVC radiation. Positive results obtained in this study speak in favour of continuing the research on effectiveness of Echinacea purpurea preparations and their potential application in developing cosmetic products for skin protection.(author)

  17. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  18. Varying the morphology of silver nanoparticles results in differential toxicity against micro-organisms, HaCaT keratinocytes and affects skin deposition.

    Science.gov (United States)

    Holmes, Amy M; Lim, Julian; Studier, Hauke; Roberts, Michael S

    2016-12-01

    The use of silver nanoparticles (Ag NPs) within the healthcare sector and consumer products is rapidly increasing. There are now a range of diverse-shaped Ag NPs that are commercially available and many of the products containing nanosilver are topically applied to human skin. Currently, there is limited data on the extent to which the antimicrobial efficacy and cytotoxicity of Ag NPs is related to their shape and how the shape of the Ag NPs affects their distribution in both intact and burn wounded human skin after topical application. In this study, we related the relative Ag NP cytotoxicity to potential skin pathogens and HaCaT keratinocytes in vitro with the shape of the Ag NPs. We employed multiphoton fluorescence lifetime imaging to map the distribution of the native and unlabeled Ag NPs after topical application to both intact and burn wounded human skin using the localized surface plasmon resonance signal of the Ag NPs. Truncated plate shaped Ag NPs led to the highest cytotoxicity against both bacteria (IC 50 ranges from 31.25 to 125 μg/mL depending on the bacterial species) and HaCaT keratinocytes (IC 50 78.65 μg/mL [95%CI 63.88, 96.83]) thus both with similar orders of magnitude. All Ag NPs were less cytotoxic than solutions of silver nitrate (IC 50 of 7.85 μg/mL [95%CI 1.49, 14.69]). Plate-shaped Ag NPs displayed the highest substantivity within the superficial layers of the stratum corneum when topically applied to intact skin and the highest deposition into the wound bed when applied to burned ex vivo human skin relative to other Ag NP shapes.

  19. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  20. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  1. Enhanced constitutive invasion activity in human nontumorigenic keratinocytes exposed to a low level of barium for a long time.

    Science.gov (United States)

    Thang, Nguyen D; Yajima, Ichiro; Ohnuma, Shoko; Ohgami, Nobutaka; Kumasaka, Mayuko Y; Ichihara, Gaku; Kato, Masashi

    2015-02-01

    We have recently demonstrated that exposure to barium for a short time (≤4 days) and at a low level (5 µM = 687 µg/L) promotes invasion of human nontumorigenic HaCaT cells, which have characteristics similar to those of normal keratinocytes, suggesting that exposure to barium for a short time enhances malignant characteristics. Here we examined the effect of exposure to low level of barium for a long time, a condition mimicking the exposure to barium through well water, on malignant characteristics of HaCaT keratinocytes. Constitutive invasion activity, focal adhesion kinase (FAK) protein expression and activity, and matrix metalloproteinase 14 (MMP14) protein expression in primary cultured normal human epidermal keratinocytes, HaCaT keratinocytes, and HSC5 and A431 human squamous cell carcinoma cells were augmented following an increase in malignancy grade of the cells. Constitutive invasion activity, FAK phosphorylation, and MMP14 expression levels of HaCaT keratinocytes after treatment with 5 µM barium for 4 months were significantly higher than those of control untreated HaCaT keratinocytes. Taken together, our results suggest that exposure to a low level of barium for a long time enhances constitutive malignant characteristics of HaCaT keratinocytes via regulatory molecules (FAK and MMP14) for invasion. © 2013 Wiley Periodicals, Inc.

  2. Markedly diminished epidermal keratinocyte expression of intercellular adhesion molecule-1 (ICAM-1) in Sezary syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))

    1989-04-21

    In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.

  3. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  4. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    International Nuclear Information System (INIS)

    Shi, Ge; Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin; Ou, Bai-sheng; Kim, Sooil; Lee, Young Ho; Yoon, Tae-Jin; Kim, Seong-Jin; Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon; Kim, Chang Deok

    2010-01-01

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  6. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Ge [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Ou, Bai-sheng [Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Kim, Sooil; Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Kim, Seong-Jin [Department of Dermatology, Chonnam National University Medical School, Gwangju, 501-757 (Korea, Republic of); Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Kim, Chang Deok, E-mail: cdkimd@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of)

    2010-11-15

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  7. PER, a Circadian Clock Component, Mediates the Suppression of MMP-1 Expression in HaCaT Keratinocytes by cAMP.

    Science.gov (United States)

    Yeom, Miji; Lee, HansongI; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun

    2018-03-23

    Skin circadian clock system responds to daily changes, thereby regulating skin functions. Exposure of the skin to UV irradiation induces the expression of matrix metalloproteinase-1 (MMP-1) and causes DNA damage. It has been reported both DNA repair and DNA replication are regulated by the circadian clock in mouse skin. However, the molecular link between circadian clock and MMP-1 has little been investigated. We found PERIOD protein, a morning clock component, represses the expression of MMP-1 in human keratinocytes by using a PER-knockdown strategy. Treatment with siPer3 alleviated the suppression of MMP-1 expression induced by forskolin. Results revealed PER3 suppresses the expression of MMP-1 via cAMP signaling pathway. Additionally, we screened for an activator of PER that could repress the expression of MMP-1 using HaCaT cell line containing PER promoter-luciferase reporter gene. Results showed Lespedeza capitate extract (LCE) increased PER promoter activity. LCE inhibited the expression of MMP-1 and its effect of LCE was abolished in knockdown of PER2 or PER3, demonstrating LCE can repress the expression of MMP-1 through PER. Since circadian clock component PER can regulate MMP-1 expression, it might be a new molecular mechanism to develop therapeutics to alleviate skin aging and skin cancer.

  8. PER, a Circadian Clock Component, Mediates the Suppression of MMP-1 Expression in HaCaT Keratinocytes by cAMP

    Directory of Open Access Journals (Sweden)

    Miji Yeom

    2018-03-01

    Full Text Available Skin circadian clock system responds to daily changes, thereby regulating skin functions. Exposure of the skin to UV irradiation induces the expression of matrix metalloproteinase-1 (MMP-1 and causes DNA damage. It has been reported both DNA repair and DNA replication are regulated by the circadian clock in mouse skin. However, the molecular link between circadian clock and MMP-1 has little been investigated. We found PERIOD protein, a morning clock component, represses the expression of MMP-1 in human keratinocytes by using a PER-knockdown strategy. Treatment with siPer3 alleviated the suppression of MMP-1 expression induced by forskolin. Results revealed PER3 suppresses the expression of MMP-1 via cAMP signaling pathway. Additionally, we screened for an activator of PER that could repress the expression of MMP-1 using HaCaT cell line containing PER promoter-luciferase reporter gene. Results showed Lespedeza capitate extract (LCE increased PER promoter activity. LCE inhibited the expression of MMP-1 and its effect of LCE was abolished in knockdown of PER2 or PER3, demonstrating LCE can repress the expression of MMP-1 through PER. Since circadian clock component PER can regulate MMP-1 expression, it might be a new molecular mechanism to develop therapeutics to alleviate skin aging and skin cancer.

  9. Effects of fiber density and plasma modification of nanofibrous membranes on the adhesion and growth of HaCaT keratinocytes.

    Science.gov (United States)

    Bacakova, Marketa; Lopot, Frantisek; Hadraba, Daniel; Varga, Marian; Zaloudkova, Margit; Stranska, Denisa; Suchy, Tomas; Bacakova, Lucie

    2015-01-01

    It may be possible to regulate the cell colonization of biodegradable polymer nanofibrous membranes by plasma treatment and by the density of the fibers. To test this hypothesis, nanofibrous membranes of different fiber densities were treated by oxygen plasma with a range of plasma power and exposure times. Scanning electron microscopy and mechanical tests showed significant modification of nanofibers after plasma treatment. The intensity of the fiber modification increased with plasma power and exposure time. The exposure time seemed to have a stronger effect on modifying the fiber. The mechanical behavior of the membranes was influenced by the plasma treatment, the fiber density, and their dry or wet state. Plasma treatment increased the membrane stiffness; however, the membranes became more brittle. Wet membranes displayed significantly lower stiffness than dry membranes. X-ray photoelectron spectroscopy (XPS) analysis showed a slight increase in oxygen-containing groups on the membrane surface after plasma treatment. Plasma treatment enhanced the adhesion and growth of HaCaT keratinocytes on nanofibrous membranes. The cells adhered and grew preferentially on membranes of lower fiber densities, probably due to the larger area of void spaces between the fibers. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  10. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mei Jing Piao

    2015-09-01

    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  11. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  12. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  13. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  14. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  15. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  16. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  17. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  18. Time and dose effects of cigarette smoke and acrolein on protein carbonyl formation in HaCaT keratinocytes.

    Science.gov (United States)

    Avezov, K; Reznick, A Z; Aizenbud, D

    2015-01-01

    Cigarette smoke (CS) is an important environmental source of human exposure to a highly toxic and chemically active α,β-unsaturated aldehyde: acrolein. It is capable of causing protein carbonylation and dysfunction, especially in oral tissues of smokers, constantly exposed to CS toxic constituents. The foremost damage is considered to be cumulative, but even a short exposure can be potentially harmful. The objectives of the current study were to examine the short time and dose effects of direct CS and acrolein exposure on intracellular protein carbonylation in epithelial cells. HaCaT-keratinocytes were exposed to different doses of acrolein and whole phase CS using a unique smoking simulator apparatus that mimics the exposure in smokers. The rate of intracellular protein carbonyl modification was examined 10-60 min after the exposure by Western blot. In addition, the effect of pre-incubation with a thiol scavenger N-acetylcysteine (NAC) was also assessed. We found that intracellular protein carbonyls increased as fast as 10 min after CS exposure and their concentration doubled after 20 min, with a slight elevation afterwards. Also, carbonyl levels increased gradually as CS and acrolein doses were elevated. Addition of 1 mM NAC neutralized part of the damage. We conclude that CS and acrolein intracellular protein carbonylation is dose- and time- dependent. Even a short time exposure to CS and its aldehydic constituents can be potentially harmful.

  19. Light-Induced Cytotoxicity and Genotoxicity of a Sunscreen Agent, 2-Phenylbenzimidazole in Salmonella typhimurium TA 102 and HaCaT Keratinocytes

    Directory of Open Access Journals (Sweden)

    Hongtao Yu

    2007-06-01

    Full Text Available 2-Phenylbenzimidazole (PBI is an ingredient found in sunscreen agents. PBI can absorb the UV portion of the solar light and undergo a series of light-induced reactions to cause adverse effects in humans. Therefore, chemical and photochemical toxicity of PBI were investigated in the bacteria Salmonella typhimurium TA 102 and human skin keratinocyte cells. There is no appreciable bacteria death due to the exposure to PBI alone, indicating that PBI is not chemically toxic to the bacteria at a dose as high as 625μM. However, exposure to PBI and a solar simulator light (300-W Xe/Hg lamp, 30 min, 18.6 J/cm2, equivalent to 30 min outdoor sunlight causes significant bacteria death: 35% at 25μM and 55% at 625μM PBI. Exposure of the bacteria to light and PBI at doses 5-25μM causes the bacteria to revert, an indication of mutation. In the presence of PBI but without light irradiation, the number of revertant bacteria colonies is around 200 due to spontaneous mutation. Combination of light irradiation and PBI causes the number of revertant TA 102 colonies to increase in a dose dependent manner, reaching a maximum of around 1700 revertant colonies at 25 μM PBI. At higher PBI concentrations, the number of revertant colonies remains constant. This result clearly indicates that PBI is photomutagenic in TA 102. Exposure of the human skin HaCaT keratinocytes in aqueous solution in the presence of PBI causes the cell to lose its viability with or without light irradiation. There is no significant difference in cell viability for the light irradiated or non-irradiated groups, indication PBI is not photocytotoxic. However, exposure of the cells to both PBI and light irradiation causes cellular DNA damage, while exposure to PBI alone does not cause DNA damage.

  20. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  1. SNOM and AFM microscopy techniques to study the effect of non-ionizing radiation on the morphological and biochemical properties of human keratinocytes cell line (HaCaT).

    Science.gov (United States)

    Rieti, S; Manni, V; Lisi, A; Giuliani, L; Sacco, D; D'Emilia, E; Cricenti, A; Generosi, R; Luce, M; Grimaldi, S

    2004-01-01

    In this study we have employed atomic force microscopy (AFM) and scanning near-field optical microscopy (SNOM) techniques to study the effect of the interaction between human keratinocytes (HaCaT) and electromagnetic fields at low frequency. HaCaT cells were exposed to a sinusoidal magnetic field at a density of 50 Hz, 1 mT. AFM analysis revealed modification in shape and morphology in exposed cells with an increase in the areas of adhesion between cells. This latter finding was confirmed by SNOM indirect immunofluorescence analysis performed with a fluorescent antibody against the adhesion marker beta4 integrin, which revealed an increase of beta4 integrin segregation in the cell membrane of 50-Hz exposed cells, suggesting that a higher percentage of these cells shows a modified pattern of this adhesion marker.

  2. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  3. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  4. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  5. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10.

    Science.gov (United States)

    Lee, Jeong-Won; Seok, Jin Kyung; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter can cause oxidative stress, inflammation, and premature skin aging. Marine plants such as Ecklonia cava Kjellman contain high amounts of polyphenolic antioxidants. The purpose of this study was to examine the antioxidative effects of E. cava extract in cultured keratinocytes exposed to airborne particulate matter with a diameter of <10  μ m (PM10). After the exposure of cultured HaCaT keratinocytes to PM10 in the absence and presence of E. cava extract and its constituents, cell viability and cellular lipid peroxidation were assessed. The effects of eckol and dieckol on cellular lipid peroxidation and cytokine expression were examined in human epidermal keratinocytes exposed to PM10. The total phenolic content of E. cava extract was the highest among the 50 marine plant extracts examined. The exposure of HaCaT cells to PM10 decreased cell viability and increased lipid peroxidation. The PM10-induced cellular lipid peroxidation was attenuated by E. cava extract and its ethyl acetate fraction. Dieckol more effectively attenuated cellular lipid peroxidation than eckol in both HaCaT cells and human epidermal keratinocytes. Dieckol and eckol attenuated the expression of inflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1 β , IL-6, and IL-8 in human epidermal keratinocytes stimulated with PM10. This study suggested that the polyphenolic constituents of E. cava , such as dieckol, attenuated the oxidative and inflammatory reactions in skin cells exposed to airborne particulate matter.

  6. Frozen cultured sheets of epidermal keratinocytes in reepithelialization and repair of the cornea after photorefractive keratectomy.

    Science.gov (United States)

    Castro-Muñozledo, Federico; Ozorno-Zarate, Jorge; Naranjo-Tackman, Ramon; Kuri-Harcuch, Walid

    2002-09-01

    To determine whether frozen cultured sheets of human allogeneic epidermal keratinocytes (CEAK) improved wound repair after experimental corneal ablation by photorefractive keratectomy (PRK). Hospital "Luis Sanchez Bulnes" de la Asociación para Evitar la Ceguera en Mexico, I.A.P, and Department of Cell Biology, CINVESTAV-IPN, Mexico City, Mexico. Transepithelial PRK was performed in the right eye of male albino rabbits to obtain a 112 microm deep and 6.0 mm diameter ablation zone. In 17 eyes, the ablations were covered with frozen CEAK; in 11 eyes, the ablations were covered with a disposable contact lens without the cultured sheets; and in the control group (13 eyes), the ablations were not covered. Subepithelial fibrosis and reepithelialization of the ablated zone were evaluated in serial paraffin-embedded tissue sections from all wounds. Treatment with CEAK reduced fibroblast proliferation and the inflammatory response beneath the ablated zone and produced better organization of the newly formed epithelium by eliminating significant hyperplasia or discontinuities in the periodic acid Shiff-stained basement membrane. It also led to accelerated reepithelialization. The use of frozen CEAK as a biologically active wound dressing improved tissue repair at 1 month in corneas ablated by transepithelial PRK in the male albino rabbit model. Treatment with CEAK could improve the outcome of PRK in humans.

  7. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  8. Fisetin inhibits TNF-α-induced inflammatory action and hydrogen peroxide-induced oxidative damage in human keratinocyte HaCaT cells through PI3K/AKT/Nrf-2-mediated heme oxygenase-1 expression.

    Science.gov (United States)

    Seo, Seung-Hee; Jeong, Gil-Saeng

    2015-12-01

    Oxidative skin damage and skin inflammation play key roles in the pathogenesis of skin-related diseases. Fisetin is a naturally occurring flavonoid abundantly found in several vegetables and fruits. Fisetin has been shown to exert various positive biological effects, such as anti-cancer, anti-proliferative, neuroprotective and anti-oxidative effects. In this study, we investigate the skin protective effects and anti-inflammatory properties of fisetin in hydrogen peroxide- and TNF-α-challenged human keratinocyte HaCaT cells. When HaCaT cells were treated with non-cytotoxic concentrations of fisetin (1-20μM), heme oxygenase (HO)-1 mRNA and protein expression increased in a dose-dependent manner. Furthermore, fisetin dose-dependently increased cell viability and reduced ROS production in hydrogen peroxide-treated HaCaT cells. Fisetin also inhibited the production of NO, PGE2 IL-1β, IL-6, expression of iNOS and COX-2, and activation of NF-κB in HaCaT cells treated with TNF-α. Fisetin induced Nrf2 translocation to the nuclei. HO-1 siRNA transient transfection reversed the effects of fisetin on cytoprotection, ROS reduction, NO, PGE2, IL-1β, IL-6, and TNF-α production, and NF-κB DNA-binding activity. Moreover, fisetin increased Akt phosphorylation and a PI3K pathway inhibitor (LY294002) abolished fisetin-induced cytoprotection and NO inhibition. Taken together, these results provide evidence for a beneficial role of fisetin in skin therapy. Copyright © 2015. Published by Elsevier B.V.

  9. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  10. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  11. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  12. Photoprotection by Punica granatum seed oil nanoemulsion entrapping polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in human keratinocyte (HaCaT) cell line.

    Science.gov (United States)

    Baccarin, Thaisa; Mitjans, Montserrat; Ramos, David; Lemos-Senna, Elenara; Vinardell, Maria Pilar

    2015-12-01

    There has been an increase in the use of botanicals as skin photoprotective agents. Pomegranate (Punica granatum L.) is well known for its high concentration of polyphenolic compounds and for its antioxidant and anti-inflammatory properties. The aim of this study was to analyze the photoprotection provided by P. granatum seed oil nanoemulsion entrapping the polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in the keratinocyte HaCaT cell line. For this purpose, HaCaT cells were pretreated for 1h with nanoemulsions in a serum-free medium and then irradiated with UVB (90-200 mJ/cm(2)) rays. Fluorescence microscopy analysis provided information about the cellular internalization of the nanodroplets. We also determined the in vitro SPF of the nanoemulsions and evaluated their phototoxicity using the 3T3 Neutral Red Uptake Phototoxicity Test. The nanoemulsions were able to protect the cells' DNA against UVB-induced damage in a concentration dependent manner. Nanodroplets were internalized by the cells but a higher proportion was detected along the cell membrane. The SPF obtained (~25) depended on the concentration of the ethyl acetate fraction and pomegranate seed oil in the nanoemulsion. The photoprotective formulations were classified as non-phototoxic. In conclusion, nanoemulsions entrapping the polyphenol-rich ethyl acetate fraction show potential for use as a sunscreen product. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Keratinocyte Motility Is Affected by UVA Radiation—A Comparison between Normal and Dysplastic Cells

    Directory of Open Access Journals (Sweden)

    Cristina M. Niculiţe

    2018-06-01

    Full Text Available UVA radiation induces multiple and complex changes in the skin, affecting epidermal cell behavior. This study reports the effects of UVA exposure on normal (HaCaT and dysplastic (DOK keratinocytes. The adherence, spreading and proliferation were investigated by time-lapse measurement of cell layer impedance on different matrix proteins. Prior to UVA exposure, the time required for adherence and spreading did not differ significantly for HaCaT and DOK cells, while spreading areas were larger for HaCaT cells. Under UVA exposure, HaCaT and DOK cells behavior differed in terms of movement and proliferation. The cells’ ability to cover the denuded surface and individual cell trajectories were recorded by time-lapse videomicroscopy, during wound healing experiments. Dysplastic keratinocytes showed more sensitivity to UVA, exhibiting transient deficiencies in directionality of movement and a delay in re-coating the denuded area. The actin cytoskeleton displayed a cortical organization immediately after irradiation, in both cell lines, similar to mock-irradiated cells. Post-irradiation, DOK cells displayed a better organization of stress fibers, persistent filopodia, and new, stronger focal contacts. In conclusion, after UVA exposure HaCaT and DOK cells showed a different behavior in terms of adherence, spreading, motility, proliferation, and actin cytoskeleton dynamics, with the dyplastic keratinocytes being more sensitive.

  14. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT].

    Science.gov (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z

    2016-09-20

    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  15. Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J.; Cruickshank, Sheena M.

    2014-01-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. PMID:25015889

  16. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  17. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  18. Effects of fiber density and plasma modification of nanofibrous membranes on the adhesion and growth of HaCaT keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Bačáková, Markéta; Lopot, F.; Hadraba, Daniel; Varga, Marián; Žaloudková, Margit; Stránská, D.; Suchý, Tomáš; Bačáková, Lucie

    2015-01-01

    Roč. 29, č. 6 (2015), s. 837-853 ISSN 0885-3282 R&D Projects: GA ČR(CZ) GBP108/12/G108; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 ; RVO:68378271 ; RVO:67985891 Keywords : tissue engineering * fibroblasts * keratinocytes Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.988, year: 2015

  19. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872 ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  20. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Transcriptional profiling in human HaCaT keratinocytes in response to kaempferol and identification of potential transcription factors for regulating differential gene expression

    Science.gov (United States)

    Kang, Byung Young; Lee, Ki-Hwan; Lee, Yong Sung; Hong, Il; Lee, Mi-Ock; Min, Daejin; Chang, Ihseop; Hwang, Jae Sung; Park, Jun Seong; Kim, Duck Hee

    2008-01-01

    Kaempferol is the major flavonol in green tea and exhibits many biomedically useful properties such as antioxidative, cytoprotective and anti-apoptotic activities. To elucidate its effects on the skin, we investigated the transcriptional profiles of kaempferol-treated HaCaT cells using cDNA microarray analysis and identified 147 transcripts that exhibited significant changes in expression. Of these, 18 were up-regulated and 129 were down-regulated. These transcripts were then classified into 12 categories according to their functional roles: cell adhesion/cytoskeleton, cell cycle, redox homeostasis, immune/defense responses, metabolism, protein biosynthesis/modification, intracellular transport, RNA processing, DNA modification/ replication, regulation of transcription, signal transduction and transport. We then analyzed the promoter sequences of differentially-regulated genes and identified over-represented regulatory sites and candidate transcription factors (TFs) for gene regulation by kaempferol. These included c-REL, SAP-1, Ahr-ARNT, Nrf-2, Elk-1, SPI-B, NF-κB and p65. In addition, we validated the microarray results and promoter analyses using conventional methods such as real-time PCR and ELISA-based transcription factor assay. Our microarray analysis has provided useful information for determining the genetic regulatory network affected by kaempferol, and this approach will be useful for elucidating gene-phytochemical interactions. PMID:18446059

  2. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant

    2014-01-01

    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  3. The Modulatory Effect of Ellagic Acid and Rosmarinic Acid on Ultraviolet-B-Induced Cytokine/Chemokine Gene Expression in Skin Keratinocyte (HaCaT Cells

    Directory of Open Access Journals (Sweden)

    Serena Lembo

    2014-01-01

    Full Text Available Ultraviolet radiation (UV induces an increase in multiple cutaneous inflammatory mediators. Ellagic acid (EA and rosmarinic acid (RA are natural anti-inflammatory and immunomodulatory compounds found in many plants, fruits, and nuts. We assessed the ability of EA and RA to modulate IL-1β, IL-6, IL-8, IL-10, MCP-1, and TNF-α gene expression in HaCaT cells after UVB irradiation. Cells were treated with UVB (100 mJ/cm2 and simultaneously with EA (5 μM in 0.1% DMSO or RA (2.7 μM in 0.5% DMSO. Moreover, these substances were added to the UVB-irradiated cells 1 h or 6 h before harvesting, depending on the established UVB-induced cytokine expression peak. Cytokine gene expression was examined using quantitative real time polymerase chain reaction. RA produced a significant reduction in UVB-induced expression of IL-6, IL-8, MCP-1, and TNF-α when applied at the same time as irradiation. EA showed milder effects compared with RA, except for TNF-α. Both substances decreased IL-6 expression, also when applied 5 h after irradiation, and always produced a significant increase in UVB-induced IL-10 expression. Our findings suggest that EA and RA are able to prevent and/or limit the UVB-induced inflammatory cascade, through a reduction in proinflammatory mediators and the enhancement of IL-10, with its protective function.

  4. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

    Directory of Open Access Journals (Sweden)

    Santosh K Katiyar

    Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

  5. The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin.

    Science.gov (United States)

    Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M

    1999-09-27

    Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost

  6. Epidermal growth factor induction of front–rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2

    Science.gov (United States)

    Ho, Ernest; Dagnino, Lina

    2012-01-01

    Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front–rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front–rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front–rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front–rear polarity and forward movement. PMID:22160594

  7. Epidermal growth factor induction of front-rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2.

    Science.gov (United States)

    Ho, Ernest; Dagnino, Lina

    2012-02-01

    Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front-rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front-rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front-rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front-rear polarity and forward movement.

  8. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  9. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  10. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  11. Titanium Dioxide Nanoparticle Penetration into the Skin and Effects on HaCaT Cells

    Directory of Open Access Journals (Sweden)

    Matteo Crosera

    2015-08-01

    Full Text Available Titanium dioxide nanoparticles (TiO2NPs suspensions (concentration 1.0 g/L in synthetic sweat solution were applied on Franz cells for 24 h using intact and needle-abraded human skin. Titanium content into skin and receiving phases was determined. Cytotoxicity (MTT, AlamarBlue® and propidium iodide, PI, uptake assays was evaluated on HaCat keratinocytes after 24 h, 48 h, and seven days of exposure. After 24 h of exposure, no titanium was detectable in receiving solutions for both intact and damaged skin. Titanium was found in the epidermal layer after 24 h of exposure (0.47 ± 0.33 μg/cm2 while in the dermal layer, the concentration was below the limit of detection. Damaged skin, in its whole, has shown a similar concentration (0.53 ± 0.26 μg/cm2. Cytotoxicity studies on HaCaT cells demonstrated that TiO2NPs induced cytotoxic effects only at very high concentrations, reducing cell viability after seven days of exposure with EC50s of 8.8 × 10−4 M (MTT assay, 3.8 × 10−5 M (AlamarBlue® assay, and 7.6 × 10−4 M (PI uptake, index of a necrotic cell death. Our study demonstrated that TiO2NPs cannot permeate intact and damaged skin and can be found only in the stratum corneum and epidermis. Moreover, the low cytotoxic effect observed on human HaCaT keratinocytes suggests that these nano-compounds have a potential toxic effect at the skin level only after long-term exposure.

  12. Titanium Dioxide Nanoparticle Penetration into the Skin and Effects on HaCaT Cells.

    Science.gov (United States)

    Crosera, Matteo; Prodi, Andrea; Mauro, Marcella; Pelin, Marco; Florio, Chiara; Bellomo, Francesca; Adami, Gianpiero; Apostoli, Pietro; De Palma, Giuseppe; Bovenzi, Massimo; Campanini, Marco; Filon, Francesca Larese

    2015-08-07

    Titanium dioxide nanoparticles (TiO2NPs) suspensions (concentration 1.0 g/L) in synthetic sweat solution were applied on Franz cells for 24 h using intact and needle-abraded human skin. Titanium content into skin and receiving phases was determined. Cytotoxicity (MTT, AlamarBlue(®) and propidium iodide, PI, uptake assays) was evaluated on HaCat keratinocytes after 24 h, 48 h, and seven days of exposure. After 24 h of exposure, no titanium was detectable in receiving solutions for both intact and damaged skin. Titanium was found in the epidermal layer after 24 h of exposure (0.47 ± 0.33 μg/cm(2)) while in the dermal layer, the concentration was below the limit of detection. Damaged skin, in its whole, has shown a similar concentration (0.53 ± 0.26 μg/cm(2)). Cytotoxicity studies on HaCaT cells demonstrated that TiO2NPs induced cytotoxic effects only at very high concentrations, reducing cell viability after seven days of exposure with EC50s of 8.8 × 10(-4) M (MTT assay), 3.8 × 10(-5) M (AlamarBlue(®) assay), and 7.6 × 10(-4) M (PI uptake, index of a necrotic cell death). Our study demonstrated that TiO2NPs cannot permeate intact and damaged skin and can be found only in the stratum corneum and epidermis. Moreover, the low cytotoxic effect observed on human HaCaT keratinocytes suggests that these nano-compounds have a potential toxic effect at the skin level only after long-term exposure.

  13. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms.

    Science.gov (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette

    2017-04-15

    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  14. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  15. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  16. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  17. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  18. Eradication of damaged keratinocytes in cutaneous lichen planus forms demonstrated by evaluation of epidermal and follicular expression of CK15, indices of apoptosis and regulatory protein S100.

