WorldWideScience

Sample records for epidermal keratinocytes cultured

  1. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  2. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the present......-hydroxyacid-phytosphingosine ceramides (NP) were absent. Also some alterations in fatty acid profiles of ROC ceramides were noted, e.g., esterified omega-hydroxyacid-sphingosine contained increased levels of oleic acid instead of linoleic acid. The fraction of lipids covalently bound to corneocyte proteins was distinctly lower in ROC...

  3. Assessment of Transformed Properties In Vitro and of Tumorigenicity In Vivo in Primary Keratinocytes Cultured for Epidermal Sheet Transplantation

    Directory of Open Access Journals (Sweden)

    A. Thépot

    2011-01-01

    Full Text Available Epidermal keratinocytes are used as a cell source for autologous and allogenic cell transplant therapy for skin burns. The question addressed here is to determine whether the culture process may induce cellular, molecular, or genetic alterations that might increase the risk of cellular transformation. Keratinocytes from four different human donors were investigated for molecular and cellular parameters indicative of transformation status, including (i karyotype, (ii telomere length, (iii proliferation rate, (iv epithelial-mesenchymal transition, (v anchorage-independent growth potential, and (vi tumorigenicity in nude mice. Results show that, despite increased cell survival in one keratinocyte strain, none of the cultures displayed characteristics of cell transformations, implying that the culture protocol does not generate artefacts leading to the selection of transformed cells. We conclude that the current protocol does not result in an increased risk of tumorigenicity of transplanted cells.

  4. Effects of epidermal growth factor, platelet derived growth factor and growth hormone on cultured rat keratinocytes cells in vitro.

    Science.gov (United States)

    Safari, Manouchehr; Ghahari, Laya; Zoroufchi, M D Babak Hossein Zadeh

    2014-07-01

    Some growth factors, such as Epidermal Growth Factor (EGF), Growth Hormone (GH) and Platelet Derived Growth Factor (PDGF) have beneficial effects on keratinocyte proliferation and wound healing. Although the mechanism of these factors is unclear. In response to injury, growth factors are secreted by kinds of cutaneous cells. The goal of this project is to investigate the factors that could cause proliferate of the keratinocyte cells in vitro. The keratinocytes were removed from rat pups (10 days). Cultured in media with different concentration of GH, PDGF and EGF separately. The proliferation of cells was evaluated by the method of MTT and 3H-thymidine incorporation. Proliferation of keratinocytes was significantly higher in experimental groups than in control group. EGF maximally stimulated at 10 and 25 ng mL(-1). PDGF-BB maximally stimulated at 50 ng mL(-1), respectively. And maximal stimulation of GH was 2.5 IU L(-1). GH, PDGF-BB and EGF stimulate keratinocyte cells proliferation in different concentration. These growth factors could play in healing of the skin.

  5. The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin.

    Science.gov (United States)

    Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M

    1999-09-27

    Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost

  6. Rosmarinic acid inhibits poly(I:C)-induced inflammatory reaction of epidermal keratinocytes.

    Science.gov (United States)

    Zhou, Ming-Wei; Jiang, Ri-Hua; Kim, Ki-Duck; Lee, Jin-Hyup; Kim, Chang-Deok; Yin, Wei-Tian; Lee, Jeung-Hoon

    2016-06-15

    Keratinocytes are the predominant cells in the epidermis, exerting their primary role of physical barrier through sophisticated differentiation process. In addition, keratinocytes contribute to the activation of innate immunity, providing the surveillant role against external pathogens. It has been known that chronic skin inflammatory disease such as psoriasis can be provoked by viral pathogens including double-stranded RNA. In this study, we demonstrated that rosmarinic acid (RA) has an inhibitory potential on inflammatory reaction induced by double-stranded RNA mimic poly(I:C) in epidermal keratinocytes. We cultured human epidermal keratinocytes and induced inflammatory reaction by poly(I:C) treatment. The effect of RA on inflammatory reaction of keratinocytes was determined by RT-PCR and Western blot. RA significantly inhibited poly(I:C)-induced expression of inflammatory cytokines including IL-1β, IL-6, IL-8, CCL20, and TNF-α, and downregulated NF-κB signaling pathway in human keratinocytes. In addition, RA significantly inhibited poly(I:C)-induced inflammasome activation, in terms of secretion of active form of IL-1β and caspase-1. Furthermore, RA markedly inhibited poly(I:C)-induced NLRP3 and ASC expression. These results indicate that RA can inhibit poly(I:C)-induced inflammatory reaction of keratinocytes, and suggest that it may be a potential candidate for the treatment of psoriasis. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Optimised retroviral infection of human epidermal keratinocytes: long-term expression of transduced integrin gene following grafting on to SCID mice.

    Science.gov (United States)

    Levy, L; Broad, S; Zhu, A J; Carroll, J M; Khazaal, I; Péault, B; Watt, F M

    1998-07-01

    Previous attempts to achieve long-term gene expression in retrovirally transduced human epidermal keratinocytes in vivo have been largely unsuccessful. This has been variously attributed to a failure to target epidermal stem cells, suboptimal grafting conditions or inactivation of the retroviral vector. In an attempt to overcome these problems we expressed the chick beta 1 integrin subunit in primary human epidermal keratinocytes, which allowed us to monitor retroviral gene expression on a cell-by-cell basis. We describe optimised methods for selecting high-titre amphotropic packaging cells and for infecting keratinocytes in culture. When transduced cells were grafted into mice, graft survival was comparable in nude and SCID mice, but it was essential to combine the keratinocytes with a dermal substrate. Using these methods the majority of keratinocytes expressed the chick beta 1 integrin subunit for at least 16 weeks after grafting. We conclude that epidermal keratinocytes are attractive recipient cells for gene therapy.

  8. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  9. Epidermal anti-Inflammatory properties of 5,11,14 20:3: Effects on mouse ear edema, PGE2 levels in cultured keratinocytes, and PPAR activation

    Directory of Open Access Journals (Sweden)

    Baur Markus

    2002-12-01

    Full Text Available Abstract Background 5,11,14 20:3 is similar to 20:4n-6 but lacks the internal Δ8 double bond essential for prostaglandin and eicosanoid synthesis. When previously fed to laboratory animals as a gymnosperm seed oil component it has shown anti-inflammatory properties. Results Herein, topically applied Podocarpus nagi methyl esters (containing 26% 5,11,14 20:3 were incorporated into mouse ear phospholipids, reduced 20:4n-6, and reduced 20:4n-6- and TPA-induced mouse ear edema. Purified 5,11,14 20:3 was taken up by cultured human skin keratinocytes, reduced 20:4n-6, and reduced PGE2 levels dramatically. Purified 5,11,14 20:3 did not affect PPARα, PPARγ, or PPARδ transactivation. Conclusions Topical application of 5,11,14 20:3 to skin surfaces can thus reduce inflammatory processes, most likely by displacing 20:4n-6 from phospholipid pools and reducing downstream inflammatory products derived from 20:4n-6 such as PGE2 and leukotrienes. It could have potential use in treating clinical skin disorders resulting from overproduction of 20:4n-6-derived eicosanoid products.

  10. Clasp2 ensures mitotic fidelity and prevents differentiation of epidermal keratinocytes

    DEFF Research Database (Denmark)

    Shahbazi, Marta N; Peña-Jimenez, Daniel; Antonucci, Francesca

    2017-01-01

    Epidermal homeostasis is tightly controlled by a balancing act of self-renewal or terminal differentiation of proliferating basal keratinocytes. An increase in DNA content as a consequence of a mitotic block is a recognized mechanism underlying keratinocyte differentiation, but the molecular mech...

  11. Epidermal expression of neuropilin 1 protects murine keratinocytes from UVB-induced apoptosis.

    Directory of Open Access Journals (Sweden)

    Anna Riese

    Full Text Available BACKGROUND: Neuropilin 1 (NRP1 is expressed on several cell types including neurons and endothelial cells, where it functions as an important regulator in development and during angiogenesis. As a cell surface receptor, NRP1 is able to bind to members of the VEGF family of growth factors and to secreted class 3 semaphorins. Neuropilin 1 is also highly expressed in keratinocytes, but the function of NRP1 in epidermal physiology and pathology is still unclear. METHODS AND RESULTS: To elucidate the role of NRP1 in skin in vivo we generated an epidermis-specific neuropilin 1 knock out mouse model by using the Cre-LoxP-System. Mice were viable and fertile and did not display any obvious skin or hair defects. After challenge with UVB irradiation, we found that deletion of epidermal NRP1 leads to increased rates of apoptosis both in vitro and in vivo. NRP1-deficient primary keratinocytes cultured in vitro showed significantly higher rates of apoptosis 24 hours after UVB. Likewise, there is a significant increase of active caspase 3 positive cells in the epidermis of Keratin 14-Cre-NRP1 (-/- mice 24 hours after UVB irradiation. By Western Blot analysis we could show that NRP1 influences the cytosolic levels of Bcl-2, a pro-survival member of the Bcl-2 family. After UVB irradiation the amounts of Bcl-2 decrease in both protein extracts from murine epidermis and in NRP1-deficient keratinocytes in vitro, whereas wild type cells retain their Bcl-2 levels. Likewise, levels of phospho-Erk and Rac1 were lower in NRP1-knock out keratinocytes, whereas levels of pro-apoptotic p53 were higher. CONCLUSION: NRP1 expression in keratinocytes is dispensable for normal skin development. Upon UVB challenge, NRP1 contributes to the prevention of keratinocyte apoptosis. This pro-survival function of NRP1 is accompanied by the maintenance of high levels of the antiapoptotic regulator Bcl-2 and by lower levels of pro-apoptotic p53.

  12. Epidermal keratinocytes initiate wound healing and pro-inflammatory immune responses following percutaneous schistosome infection.

    Science.gov (United States)

    Bourke, Claire D; Prendergast, Catriona T; Sanin, David E; Oulton, Tate E; Hall, Rebecca J; Mountford, Adrian P

    2015-03-01

    Keratinocytes constitute the majority of cells in the skin's epidermis, the first line of defence against percutaneous pathogens. Schistosome larvae (cercariae) actively penetrate the epidermis to establish infection, however the response of keratinocytes to invading cercariae has not been investigated. Here we address the hypothesis that cercariae activate epidermal keratinocytes to promote the development of a pro-inflammatory immune response in the skin. C57BL/6 mice were exposed to Schistosoma mansoni cercariae via each pinna and non-haematopoietic cells isolated from epidermal tissue were characterised for the presence of different keratinocyte sub-sets at 6, 24 and 96 h p.i. We identified an expansion of epidermal keratinocyte precursors (CD45(-), CD326(-), CD34(+)) within 24 h of infection relative to naïve animals. Following infection, cells within the precursor population displayed a more differentiated phenotype (α6integrin(-)) than in uninfected skin. Parallel immunohistochemical analysis of pinnae cryosections showed that this expansion corresponded to an increase in the intensity of CD34 staining, specifically in the basal bulge region of hair follicles of infected mice, and a higher frequency of keratinocyte Ki67(+) nuclei in both the hair follicle and interfollicular epidermis. Expression of pro-inflammatory cytokine and stress-associated keratin 6b genes was also transiently upregulated in the epidermal tissue of infected mice. In vitro exposure of keratinocyte precursors isolated from neonatal mouse skin to excretory/secretory antigens released by penetrating cercariae elicited IL-1α and IL-1β production, supporting a role for keratinocyte precursors in initiating cutaneous inflammatory immune responses. Together, these observations indicate that S.mansoni cercariae and their excretory/secretory products act directly upon epidermal keratinocytes, which respond by initiating barrier repair and pro-inflammatory mechanisms similar to those

  13. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model

    Science.gov (United States)

    Gschwandtner, M; Mildner, M; Mlitz, V; Gruber, F; Eckhart, L; Werfel, T; Gutzmer, R; Elias, P M; Tschachler, E

    2013-01-01

    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated genes and epidermal junction proteins was quantified by real-time PCR, Western blot, and immunofluorescence labeling. The barrier function of human skin models was tested by the application of biotin as tracer molecule. Results The addition of histamine to human keratinocyte cultures and organotypic skin models reduced the expression of the differentiation-associated proteins keratin 1/10, filaggrin, and loricrin by 80–95%. Moreover, the addition of histamine to skin models resulted in the loss of the granular layer and thinning of the epidermis and stratum corneum by 50%. The histamine receptor H1R agonist, 2-pyridylethylamine, suppressed keratinocyte differentiation to the same extent as did histamine. Correspondingly, cetirizine, an antagonist of H1R, virtually abrogated the effect of histamine. The expression of tight junction proteins zona occludens-1, occludin, claudin-1, and claudin-4, as well as that of desmosomal junction proteins corneodesmosin and desmoglein-1, was down-regulated by histamine. The tracer molecule biotin readily penetrated the tight junction barrier of skin cultures grown in the presence of histamine, while their diffusion was completely blocked in nontreated controls. Conclusions Our findings suggest a new mechanism by which mast cell activation and histamine release contribute to skin barrier defects in inflammatory skin diseases. PMID:23157658

  14. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Ge [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Ou, Bai-sheng [Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Kim, Sooil; Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Kim, Seong-Jin [Department of Dermatology, Chonnam National University Medical School, Gwangju, 501-757 (Korea, Republic of); Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Kim, Chang Deok, E-mail: cdkimd@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of)

    2010-11-15

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  15. Epidermal hyperpigmentation in non-syndromic solitary cafe-au-lait macules may be associated with increased secretion of endothelin-1 by lesional keratinocytes.

    Science.gov (United States)

    Okazaki, Mutsumi; Yoshimura, Kotaro; Uchida, Gentaro; Suzuki, Yasutoshi; Kitano, Yukie; Harii, Kiyonori

    2005-01-01

    To clarify the mechanism of accentuated melanisation in non-syndromic solitary cafe-au-lait macules we used an enzyme-linked immunosorbent assay (ELISA) to measure the concentration of melanogenic cytokines secreted by cultured keratinocytes and fibroblasts derived from the skins of the macules and compared them with those derived from normal people. Endothelin-1 (ET-1) was significantly increased in cultured keratinocytes in the macules compared with the normals. In contrast, the secretion of other cytokines secreted by keratinocytes or fibroblasts did not differ between the groups. It may be that the increased secretion of ET-1 by epidermal keratinocytes has a role in the accentuated epidermal melanisation seen in non-syndromic macules.

  16. Automated identification of epidermal keratinocytes in reflectance confocal microscopy

    Science.gov (United States)

    Gareau, Dan

    2011-03-01

    Keratinocytes in skin epidermis, which have bright cytoplasmic contrast and dark nuclear contrast in reflectance confocal microscopy (RCM), were modeled with a simple error function reflectance profile: erf( ). Forty-two example keratinocytes were identified as a training set which characterized the nuclear size a = 8.6+/-2.8 μm and reflectance gradient b = 3.6+/-2.1 μm at the nuclear/cytoplasmic boundary. These mean a and b parameters were used to create a rotationally symmetric erf( ) mask that approximated the mean keratinocyte image. A computer vision algorithm used an erf( ) mask to scan RCM images, identifying the coordinates of keratinocytes. Applying the mask to the confocal data identified the positions of keratinocytes in the epidermis. This simple model may be used to noninvasively evaluate keratinocyte populations as a quantitative morphometric diagnostic in skin cancer detection and evaluation of dermatological cosmetics.

  17. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  18. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  19. ZNF750 is expressed in differentiated keratinocytes and regulates epidermal late differentiation genes.

    Directory of Open Access Journals (Sweden)

    Idan Cohen

    Full Text Available Disrupted skin barrier due to altered keratinocyte differentiation is common in pathologic conditions such as atopic dermatitis, ichthyosis and psoriasis. However, the molecular cascades governing keratinocyte terminal differentiation are poorly understood. We have previously demonstrated that a dominant mutation in ZNF750 leads to a clinical phenotype reminiscent of psoriasis and seborrheic dermatitis. Here we show that ZNF750 is a nuclear protein bearing a functional C-terminal nuclear localization signal. ZNF750 was specifically expressed in the epidermal suprabasal layers and its expression was augmented during differentiation, both in human skin and in-vitro, peaking in the granular layer. Silencing of ZNF750 in Ca2+-induced HaCaT keratinocytes led to morphologically apparent arrest in the progression of late differentiation, as well as diminished apoptosis and sustained proliferation. ZNF750 knockdown cells presented with markedly reduced expression of epidermal late differentiation markers, including gene subsets of epidermal differentiation complex and skin barrier formation such as FLG, LOR, SPINK5, ALOX12B and DSG1, known to be mutated in various human skin diseases. Furthermore, overexpression of ZNF750 in undifferentiated cells induced terminal differentiation genes. Thus, ZNF750 is a regulator of keratinocyte terminal differentiation and with its downstream targets can serve in future elucidation of therapeutics for common diseases of skin barrier.

  20. Distinct epidermal keratinocytes respond to extremely low-frequency electromagnetic fields differently.

    Directory of Open Access Journals (Sweden)

    Chao-Ying Huang

    Full Text Available Following an increase in the use of electric appliances that can generate 50 or 60 Hz electromagnetic fields, concerns have intensified regarding the biological effects of extremely low-frequency electromagnetic fields (ELF-EMFs on human health. Previous epidemiological studies have suggested the carcinogenic potential of environmental exposure to ELF-EMFs, specifically at 50 or 60 Hz. However, the biological mechanism facilitating the effects of ELF-EMFs remains unclear. Cellular studies have yielded inconsistent results regarding the biological effects of ELF-EMFs. The inconsistent results might have been due to diverse cell types. In our previous study, we indicated that 1.5 mT, 60 Hz ELF-EMFs will cause G1 arrest through the activation of the ATM-Chk2-p21 pathway in human keratinocyte HaCaT cells. The aim of the current study was to investigate whether ELF-EMFs cause similar effects in a distinct epidermal keratinocyte, primary normal human epidermal keratinocytes (NHEK, by using the same ELF-EMF exposure system and experimental design. We observed that ELF-EMFs exerted no effects on cell growth, cell proliferation, cell cycle distribution, and the activation of ATM signaling pathway in NHEK cells. We demonstrated that the 2 epidermal keratinocytes responded to ELF-EMFs differently. To further validate this finding, we simultaneously exposed the NHEK and HaCaT cells to ELF-EMFs in the same incubator for 168 h and observed the cell growths. The simultaneous exposure of the two cell types results showed that the NHEK and HaCaT cells exhibited distinct responses to ELF-EMFs. Thus, we confirmed that the biological effects of ELF-EMFs in epidermal keratinocytes are cell type specific. Our findings may partially explain the inconsistent results of previous studies when comparing results across various experimental models.

  1. Beneficial Effects of the Genus Aloe on Wound Healing, Cell Proliferation, and Differentiation of Epidermal Keratinocytes.

    Science.gov (United States)

    Moriyama, Mariko; Moriyama, Hiroyuki; Uda, Junki; Kubo, Hirokazu; Nakajima, Yuka; Goto, Arisa; Akaki, Junji; Yoshida, Ikuyo; Matsuoka, Nobuya; Hayakawa, Takao

    2016-01-01

    Aloe has been used as a folk medicine because it has several important therapeutic properties. These include wound and burn healing, and Aloe is now used in a variety of commercially available topical medications for wound healing and skin care. However, its effects on epidermal keratinocytes remain largely unclear. Our data indicated that both Aloe vera gel (AVG) and Cape aloe extract (CAE) significantly improved wound healing in human primary epidermal keratinocytes (HPEKs) and a human skin equivalent model. In addition, flow cytometry analysis revealed that cell surface expressions of β1-, α6-, β4-integrin, and E-cadherin increased in HPEKs treated with AVG and CAE. These increases may contribute to cell migration and wound healing. Treatment with Aloe also resulted in significant changes in cell-cycle progression and in increases in cell number. Aloe increased gene expression of differentiation markers in HPEKs, suggesting roles for AVG and CAE in the improvement of keratinocyte function. Furthermore, human skin epidermal equivalents developed from HPEKs with medium containing Aloe were thicker than control equivalents, indicating the effectiveness of Aloe on enhancing epidermal development. Based on these results, both AVG and CAE have benefits in wound healing and in treatment of rough skin.

  2. In vitro culture of Keratinocytes from human umbilical cord blood mesenchymal stem cells: the Saigonese culture.

    Science.gov (United States)

    Tran, Cong Toai; Huynh, Duy Thao; Gargiulo, Ciro; Nguyen, Phuong Thao; Tran, Thi Thanh Thuy; Huynh, Minh Tuan; Nguyen, Thanh Tung; Filgueira, Luis; Strong, D Micheal

    2011-05-01

    There have been many attempts to acquire and culture human keratinocytes for clinical purposes including from keratotome slices in media with fetal calf serum (FCS) or pituitary extract (PE), from skin specimens in media with feeder layers, from suction blister epidermal roofs' in serum-free culture and from human umbilical cord blood (hUCB) mesenchymal stem cells (MSCs) in media with skin feeder layers. Conversely this study was designed to investigate whether keratinocytes could be obtained directly from hUCB MSCs in vitro. It is widely established that mesenchymal stem cells from human umbilical cord blood have multipotent capacity and the ability to differentiate into disparate cell lineages hUCB MSCs were directly induced to differentiate into keratinocytes by using a specific medium composed of primary culture medium (PCM) and serum free medium (SFM) in a ratio 1:9 for a period of 7 days and tested by immunostain p63 and K1-K10. Cells thus cultured were positive in both tests, confirming the possibility to directly obtain keratinocytes from MSCs hUCB in vitro.

  3. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  4. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  5. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model

    OpenAIRE

    Gschwandtner, M; Mildner, M.; Mlitz, V; Gruber, F; Eckhart, L; Werfel, T.; Gutzmer, R.; Elias, P M; Tschachler, E.

    2012-01-01

    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated gen...

  6. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Science.gov (United States)

    Sugiyama, Yoshinori; Yamazaki, Kohei; Kusaka-Kikushima, Ayumi; Nakahigashi, Kyoko; Hagiwara, Hiromi; Miyachi, Yoshiki

    2014-01-01

    Aquaporin 9 (AQP9) is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK), knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA), a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3. PMID:25161869

  7. Formation of keratinocyte multilayers on filters under airlifted or submerged culture conditions in medium containing calcium, ascorbic acid, and keratinocyte growth factor.

    Science.gov (United States)

    Seo, Akira; Kitagawa, Norio; Matsuura, Takashi; Sato, Hironobu; Inai, Tetsuichiro

    2016-11-01

    Three-dimensional (3D) cell culture is a powerful in vitro technique to study the stratification and differentiation of keratinocytes. However, culture conditions, including culture media, supplements, and scaffolds (e.g., collagen gels with or without fibroblasts), can vary considerably. Here, we evaluated the roles of calcium, L-ascorbic acid phosphate magnesium salt n-hydrate (APM), and keratinocyte growth factor (KGF) in a chemically defined medium, EpiLife, in 3D cultures of primary human epidermal keratinocytes directly plated on polycarbonate filter inserts under airlifted or submerged conditions. Eight culture media containing various combinations of these three supplements were examined. Calcium was necessary for the stratification and differentiation of keratinocytes based on the localization of keratins and involucrin. However, the localization patterns of keratins and integrin β4 were partially disrupted and Ki67-positive basal cells almost disappeared 3 weeks after airlift. The addition of KGF, but not APM, prevented these changes. Further addition of APM markedly improved the tissue architecture, including basal cell morphology and the appearance of keratohyalin granules and localized involucrin in the upper suprabasal cells, even after 1 week. Although the submerged culture also formed cornified epithelium-like multilayers, involucrin was localized in the cornified layer, where nuclei were often found. Based on these results, it is most effective to culture keratinocytes at the air-liquid interface in EpiLife medium supplemented with calcium, APM, and KGF to form well-organized and orthokeratinized multilayers as skin analogues.

  8. Lactobacillus rhamnosus GG inhibits the toxic effects of Staphylococcus aureus on epidermal keratinocytes.

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J; Cruickshank, Sheena M; O'Neill, Catherine A

    2014-09-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 10(8) CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Calcium and Vitamin D increase mRNA levels for the growth control hIK1 channel in human epidermal keratinocytes but functional channels are not observed

    Directory of Open Access Journals (Sweden)

    Rossie Sandra

    2004-06-01

    Full Text Available Abstract Background Intermediate-conductance, calcium-activated potassium channels (IKs modulate proliferation and differentiation in mesodermal cells by enhancing calcium influx, and they contribute to the physiology of fluid movement in certain epithelia. Previous reports suggest that IK channels stimulate proliferative growth in a keratinocyte cell line; however, because these channels indirectly promote calcium influx, a critically unique component of the keratinocyte differentiation program, an alternative hypothesis is that they would be anti-proliferative and pro-differentiating. This study addresses these hypotheses. Methods Real-time PCR, patch clamp electrophysiology, and proliferation assays were used to determine if human IK1 (hIK1 expression and function are correlated with either proliferation or differentiation in cultured human skin epidermal keratinocytes, and skin biopsies grown in explant culture. Results hIK1 mRNA expression in human keratinocytes and skin was increased in response to anti-proliferative/pro-differentiating stimuli (elevated calcium and Vitamin D. Correspondingly, the hIK1 agonist 1-EBIO inhibited keratinocyte proliferation suggesting that the channel could be anti-proliferative and pro-differentiating. However, this proliferative inhibition by 1-EBIO was not reversed by a panel of hIK1 blockers, calling into question the mechanism of 1-EBIO action. Subsequent patch clamp electrophysiological analysis failed to detect hIK1 channel currents in keratinocytes, even those expressing substantial hIK1 mRNA in response to calcium and Vitamin D induced differentiation. Identical electrophysiological recording conditions were then used to observe robust IK1 currents in fibroblasts which express IK1 mRNA levels comparable to those of keratinocytes. Thus, the absence of observable hIK1 currents in keratinocytes was not a function of the electrophysiological techniques. Conclusion Human keratinocyte differentiation is

  10. Geraniin supplementation increases human keratinocyte proliferation in serum-free culture

    Directory of Open Access Journals (Sweden)

    Indra Kusuma

    2013-04-01

    Full Text Available Background Various products used in cellular therapy utilize tissue culture techniques requiring keratinocyte culture. An efficient and clinically acceptable keratinocyte culture system requires supplements with mitogenic activity. Geraniin is a phytochemical with the potential as a supplement for expansion culture of keratinocytes. The objective of the present study was to verify the mitogenic activity of geraniin on human keratinocytes. Methods This was an experimental study using two samples of human foreskin obtained by circumcision of a male child. Epidermal keratinocytes were isolated from the foreskin samples and were divided into paired groups, comprising intervention and control groups. The intervention groups were cultured with geraniin supplementation, whereas the control groups with standard supplements, without the addition of geraniin. Mitochondrial activity of the cells was evaluated by means of the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium-bromide (MTT proliferation assay. Absorbance values in each of the groups was measured at 450 nm. Data analysis was performed with the paired t-test. Results Geraniin supplementation significantly increased the keratinocyte proliferation rates at dosages of 0.8 to 3.1 µM. An increase of 57% in the proliferation rate was obtained at a dosage of 1.6 µM, while at a dosage of 12.5 µM toxic effects were starting to appear. Geraniin presumably causes increased cellular energy status, resulting in increased proliferation rates. Conclusion The findings in this study provide evidence in support of the utilization of geraniin as a supplement for expansion culture of keratinocytes. Further studies may presumably identify the molecules acting as geraniin receptors and the intracellular mechanisms underlying the increase in proliferation rates.

  11. Cell kinetic characterization of cultured human keratinocytes from normal and psoriatic individuals.

    Science.gov (United States)

    van Ruissen, F; de Jongh, G J; van Erp, P E; Boezeman, J B; Schalkwijk, J

    1996-09-01

    Psoriasis is a chronic skin disease characterized by epidermal hyperproliferation, disturbed differentiation, and inflammation. It is still a matter of debate whether the pathogenesis of psoriasis is based on immunological mechanisms, on defective growth control mechanisms, or possibly on a combination of both. Several in vivo cell biological differences between psoriatic lesional epidermis and normal epidermis have been reported. However, it is not clear whether these changes are causal or consequential. In case that keratinocytes from psoriatic patients have genetically determined deficiencies or polymorphisms with respect to autocrine growth regulation and the response to inflammatory cytokines, we hypothesize that these differences should be maintained in culture. Here we have started a systematic comparison of first passage keratinocytes cultured from normal skin and uninvolved psoriatic skin to address the question whether there are intrinsic differences in basic cell cycle parameters. In an established, defined culture system using keratinocyte growth medium (KGM) we have determined: (i) cell cycle parameters of exponentially growing keratinocytes, (ii) induction of quiescence by transforming growth factor beta 1 (TGF-beta 1) and (iii) restimulation from the G0-phase of the cell cycle. Bivariate analysis of lodo-deoxyuridine incorporation and relative DNA content was performed by flow cytometry. Within the limitations of this model no gross differences were found between normal and psoriatic keratinocytes with respect to S-phase duration (Ts), total cell cycle duration (Tc), responsiveness to TGF-beta 1 and the kinetics for recruitment from G0. In psoriatic keratinocytes we found a lower amount of cell in S-phase and a shorter duration of G1, compared to normal keratinocytes. The methodology developed here provides us with a model for further studies on differences between normal and psoriatic keratinocytes in their response to immunological and inflammatory

  12. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... PI3K binding to its main target, the epidermal growth factor receptor, nor its ability to convert phosphatidylinositol 4,5-bisphosphate to phosphatidylinositol 3,4,5-trisphosphate but impaired Akt phosphorylation at the regulatory sites Thr(308) and Ser(473). Diminished Akt activity resulted...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

  13. Saliva induces expression of antimicrobial peptides and promotes intracellular killing of bacteria in keratinocytes by epidermal growth factor receptor transactivation.

    Science.gov (United States)

    Mohanty, T; Alberius, P; Schmidtchen, A; Reiss, K; Schröder, J-M; Sørensen, O E

    2017-02-01

    Wounds in the oral cavity, constantly exposed to both saliva and bacteria, heal quickly without infection. Furthermore, during licking of skin wounds, saliva promotes wound healing and plays a role in keeping the wound free of infection. To investigate whether saliva induces expression of antimicrobial peptides (AMPs) in human epidermal keratinocytes and whether saliva promotes clearance of intracellular bacteria in these cells. Expression of AMPs was investigated in the oral mucosa and ex vivo injured skin by immunohistochemistry. Human beta-defensin-3 expression was investigated in epidermal keratinocytes after saliva stimulation, using real-time polymerase chain reaction and immunofluorescence. We found higher expression of AMPs in the oral mucosa than in the epidermis. Saliva accelerated the injury-induced expression of AMPs in human skin ex vivo and was a potent inducer of the expression of AMPs in epidermal keratinocytes. The expression of AMPs was induced by metalloproteinase-dependent epidermal growth factor receptor (EGFR) transactivation mediated by a salivary lipid. Saliva increased the intracellular clearance of Staphylococcus aureus in keratinocytes through EGFR activation. These findings suggest a previously unreported role of saliva in innate immunity and demonstrate for the first time that saliva induces gene expression in epidermal keratinocytes. © 2016 British Association of Dermatologists.

  14. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  15. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays.Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation.  The most widespread, intense and uniform staining for PCNA

  16. Examining communication between ultraviolet (UV)-damaged cutaneous nerve cells and epidermal keratinocytes in vitro.

    Science.gov (United States)

    Gruber, J V; Holtz, R

    2009-01-01

    The exposure of the skin to Ultraviolet (UV) radiation is a stressful event and the skin has multiple innate defense mechanisms to counter this threat. For instance, oxidatively damaged nerve cells will express neuroglobin, a hexa-coordinate heme protein, to scavenge free radicals such as nitric oxide (NO). Likewise, keratinocytes will express various anti-oxidant enzymes such as superoxide dismutase (SOD), which will defend the cells against oxidative threats. Nonetheless, cells will still express free radicals during excessive irradiation. A fundamental question that needs to be asked is: what do these cells communicate to one another during such stressful events? This paper will present results of an in vitro study in which dorsal root ganglion were irradiated with UV radiation to elicit oxidative events such as release of NO and calcitonin gene-related peptide (CGRP), a potent neuropeptide. Cell survival was also examined using the standard MTT assay. A plant-based neuroglobin mimic called phytoglobin was used as an NO scavenger to see if control of NO would influence CGRP expression and cell survival. Results of this study demonstrate that control of NO expression in irradiated nerve cells can influence CGRP expression and can also increase cell survival rates. Following this preliminary study, controlled amounts of the nerve cell growth media were added to cultures of normal human keratinocytes and the keratinocytes were allowed to interact with the nerve cell media for 24 h. Following this treatment period, human microarrays were run on the keratinocytes to see what genes were influenced in the keratinocytes as a result of contact with the irradiated nerve cell growth media. It was found that several critical genes expressed by the keratinocytes including NO synthase (NOS1), superoxide dismutase 1 (SOD1), transglutaminase 1 and 3 (TGM1 and TGM3), metallopeptidase inhibitor 1 (TIMP1), and filaggrin (FLG) were clearly influenced by the damaged nerve cells.

  17. Eccrine Sweat Contains IL-1α, IL-1β and IL-31 and Activates Epidermal Keratinocytes as a Danger Signal

    Science.gov (United States)

    Dai, Xiuju; Okazaki, Hidenori; Hanakawa, Yasushi; Murakami, Masamoto; Tohyama, Mikiko; Shirakata, Yuji; Sayama, Koji

    2013-01-01

    Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal. PMID:23874436

  18. Eccrine sweat contains IL-1α, IL-1β and IL-31 and activates epidermal keratinocytes as a danger signal.

    Directory of Open Access Journals (Sweden)

    Xiuju Dai

    Full Text Available Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal.

  19. Nuclear expression of IL-33 in epidermal keratinocytes promotes wound healing in mice.

    Science.gov (United States)

    Oshio, Tomoyuki; Komine, Mayumi; Tsuda, Hidetoshi; Tominaga, Shin-Ichi; Saito, Hirohisa; Nakae, Susumu; Ohtsuki, Mamitaro

    2017-02-01

    Skin is the outermost tissue of the human body, and works as a mechanical, chemical, and biological barrier. The epidermis is the uppermost layer of the skin, and keratinocytes constitute the majority of epidermal cells. Wounds are disruptions of skin integrity, and cause tremendous disadvantages to humans; accordingly, rapid wound healing is very important. Interleukin (IL)-33 is expressed in barrier tissue cells, such as epithelial and endothelial cells. Upon injury, IL-33 is released to stimulate immune cells, functioning as an "alarmin." ST2 is a receptor for IL-33; its soluble form (s)ST2 acts as a decoy receptor and competes for IL-33 binding. We aimed to clarify the role of IL-33 in wound healing. Wild-type (WT), IL-33 knockout (IL33 KO) mice, and sST2 transgenic (Tg) mice were wounded with a 4-mm punch, and the wound healing process was compared. Immunohistochemical analyses were performed to detect macrophages, neutrophils, and mast cells. Total RNA was extracted from the skin samples and real-time PCR was performed. An in vitro scratch wound assay was performed. Wound healing was delayed in IL33 KO mice compared to WT mice, while wound healing in sST2 Tg mice was comparable to that of WT mice. A histological examination showed delayed elongation of the epidermal tongue in IL-33 KO mice. An immunohistochemical study revealed prolonged neutrophilic infiltration at a later stage in IL-33 KO mice. IL-6, IL-1β, and CXCL1 transcripts were more abundant in the wounds of IL-33 KO mice than WT mice. Intraperitoneal administration of an NFκB inhibitor to IL-33 KO mice normalized the delayed wound healing and the enhanced expression of IL-6 in IL-33 KO mice. Epidermal keratinocytes from IL-33 KO mice showed delayed wound closure compared to those from WT mice. Our results indicate that nuclear IL-33, but not IL-33 as a cytokine, has beneficial effects on wound healing in mice, probably by suppressing NFκB to inhibit excessive inflammation and by maintaining

  20. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  1. Human keratinocyte caspase-14 expression is altered in human epidermal 3D models by dexamethasone and by natural products used in cosmetics.

    Science.gov (United States)

    Kataoka, Saori; Hattori, Kenji; Date, Akira; Tamura, Hiroomi

    2013-10-01

    Caspase-14 is a cysteinyl-aspartate-specific proteinase that is specifically expressed in epidermal keratinocytes. Dysregulation of caspase-14 expression is implicated in impaired skin barrier formation. To elucidate the regulation of caspase-14 in differentiated keratinocytes, we characterized the expression of caspase-14 in normal human epidermal keratinocytes (NHEKs) and two types of three-dimensional (3D) human epidermis culture models, EPI-200 and EPI-201, via RT-PCR and immunoblot analyses. Caspase-14 expression was absent in subconfluent NHEKs, but was present in confluent NHEKs as well as those induced to differentiate by calcium. Caspase-14 expression levels in the 3D epidermis models were almost equal to that in the Ca(2+)-treated differentiated NHEKs. Despite the presence of caspase-14 expression in these models, caspase-14 activity was found only in the mature 3D skin model, EPI-200. This was confirmed by detection of a 17 kDa cleaved fragment of caspase-14 present only in the EPI-200 model. Since glucocorticoid (GC) receptor is required for skin barrier competence, we investigated whether the GC dexamethasone (Dex) and various natural components of common skin moisturizers affect caspase-14 expression in keratinocytes. Dex decreased caspase-14 expression in undifferentiated, but not differentiated, NHEKs. Conversely, Dex increased caspase-14 expression in both 3D skin models, although it did not alter caspase protease activity. Similar to treatment with Dex, treatment of the premature 3D skin mode, EPI-201 with a Galactomyces ferment filtrate markedly increased expression of caspase-14. Further, these results suggest that the effect of Dex, or lack thereof, on caspase-14 expression is dependent on the stage of keratinocyte differentiation.

  2. Eph-2B, acting as an extracellular ligand, induces differentiation markers in epidermal keratinocytes.

    Science.gov (United States)

    Walsh, Rebecca; Blumenberg, Miroslav

    2012-06-01

    In the bi-directional signaling system comprising ephrins (EFNs) and ephrin receptors (Ephs), both EFNs and Ephs simultaneously function both as ligands and as receptors. Importantly, the EFN/Eph system is deregulated in human cancers and has been implicated in the metastatic processes because of its effects on the adhesion and migration of epithelial cells. The idiosyncratic function of Ephs, membrane-bound receptor kinases, as extracellular signaling ligands, has not been extensively studied. This prompted us to explore the transcriptional targets regulated by Ephs acting solely as ligands. To define the ligand function of EphB2 in human epidermal keratinocytes, we treated these cells with EphB2 as Fc-conjugate dimmers, which thus act exclusively as extracellular ligands. We compared the EphB2 and EFNA4 effects during a 48 h time course, using transcriptional profiling. We found that EphB2, acting as a ligand, promotes epidermal differentiation. For example, EphB2 induces expression of markers of epidermal differentiation, including keratins KRT1 and KRT10, SPRRs, desmosomal proteins and cell cycle inhibitors, while suppressing basal layer markers, integrins and cell cycle proteins. The effects of EphB2 are delayed relative to those of EFNA4. Unlike EFNA4, EphB2 did not induce lipid metabolism proteins, this particular aspect of epidermal differentiation seems not to be regulated by EphB2. Our results define the transcriptional targets of the reverse signaling by EphB2 acting exclusively as a ligand and begin to characterize this intriguing function of Ephs. Copyright © 2011 Wiley Periodicals, Inc.

  3. Asian dust storm particles induce a broad toxicological transcriptional program in human epidermal keratinocytes.

    Science.gov (United States)

    Choi, Hyun; Shin, Dong Wook; Kim, Wonnyon; Doh, Seong-Jae; Lee, Soo Hwan; Noh, Minsoo

    2011-01-15

    Exposure to airborne dust particles originated from seasonal Asian dust storms in Chinese and Mongolian deserts results in increased incidence of a range of diseases including asthma, contact dermatitis and conjunctivitis. The areas affected by Asian dust particles extend from East China to the west coast of North America. In order to study toxicological mechanisms in human skin, we evaluated the effects of dust particles collected during Asian dust storms (Asian dust particles) on gene expression in human epidermal keratinocytes (HEK). In HEK, exposure to Asian dust particles significantly increased gene expressions of cytochrome P450 1A1 (CYP1A1), CYP1A2, and CYP1B1, which is an indication of aryl hydrocarbon receptor (AHR) activation. In addition, Asian dust particles increased gene transcription of the cytokines IL-6, IL-8, and GM-CSF, which have broad pro-inflammatory and immunomodulatory properties. Asian dust particles significantly up-regulated expression of caspase 14 in HEK, suggesting that Asian dust particles directly affect keratinocyte differentiation. We also demonstrated that protein extract of pollen, a material frequently adsorbed onto Asian dust particles, potentially contributes to the increased transcription of IL-6, CYP1A1, CYP1A2, and CYP1B1. Taken together, these studies suggest that Asian dust particles can exert toxicological effects on human skin through the activation of the cellular detoxification system, the production of pro-inflammatory and immunomodulatory cytokines, and changes in the expression of proteins essential in normal epidermal differentiation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  4. Permeability barrier properties of oral keratinocyte cultures: a model of intact human oral mucosa.

    Science.gov (United States)

    Selvaratnam, L; Cruchley, A T; Navsaria, H; Wertz, P W; Hagi-Pavli, E P; Leigh, I M; Squier, C A; Williams, D M

    2001-07-01

    The aim of this study was to establish whether an in vitro model of human oral mucosa had similar permeability characteristics to normal oral mucosa. Such a model would have considerable value as an alternative to the use of mucosal biopsies in studies of transmucosal drug delivery. Keratinocytes obtained from buccal mucosa, hard palate and abdominal skin were seeded onto inert collagen membranes (Cellagen Discs) or dead de-epidermised dermis (DDED) and grown either as submerged or air-liquid interface cultures. Subsequently the ultrastructural characteristics, permeability to water and barrier lipid content of the epithelial cultures were assessed and compared with samples of intact mucosa and skin. All the cultures stratified into multilayered epithelia and displayed features of differentiation including tonofilaments, desmosomes and membrane coating granules. The permeability characteristics and barrier lipid content of the oral mucosal cultures resembled those of intact mucosa. By contrast, epidermal keratinocytes failed to produce a permeability barrier comparable with that of skin and had low levels of barrier associated lipids. Cultures of human oral mucosal keratinocytes obtained from healthy adults develop similar permeability properties and barrier lipid composition to their site of origin. This model system may be useful for the evaluation of local and systemic oral mucosal drug delivery.

  5. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  6. The Alteration of the Epidermal Basement Membrane Complex of Human Nevus Tissue and Keratinocyte Attachment after High Hydrostatic Pressurization

    Directory of Open Access Journals (Sweden)

    Naoki Morimoto

    2016-01-01

    Full Text Available We previously reported that human nevus tissue was inactivated after high hydrostatic pressure (HHP higher than 200 MPa and that human cultured epidermis (hCE engrafted on the pressurized nevus at 200 MPa but not at 1000 MPa. In this study, we explore the changes to the epidermal basement membrane in detail and elucidate the cause of the difference in hCE engraftment. Nevus specimens of 8 mm in diameter were divided into five groups (control and 100, 200, 500, and 1000 MPa. Immediately after HHP, immunohistochemical staining was performed to detect the presence of laminin-332 and type VII collagen, and the specimens were observed by transmission electron microscopy (TEM. hCE was placed on the pressurized nevus specimens in the 200, 500, and 1000 MPa groups and implanted into the subcutis of nude mice; the specimens were harvested at 14 days after implantation. Then, human keratinocytes were seeded on the pressurized nevus and the attachment was evaluated. The immunohistochemical staining results revealed that the control and 100 MPa, 200 MPa, and 500 MPa groups were positive for type VII collagen and laminin-332 immediately after HHP. TEM showed that, in all of the groups, the lamina densa existed; however, anchoring fibrils were not clearly observed in the 500 or 1000 MPa groups. Although the hCE took in the 200 and 500 MPa groups, keratinocyte attachment was only confirmed in the 200 MPa group. This result indicates that HHP at 200 MPa is preferable for inactivating nevus tissue to allow its reuse for skin reconstruction in the clinical setting.

  7. Production of the long and short forms of MFG-E8 by epidermal keratinocytes.

    Science.gov (United States)

    Watanabe, Tatsuya; Totsuka, Rakuno; Miyatani, Seiji; Kurata, Shun-ichi; Sato, Shingo; Katoh, Iyoko; Kobayashi, Shizuko; Ikawa, Yoji

    2005-08-01

    Mouse milk fat globule-EGF factor 8, MFG-E8, is the ortholog to the human mammary tumor marker, lactadherin, and comprises two spliced variants, the L and S forms. Recent studies have suggested that MFG-E8-L produced by macrophages and Langerhans cells in the skin serves as a linker between phagocytic cells and apoptotic cells, and that MFG-E8-S, also termed SED1, facilitates sperm-egg interaction for fertilization. However, Mfge8 gene expression occurs in various tissues apparently unrelated to these critical events. Our in situ hybridization study has revealed that Mfge8 is expressed in the periderm (the premature epidermis) on embryonic day-14, well before Langerhans cells begin to grow in the prenatal phase. Mfge8 transcript is detectable in the basal and spinous layers throughout skin development, whereas immunostaining has revealed MFG-E8 protein accumulation in the spinous layer. Cultured keratinocyte stem cells consistently express Mfge8-L and -S mRNAs and produce the L protein, which is primarily detectable in the culture supernatant, and the S protein, which is mostly associated with the cells. Upon Ca(2+)-stimulated differentiation, which is detected by a decrease in keratinocyte stem cell marker p63(p51) and the induction of keratin1, we have observed suppression of Mfge8, and the protein becomes localized to the cell-cell borders. Papillomas and carcinomas caused by chronic UV-B irradiation produce MFG-E8 as determined by immunostaining. Thus, undifferentiated and poorly differentiated keratinocytes produce the L and S forms of MFG-E8 during normal and pathological tissue development, probably to support an as yet unidentified membrane function.

  8. Epigallocatechin-3-gallate attenuates the AIM2-induced secretion of IL-1β in human epidermal keratinocytes.

    Science.gov (United States)

    Yun, Mihee; Seo, Gimoon; Lee, Ji-Young; Chae, Gue Tae; Lee, Seong-Beom

    2015-11-27

    The pro-inflammatory cytokine interleukin-1β (IL-1β) plays a central role in the pathogenesis of psoriasis. Keratinocytes are a major source of IL-1β and express absent in melanoma 2 (AIM2). AIM2 recognizes a double-stranded DNA and initiates the IL-1β-processing of inflammasome. The AIM2 inflammasome is a cytosolic multiprotein complex composed of AIM2, an apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC), and pro-caspase-1. Epigallocatechin-3-Gallate (EGCG), a major polyphenolic component of green tea, has anti-inflammatory properties. In the current study, we investigated the issue of whether or how EGCG suppresses AIM2 inflammasome in human epidermal keratinocytes, neonatal (HEKn). Treatment with EGCG, before or after IFN-γ priming, attenuated poly(dA:dT)-induced IL-1β secretion in HEKn cells. Pre-treatment with EGCG reduced the level of IFN-γ-induced priming signal via the down-regulation of pro-IL-1β and pro-capspase-1 in HEKn cells. Furthermore, treatment with EGCG attenuated poly(dA:dT)-induced ASC oligomerization and caspase-1 activation in IFN-γ-primed HEKn cells. These results suggest that EGCG attenuates AIM2-induced IL-1β secretion by suppressing both IFN-γ-mediated priming and poly(dA:dT)-induced ASC oligomerization of inflammasomes in human epidermal keratinocytes. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Development of culture techniques of keratinocytes for skin graft production.

    Science.gov (United States)

    Masahiro, Kino-oka; Taya, Masahito

    2004-01-01

    The in vitro cultures of human tissues have attracted a great deal of medical attention as a promising technique for repairing defective tissues in vivo. In the last decade many companies have been established for supplying the regenerated grafts by means of tissue cultures of skin, cartilage, bone and so on. From the viewpoint of biochemical engineering, however, the culture systems for these tissues are not so sophisticated nor so programmed as the submerged culture systems developed for microorganisms. In manufacturing skin grafts, for instance, the raw materials of cells harvested from patients are heterogeneous, and the products of cultured tissues vary in the required size for individual epithelial sheets. Therefore, a reliable and robust process is desired for the production of cultured tissues with high reproducibility and quality. This review focuses on the strategies for developing the culture processes of keratinocytes targeting the epithelial sheet production, including (i) the introduction of culture techniques for keratinocyte cells and survey of skin graft production as it is, (ii) construction of kinetic model of cell growth, (iii) evaluation of cell properties based on image-analyzing techniques, and (iv) design of bioreactor system.

  10. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Science.gov (United States)

    Nayak, Sunita; Dey, Sancharika; Kundu, Subhas C

    2013-01-01

    The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide) production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  11. Skin Equivalent Tissue-Engineered Construct: Co-Cultured Fibroblasts/ Keratinocytes on 3D Matrices of Sericin Hope Cocoons

    Science.gov (United States)

    Nayak, Sunita; Dey, Sancharika; Kundu, Subhas C.

    2013-01-01

    The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from “Sericin Hope” silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide) production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair. PMID:24058626

  12. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  13. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    OpenAIRE

    Yu-Ping Hsiao; Wan-Wen Lai; Shi-Bei Wu; Chung-Hung Tsai; Sheau-Chung Tang; Jing-Gung Chung; Jen-Hung Yang

    2015-01-01

    Malic acid (MA) has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT). The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs). Flow cytometric assa...

  14. Mechanism of interleukin-1α transcriptional regulation of S100A9 in a human epidermal keratinocyte cell line

    Science.gov (United States)

    Bando, Mika; Zou, Xianqiong; Hiroshima, Yuka; Kataoka, Masatoshi; Ross, Karen F; Shinohara, Yasuo; Nagata, Toshihiko; Herzberg, Mark C; Kido, Jun-ichi

    2013-01-01

    S100A9 is a calcium-binding protein and subunit of antimicrobial calprotectin complex (S100A8/A9). Produced by neutrophils, monocytes/ macrophages and keratinocytes, S100A9 expression increases in response to inflammation. For example, IL-1α produced by epithelial cells acts autonomously on the same cells to induce expression of S100A8/A9 and cellular differentiation. Whereas it is well known that IL-1α and members of the IL-10 family of cytokines upregulate S100A8 and S100A9 in several cell lineages, the pathway and mechanism of IL-1α-dependent transcriptional control of S100A9 in epithelial cells is not established. Modeled using human epidermal keratinocytes (HaCaT cells), IL-1α stimulated phosphorylation of p38 MAPK and induced S100A9 expression, which was blocked by IL-1 receptor antagonist, RNAi suppression of p38, or a p38 MAPK inhibitor. Transcription of S100A9 in HaCaT cells depended on nucleotides -94 to -53 in the upstream promoter region, based upon use of deletion constructs and luciferase reporter activity. Within the responsive promoter region, IL-1α increased the binding activity of CCAAT/enhancer binding protein β (C/EBPβ). Mutated C/EBPβ binding sequences or C/EBPβ-specific siRNA inhibited the S100A9 transcriptional response. Hence, IL-1α is strongly suggested to increase S100A9 expression in a human epidermal keratinocyte cell line by signaling through the IL-1 receptor and p38 MAPK, increasing C/EBPβ-dependent transcriptional activity. PMID:23563247

  15. Tacrolimus Reverses UVB Irradiation-Induced Epidermal Langerhans Cell Reduction by Inhibiting TNF-α Secretion in Keratinocytes via Regulation of NF-κB/p65

    Directory of Open Access Journals (Sweden)

    JiaLi Xu

    2018-02-01

    Full Text Available Background: Topical calcineurin inhibitors including tacrolimus and pimecrolimus are used in the treatment of many inflammatory skin diseases mainly via blocking T-cell proliferation. Our previous studies found that pimecrolimus 1% cream could reverse high-dose ultraviolet B (UVB irradiation-induced epidermal Langerhans cell (LC reduction via inhibition of LC migration. We conducted this study to investigate the effects of topical tacrolimus 0.03% ointment on high-dose UVB-irradiated human epidermal LCs.Methods: Twenty fresh human foreskin tissues were randomly divided into four groups as follows: Control, Tacrolimus (0.03%, UVB (180 mJ/cm2, and UVB (180 mJ/cm2 + Tacrolimus (0.03%. Four time points were set as follows: 0, 18, 24, and 48 h. We collected culture medium and tissues at each time point. The percentage of CD1a+ cells in the medium was detected by means of flow cytometry. Each tissue was prepared for immunohistochemistry, real-time quantitative PCR, and western blot. HaCaT cells were cultured and divided into four groups: Control, Tacrolimus (1 μg/ml, UVB (30 mJ/cm2, and UVB (30 mJ/cm2 + Tacrolimus (1 μg/ml. The cells were incubated for 24 h and prepared for real-time quantitative PCR and western blot.Results: Topical tacrolimus significantly reversed high-dose UVB irradiation-induced epidermal LC reduction and CD1a+ cell increment in culture medium. Tacrolimus significantly inhibited UVB irradiation-induced tumor necrosis factor-α (TNF-α and nuclear factor kappa B (NF-κB/p65 mRNA and protein expression in HaCaT cells. Tacrolimus also significantly inhibited high-dose UVB irradiation-induced TNF-α expression in cultured tissues. Finally, TNF-α antagonist (recombinant human TNF-α receptor II: IgG Fc fusion protein could significantly reverse UVB irradiation-induced epidermal LC reduction.Conclusion: Topical tacrolimus 0.03% could reverse UVB irradiation-induced epidermal LC reduction by inhibiting TNF-α secretion in

  16. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  17. Enhanced keratinocyte proliferation and migration in co-culture with fibroblasts.