    Science.gov (United States)

    Upeniece, Ilze; Groma, Valerie; Skuja, Sandra; Cauce, Vinita

    The study of cytoskeleton arrangement and its contribution to survival of cell-to-cell contacts appears to be essential for understanding of numerous cellular and tissue processes. Applying CK15, S100 labeling and TUNEL reaction to cutaneous lichen planus subtypes, we found CK15 expression in the outer and inner root sheath of hair follicles, the basal epidermal layer, and eccrine glands. Its follicular expression was decreased in nearby inflammatory infiltrates. The CK15 immunopositivity was mostly described as weak (92.3%) for lichen planus but equally subdivided into weak, moderate and strong in lichen planopilaris (2 = 32.514; df = 4; p lichen planopilaris involving the scalp: 81.2 ±10.7; 87.8 ±10.7 and 88.0 ±10.5 for the basal, spinous and upper epidermal layers, respectively. S100 positive epidermal and follicular cells did not differ in the lesions demonstrated in the study groups; still immunoreactivity was more pronounced in the scalp region of lichen planopilaris. Damage of cell-to-cell contacts was confirmed by electron microscopy. Apart from immunocyte-mediated keratinocyte death, cytoskeleton-based injury and loss of cell-to-cell and matrix contacts may be of great importance, leading to eradication of degrading cells and thus contributing to the pathogenesis of lichen planus.

  19. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  20. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  1. Synergistic augmentation of ATP-induced interleukin-6 production by arsenite in HaCaT cells.

    Science.gov (United States)

    Sumi, Daigo; Asao, Masashi; Okada, Hideta; Yogi, Kuniko; Miyataka, Hideki; Himeno, Seiichiro

    2016-06-01

    Chronic arsenic exposure causes cutaneous diseases such as hyperkeratosis and skin cancer. However, little information has been available regarding the molecular mechanisms underlying these symptoms. Because extracellular ATP and interleukin-6 (IL-6) are involved in pathological aspects of cutaneous diseases, we examined whether sodium arsenite (As(III)) affects ATP-induced IL-6 production in human epidermal keratinocyte HaCaT cells. The results showed that the addition of As(III) into the medium of HaCaT cells dose dependently increased the production of IL-6 induced by extracellular ATP, although As(III) alone had no effect on IL-6 production. To elucidate the mechanism of the synergistic effect of As(III) on IL-6 production by extracellular ATP, we next examined the phosphorylation of p38, ERK and epidermal growth factor receptor (EGFR), since we found that these signaling molecules were stimulated by exposure to extracellular ATP. The results indicated that ATP-induced phosphorylation of p38, ERK and EGFR was synergistically enhanced by co-exposure to As(III). To clarify the mechanisms underlying the enhanced phosphorylation of p38, ERK and EGFR by As(III), we explored two possible mechanisms: the inhibition of extracellular ATP degradation and the inhibition of protein tyrosine phosphatases (PTPs) activity by As(III). The degradation of extracellular ATP was not changed by As(III), whereas the activity of PTPs was significantly inhibited by As(III). Our results suggest that As(III) augments ATP-induced IL-6 production in HaCaT cells through enhanced phosphorylation of the EGFR and p38/ERK pathways, which is associated with the inhibition of PTPs activity.

  2. Effect of Absolute From Hibiscus syriacus L. Flower on Wound Healing in Keratinocytes

    Science.gov (United States)

    Yoon, Seok Won; Lee, Kang Pa; Kim, Do-Yoon; Hwang, Dae Il; Won, Kyung-Jong; Lee, Dae Won; Lee, Hwan Myung

    2017-01-01

    Background: Proliferation and migration of keratinocytes are essential for the repair of cutaneous wounds. Hibiscus syriacus L. has been used in Asian medicine; however, research on keratinocytes is inadequate. Objective: To establish the dermatological properties of absolute from Hibiscus syriacus L. flower (HSF) and to provide fundamental research for alternative medicine. Materials and Methods: We identified the composition of HSF absolute using gas chromatography-mass spectrometry analysis. We also examined the effect of HSF absolute in HaCaT cells using the XTT assay, Boyden chamber assay, sprout-out growth assay, and western blotting. We conducted an in-vivo wound healing assay in rat tail-skin. Results: Ten major active compounds were identified from HSF absolute. As determined by the XTT assay, Boyden chamber assay, and sprout-out growth assay results, HSF absolute exhibited similar effects as that of epidermal growth factor on the proliferation and migration patterns of keratinocytes (HaCaT cells), which were significantly increased after HSF absolute treatment. The expression levels of the phosphorylated signaling proteins relevant to proliferation, including extracellular signal-regulated kinase 1/2 (Erk 1/2) and Akt, were also determined by western blot analysis. Conclusion: These results of our in-vitro and ex-vivo studies indicate that HSF absolute induced cell growth and migration of HaCaT cells by phosphorylating both Erk 1/2 and Akt. Moreover, we confirmed the wound-healing effect of HSF on injury of the rat tail-skin. Therefore, our results suggest that HSF absolute is promising for use in cosmetics and alternative medicine. SUMMARY Hisbiscus syriacus L. flower absolute increases HaCaT cell migration and proliferation.Hisbiscus syriacus L. flower absolute regulates phosphorylation of ERK 1/2 and Akt in HaCaT cell.Treatment with Hisbiscus syriacus L. flower induced sprout outgrowth.The wound in the tail-skin of rat was reduced by Hisbiscus syriacus

  3. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  4. H-Ras activation promotes cytoplasmic accumulation and phosphoinositide 3-OH kinase association of beta-catenin in epidermal keratinocytes

    DEFF Research Database (Denmark)

    Espada, J; Pérez-Moreno, M; Braga, V M

    1999-01-01

    The mechanisms underlying downregulation of the cadherin/catenin complexes and beta-catenin signaling during tumor progression are not fully understood. We have analyzed the effect of oncogenic H-Ras on E-cadherin/catenin complex formation/stabilization and beta-catenin distribution in epidermal ...

  5. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  6. RNA-Seq Analysis of IL-1B and IL-36 Responses in Epidermal Keratinocytes Identifies a Shared MyD88-Dependent Gene Signature.

    Science.gov (United States)

    Swindell, William R; Beamer, Maria A; Sarkar, Mrinal K; Loftus, Shannon; Fullmer, Joseph; Xing, Xianying; Ward, Nicole L; Tsoi, Lam C; Kahlenberg, Michelle J; Liang, Yun; Gudjonsson, Johann E

    2018-01-01

    IL-36 cytokines have recently emerged as mediators of inflammation in autoimmune conditions including psoriasis vulgaris (PsV) and generalized pustular psoriasis (GPP). This study used RNA-seq to profile the transcriptome of primary epidermal keratinocytes (KCs) treated with IL-1B, IL-36A, IL-36B, or IL-36G. We identified some early IL-1B-specific responses (8 h posttreatment), but nearly all late IL-1B responses were replicated by IL-36 cytokines (24 h posttreatment). Type I and II interferon genes exhibited time-dependent response patterns, with early induction (8 h) followed by no response or repression (24 h). Altogether, we identified 225 differentially expressed genes (DEGs) with shared responses to all 4 cytokines at both time points (8 and 24 h). These involved upregulation of ligands ( IL1A, IL1B , and IL36G ) and activating proteases ( CTSS ) but also upregulation of inhibitors such as IL1RN and IL36RN . Shared IL-1B/IL-36 DEGs overlapped significantly with genes altered in PsV and GPP skin lesions, as well as genes near GWAS loci linked to autoimmune and autoinflammatory diseases (e.g., PsV, psoriatic arthritis, inflammatory bowel disease, and primary biliary cholangitis). Inactivation of MyD88 adapter protein using CRISPR/Cas9 completely abolished expression responses of such DEGs to IL-1B and IL-36G stimulation. These results provide a global view of IL-1B and IL-36 expression responses in epidermal KCs with fine-scale characterization of time-dependent and cytokine-specific response patterns. Our findings support an important role for IL-1B and IL-36 in autoimmune or autoinflammatory conditions and show that MyD88 adaptor protein mediates shared IL-1B/IL-36 responses.

  7. Significance of Ubiad1 for Epidermal Keratinocytes Involves More Than CoQ10 Synthesis: Implications for Skin Aging

    Directory of Open Access Journals (Sweden)

    Florian Labarrade

    2018-01-01

    Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  9. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  10. Transfer of a two-tiered keratinocyte assay: IL-18 production by NCTC2544 to determine the skin sensitizing capacity and epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2013-01-01

    . The two tiered approach may offer an unique opportunity to provide an alternative method to the Local Lymph Node Assay (LLNA). These assays are both based on the use of human keratinocytes, which have been shown over the last two decades, to play a key role in all phases of skin sensitization....

  11. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  12. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  13. Two-tiered keratinocyte assay: IL-18 production by NCTC2544 cells to determine the skin sensitizing capacity and an epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2012-01-01

    the use of animals. The aim of the EU FP6 Integrated Project Sens-it-iv was to develop and optimize an integrated testing strategy consisting of in vitro, human cell based assays which will closely mimic sensitization mechanisms in vivo. These assays should be an alternative approach to the LLNA. The NCTC...... method to the LLNA. Both assays are based on the use of human keratinocytes, which have been shown, over the last two decades, to play a key role in all phases of skin sensitization. First, 4 known chemicals were tested during a transferability study in which 6 laboratories participated. Three...

  14. The involvement of Gab1 and PI 3-kinase in β1 integrin signaling in keratinocytes

    International Nuclear Information System (INIS)

    Kuwano, Yoshihiro; Fujimoto, Manabu; Watanabe, Rei; Ishiura, Nobuko; Nakashima, Hiroko; Komine, Mayumi; Hamazaki, Tatsuo S.; Tamaki, Kunihiko; Okochi, Hitoshi

    2007-01-01

    The control of the stem cell compartment in epidermis is closely linked to the regulation of keratinocyte proliferation and differentiation. β1 integrins are expressed 2-fold higher by stem cells than transit-amplifying cells. Signaling from these β1 integrins is critical for the regulation of the epidermal stem cell compartment. To clarify the functional relevance of this differential expression of β1 integrins, we established HaCaT cells with high β1integrin expression by repeated flow cytometric sorting of this population from the parental cell line. In these obtained cells expressing β1 integrins by 5-fold, MAPK activation was markedly increased. Regarding the upstream of MAPK, Gab1 phosphorylation was also higher with high β1 integrin expression, while Shc phosphorylation was not altered. In addition, enhanced phosphatidylinositol 3-kinase activation was also observed. These observations suggest that Gab1 and phosphatidylinositol 3-kinase play pivotal roles in the β1 integrin-mediated regulation of the epidermal stem cell compartment

  15. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  16. Sargahydroquinoic acid inhibits TNFα-induced AP-1 and NF-κB signaling in HaCaT cells through PPARα activation

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Youngsic; Jung, Yujung; Kim, Min Cheol; Kwon, Hak Cheol [Natural Medicine Center, KIST Gangneung Institute, Gangneung 210-340 (Korea, Republic of); Kang, Ki Sung [College of Korean Medicine, Gachon University, Seongnam 461-701 (Korea, Republic of); Kim, Yong Kee, E-mail: yksnbk@sm.ac.kr [College of Pharmacy, Sookmyung Women’s University, Seoul 140-742 (Korea, Republic of); Kim, Su-Nam, E-mail: snkim@kist.re.kr [Natural Medicine Center, KIST Gangneung Institute, Gangneung 210-340 (Korea, Republic of)

    2014-08-08

    Highlights: • SHQA increases PPARα/γ transactivation and inhibits MMP-2/-9 expression. • SHQA inhibits TNFα-induced AP-1 and MAPK signaling. • SHQA inhibits TNFα-induced p65 translocation and IκBα phosphorylation. • SHQA inhibits TNFα-induced AP-1 and NF-κB signaling via PPARα. - Abstract: Peroxisome proliferator-activated receptors (PPARs) are members of the nuclear hormone receptor superfamily of ligand-activated transcription factors and expressed in various cell types in the skin, including keratinocytes, fibroblasts and infiltrating immune cells. Thus, their ligands are targets for the treatment of various skin disorders, such as photo-aging and chronological aging of skin. Intensive studies have revealed that PPARα/γ functions in photo-aging and age-related inflammation by regulating matrix metalloproteinases (MMPs) via activator protein-1 (AP-1) and nuclear factor kappa B (NF-κB). However, the detailed mechanism of PPARα/γ’s role in skin aging has not yet been elucidated. In this study, we confirmed that sargahydroquinoic acid (SHQA) as a PPARα/γ ligand significantly decreased Tumor Necrosis Factor-alpha (TNFα)-induced MMP-2/-9 expression by downregulating TNFα-induced transcription factors, subsequently reducing IκBα degradation and blocking NF-κB p65 nuclear translocation in HaCaT human epidermal keratinocyte cells. Treatment of cells with SHQA and GW6471 (PPARα antagonist) not bisphenol A diglycidyl ether (PPARγ antagonists), reversed the effect on TNFα-induced inflammatory signaling pathway activation. Taken together, our data suggest that SHQA inhibit TNFα-induced MMP-2/-9 expression and age-related inflammation by suppressing AP-1 and NF-κB pathway via PPARα.

  17. Keratinocytes at the uppermost layer of epidermis might act as sensors of atmospheric pressure change.

    Science.gov (United States)

    Denda, Mitsuhiro

    2016-01-01

    It has long been suggested that climate, especially atmospheric pressure change, can cause health problems ranging from migraine to myocardial infarction. Here, I hypothesize that the sensory system of epidermal keratinocytes mediates the influence of atmospheric pressure change on the human physiological condition. We previously demonstrated that even subtle changes of atmospheric pressure (5-20 hPa) induce elevation of intracellular calcium level in cultured human keratinocytes (excitation of keratinocytes). It is also established that communication occurs between epidermal keratinocytes and peripheral nerve systems. Moreover, various neurotransmitters and hormones that influence multiple systems (nervous, cardiovascular, endocrine, and immune systems) are generated and released from epidermal keratinocytes in response to various external stimuli. Thus, I suggest that pathophysiological phenomena induced by atmospheric pressure changes might be triggered by epidermal keratinocytes.

  18. Electrospun tilapia collagen nanofibers accelerating wound healing via inducing keratinocytes proliferation and differentiation.

    Science.gov (United States)

    Zhou, Tian; Wang, Nanping; Xue, Yang; Ding, Tingting; Liu, Xin; Mo, Xiumei; Sun, Jiao

    2016-07-01

    The development of biomaterials with the ability to induce skin wound healing is a great challenge in biomedicine. In this study, tilapia skin collagen sponge and electrospun nanofibers were developed for wound dressing. The collagen sponge was composed of at least two α-peptides. It did not change the number of spleen-derived lymphocytes in BALB/c mice, the ratio of CD4(+)/CD8(+) lymphocytes, and the level of IgG or IgM in Sprague-Dawley rats. The tensile strength and contact angle of collagen nanofibers were 6.72±0.44MPa and 26.71±4.88°, respectively. They also had good thermal stability and swelling property. Furthermore, the nanofibers could significantly promote the proliferation of human keratinocytes (HaCaTs) and stimulate epidermal differentiation through the up-regulated gene expression of involucrin, filaggrin, and type I transglutaminase in HaCaTs. The collagen nanofibers could also facilitate rat skin regeneration. In the present study, electrospun biomimetic tilapia skin collagen nanofibers were succesfully prepared, were proved to have good bioactivity and could accelerate rat wound healing rapidly and effectively. These biological effects might be attributed to the biomimic extracellular matrix structure and the multiple amino acids of the collagen nanofibers. Therefore, the cost-efficient tilapia collagen nanofibers could be used as novel wound dressing, meanwhile effectively avoiding the risk of transmitting animal disease in the future clinical apllication. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Stereotyped distribution of proliferating keratinocytes in disorders affecting the epidermis

    International Nuclear Information System (INIS)

    Pierard-Franchimont, C.; Pierard, G.E.

    1989-01-01

    We used the technique of autoradiography after incorporation of tritiated thymidine ( 3 H-TdR) to evaluate keratinocyte proliferation in basal, epibasal, and other epidermal layers in 30 diseases affecting the epidermis. The number and proportion of 3 H-TdR-labeled keratinocytes were counted in the different layers of the epidermis. Significant correlations were found between the proliferative indices of the different epidermal layers. Such links indicate that the epidermis responds in a rather stereotyped way to various pathological conditions. There exists some regulation in the distribution, number, and proportion of 3 H-TdR-labeled keratinocytes in the various layers of the epidermis

  20. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  1. The induction of apoptosis in pre-malignant keratinocytes by omega-3 polyunsaturated fatty acids docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) is inhibited by albumin.

    Science.gov (United States)

    Nikolakopoulou, Zacharoula; Shaikh, Mushfiq Hassan; Dehlawi, Hebah; Michael-Titus, Adina Teodora; Parkinson, Eric Kenneth

    2013-04-12

    The long chain omega-3 polyunsaturated fatty acids (PUFA) have been reported to exert anti-cancer effects. At this study we tested the effect of the omega-3 PUFA, docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), on pre-malignant keratinocytes growth in the well-characterised human pre-malignant epidermal cell line, HaCaT and attempted to identify a PUFA serum antagonist. Both EPA and DHA inhibited HaCaT growth and induced apoptosis. At the 10% (v/v) foetal bovine serum (FBS) medium, limited growth inhibition (3-20% for 50μM DHA and EPA respectively) and negligible apoptosis were observed with PUFA use. However, at 3% (v/v) FBS medium, 30-50μM of PUFA caused impressive levels of growth inhibition (82-83% for 50μM DHA and EPA respectively) and increase of apoptosis (8-19% increase in 72h). None of the numerous serum growth factors present in FBS or the antioxidant n-tert-butyl-α-phenylnitrone could inhibit the PUFA-induced cytotoxicity. In contrast, bovine and human albumin (0.1-0.3%, w/v) significantly antagonized the growth inhibitory and apoptosis-inducing effects of PUFA. In conclusion, we have shown for the first time that omega-3 PUFA inhibit the growth and induce apoptosis of pre-malignant keratinocytes and identified albumin as a major antagonistic factor in serum that could limit their effectiveness at pharmacologically-achievable doses. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  2. Asymmetric migration of human keratinocytes under mechanical stretch and cocultured fibroblasts in a wound repair model.

    Directory of Open Access Journals (Sweden)

    Dongyuan Lü

    Full Text Available Keratinocyte migration during re-epithelization is crucial in wound healing under biochemical and biomechanical microenvironment. However, little is known about the underlying mechanisms whereby mechanical tension and cocultured fibroblasts or keratinocytes modulate the migration of keratinocytes or fibroblasts. Here we applied a tensile device together with a modified transwell assay to determine the lateral and transmembrane migration dynamics of human HaCaT keratinocytes or HF fibroblasts. A novel pattern of asymmetric migration was observed for keratinocytes when they were cocultured with non-contact fibroblasts, i.e., the accumulative distance of HaCaT cells was significantly higher when moving away from HF cells or migrating from down to up cross the membrane than that when moving close to HF cells or when migrating from up to down, whereas HF migration was symmetric. This asymmetric migration was mainly regulated by EGF derived from fibroblasts, but not transforming growth factor α or β1 production. Mechanical stretch subjected to fibroblasts fostered keratinocyte asymmetric migration by increasing EGF secretion, while no role of mechanical stretch was found for EGF secretion by keratinocytes. These results provided a new insight into understanding the regulating mechanisms of two- or three-dimensional migration of keratinocytes or fibroblasts along or across dermis and epidermis under biomechanical microenvironment.

  3. The radiosensitivity of human keratinocytes: influence of activated c-H-ras oncogene expression and tumorigenicity

    International Nuclear Information System (INIS)

    Mendonca, M.S.; Redpath, J.L.; Stanbridge, E.J.

    1991-01-01

    The authors investigated γ-ray sensitivity of several activated c-H-ras (EJ) containing clones established after transfection of the spontaneously immortalized non-tumorigenic human keratinocyte cell line HaCaT. The clones were grouped according to tumorigenic potential after subcutaneous injection into nude mice, and fell into three classes: Class I clones A-4 and I-6 are non-tumorigenic and express very low levels of c-H-ras mRNA and no mutated ras protein (p 21 ); Class II clones I-5 and I-7 grow to large (benign) epidermal cysts, express intermediate to high c-H-ras mRNA and variable levels of mutated ras p 21 protein with clone I-5 expressing little and clone I-7 expressing high levels of p 21 ; Class III clones II-3 and II-4 grow to solid squamous cell carcinomas, express high c-H-ras mRNA and high level of mutated p 21 ras protein similar to clone I-7. Comparison of single-hit multitarget or linear-quadratic survival curve parameters, and survival at 2Gy (S 2 ) indicate no general correlation with either activated c-H-ras expression level or tumorigenic potential, and increased radioresistance. (author)

  4. The hormesis effect of plasma-elevated intracellular ROS on HaCaT cells

    Science.gov (United States)

    Szili, Endre J.; Harding, Frances J.; Hong, Sung-Ha; Herrmann, Franziska; Voelcker, Nicolas H.; Short, Robert D.

    2015-12-01

    We have examined the link between ionized-gas plasma delivery of reactive oxygen species (ROS) to immortalized keratinocyte (HaCaT) cells and cell fate, defined in terms of cell viability versus death. Phospholipid vesicles were used as cell mimics to measure the possible intracellular ROS concentration, [ROSi], delivered by various plasma treatments. Cells were exposed to a helium cold atmospheric plasma (CAP) jet for different plasma exposure times (5-60 s) and gas flow rates (50-1000 ml min-1). Based upon the [ROSi] data we argue that plasma-generated ROS in the cell culture medium can readily diffuse into real cells. Plasma exposure that equated to an [ROSi] in the range of 3.81  ×  10-10-9.47  ×  10-8 M, measured at 1 h after the plasma exposure, resulted in increased cell viability at 72 h; whereas a higher [ROSi] at 1 h decreased cell viability after 72 h of culture. This may be because of the manner in which the ROS are delivered by the plasma: HaCaT cells better tolerate a low ROS flux over an extended plasma exposure period of 1 min, compared to a high flux delivered in a few seconds, although the final [ROSi] may be the same. Our results suggest that plasma stimulation of HaCaT cells follows the principle of hormesis.

  5. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Manwaring, John, E-mail: manwaring.jd@pg.com [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Rothe, Helga [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany); Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A. [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Hewitt, Nicola J. [SWS, Erzhausen (Germany); Goebel, Carsten [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany)

    2015-09-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K{sub m} and V{sub max} values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C{sub max} was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human

  6. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

    International Nuclear Information System (INIS)

    Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A.; Hewitt, Nicola J.; Goebel, Carsten

    2015-01-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K m and V max values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C max was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human skin explants and

  7. miR-125b inhibits keratinocyte proliferation and promotes keratinocyte apoptosis in oral lichen planus by targeting MMP-2 expression through PI3K/Akt/mTOR pathway.

    Science.gov (United States)

    Wang, Jing; Luo, Hong; Xiao, Yan; Wang, Luyao

    2016-05-01

    Oral lichen planus (OLP) is a chronic inflammatory mucosal disease that involves the degeneration of keratinocytes. However, the etiology and mechanisms of OLP pathogenesis have not been fully elucidated. In this study, we used keratinocytes HaCaT stimulated with lipopolysaccharide (LPS) to mimic a local OLP immune environment, and investigated the regulatory role of miR-125b in keratinocyte proliferation and apoptosis under OLP conditions. Immunohistochemical analysis and quantitative real-time PCR (qRT-PCR) assay showed that MMP-2 expression was up-regulated and miR-125b expression was down-regulated in both OLP mucosa tissues and LPS-incubated HaCaT cells. Western blot analysis indicated that miR-125b overexpression suppressed LPS-induced MMP-2 expression in HaCaT cells. Molecularly, our results confirmed that MMP-2 is a target gene of miR-125b in HaCaT cells. The effect of miR-125b on cell proliferation was revealed by CCK-8 assay, BrdU assay and cell cycle analysis, which illustrated that miR-125b overexpression impeded LPS-induced HaCaT cell proliferation. Flow cytometry analysis further demonstrated that miR-125b overexpression promoted HaCaT cell apoptosis. Moreover, these effects were involved in PI3K/Akt/mTOR activation, as miR-125b overexpression inhibited LPS-enhanced expression of p-Akt and p-mTOR proteins. Taken together, these data confirm that miR-125b might inhibit keratinocyte proliferation and promote keratinocyte apoptosis in OLP pathogenesis by targeting MMP-2 through PI3K/Akt/mTOR pathway. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    International Nuclear Information System (INIS)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-01-01

    The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.

  9. Inability of keratinocytes lacking their specific transglutaminase to form cross-linked envelopes: Absence of envelopes as a simple diagnostic test for lamellar ichthyosis

    OpenAIRE

    Jeon, Saewha; Djian, Philippe; Green, Howard

    1998-01-01

    Epidermal keratinocytes, late in their terminal differentiation, form cross-linked envelopes resistant to ionic detergent and reducing agent. Because the cross-linking process is catalyzed by the keratinocyte transglutaminase, the absence of active transglutaminase should result in failure of the keratinocyte to form a cross-linked envelope. Three keratinocyte strains bearing mutations in the keratinocyte transglutaminase were examined: two contained no detectable transglutaminase mRNA and no...

  10. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  11. Enhancement of UVB radiation-mediated apoptosis by knockdown of cytosolic NADP+-dependent isocitrate dehydrogenase in HaCaT cells

    OpenAIRE

    Lee, Su Jeong; Park, Jeen-Woo

    2014-01-01

    Ultraviolet B (UVB) radiation induces the production of reactive oxygen species (ROS) that promote apoptotic cell death. We showed that cytosolic NADP+-dependent isocitrate dehydrogenase (IDPc) plays an essential role in the control of cellular redox balance and defense against oxidative damage, by supplying NADPH for antioxidant systems. In this study, we demonstrated that knockdown of IDPc expression by RNA interference enhances UVB-induced apoptosis of immortalized human HaCaT keratinocyte...

  12. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a...

  13. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro.

    Science.gov (United States)

    Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J; Baker, Timothy R; Troutman, John A; Hewitt, Nicola J; Goebel, Carsten

    2015-09-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis-Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte Km and Vmax values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and Cmax was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. Copyright © 2015. Published by Elsevier Inc.

  14. Suppression of skin inflammation in keratinocytes and acute/chronic disease models by caffeic acid phenethyl ester.

    Science.gov (United States)

    Lim, Kyung-Min; Bae, SeungJin; Koo, Jung Eun; Kim, Eun-Sun; Bae, Ok-Nam; Lee, Joo Young

    2015-04-01

    Skin inflammation plays a central role in the pathophysiology and symptoms of diverse chronic skin diseases including atopic dermatitis (AD). In this study, we examined if caffeic acid phenethyl ester (CAPE), a skin-permeable bioactive compound from propolis, was protective against skin inflammation using in vitro cell system and in vivo animal disease models. CAPE suppressed TNF-α-induced NF-κB activation and expression of inflammatory cytokines in human keratinocytes (HaCaT). The potency and efficacy of CAPE were superior to those of a non-phenethyl derivative, caffeic acid. Consistently, topical treatment of CAPE (0.5 %) attenuated 12-O-tetradecanoylphorbol-13-acetate(TPA)-induced skin inflammation on mouse ear as CAPE reduced ear swelling and histologic inflammation scores. CAPE suppressed increased expression of pro-inflammatory molecules such as TNF-α, cyclooxygenase-2 and inducible NO synthase in TPA-stimulated skin. TPA-induced phosphorylation of IκB and ERK was blocked by CAPE suggesting that protective effects of CAPE on skin inflammation is attributed to inhibition of NF-κB activation. Most importantly, in an oxazolone-induced chronic dermatitis model, topical application of CAPE (0.5 and 1 %) was effective in alleviating AD-like symptoms such as increases of trans-epidermal water loss, skin thickening and serum IgE as well as histologic inflammation assessment. Collectively, our results propose CAPE as a promising candidate for a novel topical drug for skin inflammatory diseases.

  15. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  16. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  17. Effects of titanium dioxide nanoparticles on human keratinocytes.

    Science.gov (United States)

    Wright, Clayton; Iyer, Anand Krishnan V; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S; Rojanasakul, Yon; Azad, Neelam

    2017-01-01

    Titanium dioxide (TiO 2 ) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO 2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO 2 nanoparticles (H 2 TiO 7 ) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO 2 particles varying in size (Fine, Ultrafine and H 2 TiO 7 ) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO 2 ; however, there is no consistent effect on cell viability and proliferation with either of these TiO 2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO 2 , we did not observe any significant effect of UV-C exposure combined with TiO 2 treatment on HaCaTs. Furthermore, TiO 2 -treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H 2 TiO 7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO 2 .

  18. Relative cytotoxicity of complexes of platinum(II and palladium(II against pure cell culture Paramecium caudatum and human cell lines A431 and HaCaT

    Directory of Open Access Journals (Sweden)

    Aleksei Vladimirovich Eremin

    2018-04-01

    Full Text Available The results of cytotoxicity cisplatin-like complexes of platinum(II and palladium(II are presented. The cytotoxicity was researched by method of  biotesting with Paramecium caudatum and by MTT-assay with human cells: epidermoid carcimoma A431 and minimal transformed aneuploid keratinocytes HaCaT. Cytotoxicity of complexes toward protists is high, however, comparatively HaCaT are more sensitive than A431. Furthemore, cytotoxicity of palladium(II complexes is higher than the analogues with platinum(II.

  19. Fragrance chemicals lyral and lilial decrease viability of HaCat cells' by increasing free radical production and lowering intracellular ATP level: protection by antioxidants.

    Science.gov (United States)

    Usta, Julnar; Hachem, Yassmine; El-Rifai, Omar; Bou-Moughlabey, Yolla; Echtay, Karim; Griffiths, David; Nakkash-Chmaisse, Hania; Makki, Rajaa Fakhoury

    2013-02-01

    We investigate in this study the biochemical effects on cells in culture of two commonly used fragrance chemicals: lyral and lilial. Whereas both chemicals exerted a significant effect on primary keratinocyte(s), HaCat cells, no effect was obtained with any of HepG2, Hek293, Caco2, NIH3T3, and MCF7 cells. Lyral and lilial: (a) decreased the viability of HaCat cells with a 50% cell death at 100 and 60 nM respectively; (b) decreased significantly in a dose dependant manner the intracellular ATP level following 12-h of treatment; (c) inhibited complexes I and II of electron transport chain in liver sub-mitochondrial particles; and (d) increased reactive oxygen species generation that was reversed by N-acetyl cysteine and trolox and the natural antioxidant lipoic acid, without influencing the level of free and/or oxidized glutathione. Lipoic acid protected HaCat cells against the decrease in viability induced by either compound. Dehydrogenation of lyral and lilial produce α,β-unsaturated aldehydes, that reacts with lipoic acid requiring proteins resulting in their inhibition. We propose lyral and lilial as toxic to mitochondria that have a direct effect on electron transport chain, increase ROS production, derange mitochondrial membrane potential, and decrease cellular ATP level, leading thus to cell death. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  1. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays

    International Nuclear Information System (INIS)

    Walter, M.N.M.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E.B.