    Directory of Open Access Journals (Sweden)

    Zhenxiang Wang

    Full Text Available Wound healing is primarily controlled by the proliferation and migration of keratinocytes and fibroblasts as well as the complex interactions between these two cell types. To investigate the interactions between keratinocytes and fibroblasts and the effects of direct cell-to-cell contact on the proliferation and migration of keratinocytes, keratinocytes and fibroblasts were stained with different fluorescence dyes and co-cultured with or without transwells. During the early stage (first 5 days of the culture, the keratinocytes in contact with fibroblasts proliferated significantly faster than those not in contact with fibroblasts, but in the late stage (11(th to 15(th day, keratinocyte growth slowed down in all cultures unless EGF was added. In addition, keratinocyte migration was enhanced in co-cultures with fibroblasts in direct contact, but not in the transwells. Furthermore, the effects of the fibroblasts on keratinocyte migration and growth at early culture stage correlated with heparin-binding EGF-like growth factor (HB-EGF, IL-1α and TGF-β1 levels in the cultures where the cells were grown in direct contact. These effects were inhibited by anti-HB-EGF, anti-IL-1α and anti-TGF-β1 antibodies and anti-HB-EGF showed the greatest inhibition. Co-culture of keratinocytes and IL-1α and TGF-β1 siRNA-transfected fibroblasts exhibited a significant reduction in HB-EGF production and keratinocyte proliferation. These results suggest that contact with fibroblasts stimulates the migration and proliferation of keratinocytes during wound healing, and that HB-EGF plays a central role in this process and can be up-regulated by IL-1α and TGF-β1, which also regulate keratinocyte proliferation differently during the early and late stage.

  18. Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model.

    Science.gov (United States)

    Lamb, Rebecca; Ambler, Carrie A

    2013-01-01

    Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.

  19. RIP4 is a target of multiple signal transduction pathways in keratinocytes: Implications for epidermal differentiation and cutaneous wound repair

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Stephanie [Charite, University Medicine Berlin, Institute of Physiology, Arnimallee 22, D-14195 Berlin (Germany); Munz, Barbara, E-mail: barbara.munz@charite.de [Charite, University Medicine Berlin, Institute of Physiology, Arnimallee 22, D-14195 Berlin (Germany)

    2010-01-01

    Receptor interacting protein 4 (RIP4) is an important regulator of epidermal morphogenesis during embryonic development. We could previously show that expression of the rip4 gene is strongly downregulated in cutaneous wound repair, which might be initiated by a broad variety of growth factors and cytokines. Here, we demonstrate that in keratinocytes, rip4 expression is controlled by a multitude of different signal transduction pathways, such as the p38 mitogen-activated protein kinase (MAPK) and the nuclear factor kappa B (NF-{kappa}B) cascade, in a unique and specific manner. Furthermore, we show that the steroid dexamethasone abolishes the physiological rip4 downregulation after injury and might thus contribute to the phenotype of reduced and delayed wound reepithelialization seen in glucocorticoid-treated patients. As a whole, our data indicate that rip4 expression is regulated in a complex manner, which might have therapeutic implications.

  20. RhoB protects human keratinocytes from UVB-induced apoptosis through epidermal growth factor receptor signaling.

    Science.gov (United States)

    Canguilhem, Bruno; Pradines, Anne; Baudouin, Caroline; Boby, Céline; Lajoie-Mazenc, Isabelle; Charveron, Marie; Favre, Gilles

    2005-12-30

    Exposure of the skin to UVB light results in the formation of DNA photolesions that can give rise to cell death, mutations, and the onset of carcinogenic events. Specific proteins are activated by UVB and then trigger signal transduction pathways that lead to cellular responses. An alteration of these signaling molecules is thought to be a fundamental event in tumor promotion by UVB irradiation. RhoB, encoding a small GTPase has been identified as a DNA damage-inducible gene. RhoB is involved in epidermal growth factor (EGF) receptor trafficking, cytoskeletal organization, cell transformation, and survival. We have analyzed the regulation of RhoB and elucidated its role in the cellular response of HaCaT keratinocytes to relevant environmental UVB irradiation. We report here that the activated GTP-bound form of RhoB is increased rapidly within 5 min of exposure to UVB, and then RhoB protein levels increased concomitantly with EGF receptor (EGFR) activation. Inhibition of UVB-induced EGFR activation prevents RhoB protein expression and AKT phosphorylation but not the early activation of RhoB. Blocking UVB-induced RhoB expression with specific small interfering RNAs inhibits AKT and glycogen synthase kinase-3beta phosphorylation through inhibition of EGFR expression. Moreover, down-regulation of RhoB potentiates UVB-induced cell apoptosis. In contrast, RhoB overexpression protects keratinocytes against UVB-induced apoptosis. These results indicated that RhoB is regulated upon UVB exposure by a two-step process consisting of an early EGFR-independent RhoB activation followed by an EGFR-dependent induction of RhoB expression. Moreover, we have demonstrated that RhoB is essential in regulating keratinocyte cell survival after UVB exposure, suggesting its potential role in photocarcinogenesis.

  1. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  2. Amygdalin analogues inhibit IFN-γ signalling and reduce the inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Paoletti, Iole; De Gregorio, Vincenza; Baroni, Adone; Tufano, Maria Antonietta; Donnarumma, Giovanna; Perez, Juan Jesus

    2013-12-01

    Peptide T (PT), an octapeptide fragment located in the V2 region of the HIV-1 gp120-coating protein, appears to be beneficial in the treatment of psoriasis. Our previous investigations suggest that keratinocytes play a key role in conditioning the therapeutic effects of PT in psoriasis. The aim of this study was to explore the effects of PT and the peptidomimetic natural products, Dhurrin and Prunasin, on the expression of the IL-6, IL-8, IL-23, HSP70 and ICAM-1 on IFN-γ and TNF-α-NHEK activated cells. Moreover, we analysed the interference of PT and its analogues through STAT-3 activation. Our results show that the analogues tested exhibit the beneficial biological effects of PT, suggesting the primary role of keratinocytes upon which PT and the peptidomimetics act directly, by reducing proinflammatory responses. Its reduction appears to be important for therapeutic approach in psoriasis pathogenesis.

  3. New procedure for epidermal cell isolation using kiwi fruit actinidin, and improved culture of melanocytes in the presence of leukaemia inhibitory factor and forskolin.

    Science.gov (United States)

    Yarani, Reza; Mansouri, Kamran; Mohammadi-Motlagh, Hamid Reza; Bakhtiari, Mitra; Mostafaie, Ali

    2013-06-01

    Conventional isolation of epidermis from the dermis and disruption of epidermal sheets to liberate the cells, are performed using proteolytic enzymes such as thermolysin or collagenase. Selective population expansion of melanocytes is achieved by suppressing proliferation of keratinocytes and fibroblasts in epidermal cell suspensions, using phorbol esters and cholera toxin. Here, we introduce a new procedure for isolation of epidermal cells, using proteolytic activity of kiwi fruit actinidin, and also an improved growth medium for melanocytes in the presence of leukaemia inhibitory factor (LIF) and forskolin. Dermo-epidermal separation and epidermal sheet cell dispersion were performed using actinidin compared to conventional proteases including collagenase, thermolysin or trypsin. Thereafter, melanocyte culture was performed in two common media and one modified medium to discover optimization for these cells. We found that dermo-epidermal separation and epidermal sheet cell dispersion using kiwi fruit actinidin were considerably better than previously used methods, both from the aspect of less fibroblast and keratinocyte contamination, and of more viable native cells. Also, melanocytes proliferated better in phorbol ester- and cholera toxin-free proliferation medium supplemented with LIF and forskolin. Less contamination and higher numbers of viable cells were actinidin preferential for separation of epidermis and isolation of epidermal cells. Supplementation of LIF and forskolin to new medium increased proliferation potential of melanocytes in comparison to exogenous mitogens. © 2013 Blackwell Publishing Ltd.

  4. Keratinocyte cultures from involved skin in vitiligo patients show an impaired in vitro behaviour.

    Science.gov (United States)

    Bondanza, Sergio; Maurelli, Riccardo; Paterna, Patrizia; Migliore, Eleonora; Giacomo, Fabio Di; Primavera, Giovanni; Paionni, Emanuel; Dellambra, Elena; Guerra, Liliana

    2007-08-01

    Vitiligo depigmentation is considered a consequence of either melanocyte disappearance or loss of functioning melanocytes in the involved areas. However, it has been reported that keratinocytes in involved vitiligo skin are damaged too. Based on this evidence, we evaluated the in vitro behaviour, in life span cultures, of involved and uninvolved vitiligo keratinocytes and their expression of proliferation, differentiation and senescence markers. An additional purpose was to investigate whether vitiligo keratinocytes from depigmented skin are able to sustain survival and growth of normal melanocytes (when added in co-culture experiments), as normal human keratinocytes manage to do. Our results demonstrate that almost all involved vitiligo keratinocytes have a shorter life span in vitro than the uninvolved cells and all of them do not maintain melanocytes in culture in a physiological ratio. Modification of proliferation and senescence marker expression also occurs. Indeed, we detected low initial expression levels of the senescence marker p16 in involved vitiligo keratinocytes, despite their shorter in vitro life span, and increased expression of proliferating cell nuclear antigen and p53. This preliminary analysis of a small number of in vitro cultured vitiligo keratinocytes suggests an impaired senescence process in lesional vitiligo keratinocytes and attempts to regulate it.

  5. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... rafts is required for the activity of Akt and cell survival and may serve as a potential pharmacological target in the treatment of epidermal cancers....

  6. Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

    DEFF Research Database (Denmark)

    Kuntsche, Judith; Herre, Angela; Fahr, Alfred

    2013-01-01

    Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence.......g. slightly smaller than that determined for human SC in the present study (127Å). Moreover, SAXS results also indicate the presence of covalently bound ceramides, which are crucial for a proper SC barrier, although the corresponding thermal transitions were not clearly detectable by DSC. Due to the competent...

  7. Role of taurine accumulation in keratinocyte hydration.

    Science.gov (United States)

    Janeke, Guido; Siefken, Wilfried; Carstensen, Stefanie; Springmann, Gunja; Bleck, Oliver; Steinhart, Hans; Höger, Peter; Wittern, Klaus-Peter; Wenck, Horst; Stäb, Franz; Sauermann, Gerhard; Schreiner, Volker; Doering, Thomas

    2003-08-01

    Epidermal keratinocytes are exposed to a low water concentration at the stratum corneum-stratum granulosum interface. When epithelial tissues are osmotically perturbed, cellular protection and cell volume regulation is mediated by accumulation of organic osmolytes such as taurine. Previous studies reported the presence of taurine in the epidermis of several animal species. Therefore, we analyzed human skin for the presence of the taurine transporter (TAUT) and studied the accumulation of taurine as one potential mechanism protecting epidermal keratinocytes from dehydration. According to our results, TAUT is expressed as a 69 kDa protein in human epidermis but not in the dermis. For the epidermis a gradient was evident with maximal levels of TAUT in the outermost granular keratinocyte layer and lower levels in the stratum spinosum. No TAUT was found in the basal layer or in the stratum corneum. Keratinocyte accumulation of taurine was induced by experimental induction of skin dryness via application of silica gel to human skin. Cultured human keratinocytes accumulated taurine in a concentration- and osmolarity-dependent manner. TAUT mRNA levels were increased after exposure of human keratinocytes to hyperosmotic culture medium, indicating osmosensitive TAUT mRNA expression as part of the adaptation of keratinocytes to hyperosmotic stress. Keratinocyte uptake of taurine was inhibited by beta-alanine but not by other osmolytes such as betaine, inositol, or sorbitol. Accumulation of taurine protected cultured human keratinocytes from both osmotically induced and ultraviolet-induced apoptosis. Our data indicate that taurine is an important epidermal osmolyte required to maintain keratinocyte hydration in a dry environment.

  8. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

    Directory of Open Access Journals (Sweden)

    Santosh K Katiyar

    Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

  9. EGF-receptor tyrosine kinase inhibition induces keratinocyte growth arrest and terminal differentiation.

    Science.gov (United States)

    Peus, D; Hamacher, L; Pittelkow, M R

    1997-12-01

    Epidermal keratinocyte growth and differentiation are regulated by specific families of growth factors and receptors. Peptide growth factors of the epidermal growth factor family stimulate proliferation of clonal density human keratinocytes and suppress markers of terminal differentiation in confluent cultures of human keratinocytes. We present evidence that selected inhibitors of activation of the type I human epidermal growth factor receptor (EGFR or HER-1), namely, neutralizing monoclonal antibody to HER-1/EGFR and the specific tyrosine kinase inhibitor PD 153035, potently inhibit proliferation of human keratinocytes in autonomously replicating subconfluent cultures. Coupled to growth arrest is the suppression of HER-1 tyrosine autophosphorylation in inhibitor-treated human keratinocytes. Proliferation and tyrosine autophosphorylation are initially reversible following removal of the inhibitor and restimulation of cells with epidermal growth factor. Sustained inactivation of HER-1 in autonomously replicating cultures of human keratinocytes induces expression of keratin 1 and keratin 10 genes, early markers of terminal differentiation. Reversal of growth inhibition by epidermal growth factor suppresses keratin 1 and keratin 10 expression. These results demonstrate that human keratinocyte terminal differentiation as well as proliferation are mediated by HER-1. Co-expression of autocrine epidermal growth factor-related ligands as well as HER-1 by human keratinocyte may function as part of the signal transduction network in epidermis to regulate cell number, replication rate, and terminal differentiation.

  10. UV irradiation-induced zinc dissociation from commercial zinc oxide sunscreen and its action in human epidermal keratinocytes.

    Science.gov (United States)

    Martorano, Lisa M; Stork, Christian J; Li, Yang V

    2010-12-01

    Zinc oxide (ZnO) is an active ingredient in sunscreen owing to its properties of broadly filtering the ultraviolet (UV) light spectrum and it is used to protect against the carcinogenic and photodamaging effects of solar radiation on the skin. This study investigated the dissociation of zinc (Zn(2+) ) from ZnO in commercial sunscreens under ultraviolet type B light (UVB) irradiation and assessed the cytotoxicity of Zn(2+) accumulation in human epidermal keratinocytes (HEK). Using Zn(2+) fluorescent microscopy, we observed a significant increase in Zn(2+) when ZnO sunscreens were irradiated by UVB light. The amount of Zn(2+) increase was dependent on both the irradiation intensity as well as on the ZnO concentration. A reduction in cell viability as a function of ZnO concentration was observed with cytotoxic assays. In a real-time cytotoxicity assay using propidium iodide, the treatment of UVB-irradiated ZnO sunscreen caused a late- or delayed-type cytotoxicity in HEK. The addition of a Zn(2+) chelator provided a protective effect against cellular death in all assays. Furthermore, Zn(2+) was found to induce the production of reactive oxygen species (ROS) in HEK. Our data suggest that UVB irradiation produces an increase in Zn(2+) dissociation in ZnO sunscreen and, consequently, the accumulation of free or labile Zn(2+) from sunscreen causes cytotoxicity and oxidative stress. © 2010 Wiley Periodicals, Inc.

  11. Nicotinamide attenuates aquaporin 3 overexpression induced by retinoic acid through inhibition of EGFR/ERK in cultured human skin keratinocytes.

    Science.gov (United States)

    Song, Xiuzu; Xu, Aie; Pan, Wei; Wallin, Brittany; Kivlin, Rebecca; Lu, Shan; Cao, Cong; Bi, Zhigang; Wan, Yinsheng

    2008-08-01

    The most common adverse effects that are related to all-trans retinoic acid (atRA) treatment are irritation and dryness of the skin. atRA therapy is reported to impair barrier function as achieved by trans-epidermal water loss (TEWL). Treatment with nicotinamide prior to initiation of atRA therapy provides additional barrier protection and thus reduces susceptibility of retinoic acid. Our previous studies showed that atRA upregulates aquaporin 3 (AQP3) in cultured human skin keratinocytes and fibroblasts. Others have demonstrated that in atopic dermatitis, overexpression of AQP3 is linked to elevated TEWL and that nicotinamide treatment reduces skin TEWL. In this study, we observed that while atRA upregulates AQP3 expression in cultured human skin keratinocytes (HaCaT cells), nicotinamide attenuates the effect of atRA in a concentration-dependent manner. atRA treatment induces EGFR and ERK activation. PD153035, an EGFR inhibitor, and U0126, an ERK inhibitor, inhibit atRA-induced upregulation of AQP3. Nicotinamide also inhibits atRA-induced activation of EGFR/ERK signal transduction and decreases water permeability by downregulating AQP3 expression. Collectively, our results indicate that the effect of atRA on AQP3 expression is at least partly mediated by EGFR/ERK signaling in cultured human skin keratinocytes. Nicotinamide attenuates atRA-induced AQP3 expression through inhibition of EGFR/ERK signal transduction and eventually decreases water permeability and water loss. Our study provides insights into the molecular mechanism through which nicotinamide reverses the side effects of dryness in human skin after treatment with atRA.

  12. Transcription of melanogenesis enzymes in melanocytes: dependence upon culture conditions and co-cultivation with keratinocytes.

    Science.gov (United States)

    Kippenberger, S; Bernd, A; Bereiter-Hahn, J; Ramirez-Bosca, A; Kaufmann, R; Holzmann, H

    1996-08-01

    Eumelanogenesis of human skin melanocytes requires at least three enzymes: tyrosinase, TRP 1, and TRP 2. The regulation of these enzymes on transcriptional level was detected in a semiquantitative attempt. The total RNA of melanocytes was reverse-transcripted and followed by a PCR with degenerated primers for all three enzymes. The amplification products were related to each other densitometrically. We examined five different culture conditions: 1) melanocytes in a popular phorbolester containing F-10-medium, 2) melanocytes in a co-culture medium with EGF, 3) melanocytes in a co-culture medium with high calcium, 4) melanocytes co-cultured with keratinocytes in EGF containing co-culture medium, and 5) melanocytes co-cultured with keratinocytes in co-culture medium with high calcium. Melanocytes cultured in phorbolester containing F-10-medium featured transcripts of tyrosinase, TRP 1, and TRP 2 in the ratio 45:45:10. The same results were obtained for melanocytes co-cultured with keratinocytes under the two different culture conditions. In melanocytes cultured alone in co-culture media only TRP 1-transcripts were present. It is likely that under co-culture conditions a keratinocyte-derived factor supports the transcription of all three enzymes. For melanocytes in the phorbolester-containing melanocyte medium a proteinkinase C dependent regulation of transcription seems possible.

  13. Piebald trait: implication of kit mutation on in vitro melanocyte survival and on the clinical application of cultured epidermal autografts.

    Science.gov (United States)

    Bondanza, Sergio; Bellini, Melissa; Roversi, Gaia; Raskovic, Desanka; Maurelli, Riccardo; Paionni, Emanuel; Paterna, Patrizia; Dellambra, Elena; Larizza, Lidia; Guerra, Liliana

    2007-03-01

    Piebald trait leukoderma results from "loss-of-function" mutations in the kit gene. Correlations between mutation type and clinical phenotype have been reported. However, mutation classification has been mainly based on the clinical features of patients. The aim of this study was to get a better understanding of the pathogenesis of human piebaldism by establishing whether the kit mutation type may affect the in vitro survival/proliferation of patient melanocytes. Overall, the research was finalized to implement the clinical application of the autologous cultured epidermis in the treatment of piebald patients. Seven patients, who were transplanted with autologous in vitro reconstituted epidermis, showed an average percentage of repigmentation of 90.7. Six novel and one previously reported mutations were found and their postulated effects discussed in relation to the clinical phenotype and in vitro behavior of epidermal cells. Although mutation type did not impair repigmentation given by autotransplantation, it was shown to influence the survival/proliferation of co-cultured melanocytes and keratinocytes. In particular, tyrosine kinase domain mutations were found with melanocyte loss and keratinocyte senescence during expansion of epidermal cultures. Results indicate that the clinical application of cultured epidermis in piebald patients may be optimized by investigating mutation functional effects before planning surgical operations.

  14. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed

  15. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  16. Triggering apoptotic death of human epidermal keratinocytes by malic Acid: involvement of endoplasmic reticulum stress- and mitochondria-dependent signaling pathways.

    Science.gov (United States)

    Hsiao, Yu-Ping; Lai, Wan-Wen; Wu, Shi-Bei; Tsai, Chung-Hung; Tang, Sheau-Chung; Chung, Jing-Gung; Yang, Jen-Hung

    2015-01-09

    Malic acid (MA) has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT). The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs). Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX) but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR) was significantly decreased whereas extracellular acidification rate (ECAR) was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  17. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  18. Outcome of burns treated with autologous cultured proliferating epidermal cells: a prospective randomized multicenter intrapatient comparative trial

    NARCIS (Netherlands)

    Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.

    2016-01-01

    Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. H-Ras activation promotes cytoplasmic accumulation and phosphoinositide 3-OH kinase association of beta-catenin in epidermal keratinocytes

    DEFF Research Database (Denmark)

    Espada, J; Pérez-Moreno, M; Braga, V M

    1999-01-01

    keratinocytes. Microinjection or stable expression of V12Ras into keratinocytes promotes the loss of E-cadherin and alpha-catenin and relocalization of beta-catenin to the cytoplasm and nucleus. Moreover, these effects are dependent on PI3K (phosphoinositide 3-OH kinase) activity. Interestingly, a strong...

  1. Keratinocytes regulate the function of melanocytes

    Directory of Open Access Journals (Sweden)

    Tomohisa Hirobe

    2014-12-01

    Full Text Available Mammalian keratinocytes compose the bulk of the epithelium, undergo keratinization, and form the dead superficial layer of the skin. These superficial keratinized cells are continuously replaced by cells derived from mitotic cells in the lowest layer of the epidermis (i.e., the basal layer. Melanocytes locate in the basal layer and do not keratinize; however, they can produce melanin pigments. Melanin is accumulated in small granules called melanosomes. The melanosomes are transported to dendrites from which the melanosomes are transferred to keratinocytes. Epidermal invaginations such as keratinocytes and melanocytes extend to the dermis to form hair follicles. In addition to these two cells, dermal fibroblasts are also required for the formation of hair follicles. The homeostasis of the epidermis and hair follicle is primarily regulated by the cellular interaction between keratinocytes and melanocytes. Keratinocytes stimulate melanocyte functions such as proliferation, differentiation, melanogenesis, and dendritogenesis. Using the techniques of tissue culture, biochemistry, and molecular biology, factors that have been derived from keratinocytes are hormones, growth factors, and cytokines such as α-melanocyte-stimulating hormone, adrenocorticotrophic hormone, basic fibroblast growth factor, nerve growth factor, endothelins, granulocyte-macrophage colony-stimulating factor, stem cell factor, leukemia inhibitory factor, and hepatocyte growth factor. These keratinocyte-derived paracrine factors have a key role in regulating melanocyte function through receptor-mediated signaling pathways, followed by maintaining epidermal and hair follicular homeostasis.

  2. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved......, melanocytes, fibroblasts, dermal microvascular endothelial cells, peripheral blood mononuclear cells and sweat duct cells. The keratinocyte 2-D gel protein database will be updated yearly in the November issue of Electrophoresis. Udgivelsesdato: 1991-Nov...

  3. Infection of Keratinocytes with Trichophytum rubrum Induces Epidermal Growth Factor-Dependent RNase 7 and Human Beta-Defensin-3 Expression

    Science.gov (United States)

    Rademacher, Franziska; Schröder, Lena; Brasch, Jochen; Harder, Jürgen

    2014-01-01

    Human keratinocytes are able to express various antimicrobial peptides (AMP) to protect the skin from exaggerated microbial colonization and infection. Recently, in vitro growth-inhibiting activity of the skin-derived AMP psoriasin, RNase 7 and human beta-defensin (hBD)-2 against dermatophytes such as Trichophyton (T.) rubrum have been reported. To evaluate whether keratinocytes are able to respond to T. rubrum infection by an induced expression of AMP we exposed primary keratinocytes to living conidia of T. rubrum. This led to conidia germination and mycelial growth which was paralleled by a strong gene induction of the skin-derived AMP RNase 7 and hBD-3. Gene expression of the AMP psoriasin (S100A7) and hBD-2 were only slightly induced. The T. rubrum-mediated RNase 7 gene induction was accompanied by increased secretion of RNase 7. Parallel treatment of the keratinocytes with T. rubrum and the cytokine combination IL-17A/IFN-γ resulted in synergistic induction of RNase 7 and hBD-3 expression. Since patients receiving therapy by inhibition of the epidermal growth factor receptor (EGFR) more often suffer from dermatophytoses we investigated whether EGFR may be involved in the T. rubrum-mediated RNase 7 and hBD-3 induction. Primary keratinocytes incubated with an EGFR blocking antibody as well as with the EGFR antagonist AG1478 showed a significantly diminished RNase 7 and hBD-3 induction upon exposure of the keratinocytes to T. rubrum indicating that EGFR is involved in the T. rubrum-mediated induction of RNase 7 and hBD-3. The growth of T. rubrum in vitro was inhibited by hBD-3 in a dose-dependent manner suggesting that hBD-3 may contribute to cutaneous innate defense against T. rubrum. Taken together our data indicate that keratinocytes are able to initiate a fast defense response towards T. rubrum by the increased expression of AMP active against T. rubrum. A dysregulation of AMP may contribute to chronic and recurring dermatophytoses. PMID:24747887

  4. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  5. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  6. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  7. Treponema pallidum flagellins stimulate MMP-9 and MMP-13 expression via TLR5 and MAPK/NF-κB signaling pathways in human epidermal keratinocytes.