    2010-01-01

    We have used in vitro scratch assays to examine the relative contribution of dermal fibroblasts and keratinocytes in the wound repair process and to test the influence of mesenchymal stem cell (MSC) secreted factors on both skin cell types. Scratch assays were established using single cell and co-cultures of L929 fibroblasts and HaCaT keratinocytes, with wound closure monitored via time-lapse microscopy. Both in serum supplemented and serum free conditions, wound closure was faster in L929 fibroblast than HaCaT keratinocyte scratch assays, and in co-culture the L929 fibroblasts lead the way in closing the scratches. MSC-CM generated under serum free conditions significantly enhanced the wound closure rate of both skin cell types separately and in co-culture, whereas conditioned medium from L929 or HaCaT cultures had no significant effect. This enhancement of wound closure in the presence of MSC-CM was due to accelerated cell migration rather than increased cell proliferation. A number of wound healing mediators were identified in MSC-CM, including TGF-β1, the chemokines IL-6, IL-8, MCP-1 and RANTES, and collagen type I, fibronectin, SPARC and IGFBP-7. This study suggests that the trophic activity of MSC may play a role in skin wound closure by affecting both dermal fibroblast and keratinocyte migration, along with a contribution to the formation of extracellular matrix.

  2. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    International Nuclear Information System (INIS)

    Khadjavi, Amina; Magnetto, Chiara; Panariti, Alice; Argenziano, Monica; Gulino, Giulia Rossana; Rivolta, Ilaria; Cavalli, Roberta; Giribaldi, Giuliana; Guiot, Caterina; Prato, Mauro

    2015-01-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  3. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  4. Pepsin-solubilised collagen (PSC) from Red Sea cucumber (Stichopus japonicus) regulates cell cycle and the fibronectin synthesis in HaCaT cell migration.

    Science.gov (United States)

    Park, Soo-Yeong; Lim, Hee Kyoung; Lee, Seogjae; Hwang, Hyeong Cheol; Cho, Somi K; Cho, Moonjae

    2012-05-01

    Pepsin-solubilised collagen (PSC) from Red Sea cucumber (Stichopus japonicus) was studied with respect to its wound-healing effects on a human keratinocyte (HaCaT) cell line. Disaggregated collagen fibres were treated with 0.1M NaOH for 24h and digested with pepsin for 72h to reach maximum yield of 26.6%. The results of an in vitro wound-healing test showed that migration of HaCaT cells was 1.5-fold faster on PSC-coated plates than on untreated plates. The migration rate of sea cucumber PSC was similar to that of rat PSC, but five times higher than that of bovine gelatin. HaCaT cells grown on PSC-coated plates revealed increased fibronectin synthesis (6-fold and 3-fold compared to gelatin and rat PSC, respectively). Additionally, sea cucumber PSCs induced HaCaT cell proliferation by decreasing the G1 phase by 5% and maintaining a larger population (8%) of cells in mitosis. Collagen from Red Sea cucumber might be useful as an alternative to mammalian collagen in the nutraceutical and pharmaceutical industries. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Integrin β4 Regulates Migratory Behavior of Keratinocytes by Determining Laminin-332 Organization*s

    Science.gov (United States)

    Sehgal, Bernd U.; DeBiase, Phillip J.; Matzno, Sumio; Chew, Teng-Leong; Claiborne, Jessica N.; Hopkinson, Susan B.; Russell, Alan; Marinkovich, M. Peter; Jones, Jonathan C. R.

    2010-01-01

    Whether α6β4 integrin regulates migration remains controversial. β4 integrin-deficient (JEB) keratinocytes display aberrant migration in that they move in circles, a behavior that mirrors the circular arrays of laminin (LM)-332 in their matrix. In contrast, wild-type keratinocytes and JEB keratinocytes, induced to express β4 integrin, assemble laminin-332 in linear tracks over which they migrate. Moreover, laminin-332-dependent migration of JEB keratinocytes along linear tracks is restored when cells are plated on wild-type keratinocyte matrix, whereas wild-type keratinocytes show rotation over circular arrays of laminn-332 in JEB keratinocyte matrix. The activities of Rac1 and the actin cytoskeleton-severing protein cofilin are low in JEB keratinocytes compared with wild-type cells but are rescued following expression of wild-type β4 integrin in JEB cells. Additionally, in wild-type keratinocytes Rac1 is complexed with α6β4 integrin. Moreover, Rac1 or cofilin inactivation induces wild-type keratinocytes to move in circles over rings of laminin-332 in their matrix. Together these data indicate that laminin-332 matrix organization is determined by the α6β4 integrin/actin cytoskeleton via Rac1/cofilin signaling. Furthermore, our results imply that the organizational state of laminin-332 is a key determinant of the motility behavior of keratinocytes, an essential element of skin wound healing and the successful invasion of epidermal-derived tumor cells. PMID:16973601

  6. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  7. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)

    2016-04-08

    The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.

  8. TRB3 is elevated in psoriasis vulgaris lesions and mediates HaCaT cells proliferation in vitro.

    Science.gov (United States)

    Yu, Xiao-Jing; Song, Tie-Jun; Zhang, Lu-Wei; Su, Ying; Wang, Ke-Yu; Sun, Qing

    2017-10-01

    Psoriasis is a chronic skin disease characterized by abnormal keratinocyte proliferation and differentiation, inflammation, and angiogenesis. Overexpression of tribbles homolog3 (TRB3), which belongs to the tribbles family of pseudokinases, has been found in several human tumors and metabolic diseases, but its role in psoriasis has not been fully clarified. The aim of this study is to investigate the expression of TRB3 in psoriasis and explore its roles in the proliferation of keratinocytes. Twenty-four patients with psoriasis vulgaris were recruited for the study. Diagnosis of psoriasis was based on clinical and histologic examinations. Immunohistochemistry and real-time reverse transcription PCR (RT-PCR) were performed to determine protein and messenger RNA (mRNA) expression of TRB3 in psoriasis lesions. 5-Bromo-2-deoxyUridine (BrdU) incorporation assay were performed for cell proliferation. Cell cycle distribution was assessed by flow cytometry analysis. The levels of TRB3 is elevated in psoriatic lesions compared with psoriatic non-lesions. The HaCat cells expressed the TRB3 gene. We found TRB3 silencing to significantly inhibit HaCat cell proliferation. Furthermore, the specific knockdown of TRB3 slowed down the cell cycle at the gap 0/first gap phase. In conclusion, our data suggest that TRB3 is overexpressed in lesions of patients with psoriasis and may be involved in the abnormal proliferation of keratinocytes. Therefore, TRB3 may be a potential therapeutic target for psoriasis. © American Federation for Medical Research (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

    International Nuclear Information System (INIS)

    Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

    2014-01-01

    The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

  10. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  11. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  12. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  13. Cytoprotective responses in HaCaT keratinocytes exposed to high doses of curcumin

    NARCIS (Netherlands)

    Lundvig, D.M.S.; Pennings, S.W.C.; Brouwer, K.M.; Mtaya-Mlangwa, M.; Mugonzibwa, E.; Kuijpers-Jagtman, A.M.; Wagener, F.A.D.T.G.; Hoff, J.W. Von den

    2015-01-01

    Wound healing is a complex process that involves the well-coordinated interactions of different cell types. Topical application of high doses of curcumin, a plant-derived polyphenol, enhances both normal and diabetic cutaneous wound healing in rodents. For optimal tissue repair interactions between

  14. In vivo relative quantitative proteomics reveals HMGB1 as a downstream mediator of oestrogen-stimulated keratinocyte migration.

    Science.gov (United States)

    Shin, Jung U; Noh, Ji Yeon; Lee, Ju Hee; Lee, Won Jai; Yoo, Jong Shin; Kim, Jin Young; Kim, Hyeran; Jung, Inhee; Jin, Shan; Lee, Kwang Hoon

    2015-06-01

    It is known that oestrogen influences skin wound healing by modulating the inflammatory response, cytokine expression and extracellular matrix deposition; accelerating re-epithelialization; and stimulating angiogenesis. To identify novel proteins associated with effects of oestrogen on keratinocyte, stable isotope labelling by amino acids in cell culture (SILAC)-based mass spectrometry was performed. Using SILAC, quantification of 1085 proteins was achieved. Among these proteins, 60 proteins were upregulated and 32 proteins were downregulated. Among significantly upregulated proteins, high-mobility group protein B1 (HMGB1) has been further evaluated for its role in the effect of oestrogen on keratinocytes. HMGB1 expression was strongly induced in oestrogen-treated keratinocytes in dose- and time-dependent manner. Further, HMGB1 was able to significantly accelerate the rate of HaCaT cell migration. To determine whether HMGB1 is involved in E2-induced HaCaT cell migration, cells were transfected with HMGB1 siRNA. Knockdown of HMGB1 blocked oestrogen-induced keratinocyte migration. Collectively, these experiments demonstrate that HMGB1 is a novel downstream mediator of oestrogen-stimulated keratinocyte migration. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  16. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  17. Scanning Ion Conductance Microscopy of Live Keratinocytes

    International Nuclear Information System (INIS)

    Hegde, V; Mason, A; Saliev, T; Smith, F J D; McLean, W H I; Campbell, P A

    2012-01-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (< nN), could not routinely image microvilli: rather, an apparently convolved image of the underlying cytoskeleton was instead prevalent. We note that the present incarnation of the commercial instrument falls some way behind the market leading SPMs in terms of technical prowess and scanning speed, however, the intrinsic non-obtrusive nature of

  18. Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

    Science.gov (United States)

    Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

    1999-01-01

    Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

  19. Staphylococcus aureus keratinocyte invasion is mediated by integrin-linked kinase and Rac1.

    Science.gov (United States)

    Sayedyahossein, Samar; Xu, Stacey X; Rudkouskaya, Alena; McGavin, Martin J; McCormick, John K; Dagnino, Lina

    2015-02-01

    Staphylococcus aureus is a major component of the skin microbiota and causes a large number of serious infections. S. aureus first interacts with epidermal keratinocytes to breach the epidermal barrier through mechanisms not fully understood. By use of primary keratinocytes from mice with epidermis-restricted Ilk gene inactivation and control integrin-linked kinase (ILK)-expressing littermates, we investigated the role of ILK in epidermal S. aureus invasion. Heat-killed, but not live, bacteria were internalized to Rab5- and Rab7-positive phagosomes, and incubation with keratinocyte growth factor increased their uptake 2.5-fold. ILK-deficient mouse keratinocytes internalized bacteria 2- to 4-fold less efficiently than normal cells. The reduced invasion by live S. aureus of ILK-deficient cells was restored in the presence of exogenous, constitutively active Rac1. Thus, Rac1 functions downstream from ILK during invasion. Further, invasion by S. aureus of Rac1-deficient cells was 2.5-fold lower than in normal cells. Paradoxically, staphylococcal cutaneous penetration of mouse skin explants with ILK-deficient epidermis was 35-fold higher than that of normal skin, indicating defects in epidermal barrier function in the absence of ILK. Thus, we identified an ILK-Rac1 pathway essential for bacterial invasion of keratinocytes, and established ILK as a key contributor to prevent invasive staphylococcal cutaneous infection. © FASEB.

  20. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  1. Outcome of burns treated with autologous cultured proliferating epidermal cells: a prospective randomized multicenter intrapatient comparative trial

    NARCIS (Netherlands)

    Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.

    2016-01-01

    Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,

  2. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    OpenAIRE

    Bayer, Andreas; Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF?) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiatio...

  3. Characterization of Palytoxin Binding to HaCaT Cells Using a Monoclonal Anti-Palytoxin Antibody

    Directory of Open Access Journals (Sweden)

    Chiara Florio

    2013-02-01

    Full Text Available Palytoxin (PLTX is the reference compound for a group of potent marine biotoxins, for which the molecular target is Na+/K+-ATPase. Indeed, ouabain (OUA, a potent blocker of the pump, is used to inhibit some PLTX effects in vitro. However, in an effort to explain incomplete inhibition of PLTX cytotoxicity, some studies suggest the possibility of two different binding sites on Na+/K+-ATPase. Hence, this study was performed to characterize PLTX binding to intact HaCaT keratinocytes and to investigate the ability of OUA to compete for this binding. PLTX binding to HaCaT cells was demonstrated by immunocytochemical analysis after 10 min exposure. An anti-PLTX monoclonal antibody-based ELISA showed that the binding was saturable and reversible, with a Kd of 3 × 10−10 M. However, kinetic experiments revealed that PLTX binding dissociation was incomplete, suggesting an additional, OUA-insensitive, PLTX binding site. Competitive experiments suggested that OUA acts as a negative allosteric modulator against high PLTX concentrations (0.3–1.0 × 10−7 M and possibly as a non-competitive antagonist against low PLTX concentrations (0.1–3.0 × 10−9 M. Antagonism was supported by PLTX cytotoxicity inhibition at OUA concentrations that displaced PLTX binding (1 × 10−5 M. However, this inhibition was incomplete, supporting the existence of both OUA-sensitive and -insensitive PLTX binding sites.

  4. A novel DLX3-PKC integrated signaling network drives keratinocyte differentiation.

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-Wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-04-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  5. Anti-Inflammatory Effect of Melittin on Porphyromonas Gingivalis LPS-Stimulated Human Keratinocytes.

    Science.gov (United States)

    Kim, Woon-Hae; An, Hyun-Jin; Kim, Jung-Yeon; Gwon, Mi-Gyeong; Gu, Hyemin; Jeon, Minji; Kim, Min-Kyung; Han, Sang-Mi; Park, Kwan-Kyu

    2018-02-05

    Periodontitis is a chronic inflammatory disease that contributes to the destruction of the gingiva. Porphyromonas gingivalis ( P. gingivalis ) can cause periodontitis via its pathogenic lipopolysaccharides (LPS). Melittin, a major component of bee venom, is known to have anti-inflammatory and antibacterial effects. However, the role of melittin in the inflammatory response has not been elucidated in periodontitis-like human keratinocytes. Therefore, we investigated the anti-inflammatory effects of melittin on a P. gingivalis LPS (PgLPS)-treated HaCaT human keratinocyte cell line. The cytotoxicity of melittin was measured using a human keratinocyte cell line, HaCaT, and a Cell Counting Kit-8. The effect of melittin on PgLPS-induced inflammation was determined with Western blot, real-time quantitative PCT, and immunofluorescence. PgLPS increased the expression of toll-like receptor (TLR) 4 and proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-6, IL-8, and interferon-γ (IFN-γ). Moreover, PgLPS induced activation of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), extracellular signal-regulated kinase (ERK), and protein kinase B/Akt. Melittin also inhibited the expression of proinflammatory cytokines by suppressing the activation of the NF-κB signaling pathway, ERK, and Akt. Melittin attenuates the PgLPS-induced inflammatory response and could therefore be applied in the treatment of periodontitis for anti-inflammatory effects.

  6. Valproic acid induces cutaneous wound healing in vivo and enhances keratinocyte motility.

    Directory of Open Access Journals (Sweden)

    Soung-Hoon Lee

    Full Text Available BACKGROUND: Cutaneous wound healing is a complex process involving several signaling pathways such as the Wnt and extracellular signal-regulated kinase (ERK signaling pathways. Valproic acid (VPA is a commonly used antiepileptic drug that acts on these signaling pathways; however, the effect of VPA on cutaneous wound healing is unknown. METHODS AND FINDINGS: We created full-thickness wounds on the backs of C3H mice and then applied VPA. After 7 d, we observed marked healing and reduced wound size in VPA-treated mice. In the neo-epidermis of the wounds, β-catenin and markers for keratinocyte terminal differentiation were increased after VPA treatment. In addition, α-smooth muscle actin (α-SMA, collagen I and collagen III in the wounds were significantly increased. VPA induced proliferation and suppressed apoptosis of cells in the wounds, as determined by Ki67 and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL staining analyses, respectively. In vitro, VPA enhanced the motility of HaCaT keratinocytes by activating Wnt/β-catenin, ERK and phosphatidylinositol 3-kinase (PI3-kinase/Akt signaling pathways. CONCLUSIONS: VPA enhances cutaneous wound healing in a murine model and induces migration of HaCaT keratinocytes.

  7. Effects of bee venom against Propionibacterium acnes-induced inflammation in human keratinocytes and monocytes.

    Science.gov (United States)

    Kim, Jung-Yeon; Lee, Woo-Ram; Kim, Kyung-Hyun; An, Hyun-Jin; Chang, Young-Chae; Han, Sang-Mi; Park, Yoon-Yub; Pak, Sok Cheon; Park, Kwan-Kyu

    2015-06-01

    Propionibacterium acnes (P. acnes) cause inflammatory acne and play an important role in the pathogenesis of acne by inducing inflammatory mediators. P. acnes contributes to the inflammatory responses of acne by activating inflammatory cells, keratinocytes and sebocytes to secrete pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-8. Bee venom has traditionally been used in the treatment of certain immune-related diseases. However, there has not yet been a robust trial to prove the therapeutic effect of bee venom in skin inflammation. The aim of the present study was to investigate anti-inflammatory properties of bee venom in skin inflammation induced by P. acnes using keratinocytes (HaCaT) and monocytes (THP-1). P. acnes is known to stimulate the production of pro-inflammatory cytokines such as IL-1, IL-8, IL-12 and TNF-α. In the present study, the production of interferon-γ (IFN-γ), IL-1β, IL-8 and TNF-α was increased by P. acnes treatment in HaCaT and THP-1 cells. By contrast, bee venom effectively inhibited the secretion of IFN-γ, IL-1β, IL-8 and TNF-α. Furthermore, P. acnes treatment activated the expression of IL-8 and toll-like receptor 2 (TLR2) in HaCaT cells. However, bee venom inhibited the expression of IL-8 and TLR2 in heat-killed P. acnes. Based on these results, it is concluded that bee venom has an effective anti-inflammatory activity against P. acnes in HaCaT and THP-1 cells. Therefore, we suggest that bee venom is an alternative treatment to antibiotic therapy of acne.

  8. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  9. The herpes simplex virus-induced demise of keratinocytes is associated with a dysregulated pattern of p63 expression.

    Science.gov (United States)

    Megyeri, Klára; Orosz, László; Kormos, Bernadett; Pásztor, Katalin; Seprényi, György; Ocsovszki, Imre; Mándi, Yvette; Bata-Csörgo, Zsuzsanna; Kemény, Lajos

    2009-01-01

    p63 plays a pivotal role in the development and maintenance of stratified epithelial tissues. In an effort to gain insight into the pathogenic mechanisms of skin infections caused by HSV-1 and HSV-2, we determined the patterns of p63 expression in primary keratinocytes and in the HaCaT cell line. The levels of DeltaNp63alpha and a 50kDa p73 isoform were decreased, Bax-alpha remained unaffected, while the expressions of the Bax-beta, TAp63gamma and a 44.5kDa p73 isoform were highly increased in both HSV-1-infected HaCaT cells and primary keratinocytes. In contrast, in response to HSV-2 infection the levels of DeltaNp63alpha, a 50kDa p73 isoform and a 44.5kDa p73 protein were decreased, Bax-alpha and TAp63gamma remained unaffected, while the expression of Bax-beta was slightly increased. The knockdown of TAp63 expression enhanced the viability of HSV-1-infected cells. Thus, HSV-1 and HSV-2 modulate the patterns of p63 and Bax expression in a serotype-specific manner. The dysregulated pattern of p63 expression observed in HSV-infected keratinocytes may comprise part of a mechanism by which these viruses perturb the functions of keratinocytes and lead to their demise.

  10. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  11. Factors affecting ultraviolet-A photon emission from β-irradiated human keratinocyte cells.

    Science.gov (United States)

    Le, M; Mothersill, C E; Seymour, C B; Ahmad, S B; Armstrong, A; Rainbow, A J; McNeill, F E

    2015-08-21

    The luminescence intensity of 340±5 nm photons emitted from HaCaT (human keratinocyte) cells was investigated using a single-photon-counting system during cellular exposure to (90)Y β-particles. Multiple factors were assessed to determine their influence upon the quantity and pattern of photon emission from β-irradiated cells. Exposure of 1 x 10(4) cells/5 mL to 703 μCi resulted in maximum UVA photoemission at 44.8 x 10(3)±2.5 x 10(3) counts per second (cps) from live HaCaT cells (background: 1-5 cps); a 16-fold increase above cell-free controls. Significant biophoton emission was achieved only upon stimulation and was also dependent upon presence of cells. UVA luminescence was measured for (90)Y activities 14 to 703 μCi where a positive relationship between photoemission and (90)Y activity was observed. Irradiation of live HaCaT cells plated at various densities produced a distinct pattern of emission whereby luminescence increased up to a maximum at 1 x 10(4) cells/5 mL and thereafter decreased. However, this result was not observed in the dead cell population. Both live and dead HaCaT cells were irradiated and were found to demonstrate different rates of photon emission at low β activities (⩽400 μCi). Dead cells exhibited greater photon emission rates than live cells which may be attributable to metabolic processes taking place to modulate the photoemissive effect. The results indicate that photon emission from HaCaT cells is perturbed by external stimulation, is dependent upon the activity of radiation delivered, the density of irradiated cells, and cell viability. It is postulated that biophoton emission may be modulated by a biological or metabolic process.

  12. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  13. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  14. Sustainability of keratinocyte gene transfer and cell survival in vivo.

    Science.gov (United States)

    Choate, K A; Khavari, P A

    1997-05-20

    The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.

  15. Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor

    International Nuclear Information System (INIS)

    Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.

    1991-01-01

    Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes

  16. Essential role of integrin-linked kinase in regulation of phagocytosis in keratinocytes.

    Science.gov (United States)

    Sayedyahossein, Samar; Nini, Lylia; Irvine, Timothy S; Dagnino, Lina

    2012-10-01

    Phagocytic melanosome uptake by epidermal keratinocytes is a central protective mechanism against damage induced by ultraviolet radiation. Phagocytosis requires formation of pseudopodia via actin cytoskeleton rearrangements. Integrin-linked kinase (ILK) is an important modulator of actin cytoskeletal dynamics. We have examined the role of ILK in regulation of phagocytosis, using epidermal keratinocytes isolated from mice with epidermis-restricted Ilk gene inactivation. ILK-deficient cells exhibited severely impaired capacity to engulf fluorescent microspheres in response to stimulation of the keratinocyte growth factor (KGF) receptor or the protease-activated receptor-2. KGF induced ERK phosphorylation in ILK-expressing and ILK-deficient cells, suggesting that ILK is not essential for KGF receptor signaling. In contrast, KGF promoted activation of Rac1 and formation of pseudopodia in ILK-expressing, but not in ILK-deficient cells. Rac1-deficient keratinocytes also showed substantially impaired phagocytic ability, underlining the importance of ILK-dependent Rac1 function for particle engulfment. Finally, cross-modulation of KGF receptors by integrins may be another important element, as integrin β1-deficient keratinocytes also fail to show significant phagocytosis in response to KGF. Thus, we have identified a novel signaling pathway essential for phagocytosis in keratinocytes, which involves ILK-dependent activation of Rac1 in response to KGF, resulting in the formation of pseudopodia and particle uptake.

  17. Ca2+-dependent localization of integrin-linked kinase to cell junctions in differentiating keratinocytes.

    Science.gov (United States)

    Vespa, Alisa; Darmon, Alison J; Turner, Christopher E; D'Souza, Sudhir J A; Dagnino, Lina

    2003-03-28

    Integrin complexes are necessary for proper proliferation and differentiation of epidermal keratinocytes. Differentiation of these cells is accompanied by down-regulation of integrins and focal adhesions as well as formation of intercellular adherens junctions through E-cadherin homodimerization. A central component of integrin adhesion complexes is integrin-linked kinase (ILK), which can induce loss of E-cadherin expression and epithelial-mesenchymal transformation when ectopically expressed in intestinal and mammary epithelia. In cultured primary mouse keratinocytes, we find that ILK protein levels are independent of integrin expression and signaling, since they remain constant during Ca(2+)-induced differentiation. In contrast, keratinocyte differentiation is accompanied by marked reduction in kinase activity in ILK immunoprecipitates and altered ILK subcellular distribution. Specifically, ILK distributes in close apposition to actin fibers along intercellular junctions in differentiated but not in undifferentiated keratinocytes. ILK localization to cell-cell borders occurs independently of integrin signaling and requires Ca(2+) as well as an intact actin cytoskeleton. Further, and in contrast to what is observed in other epithelial cells, ILK overexpression in differentiated keratinocytes does not promote E-cadherin down-regulation and epithelial-mesenchymal transition. Thus, novel tissue-specific mechanisms control the formation of ILK complexes associated with cell-cell junctions in differentiating murine epidermal keratinocytes.

  18. Derivation of keratinocytes from chicken embryonic stem cells: Establishment and characterization of differentiated proliferative cell populations

    Directory of Open Access Journals (Sweden)

    Mathilde Couteaudier

    2015-03-01

    Full Text Available A common challenge in avian cell biology is the generation of differentiated cell-lines, especially in the keratinocyte lineage. Only a few avian cell-lines are available and very few of them show an interesting differentiation profile. During the last decade, mammalian embryonic stem cell-lines were shown to differentiate into almost all lineages, including keratinocytes. Although chicken embryonic stem cells had been obtained in the 1990s, few differentiation studies toward the ectodermal lineage were reported. Consequently, we explored the differentiation of chicken embryonic stem cells toward the keratinocyte lineage by using a combination of stromal induction, ascorbic acid, BMP4 and chicken serum. During the induction period, we observed a downregulation of pluripotency markers and an upregulation of epidermal markers. Three homogenous cell populations were derived, which were morphologically similar to chicken primary keratinocytes, displaying intracellular lipid droplets in almost every pavimentous cell. These cells could be serially passaged without alteration of their morphology and showed gene and protein expression profiles of epidermal markers similar to chicken primary keratinocytes. These cells represent an alternative to the isolation of chicken primary keratinocytes, being less cumbersome to handle and reducing the number of experimental animals used for the preparation of primary cells.

  19. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  20. EPR Technology as Sensitive Method for Oxidative Stress Detection in Primary and Secondary Keratinocytes Induced by Two Selected Nanoparticles.

    Science.gov (United States)

    Lohan, S B; Ahlberg, S; Mensch, A; Höppe, D; Giulbudagian, M; Calderón, M; Grether-Beck, S; Krutmann, J; Lademann, J; Meinke, M C

    2017-12-01

    Exogenous factors can cause an imbalance in the redox state of biological systems, promoting the development of oxidative stress, especially reactive oxygen species (ROS). To monitor the intensity of ROS production in secondary keratinocytes (HaCaT) by diesel exhaust particles and thermoresponsive nanogels (tNG), electron paramagnetic resonance (EPR) spectroscopy after 1 and 24 h of incubation, respectively, was applied. Their cytotoxicity was analyzed by a cell viability assay (XTT). For tNG an increase in the cell viability and ROS production of 10% was visible after 24 h, whereas 1 h showed no effect. A ten times lower concentration of diesel exhaust particles exhibited no significant toxic effects on HaCaT cells for both incubation times, thus normal adult human keratinocytes (NHK) were additionally analyzed by XTT and EPR spectroscopy. Here, after 24 h a slight increase of 18% in metabolic activity was observed. However, this effect could not be explained by the ROS formation. A slight increase in the ROS production was only visible after 1 h of incubation time for HaCaT (9%) and NHK (14%).

  1. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  2. Melanoma cells influence the differentiation pattern of human epidermal keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Kodet, O.; Lacina, L.; Krejčí, E.; Dvořáková, B.; Grim, M.; Štork, J.; Kodetová, D.; Vlček, Čestmír; Šáchová, Jana; Kolář, Michal; Strnad, Hynek; Smetana, K.

    2015-01-01

    Roč. 14, č. 1 (2015), s. 1-1 ISSN 1476-4598 R&D Projects: GA ČR GAP304/12/1333; GA MZd(CZ) NT13488; GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:Charles University in Prague(CZ) PRVOUK 27 – 1; Charles University in Prague(CZ) UNCE 204013 Institutional support: RVO:68378050 Keywords : Melanoma * Cancer microenvironment * Melanocyte Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.888, year: 2015

  3. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  4. Abnormalities in the basement membrane structure promote basal keratinocytes in the epidermis of hypertrophic scars to adopt a proliferative phenotype.

    Science.gov (United States)

    Yang, Shaowei; Sun, Yexiao; Geng, Zhijun; Ma, Kui; Sun, Xiaoyan; Fu, Xiaobing

    2016-05-01

    The majority of studies on scar formation have mainly focused on the dermis and little is known of the involvement of the epidermis. Previous research has demonstrated that the scar tissue-derived keratinocytes are different from normal cells at both the genetic and cell biological levels; however, the mechanisms responsible for the fundamental abnormalities in keratinocytes during scar development remain elusive. For this purpose, in this study, we used normal, wound edge and hypertrophic scar tissue to examine the morphological changes which occur during epidermal regeneration as part of the wound healing process and found that the histological structure of hypertrophic scar tissues differed from that of normal skin, with a significant increase in epidermal thickness. Notably, staining of the basement membrane (BM) appeared to be absent in the scar tissues. Moreover, immunofluorescence staining for cytokeratin (CK)10, CK14, CK5, CK19 and integrin-β1 indicated the differential expression of cell markers in the epidermal keratinocytes among the normal, wound edge and hypertrophic scar tissues, which corresponded with the altered BM structures. By using a panel of proteins associated with BM components, we validated our hypothesis that the BM plays a significant role in regulating the cell fate decision of epidermal keratinocytes during skin wound healing. Alterations in the structure of the BM promote basal keratinocytes to adopt a proliferative phenotype both in vivo and in vitro.

  5. Podoplanin expression in peritumoral keratinocytes predicts aggressive behavior in extramammary Paget's disease.

    Science.gov (United States)

    Cho, Zaigen; Konishi, Eiichi; Kanemaru, Mai; Isohisa, Taro; Arita, Takahiro; Kawai, Minako; Tsutsumi, Miho; Mizutani, Hiromi; Takenaka, Hideya; Ozawa, Toshiyuki; Tsuruta, Daisuke; Katoh, Norito; Asai, Jun

    2017-07-01

    Recent studies have demonstrated podoplanin expression in several tumors, which has been associated with lymph node metastasis and poor prognosis. Podoplanin expression in peritumoral cells such as cancer-associated fibroblasts also correlates with tumor progression in several cancers. However, podoplanin expression and its association with extramammary Paget's disease (EMPD) remain unclear. In this study, we examined whether the presence of podoplanin expression in tumor cells or peritumoral basal keratinocytes correlated with aggressive behavior in patients with EMPD and investigated the mechanisms of podoplanin-mediated tumor invasion in this disorder. Skin samples of 37 patients with EMPD were investigated by immunohistochemical analysis. The functions of podoplanin in keratinocytes were examined in vitro by RT-PCR and with invadopodia gelatin-degradation assays using HaCaT cells. Podoplanin was not identified in tumor cells in all cases. Podoplanin expression in peritumoral basal keratinocytes was observed in 25 patients (67.6%). In in situ EMPD, 50% of cases (9 in 18) exhibited podoplanin-positive keratinocytes, whereas 84.2% (16 in 19) demonstrated positive staining in invasive EMPD (P<0.05). Podoplanin expression in peritumoral keratinocytes was also associated with tumor thickness (P<0.005). By immunohistochemical analysis, podoplanin-positive peritumoral keratinocytes were found to be negative for E-cadherin, one of the major adhesion molecules of keratinocytes, which might contribute to tumor invasion into the dermis through a crack in the basal cell layer induced by down-regulation of cell adhesion therein. We further found that podoplanin-positive keratinocytes exhibited invadopodia, which are thought to function in the migration of cancer cells through tissue barriers, indicating that podoplanin-positive peritumoral basal keratinocytes might assist tumor invasion by degrading the extracellular matrix. The presence of podoplanin expression in

  6. The role of lipid raft translocation of prohibitin in regulation of Akt and Raf-protected apoptosis of HaCaT cells upon ultraviolet B irradiation.

    Science.gov (United States)

    Wu, Qiong; Wu, Shiyong

    2017-07-01

    Prohibitin (PHB) plays a role in regulation of ultraviolet B light (UVB)-induced apoptosis of human keratinocytes, HaCaT cells. The regulatory function of PHB appears to be associated with its lipid raft translocation. However, the detailed mechanism for PHB-mediated apoptosis of these keratinocytes upon UVB irradiation is not clear. In this report, we determined the role of lipid raft translocation of PHB in regulation of UVB-induced apoptosis. Our data show that upon UVB irradiation PHB is translocated from the non-raft membrane to the lipid rafts, which is correlated with a release of both Akt and Raf from membrane. Overexpression of Akt and/or Raf impedes UVB-induced lipid raft translocation of PHB. Immunoprecipitation analysis indicates that UVB alters the interactions among PHB, Akt, and Raf. Reduced expression of PHB leads to a decreased phosphorylation of Akt and ERK, as well as a decreased activity of Akt, and increased apoptosis of the cells upon UVB irradiation. These results suggest that PHB regulates UVB-induced apoptosis of keratinocytes via a mechanism that involves detachment from Akt and Raf on the plasma membrane, and sequential lipid raft translocation. © 2017 Wiley Periodicals, Inc.

  7. Gelatin for purification and proliferation of primary keratinocyte culture for use in chronic wounds and burns.

    Science.gov (United States)

    Rahsaz, Marjan; Geramizadeh, Bita; Kaviani, Maryam; Marzban, Saeed

    2015-04-01

    Human epidermal keratinocytes are currently established as a treatment for burns and wounds and have laboratory applications. Keratinocyte culture contamination by unwanted cells and inhibition of cell proliferation are barriers in primary keratinocyte culture. According to the recent literature, these cells are hard to culture. The present study was conducted to evaluate the efficacy of gelatin-coated surfaces in keratinocyte cultures. After enzymatic isolation of keratinocytes from normal epidermis by trypsin, the cells were cultured on gelatin-coated flasks in serum-free medium. Another group of cells were cultured as a control group without gelatin coating. We showed positive effects of surface coating with gelatin on the primary culture of keratinocytes. Culture of these cells on a gelatincoated surface showed better proliferation with suitable morphology. By using gelatin, adhesion of these cells to the surface was more efficient and without contamination by small round cells. Successful primary culture of keratinocytes on a gelatin-coated surface may provide better yield and optimal number of cells for research and clinical applications.

  8. [Cultivated keratinocytes on micro-carriers: in vitro studies of a new carrier system].

    Science.gov (United States)

    Hecht, J; Hoefter, E A; Hecht, J; Haraida, S; Nerlich, A; Hartinger, A; Mühlbauer, W; Dimoudis, N

    1997-03-01

    Epidermal grafts from confluently cultivated keratinocytes have been used since the early eighties for the treatment of severe burns, where the shortage of donor sites for split-thickness skin grafts did not allow for adequate wound coverage. The difficult handling of these grafts as well as the advanced differentiation of their epithelial cells into a multilayer sheet poses a problem for their clinical application. The aim of the study was to characterize cultivated keratinocytes, as well as to observe their migration and proliferation from the MC onto a surface. Keratinocytes were isolated from human foreskin and cultivated in serum-free and serum-containing medium according to a modified method by Rheinwald and Green. Collagen-coated Dextran beads were used as MC. The MC were colonized with keratinocytes using the Spinner culture technique. After seeding the colonized MC into culture flasks, their migration and proliferation was monitored regularly through immunohistochemical studies and measurement of the metabolic cell activity. Immunohistological staining proved that the cells isolated from human foreskin represent keratinocytes of the basal type. Keratinocytes, cultivated with serum-containing and serum free medium, both adhered to the surface of the MC, then migrated onto the surface of the flasks and proliferated to form a multilayer of epithelial cells. In the long-term, a flexible epithelial graft consisting of poorly differentiated keratinocytes should be available, which is simple to produce and easy to handle. This would be an alternative method for treating wounds, where the conventional multilayer epithelial graft (ET) is insufficient.

  9. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  10. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Science.gov (United States)

    Yeung, Bonnie H Y; Wong, Chris K C

    2011-01-01

    Stanniocalcin-1 (STC1), a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam) formation, followed by cell migration. In this study, staurosporine (STS) treatment induced human keratinocyte (HaCaT) e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK), the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl) could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  11. The ultrastructural surface morphology of oral cancer cells and keratinocytes after exposure to chitosan

    Science.gov (United States)

    Fatimah; Sarsito, A. S.; Wimardhani, Y. S.

    2017-08-01

    Low-molecular-weight chitosan (LMWC) has the same selective cytotoxic effects on oral cancer cells as cisplatin. The cell deaths caused by the anticancer characteristics of chitosan show that apoptosis is not the death pathway of the primary cells involved. The interactions between LMWC and the cells need to be explored. The objective of this study was to compare the ultrastructural morphology of oral Squamous Cell Carcinoma (SCC Ca)-922 and noncancer keratinocyte HaCaT cell lines after exposure to LMWC and cisplatin. The cells were treated with LMWC and cisplatin, and their ultrastructural morphology was analyzed using scanning electron micrographs. Features of early apoptosis, seen as the loss of microvilli, were detected in the LMWC-exposed Ca9-22 cells, and there was a material surrounding the cells. In contrast, the LMWC-exposed HaCaT cells showed no changes related to apoptosis. The results were the opposite when cisplatin was used. This study confirms that there are differences in the ultrastructural surface morphology of LMWC-exposed and cisplatin-exposed oral cancer cells and keratinocytes that could be correlated with their biological activity.

  12. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Ansel, J.C.; Luger, T.A.; Green, I.

    1983-01-01

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  13. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  14. Proteomic profiling and post-translational modifications in human keratinocytes treated with Mucuna pruriens leaf extract.

    Science.gov (United States)

    Cortelazzo, Alessio; Lampariello, Raffaella L; Sticozzi, Claudia; Guerranti, Roberto; Mirasole, Cristiana; Zolla, Lello; Sacchetti, Gianni; Hajek, Joussef; Valacchi, Giuseppe

    2014-02-03

    Mucuna pruriens (Mp) is a plant belonging to the Fabaceae family, with several medicinal properties among which its potential to treat diseases where reactive oxygen species (ROS) play an important role in the pathogeneses. The aim was to investigate the effects of Mp leaf methanolic extract (MPME) on human keratinocytes protein expression and its role in preventing proteins oxidation after oxidative stress (OS) exposure. The effects of MPME on HaCaT cells protein expression were evaluated treating cells with different concentrations of MPME, with glucose oxidase (GO, source of OS) and with MPME subsequently treated with GO. The protein patterns of treated HaCaT cells are analyzed by two-dimensional gel electrophoresis (2-DE) and compared with that of untreated HaCaT. Immunoblotting was then used to evaluate the role of MPME in preventing the 4-hydroxynonenal protein adducts (4-HNE PAs) formation (marker of OS). Eighteen proteins, identified by mass spectrometry (LC-ESI-CID-MS/MS), were modulated distinctly by MPME in HaCaT. Overall, MPME counteract GO effect, reducing the GO-induced overexpression of several proteins involved in stress response (T-complex protein 1, Protein disulfide-isomerase A3, Protein DJ-1, and Stress-induced-phosphoprotein 1), in cell energy methabolism (Inorganic pyrophosphatase, Triosephosphate isomerase isoform 1, 2-phosphopyruvate-hydratase alpha-enolase, and Fructose-bisphosphate aldolase A isoform 1), in cytoskeletal organization (Cytokeratins 18, 9, 2, Cofilin-1, Annexin A2 and F-actin-capping protein subunit beta isoform 1) and in cell cycle progression (Eukaryotic translation initiation factor 5A-1 isoform B). In addition, MPME decreased the 4-HNE PAs levels, in particular on 2-phosphopyruvate-hydratase alpha-enolase and Cytokeratin 9. Our findings show that MPME might be helpful in the treatment of OS-related skin diseases by preventing protein post-translational modifications (4-HNE PAs). © 2013 Published by Elsevier Ireland Ltd.

  15. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  16. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal α-toxin-induced keratinocyte death.

    Science.gov (United States)

    Brauweiler, Anne M; Bin, Lianghua; Kim, Byung Eui; Oyoshi, Michiko K; Geha, Raif S; Goleva, Elena; Leung, Donald Y M

    2013-02-01

    The skin of patients with atopic dermatitis (AD) has defects in keratinocyte differentiation, particularly in expression of the epidermal barrier protein filaggrin. AD skin lesions are often exacerbated by Staphylococcus aureus-mediated secretion of the virulence factor α-toxin. It is unknown whether lack of keratinocyte differentiation predisposes to enhanced lethality from staphylococcal toxins. We investigated whether keratinocyte differentiation and filaggrin expression protect against cell death induced by staphylococcal α-toxin. Filaggrin-deficient primary keratinocytes were generated through small interfering RNA gene knockdown. RNA expression was determined by using real-time PCR. Cell death was determined by using the lactate dehydrogenase assay. Keratinocyte cell survival in filaggrin-deficient (ft/ft) mouse skin biopsies was determined based on Keratin 5 staining. α-Toxin heptamer formation and acid sphingomyelinase expression were determined by means of immunoblotting. We found that filaggrin expression, occurring as the result of keratinocyte differentiation, significantly inhibits staphylococcal α-toxin-mediated pathogenicity. Furthermore, filaggrin plays a crucial role in protecting cells by mediating the secretion of sphingomyelinase, an enzyme that reduces the number of α-toxin binding sites on the keratinocyte surface. Finally, we determined that sphingomyelinase enzymatic activity directly prevents α-toxin binding and protects keratinocytes against α-toxin-induced cytotoxicity. The current study introduces the novel concept that S aureus α-toxin preferentially targets and destroys filaggrin-deficient keratinocytes. It also provides a mechanism to explain the increased propensity for S aureus-mediated exacerbation of AD skin disease. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  17. Enhancement of UVB radiation-mediated apoptosis by knockdown of cytosolic NADP+-dependent isocitrate dehydrogenase in HaCaT cells.

    Science.gov (United States)

    Lee, Su Jeong; Park, Jeen-Woo

    2014-04-01

    Ultraviolet B (UVB) radiation induces the production of reactive oxygen species (ROS) that promote apoptotic cell death. We showed that cytosolic NADP+-dependent isocitrate dehydrogenase (IDPc) plays an essential role in the control of cellular redox balance and defense against oxidative damage, by supplying NADPH for antioxidant systems. In this study, we demonstrated that knockdown of IDPc expression by RNA interference enhances UVB-induced apoptosis of immortalized human HaCaT keratinocytes. This effect manifested as DNA fragmentation, changes in cellular redox status, mitochondrial dysfunction, and modulation of apoptotic marker expression. Based on our findings, we suggest that attenuation of IDPc expression may protect skin from UVB-mediated damage, by inducing the apoptosis of UV-damaged cells.

  18. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  19. Platelets Regulate the Migration of Keratinocytes via Podoplanin/CLEC-2 Signaling during Cutaneous Wound Healing in Mice.

    Science.gov (United States)

    Asai, Jun; Hirakawa, Satoshi; Sakabe, Jun-ichi; Kishida, Tsunao; Wada, Makoto; Nakamura, Naomi; Takenaka, Hideya; Mazda, Osam; Urano, Tetsumei; Suzuki-Inoue, Katsue; Tokura, Yoshiki; Katoh, Norito

    2016-01-01

    Podoplanin is an endogenous ligand for C-type lectin-like receptor 2 (CLEC-2), which is expressed on platelets. Recent evidence indicates that this specific marker of lymphatic endothelial cells is also expressed by keratinocytes at the edge of wounds. However, whether podoplanin or platelets play a role in keratinocyte activity during wound healing remains unknown. We evaluated the effect of podoplanin expression levels on keratinocyte motility using cultured primary normal human epidermal keratinocytes (NHEKs). Down-regulation of podoplanin in NHEKs via transfection with podoplanin siRNA inhibited their migration, indicating that podoplanin plays a mandatory role in this process. In addition, down-regulation of podoplanin was correlated with up-regulation of E-cadherin, suggesting that podoplanin-mediated stimulation of keratinocyte migration is associated with a loss of E-cadherin. Both the addition of platelets and treatment with CLEC-2 inhibited the migration of NHEKs. The down-regulation of RhoA activity and the up-regulation of E-cadherin in keratinocytes were also induced by CLEC-2. In conclusion, these results suggest that podoplanin/CLEC-2 signaling regulates keratinocyte migration via modulating E-cadherin expression through RhoA signaling. Altering the regulation of keratinocyte migration by podoplanin might be a novel therapeutic approach to improve wound healing. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  20. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  1. Keratinocytes from APP/APLP2-deficient mice are impaired in proliferation, adhesion and migration in vitro

    International Nuclear Information System (INIS)

    Siemes, Christina; Quast, Thomas; Kummer, Christiane; Wehner, Sven; Kirfel, Gregor; Mueller, Ulrike; Herzog, Volker

    2006-01-01

    Growing evidence shows that the soluble N-terminal form (sAPPα) of the amyloid precursor protein (APP) represents an epidermal growth factor fostering keratinocyte proliferation, migration and adhesion. APP is a member of a protein family including the two mammalian amyloid precursor-like proteins APLP1 and APLP2. In the mammalian epidermis, only APP and APLP2 are expressed. APP and APLP2-deficient mice die shortly after birth but do not display a specific epidermal phenotype. In this report, we investigated the epidermis of APP and/or APLP2 knockout mice. Basal keratinocytes showed reduced proliferation in vivo by about 40%. Likewise, isolated keratinocytes exhibited reduced proliferation rates in vitro, which could be completely rescued by either exogenously added recombinant sAPPα, or by co-culture with dermal fibroblasts derived from APP knockout mice. Moreover, APP-knockout keratinocytes revealed reduced migration velocity resulting from severely compromised cell substrate adhesion. Keratinocytes from double knockout mice died within the first week of culture, indicating essential functions of APP-family members for survival in vitro. Our data indicate that sAPPα has to be considered as an essential epidermal growth factor which, however, in vivo can be functionally compensated to a certain extent by other growth factors, e.g., factors released from dermal fibroblasts

  2. Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

    International Nuclear Information System (INIS)

    Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

    2008-01-01

    The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

  3. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  4. The extracellular adherence protein (Eap) of Staphylococcus aureus acts as a proliferation and migration repressing factor that alters the cell morphology of keratinocytes.

    Science.gov (United States)

    Eisenbeis, Janina; Peisker, Henrik; Backes, Christian S; Bur, Stephanie; Hölters, Sebastian; Thewes, Nicolas; Greiner, Markus; Junker, Christian; Schwarz, Eva C; Hoth, Markus; Junker, Kerstin; Preissner, Klaus T; Jacobs, Karin; Herrmann, Mathias; Bischoff, Markus

    2017-02-01

    Staphyloccocus aureus is a major human pathogen and a common cause for superficial and deep seated wound infections. The pathogen is equipped with a large arsenal of virulence factors, which facilitate attachment to various eukaryotic cell structures and modulate the host immune response. One of these factors is the extracellular adherence protein Eap, a member of the "secretable expanded repertoire adhesive molecules" (SERAM) protein family that possesses adhesive and immune modulatory properties. The secreted protein was previously shown to impair wound healing by interfering with host defense and neovascularization. However, its impact on keratinocyte proliferation and migration, two major steps in the re-epithelialization process of wounds, is not known. Here, we report that Eap affects the proliferation and migration capacities of keratinocytes by altering their morphology and adhesive properties. In particular, treatment of non-confluent HaCaT cell cultures with Eap resulted in cell morphology changes as well as a significant reduction in cell proliferation and migration. Eap-treated HaCaT cells changed their appearance from an oblong via a trapezoid to an astral-like shape, accompanied by decreases in cell volume and cell stiffness, and exhibited significantly increased cell adhesion. Eap had a similar influence on endothelial and cancer cells, indicative for a general effect of Eap on eukaryotic cell morphology and functions. Specifically, Eap was found to interfere with growth factor-stimulated activation of the mitogen-activated protein kinase (MAPK) pathway that is known to be responsible for cell shape modulation, induction of proliferation and migration of epithelial cells. Western blot analyses revealed that Eap blocked the phosphorylation of extracellular signal-regulated kinase 1 and 2 (Erk1/2) in keratinocyte growth factor (KGF)-stimulated HaCaT cells. Together, these data add another antagonistic mechanism of Eap in wound healing, whereby the

  5. Internalization of EGF receptor following lipid rafts disruption in keratinocytes is delayed and dependent on p38 MAPK activation

    DEFF Research Database (Denmark)

    Lambert, S.; Ameels, H.; Gniadecki, R.

    2008-01-01

    The receptor for epidermal growth factor (EGF) plays an important role in epidermal keratinocytes and is known to move out of lipid raft after cholesterol depletion, leading to ligand-independent activation. Accumulation of evidence indicates the ability of EGF receptor (EGFR) to undergo internal......The receptor for epidermal growth factor (EGF) plays an important role in epidermal keratinocytes and is known to move out of lipid raft after cholesterol depletion, leading to ligand-independent activation. Accumulation of evidence indicates the ability of EGF receptor (EGFR) to undergo...... internalization without participation of the ligand under the control of p38 MAPK during stress conditions. Since cholesterol depletion using methyl-beta-cyclodextrin is known to induce ligand-independent activation of EGFR in keratinocytes, we investigated by confocal microscopy and ligand-binding tests...... the process of internalization, which can be considered as a protective response to stress. Moreover, cholesterol-depleted keratinocytes recover their ability to proliferate during the recovery period that follows lipid raft disruption Udgivelsesdato: 2008/12...

  6. A novel DLX3–PKC integrated signaling network drives keratinocyte differentiation

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-01-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  7. The effect of Candida albicans on the expression levels of toll-like receptor 2 and interleukin-8 in HaCaT cells under High- and Low-glucose conditions

    Directory of Open Access Journals (Sweden)

    Di Wang

    2018-01-01

    Full Text Available Background: The diabetics are prone to skin infections, especially with Candida albicans. It is important to elucidate the different antifungal abilities of patients with hyperglycemia and healthy controls for the treatment of this condition. The toll-like receptor 2 (TLR2 and interleukin (IL-8 secreted by keratinocytes counteract C. albicans. Aim: This study aims to explore the differential expression of toll-like receptor 2 (TLR2 and interleukin (IL-8 secretion by keratinocytes between controls and diabetic patients when challenged with C. albicans. Materials and Methods: HaCaT cells were cultured in high-glucose (HG Dulbecco's modified Eagle's medium (DMEM and low-glucose (LG DMEM. Then, they were exposed to C. albicans hyphae for 24 h. The expression levels of TLR2 and IL-8 were determined at different periods in both the HG and LG groups. Real-time polymerase chain reaction analysis, western blotting, and enzyme-linked immunosorbent assays were performed in this study. The morphological changes of HaCaT cells under two different glucose concentrations were also observed. Results: We found that the expression levels of both TLR2 and IL-8 increased and then decreased in the two groups. Notably, the IL-8 levels in the LG group were higher than those in the HG group at each time point (P<0.05, and the TLR2 levels in the LG group were higher than those in the HG group at the beginning of the experiment and after 24 h of treatment with C. albicans (P<0.05. In each group, the levels of IL-8 and TLR2 at the secretion peak were significantly different from those in the initial and the last period of observation (P<0.05. The cellular morphology of HaCaT cells treated with different concentrations of glucose was also similar. However, with prolonged coculture time, cell death increased. Conclusion: These observations showed that TLR2 and IL-8 act on the keratinocytes interacting with C. albicans, and HG status might affect the function of HaCaT cells

  8. Interactions Between Epidermal Keratinocytes, Dendritic Epidermal T-Cells, and Hair Follicle Stem Cells.

    Science.gov (United States)

    Badarinath, Krithika; Dutta, Abhik; Hegde, Akshay; Pincha, Neha; Gund, Rupali; Jamora, Colin

    2018-06-13

    The interplay of immune cells and stem cells in maintaining skin homeostasis and repair is an exciting new frontier in cutaneous biology. With the growing appreciation of the importance of this new crosstalk comes the requirement of methods to interrogate the molecular underpinnings of these leukocyte-stem cell interactions. Here we describe how a combination of FACS, cellular coculture assays, and conditioned media treatments can be utilized to advance our understanding of this emerging area of intercellular communication between immune cells and stem cells.

  9. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  10. Neurohumoral mechanisms of keratinocytes regulation in diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Ekaterina Viktorovna Artemova

    2016-12-01

    Full Text Available The extent of damage to the nervous, vascular and microcirculatory systems in diabetic patients determine the regulation of physiological events that lead to the formation of chronic wounds, reduction of patient quality of life and increase of the financial value of medical care. Successful physiological repair is impossible without the successive phases of inflammation, proliferation and wound healing. Keratinocytes are the major cellular barrier components of the epidermis. These cells play an important role in physiological repair, as suggested by recent research, with many cells able to secrete steroid hormones de novo. Damage to the integrity of the skin leads to keratinocyte activation, triggering a cascade of reactions that contribute to changes in epidermal cell phenotype and lead to their proliferation and migration, analogous to changes in cellular adhesion and configuration of the cytoskeleton. An open question remains as to how the keratinocyte cell cycle, which is altered under conditions of hyperglycemia, and neurotransmitter metabolism during different stages of physiological repair are regulated. Understanding these processes will provide a scientific basis for the development of new targets for pharmacotherapies.

  11. UVA Irradiation of Dysplastic Keratinocytes: Oxidative Damage versus Antioxidant Defense

    Science.gov (United States)

    Nechifor, Marina T.; Niculiţe, Cristina M.; Urs, Andreea O.; Regalia, Teodor; Mocanu, Mihaela; Popescu, Alexandra; Manda, Gina; Dinu, Diana; Leabu, Mircea

    2012-01-01

    UVA affects epidermal cell physiology in a complex manner, but the harmful effects have been studied mainly in terms of DNA damage, mutagenesis and carcinogenesis. We investigated UVA effects on membrane integrity and antioxidant defense of dysplastic keratinocytes after one and two hours of irradiation, both immediately after exposure, and 24 h post-irradiation. To determine the UVA oxidative stress on cell membrane, lipid peroxidation was correlated with changes in fatty acid levels. Membrane permeability and integrity were assessed by propidium iodide staining and lactate dehydrogenase release. The effects on keratinocyte antioxidant protection were investigated in terms of catalase activity and expression. Lipid peroxidation increased in an exposure time-dependent manner. UVA exposure decreased the level of polyunsaturated fatty acids, which gradually returned to its initial value. Lactate dehydrogenase release showed a dramatic loss in membrane integrity after 2 h minimum of exposure. The cell ability to restore membrane permeability was noted at 24 h post-irradiation (for one hour exposure). Catalase activity decreased in an exposure time-dependent manner. UVA-irradiated dysplastic keratinocytes developed mechanisms leading to cell protection and survival, following a non-lethal exposure. The surviving cells gained an increased resistance to apoptosis, suggesting that their pre-malignant status harbors an abnormal ability to control their fate. PMID:23222638

  12. Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

    NARCIS (Netherlands)

    Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.

    2015-01-01

    Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis

  13. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  14. Increased keratinocyte proliferation initiated through downregulation of desmoplakin by RNA interference

    International Nuclear Information System (INIS)

    Wan Hong; South, Andrew P.; Hart, Ian R.

    2007-01-01

    The intercellular adhesive junction desmosomes are essential for the maintenance of tissue structure and integrity in skin. Desmoplakin (Dp) is a major obligate plaque protein which plays a fundamental role in anchoring intermediate filaments to desmosomal cadherins. Evidence from hereditary human disease caused by mutations in the gene encoding Dp, e.g. Dp haploinsufficiency, suggests that alterations in Dp expression result not only in the disruption of tissue structure and integrity but also could evoke changes in keratinocyte proliferation. We have used transient RNA interference (RNAi) to downregulate Dp specifically in HaCaT keratinocytes. We showed that this Dp downregulation also caused reduced expression of several other desmosomal proteins. Increased cell proliferation and enhanced G 1 -to-S-phase entry in the cell cycle, as monitored by colonial cellular density and BrdU incorporation, were seen in Dp RNAi-treated cells. These proliferative changes were associated with elevated phospho-ERK1/2 and phospho-Akt levels. Furthermore, this increase in phospho-ERK/1/2 and phospho-Akt levels was sustained in Dp RNAi-treated cells at confluence whereas in control cells there was a significant reduction in phosphorylation of ERK1/2. This study indicates that Dp may participate in the regulation of keratinocyte cell proliferation by, in part at least, regulating cell cycle progression

  15. Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuaki Kobayashi

    Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

  16. Imiquimod-induced psoriasis-like inflammation in differentiated Human keratinocytes: Its evaluation using curcumin.

    Science.gov (United States)

    Varma, Sandeep R; Sivaprakasam, Thiyagarajan O; Mishra, Abheepsa; Prabhu, Sunil; M, Rafiq; P, Rangesh

    2017-10-15

    Psoriasis is considered to be a systemic disease of immune dysfunction. It is still unclear what triggers the inflammatory cascade associated with psoriasis but recent evidences suggest the vital role of IL-23/IL-17A cytokine axis in etiology of psoriasis. Several studies have been conducted in psoriatic-like animal models but ethical issues and complexity surrounding it halts the screening of new anti-psoriatic drug candidates. Hence, in this study, we developed a new in-vitro model for psoriasis using imiquimod (IMQ) induced differentiated HaCaT cells which could be used for screening of new anti-psoriatic drug candidates. The differentiated HaCaT cells were treated with IMQ (100μM) to induce psoriatic like inflammation and its effect was investigated using a natural anti-psoriatic compound, curcumin. The proliferation of psoriatic-like cells was inhibited by curcumin at 25 and 50µM concentrations. The psoriatic-like cells decreased in number with increase in apoptotic and dead cells upon curcumin treatment. Curcumin inhibited the proliferation of IMQ-induced differentiated HaCaT cells (Psoriatic-like cells) by down-regulation of pro-inflammatory cytokines, interleukin-17, tumor necrosis factor-α, interferon-γ, and interleukin-6. Apart from this, curcumin significantly enhanced the skin-barrier function by up-regulation of involucrin (iNV) and filaggrin (FLG), the regulators of epidermal skin barrier. The IMQ-induced differentiated HaCaT in vitro model recapitulated some aspects of the psoriasis pathogenesis similar to murine model. Henceforth, we conclude that this model may be used for rapid screening of anti-psoriatic drug candidates and warrant further mechanistic studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. In Vitro Growth of Human Keratinocytes and Oral Cancer Cells into Microtissues: An Aerosol-Based Microencapsulation Technique

    Directory of Open Access Journals (Sweden)

    Wai Yean Leong

    2017-05-01

    Full Text Available Cells encapsulation is a micro-technology widely applied in cell and tissue research, tissue transplantation, and regenerative medicine. In this paper, we proposed a growth of microtissue model for the human keratinocytes (HaCaT cell line and an oral squamous cell carcinoma (OSCC cell line (ORL-48 based on a simple aerosol microencapsulation technique. At an extrusion rate of 20 μL/min and air flow rate of 0.3 L/min programmed in the aerosol system, HaCaT and ORL-48 cells in alginate microcapsules were encapsulated in microcapsules with a diameter ranging from 200 to 300 μm. Both cell lines were successfully grown into microtissues in the microcapsules of alginate within 16 days of culture. The microtissues were characterized by using a live/dead cell viability assay, field emission-scanning electron microscopy (FE-SEM, fluorescence staining, and cell re-plating experiments. The microtissues of both cell types were viable after being extracted from the alginate membrane using alginate lyase. However, the microtissues of HaCaT and ORL-48 demonstrated differences in both nucleus size and morphology. The microtissues with re-associated cells in spheroids are potentially useful as a cell model for pharmacological studies.