    Science.gov (United States)

    Jiang, Chuanhao; Xu, Man; Kuang, Xingxing; Xiao, Jinhong; Tan, Manyi; Xie, Yafeng; Xiao, Yongjian; Zhao, Feijun; Wu, Yimou

    2017-12-01

    Syphilis is a chronic disease caused by Treponema pallidum and the pathogenesis is still unclear. T. pallidum infection induced inflammatory responses are involved in the immunopathological damage in skin and other tissues. Flagellin, the monomeric subunit of bacterial flagella, is a classic pathogen associated molecular patterns (PAMPs) that interacts to TLR5 and induces inflammatory responses. Keratinocytes, as immune sentinels recognize the PAMPs via TLRs, play an important role in skin innate immune response. Matrix metalloproteinases (MMPs) expressed by keratinocytes are involved in skin inflammatory responses and promoting pathogens invasion. In this study, we demonstrate that FlaB1, FlaB2 and FlaB3, the flagellins of T. pallidum, induced MMP-9 and MMP-13 production in human immortalized keratinocytes cell line HaCaT. Silencing of TLR5, but not TLR2 and TLR4 attenuated MMP-9 and MMP-13 expressions induced by T. pallidum flagellins. MMP-9 and MMP-13 expressions were also be abrogated by transfection with a dominant negative (DN) plasmid of MyD88. We also found that treatment of HaCaT cells with FlaB1, FlaB2 and FlaB3 activate the MAPK and NF-κB signaling pathways. Inhibited of ERK, JNK, p38 and NF-κB suppressed MMP-9 expression induced by the FlaB1. MMP-13 expression was found to be suppressed by pretreatment with inhibitors of ERK, JNK and NF-κB, but not p38. These findings demonstrate that T. pallidum flagellins (FlaB1, FlaB2 or FlaB3) can stimulate MMP-9 and MMP-13 expression through TLR5 and MAPK/NF-κB signaling pathways in human epidermal keratinocytes, which could contribute to the pathogenesis of T. pallidum infection. Copyright © 2017. Published by Elsevier Inc.

  8. IL-2, IL-5, TNF-α and IFN-γ mRNA expression in epidermal keratinocytes of systemic lupus erythematosus skin lesions

    Directory of Open Access Journals (Sweden)

    José Ronaldo M Carneiro

    2011-01-01

    Full Text Available OBJECTIVE: To analyze cytokine gene expression in keratinocytes from patients with systemic lupus erythematosus (SLE. INTRODUCTION: Keratinocytes represent 95% of epidermal cells and can secrete several cytokines. METHODS: Keratinocytes were obtained by laser microdissection from 21 patients with SLE (10 discoid and 11 acute lesions at involved and uninvolved sites. All patients were receiving a low/moderate prednisone dose and 18 were receiving chloroquine diphosphate. IL-2, IL-5, TNF-α and IFN-γ gene expression was evaluated by real-time PCR and expressed as the ratio (R to a pool of skin samples from 12 healthy volunteers. RESULTS: Heterogeneity in cytokine gene expression was found among patients with SLE. Eighteen of 38 valid SLE samples (47% presented overexpression (R>1 of at least one cytokine. Lesional skin samples tended to show higher cytokine expression than samples from uninvolved skin (p = 0.06. IL-5 and IFN-γ were the most commonly overexpressed cytokines. Samples with cytokine overexpression corresponded to more extensive and severe lesions. Prednisone dose did not differ between samples without cytokine overexpression (15.71±3.45 mg/day and those with overexpressed cytokines (12.68±5.41 mg/day (p = 0.216. Samples from all patients not receiving diphosphate chloroquine had at least one overexpressed cytokine. CONCLUSIONS: The heterogeneous keratinocyte cytokine gene expression reflects the complex immunological and inflammatory background in SLE. Patients with severe/extensive skin lesions showed a higher frequency of cytokine gene overexpression. Increased IFN-γ and IL-5 expression suggests that Th1 and Th2 cells are involved in SLE skin inflammation. The possibility that prednisone and antimalarial drugs may have contributed to low cytokine gene expression in some samples cannot be ruled out.

  9. Primary cell culture from human oral tissue: gingival keratinocytes,gingival fibroblasts and periodontal ligament fibroblasts

    Directory of Open Access Journals (Sweden)

    Supreya Wanichpakorn

    2010-08-01

    Full Text Available Primary cell culture of human oral tissue has many applications for oral biology research. There are two techniques in primary culture, which includes the enzymatic and direct explant technique. The objectives of this study were (1 to isolate and investigate the difference in percentage the success in culturing three cell types from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts by using the direct explant technique; (2 to compare the effect of sex and age on the success of tissue culturing. Twenty seven tissue samples were obtained from healthy human gingival tissue, 19 female and 8 male patients aged 14-67 years (37.7±17.5. The tissue was cut into 1x1 mm pieces and placed on plastic culture plates containing Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 µg/ml streptomycin and 1% amphotericin B. For the keratinocytes culture, after the epithelial cells started to multiply around the gingival origin and the diameter was 2-5 mm., the fibroblasts were liminated by mechanical removal under inverted microscope to prevent fibroblast overgrowth and the medium was changed to keratinocyte-SFM (Gibco, BRL supplemented with 5 µg/ml gentamycin. The results revealed that gingival fibroblast gave the highest success rate in culture (96.3%, followed by gingival keratinocytes (88.9% and periodontal ligament fibroblasts (81.5%. There was no significant difference in the success rate of cultivation between younger and older individuals, as between sex of the subjects (p>0.05. The risk of failure in culture techniques is mainly caused by microbiological contamination from the tissue samples.

  10. Eradication of damaged keratinocytes in cutaneous lichen planus forms demonstrated by evaluation of epidermal and follicular expression of CK15, indices of apoptosis and regulatory protein S100.

    Science.gov (United States)

    Upeniece, Ilze; Groma, Valerie; Skuja, Sandra; Cauce, Vinita

    The study of cytoskeleton arrangement and its contribution to survival of cell-to-cell contacts appears to be essential for understanding of numerous cellular and tissue processes. Applying CK15, S100 labeling and TUNEL reaction to cutaneous lichen planus subtypes, we found CK15 expression in the outer and inner root sheath of hair follicles, the basal epidermal layer, and eccrine glands. Its follicular expression was decreased in nearby inflammatory infiltrates. The CK15 immunopositivity was mostly described as weak (92.3%) for lichen planus but equally subdivided into weak, moderate and strong in lichen planopilaris (2 = 32.514; df = 4; p lichen planopilaris involving the scalp: 81.2 ±10.7; 87.8 ±10.7 and 88.0 ±10.5 for the basal, spinous and upper epidermal layers, respectively. S100 positive epidermal and follicular cells did not differ in the lesions demonstrated in the study groups; still immunoreactivity was more pronounced in the scalp region of lichen planopilaris. Damage of cell-to-cell contacts was confirmed by electron microscopy. Apart from immunocyte-mediated keratinocyte death, cytoskeleton-based injury and loss of cell-to-cell and matrix contacts may be of great importance, leading to eradication of degrading cells and thus contributing to the pathogenesis of lichen planus.

  11. Eradication of damaged keratinocytes in cutaneous lichen planus forms demonstrated by evaluation of epidermal and follicular expression of CK15, indices of apoptosis and regulatory protein S100

    Directory of Open Access Journals (Sweden)

    Ilze Upeniece

    2016-11-01

    Full Text Available The study of cytoskeleton arrangement and its contribution to survival of cell-to-cell contacts appears to be essential for understanding of numerous cellular and tissue processes. Applying CK15, S100 labeling and TUNEL reaction to cutaneous lichen planus subtypes, we found CK15 expression in the outer and inner root sheath of hair follicles, the basal epidermal layer, and eccrine glands. Its follicular expression was decreased in nearby inflammatory infiltrates. The CK15 immunopositivity was mostly described as weak (92.3% for lichen planus but equally subdivided into weak, moderate and strong in lichen planopilaris (2 = 32.514; df = 4; p < 0.001. The greatly varying apoptotic index was the highest in the lichen planopilaris involving the scalp: 81.2 ±10.7; 87.8 ±10.7 and 88.0 ±10.5 for the basal, spinous and upper epidermal layers, respectively. S100 positive epidermal and follicular cells did not differ in the lesions demonstrated in the study groups; still immunoreactivity was more pronounced in the scalp region of lichen planopilaris. Damage of cell-to-cell contacts was confirmed by electron microscopy. Apart from immunocyte-mediated keratinocyte death, cytoskeleton-based injury and loss of cell-to-cell and matrix contacts may be of great importance, leading to eradication of degrading cells and thus contributing to the pathogenesis of lichen planus.

  12. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...... components in keratinocytes and epidermis following stimulation with proinflammatory cytokines. Importantly, EGFR inhibition of cultured keratinocytes either alone or in combination with proinflammatory stimulus promoted activation of the complement system after incubation with serum. In keratinocytes...... wounds in vivo and in cultured keratinocytes after exposure to supernatant from stimulated mononuclear cells. In contrast, the epidermal expression of complement components was downregulated in ex vivo injured skin lacking the stimulation from infiltrating inflammatory cells but with intact injury...

  13. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... that could explain regional variation in epithelial growth and wound healing. Normal human fibroblasts were cultured on polystyrene or maintained in collagen matrix and stimulated with keratinocytes cultured on membranes. The amount of HGF and KGF protein in the culture medium was determined every 24 h for 5...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...

  14. Experimental model of cultured keratinocytes Modelo experimental de cultura de queratinócitos

    Directory of Open Access Journals (Sweden)

    Alfredo Gragnani

    2003-01-01

    Full Text Available The bioengineering research is essential in the development of ideal combination of biomaterials and cultured cells to produce the permanent wound coverage. The experimental model of cultured keratinocytes presents all steps of the culture, since the isolation of the keratinocytes, preparation of the human acellular dermis, preparation of the composite skin graft and their elevation to the air-liquid interface. The research in cultured keratinocytes model advances in two main ways: 1. optimization of the methods in vitro to the skin cells culture and proliferation and 2. developing biomaterials that present similar skin properties.A pesquisa em bioengenharia é primordial no desenvolvimento da combinação ideal de biomateriais e células cultivadas para produzir a cobertura definitiva das lesões. O modelo experimental da cultura de queratinócitos apresenta toda as etapas do cultivo, desde o isolamento dos queratinócitos, preparação da derme acelular humana, do enxerto composto e da sua elevação à interface ar-líquido. A pesquisa em modelo de cultura de queratinócitos desenvolve-se em duas vias principais: 1. otimização dos métodos in vitro para cultivo e proliferação de células da pele e 2. desenvolvimento de biomateriais que mimetizem as propriedades da pele.

  15. APR-246/PRIMA-1(MET) rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations

    NARCIS (Netherlands)

    Shen, J.; Bogaard, E.H.J. van den; Kouwenhoven, E.N.; Bykov, V.J.; Rinne, T.K.; Zhang, Q.; Tjabringa, G.S.; Gilissen, C.F.H.A.; Heeringen, S.J. van; Schalkwijk, J.; Bokhoven, J.H.L.M. van; Wiman, K.G.; Zhou, H.

    2013-01-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly,

  16. Epidermal Growth Factor Receptor Transactivation Is Required for Mitogen-Activated Protein Kinase Activation by Muscarinic Acetylcholine Receptors in HaCaT Keratinocytes

    Directory of Open Access Journals (Sweden)

    Wymke Ockenga

    2014-11-01

    Full Text Available Non-neuronal acetylcholine plays a substantial role in the human skin by influencing adhesion, migration, proliferation and differentiation of keratinocytes. These processes are regulated by the Mitogen-Activated Protein (MAP kinase cascade. Here we show that in HaCaT keratinocytes all five muscarinic receptor subtypes are expressed, but M1 and M3 are the subtypes involved in mitogenic signaling. Stimulation with the cholinergic agonist carbachol leads to activation of the MAP kinase extracellular signal regulated kinase, together with the protein kinase Akt. The activation is fully dependent on the transactivation of the epidermal growth factor receptor (EGFR, which even appears to be the sole pathway for the muscarinic receptors to facilitate MAP kinase activation in HaCaT cells. The transactivation pathway involves a triple-membrane-passing process, based on activation of matrix metalloproteases, and extracellular ligand release; whereas phosphatidylinositol 3-kinase, Src family kinases or protein kinase C do not appear to be involved in MAP kinase activation. Furthermore, phosphorylation, ubiquitination and endocytosis of the EGF receptor after cholinergic transactivation are different from that induced by a direct stimulation with EGF, suggesting that ligands other than EGF itself mediate the cholinergic transactivation.

  17. Kanglaite attenuates UVB-induced down-regulation of aquaporin-3 in cultured human skin keratinocytes

    Science.gov (United States)

    SHAN, SHI-JUN; XIAO, TING; CHEN, JOHN; GENG, SHI-LING; LI, CHANG-PING; XU, XUEGANG; HONG, YUXIAO; JI, CHAO; GUO, YING; WEI, HUACHEN; LIU, WEI; LI, DAPENG; CHEN, HONG-DUO

    2012-01-01

    Ultraviolet (UV) radiation plays an important role in the pathogenesis of skin photoaging. Depending on the wavelength of UV, the epidermis is affected primarily by UVB. One major characteristic of photoaging is the dehydration of the skin. Membrane-inserted water channels (aquaporins) are involved in this process. In this study we demonstrated that UVB radiation induced aquaporin-3 (AQP3) down-regulation in cultured human skin keratinocytes. Kanglaite is a mixture consisting of extractions of Coix Seed, which is an effective anti-neoplastic agent and can inhibit the activities of protein kinase C and NF-κB. We demonstrated that Kanglaite inhibited UVB-induced AQP3 down-regulation of cultured human skin keratinocytes. Our findings provide a potential new agent for anti-photoaging. The related molecular mechanisms remain to be further elucidated. PMID:22211241

  18. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  19. Effect of different alcohols on stratum corneum kallikrein 5 and phospholipase A2together with epidermal keratinocytes and skin irritation.

    Science.gov (United States)

    Cartner, T; Brand, N; Tian, K; Saud, A; Carr, T; Stapleton, P; Lane, M E; Rawlings, A V

    2017-04-01

    The aim of this exploratory study was to investigate the effect of ethanol, isopropanol and n-propanol on stratum corneum (SC) enzymes and keratinocytes in vitro together with their effects on skin condition and function. Activities of kallikrein 5 (KLK5) and phospholipase A2 (PLA2) as well as keratinocyte metabolic activity, interleukin-1α (IL-1α) and tumor necrosis factor-α (TNF-α) were measured in vitro in the presence and absence of the different alcohols. We also measured transepidermal water loss (TEWL), skin capacitance, visual dryness and visual redness on the volar forearms of 25 Caucasian women following application of the alcohols 20 and 100 times per day over a period of 14 days in a clinical study. Reduced activities of KLK5 and PLA2 were observed in the presence of the alcohols. The greatest denaturing effect was always observed for n-propanol (P effect of isopropanol was greater than ethanol (P effects on keratinocyte metabolic activity and cytokine secretion (P effects were on the induction of skin irritation (increased dropout rates) and ranked the intolerance of the different alcohols as follows: n-propanol > isopropanol > ethanol. At the high application frequencies, the effect of the different alcohols on transepidermal water loss (TEWL) and skin capacitance was similar, but at the low application frequencies, n-propanol had a significant effect on TEWL and capacitance values (P alcohols and should be the active ingredient of choice. © 2016 The Authors. International Journal of Cosmetic Science published by John Wiley & Sons Ltd on behalf of Society of Cosmetic Scientists and Société Française de Cosmétologie.

  20. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  1. Hypotonic stress induces E-cadherin expression in cultured human keratinocytes.

    Science.gov (United States)

    Kippenberger, Stefan; Loitsch, Stefan; Guschel, Maike; Müller, Jutta; Kaufmann, Roland; Bernd, August

    2005-01-03

    Human epidermis marks the interface between internal and external environments with the major task being to maintain body hydration. Alternating exposure of skin to a dry or humid environment is likely to cause changes in the epidermal water gradient resulting in osmotic alterations of epidermal keratinocytes. The present in vitro approach studied the effect of hypotonicity on cell-cell contact. It was demonstrated that hypotonic stress applied to human epithelial cells (HaCaT, A-431) induced upregulation of E-cadherin at both, the protein and mRNA level. 5'-deletional mutants of the E-cadherin promoter identified an element ranging from -53 to +31 that conveyed strong transactivation under hypotonic stress. In order to define relevant upstream regulators members of the MAP kinase family, the epidermal growth factor receptor (EGFR) and protein kinase B/Akt (PKB/Akt) were investigated. Hypotonic conditions led to a fast activation of ERK1/2, SAPK/JNK, p38, EGFR and PKB/Akt with distinct activation patterns. Experiments using specific inhibitors showed that p38 contributes to the E-cadherin transactivation under hypotonic conditions. Further upstream, adhesion was found to be a prerequisite for E-cadherin transactivation in this model. In summary, the present study provides evidence that E-cadherin is an osmo-sensitive gene that responds to hypotonic stress. The function of this regulation may be found in morphological changes induced by cell swelling. It is likely that induction of E-cadherin contributes to the stabilization between adjacent cells in order to withstand the physical forces induced by hypotonicity.

  2. Cell proliferation and cytokine induction by TNF-α of psoriatic keratinocytes are not different from normal keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Takahashi Hidetoshi

    2009-01-01

    Full Text Available Background: Recent studies indicate that various cytokines including tumor necrosis factor-á (TNF-á play an essential role in the induction and maintenance of psoriatic lesion. Aims: To compare the cell proliferation of keratinocytes by various cytokines and TNF-á-induced cytokine secretion among normal keratinocytes, uninvolved, and involved keratinocytes. Methods: The keratinocytes from normal skin, uninvolved, and involved psoriasis were cultured in the presence of IL-6, IL-8, epidermal growth factor (EGF, hepatocyte growth factor (HGF, transforming growth factor-α (TGF-α epiregulin, amphiregulin, and TNF-α and then MTT assay for keratinocytes proliferation was performed. Furthermore, TNF-α-induced secretion of IL-6, IL-8, EGF, HGF, TGF-α, epiregulin, and amphiregulin were compared among these keratinocytes. Results: IL-6, IL-8, EFG, TGF-á, epiregulin, and amphiregulin, but not TNF-α increased keratinocyte proliferation of normal, psoriatic uninvolved, and involved skin. The increased cell proliferation by these cytokines and growth factors were not different among the keratinocytes derived from normal skin, uninvolved, and involved psoriasis. The significant induction of TNF-α increased IL-6, IL-8, EGF, HGF, TGF-α, epiregulin, and amphiregulin, but the increase in these cytokines and growth factors were not different among normal skin, uninvolved, and involved psoriasis. Conclusion: Cell proliferation by various cytokines and growth factors and TNF-α-induced cytokine secretion are not different between normal and psoriatic keratinocytes. α

  3. Phototoxic effects of Hypericum extract in cultures of human keratinocytes compared with those of psoralen.

    Science.gov (United States)

    Bernd, A; Simon, S; Ramirez Bosca, A; Kippenberger, S; Diaz Alperi, J; Miquel, J; Villalba Garcia, J F; Pamies Mira, D; Kaufmann, R

    1999-02-01

    Extracts of Hypericum perforatum (St. John's wort) are used in the treatment of depression. They contain the plant pigment hypericin and hypericin derivates. These compounds have light-dependent activities. In order to estimate the potential risk of phototoxic skin damage during antidepressive therapy, we investigated the phototoxic activity of hypericin extract using cultures of human keratinocytes and compared it with the effect of the well-known phototoxic agent psoralen. The absorbance spectrum of our Hypericum extract revealed maxima in the whole UV range and in parts of the visible range. We cultivated human keratinocytes in the presence of different Hypericum concentrations and irradiated the cells with 150 mJ/cm2 UVB, 1 J/cm2 UVA or 3 h with a white light of photon flux density 2.6 mumol m-2 s-1. The determination of the bromodeoxyuridine incorporation rate showed a concentration- and light-dependent decrease in DNA synthesis with high hypericin concentrations (> or = 50 micrograms/mL) combined with UVA or visible light radiation. In the case of UVB irradiation a clear phototoxic cell reaction was not detected. We found phototoxic effects even with 10 ng/mL psoralen using UVA with the same study design as in the case of the Hypericum extract. These results confirm the phototoxic activity of Hypericum extract on human keratinocytes. However, the blood levels that are to be expected during antidepressive therapy are presumably too low to induce phototoxic skin reactions.

  4. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  5. TiO2 nanoparticles alleviate toxicity by reducing free Zn2+ ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    Science.gov (United States)

    Kathawala, Mustafa Hussain; Ng, Kee Woei; Loo, Say Chye Joachim

    2015-06-01

    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO2) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO2, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO2 was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml-1 after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO2 nanoparticles which remained non-toxic until very high concentrations. It was found that TiO2 nanoparticles could play "vigilante" by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO2 nanoparticles caused an attenuation of free intracellular Zn2+ ions concentration, by adsorbing and immobilizing free Zn2+ ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  6. TiO{sub 2} nanoparticles alleviate toxicity by reducing free Zn{sup 2+} ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Kathawala, Mustafa Hussain; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)

    2015-06-15

    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO{sub 2}) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO{sub 2}, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO{sub 2} was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml{sup −1} after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO{sub 2} nanoparticles which remained non-toxic until very high concentrations. It was found that TiO{sub 2} nanoparticles could play “vigilante” by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO{sub 2} nanoparticles caused an attenuation of free intracellular Zn{sup 2+} ions concentration, by adsorbing and immobilizing free Zn{sup 2+} ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  7. Wound-Healing Potential of Cultured Epidermal Sheets Is Unaltered after Lyophilization: A Preclinical Study in Comparison to Cryopreserved CES

    Directory of Open Access Journals (Sweden)

    H. Jang

    2013-01-01

    Full Text Available Lyophilized Cultured Epidermal Sheets (L-CES have been reported to be as effective as the cryopreserved CES (F-CES in treating skin ulcers. However, unlike F-CES, no preclinical study assessing wound-healing effects has been conducted for L-CES. The present study was set out to investigate the microstructure, cytokine profile, and wound-healing effects of L-CES in comparison to those of F-CES. Keratinocytes were cultured to prepare CES, followed by cryopreservation at −70°C and lyophilization. Under microscopic observation, intact cells with apparent intracellular junctions were observed in L-CES. The L-CES, like fresh CES, consisted of three to four well-maintained epidermal layers, as shown by the expression of keratins, involucrin, and p63. There were no differences in the epidermal layer or protein expression between L-CES and F-CES, and both CES were comparable to fresh CES. TGF-α, EGF, VEGF, IL-1α, and MMPs were detected in L-CES at levels similar to those in F-CES. In a mouse study, wounds treated with L-CES or F-CES completely healed at least 4 days faster than untreated wounds. CES-treated wounds completely healed by day 10, while the untreated wounds did not heal by day 14. Masson’s trichrome staining showed that collagen deposition in the CES-treated wounds was highly increased in the dermis of the wound center compared to that in the control wounds. Thus, this study demonstrates that L-CES is as clinically effective as F-CES for wound treatment.

  8. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  9. The IL-8 release from cultured human keratinocytes, mediated by antibodies to bullous pemphigoid autoantigen 180, is inhibited by dapsone

    Science.gov (United States)

    Schmidt, E; Reimer, S; Kruse, N; Bröcker, E-B; Zillikens, D

    2001-01-01

    Bullous pemphigoid (BP) is a subepidermal blistering disease associated with autoantibodies to the hemidesmosomal 180 kD BP autoantigen (BP180). However, the binding of autoantibodies to BP180 alone is not sufficient for blister formation in this disease and the infiltration of neutrophils into the skin is required. Dapsone and nicotinamide inhibit neutrophil chemotaxis and are used effectively in treating BP. IL-8 is a known chemoattractant for neutrophils and has been implicated in the inflammatory process of both human and experimental murine BP. We have recently shown that antibodies to BP180 mediate a dose and time-dependent release of IL-6 and IL-8 from cultured normal human epidermal keratinocytes (NHEK). In the present study, we addressed the question whether dapsone or nicotinamide influence this cytokine release. We demonstrate that dapsone, but not nicotinamide, in its pharmacological range, inhibits the IL-8, but not the IL-6 release from NHEK, induced by anti-BP180 IgG, in a dose-dependent fashion as detected by ELISA. IL-8 mRNA levels, as determined by RT-PCR, were the same in cells treated with BP IgG alone compared to cells treated with BP IgG plus dapsone. This observation suggests that dapsone inhibits the BP IgG-induced IL-8 release from cultured NHEK by mechanisms at the post-transcriptional level. Our findings contribute to the understanding how dapsone leads to a reduced influx of neutrophils into BP lesions and, finally, to the cessation of blister formation in this disease. PMID:11359455

  10. Photoprotective Potential of Glycolic Acid by Reducing NLRC4 and AIM2 Inflammasome Complex Proteins in UVB Radiation-Induced Normal Human Epidermal Keratinocytes and Mice.

    Science.gov (United States)

    Hung, Sung-Jen; Tang, Sheau-Chung; Liao, Pei-Yun; Ge, Jheng-Siang; Hsiao, Yu-Ping; Yang, Jen-Hung

    2017-02-01

    Exposure to UVB radiation induces inflammation and free radical-mediated oxidative stress through reactive oxygen species (ROS) that play a crucial role in the induction of skin cancer. Glycolic acid (GA) is frequently used in cosmetics and dermatology. The aim of the study was to analyze the photoprotective mechanisms through which GA retards UVB-induced ROS accumulation and inflammation in normal human epidermal keratinocytes (NHEKs) and mice skin, respectively. NHEK cell line and C57BL/6J mice were treated with GA (0.1 or 5 mM) for 24 h followed by UVB irradiation. ROS accumulation, DNA damage, and expression of inflammasome complexes (NLRP3, NLRC4, ASC, and AIM2) were measured in vitro. Epidermal thickness and inflammasome complex proteins were analyzed in vivo. GA significantly prevented UVB-induced loss of skin cell viability, ROS formation, and DNA damage (single and double strands DNA break). GA suppressed the mRNA expression levels of NLRC4 and AIM2 among the inflammasome complexes. GA also blocked interleukin (IL)-1β by reducing the activity of caspase-1 in the NHEKs. Treatment with GA (2%) inhibited UVB-induced inflammation marker NLRC4 protein levels in mouse dorsal skin. The photoprotective activity of GA was ascribed to the inhibition of ROS formation and DNA damage, as well as a reduction in the activities of inflammasome complexes and IL-1β. We propose that GA has anti-inflammatory and photoprotective effects against UVB irradiation. GA is potentially beneficial to the protection of human skin from UV damage.

  11. Micropatterned dermal-epidermal regeneration matrices create functional niches that enhance epidermal morphogenesis.

    Science.gov (United States)

    Clement, Amanda L; Moutinho, Thomas J; Pins, George D

    2013-12-01

    Although tissue engineered skin substitutes have demonstrated some clinical success for the treatment of chronic wounds such as diabetic and venous ulcers, persistent graft take and stability remain concerns. Current bilayered skin substitutes lack the characteristic microtopography of the dermal-epidermal junction that gives skin enhanced mechanical stability and creates cellular microniches that differentially promote keratinocyte function to form skin appendages and enhance wound healing. We developed a novel micropatterned dermal-epidermal regeneration matrix (μDERM) which incorporates this complex topography and substantially enhances epidermal morphology. Here, we describe the use of this three-dimensional (3-D) in vitro culture model to systematically evaluate different topographical geometries and to determine their relationship to keratinocyte function. We identified three distinct keratinocyte functional niches: the proliferative niche (narrow geometries), the basement membrane protein synthesis niche (wide geometries) and the putative keratinocyte stem cell niche (narrow geometries and corners). Specifically, epidermal thickness and keratinocyte proliferation is significantly (p<0.05) increased in 50 and 100 μm channels while laminin-332 deposition is significantly (p<0.05) increased in 400 μm channels compared to flat controls. Additionally, β1(bri)p63(+) keratinocytes, putative keratinocyte stem cells, preferentially cluster in channel geometries (similar to clustering observed in native skin) compared to a random distribution on flats. This study identifies specific target geometries to enhance skin regeneration and graft performance. Furthermore, these results suggest the importance of μDERM microtopography in designing the next generation of skin substitutes. Finally, we anticipate that 3-D organotypic cultures on μDERMS will provide a novel tissue engineered skin substitute for in vitro investigations of skin morphogenesis, wound healing and

  12. Hyaluronan-Phosphatidylethanolamine Polymers Form Pericellular Coats on Keratinocytes and Promote Basal Keratinocyte Proliferation

    Science.gov (United States)

    Symonette, Caitlin J.; Tan, Xiao Cherie; Tolg, Cornelia; Ma, Jenny; Perera, Francisco; Turley, Eva A.

    2014-01-01

    Aged keratinocytes have diminished proliferative capacity and hyaluronan (HA) cell coats, which are losses that contribute to atrophic skin characterized by reduced barrier and repair functions. We formulated HA-phospholipid (phosphatidylethanolamine, HA-PE) polymers that form pericellular coats around cultured dermal fibroblasts independently of CD44 or RHAMM display. We investigated the ability of these HA-PE polymers to penetrate into aged mouse skin and restore epidermal function in vivo. Topically applied Alexa647-HA-PE penetrated into the epidermis and dermis, where it associated with both keratinocytes and fibroblasts. In contrast, Alexa647-HA was largely retained in the outer cornified layer of the epidermis and quantification of fluorescence confirmed that significantly more Alexa647-HA-PE penetrated into and was retained within the epidermis than Alexa647-HA. Multiple topical applications of HA-PE to shaved mouse skin significantly stimulated basal keratinocyte proliferation and epidermal thickness compared to HA or vehicle cream alone. HA-PE had no detectable effect on keratinocyte differentiation and did not promote local or systemic inflammation. These effects of HA-PE polymers are similar to those reported for endogenous epidermal HA in youthful skin and show that topical application of HA-PE polymers can restore some of the impaired functions of aged epidermis. PMID:25276814

  13. Role of STIM1- and Orai1-mediated Ca2+ entry in Ca2+-induced epidermal keratinocyte differentiation.

    Science.gov (United States)

    Numaga-Tomita, Takuro; Putney, James W

    2013-01-15

    The uppermost thin layer on the surface of the skin, called the epidermis, is responsible for the barrier function of the skin. The epidermis has a multilayered structure in which each layer consists of keratinocytes (KCs) of different differentiation status. The integrity of KC differentiation is crucial for the function of skin and its loss causes or is accompanied by skin diseases. Intracellular and extracellular Ca(2+) is known to play important roles in KC differentiation. However, the molecular mechanisms underlying Ca(2+) regulation of KC differentiation are still largely unknown. Store-operated Ca(2+) entry (SOCE) is a major Ca(2+) influx pathway in most non-excitable cells. SOCE is evoked in response to a fall in Ca(2+) concentration in the endoplasmic reticulum. Two proteins have been identified as essential components of SOCE: STIM1, a Ca(2+) sensor in the ER, and Orai1, a subunit of Ca(2+) channels in the plasma membrane. In this study, we analyzed the contribution of SOCE to KC growth and differentiation using RNAi knockdown of STIM1 and Orai1 in the human keratinocyte cell line, HaCaT. KC differentiation was induced by a switch in extracellular Ca(2+) concentration from low (0.03 mM; undifferentiated KCs) to high (1.8 mM; differentiated KCs). This Ca(2+) switch triggers phospholipase-C-mediated intracellular Ca(2+) signals (Ca(2+)-switch-induced Ca(2+) response), which would probably involve the activation of SOCE. Knockdown of either STIM1 or Orai1 strongly suppressed SOCE and almost completely abolished the Ca(2+)-switch-induced Ca(2+) responses, resulting in impaired expression of keratin1, an early KC differentiation marker. Furthermore, loss of either STIM1 or Orai1 suppressed normal growth of HaCaT cells in low Ca(2+) and inhibited the growth arrest in response to a Ca(2+) switch. These results demonstrate that SOCE plays multiple crucial roles in KC differentiation and function.

  14. [The effect of retrovirus-mediated hTRT transfection into cultured oral keratinocytes].

    Science.gov (United States)

    Huang, Ji-yan; Liu, Wei; Zhou, Zeng-tong; Zhou, Hai-wen

    2014-06-01

    Human telomerase reverse transcriptase (hTRT) was transfected into cultured oral keratinocytes (OKC) mediated by pBABE-tert recombined retrovirus to investigate the effect on OKC lifespan. pBABE-tert recombined retrovirus loaded with hTRT gene was amplified by transfected PT67 cells, and then transfected into cultured OKC in vitro. The positive clones of OKC were separated by puromycin and subcultured. Telomerase activity was analyzed by telomerase PCR-ELISA and PCR-PAGE. The hTRT positive clones of OKC showed telomerase expression, with extending lifespan to 8-9 passages. The hTRT transfected OKC can prolong doubly lifespan but not be immortalized, which indicates that cellular immortality mechanism is complicated and multi-controled. Telomerase activity is the key for cell immortalization but not the only impact factor.

  15. Rhodiola rosea ability to enrich cellular antioxidant defences of cultured human keratinocytes.

    Science.gov (United States)

    Calcabrini, Cinzia; De Bellis, Roberta; Mancini, Umberto; Cucchiarini, Luigi; Potenza, Lucia; De Sanctis, Roberta; Patrone, Vania; Scesa, Carla; Dachà, Marina

    2010-04-01

    Keratinocytes are cells strongly exposed to oxidative stress, but normally good equipped for antioxidant responses. However, it has long been suggested that exogenous antioxidants could play a useful role in minimizing the adverse skin responses associated with such oxidant species. In this work it was paid attention to the extract of Rhodiola rosea L. roots by using the phytocomplex as a whole because of the important activity of its composition and mutual distribution of its components. We have measured the protection afforded by the extract to reduced glutathione levels, glyceraldehyde-3-phosphate dehydrogenase activity, and thiobarbituric acid reactive substances levels in cultured human keratinocytes (NCTC 2544) exposed to different oxidative insults: Fe(II)/ascorbate, Fe(II)/H(2)O(2), and tert-butyl-hydroperoxide. We also have investigated the influence of the R. rosea extract on the production of intracellular reactive oxygen species and on the activity of antioxidant enzymes (catalase, superoxide dismutase, glutathione peroxidase, and glutathione reductase). Furthermore, we have demonstrated that R. rosea extract was able to increase in a time- and dose-dependent manner the activity of the trans plasma membrane oxido reductase activity as an indirect evaluation of the intracellular redox status and this effect was already evident with small concentration of the extract and in a long time. As a result, NCTC 2544 are able to better counteract to several oxidative insults if incubated with R. rosea extract demonstrating a very good antioxidant activity of this phytocomplex.

  16. Recombinant adeno-associated virus type 2-mediated gene transfer into human keratinocytes is influenced by both the ubiquitin/proteasome pathway and epidermal growth factor receptor tyrosine kinase.

    Science.gov (United States)

    Braun-Falco, Markus; Eisenried, Angelika; Büning, Hildegard; Ring, Johannes

    2005-05-01

    Efficient gene delivery into keratinocytes is a prerequisite for successful skin gene therapy. Vectors based on recombinant adeno-associated virus type 2 (rAAV-2) offer several promising features that make them attractive for cutaneous applications. However, highly efficient gene delivery may be hampered by different cellular factors, including lack of viral receptors, impairment of cytoplasmic trafficking or limitations in viral second-strand synthesis. This study was undertaken to find factors that influence rAAV-2-mediated in vitro gene transfer into human keratinocytes and, consequently, ways to optimize gene delivery. Transduction experiments using rAAV-2 vectors expressing green fluorescent protein (GFP) demonstrated that impaired cellular trafficking of vector particles and high levels of autophosphorylation at epidermal growth factor receptor tyrosine kinase (EGF-R TK) have a negative influence on gene transfer into keratinocytes. Treatment of keratinocytes with proteasome inhibitor MG132 resulted in a transient augmentation of GFP expression in up to 37% of cells. Treatment with EGF-R TK inhibitors (quinazoline type) enhanced transgene expression in 10-14.5% of the cells. Gene expression was stable for more than 10 weeks and persisted until proliferative senescence occurred. This stable gene expression allows speculation that keratinocyte stem cells have initially been transduced. These findings might have relevance for the use of rAAV-2 vectors in skin gene therapy: transient enhancement of rAAV-2 transduction with proteasome inhibitors might be useful for genetic promotion of wound healing or skin-directed vaccination. Treatment with quinazolines may increase rAAV-2 transduction of keratinocyte stem cells, which is important for gene therapy approaches to inherited diseases.

  17. The Inflammasome and the Epidermal Growth Factor Receptor (EGFR Are Involved in the Staphylococcus aureus-Mediated Induction of IL-1alpha and IL-1beta in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Maren Simanski

    Full Text Available Staphylococcus (S. aureus is an important pathogen causing various infections including those of the skin. Keratinocytes are able to sense invading S. aureus and to initiate a fast defense reaction by the rapid release of innate defense mediators such as antimicrobial peptides and cytokines. There is increasing evidence that the cytokines IL-1alpha and IL-1beta, which both signal through the IL-1 receptor, play an important role in cutaneous defense against S. aureus. The aim of this study was to gain more insight into the underlying mechanisms leading to the S. aureus-induced IL-1alpha and IL-1beta expression in keratinocytes. Infection of human primary keratinocytes with S. aureus led to the induction of gene expression and protein secretion of IL-1alpha and IL-1beta. Full S. aureus-induced IL-1 protein release required the inflammasome components caspase-1 and ASC (apoptosis-associated speck-like protein containing a CARD whereas gene induction of IL-1alpha and IL-beta by S. aureus was not dependent on caspase-1 and ASC. Since patients receiving anti-cancer therapy by inhibition of the epidermal growth factor receptor (EGFR often suffer from skin infections caused by S. aureus we additionally evaluated whether the EGFR pathway may be involved in the IL-1alpha and IL-1beta induction by S. aureus. Inactivation of the EGFR with a blocking antibody decreased the S. aureus-mediated IL-1alpha and IL-1beta induction in primary keratinocytes. Moreover, the use of siRNA experiments revealed that ADAM17 (A Disintegrin and A Metalloprotease 17, a metalloproteinase known to mediate the shedding and release of EGFR ligands, was required for full induction of IL-1alpha and IL-1beta in keratinocytes infected with S. aureus. A failure of keratinocytes to adequately upregulate IL-1alpha and IL-1beta may promote S. aureus skin infections.

  18. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  19. Epidermal RelA specifically restricts contact allergen-induced inflammation and apoptosis in skin.

    Science.gov (United States)

    Kumari, Snehlata; Herzberg, Benjamin; Pofahl, Ruth; Krieg, Thomas; Haase, Ingo

    2014-10-01

    Strong inhibition of NF-κB signaling in the epidermis results in spontaneous skin inflammation in mice and men. As there is evidence for linkage between polymorphisms within the NF-κB signaling pathway and human inflammatory skin phenotypes, we asked whether partial functional inhibition of NF-κB signaling in epidermal keratinocytes can modulate clinically relevant skin inflammation. We therefore mutated rela specifically in the epidermis of mice (RelA(E-MUT) mice). These mice show no inflammatory phenotype. Induction of contact allergy, but not croton oil-induced irritant dermatitis, resulted in stronger ear swelling and increased epidermal thickness in RelA(E-MUT) mice. Both contact allergen and croton oil treatment led to increased expression of calgranulins A and B (S100A8/A9) in RelA(E-MUT) mice. Epidermal hyperproliferation in RelA(E-MUT) mice was non-cell autonomous as cultured primary epidermal keratinocytes from RelA(E-MUT) mice showed reduced proliferation compared with controls. These results demonstrate that epidermal RelA specifically regulates delayed-type hypersensitivity-induced skin inflammation. In addition, we describe here an essential but nonspecific function of RelA in the protection of epidermal keratinocytes from apoptosis. Our study identifies functions of NF-κB signaling in the epidermis and corroborates a specific role of epidermal keratinocytes in the regulation of skin inflammation.

  20. A flexible thermoresponsive cell culture substrate for direct transfer of keratinocyte cell sheets.

    Science.gov (United States)

    Praveen, Wulligundam; Madathil, Bernadette K; Sajin Raj, R S; Kumary, T V; Anil Kumar, P R

    2017-10-25

    Most cell sheet engineering systems require a support or carrier to handle the harvested cell sheets. In this study, polyethylene terephthalate-based overhead projection transparency sheets (OHPS) were subjected to surface hydrolysis by alkali treatment to increase pliability and hydrophilicity and enable poly(N-isopropylacrylamide-co-glycidylmethacrylate) copolymer (NGMA) coating to impart thermoresponsiveness. NGMA was applied on the modified OHPS by the technique of spin coating using an indigenously designed spin coater. The spin coating had the advantage of using low volumes of the polymer and a reduced coating time. The surface chemistry and thermoresponsive coating was analyzed by Fourier transform infrared spectroscopy and water contact angle. Human keratinocyte cells were cultured on the spin coated surface and scaffold-free cell sheets were successfully harvested by simple variation of temperature. These cell sheets were found to be viable, exhibited epithelial characteristic and cell-cell contact as confirmed by positive immunostaining for ZO-1. The integrity and morphology of the cell sheet was confirmed by stereomicroscopy and E-SEM. These results highlight the potential of the NGMA spin coated modified OHPS to serve as a thermoresponsive culture surface-cum-flexible transfer tool.

  1. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  2. Effect of Storage Temperature on Structure and Function of Cultured Human Oral Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Rakibul Islam

    Full Text Available To assess the effect of storage temperature on the viability, phenotype, metabolism, and morphology of cultured human oral keratinocytes (HOK.Cultured HOK cells were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium (MEM at nine temperatures in approximately 4 °C increments from 4 °C to 37 °C for seven days. Cells were characterized for viability by calcein fluorescence, phenotype retention by immunocytochemistry, metabolic parameters (pH, glucose, lactate, and O2 within the storage medium by blood gas analysis, and morphology by scanning electron microscopy and light microscopy.Relative to the cultured, but non-stored control cells, a high percentage of viable cells were retained only in the 12 °C and 16 °C storage groups (85% ± 13% and 68% ± 10%, respectively. Expression of ABCG2, Bmi1, C/EBPδ, PCNA, cytokeratin 18, and caspase-3 were preserved after storage in the 5 groups between 4 °C and 20 °C, compared to the non-stored control. Glucose, pH and pO2 in the storage medium declined, whereas lactate increased with increasing storage temperature. Morphology was best preserved following storage of the three groups between 12 °C, 16 °C, and 20 °C.We conclude that storage temperatures of 12 °C and 16 °C were optimal for maintenance of cell viability, phenotype, and morphology of cultured HOK. The storage method described in the present study may be applicable for other cell types and tissues; thus its significance may extend beyond HOK and the field of ophthalmology.

  3. The autoimmune regulator (AIRE), which is defective in autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy patients, is expressed in human epidermal and follicular keratinocytes and associates with the intermediate filament protein cytokeratin 17.

    Science.gov (United States)

    Kumar, Vipul; Pedroza, Luis A; Mace, Emily M; Seeholzer, Steven; Cotsarelis, George; Condino-Neto, Antonio; Payne, Aimee S; Orange, Jordan S

    2011-03-01

    Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome, which is caused by mutation of the autoimmune regulator (AIRE) gene, is a highly variable disease characterized by multiple endocrine failure, chronic mucocutaneous candidiasis, and various ectodermal defects. AIRE is a transcriptional regulator classically expressed in medullary thymic epithelial cells, monocytes, macrophages, and dendritic cells. Previous studies have suggested that AIRE can shuttle between the nucleus and cytoplasm of cells, although its cytoplasmic functions are poorly characterized. Through mass spectrometry analysis of proteins co-immunoprecipitating with cytoplasmic AIRE, we identified a novel association of AIRE with the intermediate filament protein cytokeratin 17 (K17) in the THP-1 monocyte cell line. We confirmed AIRE expression in HaCaT epidermal keratinocytes, as well as its interaction with K17. Confocal microscopy of human fetal and adult scalp hair follicles demonstrated a cytoplasmic pattern of AIRE staining that moderately colocalized with K17. The cytoplasmic association of AIRE with the intermediate filament network in human epidermal and follicular keratinocytes may provide a new path to understanding the ectodermal abnormalities associated with the APECED syndrome. Copyright © 2011 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  4. Cost-efficacy of cultured epidermal autografts in massive pediatric burns

    NARCIS (Netherlands)

    Barret, JP; Wolf, SE; Desai, MH; Herndon, DN

    Objective To assess the efficacy of cultured epidermal autografts (CEA) for closure of burn wounds in pediatric burn patients with full-thickness burns of more than 90% total body surface area. Summary Background Data Paucity of donor sites in massive burns makes the use of expanded skin of

  5. Taurin-conjugated ursodeoxycholic acid has a reversible inhibitory effect on human keratinocyte growth.

    Science.gov (United States)

    Yamaguchi, Y; Itami, S; Nishida, K; Ando, Y; Okamoto, S; Hosokawa, K; Yoshikawa, K

    1998-09-01

    Tauroursodeoxycholic acid (TUDC) is one of the most hydrophilic taurin conjugated bile acids. TUDC has a suppressive effect on DNA synthesis in primary cultured rat hepatocytes. In this study, we investigated the growth inhibitory effect of TUDC on cultured human keratinocytes. TUDC suppressed the proliferation of keratinocytes in a dose dependent fashion, as measured by both cell counts and 5-bromo-2'-deoxyuridine (BrdU) uptake. Keratinocytes reproliferated and reached almost the same cell number as control after removal of TUDC from the medium. TUDC (1 mM) had no effect on the cell viability, as measured by the dye exclusion test. Epidermal sheets stratified in the presence of TUDC appeared thinner than those stratified without TUDC. These results suggest that TUDC has a reversible growth suppressive effect on human keratinocytes through the mechanism other than cytotoxicity and would be applicable for the treatment of hyperproliferative skin disorders such as psoriasis.

  6. Wound closure with human keratinocytes cultured on a polyurethane dressing overlaid on a cultured human dermal replacement.

    Science.gov (United States)

    Rennekampff, H O; Hansbrough, J F; Kiessig, V; Abiezzi, S; Woods, V

    1996-07-01

    Burn excision followed by immediate wound coverage has become the clinical standard for managing extensive burn injuries in much of the world. When sufficient autograft skin to achieve permanent wound closure is unavailable, cell culture technology has made the use of cultured human keratinocyte (HK) sheets clinically feasible. Whereas previous techniques have focused on development of multilayered, differentiated HK sheets, our attention has been drawn to using HK in a highly proliferative, less differentiated state. Time requirements for preparation of multistratified cultured HK are high, and preparatory steps may destroy important integrin adhesion molecules. We describe the use of HK cultured to single layer confluence on a polyurethane membrane(HD), with serum-free medium. HK-HD grafts were transplanted to full-thickness wounds on athymic mice (n = 31). A second group of mice (DG-HK-HD), n = 28) received a living human dermal replacement containing cultured fibroblasts before placement of HK-HD. Control mice received HD alone (n = 4). Basement membrane proteins on healed wounds and surface integrins on cultured HK were identified by means of immunostaining and direct microscopic visualization. HK cultured just to the confluent state on polyurethane membrane were positive for integrins alpha(5) and alpha(6), major integrins on proliferating HK. Histologic analysis showed epithelialized wounds in all groups after 21 days. Using an anti-human involucrin antibody we demonstrated the presence of HK in 64.5% of the HK-HD group, 61% of the DG-HK-HD group, and 0% in the HD group. Mice that received the living human dermal replacement containing cultured fibroblasts in combination with HK-HD grafts developed a thick, well-vascularized neodermis. Strong laminin and collagen IV staining was observed in wound areas covered with HK. These data show that full-thickness wounds can be closed by application of a single layer of proliferating HK cultured on a biocompatible

  7. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  8. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W. [Kaohsiung Medical College (Taiwan). Dept. of Dermatology; Chiang, L.-C. [Kaohsiung Medical College (Taiwan). Dept. of Microbiology and Immunology; Yu, C.-L. [National Yang-Ming University School of Medicine (Taiwan). Veterans General Hospital-Taipei

    1996-08-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm{sup 2} UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author).

  9. Autologous epidermal cell suspension: A promising treatment for chronic wounds.

    Science.gov (United States)

    Zhao, Hongliang; Chen, Yan; Zhang, Cuiping; Fu, Xiaobing

    2016-02-01

    Chronic wounds have become an increasing medical and economic problem of aging societies because they are difficult to manage. Skin grafting is an important treatment method for chronic wounds, which are refractory to conservative therapy. The technique involving epidermal cell suspensions was invented to enable the possibility of treating larger wounds with only a small piece of donor skin. Both uncultured and cultured autologous epidermal cell suspensions can be prepared and survive permanently on the wound bed. A systematic search was conducted of EMBASE, Cochrane Library, PubMed and web of science by using Boolean search terms, from the establishment of the database until May 31, 2014. The bibliographies of all retrieved articles in English were searched. The search terms were: (epithelial cell suspension OR keratinocyte suspension) and chronic and wound. From the included, 6 studies are descriptive interventions and discussed the use of autologous keratinocyte suspension to treat 61 patients' chronic wound. The various methods of preparation of epidermal cell suspension are described. The advantages and shortcomings of different carriers for epidermal cell suspensions are also summarised. Both uncultured and cultured autologous epidermal cell suspensions have been used to treat chronic wounds. Although the limitations of these studies include the small number of patient populations with chronic wounds and many important problems that remain to be solved, autologous epidermal cell suspension is a promising treatment for chronic wounds. Copyright © 2015 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  10. Reconstruction of epidermis by grafting of keratinocytes cultured on polymer support - clinical study

    Czech Academy of Sciences Publication Activity Database

    Dvořánková, B.; Holíková, Z.; Vacík, Jiří; Königová, R.; Kapounková, Z.; Michálek, Jiří; Přádný, Martin; Smetana, Karel

    2003-01-01

    Roč. 42, č. 3 (2003), s. 219-223 ISSN 0011-9059 R&D Projects: GA MŠk LN00A065; GA MZd ND6340; GA AV ČR IBS4050005 Institutional research plan: CEZ:AV0Z4050913 Keywords : keratinocytes * graft * polymer support Subject RIV: FH - Neurology Impact factor: 0.736, year: 2003

  11. Global effects of human papillomavirus type 18 E6/E7 in an organotypic keratinocyte culture system.

    Science.gov (United States)

    Garner-Hamrick, Peggy A; Fostel, J M; Chien, Wei-Ming; Banerjee, N Sanjib; Chow, Louise T; Broker, Thomas R; Fisher, Chris

    2004-09-01

    The effects of human papillomavirus type 18 (HPV-18) E6 and E7 proteins on global patterns of host gene expression in primary human keratinocytes grown in organotypic raft culture system were assessed. Primary human keratinocytes were infected with retroviruses that express the wild-type HPV-18 E6 and E7 genes from the native differentiation-dependent HPV enhancer-promoter. Total RNA was isolated from raft cultures and used to generate probes for querying Affymetrix U95A microarrays, which contain >12,500 human gene sequences. Quadruplicate arrays of each E6/E7-transduced and empty vector-transduced samples were analyzed by 16 pairwise comparisons. Transcripts altered in > or =12 comparisons were selected for further analysis. With this approach, HPV-18 E6/E7 expression significantly altered the expression of 1,381 genes. A large increase in transcripts associated with DNA and RNA metabolism was observed, with major increases noted for transcription factors, splicing factors, and DNA replication elements, among others. Multiple genes associated with protein translation were downregulated. In addition, major alterations were found in transcripts associated with the cell cycle and cell differentiation. Our study provides a systematic description of transcript changes brought about by HPV-18 E6/E7 in a physiologically relevant model and should furnish a solid source of information to guide future studies.

  12. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  13. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  14. Arsenic Induces p62 Expression to Form a Positive Feedback Loop with Nrf2 in Human Epidermal Keratinocytes: Implications for Preventing Arsenic-Induced Skin Cancer.

    Science.gov (United States)

    Shah, Palak; Trinh, Elaine; Qiang, Lei; Xie, Lishi; Hu, Wen-Yang; Prins, Gail S; Pi, Jingbo; He, Yu-Ying

    2017-01-24

    Exposure to inorganic arsenic in contaminated drinking water poses an environmental public health threat for hundreds of millions of people in the US and around the world. Arsenic is a known carcinogen for skin cancer. However, the mechanism by which arsenic induces skin cancer remains poorly understood. Here, we have shown that arsenic induces p62 expression in an autophagy-independent manner in human HaCaT keratinocytes. In mouse skin, chronic arsenic exposure through drinking water increases p62 protein levels in the epidermis. Nrf2 is required for basal and arsenic-induced p62 up-regulation. p62 knockdown reduces arsenic-induced Nrf2 activity, and induces sustained p21 up-regulation. p62 induction is associated with increased proliferation in mouse epidermis. p62 knockdown had little effect on arsenic-induced apoptosis, while it decreased cell proliferation following arsenic treatment. Our findings indicate that arsenic induces p62 expression to regulate the Nrf2 pathway in human keratinocytes and suggest that targeting p62 may help prevent arsenic-induced skin cancer.