  18. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  19. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  20. Differential effect of extracellular matrix derived from papillary and reticular fibroblasts on epidermal development in vitro.

    Science.gov (United States)

    Janson, David; Rietveld, Marion; Mahé, Christian; Saintigny, Gaëlle; El Ghalbzouri, Abdoelwaheb

    2017-06-01

    Papillary and reticular fibroblasts have different effects on keratinocyte proliferation and differentiation. The aim of this study was to investigate whether these effects are caused by differential secretion of soluble factors or by differential generation of extracellular matrix from papillary and reticular fibroblasts. To study the effect of soluble factors, keratinocyte monolayer cultures were grown in papillary or reticular fibroblast-conditioned medium. To study the effect of extracellular matrix, keratinocytes were grown on papillary or reticular-derived matrix. Conditioned medium from papillary or reticular fibroblasts did not differentially affect keratinocyte viability or epidermal development. However, keratinocyte viability was increased when grown on matrix derived from papillary, compared with reticular, fibroblasts. In addition, the longevity of the epidermis was increased when cultured on papillary fibroblast-derived matrix skin equivalents compared with reticular-derived matrix skin equivalents. The findings indicate that the matrix secreted by papillary and reticular fibroblasts is the main causal factor to account for the differences in keratinocyte growth and viability observed in our study. Differences in response to soluble factors between both populations were less significant. Matrix components specific to the papillary dermis may account for the preferential growth of keratinocytes on papillary dermis.

  1. Air-Stimulated ATP Release from Keratinocytes Occurs through Connexin Hemichannels

    Science.gov (United States)

    Barr, Travis P.; Albrecht, Phillip J.; Hou, Quanzhi; Mongin, Alexander A.; Strichartz, Gary R.; Rice, Frank L.

    2013-01-01

    Cutaneous ATP release plays an important role in both epidermal stratification and chronic pain, but little is known about ATP release mechanisms in keratinocytes that comprise the epidermis. In this study, we analyzed ATP release from cultured human neonatal keratinocytes briefly exposed to air, a process previously demonstrated to trigger ATP release from these cells. We show that exposing keratinocytes to air by removing media for 15 seconds causes a robust, long-lasting ATP release. This air-stimulated ATP release was increased in calcium differentiated cultures which showed a corresponding increase in connexin 43 mRNA, a major component of keratinocyte hemichannels. The known connexin hemichannel inhibitors 1-octanol and carbenoxolone both significantly reduced air-stimulated ATP release, as did two drugs traditionally used as ABC transporter inhibitors (glibenclamide and verapamil). These same 4 inhibitors also prevented an increase in the uptake of a connexin permeable dye induced by air exposure, confirming that connexin hemichannels are open during air-stimulated ATP release. In contrast, activity of the MDR1 ABC transporter was reduced by air exposure and the drugs that inhibited air-stimulated ATP release had differential effects on this transporter. These results indicate that air exposure elicits non-vesicular release of ATP from keratinocytes through connexin hemichannels and that drugs used to target connexin hemichannels and ABC transporters may cross-inhibit. Connexins represent a novel, peripheral target for the treatment of chronic pain and dermatological disease. PMID:23457608

  2. Extracellular calcium alters the effects of retinoic acid on DNA synthesis in cultured murine keratinocytes

    International Nuclear Information System (INIS)

    Tong, P.; Mayes, D.; Wheeler, L.

    1986-01-01

    The rate of proliferation of epidermal keratinocytes was manipulated by growing the cells in medium containing high or low concentrations of calcium. Keratinocytes cultured in high extracellular Ca ++ (1.4 mM and 2.8 mM) proliferated twice as fast as those grown in low Ca ++ medium (0.09 mM) as measured by incorporation of [ 3 H] thymidine into DNA. Exposure of high calcium keratinocytes to all-trans retinoic acid for 4 days caused a dose-related inhibition of DNA synthesis with an IC 50 of about 10 μM. In contrast, incubating low calcium keratinocytes with all-trans retinoic acid caused a dose-related stimulation of DNA synthesis with maximum increase of 278% over control at 10 μM. This increase was accompanied by increases in culture confluency with maximum increase of 109% in cell number of control at 10 μM. These results are of importance since they suggest Ca ++ may influence the effect of retinoids on keratinocytes

  3. Integrin-linked kinase and ELMO2 modulate recycling endosomes in keratinocytes.

    Science.gov (United States)

    Ho, Ernest; Ivanova, Iordanka A; Dagnino, Lina

    2016-12-01

    The formation of tight cell-cell junctions is essential in the epidermis for its barrier properties. In this tissue, keratinocytes follow a differentiation program tightly associated with their movement from the innermost basal to the outer suprabasal layers, and with changes in their cell-cell adhesion profile. Intercellular adhesion in keratinocytes is mediated through cell-cell contacts, including E-cadherin-based adherens junctions. Although the mechanisms that mediate E-cadherin delivery to the plasma membrane have been widely studied in simple epithelia, this process is less well understood in the stratified epidermis. In this study, we have investigated the role of Engulfment and Cell Motility 2 (ELMO2) and integrin-linked kinase (ILK) in the positioning of E-cadherin-containing recycling endosomes during establishment of cell-cell contacts in differentiating keratinocytes. We now show that induction of keratinocyte differentiation by Ca 2+ is accompanied by localization of ELMO2 and ILK to Rab4- and Rab11a-containing recycling endosomes. The positioning of long-loop Rab11a-positive endosomes at areas adjacent to cell-cell contacts is disrupted in ELMO2- or ILK-deficient keratinocytes, and is associated with impaired localization of E-cadherin to cell borders. Our studies show a previously unrecognized role for ELMO2 and ILK in modulation of endosomal positioning, which may play key roles in epidermal sheet maintenance and permeability barrier function. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  5. Low-level laser irradiation promotes the proliferation and maturation of keratinocytes during epithelial wound repair

    Science.gov (United States)

    Sperandio, Felipe F.; Simões, Alyne; Corrêa, Luciana; Aranha, Ana Cecília C.; Giudice, Fernanda S.; Hamblin, Michael R.; Sousa, Suzana C.O.M.

    2015-01-01

    Low-level laser therapy (LLLT) has been extensively employed to improve epithelial wound healing, though the exact response of epithelium maturation and stratification after LLLT is unknown. Thus, this study aimed to assess the in vitro growth and differentiation of keratinocytes (KCs) and in vivo wound healing response when treated with LLLT. Human KCs (HaCaT cells) showed an enhanced proliferation with all the employed laser energy densities (3, 6 and 12 J/cm2, 660nm, 100mW), together with an increased expression of Cyclin D1. Moreover, the immunoexpression of proteins related to epithelial proliferation and maturation (p63, CK10, CK14) all indicated a faster maturation of the migrating KCs in the LLLT-treated wounds. In that way, an improved epithelial healing was promoted by LLLT with the employed parameters; this improvement was confirmed by changes in the expression of several proteins related to epithelial proliferation and maturation. PMID:25411997

  6. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  7. Cell cycle pathway dysregulation in human keratinocytes during chronic exposure to low arsenite.

    Science.gov (United States)

    Al-Eryani, Laila; Waigel, Sabine; Jala, Venkatakrishna; Jenkins, Samantha F; States, J Christopher

    2017-09-15

    Arsenic is naturally prevalent in the earth's crust and widely distributed in air and water. Chronic low arsenic exposure is associated with several cancers in vivo, including skin cancer, and with transformation in vitro of cell lines including immortalized human keratinocytes (HaCaT). Arsenic also is associated with cell cycle dysregulation at different exposure levels in multiple cell lines. In this work, we analyzed gene expression in HaCaT cells to gain an understanding of gene expression changes contributing to transformation at an early time point. HaCaT cells were exposed to 0 or 100nM NaAsO 2 for 7weeks. Total RNA was purified and analyzed by microarray hybridization. Differential expression with fold change≥|1.5| and p-value≤0.05 was determined using Partek Genomic Suite™ and pathway and network analyses using MetaCore™ software (FDR≤0.05). Cell cycle analysis was performed using flow cytometry. 644 mRNAs were differentially expressed. Cell cycle/cell cycle regulation pathways predominated in the list of dysregulated pathways. Genes involved in replication origin licensing were enriched in the network. Cell cycle assay analysis showed an increase in G2/M compartment in arsenite-exposed cells. Arsenite exposure induced differential gene expression indicating dysregulation of cell cycle control, which was confirmed by cell cycle analysis. The results suggest that cell cycle dysregulation is an early event in transformation manifested in cells unable to transit G2/M efficiently. Further study at later time points will reveal additional changes in gene expression related to transformation processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  9. Enhancement of keratinocyte performance in the production of tissue-engineered skin using a low-calcium medium.

    Science.gov (United States)

    Hernon, Catherine A; Harrison, Caroline A; Thornton, Daniel J A; MacNeil, Sheila

    2007-01-01

    The success of laboratory-expanded autologous keratinocytes for the treatment of severe burn injuries is often compromised by their lack of dermal remnants and failure to establish a secure dermo-epidermal junction on the wound bed. We have developed a tissue-engineered skin substitute for in vivo use, based on a sterilized donor human dermis seeded with autologous keratinocytes and fibroblasts. However, culture rates are currently too slow for clinical use in acute burns. Our aim in this study was to increase the rate of production of tissue-engineered skin. Two approaches were explored: one using a commercial low-calcium media and the other supplementing well-established media for keratinocyte culture with the calcium-chelating agent ethylene glutamine tetra-acetic acid (EGTA). Using commercial low-calcium media for both the initial cell culture and subsequent culture of tissue-engineered skin did not produce tissue suitable for clinical use. However, it was possible to enhance the initial proliferation of keratinocytes and to increase their horizontal migration in tissue-engineered skin by supplementing established culture medium with 0.04 mM EGTA without sacrificing epidermal attachment and differentiation. Enhancement of keratinocyte migration with EGTA was also maximal in the absence of fibroblasts or basement membrane.

  10. α6 Integrin and CD44 enrich for a primary keratinocyte population that displays resistance to UV-induced apoptosis.

    Directory of Open Access Journals (Sweden)

    Helen Wray

    Full Text Available Epidermal human keratinocytes are exposed to a wide range of environmental genotoxic insults, including the UV component of solar radiation. Epidermal homeostasis in response to cellular or tissue damage is maintained by a population of keratinocyte stem cells (KSC that reside in the basal layer of the epithelium. Using cell sorting based on cell-surface markers, we have identified a novel α6 integrin(high+/CD44(+ sub-population of basal keratinocytes. These α6 integrin(high+/CD44(+ keratinocytes have both high proliferative potential, form colonies in culture that have characteristics of holoclones and have a unique pattern of resistance to apoptosis induced by UVB radiation or by agents that induce single- or double strand DNA breaks. Resistance to UVB induced apoptosis in the α6 integrin(high+/CD44(+ cells involved increased expression of TAp63 and was overcome by PI-3 kinase inhibition. In marked contrast, the α6 integrin(high+/CD44(+ cells were sensitive to apoptosis induced by the cross-linking agent cisplatin, and imatinib inhibition of c-Abl blocked the ability of cisplatin to kill α6 integrin(high+/CD44(+ cells. Our findings reveal a population of basal keratinocytes with long-term proliferative properties that display specific patterns of apoptotic resistance that is dependent upon the genotoxic stimulus, and provide insights into how these cells can be targeted with chemotherapeutic agents.

  11. Insights into the impact of silver nanoparticles on human keratinocytes metabolism through NMR metabolomics.

    Science.gov (United States)

    Carrola, Joana; Bastos, Verónica; Ferreira de Oliveira, José Miguel P; Oliveira, Helena; Santos, Conceição; Gil, Ana M; Duarte, Iola F

    2016-01-01

    Due to their antimicrobial properties, silver nanoparticles (AgNPs) are increasingly incorporated into consumer goods and medical products. Their potential toxicity to human cells is however a major concern, and there is a need for improved understanding of their effects on cell metabolism and function. Here, Nuclear Magnetic Resonance (NMR) metabolomics was used to investigate the metabolic profile of human epidermis keratinocytes (HaCaT cell line) exposed for 48 h to 30 nm citrate-stabilized spherical AgNPs (10 and 40 μg/mL). Intracellular aqueous extracts, organic extracts and extracellular culture medium were analysed to provide an integrated view of the cellular metabolic response. The specific metabolite variations, highlighted through multivariate analysis and confirmed by spectral integration, suggested that HaCaT cells exposed to AgNPs displayed upregulated glutathione-based antioxidant protection, increased glutaminolysis, downregulated tricarboxylic acid (TCA) cycle activity, energy depletion and cell membrane modification. Importantly, most metabolic changes were apparent in cells exposed to a concentration of AgNPs which did not affect cell viability at significant levels, thus underlying the sensitivity of NMR metabolomics to detect early biochemical events, even in the absence of a clear cytotoxic response. It can be concluded that NMR metabolomics is an important new tool in the field of in vitro nanotoxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Assessment of radiation induced cytogenetic damage in human keratinocytes by comet assay

    International Nuclear Information System (INIS)

    Joseph, Praveen; Sanjeev Ganesh; Narayana, Y.; Puthali, Abhay; Bhat, N.N.

    2010-01-01

    In the present study the effect of gamma radiation on normal human keratinocytes (HaCaT) cells has been analyzed using alkaline comet assay and a comparative study over the sensitivity of different comet parameters such as tail length (TL), olive tail moment (OTM) and percentage tail DNA (TDNA) has also been made. Human keratinocytes (HaCaT) cells were grown in Dulbecco's modified essential medium (DMEM) (10% FCS) at 37 °C in a humidified atmosphere containing 5% CO 2 . Cultured cells were harvested with 0.025 % trypsin EDTA. The sample (2 X 10 cells/ml) was exposed to gamma radiation of different dose using a 60 Co gamma source at dose rate of 2 Gy min -1 and the dosimetry has been carried out using Fricke and FBX dosimeters. After irradiation, to quantify the DNA damage the comet assay (single cell gel electrophoresis) was carried out under alkaline conditions, by the methods outlined by Singh et al. The quantification of the DNA strand breaks in each cells were performed using CASP software. The DNA damage quantification can be accomplished by measuring those comet parameters which exhibit a linear dependence on the amount of DNA damage. In the present study, comet parameters such as OTM, TL and TDNA were recorded and the variation of these parameters and their correlation coefficients for different doses of gamma radiation is plotted. The OTM value is normalized with control value and control for TL and TDNA is adjusted to zero to avoid initial variations in different experiments

  13. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

    Directory of Open Access Journals (Sweden)

    Aleksandra Piwko-Czuchra

    Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

  14. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  15. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  16. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  17. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  18. Ultraviolet-evoked prostaglandin biosynthesis in varying stages of keratinocyte differentiation in guinea pig skin

    Energy Technology Data Exchange (ETDEWEB)

    Karmali, R A; Safai, B

    1984-09-01

    Prostaglandin (PG) production by guinea pig epidermal cells was evaluated at various incubation intervals in normal and UV-exposed cultures. Prostaglandins have been implicated as mediators of the early phase of erythema in skin exposed to sunlight or UV-radiation. Using a density gradient centrifugation procedure, the epidermal cells were fractionated according to the various maturation stages of epidermal keratinocytes: high-density epidermal cells (HDEC) consisting of round, less mature cells; low-density epidermal cells (LDEC) consisting of polygonal keratinized cells; and intermediate-density epidermal cells (IDEC) consisting of both HDEC and LDEC. When cultures of 1 X 10(6) cells were incubated at 37 degrees C in 5% CO/sub 2/ the highest concentrations of five PG moieties measured were present in supernatants from the LDEC cultures as compared to those of IDEC or HDEC. Levels of PGF 2 alpha were much higher than the rest, which were found in the order PGF2 alpha greater than PGE2 greater than PGE1 greater than 6-keto-PGF1 alpha greater than thromboxane (TX)B2. UV-irradiation induced increases in all but TXA2 production. These results identify and quantitate five compounds produced as a result of exaggerated activity of the cyclooxygenase induced by UV-irradiation.

  19. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  20. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  1. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

  2. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  3. Development of a co-culture of keratinocytes and immune cells for in vitro investigation of cutaneous sulfur mustard toxicity.

    Science.gov (United States)

    Balszuweit, Frank; Menacher, Georg; Bloemeke, Brunhilde; Schmidt, Annette; Worek, Franz; Thiermann, Horst; Steinritz, Dirk

    2014-11-05

    Sulfur mustard (SM) is a chemical warfare agent causing skin blistering, ulceration and delayed wound healing. Inflammation and extrinsic apoptosis are known to have an important role in SM-induced cytotoxicity. As immune cells are involved in those processes, they may significantly modulate SM toxicity, but the extent of those effects is unknown. We adapted a co-culture model of immortalized keratinocytes (HaCaT) and immune cells (THP-1) and exposed this model to SM. Changes in necrosis, apoptosis and inflammation, depending on SM challenge, absence or presence and number of THP-1 cells were investigated. THP-1 were co-cultured for 24h prior to SM exposure in order to model SM effects on immune cells continuously present in the skin. Our results indicate that the presence of THP-1 strongly increased necrosis, apoptosis and inflammation. This effect was already significant when the ratio of THP-1 and HaCaT cells was similar to the ratio of Langerhans immune cells and keratinocytes in vivo. Any further increases in the number of THP-1 had only slight additional effects on SM-induced cytotoxicity. In order to assess the effects of immune cells migrating into skin areas damaged by SM, we added non-exposed THP-1 to SM-exposed HaCaT. Those THP-1 had only slight effects on SM-induced cytotoxicity. Notably, in HaCaT exposed to 300μM SM, necrosis and inflammation were slightly reduced by adding intact THP-1. This effect was dependent on the number of immune cells, steadily increasing with the number of unexposed THP-1 added. In summary, we have demonstrated that (a) the presented co-culture is a robust model to assess SM toxicity and can be used to test the efficacy of potential antidotes in vitro; (b) immune cells, damaged by SM strongly amplified cytotoxicity, (c) in contrast, unexposed THP-1 (simulating migration of immune cells into affected areas after exposure in vivo) had no pronounced adverse, but exhibited some protective effects. Thus, protecting immune cells

  4. Trehalose improves cell proliferation and dehydration tolerance of human HaCaT cells

    Directory of Open Access Journals (Sweden)

    Lee Kyung Eun

    2015-01-01

    Full Text Available Trehalose is a disaccharide molecule that serves as a natural osmotic regulator in halophilic microorganisms and plants but not in mammals. We observed that human HaCaT cells supplied with trehalose improved cell proliferation and extended viability under dehydration. In HaCaT cells, in response to increasing concentrations of exogenous trehalose, the levels of heat shock protein (HSP 70 increased and matrix metalloproteinase (MMP 1 decreased. Proteome analysis of trehalose-treated HaCaT cells revealed remarkable increases in the levels of proteins involved in cell signaling and the cell cycle, including p21 activated kinase I, Sec I family domain protein and elongation factor G. Moreover, the proteins for cell stress resistance, tryptophan hydroxylase, serine/cysteine proteinase inhibitors and vitamin D receptors were also increased. In addition, the proteins responsible for the maintenance of the cytoskeleton and cellular structures including procollagen-lysine dioxygenase, vinculin and ezrin were increased. Proteomic data revealed that trehalose affected HaCaT cells by inducing the proteins involved in cell proliferation. These results suggest that trehalose improves the proliferation and dehydration tolerance of HaCaT cells by inducing proteins involved in cell growth and dehydration protection.

  5. Studies on acute toxic effects to keratinocytes induced by hematoporphyrin derivatives and laser light.

    Science.gov (United States)

    Artuc, M; Ramshad, M; Kappus, H

    1989-01-01

    Human epidermal keratinocytes were grown in culture and the uptake of hematoporphyrin derivatives (HPDs) used in photodynamic therapy was estimated. Keratinocytes loaded with HPDs were irradiated with laser light of 632 nm generated by a helium-neon laser and cell toxicity was determined by the trypan blue exclusion test and the measurement of enzyme release. With increasing intracellular concentration of HPDs and with increasing intensity of the laser light, an increasing number of cells took up trypan blue and released the cytosolic enzyme lactate dehydrogenase and the lysosomal enzyme acid phosphatase after 1 h incubation of the irradiated cells at 37 degrees C. Cytotoxicity was less pronounced when the irradiated cells were incubated at 0 degree C indicating the involvement of enzyme reactions in cell death. No lipid peroxidation as measured by malondialdehyde and ethane formation was detectable. Our results suggest that during photodynamic therapy with HPDs and laser light epidermal keratinocytes may be seriously damaged. The data indicate that not lipid peroxidation but rather the activation of lysosomal enzymes is responsible for the cytotoxicity observed.

  6. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  7. Attachment and growth of human keratinocytes in a serum-free environment.

    Science.gov (United States)

    Gilchrest, B A; Calhoun, J K; Maciag, T

    1982-08-01

    Using a serum-free system, we have investigated the influence of human fibronectin (HFN) and selected growth factors (GF) on the attachment and growth of normal human keratinocytes in vitro. Single-cell suspensions of keratinocytes from near-confluent primary plates, plated on 5-10 microgram/cm2 HFN, showed approximately 30-40% attachment after 2-24 hours of incubation at 37 degrees C, compared with 4-6% attachment on uncoated platic plates. Percentage of attached cells was independent of seed density, tissue donor age, in vitro culture age, or medium composition, while subsequent cellular proliferation was strongly dependent on these factors. Keratinocytes grown on an adequate HFN matrix in a previously described hormone-supplemented medium (Maciag et al., 1981a) achieved four to eight population doubling over 7-12 days at densities greater than or equal to 104 cell/cm2. Removal of most GF individually from the medium had little or no effect on growth, while removal of epidermal growth factor (EGF) alone reduced growth by 30-35% and removal of bovine brain extract (BE) alone reduced growth by approximately 90%. Conversely, EGF alone in basal medium supported approximately 10% control growth, BE alone supported 30-40% control growth, and the combination of EGF and BE approximately 70%. In addition to its major effect on proliferation in this system, BE was necessary to preserve normal keratinocyte morphology and protein production. These findings expand earlier observations that HFN facilitates keratinocyte attachment in vitro and that a brain-derived extract can exert a major positive influence on cultured keratinocytes.

  8. Protective effect of different antioxidant agents in UVB-irradiated keratinocytes

    Directory of Open Access Journals (Sweden)

    Sara Salucci

    2017-09-01

    Full Text Available Skin cells can respond to UVB-induced damage either by tolerating it, or restoring it through antioxidant activation and DNA repair mechanisms or, ultimately, undergoing programmed cell death, when damage is massive. Nutritional factors, in particular, food antioxidants, have attracted much interest because of their potential use in new preventive, protective, and therapeutic strategies for chronic degenerative diseases, including skin inflammation and cancer. Some polyphenols, present in virgin olive oil, well tolerated by organism after oral administration, show a variety of pharmacological and clinical benefits such as anti-oxidant, anti-cancer, anti-inflammatory, and neuro-protective activities. Here, the protective effects of antioxidant compounds against UV-induced apoptosis have been described in HaCat cell line. Human keratinocytes were pre-treated with antioxidants before UVB exposure and their effects have been evaluated by means of ultrastructural analyses. After UVB radiation, a known cell death trigger, typical apoptotic features, absent in control condition and in antioxidant alone-treated cells, appear. An evident numerical decrease of ultrastructural apoptotic patterns and TUNEL positive nuclei can be observed when natural antioxidants were supplied before cell death induction. These data have been confirmed by molecular investigation of caspase activity. In conclusion, this paper highlights antioxidant compound ability to prevent apoptotic cell death in human keratinocytes exposed to UVB, suggesting, for these molecules, a potential role in preventing skin damage. 

  9. Ultraviolet Radiation Increases the Toxicity of Pyrene, 1-Aminopyrene and 1-Hydroxypyrene to Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Huey-Min Hwang

    2005-04-01

    Full Text Available Over the past several years, a great deal of interest has been focused on the harmful effects of ultraviolet (UV radiation to human skin. UV light has been implicated in aging, sunburn and skin cancer. Few studies, however, have been done to determine the effects that UV light, in conjunction with other environmental contaminants, may have on human skin. Polycyclic Aromatic Hydrocarbons (PAHs are a class of compounds that have been reported to be toxic, mutagenic and carcinogenic to many eukaryotic organisms. UV light is also known to increase the toxicity of PAHs through photo-activation and photo-modification. The purpose of this study was to assess the effects of UV-A irradiated pyrene (Pyr, 1-aminopyrene (1-AP and 1-hydroxypyrene (1-HP on human keratinocytes, the skin primary site of UV irradiated PAH exposure. Our findings indicate that simultaneous treatment of human keratinocyte cell line, HaCaT, with 1.0μg/ml pyrene, 1-AP or 1-HP and 3.9 J/cm2/min UV-A light resulted in significant inhibition of cell proliferation. Approximately 100% of the cells died in the case of UV-A irradiated 1-AP and 1-HP. In the case of UV-A irradiated pyrene, more than 70% of the cells died, indicating that UV-A is able to transform these PAHs into more harmful intermediates.

  10. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Directory of Open Access Journals (Sweden)

    Tatiana Takahasi Komoto

    2015-01-01

    Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.

  11. Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

    Science.gov (United States)

    Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2017-10-19

    Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

  12. Hyperthermia-induced micronucleus formation in a human keratinocyte cell line

    International Nuclear Information System (INIS)

    Hintzsche, Henning; Riese, Thorsten; Stopper, Helga

    2012-01-01

    Elevated temperature can cause biological effects in vitro and in vivo. Many studies on effects of hypo- and hyperthermia have been conducted, but only few studies systematically investigated the formation of genomic damage in the micronucleus test in human cells in vitro as a consequence of different temperatures. In the present study, HaCaT human keratinocytes were exposed to different temperatures from 37 °C to 42 °C for 24 h in a regular cell culture incubator. Micronucleus frequency as a marker of genomic damage was elevated in a temperature-dependent and statistically significant manner. Apoptosis occurred at temperatures of 39 °C or higher. Cell proliferation was unaffected up to 40 °C and decreased at 41 °C and 42 °C. Expression of the heat shock protein Hsp70 was elevated, particularly at temperatures of 40 °C and higher. These findings are in agreement with several in vivo studies and some in vitro studies looking at single, specific temperatures, but a systematically investigated temperature-dependent increase of genomic damage in human keratinocytes in vitro is demonstrated for the first time here.

  13. Cytoskeleton and pericellular matrix organization of pure adult human keratinocytes cultured from suction-blister roof epidermis.

    Science.gov (United States)

    Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I

    1982-12-01

    Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.

  14. The effect of anthocyanins from red wine and blackberry on the integrity of a keratinocyte model using ECIS.

    Science.gov (United States)

    Évora, Ana; de Freitas, Victor; Mateus, Nuno; Fernandes, Iva

    2017-11-15

    There is a growing market demand for the incorporation of plant-derived ingredients into new products for the cosmetic industry. Anthocyanins are polyphenols arising from plant secondary metabolism that have been shown to possess many bioactive properties such as free radical scavenging, antimicrobial, and chemopreventive activities. In this work, the biological activities of red wine and blackberry anthocyanins were assessed by developing a new keratinocyte barrier model using the HaCat cell line and a microelectrode-based biosensor device, referred to as Electric Cell-Substrate Impedance Sensing (ECIS). Cells were seeded at the optimal cellular density of 1.6 × 10 6 cells per mL and the half-time was calculated to be 3.55 ± 0.67 hours. The compounds' cytotoxicity was assessed and anthocyanin pigments showed no cytotoxicity towards keratinocyte cells. Wound healing assays were also performed using ECIS and it was observed that the tested pigments enhanced the healing rate of keratinocyte cells by reducing the healing time more than 50%. Cyanidin-3-glucoside presented the best results recovering 50% of the injured area in 1.48(±0.15) hours, followed by the blackberry anthocyanins (2.01 ± 0.18 hours), malvidin-3-glucoside (2.03 ± 0.09 hours) and red wine anthocyanins (2.36 ± 0.76 hours). All presented significant differences from the control 4.91(±1.11) hours.

  15. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  16. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    Science.gov (United States)

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  17. Radiation quality-dependence of bystander effect in unirradiated fibroblasts is associated with TGF-β1-Smad2 pathway and miR-21 in irradiated keratinocytes

    Science.gov (United States)

    Yin, Xiaoming; Tian, Wenqian; Wang, Longxiao; Wang, Jingdong; Zhang, Shuyu; Cao, Jianping; Yang, Hongying

    2015-01-01

    Traditional radiation biology states that radiation causes damage only in cells traversed by ionizing radiation. But radiation-induced bystander effect (RIBE), which refers to the biological responses in unirradiated cells when the neighboring cells are exposed to radiation, challenged this old dogma and has become a new paradigm of this field. By nature, RIBEs are the consequences of intercellular communication between irradiated and unirradiated cells. However, there are still some important questions remain unanswered such as whether RIBE is dependent on radiation quality, what are the determining factors if so, etc. Using a transwell co-culture system, we found that HaCaT keratinocytes irradiated with α-particles but not X-rays could induce bystander micronucleus formation in unirradiated WS1 fibroblasts after co-culture. More importantly, the activation of TGF-β1-Smad2 pathway and the consistent decrease of miR-21 level in α-irradiated HaCaT cells were essential to the micronucleus induction in bystander WS1 cells. On the other hand, X-irradiation did not induce bystander effect in unirradiated WS1 cells, accompanied by lack of Smad2 activation and consistent decrease of miR-21 in X-irradiated HaCaT cells. Taken together, these results suggest that the radiation quality-dependence of bystander effect may be associated with the TGF-β1-Smad2 pathway and miR-21 in irradiated cells. PMID:26080011

  18. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  19. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  20. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  1. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  2. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  3. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  4. Development of novel antibacterial active, HaCaT biocompatible and biodegradable CA-g-P(3HB-EC biocomposites with caffeic acid as a functional entity

    Directory of Open Access Journals (Sweden)

    H. M. N. Iqbal

    2015-09-01

    Full Text Available We have developed novel composites by grafting caffeic acid (CA onto the P(3HB-EC based material and laccase from Trametes versicolor was used for grafting purposes. The resulting composites were designated as CA-g-P(3HB-EC i.e., P(3HB-EC (control, 5CA-g-P(3HB-EC, 10CA-g-P(3HB-EC, 15CA-g-P(3HB-EC and 20CA-g-P(3HB-EC. FT-IR (Fourier-transform infrared spectroscopy was used to examine the functional and elemental groups of the control and laccase-assisted graft composites. Evidently, 15CA-g-P(3HB-EC composite exhibited resilient antibacterial activity against Gram-positive and Gram-negative bacterial strains. Moreover, a significant level of biocompatibility and biodegradability of the CA-g-P(3HB-EC composites was also achieved with the human keratinocytes-like HaCaT cells and soil burial evaluation, respectively. In conclusion, the newly developed novel composites with multi characteristics could well represent the new wave of biomaterials for medical applications, and more specifically have promising future in the infection free would dressings, burn and/or skin regeneration field due to their sophisticated characteristics.

  5. Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

    Directory of Open Access Journals (Sweden)

    Naser Tayyebi Meibodi

    2011-01-01

    Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

  6. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  7. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.

    Science.gov (United States)

    Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F

    2005-09-15

    Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.

  8. TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

    Directory of Open Access Journals (Sweden)

    Aurélie Hayez

    Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

  9. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

    DEFF Research Database (Denmark)

    Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

    2009-01-01

    BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

  10. Inflammatory responses of a human keratinocyte cell line to 10 nm citrate- and PEG-coated silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Bastos, V. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal); Brown, D.; Johnston, H. [Heriot-Watt University, School of Life Sciences (United Kingdom); Daniel-da-Silva, A. L.; Duarte, I. F. [University of Aveiro, Department of Chemistry, CICECO – Aveiro Institute of Materials (Portugal); Santos, C., E-mail: csantos@fc.up.pt; Oliveira, H. [University of Aveiro, CESAM & Laboratory of Biotechnology and Cytomics (Portugal)

    2016-07-15

    Silver nanoparticles (AgNPs) are among the most commonly used engineered NPs and various commercially available products are designed to come in direct contact with the skin (wound dressings, textiles, creams, among others). Currently, there is limited understanding of the influence of coatings on the toxicity of AgNPs and in particular their ability to impact on AgNP’s mediated inflammatory responses. As AgNPs are often stabilized by different coatings, including citrate and polyethyleneglycol (PEG), in this study we investigate the influence of citrate (Cit10) or PEG (PEG10) coatings to 10 nm AgNP on skin, using human HaCaT keratinocytes. AgNPs cytotoxicity and inflammatory response (nuclear factor (NF)-κB induction and cytokine production) of HaCaT were assessed after in vitro exposure to 10 and 40 µg/mL after 4, 24, and 48 h. Results showed that although both types of coated AgNPs decreased cell proliferation and viability, Cit10 AgNPs were more toxic. NF-κB inhibition was observed for the highest concentration (40 µg/mL) of PEG10 AgNPs, and the putative link to early apoptotic pathways observed in these cells is discussed. No production of IL-1β, IL-6, IL-10, and TNFα was stimulated by AgNPs. Furthermore, Cit10 and PEG10 AgNPs decreased the release of MCP-1 by HaCaT cells after 48 h of exposure. As cytokines are vital for the immunologic regulation in the human body, and it is demonstrated that they may interfere with NPs, more research is needed to understand how different AgNPs affect the immune system.

  11. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  12. Induction of keratinocyte migration by ECa 233 is mediated through FAK/Akt, ERK, and p38 MAPK signaling.

    Science.gov (United States)

    Singkhorn, Sawana; Tantisira, Mayuree H; Tanasawet, Supita; Hutamekalin, Pilaiwanwadee; Wongtawatchai, Tulaporn; Sukketsiri, Wanida

    2018-03-13

    Centella asiatica is widely considered the most important medicinal plant for treating and relieving skin diseases. Recently developed standardized extract of Centella asiatica ECa 233 has demonstrated positive effects on wound healing of incision and burn wound in rats. However, knowledge associated with wound healing mechanism of ECa 233 was scare. Therefore, this study aimed to investigate the effect and underlying molecular mechanisms of ECa 233 on the migration of a human keratinocyte cell line (HaCaT) using scratch wound healing assay. Formation of filopodia, a key protein in cell migration as well as signaling pathways possibly involved were subsequently assessed. It was found that HaCaT cell migration was significantly enhanced by ECa 233 in a concentration- and time-dependent manner. The filopodia formations were accordingly increased in exposure to ECa 233 at concentrations of 0.1-100 μg/ml. Furthermore, ECa 233 was found to significantly upregulate the expression of Rac1 and RhoA and to induce phosphorylation of FAK and Akt as well as ERK and p38 MAPK. Taken all together, it is suggestive that ECa 233 induces cell migration and subsequently promotes wound healing activity, through the activation of FAK, Akt, and MAPK signaling pathways thereby supporting the role of ECa 233 to be further developed for the clinical treatment of wound. Copyright © 2018 John Wiley & Sons, Ltd.

  13. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Keratinocyte proliferation, differentiation, and apoptosis-Differential mechanisms of regulation by curcumin, EGCG and apigenin

    International Nuclear Information System (INIS)

    Balasubramanian, Sivaprakasam; Eckert, Richard L.

    2007-01-01

    We have proposed that it is important to examine the impact of chemopreventive agents on the function of normal human epidermal keratinocytes since these cells comprise the barrier that protects the body from a range of environmental insults. In this context, it is widely appreciated that cancer may be retarded by consumption or topical application of naturally occurring food-derived chemopreventive agents. Our studies show that (-)-epigallocatechin-3-gallate (EGCG), a green tea-derived polyphenol, acts to enhance the differentiation of normal human keratinocytes as evidenced by its ability to increase involucrin (hINV), transglutaminase type 1 (TG1) and caspase-14 gene expression. EGCG also stimulates keratinocyte morphological differentiation. These actions of EGCG are mediated via activation of a nPKC, Ras, MEKK1, MEK3, p38δ-ERK1/2 signaling cascade which leads to increased activator protein 1 (AP1) and CAATT enhancer binding protein (C/EBP) transcription factor expression, increased binding of these factors to DNA, and increased gene transcription. In contrast, apigenin, a dietary flavonoid derived from plants and vegetables, and curcumin, an agent derived from turmeric, inhibit differentiation by suppressing MAPK signal transduction and reducing API transcription factor level. Curcumin also acts to enhance apoptosis, although EGCG and apigenin do not stimulate apoptosis. In addition, all of these agents inhibit keratinocyte proliferation. These findings indicate that each of these diet-derived chemopreventive agents has a profound impact on normal human keratinocyte function and that they operate via distinct and sometimes opposing mechanisms. However, all are expected to act as chemopreventive agents

  15. CDH1 regulates E2F1 degradation in response to differentiation signals in keratinocytes.

    Science.gov (United States)

    Singh, Randeep K; Dagnino, Lina

    2017-01-17

    The E2F1 transcription factor plays key roles in skin homeostasis. In the epidermis, E2F1 expression is essential for normal proliferation of undifferentiated keratinocytes, regeneration after injury and DNA repair following UV radiation-induced photodamage. Abnormal E2F1 expression promotes nonmelanoma skin carcinoma. In addition, E2F1 must be downregulated for proper keratinocyte differentiation, but the relevant mechanisms involved remain poorly understood. We show that differentiation signals induce a series of post-translational modifications in E2F1 that are jointly required for its downregulation. Analysis of the structural determinants that govern these processes revealed a central role for S403 and T433. In particular, substitution of these two amino acid residues with non-phosphorylatable alanine (E2F1 ST/A) interferes with E2F1 nuclear export, K11- and K48-linked polyubiquitylation and degradation in differentiated keratinocytes. In contrast, replacement of S403 and T433 with phosphomimetic aspartic acid to generate a pseudophosphorylated E2F1 mutant protein (E2F1 ST/D) generates a protein that is regulated in a manner indistinguishable from that of wild type E2F1. Cdh1 is an activating cofactor that interacts with the anaphase-promoting complex/cyclosome (APC/C) ubiquitin E3 ligase, promoting proteasomal degradation of various substrates. We found that Cdh1 associates with E2F1 in keratinocytes. Inhibition or RNAi-mediated silencing of Cdh1 prevents E2F1 degradation in response to differentiation signals. Our results reveal novel regulatory mechanisms that jointly modulate post-translational modifications and downregulation of E2F1, which are necessary for proper epidermal keratinocyte differentiation.

  16. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  17. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  18. Characterization of A Three-Dimensional Organotypic Co-Culture Skin Model for Epidermal Differentiation of Rat Adipose-Derived Stem Cells.

    Science.gov (United States)

    Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar

    2016-01-01

    The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.

  19. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  20. IKKα regulates human keratinocyte migration through surveillance of the redox environment.

    Science.gov (United States)

    Lisse, Thomas S; Rieger, Sandra

    2017-03-01

    Although the functions of H 2 O 2 in epidermal wound repair are conserved throughout evolution, the underlying signaling mechanisms are largely unknown. In this study we used human keratinocytes (HEK001) to investigate H 2 O 2 -dependent wound repair mechanisms. Scratch wounding led to H 2 O 2 production in two or three cell layers at the wound margin within ∼30 min and subsequent cysteine modification of proteins via sulfenylation. Intriguingly, exogenous H 2 O 2 treatment resulted in preferential sulfenylation of keratinocytes that adopted a migratory phenotype and detached from neighboring cells, suggesting that one of the primary functions of H 2 O 2 is to stimulate signaling factors involved in cell migration. Based on previous findings that revealed epidermal growth factor receptor (EGFR) involvement in H 2 O 2 -dependent cell migration, we analyzed oxidation of a candidate upstream target, the inhibitor of κB kinase α (IKKα; encoded by CHUK ), as a mechanism of action. We show that IKKα is sulfenylated at a conserved cysteine residue in the kinase domain, which correlates with de-repression of EGF promoter activity and increased EGF expression. Thus, this indicates that IKKα promotes migration through dynamic interactions with the EGF promoter depending on the redox state within cells. © 2017. Published by The Company of Biologists Ltd.

  1. Hydrogen-enriched water restoration of impaired calcium propagation by arsenic in primary keratinocytes

    Science.gov (United States)

    Yu, Wei-Tai; Chiu, Yi-Ching; Lee, Chih-Hung; Yoshioka, Tohru; Yu, Hsin-Su

    2013-11-01

    Endemic contamination of artesian water for drinking by arsenic is known to cause several human cancers, including cancers of the skin, bladder, and lungs. In skin, multiple arsenic-induced Bowen's disease (As-BD) can develop into invasive cancers after decades of arsenic exposure. The characteristic histological features of As-BD include full-layer epidermal dysplasia, apoptosis, and abnormal proliferation. Calcium propagation is an essential cellular event contributing to keratinocyte differentiation, proliferation, and apoptosis, all of which occur in As-BD. This study investigated how arsenic interferes calcium propagation of skin keratinocytes through ROS production and whether hydrogen-enriched water would restore arsenic-impaired calcium propagation. Arsenic was found to induce oxidative stress and inhibit ATP- and thapsigaragin-induced calcium propagation. Pretreatment of arsenic-treated keratinocytes by hydrogen-enriched water or beta-mercaptoethanol with potent anti-oxidative effects partially restored the propagation of calcium by ATP and by thapsigaragin. It was concluded that arsenic may impair calcium propagation, likely through oxidative stress and interactions with thiol groups in membrane proteins.

  2. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    International Nuclear Information System (INIS)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao

    1996-01-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0 o C for 20 min and at 5 o C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0 o C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0 o C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author)

  3. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao [Hirosaki Univ., Aomori (Japan). School of Medicine

    1996-12-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0{sup o}C for 20 min and at 5{sup o}C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0{sup o}C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0{sup o}C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author).

  4. Intercellular Communication between Keratinocytes and Fibroblasts Induces Local Osteoclast Differentiation: a Mechanism Underlying Cholesteatoma-Induced Bone Destruction.

    Science.gov (United States)

    Iwamoto, Yoriko; Nishikawa, Keizo; Imai, Ryusuke; Furuya, Masayuki; Uenaka, Maki; Ohta, Yumi; Morihana, Tetsuo; Itoi-Ochi, Saori; Penninger, Josef M; Katayama, Ichiro; Inohara, Hidenori; Ishii, Masaru

    2016-06-01

    Bone homeostasis is maintained by a balance in activity between bone-resorbing osteoclasts and bone-forming osteoblasts. Shifting the balance toward bone resorption causes osteolytic bone diseases such as rheumatoid arthritis and periodontitis. Osteoclast differentiation is regulated by receptor activator of nuclear factor κB ligand (RANKL), which, under some pathological conditions, is produced by T and B lymphocytes and synoviocytes. However, the mechanism underlying bone destruction in other diseases is little understood. Bone destruction caused by cholesteatoma, an epidermal cyst in the middle ear resulting from hyperproliferation of keratinizing squamous epithelium, can lead to lethal complications. In this study, we succeeded in generating a model for cholesteatoma, epidermal cyst-like tissue, which has the potential for inducing osteoclastogenesis in mice. Furthermore, an in vitro coculture system composed of keratinocytes, fibroblasts, and osteoclast precursors was used to demonstrate that keratinocytes stimulate osteoclast differentiation through the induction of RANKL in fibroblasts. Thus, this study demonstrates that intercellular communication between keratinocytes and fibroblasts is involved in the differentiation and function of osteoclasts, which may provide the molecular basis of a new therapeutic strategy for cholesteatoma-induced bone destruction. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Protective Effect of the Ethyl Acetate Fraction of Sargassum muticum against Ultraviolet B–Irradiated Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jin Won Hyun

    2011-11-01

    Full Text Available The aim of this study was to investigate the cytoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME against ultraviolet B (UVB-induced cell damage in human keratinocytes (HaCaT cells. SME exhibited scavenging activity toward the 1,1-diphenyl-2-picrylhydrazyl radicals and hydrogen peroxide (H2O2 and UVB-induced intracellular reactive oxygen species (ROS. SME also scavenged the hydroxyl radicals generated by the Fenton reaction (FeSO4 + H2O2, which was detected using electron spin resonance spectrometry. In addition, SME decreased the level of lipid peroxidation that was increased by UVB radiation, and restored the level of protein expression and the activities of antioxidant enzymes that were decreased by UVB radiation. Furthermore, SME reduced UVB-induced apoptosis as shown by decreased DNA fragmentation and numbers of apoptotic bodies. These results suggest that SME protects human keratinocytes against UVB-induced oxidative stress by enhancing antioxidant activity in cells, thereby inhibiting apoptosis.

  6. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  7. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  8. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  9. Differences in the melanosome distribution within the epidermal melanin units and its association with the impairing background of leukoderma in vitiligo and halo nevi: a retrospective study.

    Science.gov (United States)

    Xiong, Xi-Xi; Ding, Gao-Zhong; Zhao, Wen-E; Li, Xue; Ling, Yu-Ting; Sun, Li; Gong, Qing-Li; Lu, Yan

    2017-07-01

    Skin color is determined by the number of melanin granules produced by melanocytes that are transferred to keratinocytes. Melanin synthesis and the distribution of melanosomes to keratinocytes within the epidermal melanin unit (EMU) within the skin of vitiligo patients have been poorly studied. The ultrastructure and distribution of melanosomes in melanocytes and surrounding keratinocytes in perilesional vitiligo and normal skin were investigated using transmission electron microscopy (TEM). Furthermore, we performed a quantitative analysis of melanosome distribution within the EMUs with scatter plot. Melanosome count within keratinocytes increased significantly compared with melanocytes in perilesional stable vitiligo (P vitiligo. Furthermore, melanosome counts within melanocytes and their surrounding keratinocytes in perilesional active vitiligo skin decreased significantly compared with the other groups. In addition, taking the means-standard error of melanosome count within melanocytes and keratinocytes in healthy controls as a normal lower limit, EMUs were graded into 3 stages (I-III). Perilesional active vitiligo presented a significantly different constitution in stages compared to other groups (P vitiligo. Active vitiligo varies in stages and in stage II, EMUs are slightly impaired, but can be resuscitated, providing a golden opportunity with the potential to achieve desired repigmentation with an appropriate therapeutic choice. Adverse milieu may also contribute to the low melanosome count in keratinocytes.

  10. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    International Nuclear Information System (INIS)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-01-01

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  11. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Yang, Hongying, E-mail: yanghongying@suda.edu.cn [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Institute of Radiotherapy & Oncology, Soochow University (China)

    2015-10-15

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  12. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  13. Impaired hair follicle morphogenesis and polarized keratinocyte movement upon conditional inactivation of integrin-linked kinase in the epidermis.

    Science.gov (United States)

    Nakrieko, Kerry-Ann; Welch, Ian; Dupuis, Holly; Bryce, Dawn; Pajak, Agnieszka; St Arnaud, René; Dedhar, Shoukat; D'Souza, Sudhir J A; Dagnino, Lina

    2008-04-01

    Integrin-linked kinase (ILK) is key for cell survival, migration, and adhesion, but little is known about its role in epidermal development and homeostasis in vivo. We generated mice with conditional inactivation of the Ilk gene in squamous epithelia. These mice die perinatally and exhibit skin blistering and severe defects in hair follicle morphogenesis, including greatly reduced follicle numbers, failure to progress beyond very early developmental stages, and pronounced defects in follicular keratinocyte proliferation. ILK-deficient epidermis shows abnormalities in adhesion to the basement membrane and in differentiation. ILK-deficient cultured keratinocytes fail to attach and spread efficiently and exhibit multiple abnormalities in actin cytoskeletal organization. Ilk gene inactivation in cultured keratinocytes causes impaired ability to form stable lamellipodia, to directionally migrate, and to polarize. These defects are accompanied by abnormal distribution of active Cdc42 to cell protrusions, as well as reduced activation of Rac1 upon induction of cell migration in scraped keratinocyte monolayers. Significantly, alterations in cell spreading and forward movement in single cells can be rescued by expression of constitutively active Rac1 or RhoG. Our studies underscore a central and distinct role for ILK in hair follicle development and in polarized cell movements, two key aspects of epithelial morphogenesis and function.

  14. Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

    International Nuclear Information System (INIS)

    Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del; Larcher, Fernando; Guaguere, Eric; Danos, Olivier; Meneguzzi, Guerrino

    2006-01-01

    Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 (α3β3γ2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the α3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretion of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials

  15. Changes in localization of human discs large (hDlg) during keratinocyte differentiation is associated with expression of alternatively spliced hDlg variants

    International Nuclear Information System (INIS)

    Roberts, S.; Calautti, E.; Vanderweil, S.; Nguyen, H.O.; Foley, A.; Baden, H.P.; Viel, A.

    2007-01-01

    Alternative spliced variants of the human discs large (hDlg) tumour suppressor are characterized by combinations of insertions. Here, using insertions I2- and I3-specific antibodies, we show that I2 and I3 variants have distinct distributions in epidermal and cervical epithelia. In skin and cervix, I3 variants are found in the cytoplasm. Cytoplasmic localization of I3 variants decreases as cervical keratinocytes differentiate, concomitant with relocalization to the cell periphery. I2 variants are found at the cell periphery of differentiated epidermal and cervical keratinocytes. Nuclear localization of I2 variants was evident in both tissues, with concentration of nuclear I2 variants in basal and parabasal cervical keratinocytes. A prominent nuclear localization of hDlg in cells of hyperproliferative layers of psoriatic lesions, but not in mature differentiated keratinocytes, together with I2 redistribution in differentiating keratinocytes, suggests that nuclear hDlg functions may be pertinent to growth of undifferentiated cells. Supporting our findings in squamous tissues, a decrease of nuclear hDlg and an increase of membrane-bound and cytoplasmic hDlg upon calcium-induced keratinocyte differentiation were not concomitant processes. Furthermore, we confirm that the exit of I2 variants from the nucleus is linked to stimulation of epithelial differentiation. The dynamic redistribution of hDlg also correlated with a marked increase in the expression of I3 variants while the level of I2 variants showed only a moderate decrease. Because changes in the intracellular distribution of hDlg splice variants, and in their expression levels, correlate with changes in differentiation state we hypothesize that the different hDlg isoforms play distinct roles at various stages of epithelial differentiation

  16. Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model.

    Directory of Open Access Journals (Sweden)

    Rebecca Lamb

    Full Text Available Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.

  17. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  18. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  19. Psidium guajava extract inhibits thymus and activation-regulated chemokine (TARC/CCL17) production in human keratinocytes by inducing heme oxygenase-1 and blocking NF-κB and STAT1 activation.

    Science.gov (United States)

    Han, Eun Hee; Hwang, Yong Pil; Choi, Jae Ho; Yang, Ji Hye; Seo, Jong Kwon; Chung, Young Chul; Jeong, Hye Gwang

    2011-09-01

    Psidium guajava (P. guajava) is a food and medicinal plant with antioxidant, anti-inflammatory, and anti-allergic activities that support its traditional uses. The aim of this study was to determine the effects of P. guajava ethyl acetate extract (PGEA) on atopic dermatitis and to investigate the possible mechanisms by which PGEA inhibits cytokine-induced Th2 chemokine expression in HaCaT human keratinocyte cells. We found that PGEA suppressed the IFN-γ/TNF-α-co-induced production of thymus and activation-regulated chemokine (TARC) protein and mRNA in HaCaT cells. Additionally, PGEA inhibited the TNF-α/IFN-γ-co-induced activation of NF-κB and STAT1 and increased the expression of heme oxygenase-1 (HO-1) protein and mRNA. HO-1 inhibitor enhanced the suppressive effects of PGEA on TNF-α/IFN-γ-co-induced TARC production and gene expression. Collectively, these data demonstrate that PGEA inhibits chemokine expression in keratinocytes by inducing HO-1 expression and it suggests a possible therapeutic application in atopic dermatitis and other inflammatory skin diseases. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Blockage of JNK pathway enhances arsenic trioxide-induced apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Huang, H.-S.; Liu, Z.-M.; Hong, D.-Y.

    2010-01-01

    Arsenic is well known as a carcinogen predisposing humans to some severe diseases and also as an effective medicine for treating acute promyelocytic leukemia, syphilis, and psoriasis. Multiple active mechanisms, including cell cycle arrest and apoptosis, have been proposed in therapy; however, the opposing effects of arsenic remain controversial. Our previous study found that arsenic trioxide (ATO)-induced activation of p21 WAF1/CIP1 (p21) led to A431 cell death through the antagonistic effects of the signaling of ERK1/2 and JNK1. In the current study, the inhibitory effects of JNK1 on ATO-induced p21 expression were explored. Over-expression of JNK1 in A431 cells could inhibit p21 expression, which was associated with HDAC1 and TGIF. Using the GST pull-down assay and fluorescence resonance energy transfer analysis, N-terminal domain (amino acids 1-108) of TGIF, critical to its binding with c-Jun, was found. Using reporter assays, requirement of the C-terminal domain (amino acids 138-272) of TGIF to suppress ATO-induced p21 expression was observed. Thus, the domains of TGIF that carried out its inhibitory effects on p21 were identified. Finally, treatment with JNK inhibitor SP600125 could enhance ATO-induced apoptosis of HaCaT keratinocytes by using flow cytometry.

  1. UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling.

    Science.gov (United States)

    Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B

    2013-08-20

    At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.

  2. Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

    Directory of Open Access Journals (Sweden)

    Shadmehr Demehri

    2008-05-01

    Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

  3. Analysis of E2F factors during epidermal differentiation.

    Science.gov (United States)

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  4. Epidermal Expression and Regulation of Interleukin-33 during Homeostasis and Inflammation: Strong Species Differences.

    Science.gov (United States)

    Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis

    2015-07-01

    IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.

  5. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  6. Differential effects of the extracellular microenvironment on human embryonic stem cell differentiation into keratinocytes and their subsequent replicative life span.

    Science.gov (United States)

    Movahednia, Mohammad Mehdi; Kidwai, Fahad Karim; Zou, Yu; Tong, Huei Jinn; Liu, Xiaochen; Islam, Intekhab; Toh, Wei Seong; Raghunath, Michael; Cao, Tong

    2015-04-01

    Culture microenvironment plays a critical role in the propagation and differentiation of human embryonic stem cells (hESCs) and their differentiated progenies. Although high efficiency of hESC differentiation to keratinocytes (hESC-Kert) has been achieved, little is known regarding the effects of early culture microenvironment and pertinent extracellular matrix (ECM) interactions during epidermal commitment on subsequent proliferative capacity of hESC-Kert. The aim of this study is to evaluate the effects of the different ECM microenvironments during hESC differentiation on subsequent replicative life span of hESC-Kert. In doing so, H1-hESCs were differentiated to keratinocytes (H1-Kert) in two differentiation systems. The first system employed autologous fibroblast feeder support, in which keratinocytes (H1-Kert(ACC)) were derived by coculture of hESCs with hESC-derived fibroblasts (H1-ebFs). The second system employed a novel decellularized matrix from H1-ebFs to create a dermoepidermal junction-like (DEJ) matrix. H1-Kert(AFF) were derived by differentiation of hESCs on the feeder-free system employing the DEJ matrix. Our study indicated that the feeder-free system with the use of DEJ matrix was more efficient in differentiation of hESCs toward epidermal progenitors. However, the feeder-free system was not sufficient to support the subsequent replicative capacity of differentiated keratinocytes. Of note, H1-Kert(AFF) showed limited replicative capacity with reduced telomere length and early cellular senescence. We further showed that the lack of cell-cell interactions during epidermal commitment led to heightened production of TGF-β1 by hESC-Kert during extended culture, which in turn was responsible for resulting in the limited replicative life span with cellular senescence of hESC-Kert derived under the feeder-free culture system. This study highlights for the first time the importance of the culture microenvironment and cell-ECM interactions during

  7. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes.

    Science.gov (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In

    2015-10-01

    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.

  8. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  9. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  10. Making more matrix: enhancing the deposition of dermal-epidermal junction components in vitro and accelerating organotypic skin culture development, using macromolecular crowding.

    Science.gov (United States)

    Benny, Paula; Badowski, Cedric; Lane, E Birgitte; Raghunath, Michael

    2015-01-01

    Skin is one of the most accessible tissues for experimental biomedical sciences, and cultured skin cells represent one of the longest-running clinical applications of stem cell therapy. However, culture-generated skin mimetic multicellular structures are still limited in their application by the time taken to develop these constructs in vitro and by their incomplete differentiation. The development of a functional dermal-epidermal junction (DEJ) is one of the most sought after aspects of cultured skin, and one of the hardest to recreate in vitro. At the DEJ, dermal fibroblasts and epidermal keratinocytes interact to form an interlinked basement membrane of extracellular matrix (ECM), which forms as a concerted action of both keratinocytes and fibroblasts. Successful formation of this basement membrane is essential for take and stability of cultured skin autografts. We studied interactive matrix production by monocultures and cocultures of primary human keratinocytes and fibroblasts in an attempt to improve the efficiency of basement membrane production in culture using mixed macromolecular crowding (mMMC); resulting ECM were enriched with the deposition of collagens I, IV, fibronectin, and laminin 332 (laminin 5) and also in collagen VII, the anchoring fibril component. Our in vitro data point to fibroblasts, rather than keratinocytes, as the major cellular contributors of the DEJ. Not only did we find more collagen VII production and deposition by fibroblasts in comparison to keratinocytes, but also observed that decellularized fibroblast ECM stimulated the production and deposition of collagen VII by keratinocytes, over and above that of keratinocyte monocultures. In confrontation cultures, keratinocytes and fibroblasts showed spontaneous segregation and demarcation of cell boundaries by DEJ protein deposition. Finally, mMMC was used in a classical organotypic coculture protocol with keratinocytes seeded over fibroblast-containing collagen gels. Applied during

  11. Allogeneic cultured keratinocytes vs. cadaveric skin to cover wide-mesh autogenous split-thickness skin grafts.

    Science.gov (United States)

    Monstrey, S; Beele, H; Kettler, M; Van Landuyt, K; Blondeel, P; Matton, G; Naeyaert, J M

    1999-09-01

    Improved shock therapy has extended the limits of survival in patients with massive burns, and nowadays skin coverage has become the major problem in burn management. The use of mesh skin grafts is still the simplest technique to expand the amount of available donor skin. However, very wide-mesh skin grafts take a very long time to heal, often resulting in unaesthetic scar formation. On the other hand, allogeneic cultured keratinocytes have been reported as a natural source of growth factors and thus could be useful to improve wound healing of these wide-mesh grafts. A clinical study was performed to compare the use of cryopreserved allogeneic cultured keratinocytes vs. the traditional cadaveric skin as a double layer over widely expanded autogenous skin grafts. This procedure was performed in 18 pairs of full-thickness burn wounds (with similar depth and location) in 11 severely burned patients. Early clinical evaluation was made at 2, 3, and 4 to 5 weeks. Parameters such as epithelialization, granulation tissue formation, infection, and scar formation were evaluated. Biopsies were taken to compare the histological characteristics of the epidermis, the epidermal-dermal junction, and the dermis. Late evaluations were performed at 6 and 12 months regarding color, softness, thickness, and subjective feeling of the scar tissue. Aside from a faster (p keratinocyte group at 2 weeks, there were no statistically different results in any of the early evaluated parameters, neither clinically nor histologically. At long-term follow-up, clinical results and scar characteristics were not significantly different in the two compared groups. It is concluded from the results of this study that, during the early phase, epithelialization was faster with allogeneic cultured keratinocytes compared with cadaveric skin. However, taking into account the substantial difference in costs, the described use of cryopreserved allogeneic cultured keratinocytes as a double layer on meshed

  12. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  13. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  14. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  15. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...