  15. Triglyceride metabolism in human keratinocytes cultured at the air-liquid interface

    NARCIS (Netherlands)

    M. Ponec (Maria); J. Kempenaar (Johanna); A. Weerheim (Arij); L. de Lannoy (Larissa); I. Kalkman (Ina); H. Jansen

    1995-01-01

    textabstractAlthough epidermis reconstructed in vitro histologically demonstrates the presence of fully differentiated tissue with cornified strata, it does not synthesize or release epidermal barrier lipids in the same proportions as does native skin, causing the barrier function to be impaired.

  16. Structural Patterns of Rhamnogalacturonans Modulating Hsp-27 Expression in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yann Guerardel

    2008-05-01

    Full Text Available Polysaccharide extracts were obtained from chestnut bran (Castanea sativa, grape marc (Vitis vinifera and apple marc (Malus spp. and fractionated by size exclusion chromatography after endopolygalacturonase degradation. Compositional and linkage analyses by GC and GC-MS showed the characteristic rhamnogalacturonan structure with specific arabinan (apple marc and type II arabinogalactan (chestnut bran, grape marc side chains. Type II arabinogalactan rhamnogalacturonan from chestnut bran significantly stimulated the in vitro differentiation of human keratinocytes, giving evidence of a tight structure-function relationship. This molecule comprises short and ramified 3- and 3,6-β- D-galactan and 5- and 3,5-α-L-arabinan side chains, but also contains significant amounts of t-Xyl and 4-Xyl with a characteristic 2:1 ratio. Enzymatic hydrolysis of this polysaccharide produced fragments of lower molecular weight with unchanged xylose content which conserved the same ability to stimulate human keratinocyte differentiation. It could be then speculated that dimeric xylosyl-xylose and/or longer oligomeric xylose side chains attached to a galacturonan and closely associated to hairy rhamno-galacturonan domains are essential patterns that could determine the biological activity of pectins.

  17. Efficacy of glutathione in ameliorating sulfur mustard analog-induced toxicity in cultured skin epidermal cells and in SKH-1 mouse skin in vivo.

    Science.gov (United States)

    Tewari-Singh, Neera; Agarwal, Chapla; Huang, Jie; Day, Brian J; White, Carl W; Agarwal, Rajesh

    2011-02-01

    Exposure to chemical warfare agent sulfur mustard (HD) is reported to cause GSH depletion, which plays an important role in HD-linked oxidative stress and skin injury. Using the HD analog 2-chloroethyl ethyl sulfide (CEES), we evaluated the role of GSH and its efficacy in ameliorating CEES-caused skin injury. Using mouse JB6 and human HaCaT epidermal keratinocytes, we observed both protective and therapeutic effects of exogenous GSH (1 or 10 mM) in attenuating a CEES-caused decrease in cell viability and DNA synthesis, as well as S and G(2)M phase arrest in cell cycle progression. However, the protective effect of GSH was stronger than its ability to reverse CEES-induced cytotoxic effect. The observed effect of GSH could be associated with an increase in intracellular GSH levels after its treatment before or after CEES exposure, which strongly depleted cellular GSH levels. N-Acetyl cysteine, a GSH precursor, also showed both protective and therapeutic effects against CEES-caused cytotoxicity. Buthionine sulfoximine, which reduces cellular GSH levels, caused an increased CEES cytotoxicity in both JB6 and HaCaT cells. In further studies translating GSH effects in cell culture, pretreatment of mice with 300 mg/kg GSH via oral gavage 1 h before topical application of CEES resulted in significant protection against CEES-caused increase in skin bifold and epidermal thickness, apoptotic cell death, and myeloperoxidase activity, which could be associated with increased skin GSH levels. Together, these results highlight GSH efficacy in ameliorating CEES-caused skin injury and further support the need for effective antioxidant countermeasures against skin injury by HD exposure.

  18. Differential effect of extracellular matrix derived from papillary and reticular fibroblasts on epidermal development in vitro.

    Science.gov (United States)

    Janson, David; Rietveld, Marion; Mahé, Christian; Saintigny, Gaëlle; El Ghalbzouri, Abdoelwaheb

    2017-06-01

    Papillary and reticular fibroblasts have different effects on keratinocyte proliferation and differentiation. The aim of this study was to investigate whether these effects are caused by differential secretion of soluble factors or by differential generation of extracellular matrix from papillary and reticular fibroblasts. To study the effect of soluble factors, keratinocyte monolayer cultures were grown in papillary or reticular fibroblast-conditioned medium. To study the effect of extracellular matrix, keratinocytes were grown on papillary or reticular-derived matrix. Conditioned medium from papillary or reticular fibroblasts did not differentially affect keratinocyte viability or epidermal development. However, keratinocyte viability was increased when grown on matrix derived from papillary, compared with reticular, fibroblasts. In addition, the longevity of the epidermis was increased when cultured on papillary fibroblast-derived matrix skin equivalents compared with reticular-derived matrix skin equivalents. The findings indicate that the matrix secreted by papillary and reticular fibroblasts is the main causal factor to account for the differences in keratinocyte growth and viability observed in our study. Differences in response to soluble factors between both populations were less significant. Matrix components specific to the papillary dermis may account for the preferential growth of keratinocytes on papillary dermis.

  19. Non-cultured epidermal suspension in vitiligo: From laboratory to clinic

    Directory of Open Access Journals (Sweden)

    Yvon Gauthier

    2012-01-01

    Full Text Available Background: Medical treatments are ineffective in many patients and surgical methods have therefore been developed. Objective: A review of autologous non-cultured melanocyte grafting techniques is proposed to obtain a successful repigmentation of vitiligo macules. Methods: Initially in 1992, we had developed a simplified grafting method which was carried out in the following two steps: production of blisters on the depigmented lesions by freezing with liquid nitrogen and injection in each blister of a non-cultured suspension of epidermal cells. The cellular suspension was obtained from samples of skin of the hair scalp after trypsinization. This very simple technique could be used at the dermatologist′s clinic. Since 1998 (Olsson MJ, Juhlin L, quite comparable but improved and more sophisticated techniques have been proposed for the surgical treatment of vitiligo. These techniques require a laboratory set up to perform the melanocyte transplantation. The donor zone was usually taken on the gluteal region. The time of trypsinization was reduced to 60 minutes at 37΀C and the centrifuged cellular suspension added with hyaluronic acid (Van Geel was directly applied on a dermabraded or laser abraded vitiligo lesions. Results: Whatever the technique chosen, repigmentation was evident within 25 to 30 days. Coalescence of the pigmented areas was spontaneously observed or obtained after UVB radiation. It is obvious that the complete repigmentation occurred more rapidly with the recent techniques compared with the initial method, but the efficiency was quite similar. Conclusion: The use of non-cultured epidermal suspension appears to be an effective, safe, and simple method for treating patients with achromic areas lacking melanocytes.

  20. Characterization of fetal keratinocytes, showing enhanced stem cell-like properties: a potential source of cells for skin reconstruction.

    Science.gov (United States)

    Tan, Kenneth K B; Salgado, Giorgiana; Connolly, John E; Chan, Jerry K Y; Lane, E Birgitte

    2014-08-12

    Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Breast cancer resistance protein identifies clonogenic keratinocytes in human interfollicular epidermis.

    Science.gov (United States)

    Ma, Dongrui; Chua, Alvin Wen Choong; Yang, Ennan; Teo, Peiyun; Ting, Yixin; Song, Colin; Lane, Ellen Birgitte; Lee, Seng Teik

    2015-03-24

    There is a practical need for the identification of robust cell-surface markers that can be used to enrich for living keratinocyte progenitor cells. Breast cancer resistance protein (ABCG2), a member of the ATP binding cassette (ABC) transporter family, is known to be a marker for stem/progenitor cells in many tissues and organs. We investigated the expression of ABCG2 protein in normal human epidermis to evaluate its potential as a cell surface marker for identifying and enriching for clonogenic epidermal keratinocytes outside the pilosebaceous tract. Immunofluorescence and immunoblotting studies of human skin showed that ABCG2 is expressed in a subset of basal layer cells in the epidermis. Flow cytometry analysis showed approximately 2-3% of keratinocytes in non-hair-bearing epidermis expressing ABCG2; this population also expresses p63, β1 and α6 integrins and keratin 14, but not CD34, CD71, C-kit or involucrin. The ABCG2-positive keratinocytes showed significantly higher colony forming efficiency when co-cultured with mouse 3T3 feeder cells, and more extensive long-term proliferation capacity in vitro, than did ABCG2-negative keratinocytes. Upon clonal analysis, most of the freshly isolated ABCG2-positive keratinocytes formed holoclones and were capable of generating a stratified differentiating epidermis in organotypic culture models. These data indicate that in skin, expression of the ABCG2 transporter is a characteristic of interfollicular keratinocyte progentior cells and suggest that ABCG2 may be useful for enriching keratinocyte stem cells in human interfollicular epidermis.

  2. Two-tiered keratinocyte assay: IL-18 production by NCTC2544 cells to determine the skin sensitizing capacity and an epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2012-01-01

    At present, the identification of potentially sensitizing chemicals is carried out using animal models. However, it should be very important, both from ethical and economic point of view, to discriminate allergy and irritation events, and to classify sensitizers according to their potency, without......2544 IL-18 assay can be used to identify the sensitizing capacity of a chemical (NCTC assay, tier 1) while the Epidermal Equivalent potency assay is used to quantify the potency of the sensitizing agent (EE assay, tier 2). These assays combined, may offer an unique opportunity to provide an alternative...... sensitizers (DNCB, resorcinol, PPD) and 1 non sensitizer (lactic acid) were tested in tier 1. DNCB (extreme) and resorcinol (moderate) were ranked according to their potency in tier 2. These assays were successfully transferred to laboratories that did not perform both assays previously. Second, the actual...

  3. Effects of antiinflammatory triterpenes isolated from Leptadenia hastata latex on keratinocyte proliferation.

    Science.gov (United States)

    Nikiéma, J B; Vanhaelen-Fastré, R; Vanhaelen, M; Fontaine, J; De Graef, C; Heenen, M

    2001-03-01

    Several triterpenes isolated from Leptadenia hastata latex were tested for their anti-inflammatory activity. Lupeol (1), its acetate (2) and palmitate (3) esters were found to be the main antiinflammatory constituents in the croton oil-induced ear oedema test. Furthermore, lupeol hemisuccinate (4), synthesized from lupeol, exhibited a higher activity than lupeol in the test. These results prove that the triterpenes play a pivotal role in the topical antiinflammatory effect of this latex. In addition, an in vitro model of human skin keratinocytes (epidermal explants) cultured at an air-liquid interface on a de-epidermized human dermis (DED) was used to investigate the effects of lupeol esters on skin repair in vitro. Compared with the control, compounds 2 and 3 improved keratinocyte proliferation at a concentration of 5 microM in the culture medium; however, they remained less active than compounds 1 and 4. In contrast to compound 1, all the lupeol esters (2-4), and particularly compound 4, induced a good differentiation of keratinocytes with a well-formed stratum corneum without parakeratosis. These results substantiate the topical use of Leptadenia hastata latex in traditional medicine and showed that both antiinflammatory activity and the effect on keratinocyte proliferation of compound 1 could be improved by its hemisuccinylation; on the contrary, esterification by acetylation or palmitoylation decreased these activities. Copyright 2001 John Wiley & Sons, Ltd.

  4. Niacin protects against UVB radiation-induced apoptosis in cultured human skin keratinocytes

    Science.gov (United States)

    LIN, FUQUAN; XU, WEN; GUAN, CUIPING; ZHOU, MIAONI; HONG, WEISONG; FU, LIFANG; LIU, DONGYIN; XU, AIE

    2012-01-01

    Niacin and its related derivatives have been shown to have effects on cellular activities. However, the molecular mechanism of its reduced immunosuppressive effects and photoprotective effects remains unclear. In this study, we investigated the molecular mechanism of the photoprotective effect of niacin in ultraviolet (UV)-irradiated human skin keratinocytes (HaCaT cells). We found that niacin effectively suppressed the UV-induced cell death and cell apoptosis of HaCaT cells. Existing data have shown that AKT activation is involved in the cell survival process. Yet, the potential mechanism of niacin in protection against UV-induced skin damage has thus far not fully been eluvidated. We observed that niacin pretreatment enhances UV induced activation of AKT (Ser473 phosphorylation) as well as that of the downstream signal mTOR (S6 and 4E-BP1 phosphorylation). The PI3K/AKT inhibitor, LY294002, and the mTOR inhibitor, rapamycin, largely neutralized the protective effects of niacin, suggesting that AKT and downstream signaling mTOR/S6 activation are necessary for the niacin-induced protective effects against UV-induced cell death and cell apoptosis. Collectively, our data suggest that niacin may be utilized to prevent UV-induced skin damage and provide a novel mechanism of its photoprotective effects against the UV radiation of sunlight by modulating both AKT and downstream mTOR signaling pathways. PMID:22246168

  5. Epidermal cell proliferation and terminal differentiation in skin organ culture after topical exposure to sodium dodecyl sulphate

    NARCIS (Netherlands)

    Sandt, J.J.M. van de; Bos, T.A.; Rutten, A.A.J.J.L.

    1995-01-01

    Epidermal cell proliferation and differentiation were investigated in vitro after exposure to the anionic surfactant sodium dodecyl sulfate (SDS). Human skin organ cultures were exposed topically to various concentrations of SDS for 22 h, after which the irritant was removed. Cell proliferation was

  6. Lectin binding as a probe of proliferative and differentiative phases in primary monolayer cultures of cutaneous keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ku, W.W.; Bernstein, I.A. (Univ. of Michigan, Ann Arbor (USA))

    1988-04-01

    The surface of cells in the cutaneous epidermis of the newborn rat exhibits a discrete change in lectin-binding specificity from Griffonia simplicifolia I-B4 (GS I-B4), specific for {alpha}-D-galactosyl residues, to Ulex europeus agglutinin I (UEA), specific for {alpha}-L-fucose, as the cell leaves the basal layer and differentiates. Primary monolayer cultures of rat keratinocytes maintained in low Ca{sup 2+} medium exhibited a characteristic unimodal pattern in the ratio of bound UEA to bound GS I-B4 (UEA/B4 ratio) over a 7-day culture period as determined by a quantitative fluorometric assay. Estimation of DNA synthesis showed (a) a higher ({sup 3}H)thymidine incorporation when the UEA/B4 ratio was low and (b) a steady but lower incorporation between Days 3 and 4, coincident with the higher UEA/B4 ratio. Autoradiographic results further showed that cells stained intensely with UEA failed to incorporate ({sup 3}H)thymidine into their nuclei. Overall, the results suggest that (a) the increase in the UEA/B4 ratio between Days 2 and 4 reflects the progression of a proportion of the cells in the monolayer to an early spinous cell stage, the ultimate fate of which is desquamation into the medium and (b) the decrease in the UEA/B4 ratio between Days 5 and 7 reflects a consequent proliferative response to this loss of cells.

  7. A Convenient Fluorometric Method to Study Sulfur Mustard-Induced Apoptosis in Human Epidermal Keratinocytes Monolayer Microplate Culture

    Science.gov (United States)

    2005-01-01

    chloroethyl) sulfide], which causes skin blistering or vesication [(1991). Histo- and cytopathology of acute epithelial lesions. In: Papirmeis- ter, B... mitochondrial functions, energy metabolism, and death receptors, each of which can independently trigger apoptosis. However, the biochemical pathway in any...apoptosis of cancer cells. Biochemistry 37(48):16934-16942. Kerr, J. F. R., Wyllie, A. H., Currie, A. R. (1972). Apoptosis: a basic biological phenom

  8. Brn2 Is a Transcription Factor Regulating Keratinocyte Differentiation with a Possible Role in the Pathogenesis of Lichen Planus

    Science.gov (United States)

    Shi, Ge; Sohn, Kyung-Cheol; Choi, Dae-Kyoung; Kim, Yu-Jin; Kim, Seong-Jin; Ou, Bai-Sheng; Piao, Yong-Jun; Lee, Young Ho; Yoon, Tae-Jin; Lee, Young; Seo, Young-Joon; Kim, Chang Deok; Lee, Jeung-Hoon

    2010-01-01

    Terminal differentiation of skin keratinocytes is a vertically directed multi-step process that is tightly controlled by the sequential expression of a variety of genes. In this study, we investigated the role of the POU domain-containing transcription factor Brn2 in keratinocyte differentiation. Immunohistochemical analysis showed that Brn2 is expressed primarily in the upper granular layer. Consistent with its epidermal localization, Brn2 expression was highly induced at 14 days after calcium treatment of cultured normal human epidermal keratinocytes. When Brn2 was overexpressed by adenoviral transduction, Brn2 led to increased expression of the differentiation-related genes involucrin, filaggrin, and loricrin in addition to inhibition of their proliferation. Chromatin immunoprecipitation demonstrated that Brn2 bound to the promoter regions of these differentiation-related genes. We injected the purified Brn2 adenovirus into rat skin, which led to a thickened epidermis with increased amounts of differentiation related markers. The histopathologic features of adenovirus-Brn2 injected skin tissues looked similar to the features of lichen planus, a human skin disease showing chronic inflammation and well-differentiated epidermal changes. Moreover, Brn2 is shown to be expressed in almost all cell nuclei of the thickened epidermis of lichen planus, and Brn2 also attracts T lymphocytes. Our results demonstrate that Brn2 is probably a transcriptional factor playing an important role in keratinocyte differentiation and probably also in the pathogenesis of lichen planus lesions. PMID:20967260

  9. α6 Integrin and CD44 enrich for a primary keratinocyte population that displays resistance to UV-induced apoptosis.

    Directory of Open Access Journals (Sweden)

    Helen Wray

    Full Text Available Epidermal human keratinocytes are exposed to a wide range of environmental genotoxic insults, including the UV component of solar radiation. Epidermal homeostasis in response to cellular or tissue damage is maintained by a population of keratinocyte stem cells (KSC that reside in the basal layer of the epithelium. Using cell sorting based on cell-surface markers, we have identified a novel α6 integrin(high+/CD44(+ sub-population of basal keratinocytes. These α6 integrin(high+/CD44(+ keratinocytes have both high proliferative potential, form colonies in culture that have characteristics of holoclones and have a unique pattern of resistance to apoptosis induced by UVB radiation or by agents that induce single- or double strand DNA breaks. Resistance to UVB induced apoptosis in the α6 integrin(high+/CD44(+ cells involved increased expression of TAp63 and was overcome by PI-3 kinase inhibition. In marked contrast, the α6 integrin(high+/CD44(+ cells were sensitive to apoptosis induced by the cross-linking agent cisplatin, and imatinib inhibition of c-Abl blocked the ability of cisplatin to kill α6 integrin(high+/CD44(+ cells. Our findings reveal a population of basal keratinocytes with long-term proliferative properties that display specific patterns of apoptotic resistance that is dependent upon the genotoxic stimulus, and provide insights into how these cells can be targeted with chemotherapeutic agents.

  10. Irradiated Human Dermal Fibroblasts Are as Efficient as Mouse Fibroblasts as a Feeder Layer to Improve Human Epidermal Cell Culture Lifespan

    Directory of Open Access Journals (Sweden)

    Lucie Germain

    2013-02-01

    Full Text Available A fibroblast feeder layer is currently the best option for large scale expansion of autologous skin keratinocytes that are to be used for the treatment of severely burned patients. In a clinical context, using a human rather than a mouse feeder layer is desirable to reduce the risk of introducing animal antigens and unknown viruses. This study was designed to evaluate if irradiated human fibroblasts can be used in keratinocyte cultures without affecting their morphological and physiological properties. Keratinocytes were grown either with or without a feeder layer in serum-containing medium. Our results showed that keratinocytes grown either on an irradiated human feeder layer or irradiated 3T3 cells (i3T3 can be cultured for a comparable number of passages. The average epithelial cell size and morphology were also similar. On the other hand, keratinocytes grown without a feeder layer showed heavily bloated cells at early passages and stop proliferating after only a few passages. On the molecular aspect, the expression level of the transcription factor Sp1, a useful marker of keratinocytes lifespan, was maintained and stabilized for a high number of passages in keratinocytes grown with feeder layers whereas Sp1 expression dropped quickly without a feeder layer. Furthermore, gene profiling on microarrays identified potential target genes whose expression is differentially regulated in the absence or presence of an i3T3 feeder layer and which may contribute at preserving the growth characteristics of these cells. Irradiated human dermal fibroblasts therefore provide a good human feeder layer for an effective expansion of keratinocytes in vitro that are to be used for clinical purposes.

  11. Ultraviolet-evoked prostaglandin biosynthesis in varying stages of keratinocyte differentiation in guinea pig skin

    Energy Technology Data Exchange (ETDEWEB)

    Karmali, R.A.; Safai, B.

    1984-09-01

    Prostaglandin (PG) production by guinea pig epidermal cells was evaluated at various incubation intervals in normal and UV-exposed cultures. Prostaglandins have been implicated as mediators of the early phase of erythema in skin exposed to sunlight or UV-radiation. Using a density gradient centrifugation procedure, the epidermal cells were fractionated according to the various maturation stages of epidermal keratinocytes: high-density epidermal cells (HDEC) consisting of round, less mature cells; low-density epidermal cells (LDEC) consisting of polygonal keratinized cells; and intermediate-density epidermal cells (IDEC) consisting of both HDEC and LDEC. When cultures of 1 X 10(6) cells were incubated at 37 degrees C in 5% CO/sub 2/ the highest concentrations of five PG moieties measured were present in supernatants from the LDEC cultures as compared to those of IDEC or HDEC. Levels of PGF 2 alpha were much higher than the rest, which were found in the order PGF2 alpha greater than PGE2 greater than PGE1 greater than 6-keto-PGF1 alpha greater than thromboxane (TX)B2. UV-irradiation induced increases in all but TXA2 production. These results identify and quantitate five compounds produced as a result of exaggerated activity of the cyclooxygenase induced by UV-irradiation.

  12. MET signaling in keratinocytes activates EGFR and initiates squamous carcinogenesis.

    Science.gov (United States)

    Cataisson, Christophe; Michalowski, Aleksandra M; Shibuya, Kelly; Ryscavage, Andrew; Klosterman, Mary; Wright, Lisa; Dubois, Wendy; Liu, Fan; Zhuang, Anne; Rodrigues, Kameron B; Hoover, Shelley; Dwyer, Jennifer; Simpson, Mark R; Merlino, Glenn; Yuspa, Stuart H

    2016-06-21

    The receptor tyrosine kinase MET is abundant in many human squamous cell carcinomas (SCCs), but its functional significance in tumorigenesis is not clear. We found that the incidence of carcinogen-induced skin squamous tumors was substantially increased in transgenic MT-HGF (mouse metallothionein-hepatocyte growth factor) mice, which have increased abundance of the MET ligand HGF. Squamous tumors also erupted spontaneously on the skin of MT-HGF mice that were promoted by wounding or the application of 12-O-tetradecanoylphorbol 13-acetate, an activator of protein kinase C. Carcinogen-initiated tumors had Ras mutations, but spontaneous tumors did not. Cultured keratinocytes from MT-HGF mice and oncogenic RAS-transduced keratinocytes shared phenotypic and biochemical features of initiation that were dependent on autocrine activation of epidermal growth factor receptor (EGFR) through increased synthesis and release of EGFR ligands, which was mediated by the kinase SRC, the pseudoproteases iRhom1 and iRhom2, and the metallopeptidase ADAM17. Pharmacological inhibition of EGFR caused the regression of MT-HGF squamous tumors that developed spontaneously in orthografts of MT-HGF keratinocytes combined with dermal fibroblasts and implanted onto syngeneic mice. The global gene expression profile in MET-transformed keratinocytes was highly concordant with that in RAS-transformed keratinocytes, and a core RAS/MET coexpression network was activated in precancerous and cancerous human skin lesions. Tissue arrays revealed that many human skin SCCs have abundant HGF at both the transcript and protein levels. Thus, through the activation of EGFR, MET activation parallels a RAS pathway to contribute to human and mouse cutaneous cancers. Copyright © 2016, American Association for the Advancement of Science.

  13. Conditioned medium from the three-dimensional culture of human umbilical cord perivascular cells accelerate the migration and proliferation of human keratinocyte and fibroblast.

    Science.gov (United States)

    Kim, Min Ho; Wu, Wen Hao; Choi, Jee Hyun; Kim, Ji Hyun; Hong, Seok-Ho; Jun, Jin Hyun; Ko, Yong; Lee, Jong Hun

    2017-06-18

    Previous studies have reported that the conditioned medium (CM) of bone marrow-mesenchymal stem cells (BM-MSCs) stimulate the migration and proliferation of cell types involved in the wound healing process. However, these studies only show MSC-CM effects that were obtained using a two-dimensional (2D) culture. Recently, a three-dimensional (3D) culture has been considered to be a more physiologically appropriate system than the 2D culture. In addition, it has been shown that the procurement of BM-MSC is invasive, and other sources of MSC are thus being explored. Recently, perivascular cells (PVCs) have been considered as an alternative source of cells for dermal wound healing. Therefore, in this study, a PVC-conditioned medium (CM) was collected from a 3D culture (PVC-CM-3D) using highly porous polystyrene-based membranes and compared with PVC-CM from a 2D culture (PVC-CM-2D) to investigate the effects on the migration and proliferation of human keratinocytes and fibroblasts. Moreover, the PVC-CM components from the 2D and 3D cultures were identified using 2D gel electrophoresis. The migrations of the keratinocytes cells and fibroblasts were significantly higher with PVC-CM-3D than with the 2D culture; similarly, the proliferation of keratinocytes was also highly stimulated by PVC-CM-3D. Proteomic analyses of the PVC-CM revealed that type I collagen was highly expressed in the 3D-culture system. Microtubule-actin cross-linked factor 1 (KIAA0465), nebulin-related anchoring protein, and thioredoxin were specifically expressed only in PVC-CM-3D. In addition, more EVs could be isolated from the PVC-CM-3D, and EVs were found to stimulate keratinocyte migration. Taken together, 3D-culture using a polystyrene scaffold is demonstrated to be a better system for providing better physiological conditions; therefore, PVC-CM-3D could be a promising option for skin-wound healing.

  14. Keratinocyte Apoptosis is Decreased in Psoriatic Epidermis

    Directory of Open Access Journals (Sweden)

    Fatma Eskioğlu

    2009-12-01

    Full Text Available Background and Design: Abnormal differentiation and hyperproliferation of keratinocytes are the hallmarks of psoriasis vulgaris. Although psoriasis vulgaris is generally accepted as a disease of decreased keratinocyte apoptosis, the results are contradictory. The aim of the current study is to investigate whether decreased keratinocyte apoptosis contributes to the formation of a thickened epidermis as increased keratinocyte proliferation. Material and Method: Forty-three untreated psoriasis vulgaris patients and 20 healthy control subjects were included into the study. Biopsy specimens taken from the enrollee were evaluated by immunohistochemical staining for Ki-67 expressions to show the proliferation of keratinocytes and by the terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling (TUNEL method to show the apoptotic keratinocytes. Results: Apoptotic index (percentage of the TUNEL positive cells was significantly lower in psoriatic epidermis (0.33±0.64 than in normal epidermis (0.75±0.85; whereas Ki-67 index (percentage of positively staining cells for Ki-67 was significantly higher in psoriatic epidermis (30.86±10.49 than in normal epidermis (11.65±2.98, (p=0.021 and p=0.00; respectively. Conclusion: Decreased keratinocyte apoptosis also contribute to increased epidermal thickness in psoriasis as well as increased keratinocyte proliferation.

  15. Differential Utilization and Localization of ErbB Receptor Tyrosine Kinases in Skin Compared to Normal and Malignant Keratinocytes

    Directory of Open Access Journals (Sweden)

    Stefan W. Stoll

    2001-01-01

    Full Text Available Induction of heparin-binding epidermal growth factorlike growth factor (HB-EGF mRNA in mouse skin organ culture was blocked by two pan-ErbB receptor tyrosine kinase (RTK inhibitors but not by genetic ablation of ErbB1, suggesting involvement of multiple ErbB species in skin physiology. Human skin, cultured normal keratinocytes, and A431 skin carcinoma cells expressed ErbB1, ErbB2, and ErbB3, but not ErbB4. Skin and A431 cells expressed more ErbB3 than did keratinocytes. Despite strong expression of ErbB2 and ErbB3, heregulin was inactive in stimulating tyrosine phosphorylation in A431 cells. In contrast, it was highly active in MDA-MB-453 breast carcinoma cells. ErbB2 displayed punctate cytoplasmic staining in A431 and keratinocytes, compared to strong cell surface staining in MDA-MB-453. In skin, ErbB2 was cytoplasmic in basal keratinocytes, assuming a cell surface pattern in the upper suprabasal layers. In contrast, ErbB1 retained a cell surface distribution in all epidermal layers. Keratinocyte proliferation in culture was found to be ErbB1-RTK-dependent, using a selective inhibitor. These results suggest that in skin keratinocytes, ErbB2 transduces ligand-dependent differentiation signals, whereas ErbB1 transduces ligand-dependent proliferation/survival signals. Intracellular sequestration of ErbB2 may contribute to the malignant phenotype of A431 cells, by allowing them to respond to ErbB1dependent growth/survival signals, while evading ErbB2-dependent differentiation signals.

  16. DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi

    Directory of Open Access Journals (Sweden)

    Lila Gardenia

    2014-06-01

    Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.

  17. Atopic keratinocytes induce increased neurite outgrowth in a coculture model of porcine dorsal root ganglia neurons and human skin cells.

    Science.gov (United States)

    Roggenkamp, Dennis; Falkner, Susanne; Stäb, Franz; Petersen, Marlen; Schmelz, Martin; Neufang, Gitta

    2012-07-01

    Skin of patients suffering from atopic eczema displays a higher epidermal nerve fiber density, associated with neurogenic inflammation and pruritus. Using an in vitro coculture system, allowing a spatially compartmented culture of somata from porcine dorsal root ganglion neurons and human primary skin cells, we investigated the influence of dermal fibroblasts and keratinocytes on neurite outgrowth. In comparison with dermal fibroblasts, keratinocytes induced more branched and less calcitonin gene-related peptide (CGRP)-immunoreactive nerve fibers. By adding neutralizing antibodies, we showed that nerve growth factor (NGF) and glial cell-line-derived neurotrophic factor (GDNF) are pivotal neurotrophic factors of skin cell-induced neurite outgrowth. Keratinocytes and dermal fibroblasts secreted different ratios of neurotrophic factors, influencing morphology and CGRP immunoreactivity of neurites. To investigate changes of the peripheral nervous system in the pathogenesis of atopic eczema in vitro, we analyzed neurite outgrowth mediated by atopic skin cells. Atopic keratinocytes produced elevated levels of NGF and mediated an increased outgrowth of CGRP-positive sensory fibers. Our results demonstrate the impact of dermal fibroblasts and keratinocytes on skin innervation and emphasize the role of keratinocytes as key players of hyperinnervation in atopic eczema.

  18. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  19. Susceptible cytotoxicity to ultraviolet B light in fibroblasts and keratinocytes cultured from autoimmune-prone MRL/Mp-lpr/lpr mice

    Energy Technology Data Exchange (ETDEWEB)

    Furukawa, F.; Lyon, M.B.; Norris, D.A. (Univ. of Colorado School of Medicine, Denver (USA))

    1989-09-01

    The MRL/Mp-lpr/lpr (MRL/l) mouse is an autoimmune model of spontaneous lupus erythematosus (LE), in addition to lupus nephritis. In order to better understand the mechanisms of photosensitivity in LE, in vitro photocytotoxicity was examined by using fibroblasts and keratinocytes cultured from MRL/l mice, control MRL/Mp- +/+ (MRL/n) mice, and normal BALB/c mice. A colorimetric 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay and the acridine orange/ethidium bromide assay were used for determination of cytotoxicity. Fibroblasts cultured from newborn MRL/l mice showed higher susceptibility to single ultraviolet light B (UVB) light irradiation at a dose of 100-500 mJ than those from MRL/n, F1 hybrid of (MRL/l x MRL/n mice), and BALB/c mice. However, the susceptibility to UVB was not observed in young (1-month-old) and adult (4-month-old) MRL/l mice. UVA light irradiation was not cytotoxic. Keratinocytes cultured from MRL mice showed lower cytotoxicity to UVB irradiation than fibroblasts cultured. However, keratinocytes from newborn MRL/l mice showed higher cytotoxicity to 50 mJ UVB irradiation than cells from MRL/n mice. Syngeneic or allogeneic sera augmented UVB-induced cytotoxicity of fibroblasts cultured. UVB irradiation of spleen cells induced no significant difference of cytotoxicity between MRL/l and MRL/n mice. Based on the results of F1 hybrid of (MRL/l x MRL/n) mice, the susceptibility seemed to be associated with autoimmune traits and to be regulated by genetical background.

  20. Wnt signaling induces differentiation of progenitor cells in organotypic keratinocyte cultures

    Directory of Open Access Journals (Sweden)

    Liu Bob Y

    2007-02-01

    Full Text Available Abstract Background Interfollicular skin develops normally only when the activity of the progenitor cells in the basal layer is counterbalanced by the exit of cells into the suprabasal layers, where they differentiate and cornify to establish barrier function. Distinct stem and progenitor compartments have been demonstrated in hair follicles and sebaceous glands, but there are few data to describe the control of interfollicular progenitor cell activity. Wnt signaling has been shown to be an important growth-inducer of stem cell compartments in skin and many other tissues. Results Here, we test the effect of ectopic Wnt1 expression on the behavior of interfollicular progenitor cells in an organotypic culture model, and find that Wnt1 signaling inhibits their growth and promotes terminal differentiation. Conclusion These results are consistent with the phenotypes reported for transgenic mice engineered to have gain or loss of function of Wnt signaling in skin, which would recommend our culture model as an accurate one for molecular analysis. Since it is known that canonical ligands are expressed in skin, it is likely that this pathway normally regulates the balance of growth and differentiation, and suggests it could be important to pathogenesis.

  1. FRAP Analysis Reveals Stabilization of Adhesion Structures in the Epidermis Compared to Cultured Keratinocytes

    Science.gov (United States)

    Foote, Henry P.; Sumigray, Kaelyn D.; Lechler, Terry

    2013-01-01

    Proper development and tissue maintenance requires cell-cell adhesion structures, which serve diverse and crucial roles in tissue morphogenesis. Epithelial tissues have three main types of cell-cell junctions: tight junctions, which play a major role in barrier formation, and adherens junctions and desmosomes, which provide mechanical stability and organize the underlying cytoskeleton. Our current understanding of adhesion function is hindered by a lack of tools and methods to image junctions in mammals. To better understand the dynamics of adhesion in tissues we have created a knock-in ZO-1-GFP mouse and a BAC-transgenic mouse expressing desmoplakin I-GFP. We performed fluorescence recovery after photobleaching (FRAP) experiments to quantify the turnover rates of the tight junction protein ZO-1, the adherens junction protein E-cadherin, and the desmosomal protein desmoplakin in the epidermis. Proteins at each type of junction are remarkably stable in the epidermis, in contrast to the high observed mobility of E-cadherin and ZO-1 at adherens junctions and tight junctions, respectively, in cultured cells. Our data demonstrate that there are additional mechanisms for stabilizing junctions in tissues that are not modeled by cell culture. PMID:23977053

  2. Supplementation with a complex of active nutrients improved dermal and epidermal characteristics in skin equivalents generated from fibroblasts from young or aged donors.

    Science.gov (United States)

    Lacroix, Sophie; Bouez, Charbel; Vidal, Sandrine; Cenizo, Valérie; Reymermier, Corinne; Justin, Virginie; Vicanová, Jana; Damour, Odile

    2007-04-01

    Cultured skin equivalent (SE, Mimeskin) was generated by co-culturing skin fibroblasts and keratinocytes on a collagen-glycosaminoglycan-chitosan dermal substrate. In order to examine donor age effect, fibroblasts from 19- (young) or 49- (aged) year-old females were used. Culture medium was supplemented with nutrients complex containing soy extract, tomato extract, grape seed extract, white tea extract, sodium ascorbate, tocopherol acetate, zinc gluconate and BioMarine complex. Epidermal and dermal structure and composition were examined after 42 and 60 days of culture. In untreated samples, SE generated from young fibroblasts was superior to SE from aged fibroblasts in all characteristics. Those include number and regularity of keratinocyte layers, number of keratinocytes expressing proliferation marker Ki67, content of collagen type I, fibrillin-1, elastin, and SE lifespan. Effects of nutritional supplementation were observed in SE from both young and aged fibroblasts, however, those effects were more pronounced in SE from aged fibroblasts. In epidermis, the treatment increased number of keratinocyte layers and delayed epidermal senescence. The number of cells expressing Ki67 was nine folds higher than those of controls, and was similar to that of young cell SE. In dermis, the treatment increased mRNA synthesis of collagen I, fibrillin-1 and elastin. In conclusion, skin cell donor age had major important effect on formation of reconstructed SE. Imperfections in epidermal and dermal structure and composition as well as life span in SE from aged cells can be improved by supplementation with active nutrients.

  3. Dihydroceramide Desaturase Inhibition by a Cyclopropanated Dihydroceramide Analog in Cultured Keratinocytes

    Directory of Open Access Journals (Sweden)

    Susanne Brodesser

    2011-01-01

    Full Text Available Most mammalian sphingolipids contain a 4,5-(E-double bond. We report on the chemical synthesis of a dihydroceramide derivative that prevents the introduction of the double bond into sphingolipids. Minimal alteration of the parent structure by formally replacing the hydrogen atoms in the 5- and in the 6-position of the sphinganine backbone by a methylene group leads to an inhibitor of dihydroceramide desaturase in cultured cells. In the presence of 10–50 μM of compound (1, levels of biosynthetically formed dihydroceramide and—surprisingly—also of phytoceramide are elevated at the expense of ceramide. The cells respond to the lack of unsaturated sphingolipids by an elevation of mRNAs of enzymes required for sphingosine formation. At the same time, the analysis of proliferation and differentiation markers indicates that the sphingolipid double bond is required to keep the cells in a differentiated state.

  4. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  5. Human allogeneic keratinocytes cultured on acellular xenodermis: the use in healing of burns and other skin defects

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Štolbová, V.; Klein, L.; Konigová, R.; Veselý, Pavel

    2006-01-01

    Roč. 16, č. 4 (2006), s. 63-71 ISSN 0959-2989 R&D Projects: GA AV ČR(CZ) IBS5052312 Institutional research plan: CEZ:AV0Z50520514 Keywords : acellular xenodermis * human keratinocytes * wound grafting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.922, year: 2006

  6. Galectin-1 from conditioned medium of three-dimensional culture of adipose-derived stem cells accelerates migration and proliferation of human keratinocytes and fibroblasts.

    Science.gov (United States)

    Kim, Min Ho; Wu, Wen Hao; Choi, Jee Hyun; Kim, Jihyun; Jun, Jin Hyun; Ko, Yong; Lee, Jong Hun

    2017-08-30

    Keratinocytes and fibroblasts cells play important roles in the skin-wound healing process and are the cell types activated by trauma. Activated cells participate in epithelialization, granulation, scar tissue formation, wound remodeling, and angiogenesis via a series of cellular activities including migration and proliferation. Previous studies reported that the conditioned medium (CM) of adipose-derived stem cells (ADSCs) stimulated the migration and proliferation of cell types involved in the skin wound healing process; however, these studies only show ADSC-CM effects that were obtained using 2-dimensional (2D) culture. Recently, 3-dimensional (3D) culture has been considered as a more physiologically appropriate system than 2D culture for ADSC cultures; therefore, ADSC-CM was collected from 3D culture (ADSC-CM-3D) and compared with ADSC-CM from 2D culture (ADSC-CM-2D) to investigate the effects on the migration and proliferation of human keratinocytes (HaCaTs) and fibroblasts. The migrations of the HaCaT cells and fibroblasts were significantly higher with ADSC-CM-3D compared with the 2D culture; similarly, the proliferation of HaCaT cells was also highly stimulated by ADSC-CM-3D. Proteomic analyses of the ADSC-CM revealed that collagens and actins were highly expressed in the 3D-culture system. Chitinase 3-like 1 (CHI3L1), tissue inhibitor of metalloproteinases (TIMP), and galectin-1 were specifically expressed only in ADSC-CM-3D. Especially, through antibody neutralization, galectin-1 in ADSC-CM-3D was found to be an important factor for the migration of human keratinocytes. Therefore, these results suggest that ADSC-CM-3D was more effective in the wound healing than ADSC-CM-2D, and galectin-1 in ADSC-CM-3D was could be a promising option for skin-wound healing. Furthermore, the differential expressions of several ADSC-CM proteins between the 2D- and 3D-culture systems may be used as basic information for the development of efficient wound-healing strategies

  7. [Development of an engraftable skin equivalent based on matriderm with human keratinocytes and fibroblasts].

    Science.gov (United States)

    Golinski, P A; Zöller, N; Kippenberger, S; Menke, H; Bereiter-Hahn, J; Bernd, A

    2009-12-01

    A cell-based wound coverage with keratinocytes and fibroblasts on the basis of a commercially available dermal substitute (Matriderm ((R)), Kollagen/Elastin matrix) was generated, in order to treat wide burn wounds. First the expansion of keratinocytes was optimised and the culturing time was minimised. Raw material was 1-2 cm (2) split skin. Dermis and epidermis were separated by enzymatic treatment with thermolysin. After treatment of both compartments with trypsin and collagenase I, keratinocytes and fibroblasts were isolated and expanded in collagen I coated dishes. After 10 days fibroblasts were seeded on Matriderm ((R)). After cultivation of the fibroblasts-containing matrix for one week keratinocytes were seeded on top. After an additional week of submersed cultivation the matrix was lifted up to the air-liquid interface to initiate epidermal cell differentiation. After 16 days in the air-liquid interphase the matrix was fixed and underwent immunohistochemical and electron microscopic analysis. Histological analysis showed a regularly stratification of the epidermal part. We observed collagen IV, a marker for the basement membrane, between epidermis and dermis. Desmoglein and the differentiation markers involucrine and cytokeratin 10 were found in the suprabasal layers of the epidermis. Electron microscopic analysis showed the basement membrane in the epidermal junction zone as well as cell-cell connections in the form of desmosomes. Late differentiation characteristics, like granular structures and the cornified layer, were found in the stratum granulosum and stratum corneum. Our results demonstrate that a skin equivalent can be generated by using a collagen/elastin matrix, with an expansion rate of 50-100-fold. This skin equivalent may be useful for covering deep wounds.

  8. Lipophilic prodrugs of amino acids and vitamin E as osmolytes for the compensation of hyperosmotic stress in human keratinocytes.

    Science.gov (United States)

    Graf, Rüdiger; Kock, Michael; Bock, Andreas; Schubert-Zsilavecz, Manfred; Steinhilber, Dieter; Kaufmann, Roland; Gassenmeier, Thomas; Beschmann, Heike; Bernd, August; Kippenberger, Stefan

    2009-04-01

    Skin keratinocytes are subjected to changing osmotic conditions and evolved counteracting mechanisms. Particularly, the expression of osmolyte transporters serves for the maintenance of cell volume in a hypertonic environment. In this study, we show that hyperosmotic stress significantly decreases the proliferation in HaCaT keratinocytes. Supplementation of the culture medium with the amino acids glycine, sarcosine, betaine, taurine and proline restored the proliferation indicating osmoprotective properties of these substances. Amino acids are highly polar molecules and therefore unable to penetrate into deeper epidermal layers after topical application. Thus, we utilized a prodrug concept in which the tested amino acids are coupled to a lipophilic moiety. Ethyl glycinate as a first model compound also showed an osmoprotective effect. In addition, improved penetration of the glycine derivative into deeper epidermal layers could be demonstrated. The prodrug concept was further developed by using the lipid soluble antioxidant alpha-tocopherol as a lipophilic moiety. The derivatives d,l-alpha-tocopheryl-(mono-) glycinate (TMG) and d,l-alpha-tocopheryl-(mono-) prolinate caused an increase in proliferation of HaCaT keratinocytes under salt stress and a decrease in apoptosis induced by hypertonic conditions. Furthermore, the osmoprotective effect of d,l-TMG could be corroborated in normal human keratinocytes. Therefore, it seems feasible that amino acids and their lipophilic derivatives may help to improve the osmotic balance and the hydration of skin. Clinical and cosmetic indications such as atopic eczema, UV exposed skin or aged skin may benefit from this new concept.

  9. Xenobiotic metabolism capacities of human skin in comparison with a 3D epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: activating enzymes (Phase I).

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Blatz, Veronika; Jäckh, Christine; Freytag, Eva-Maria; Fabian, Eric; Landsiedel, Robert; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    Skin is important for the absorption and metabolism of exposed chemicals such as cosmetics or pharmaceuticals. The Seventh Amendment to the EU Cosmetics Directive prohibits the use of animals for cosmetic testing for certain endpoints, such as genotoxicity; therefore, there is an urgent need to understand the xenobiotic metabolizing capacities of human skin and to compare these activities with reconstructed 3D skin models developed to replace animal testing. We have measured Phase I enzyme activities of cytochrome P450 (CYP) and cyclooxygenase (COX) in ex vivo human skin, the 3D skin model EpiDerm™ (EPI-200), immortalized keratinocyte-based cell lines and primary normal human epidermal keratinocytes. Our data demonstrate that basal CYP enzyme activities are very low in whole human skin and EPI-200 as well as keratinocytes. In addition, activities in monolayer cells differed from organotypic tissues after induction. COX activity was similar in skin, EPI-200 and NHEK cells, but was significantly lower in immortalized keratinocytes. Hence, the 3D model EPI-200 might represent a more suitable model for dermatotoxicological studies. Altogether, these data help to better understand skin metabolism and expand the knowledge of in vitro alternatives used for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  10. Characterization of epidermal growth factor receptor and action on human breast cancer cells in culture.

    Science.gov (United States)

    Fitzpatrick, S L; LaChance, M P; Schultz, G S

    1984-08-01

    Epidermal growth factor (EGF) may play a role in regulating growth of breast cancer cells in vivo. We have examined the action of EGF on breast cancer cells in vitro and characterized the EGF receptor as a model system for its action in vivo. All of the fourteen breast cancer cell lines which grow attached to culture dishes specifically bound EGF, including one purportedly normal breast line (HBL-100). The one cell line examined which grows as a suspension, DU-4475, did not express measurable levels of EGF binding. The number of EGF binding sites per cell for the different cell lines varied from 200 EGF binding sites/cell (for MDA-MB-436) to 700,000 EGF binding sites/cell (for MDA-MB-231), with most cell lines having approximately 10,000 EGF binding sites/cell. Scatchard analysis of EGF binding to four of the breast cell lines indicated a single class of high-affinity binding sites for MDA-MB-231 cells (Kd = 200 pM; n = 220 fmol of EGF bound/mg of cell protein); and for T-47D cells (Kd = 4 nM, n = 85 fmol of EGF bound/mg of cell protein) and curvilinear plots for MCF-7 cells and HBL-100 cells. The EGF binding to MDA-MB-231 cells was specific for EGF and was maximum after 2 hr at 37 degrees, followed by a progressive loss of cell-associated radio-activity, which was prevented by the action of the lysosomal inhibitory agent chloroquine. Specific covalent binding of 125I-EGF to MDA-MB-231 cells indicated that the EGF receptor had molecular weights of 165,000 and 140,000. MCF-7 cells and T-47D cells grown in serum-free medium supplemented with 10 nM EGF for 3 days had significantly increased protein, DNA, and cell number, whereas MDA-MB-231 and ZR-75-1 cells did not respond significantly to EGF. These results indicate that EGF receptors are consistently expressed by breast cells grown attached to a surface but that some cell lines expressing EGF receptors do not respond mitogenically to EGF. The biochemical characteristics of EGF receptors in MDA-MD-231 breast cells

  11. New procedure for epidermal cell isolation using kiwi fruit actinidin, and improved culture of melanocytes in the presence of leukaemia inhibitory factor and forskolin

    DEFF Research Database (Denmark)

    Yarani, Reza; Mansouri, Kamran; Mohammadi-Motlagh, Hamid Reza

    2013-01-01

    factor (LIF) and forskolin. MATERIALS AND METHODS: Dermo-epidermal separation and epidermal sheet cell dispersion were performed using actinidin compared to conventional proteases including collagenase, thermolysin or trypsin. Thereafter, melanocyte culture was performed in two common media and one......, and of more viable native cells. Also, melanocytes proliferated better in phorbol ester- and cholera toxin-free proliferation medium supplemented with LIF and forskolin. CONCLUSION: Less contamination and higher numbers of viable cells were actinidin preferential for separation of epidermis and isolation...

  12. Bioengineering a Human Plasma-Based Epidermal Substitute With Efficient Grafting Capacity and High Content in Clonogenic Cells

    Science.gov (United States)

    Alexaline, Maia M.; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T.; Doucet, Christelle; Fortunel, Nicolas O.

    2015-01-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. Significance This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. PMID:25848122

  13. Epidermal Stem Cells

    Directory of Open Access Journals (Sweden)

    Osman Köse

    2015-03-01

    Full Text Available The epidermis is the outermost layer of the human skin and comprises a multilayered epithelium, the interfollicular epidermis, with associated hair follicles, sebaceous glands, and eccrine sweat glands. There are many origins of stem cells in the skin and skin appendages. These stem cells are localized in different part of the pilosebaseous units and also express many different genes. Epidermal stem cells in the pilosebaseous units not only ensure the maintenance of epidermal homeostasis and hair regeneration, but also contribute to repair of the epidermis after injury. In recent years, human induced pluripotent skin stem cells are produced from the epidermal cells such as keratinocytes, fibroblasts and melanocytes. These cells can be transdifferentiated to embriyonic stem cells. Human induced pluripotent stem cells have potential applications in cell replacement therapy and regenerative medicine. These cells provide a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. In this review, we aimed an overview of epidermal stem cells for better understanding their functions in the skin. Skin will be main organ for using the epidermal cells for regenerative medicine in near future.

  14. Differential effects of detergents on keratinocyte gene expression.

    Science.gov (United States)

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  15. Aged keratinocyte phenotyping: morphology, biochemical markers and effects of Dead Sea minerals.

    Science.gov (United States)

    Soroka, Yoram; Ma'or, Zeev; Leshem, Yael; Verochovsky, Lilian; Neuman, Rami; Brégégère, François Menahem; Milner, Yoram

    2008-10-01

    The aging process and its characterization in keratinocytes have not been studied in depth until now. We have assessed the cellular and molecular characteristics of aged epidermal keratinocytes in monolayer cultures and in skin by measuring their morphological, fluorometric and biochemical properties. Light and electron microscopy, as well as flow cytometry, revealed increase in cell size, changes in cell shape, alterations in mitochondrial structure and cytoplasmic content with aging. We showed that the expression of 16 biochemical markers was altered in aged cultured cells and in tissues, including caspases 1 and 3 and beta-galactosidase activities, immunoreactivities of p16, Ki67, 20S proteasome and effectors of the Fas-dependent apoptotic pathway. Aged cells diversity, and individual variability of aging markers, call for a multifunctional assessment of the aging phenomenon, and of its modulation by drugs. As a test case, we have measured the effects of Dead Sea minerals on keratinocyte cultures and human skin, and found that they stimulate proliferation and mitochondrial activity, decrease the expression of some aging markers, and limit apoptotic damage after UVB irradiation.

  16. Coregulatory effects of epidermal growth factor, dihydrotestosterone, and prolactin on benign human prostatic hyperplasia tissue culture proliferation.

    Science.gov (United States)

    Janssen, T; Petein, M; van Velthoven, R; De Decker, R; Assenmacher, C; Corbusier, A; Pasteels, J L; Kiss, R; Schulman, C

    1997-01-01

    A variety of hormones have demonstrated effects on prostatic tissue growth dynamics. Our goal was to define the effect of dihydrotestosterone (DHT), epidermal growth factor (EGF), and prolactin (PRL) on prostate cellular proliferation. Thirty benign human prostatic hyperplasias (BPH) were maintained 48 hr as in vitro cultures. Culture media were supplemented with EGF, DHT, and PRL alone and in combinations. Proliferation was assessed by labeling with tritiated thymidine. The proliferative response of individual BPH cultures was heterogeneous. DHT and EGF tended to have a greater proliferative effect than PRL, both in terms of the percent cultures responding and the magnitude of the response. PRL antagonized EGF-induced proliferative effects. EGF- and PRL-mediated effects correlated with each other, while DHT-mediated effects did not correlate with either those of PRL or EGF. The proliferative response of individual BPH to DHT, EGF, and PRL, alone or in combination, is too variable to define a predictable response to their influence. Our methodology represents a technique with the capacity to define therapeutic potential for individual cases.