  16. Laminin-5 Degradation Due to Mustard in Cultured Normal Human Epidermal Keratinocytes (NHEK)

    National Research Council Canada - National Science Library

    Ray, Prabhati; Jin, Xiannu; Leng, Yan; Li, Zhuangwu; Ray, Radharaman

    2003-01-01

    .... We observed that in NHEK, mustards degrade laminin-5. Calmodulin antagonist, W7 or the serine protease inhibitor, TLCK prior to mustard exposure prevented mustard-induced degradation of laminin-5...

  17. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  18. Anti-epidermal growth factor receptor skin toxicity: a matter of topical hydration.

    Science.gov (United States)

    Ferrari, Daris; Codecà, Carla; Bocci, Barbara; Crepaldi, Francesca; Violati, Martina; Viale, Giulia; Careri, Carmela; Caldiera, Sarah; Bordin, Veronica; Luciani, Andrea; Zonato, Sabrina; Cassinelli, Gabriela; Foa, Paolo

    2016-02-01

    Skin toxicity is a frequent complication of anti-epidermal growth factor receptor therapy, which can be an obstacle in maintaining the dose intensity and may negatively impact on the clinical outcome of cancer patients. Skin lesions depend on the disruption of the keratinocyte development pathways and no treatment is clearly effective in resolving the cutaneous alterations frequently found during anti-epidermal growth factor receptor therapy. Among systemic treatments, oral tetracycline proved to be useful in preventing skin manifestations. We describe the case of a patient affected by metastatic colorectal cancer, for whom a combination of chemotherapy and cetuximab was used as second-line treatment. The patient developed a symptomatic papulopustular skin rash that disappeared completely after a twice-daily application of a hydrating and moisturizing cream, mainly consisting of a mixture of paraffin, silicone compounds, and macrogol. The marked cutaneous amelioration allowed the patient to continue cetuximab without any further symptoms and was associated with a partial radiological response.

  19. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Directory of Open Access Journals (Sweden)

    David Judah

    Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  20. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Science.gov (United States)

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  1. Keratinocyte-Melanocyte graft technique followed by PUVA therapy for stable vitiligo

    Directory of Open Access Journals (Sweden)

    Kachhawa Dilip

    2008-01-01

    Full Text Available Background: Various surgical procedures for correcting stable vitiligo exist but these have their own limitations. Autologous, non-cultured, non-trypsinized, melanocyte plus keratinocyte grafting is a new and simple method of vitiligo surgery. Objective: The study aimed to evaluate efficacy of a new grafting technique in vitiligo patches. Methods: Eighteen vitiligo patches underwent this procedure. The upper layer of epidermis was removed by superficial dermabrasion using a dermabrader micromotor until the epidermis appeared wet and shiny. Then, antibiotic ointment was applied and dermabrasion was continued up to the whitish area of the upper dermis. The paste-like material (ointment with entangled epidermal particles was collected and spread over the dermabraded recipient site. Results: Pigmentation usually started at 4-6 weeks. Complete uniform pigmentation took 16-20 weeks. Conclusion: For smaller vitiligo patches this method gives cosmetically acceptable results. It is easy to perform and does not require specific laboratory setup.

  2. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  3. Vitamin D receptor-mediated control of Soggy, Wise, and Hairless gene expression in keratinocytes.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Estess, Rudolf C; Kaneko, Ichiro; Whitfield, G Kerr; Jurutka, Peter W; Haussler, Mark R

    2014-02-01

    The vitamin D receptor (VDR), but not its hormonal ligand, 1,25-dihydroxyvitamin D3 (1,25D), is required for the progression of the mammalian hair cycle. We studied three genes relevant to hair cycle signaling, DKKL1 (Soggy), SOSTDC1 (Wise), and HR (Hairless), to determine whether their expression is regulated by VDR and/or its 1,25D ligand. DKKL1 mRNA was repressed 49-72% by 1,25D in primary human and CCD-1106 KERTr keratinocytes; a functional vitamin D responsive element (VDRE) was identified at -9590 bp in murine Soggy. Similarly, SOSTDC1 mRNA was repressed 41-59% by 1,25D in KERTr and primary human keratinocytes; a functional VDRE was located at -6215 bp in human Wise. In contrast, HR mRNA was upregulated 1.56- to 2.77-fold by 1,25D in primary human and KERTr keratinocytes; a VDRE (TGGTGAgtgAGGACA) consisting of an imperfect direct repeat separated by three nucleotides (DR3) was identified at -7269 bp in the human Hairless gene that mediated dramatic induction, even in the absence of 1,25D ligand. In parallel, a DR4 thyroid hormone responsive element, TGGTGAggccAGGACA, was identified at +1304 bp in the human HR gene that conferred tri-iodothyronine (T3)-independent transcriptional activation. Because the thyroid hormone receptor controls HR expression in the CNS, whereas VDR functions in concert with the HR corepressor specifically in skin, a model is proposed wherein unliganded VDR upregulates the expression of HR, the gene product of which acts as a downstream comodulator to feedback-repress DKKL1 and SOSTDC1, resulting in integration of bone morphogenic protein and Wnt signaling to drive the mammalian hair cycle and/or influencing epidermal function.

  4. Alteration of keratinocyte differentiation and senescence by the tumor promoter dioxin

    International Nuclear Information System (INIS)

    Ray, Soma S.; Swanson, Hollie I.

    2003-01-01

    Exposure to the environmental contaminant dioxin, elicits a variety of responses, which includes tumor promotion, embryotoxicity/teratogenesis, and carcinogenesis in both animals and humans. Many of the effects of dioxin are mediated by the aryl hydrocarbon receptor (AHR), a ligand-activated bHLH (basic helix-loop-helix)/PAS transcription factor. We initiated this study to determine whether dioxin's tumor-promoting activities may lie in its ability to alter proliferation, differentiation, and/or senescence using normal human epidermal keratinocytes (HEKs). Here, we report that dioxin appears to accelerate differentiation as measured by flow cytometry and by increased expression of the differentiation markers involucrin and filaggrin. In addition, dioxin appears to increase proliferation as indicated by an increase in NADH/NADPH production and changes in cell cycle. Finally, dioxin decreases SA (senescence associated) β-galactosidase staining, an indicator of senescence, in the differentiating keratinocytes. These changes were accompanied by decreases in the expression levels of key cell cycle regulatory proteins p53, p16 INK4a , and p14 ARF . Our findings support the idea that dioxin may exert its tumor-promoting actions, in part, by downregulating the expression levels of key tumor suppressor proteins, which may impair the cell's ability to maintain its appropriate cellular status

  5. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  6. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  7. Heterogeneity of [3H]phorbol 12,13-dibutyrate binding in primary mouse keratinocytes at different stages of maturation

    International Nuclear Information System (INIS)

    Dunn, J.A.; Jeng, A.Y.; Yuspa, S.H.; Blumberg, P.M.

    1985-01-01

    Mouse keratinocytes respond heterogeneously to phorbol esters with distinct subpopulations stimulated to proliferate or induced to differentiate. The maturation state of the epidermal cell at the time of exposure may determine its response. The binding of phorbol esters to primary mouse keratinocytes was studied under culture conditions selecting for proliferating cells or differentiating cells. [20- 3 H]-12-Deoxyphorbol 13-isobutyrate ([ 3 H]-DPB) bound to both types of cells at one class of binding sites. The dissociation constant (Kd) for [ 3 H]DPB in the proliferative cells was 69 nM and the binding at saturation (Bmax) was 1.3 pmol/mg of protein. The corresponding values in the differentiative cells were 96 nM and 1.5 pmol/mg of protein, respectively. In contrast to the results obtained with [ 3 H]DPB, [20- 3 H]phorbol 12,13-dibutyrate ([ 3 H]PDBU) bound to both cell types in a heterogeneous fashion. The site for [ 3 H]DPB binding seemed to correspond to the higher affinity [ 3 H]PDBU binding site. The major difference in the cells grown in the medium containing 1.2 mM CaCl 2 was an increase in the Bmax of the lower affinity binding site with the other three parameters remaining similar. The state of epidermal differentiation thus appears to modulate the amount of the lower affinity binding sites for phorbol esters

  8. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Platelet-released growth factors (PRGF and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF® contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3 is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR. In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds.

  9. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Science.gov (United States)

    Lammel, Justus; Tohidnezhad, Mersedeh; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Cremer, Jochen; Jahr, Holger; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF®)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR). In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds. PMID:28811680

  10. Grhl3 and Lmo4 play coordinate roles in epidermal migration.

    Science.gov (United States)

    Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M

    2008-09-01

    In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.

  11. Radical Scavenging Activity-Based and AP-1-Targeted Anti-Inflammatory Effects of Lutein in Macrophage-Like and Skin Keratinocytic Cells

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2013-01-01

    Full Text Available Lutein is a naturally occurring carotenoid with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties. Although the anti-inflammatory effects of lutein have previously been described, the mechanism of its anti-inflammatory action has not been fully elucidated. Therefore, in the present study, we aimed to investigate the regulatory activity of lutein in the inflammatory responses of skin-derived keratinocytes or macrophages and to elucidate the mechanism of its inhibitory action. Lutein significantly reduced several skin inflammatory responses, including increased expression of interleukin-(IL- 6 from LPS-treated macrophages, upregulation of cyclooxygenase-(COX- 2 from interferon-γ/tumor necrosis-factor-(TNF- α-treated HaCaT cells, and the enhancement of matrix-metallopeptidase-(MMP- 9 level in UV-irradiated keratinocytes. By evaluating the intracellular signaling pathway and the nuclear transcription factor levels, we determined that lutein inhibited the activation of redox-sensitive AP-1 pathway by suppressing the activation of p38 and c-Jun-N-terminal kinase (JNK. Evaluation of the radical and ROS scavenging activities further revealed that lutein was able to act as a strong anti-oxidant. Taken together, our findings strongly suggest that lutein-mediated AP-1 suppression and anti-inflammatory activity are the result of its strong antioxidative and p38/JNK inhibitory activities. These findings can be applied for the preparation of anti-inflammatory and cosmetic remedies for inflammatory diseases of the skin.

  12. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    Energy Technology Data Exchange (ETDEWEB)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Elmets, Craig A. [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)

    2014-08-29

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34{sup +}/K15{sup +}/p63{sup +} keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in

  13. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    International Nuclear Information System (INIS)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh; Elmets, Craig A.; Athar, Mohammad

    2014-01-01

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34 + /K15 + /p63 + keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in tumors induced

  14. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes.

    Science.gov (United States)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping; Yang, Hongying

    2015-10-01

    Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects, overexpression of SOD2 abolished the bystander oxidative stress and DNA damage, indicating that SOD2 was critical to the induction of RIBEs. Moreover, we found that miR-21 regulated SOD2, suggesting that miR-21 might mediate bystander responses through its regulation on SOD2. In conclusion, this study revealed a profound role of miR-21-regulated SOD2 of unirradiated WS1

  15. Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Wen-Hung Chung

    2010-01-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

  16. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  17. Performance of a novel keratinocyte-based reporter cell line to screen skin sensitizers in vitro

    International Nuclear Information System (INIS)

    Emter, Roger; Ellis, Graham; Natsch, Andreas

    2010-01-01

    In vitro tests are needed to replace animal tests to screen for the skin sensitization potential of chemicals. Skin sensitizers are electrophilic molecules and the Nrf2-electrophile-sensing pathway comprising the repressor protein Keap1, the transcription factor Nrf2 and the antioxidant response element (ARE) is emerging as a toxicity pathway induced by skin sensitizers. Previously, we screened a large set of chemicals in the reporter cell line AREc32, which contains an eight-fold repeat of the rat GSTA2 ARE-sequence upstream of a luciferase reporter gene in the human breast cancer cell line MCF7. This approach was now further developed to bring it closer to the conditions in the human skin and to propose a fully standardized assay. To this end, a luciferase reporter gene under control of a single copy of the ARE-element of the human AKR1C2 gene was stably inserted into HaCaT keratinocytes. A standard operating procedure was developed whereby chemicals are routinely tested at 12 concentrations in triplicate for significant induction of gene activity. We report results from this novel assay on (i) a list of reference chemicals published by ECVAM, (ii) the ICCVAM list of chemicals for validation of alternative endpoints in the LLNA and (iii) on a more general list of 67 chemicals derived from the ICCVAM database. For comparison, peptide reactivity data are presented for the same chemicals. The results indicate a good predictive value of this approach for hazard identification. Its technical simplicity, the high-throughput format and the good predictivity may make this assay a candidate for rapid validation to meet the tight deadline to replace animal tests for skin sensitization by 2013 set by the European authorities.

  18. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  19. Growth of various cell types in the presence of lactic and glycolic acids: the adverse effect of glycolic acid released from PLAGA copolymer on keratinocyte proliferation.

    Science.gov (United States)

    Garric, Xavier; Molès, Jean-Pierre; Garreau, Henri; Braud, Christian; Guilhou, Jean-Jacques; Vert, Michel

    2002-01-01

    Poly(alpha-hydroxy-acid)s derived from lactic acid (LA) and glycolic acid (GA) are bioresorbable polymers that are currently used in human surgery and in pharmacology to make temporary therapeutic devices. Nowadays, increasing attention is paid to these polymers in the field of tissue engineering. However, the literature shows that a large number of factors can affect many of their properties and the responses of biological systems. As part of our investigation of the biocompatibility of degradable aliphatic polyesters, the effects of LA and GA on the proliferation of various cells under in vitro cell culture conditions were studied. The release of LA and GA from films made of a copolymer synthesized by the zinc lactate method and composed of 37.5% L-lactyl, 37.5% D-lactyl, and 25% glycolyl repeating units was first investigated over a period of 30 days under abiotic conditions in a cell culture medium in order to identify a range of acid concentrations consistent with releases to be expected in real cell cultures. Four cell lines, namely 3T3-J2, C3H10(1/2), A431, and HaCat, and three primary cell cultures, namely rat endothelial cells, rat smooth muscle cells, and human dermal fibroblasts, were then allowed to grow in the presence of LA and GA at various concentrations taken within the selected 10-1000 mg/cm3 range. Little or no effect was observed on the proliferation of all cells except human keratinocytes, whose growth was dramatically inhibited by GA at concentrations as low as 10 mg/cm3. The inhibiting effect of GA was confirmed by considering the growth of keratinocytes on films made of the same copolymer, in comparison with poly(DL-lactic acid) and polystyrene taken as references. This work shows that GA-releasing degradable matrices are not adapted to the culture of keratinocytes with the aim of making skin grafts.

  20. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  1. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  2. Molecular photoprotection of human keratinocytes in vitro by the naturally occurring mycosporine-like amino acid palythine.

    Science.gov (United States)

    Lawrence, K P; Gacesa, R; Long, P F; Young, A R

    2017-11-13

    Solar ultraviolet radiation (UVR) induces molecular and genetic changes in the skin, which result in skin cancer, photoageing and photosensitivity disorders. The use of sunscreens is advocated to prevent such photodamage; however, most formulations contain organic and inorganic UVR filters that are nonbiodegradable and can damage fragile marine ecosystems. Mycosporine-like amino acids (MAAs) are natural UVR-absorbing compounds that have evolved in marine species for protection against chronic UVR exposure in shallow-water habitats. To determine if palythine, a photostable model MAA, could offer protection against a range of UVR-induced damage biomarkers that are important in skin cancer and photoageing. HaCaT human keratinocytes were used to assess the photoprotective potential of palythine using a number of end points including cell viability, DNA damage (nonspecific, cyclobutane pyrimidine dimers and oxidatively generated damage), gene expression changes (linked to inflammation, photoageing and oxidative stress) and oxidative stress. The antioxidant mechanism was investigated using chemical quenching and Nrf2 pathway activation assays. Palythine offered statistically significant protection (P photoprotective molecule in vitro that has potential to be developed as a natural and biocompatible alternative to currently approved UVR filters. © 2017 The Authors. British Journal of Dermatology published by John Wiley & Sons Ltd on behalf of British Association of Dermatologists.

  3. Cyr61/CCN1 induces CCL20 production by keratinocyte via activating p38 and JNK/AP-1 pathway in psoriasis.

    Science.gov (United States)

    Li, Huidan; Li, Haichuan; Huo, Rongfen; Wu, Pinru; Shen, Zhengyu; Xu, Hui; Shen, Baihua; Li, Ningli

    2017-10-01

    Psoriasis is a common chronic skin disease characterized by epidermal hyperplasia and inflammation. Cysteine-rich angiogenic inducer 61 (Cyr61/CCN1) has recently been implicated in psoriasis pathogenesis by promoting keratinocyte activation. However, the mechanisms by which CCN1 enhances cutaneous inflammation are not fully understood. In this study, we investigated the role of CCN1 on the expression of CCL20 in human keratinocyte. By double-label immunofluorescence staining, we first identified that the expression of CCN1 colocalized well with CCL20 production in the epidermis of psoriasis skin lesion. Furthermore, in vivo, blocking or knockdown CCN1 expression ameliorated skin inflammation and reduced the expression of CCL20 in both imiquimod and IL-23-induced psoriasis-like mouse models, which indicated that CCN1 might be involved in the regulation of CCL20 production in psoriasis. Next, in vitro, we stimulated primary normal human epidermal keratinocyte (NHEK) with exogenous protein CCN1 and found that CCN1 directly upregulated CCL20 production independent of TNF-α, IL-22 and IL-17 pathway. Lastly, the signaling pathway study showed that CCN1 enhanced the binding of AP-1 to the CCL20 promoter via crosstalk with p38 and JNK. Our study demonstrates that CCN1 stimulates CCL20 production in vitro and in vivo, and thus supports the notion that overexpressed CCN1 in hyperproliferating keratinocyte is functionally involved in the recruitment of inflammatory cells to skin lesions affected by psoriasis. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  4. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  5. (+)-Nootkatone inhibits tumor necrosis factor α/interferon γ-induced production of chemokines in HaCaT cells.

    Science.gov (United States)

    Choi, Hyeon-Jae; Lee, Jin-Hwee; Jung, Yi-Sook

    2014-05-02

    Chemokines are important mediators of cell migration, and thymus and activation-regulated chemokine (TARC/CCL17) and macrophage-derived chemokine (MDC/CCL22) are well-known typical inflammatory chemokines involved in atopic dermatitis (AD). (+)-Nootkatone is the major component of Cyperus rotundus. (+)-Nootkatone has antiallergic, anti-inflammatory, and antiplatelet activities. The purpose of this study was to investigate the effect of (+)-nootkatone on tumor necrosis factor α (TNF-α)/interferon γ (IFN-γ)-induced expression of Th2 chemokines in HaCaT cells. We found that (+)-nootkatone inhibited the TNF-α/IFN-γ-induced expression of TARC/CCL17 and MDC/CCL22 mRNA in HaCaT cells. It also significantly inhibited TNF-α/IFN-γ-induced activation of nuclear factor kappa B (NF-κB), p38 mitogen-activated protein kinase (MAPK), and protein kinase Cζ (PKCζ). Furthermore, we showed that PKCζ and p38 MAPK contributed to the inhibition of TNF-α/IFN-γ-induced TARC/CCL17 and MDC/CCL22 expression by blocking IκBα degradation in HaCaT cells. Taken together, these results suggest that (+)-nootkatone may suppress TNF-α/IFN-γ-induced TARC/CCL17 and MDC/CCL22 expression in HaCaT cells by inhibiting of PKCζ and p38 MAPK signaling pathways that lead to activation of NF-κB. We propose that (+)-nootkatone may be a useful therapeutic candidate for inflammatory skin diseases such as AD. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    International Nuclear Information System (INIS)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A.

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs

  7. Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

    Science.gov (United States)

    Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

    2013-06-01

    In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  8. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    .... The research we have conducted during the first and second year of the grant has allowed us to conclude that human keratinocytes in vitro can be engineered to express a chimeric cell surface receptor...

  9. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    .... The research we have conducted has allowed us to conclude that human keratinocytes in vitro can be engineered to express a chimeric cell surface receptor and that these modified cells could recognize...

  10. miR-198 Represses the Proliferation of HaCaT Cells by Targeting Cyclin D2

    Directory of Open Access Journals (Sweden)

    Jian Wang

    2015-07-01

    Full Text Available Background: MiR-198 has been considered as an inhibitor of cell proliferation, invasion, migration and a promoter of apoptosis in most cancer cells, while its effect on non-cancer cells is poorly understood. Methods: The effect of miR-198 transfection on HaCaT cell proliferation was firstly detected using Cell Count Kit-8 and the cell cycle progression was analyzed by flow cytometry. Using bioinformatics analyses and luciferase assay, a new target of miR-198 was searched and identified. Then, the effect of the new target gene of miR-198 on cell proliferation and cell cycle was also detected. Results: Here we showed that miR-198 directly bound to the 3′-UTR of CCND2 mRNA, which was a key regulator in cell cycle progression. Overexpressed miR-198 repressed CCND2 expression at mRNA and protein levels and subsequently led to cell proliferation inhibition and cell cycle arrest in the G1 phase. Transfection ofSiCCND2 in HaCaT cells showed similar inhibitory effects on cell proliferation and cell cycle progression. Conclusion: In conclusion, we have identified that miR-198 inhibited HaCaT cell proliferation by directly targeting CCND2.

  11. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  12. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  14. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  15. (+)-Nootkatone inhibits tumor necrosis factor α/interferon γ-induced production of chemokines in HaCaT cells

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hyeon-Jae; Lee, Jin-Hwee [College of Pharmacy, Ajou University, Suwon 443-749 (Korea, Republic of); Jung, Yi-Sook, E-mail: yisjung@ajou.ac.kr [College of Pharmacy, Ajou University, Suwon 443-749 (Korea, Republic of); Research Institute of Pharmaceutical Sciences and Technology, Ajou University, Suwon 443-749 (Korea, Republic of)

    2014-05-02

    Highlights: • (+)-Nootkatone inhibits TNF-α/IFN-γ-induced TARC and MDC expression in HaCaT cells. • PKCζ, p38 MAPK, or NF-κB mediate TNF-α/IFN-γ-induced TARC and MDC expression. • (+)-Nootkatone inhibits TNF-α/IFN-γ-induced activation of PKCζ, p38 MAPK, or NF-κB. • (+)-Nootkatone suppresses chemokine expression by inhibiting of PKCζ and p38 pathways. - Abstract: Chemokines are important mediators of cell migration, and thymus and activation-regulated chemokine (TARC/CCL17) and macrophage-derived chemokine (MDC/CCL22) are well-known typical inflammatory chemokines involved in atopic dermatitis (AD). (+)-Nootkatone is the major component of Cyperus rotundus. (+)-Nootkatone has antiallergic, anti-inflammatory, and antiplatelet activities. The purpose of this study was to investigate the effect of (+)-nootkatone on tumor necrosis factor α (TNF-α)/interferon γ (IFN-γ)-induced expression of Th2 chemokines in HaCaT cells. We found that (+)-nootkatone inhibited the TNF-α/IFN-γ-induced expression of TARC/CCL17 and MDC/CCL22 mRNA in HaCaT cells. It also significantly inhibited TNF-α/IFN-γ-induced activation of nuclear factor kappa B (NF-κB), p38 mitogen-activated protein kinase (MAPK), and protein kinase Cζ (PKCζ). Furthermore, we showed that PKCζ and p38 MAPK contributed to the inhibition of TNF-α/IFN-γ-induced TARC/CCL17 and MDC/CCL22 expression by blocking IκBα degradation in HaCaT cells. Taken together, these results suggest that (+)-nootkatone may suppress TNF-α/IFN-γ-induced TARC/CCL17 and MDC/CCL22 expression in HaCaT cells by inhibiting of PKCζ and p38 MAPK signaling pathways that lead to activation of NF-κB. We propose that (+)-nootkatone may be a useful therapeutic candidate for inflammatory skin diseases such as AD.

  16. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  17. Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

    Science.gov (United States)

    Crawford, Melissa; Dagnino, Lina

    2017-10-02

    The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

  18. TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.

    Science.gov (United States)

    Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina

    2012-10-01

    Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.

  19. Roles of p63 in epidermal development and tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeng-Yuan Yao

    2012-12-01

    Full Text Available pidermis is composed mainly of keratinocytes and is the ma­jor barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcrip­tion factor p63. The p63 gene encodes proteins with structures simi­lar to that of p53, including an N-terminal transacti­vation (TA domain, a DNA-binding domain and a car­boxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epider­mal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis re­mains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.

  20. Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

    DEFF Research Database (Denmark)

    Kuntsche, Judith; Herre, Angela; Fahr, Alfred

    2013-01-01

    barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

  1. Differentiation and injury-repair signals modulate the interaction of E2F and pRB proteins with novel target genes in keratinocytes.

    Science.gov (United States)

    Chang, Wing Y; Andrews, Joseph; Carter, David E; Dagnino, Lina

    2006-08-01

    E2F transcription factors are central to epidermal morphogenesis and regeneration after injury. The precise nature of E2F target genes involved in epidermal formation and repair has yet to be determined. Identification of these genes is essential to understand how E2F proteins regulate fundamental aspects of epidermal homeostasis and transformation. We have conducted a genome-wide screen using CpG island microarray analysis to identify novel promoters bound by E2F3 and E2F5 in human keratinocytes. We further characterized several of these genes, and determined that multiple E2F and retinoblastoma (pRb) family proteins associate with them in exponentially proliferating cells. We also assessed the effect on E2F and pRb binding to those genes in response to differentiation induced by bone morphogenetic protein-6 (BMP-6), or to activation of repair mechanisms induced by transforming growth factor-beta (TGF-beta). These studies demonstrate promoter- and cytokine-specific changes in binding profiles of E2F and/or pRb family proteins. For example, E2F1, 3, 4 and p107 were recruited to the N-myc promoter in cells treated with BMP-6, whereas E2F1, 3, 4, 5, p107 and p130 were bound to this promoter in the presence of TGF-beta. Functionally, these different interactions resulted in transcriptional repression by BMP-6 and TGF-beta of the N-myc gene, via mechanisms that involved E2F binding to the promoter and association with pRb-family proteins. Thus, multiple combinations of E2F and pRb family proteins may associate with and transcriptionally regulate a given target promoter in response to differentiation and injury-repair stimuli in epidermal keratinocytes.

  2. Platelet-rich plasma with keratinocytes and fibroblasts enhance healing of full-thickness wounds.

    Science.gov (United States)

    Law, Jia Xian; Chowdhury, Shiplu Roy; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

    2017-08-01

    Advances in tissue engineering led to the development of various tissue-engineered skin substitutes (TESS) for the treatment of skin injuries. The majority of the autologous TESS required lengthy and costly cell expansion process to fabricate. In this study, we determine the possibility of using a low density of human skin cells suspended in platelet-rich plasma (PRP)-enriched medium to promote the healing of full-thickness skin wounds. To achieve this, full-thickness wounds of size 1.767 cm 2 were created at the dorsum part of nude mice and treated with keratinocytes (2 × 10 4  cells/cm 2 ) and fibroblasts (3 × 10 4  cells/cm 2 ) suspended in 10% PRP-enriched medium. Wound examination was conducted weekly and the animals were euthanized after 2 weeks. Gross examination showed that re-epithelialization was fastest in the PRP+cells group at both day 7 and 14, followed by the PRP group and NT group receiving no treatment. Only the PRP+cells group achieved complete wound closure by 2 weeks. Epidermal layer was presence in the central region of the wound of the PRP+cells and PRP groups but absence in the NT group. Comparison between the PRP+cells and PRP groups showed that the PRP+cells-treated wound was more mature as indicated by the presence of thinner epidermis with single cell layer thick basal keratinocytes and less cellular dermis. In summary, the combination of low cell density and diluted PRP creates a synergistic effect which expedites the healing of full-thickness wounds. This combination has the potential to be developed as a rapid wound therapy via the direct application of freshly harvested skin cells in diluted PRP. Copyright © 2017 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  3. Evaluation of gene expression profile of keratinocytes in response to JP-8 jet fuel

    International Nuclear Information System (INIS)

    Espinoza, Luis A.; Li Peijun; Lee, Richard Y.; Wang Yue; Boulares, A. Hamid; Clarke, Robert; Smulson, Mark E.

    2004-01-01

    The skin is the principal barrier against any environmental insult. Therefore, there is a high risk for a large number of military and civilian personnel exposed to jet fuel JP-8 to suffer percutaneous absorption of this fuel. This paper reports the use of cDNA microarray to identify the gene expression profile in normal human epidermal keratinocytes exposed to JP-8 for 24-h and 7-day periods. The effects of JP-8 exposure on keratinocytes at these two different periods induced a set of genes with altered expression in response to this type of insult. Microarray data were visualized using a novel algorithm based on simple statistical analyses to reduce data dimensionality and identify subsets of discriminant genes. Predictive neural networks were built using a multiplayer perceptron to carry out a proper classification task in microarray data in the untreated versus JP-8-treated samples. The pattern of expressions in response to JP-8 provides evidences that detoxificant-related and cell growth regulator genes with the most variability in the level of expression may be useful genetic markers in adverse health effects of personnel exposed to JP-8. The approaches in our analysis provide a simple, safe, novel, and effective method that is reliable in identifying and analyzing gene expression in samples treated with JP-8 or over potential toxic agents. Gene expression data from these studies can be used to build accurate predictive models that separate different molecular profiles. The data establish the use and effectiveness of these approaches for future prospective studies

  4. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  5. Serial cultivation of human scalp hair follicle keratinocytes.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Vermorken, A J; Bloemendal, H

    1983-01-01

    A method is described for the serial cultivation of adult human hair follicle keratinocytes. Plucked scalp hair follicles, placed on bovine eye lens capsules as a growth substrate, give rise to quickly expanding colonies within a few days. After trypsinization, the cells are replated with irradiated 3T3 cells as 'feeders'. Using this combination of techniques the keratinocytes can be subcultured up to four times. In this way about 10(7) keratinocytes can be generated from one single hair follicle. Moreover, the technique enables cryogenic storage of the cells, allowing for instance, convenient transportation. Subcultured hair follicle keratinocytes can be plated on glass coverslips. This allows immunofluorescence studies. The keratin cytoskeletons visualized using an antiserum against human keratin.

  6. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  7. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H+-dependent mitochondrial pathway

    International Nuclear Information System (INIS)

    Pelin, Marco; Ponti, Cristina; Sosa, Silvio; Gibellini, Davide; Florio, Chiara; Tubaro, Aurelia

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na + influx due to the transformation of Na + /K + ATPase in a cationic channel. Recently, we have demonstrated that Na + overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na + intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O 2 − production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na + -mediated H + -imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O 2 − production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O 2 − production induced by PLTX-mediated ionic imbalance. Indeed, the H + intracellular overload that follows PLTX-induced intracellular Na + accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O 2 − production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O 2 − ) production by reversing mitochondrial transport chain. ► The mechanism of O 2 − production is dependent on PLTX-induced ionic imbalance. ► The results led to the

  8. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  9. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Itoi, Saori; Terao, Mika, E-mail: mterao@derma.med.osaka-u.ac.jp; Murota, Hiroyuki; Katayama, Ichiro

    2013-10-18

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10{sup −13} M cortisol, whereas 1 × 10{sup −5} M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol

  11. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    International Nuclear Information System (INIS)

    Itoi, Saori; Terao, Mika; Murota, Hiroyuki; Katayama, Ichiro

    2013-01-01

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10 −13 M cortisol, whereas 1 × 10 −5 M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol concentrations

  12. Osteo-/odontogenic differentiation of induced mesenchymal stem cells generated through epithelial-mesenchyme transition of cultured human keratinocytes.

    Science.gov (United States)

    Yi, Jin-Kyu; Mehrazarin, Shebli; Oh, Ju-Eun; Bhalla, Anu; Oo, Jenessa; Chen, Wei; Lee, Min; Kim, Reuben H; Shin, Ki-Hyuk; Park, No-Hee; Kang, Mo K

    2014-11-01

    Revascularization of necrotic pulp has been successful in the resolution of periradicular inflammation; yet, several case studies suggest the need for cell-based therapies using mesenchymal stem cells (MSCs) as an alternative for de novo pulp regeneration. Because the availability of MSCs may be limited, especially in an aged population, the current study reports an alternative approach in generating MSCs from epidermal keratinocytes through a process called epithelial-mesenchymal transition (EMT). We induced EMT in primary normal human epidermal keratinocytes (NHEKs) by transient transfection of small interfering RNA targeting the p63 gene. The resulting cells were assayed for their mesenchymal marker expression, proliferation capacities as a monolayer and in a 3-dimensional collagen scaffold, and differentiation capacities. Transient transfection of p63 small-interfering RNA successfully abolished the expression of endogenous p63 in NHEKs and induced the expression of mesenchymal markers (eg, vimentin and fibronectin), whereas epithelial markers (eg, E-cadherin and involucrin) were lost. The NHEKs exhibiting the EMT phenotype acquired extended replicative potential and an increased telomere length compared with the control cells. Similar to the established MSCs, the NHEKs with p63 knockdown showed attachment onto the 3-dimensional collagen scaffold and underwent progressive proliferation and differentiation. Upon differentiation, these EMT cells expressed alkaline phosphatase activity, osteocalcin, and osteonectin and readily formed mineralized nodules detected by alizarin S red staining, showing osteo-/odontogenic differentiation. The induction of EMT in primary NHEKs by means of transient p63 knockdown allows the generation of induced MSCs from autologous sources. These cells may be used for tissues engineering purposes, including that of dental pulp. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  13. Noncultured keratinocyte/melanocyte cosuspension: effect on reepithelialization and repigmentation--a randomized, placebo-controlled study.

    Science.gov (United States)

    Back, Christopher; Dearman, Bronwyn; Li, Amy; Neild, Tim; Greenwood, John E

    2009-01-01

    Randomized controlled trials in the literature investigating the efficacy of noncultured keratinocyte/melanocyte suspensions are scarce; however, the advocates of such techniques press the value of their application based largely on case studies and anecdote. Caucasian patients with burn hypopigmentation seldom request cosmetic revision making worthwhile clinical trials difficult so that informal case treatments with new therapies generate anecdotal results. A randomized, placebo-controlled trial was carried out to evaluate whether cosuspensions of noncultured skin cells are capable of (1) decreasing the time to reepithelialization and (2) reestablishing pigmentation in vitiligo leukoderma following epidermal/superficial dermal ablation (in the knowledge that a positive result would make the technique likely to be successful in burn hypopigmentation). Vitiligo is common and is socially more debilitating such that suitable trial subjects for new therapies from this pool are more forthcoming. This study demonstrated that suspensions of noncultured keratinocytes and melanocytes do not decrease the time to epithelialization of superficial partial thickness wounds compared with controls. It also suggested that the achievement, quality, and duration of any pigmentation were unpredictable and largely disappointing. Some pigmentation was recorded in placebo-treated areas indicating an effect of the method of epidermal ablation in these patients. These findings have mandated a complete review of the use of these techniques in burn care at the Royal Adelaide Hospital; they have been omitted from surgical protocols where the aim of use was to speed reepithelialization. Their infrequent use in burns hypopigmentation will continue contingent on the successful repigmentation of a test patch.

  14. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed

  15. Response of Primary Human Bone Marrow Mesenchymal Stromal Cells and Dermal Keratinocytes to Thermal Printer Materials In Vitro.

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Gridelli, Bruno; Gerlach, Jörg C

    Advancement in thermal three-dimensional printing techniques has greatly increased the possible applications of various materials in medical applications and tissue engineering. Yet, potential toxic effects on primary human cells have been rarely investigated. Therefore, we compared four materials commonly used in thermal printing for bioengineering, namely thermally printed acrylonitrile butadiene styrene, MED610, polycarbonate, and polylactic acid, and investigated their effects on primary human adult skin epidermal keratinocytes and bone marrow mesenchymal stromal cells (BM-MSCs) in vitro. We investigated indirect effects on both cell types caused by potential liberation of soluble substances from the materials, and also analyzed BM-MSCs in direct contact with the materials. We found that even in culture without direct contact with the materials, the culture with MED610 (and to a lesser extent acrylonitrile butadiene styrene) significantly affected keratinocytes, reducing cell numbers and proliferation marker Ki67 expression, and increasing glucose consumption, lactate secretion, and expression of differentiation-associated genes. BM-MSCs had decreased metabolic activity, and exhibited increased cell death in direct culture on the materials. MED610 and acrylonitrile butadiene styrene induced the strongest expression of genes associated to differentiation and estrogen receptor activation. In conclusion, we found strong cell-type-specific effects of the materials, suggesting that materials for applications in regenerative medicine should be carefully selected not only based on their mechanical properties but also based on their cell-type-specific biological effects.

  16. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  17. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  18. Tumor necrosis factor alpha inhibitors in the treatment of toxic epidermal necrolysis.

    Science.gov (United States)

    Woolridge, Katelyn F; Boler, Patrick L; Lee, Brian D

    2018-01-01

    Toxic epidermal necrolysis (TEN) is a rare, life-threatening adverse drug reaction for which there is no standardized or consistently effective treatment. Due to a greater understanding of disease pathogenesis and the identification of tumor necrosis factor (TNF) α as a mediator of keratinocyte death, TNF-α antagonists have been used in the treatment of TEN. Specifically, infliximab and etanercept have been shown to be effective at halting disease progression. The objective of this study is to review published case reports and case series using anti-TNF-α medications in the treatment of TEN. Results of many of the articles reviewed support the use of TNF-α inhibitors in TEN in both adult and pediatric populations; however, the risks caused by these potent immunosuppressants must be weighed, and if administered, patients must be closely monitored for infections. Additional studies are needed to further characterize the role of TNF-α inhibition in the treatment of TEN.

  19. Delayed Hepatic Adaptation to Weaning in ACBP(-/-) Mice Is Caused by Disruption of the Epidermal Barrier

    DEFF Research Database (Denmark)

    Neess, Ditte; Bek, Signe; Bloksgaard, Maria

    2013-01-01

    in the skin rather than in the liver. Similarly to ACBP(-/-) mice, K14-ACBP(-/-) mice exhibit an increased transepidermal water loss, and we show that the hepatic phenotype is caused specifically by the epidermal barrier defect, which leads to increased lipolysis in white adipose tissue. Our data demonstrate......We previously reported that mice deficient in acyl-CoA-binding protein (ACBP) display a delayed metabolic adaptation to weaning. This includes a delayed activation of the hepatic lipogenic gene program, which may result from hepatic accumulation of triacylglycerol and/or cholesteryl esters...... in the late suckling period. To further investigate the basis for this phenotype, we generated mice deficient in ACBP in hepatocytes (Alb-ACBP(-/-)) and keratinocytes (K14-ACBP(-/-)). Surprisingly, the delayed adaptation to weaning, including hepatic lipid accumulation, is caused by ACBP deficiency...

  20. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  1. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  2. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  3. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  4. Piperine attenuates UV-R induced cell damage in human keratinocytes via NF-kB, Bax/Bcl-2 pathway: An application for photoprotection.

    Science.gov (United States)

    Verma, Ankit; Kushwaha, Hari N; Srivastava, Ajeet K; Srivastava, Saumya; Jamal, Naseem; Srivastava, Kriti; Ray, Ratan Singh

    2017-07-01

    Chronic ultraviolet radiation (UV-R) exposure causes skin disorders like erythema, edema, hyperpigmentation, photoaging and photocarcinogenesis. Recent research trends of researchers have focused more attention on the identification and use of photo stable natural agents with photoprotective properties. Piperine (PIP), as a plant alkaloid, is an important constituent present in black pepper (Piper nigrum), used widely in ayurvedic and other traditional medicines and has broad pharmacological properties. The study was planned to photoprotective efficacy of PIP in human keratinocyte (HaCaT) cell line. We have assessed the UV-R induced activation of transcription factor NF-κB in coordination with cell death modulators (Bax/Bcl-2 and p21). The LC-MS/MS analysis revealed that PIP was photostable under UV-A/UV-B exposure. PIP (10μg/ml) attenuates the UV-R (A and B) induced phototoxicity of keratinocyte cell line through the restoration of cell viability, inhibition of ROS, and malondialdehyde generation. Further, PIP inhibited UV-R mediated DNA damage, prevented micronuclei formation, and reduced sub-G1 phase in cell cycle, which supported against photogenotoxicity. This study revealed that PIP pretreatment strongly suppressed UV-R induced photodamages. Molecular docking studies suggest that PIP binds at the active site of NF-κB, and thus, preventing its translocation to nucleus. In addition, transcriptional and translational analysis advocate the increased expression of NF-κB and concomitant decrease in IkB-α expression under UV-R exposed cells, favouring the apoptosis via Bax/Bcl-2 and p21 pathways. However, PIP induced expression of IkB-α suppress the NF-κB activity which resulted in suppression of apoptotic marker genes and proteins that involved in photoprotection. Therefore, we suggest the applicability of photostable PIP as photoprotective agent for human use. Copyright © 2017. Published by Elsevier B.V.

  5. IGF-IR internalizes with Caveolin-1 and PTRF/Cavin in HaCat cells.

    Directory of Open Access Journals (Sweden)

    Barbara Salani

    Full Text Available BACKGROUND: Insulin-like growth factor-I receptor (IGF-IR is a tyrosine kinase receptor (RTK associated with caveolae, invaginations of the plasma membrane that regulate vesicular transport, endocytosis and intracellular signaling. IGF-IR internalization represents a key mechanism of down-modulation of receptors number on plasma membrane. IGF-IR interacts directly with Caveolin-1 (Cav-1, the most relevant protein of caveolae. Recently it has been demonstrated that the Polymerase I and Transcript Release Factor I (PTRF/Cavin is required for caveolae biogenesis and function. The role of Cav-1 and PTRF/Cavin in IGF-IR internalization is still to be clarified. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the interaction of IGF-IR with Cav-1 and PTRF/Cavin in the presence of IGF1in human Hacat cells. We show that IGF-IR internalization triggers Cav-1 and PTRF/Cavin translocation from plasma membrane to cytosol and increases IGF-IR interaction with these proteins. In fact, Cav-1 and PTRF/Cavin co-immunoprecipitate with IGF-IR during receptor internalization. We found a different time course of co-immunoprecipitation between IGF-IR and Cav-1 compared to IGF-IR and PTRF/Cavin. Cav-1 and PTRF/Cavin silencing by siRNA differently affect surface IGF-IR levels following IGF1 treatment: Cav-1 and PTRF/Cavin silencing significantly affect IGF-IR rate of internalization, while PTRF/Cavin silencing also decreases IGF-IR plasma membrane recovery. Since Cav-1 phosphorylation could have a role in IGF-IR internalization, the mutant Cav-1Y14F lacking Tyr14 was transfected. Cav-1Y14F transfected cells showed a reduced internalization of IGF-IR compared with cells expressing wild type Cav-1. Receptor internalization was not impaired by Clathrin silencing. These findings support a critical role of caveolae in IGF-IR intracellular traveling. CONCLUSIONS/SIGNIFICANCE: These data indicate that Caveolae play a role in IGF-IR internalization. Based on these findings

  6. Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  7. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  8. Cytotoxic Effect of the Genus Sinularia Extracts on Human SCC25 and HaCaT Cells

    International Nuclear Information System (INIS)

    Wang, G.H.; Chou, T.H.; Liang, C.H.; Lin, R.J.; Sheu, J.H.; Wang, S.H.

    2009-01-01

    Soft corals of the genus Sinularia are being increasingly adopted to treat a wide variety of disease processes. However, the mechanism underlying its activity against human oral cancer cells is poorly understood. This study evaluates the cyototoxicity effects of the genus Sinularia extracts (S. grandilobata, S. parva, S. triangula, S. scabra, S. nanolobata and S. gibberosa) by SCC25 and HaCaT cells. The cell adhesion assay indicates that extracts reduce the cell attachment. Extracts exhibit a dose-dependent cytotoxic effect using MTS assay.Treatment of extracts to observe the morphological alterations in cells, membrane blebbing, nuclear condensation, and apoptotic bodies is demonstrated. Flow cytometry shows that extracts sensitized the cells in the G0/G1 and G2/M phases with a concomitant significantly increased sub-G1 fraction, suggesting cell death by apoptosis. Extracts of the genus Sinularia thus apparently cause apoptosis of SCC25 and HaCaT cells, and warrant further research investigating the possible antioral cancer compounds in these soft corals.

  9. Correlation of initiating potency of skin carcinogens with potency to induce resistance to terminal differentiation in cultured mouse keratinocytes

    International Nuclear Information System (INIS)

    Kilkenny, A.E.; Morgan, D.; Spangler, E.F.; Yuspa, S.H.

    1985-01-01

    The induction by chemical carcinogens of resistance to terminal differentiation in cultured mouse keratinocytes has been proposed to represent a cellular change associated with the initiation phase of skin carcinogenesis. Previous results with this culture model indicated that the number of differentiation-resistant foci was correlated with the dose and known potency for several chemical carcinogens. Assay conditions were optimized to provide quantitative results for screening a variety of carcinogens for their potency as inducers of foci resistant to terminal differentiation. Eight skin initiators of varying potency and from different chemical classes and ultraviolet light were studied for their activity to induce this alteration in cultured epidermal cells from newborn BALB/c mice. There was an excellent positive correlation for the potency of these agents as initiators in vivo and as inducers of altered differentiation in vitro. The induction of resistant foci was independent of the relative cytotoxic effects of each agent except where cytotoxicity was extensive and reduced the number of foci. The results support the hypothesis that initiation of carcinogenesis in skin results in an alteration in the program of epidermal cell differentiation. The results also suggest that the assay is useful for identifying relative potency classes (strong, moderate, weak) of initiating agents

  10. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation

    International Nuclear Information System (INIS)

    Cario-Andre, M.

    2000-11-01

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  11. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  12. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  13. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  14. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Greinert, R.; Breibart, E.W.; Mitchell, D.; Smida, J.; Volkmer, B

    2000-07-01

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  15. The incidence and multiplicity rates of keratinocyte cancers in Australia.

    Science.gov (United States)

    Pandeya, Nirmala; Olsen, Catherine M; Whiteman, David C

    2017-10-16

    To assess the incidence and multiplicity of keratinocyte cancers (basal cell carcinoma [BCC] and squamous cell carcinoma [SCC]) excised in Australia, and to examine variations by age, sex, state, and prior skin cancer history. Analysis of individual-level Medicare data for keratinocyte cancer treatments (identified by eight specific MBS item codes) during 2011-2014. Histological data from the QSkin prospective cohort study were analysed to estimate BCC and SCC incidence. A 10% systematic random sample of all people registered with Medicare during 1997-2014. People aged at least 20 years in 2011 who made at least one claim for any MBS medical service during 2011-2014 (1 704 193 individuals). Age-standardised incidence rates (ASRs) and standardised incidence ratios (SIRs). The person-based incidence of keratinocyte cancer excisions in Australia was 1531 per 100 000 person-years; incidence increased with age, and was higher for men than women (SIR, 1.43; 95% CI, 1.42-1.45). Lesion-based incidence was 3154 per 100 000 person-years. The estimated ASRs for BCC and SCC were 770 per 100 000 and 270 per 100 000 person-years respectively. During 2011-2014, 3.9% of Australians had one keratinocyte cancer excised, 2.7% had more than one excised; 74% of skin cancers were excised from patients who had two or more lesions removed. Multiplicity was strongly correlated with age; most male patients over 70 were treated for multiple lesions. Keratinocyte cancer incidence was eight times as high among people with a prior history of excisions as among those without. The incidence and multiplicity of keratinocyte cancer in Australia are very high, causing a large disease burden that has not previously been quantified.

  16. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  17. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  18. Aldefluor protocol to sort keratinocytes stem cells from skin

    OpenAIRE

    Noronha, Samuel Marcos Ribeiro; Gragnani, Alfredo; Pereira, Thiago Antônio Calado; Correa, Silvana Aparecida Alves; Bonucci, Jessica; Ferreira, Lydia Masako

    2017-01-01

    Abstract Purpose: To investigate the use Aldefluor® and N, N - Dimethylaminobenzaldehyde (DEAB) to design a protocol to sort keratinocyte stem cells from cultured keratinocytes from burned patients. Methods: Activated Aldefluor® aliquots were prepared and maintained at temperature between 2 to 8°C, or stored at -20°C. Next, the cells were collected following the standard protocol of sample preparation. Results: Best results were obtained with Aldefluor® 1.5µl and DEAB 15 µl for 1 x 106 c...

  19. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  20. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  1. In vitro dermal and epidermal cellular response to titanium alloy implants fabricated with electron beam melting.

    Science.gov (United States)

    Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H

    2014-10-01

    Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  2. Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis

    International Nuclear Information System (INIS)

    Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.

    1986-01-01

    Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers

  3. Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure.

    Science.gov (United States)

    Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

    2017-10-23

    The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.

  4. Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

    Science.gov (United States)

    Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

    2010-07-20

    The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.

  5. Cultivating technique for human keratinocyte under laboratory condition%实验室条件下人角质形成细胞的培养技术

    Institute of Scientific and Technical Information of China (English)

    卢宁; 朱平; 刘玉峰; 王刚; 张海龙; 赵小东

    2006-01-01

    Two step digestion technique was used for the isolation of epidermal cells: Firstly the skin flap was digested with dispase of mass concentration of 2.5 g/L at 4 ℃ for overnight, followed by separating epidermis the next day; Secondly it was dipped in trypsin and EDTA mixture for subsequent digestion. ② Improved serum-free cultivating technology was applied to the culture of human keratinocytes. The culture medium is composed of human keratinocyte serum free culture medium +2.5 mg/L bovine pituitary lixivium +5 μg/L epidermal growth factor+438 mg/L glutamine, glutamine can promote the growth of the keratinocyte. ③Human keratinocyte in exponential phase were cryopreserved and rewarmed, then made into cell suspension with additional serum free medium, cells were incubated in culture bottle of 75 cm2 by density of 5×105/mL for subculture. Cell morphological changes were observed under microscope and transmission electron microscope.MAIN OUTCOME MEASURES: ① The growth of primary cells and passage cells. ② The cryopreservation and resuscitation of human keratinocyte from different passages. ③ Morphological observation of Keratinocytes RESULTS: ①The growing state of the primary cells and passage cells:cells suspended primarily and gradually adhered to bottom of the culture dish at about 6-24 hours, most of cells were round and gradually stretched to ellipse shape, at about day 3, some keratinocyte clones and clusters can be observed with satellite-like proliferating epidermal cells scattered around, most of them were polygon and cell homogeneity and transparency became strengthened. Cell fusion amount to 70% at around 5 days, reaching to 90% at day 9 and even completely fused into cell diaphragm at day 1 1. Keratinocyte cultured in vitro can survive 2-3 months without obvious changes in cell morphology and growth speed. ② The cryopreservation and resuscitation of human keratinocyte in different passages: Different passage keratinocytes were separately

  6. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  7. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  8. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  9. Dihydrotestosterone induces SREBP-1 expression and lipogenesis through the phosphoinositide 3-kinase/Akt pathway in HaCaT cells

    Directory of Open Access Journals (Sweden)

    Zhou Bing-rong

    2012-11-01

    Full Text Available Abstract Background The purpose of this study was to investigate the effects and mechanisms of dihydrotestosterone (DHT-induced expression of sterol regulatory element binding protein-1 (SREBP-1, and the synthesis and secretion of lipids, in HaCaT cells. HaCaT cells were treated with DHT and either the phosphoinositide 3-kinase inhibitor LY294002 or the extracellular-signal-regulated kinase (ERK inhibitor PD98059. Real time-PCR, Western blot, Oil Red staining and flow cytometry were employed to examine the mRNA and protein expressions of SREBP-1, the gene transcription of lipid synthesis, and lipid secretion in HaCaT cells. Findings We found that DHT upregulated mRNA and protein expressions of SREBP-1. DHT also significantly upregulated the transcription of lipid synthesis-related genes and increased lipid secretion, which can be inhibited by the addition of LY294002. Conclusions Collectively, these results indicate that DHT induces SREBP-1 expression and lipogenesis in HaCaT cells via activation of the phosphoinositide 3-kinase/Akt Pathway.

  10. Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN): could retinoids play a causative role?

    Science.gov (United States)

    Mawson, Anthony R; Eriator, Ike; Karre, Sridhar

    2015-01-12

    Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.

  11. Alterations of epidermal proliferation and cytokeratin expression in skin biopsies from heavy draught horses with chronic pastern dermatitis.

    Science.gov (United States)

    Geburek, Florian; Ohnesorge, Bernhard; Deegen, Eckehard; Doeleke, Renate; Hewicker-Trautwein, Marion

    2005-12-01

    We report the historical, clinical and histopathological characteristics of skin lesions in biopsies from 37 heavy draught horses with chronic pastern dermatitis. The skin lesions were divided into four macroscopic groups: scaling (group I, n=5), hyperkeratotic and hyperplastic plaque-like lesions (group II, n=14), nodular skin masses (group III, n=16) and verrucous skin lesions (group IV, n=2). The principal histological findings were hyperkeratosis and epidermal hyperplasia. There was a gradual increase in epidermal hyperplasia from groups I to IV, suggesting that the lesions represent different stages of disease. In all cases, there was perivascular dermatitis dominated by T lymphocytes with an increase in MHC class II-positive dendritic-like cells. Immunohistochemical labelling for cytokeratins CK5/6(4), CK10 and CK14 indicated a change in their expression pattern. This correlated with the degree of epidermal hyperplasia, indicating abnormal differentiation of keratinocytes. There was a statistically significant correlation between the severity of skin lesions and several other factors including increasing age, increasing cannon circumference, prominence of anatomical structures such as fetlock tufts of hairs, ergots and chestnuts, and bulges in the fetlock region.

  12. FOXO1 expression in keratinocytes promotes connective tissue healing

    Science.gov (United States)

    Zhang, Chenying; Lim, Jason; Liu, Jian; Ponugoti, Bhaskar; Alsadun, Sarah; Tian, Chen; Vafa, Rameen; Graves, Dana T.

    2017-01-01

    Wound healing is complex and highly orchestrated. It is well appreciated that leukocytes, particularly macrophages, are essential for inducing the formation of new connective tissue, which requires the generation of signals that stimulate mesenchymal stem cells (MSC), myofibroblasts and fibroblasts. A key role for keratinocytes in this complex process has yet to be established. To this end, we investigated possible involvement of keratinocytes in connective tissue healing. By lineage-specific deletion of the forkhead box-O 1 (FOXO1) transcription factor, we demonstrate for the first time that keratinocytes regulate proliferation of fibroblasts and MSCs, formation of myofibroblasts and production of collagen matrix in wound healing. This stimulation is mediated by a FOXO1 induced TGFβ1/CTGF axis. The results provide direct evidence that epithelial cells play a key role in stimulating connective tissue healing through a FOXO1-dependent mechanism. Thus, FOXO1 and keratinocytes may be an important therapeutic target where healing is deficient or compromised by a fibrotic outcome. PMID:28220813

  13. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  14. Hyaluronan minimizes effects of UV irradiation on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Hašová, M.; Crhák, Tomáš; Šafaříková, Barbora; Dvořáková, J.; Muthný, T.; Velebný, V.; Kubala, Lukáš

    2011-01-01

    Roč. 303, č. 4 (2011), s. 277-284 ISSN 0340-3696 R&D Projects: GA ČR(CZ) GA305/08/1704 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : hyaluronan * keratinocyte * ultraviolet light Subject RIV: BO - Biophysics Impact factor: 2.279, year: 2011

  15. Exploratory Study on the Stability Characteristics of Commercial Human Keratinocytes

    Science.gov (United States)

    1990-04-01

    Invest. Dermatol. 75:176- 182; 1980. 16. Hayflick , L. The limited in vitro lifetime of huiran diploid strains. Exp. Cell Res. 37:614-636; 1965. 17...culture keratinocytes were considered by some investigators to have limited proliferative potential, so they used third and fourth passage commercial

  16. Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

    Science.gov (United States)

    Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

    2013-12-01

    The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  18. No evidence for induction of key components of the Notch signaling pathway (Notch-1, Jagged-1) by treatment with UV-B, 1,25(OH)(2)D(3), and/or epigenetic drugs (TSA, 5-Aza) in human keratinocytes in vitro.

    Science.gov (United States)

    Reichrath, Sandra; Reichrath, Jörg

    2012-01-01

    Notch signaling is of high importance for growth and survival of various cell types. We now analyzed the protein expression of two key components of the Notch signaling pathway (Notch-1, Jagged-1) in spontaneously immortalized (HaCaT) and in malignant (SCL-1) human keratinocytes, using western analysis. We found that Notch-1 and its corresponding ligand Jagged-1 are expressed in both cell lines, with no marked change following UV-B treatment. Moreover, treatment of both cell lines before or after UV-B irradiation with 1,25-dihydroxyvitamin D(3), the biologically active form of vitamin D, and/or epigenetic modulating drugs (TSA; 5-Aza) did not result in a marked modulation of the protein expression of Notch-1 or Jagged-1. Under the experimental conditions of this study, treatment with 1,25(OH)(2)D(3) protected human keratinocytes in part against the antiproliferative effects of UV-B-radiation. In conclusion, our findings do not point at a differential expression of these two key components of Notch signaling in non-malignant as compared to malignant human keratinocytes, indicating that alterations in their expression are not of importance for the photocarcinogenesis of human squamous cell carcinomas. Moreover, our findings do not support the hypothesis that modulation of Notch signaling may be involved in the photoprotective effect of 1,25-dihydroxyvitamin D(3), that we and others reported previously. Additionally, we demonstrate that epigenetic modulating drugs (TSA, 5-Aza) do not markedly modulate the expression Notch-1 or Jagged-1 in UV-B-treated human keratinocytes in vitro.

  19. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    Phenylketonuria (PKU) is caused by deficiency of phenylalanine hydroxylase (PAH) and increased levels of phenylalanine. PAH requires the cofactor BH(4) to function and the rate-limiting step in the synthesis of BH(4) is GTP cyclohydrolase I (GTP-CH). The skin is a potential target tissue for PKU...

  20. Re-appraisal of keratinocytes' role in vitiligo pathogenesis

    Directory of Open Access Journals (Sweden)

    Ola Ahmed Bakry

    2018-01-01

    Full Text Available Background: Vitiligo is a common pigmentary disorder. Studies on its pathogenesis extensively investigated melanocytes' abnormalities and few studies searched for keratinocytes' role in disease development. Liver X receptor-α (LXR-α is a member of nuclear hormone receptors that acts as a transcription factor. Its target genes are the main regulators of melanocyte functions. Aim: The aim of this study is to investigate keratinocytes' role in vitiligo pathogenesis through immunohistochemical expression of LXR-α in lesional, perilesional, and distant nonlesional vitiligo skin. Materials and Methods: This case–control study was carried out on 44 participants. These included 24 patients with vitiligo and 20 age- and sex-matched normal individuals as a control group. Biopsies, from cases, were taken from lesional, perilesional, and distant nonlesional areas. Evaluation was done using immunohistochemical technique. Results: Keratinocyte LXR-α expression was upregulated in the lesional and perilesional skin (follicular and interfollicular epidermis compared with control skin (P<0.001 for all. There was significant association between higher histoscore (H-score in lesional epidermis (P<0.001 and in hair follicle (P=0.001 and the presence of angiogenesis. There was significant association between higher H-score in lesional epidermis and suprabasal vacuolization (P=0.02. No significant association was found between H-score or expression percentage and clinical data of selected cases. Conclusion: LXR-α upregulation is associated with keratinocyte damage in vitiligo lesional skin that leads to decreased keratinocyte-derived mediators and growth factors supporting the growth and/or melanization of surrounding melanocytes. Therefore, melanocyte function and survival are affected.