  17. A secretome analysis reveals that PPARα is upregulated by fractionated-dose γ-irradiation in three-dimensional keratinocyte cultures

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jee Yong; Kim, Hyun Ji; Yi, Jae Youn [Korea Institute of Radiation and Medical Sciences, Daejeon (Korea, Republic of)

    2016-05-15

    A three-dimensional (3D) environment composed of properly interconnected and differentiated cells that allows communication and cooperation among cells via secreted molecules would be expected to more accurately reflect cellular responses. Here, we investigated γ-irradiation-induced changes in the secretome of 3D-cultured keratinocytes. An analysis of keratinocyte secretome profiles following fractionated-dose γ-irradiation revealed changes in genes involved in cell adhesion, angiogenesis, and the immune system. Notably, peroxisome proliferator-activated receptor-(PPARα) was upregulated in response to fractionated-dose γ-irradiation. This upregulation was associated with an increase in the transcription of known PPARα target genes, including angiopoietin-like protein 4, dermokine and kallikrein-related peptide 12, which were differentially regulated by fractionated-dose γ-irradiation. Collectively, our data imply a mechanism linking γ-irradiation and secretome changes, and suggest that these changes could play a significant role in the coordinated cellular responses to harmful ionizing radiation, such as those associated with radiation therapy. This extension of our understanding of γ-irradiation-induced secretome changes has the potential to improve radiation therapy strategies. Control of inflammatory waves, improved wound healing, and stabilization of the skin barrier are imperative for minimizing such injuries. Therefore, PPARα agonists and antagonists have the potential to become important therapeutic agents for the treatment of γ-irradiation induced skin damage. Specifically, our analysis suggests that the undesirable consequences of long-term exposure to ionizing radiation could be alleviated by PPARα agonists.

  18. Proliferation, cell cycle exit, and onset of terminal differentiation in cultured keratinocytes: pre-programmed pathways in control of C-Myc and Notch1 prevail over extracellular calcium signals.

    Science.gov (United States)

    Kolly, Carine; Suter, Maja M; Müller, Eliane J

    2005-05-01

    So far it was reported that a switch from low to high extracellular calcium induces growth arrest and terminal differentiation in cultured human and mouse keratinocytes. We had observed that both canine and mouse keratinocytes proliferate in high (1.8 mM, respectively, 1.2 mM) or low (0.09 and 0.06 mM) calcium-containing medium. In-depth analysis of this phenomenon revealed, as reported here, that the switch between proliferation and terminal differentiation occurred irrespective of calcium conditions when the canine and murine keratinocytes reach confluency. The "confluency switch" coincided with transcriptional upregulation of cell cycle inhibitors p21(WAF1) and p27(KIP1) as well as proteins marking onset of terminal differentiation. It was further accompanied by downregulation and nuclear clearance of c-Myc, and conversely activation of Notch1, which are shown to be critical determinants of this process. Together, this study demonstrates that even in the absence of and similar to their in vivo environment, cultured canine and mouse keratinocytes follow a pre-defined differentiation program. This program is in control of c-Myc and Notch1 and does not require complementary signals for onset of terminal differentiation except those given by cell-cell contact. Once triggered, completion of the terminal differentiation process depends on elevated extracellular calcium to stabilize intercellular junctions and components of the cornified envelope.

  19. Late onset epidermal nevus with hypertrichosis and facial hemihypertrophy

    Directory of Open Access Journals (Sweden)

    M Saritha

    2014-01-01

    Full Text Available Epidermal nevus syndromes are rare conditions, characterized by different types of keratinocytic or organoid epidermal nevi in association with ocular, neurological, and skeletal manifestations. We present a case of late onset epidermal nevus with hypertrichosis and hemihypertrophy of face. Genetic analysis did not reveal presence of FGFR3 or PIK3CA mutations. The patient has features that cannot be categorized into the present well-known syndromes.

  20. Tissue engineering of cultured skin substitutes

    National Research Council Canada - National Science Library

    Horch, Raymund E; Kopp, Jürgen; Kneser, Ulrich; Beier, Justus; Bach, Alexander D

    2005-01-01

    .... Tissue‐engineered skin replacements: cultured autologous keratinocyte grafts, cultured allogeneic keratinocyte grafts, autologous/allogeneic composites, acellular biological matrices, and cellular...

  1. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  2. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    Energy Technology Data Exchange (ETDEWEB)

    Berkers, J.A.M. [Research Inst. of Toxicology, Utrecht Univ. (Netherlands); Hassing, I. [Research Inst. of Toxicology, Utrecht Univ. (Netherlands); Spenkelink, B. [Dept. of Toxicology, Wageningen Agricultural Univ. (Netherlands); Brouwer, A. [Dept. of Toxicology, Wageningen Agricultural Univ. (Netherlands); Blaauboer, B.J. [Research Inst. of Toxicology, Utrecht Univ. (Netherlands)

    1995-05-01

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the {sup 35}S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC{sub 50}) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca{sup 2+}-dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10{sup -8} M TCDD, 10{sup -6} M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  3. Epidermal growth factor containing culture supernatant enhances intestine development of early-weaned pigs in vivo: potential mechanisms involved.

    Science.gov (United States)

    Bedford, Andrea; Chen, Tao; Huynh, Evanna; Zhu, Cuilan; Medeiros, Samantha; Wey, Doug; de Lange, Cornelis; Li, Julang

    2015-02-20

    We have previously generated epidermal factor expressing Lactococcus lactis (EGF-LL) using a bioengineering approach, and shown that EGF-LL fermentation supernatant enhanced newly weaned pigs growth. The objective of the current study was to further understand the mechanisms behind this improved performance. Sixty-four piglets were weaned at 3 weeks of age and then fed ad libitum according to a 2-phase feeding program. Four pens with 8 pigs per pen were assigned to each of two treatments for 3 weeks: (1) EGF containing supernatant from EGF-LL culture (SuperEGF) or (2) blank M17GE media (Control). Consistent with previous findings, SuperEGF pigs had an increased average daily gain during week 3 post-weaning (433.4 ± 10.86 vs 388.7 ± 7.76 g; Pweaning-induced decrease of glucose cotransporter sodium-glucose linked transporter 1 (SGLT1) and glucagon-like peptide-2 (GLP2) levels was reversed by SuperEGF supplementation. Our findings add to our understanding of the mechanisms behind enhancing piglet performance by EGF containing fermentation product. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Paricalcitol Inhibits Aldosterone-Induced Proinflammatory Factors by Modulating Epidermal Growth Factor Receptor Pathway in Cultured Tubular Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Jose L. Morgado-Pascual

    2015-01-01

    Full Text Available Chronic kidney disease is characterized by Vitamin D deficiency and activation of the renin-angiotensin-aldosterone system. Increasing data show that vitamin D receptor agonists (VDRAs exert beneficial effects in renal disease and possess anti-inflammatory properties, but the underlying mechanism remains unknown. Emerging evidence suggests that “a disintegrin and metalloproteinase” (ADAM/epidermal growth factor receptor (EGFR signalling axis contributes to renal damage. Aldosterone induces EGFR transactivation regulating several processes including cell proliferation and fibrosis. However, data on tubular epithelial cells is scarce. We have found that, in cultured tubular epithelial cells, aldosterone induced EGFR transactivation via TGF-α/ADAM17. Blockade of the TGF-α/ADAM17/EGFR pathway inhibited aldosterone-induced proinflammatory gene upregulation. Moreover, among the potential downstream mechanisms, we found that TGF-α/ADAM17/EGFR inhibition blocked ERK and STAT-1 activation in response to aldosterone. Next, we investigated the involvement of TGF-α/ADAM17/EGFR axis in VDRA anti-inflammatory effects. Preincubation with the VDRA paricalcitol inhibited aldosterone-induced EGFR transactivation, TGF-α/ADAM-17 gene upregulation, and downstream mechanisms, including proinflammatory factors overexpression. In conclusion, our data suggest that the anti-inflammatory actions of paricalcitol in tubular cells could depend on the inhibition of TGF-α/ADAM17/EGFR pathway in response to aldosterone, showing an important mechanism of VDRAs action.

  5. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  6. Transforming growth factor-beta and epidermal growth factor modulate basal and interleukin-6-induced amino acid uptake and acute phase protein synthesis in cultured rat hepatocytes.

    Science.gov (United States)

    Bereta, J; Szuba, K; Fiers, W; Gauldie, J; Koj, A

    1990-06-18

    Rat hepatocytes cultured for 2 days with interleukin-6 show increased synthesis of acute phase proteins and enhanced accumulation of 14C-labelled alpha-aminoisobutyric acid. Transforming growth factor-beta 1 (0.1-10 ng/ml) inhibits whereas epidermal growth factor (1-100 ng/ml) enhances both basal and interleukin-6-induced amino acid uptake by rat hepatocytes with only a slight alteration of acute phase protein synthesis.

  7. C/EBPβ Modulates the Early Events of Keratinocyte Differentiation Involving Growth Arrest and Keratin 1 and Keratin 10 Expression

    OpenAIRE

    Zhu, Songyun; Oh, Hye-Sun; Shim, Minsub; Sterneck, Esta; Johnson, Peter F.; Smart, Robert C.

    1999-01-01

    The epidermis is a stratified squamous epithelium composed primarily of keratinocytes that become postmitotic and undergo sequential changes in gene expression during terminal differentiation. The expression of the transcription factor CCAAT/enhancer binding protein β (C/EBPβ) within mouse epidermis and primary keratinocytes has recently been described; however, the function of C/EBPβ within the epidermal keratinocyte is unknown. We report here that transient transfection of mouse primary ker...

  8. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  9. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  10. Colonization of epidermal tissue by Staphylococcus aureus produces localized hypoxia and stimulates secretion of antioxidant and caspase-14 proteins

    Energy Technology Data Exchange (ETDEWEB)

    Lone , Abdul G.; Atci, Erhan; Renslow, Ryan S.; Beyenal, Haluk; Noh, S.; Fransson, B.; Abu-Lail, Nehal; Park, Jeong-Jin; Gang, David R.; Call, Douglas R.

    2015-08-31

    A partial-thickness epidermal explant model was colonized with GFP-expressing S. aureus and the pattern of S. aureus biofilm growth was characterized using electron and confocal laser scanning microscopy. Oxygen concentration in explants was quantified using microelectrodes. The relative effective diffusivity and porosity of the epidermis were determined using magnetic resonance imaging, while hydrogen peroxide (H2O2) concentration in explant media was measured by using microelectrodes. Secreted proteins were identified and quantified using MSE mass spectrometry. We found that S. aureus biofilm grows predominantly in sebum-rich areas around hair follicles and associated skin folds. Dissolved oxygen was selectively depleted (2-3 fold) in these locations, but the relative effective diffusivity and porosity did not change between colonized and control epidermis. Histological analysis revealed keratinocyte damage across all the layers of colonized epidermis after four days of culture. The colonized explants released significantly (P< 0.01) more anti-oxidant proteins of both epidermal and S. aureus origin, consistent with elevated H2O2 concentration found in the media from the colonized explants (P< 0.001). Caspase-14 was also elevated significantly in media from infected explants. While H2O2 induces primary keratinocyte differentiation, caspase-14 is required for terminal keratinocyte differentiation and desquamation. These results are consistent with a localized biological impact from S. aureus in response to colonization of the skin surface.

  11. A chemically defined culture medium containing Rho kinase inhibitor Y-27632 for the fabrication of stratified squamous epithelial cell grafts

    Energy Technology Data Exchange (ETDEWEB)

    Aslanova, Afag [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Takagi, Ryo; Yamato, Masayuki; Okano, Teruo [Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Yamamoto, Masakazu, E-mail: yamamoto.ige@twmu.ac.jp [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan)

    2015-05-01

    With the development of a culture method for stratified squamous epithelial cells, tissue-engineered epithelial cell sheets have been successfully applied as clinical cell grafts. However, the implementation of these cell sheets without the use of any animal-derived materials is highly desirable. In this study, Rho-associated protein kinase inhibitor Y-27632 was used to develop a chemically defined culture medium for the fabrication of stratified epithelial cell grafts consisting of human epidermal and oral keratinocytes, and the proliferation activity, cell morphology, and gene expressions of the keratinocytes were analyzed. The results of a colorimetric assay indicated that Y-27632 significantly promoted the proliferation of the keratinocytes in culture media both with and without fetal bovine serum (FBS), although there were no indications of Y-27632 efficacy on cell morphology and stratification of the keratinocytes in culture medium without any animal-derived materials. The results of quantitative RT-PCR revealed that gene expressions correlated with cell adhesion, cell–cell junction, proliferation markers, and stem/progenitor markers in cultured keratinocytes were not strongly affected by the addition of Y-27632 to the culture medium. Moreover, gene expressions of differentiation markers in stratified keratinocytes cultured in medium without FBS were nearly identical to those of keratinocytes co-cultured with 3T3 feeder cells. Interestingly, the expressions of differentiation markers in cultured stratified keratinocytes were suppressed by FBS, whereas they were reconstructed by either co-culture of a 3T3 feeder layer or addition of Y-27632 into the culture medium containing FBS. These findings indicate that Y-27632 is a useful supplement for the development of a chemically defined culture medium for fabrication of stratified epithelial cell grafts for clinical applications for the purpose of developing the culture medium with a lower risk of pathogen

  12. Apigenin and Wogonin Regulate Epidermal Growth Factor Receptor Signaling Pathway Involved in MUC5AC Mucin Gene Expression and Production from Cultured Airway Epithelial Cells.

    Science.gov (United States)

    Sikder, Md Asaduzzaman; Lee, Hyun Jae; Ryu, Jiho; Park, Su Hyun; Kim, Ju-Ock; Hong, Jang-Hee; Seok, Jeong Ho; Lee, Choong Jae

    2014-03-01

    We investigated whether wogonin and apigenin significantly affect the epidermal growth factor receptor (EGFR) signaling pathway involved in MUC5AC mucin gene expression, and production from cultured airway epithelial cells; this was based on our previous report that apigenin and wogonin suppressed MUC5AC mucin gene expression and production from human airway epithelial cells. Confluent NCI-H292 cells were pretreated with wogonin or apigenin for 15 minutes or 24 hours and then stimulated with epidermal growth factor (EGF) for 24 hours or the indicated periods. We found that incubation of NCI-H292 cells with wogonin or apigenin inhibited the phosphorylation of EGFR. The downstream signals of EGFR such as phosphorylation of MEK1/2 and ERK1/2 were also inhibited by wogonin or apigenin. The results suggest that wogonin and apigenin inhibits EGFR signaling pathway, which may explain how they inhibit MUC5AC mucin gene expression and production induced by EGF.

  13. Evidence supporting a role for dihydroorotate dehydrogenase, bioenergetics, and p53 in selective teriflunomide-induced apoptosis in transformed versus normal human keratinocytes.

    Science.gov (United States)

    Hail, Numsen; Chen, Ping; Kepa, Jadwiga J; Bushman, Lane R

    2012-03-01

    We have demonstrated previously that the dihydroorotate dehydrogenase (DHODH) inhibitor teriflunomide (TFN) encourages apoptosis in transformed human keratinocytes. Here we sought to determine if this cytotoxic effect could be restricted to transformed keratinocytes relative to their normal human epidermal keratinocyte (NHEK) counterparts, and ascertain a potential mechanistic basis for the selectivity. The NHEK cells proliferated much slower than the premalignant HaCaT and malignant COLO 16 keratinocytes, and exogenous uridine added to the culture medium did not affect this growth. Similarly, DHODH expression and the bioenergetic characteristics of the normal cells were markedly dissimilar from those observed in the transformed cells indicating that de novo pyrimidine synthesis was involved with keratinocyte proliferation. Moreover, a short-term exposure to TFN caused a wild-type p53 response in the NHEK cells illustrating that pyrimidine metabolic stress could regulate this tumor suppressor protein in the normal cells. TFN-induced apoptosis occurred primarily in S phase HaCaT cells. This cell death was sensitive to uridine, an antioxidant, and a caspase inhibitor, and the suppression of Bcl-X(L) and the induction of Mn superoxide dismutase preceded it. These events suggested that mitochondrial/redox stress was involved with the cytotoxic effect of TFN. Conversely, a long-term exposure to TFN caused G(0)/G(1) arrest in the NHEK cells, which supported a cytoprotective role for p53 against TFN-induced apoptosis. Together, these results propose that TFN could be useful in the prevention or therapy of non-melanoma skin cancers and possibly other hyperproliferative keratinocytic diseases.

  14. Anti-degenerative effect of Apigenin, Luteolin and Quercetin on human keratinocyte and chondrocyte cultures: SAR evaluation.

    Science.gov (United States)

    Crascì, Lucia; Cardile, Venera; Longhitano, Giusy; Nanfitò, Francesco; Panico, Annamaria

    2017-11-06

    Background Inflammation is a dynamic process that occur on vascularized tissue in response to different stimuli causing cell injury and tissue degeneration. Reactive oxygen and nitrogen species (ROS and RNS) and advanced glycation end products (AGEs) have a key mediatory role in the development and progression of degenerative tissue process. The bioflavonoids possess a broad-spectrum of pharmacological activities. Their capability is related to their chemical structure. Methods In this study we evaluated and compare antioxidant, anti-glycative and anti-degenerative actions of two flavones apigenin and luteolin and a flavonol quercetin, in function of their hydroxyl groups arrangement. Moreover we assay, on NCTC 2544 and chondrocytes cultures, the flavonoids capacity to modulate NO and glycosamminoglycans levels, index of antidegenerative capacity. Results All tested flavonoids act as free radicals scavengers (ROO • and NO • ) and advanced glycation end products inhibitors, in agreement with their BDE, IP and molecular planarity. Quercetin showed a high ORAC value (2.70±0.12 ORAC Units), according to a low BDE (74.54 Kcal/mol) and IP (174.44 Kcal/mol) values. Luteolin is the most active compound in the NO (48.19±0.18%) and AGEs (60.06±0.52%) inhibition, in function of a low torsion angle (16.3°) between the 3-OH moiety and C'6 carbon atom. Conclusion All tested flavonoids posses a protective role on degenerative tissue events. They acts in different manner depending on the functional groups, the biological substrate and the concentration used. In any case, it can be considered a suitable product preventing a degenerative processes. © Georg Thieme Verlag KG Stuttgart · New York.

  15. Constitution of fibrin-based niche for in vitro differentiation of adipose-derived mesenchymal stem cells to keratinocytes.

    Science.gov (United States)

    Sivan, Unnikrishnan; Jayakumar, K; Krishnan, Lissy K

    2014-12-01

    Epithelialization of chronic cutaneous wound is troublesome and may require use of skin/cell substitutes. Adipose-derived mesenchymal stem cells (ADMSCs) have immense potential as autologous cell source for treating wounds; they can cross the germ layer boundary of differentiation and regenerate skin. When multipotent adult stem cells are considered for skin regeneration, lineage committed keratinocytes may be beneficial to prevent undesirable post-transplantation outcome. This study hypothesized that ADMSCs may be directed to epidermal lineage in vitro on a specifically designed biomimetic and biodegradable niche. Cells were seeded on the test niche constituted with fibrin, fibronectin, gelatin, hyaluronic acid, laminin V, platelet growth factor, and epidermal growth factor in the presence of cell-specific differentiation medium (DM). The ADMSCs grown on bare tissue culture polystyrene surface in DM is designated DM-control and those grown in basal medium (BM) is the BM-control. Lineage commitment was monitored with keratinocyte-specific markers such as cytokeratin 14, cytokeratin 5, cytokeratin 19, and integrin α6 at the transcriptional/translational level. The in vitro designed biomimetic fibrin composite matrix may have potential application as cell transplantation vehicle.

  16. Epidermal growth factor and transforming growth factor-beta differently modulate the acute phase response elicited by interleukin-6 in cultured liver cells from man, rat and mouse.

    Science.gov (United States)

    Rokita, H; Bereta, J; Koj, A; Gordon, A H; Gauldie, J

    1990-01-01

    1. Complex effects of principal inflammatory cytokines (IL-6, IL-1, TNF, IFN-gamma) on acute phase protein synthesis and other metabolic processes in cultured liver cells are briefly reviewed. 2. Molecular properties and biological functions of transforming growth factor-beta and epidermal growth factor are compared. 3. The effects of these factors with respect to both amino acid uptake and acute phase protein synthesis are described in detail. The results are found to be different for rat or mouse hepatocytes and human hepatoma cells.

  17. Noninvasive electromagnetic fields on keratinocyte growth and migration.

    Science.gov (United States)

    Huo, Ran; Ma, Qianli; Wu, James J; Chin-Nuke, Kayla; Jing, Yuqi; Chen, Juan; Miyar, Maria E; Davis, Stephen C; Li, Jie

    2010-08-01

    Although evidence has shown that very small electrical currents produce a beneficial therapeutic result for wounds, noninvasive electromagnetic field (EMF) therapy has consisted mostly of anecdotal clinical reports, with very few well-controlled laboratory mechanistic studies. In this study, we evaluate the effects and potential mechanisms of a noninvasive EMF device on skin wound repair. The effects of noninvasive EMF on keratinocytes and fibroblasts were assessed via proliferation and incisional wound model migration assays. cDNA microarray and RT-PCR were utilized to assess genetic expression changes in keratinocytes after noninvasive EMF treatment. In vitro analyses with human skin keratinocyte cultures demonstrated that noninvasive EMFs have a strong effect on accelerating keratinocyte migration and a relatively weaker effect on promoting keratinocyte proliferation. The positive effects of noninvasive EMFs on cell migration and proliferation seem keratinocyte-specific without such effects seen on dermal fibroblasts. cDNA microarray and RT-PCR performed revealed increased expression of CRK7 and HOXC8 genes in treated keratinocytes. This study suggests that a noninvasive EMF accelerates wound re-epithelialization through a mechanism of promoting keratinocyte migration and proliferation, possibly due to upregulation of CRK7 and HOXC8 genes. Copyright 2010 Elsevier Inc. All rights reserved.

  18. Evaluation of cultured human dermal- and dermo-epidermal substitutes focusing on extracellular matrix components: Comparison of protein and RNA analysis.

    Science.gov (United States)

    Oostendorp, Corien; Meyer, Sarah; Sobrio, Monia; van Arendonk, Joyce; Reichmann, Ernst; Daamen, Willeke F; van Kuppevelt, Toin H

    2017-05-01

    Treatment of full-thickness skin defects with split-thickness skin grafts is generally associated with contraction and scar formation and cellular skin substitutes have been developed to improve skin regeneration. The evaluation of cultured skin substitutes is generally based on qualitative parameters focusing on histology. In this study we focused on quantitative evaluation to provide a template for comparison of human bio-engineered skin substitutes between clinical and/or research centers, and to supplement histological data. We focused on extracellular matrix proteins since these components play an important role in skin regeneration. As a model we analyzed the human dermal substitute denovoDerm and the dermo-epidermal skin substitute denovoSkin. The quantification of the extracellular matrix proteins type III collagen and laminin 5 in tissue homogenates using western blotting analysis and ELISA was not successful. The same was true for assaying lysyl oxidase, an enzyme involved in crosslinking of matrix molecules. As an alternative, gene expression levels were measured using qPCR. Various RNA isolation procedures were probed. The gene expression profile for specific dermal and epidermal genes could be measured reliably and reproducibly. Differences caused by changes in the cell culture conditions could easily be detected. The number of cells in the skin substitutes was measured using the PicoGreen dsDNA assay, which was found highly quantitative and reproducible. The (dis) advantages of assays used for quantitative evaluation of skin substitutes are discussed. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  19. Inactivation of mitogen-activated protein kinase signaling pathway reduces caspase-14 expression in impaired keratinocytes

    OpenAIRE

    Ningning Dang; Shuguang Pang; Haiyan Song; Liguo An; Xiaoli Ma

    2016-01-01

    Objective(s): Several investigations have revealed that caspase-14 is responsible for the epidermal differentiation and cornification, as well as the regulation of moisturizing effect. However, the precise regulation mechanism is still not clear. This study was aimed to investigate the expression of caspase-14 in filaggrin-deficient normal human epidermal keratinocytes (NHEKs) and to explore the possible mechanism that contributes to the regulation of caspase-14. Materials and Methods: The fi...

  20. A novel control of human keratin expression: cannabinoid receptor 1-mediated signaling down-regulates the expression of keratins K6 and K16 in human keratinocytes in vitro and in situ

    Directory of Open Access Journals (Sweden)

    Yuval Ramot

    2013-02-01

    Full Text Available Cannabinoid receptors (CB are expressed throughout human skin epithelium. CB1 activation inhibits human hair growth and decreases proliferation of epidermal keratinocytes. Since psoriasis is a chronic hyperproliferative, inflammatory skin disease, it is conceivable that the therapeutic modulation of CB signaling, which can inhibit both proliferation and inflammation, could win a place in future psoriasis management. Given that psoriasis is characterized by up-regulation of keratins K6 and K16, we have investigated whether CB1 stimulation modulates their expression in human epidermis. Treatment of organ-cultured human skin with the CB1-specific agonist, arachidonoyl-chloro-ethanolamide (ACEA, decreased K6 and K16 staining intensity in situ. At the gene and protein levels, ACEA also decreased K6 expression of cultured HaCaT keratinocytes, which show some similarities to psoriatic keratinocytes. These effects were partly antagonized by the CB1-specific antagonist, AM251. While CB1-mediated signaling also significantly inhibited human epidermal keratinocyte proliferation in situ, as shown by K6/Ki-67-double immunofluorescence, the inhibitory effect of ACEA on K6 expression in situ was independent of its anti-proliferative effect. Given recent appreciation of the role of K6 as a functionally important protein that regulates epithelial wound healing in mice, it is conceivable that the novel CB1-mediated regulation of keratin 6/16 revealed here also is relevant to wound healing. Taken together, our results suggest that cannabinoids and their receptors constitute a novel, clinically relevant control element of human K6 and K16 expression.

  1. Epidermal growth factor can optimize a serum-free culture system for bone marrow stem cell proliferation in a miniature pig model.

    Science.gov (United States)

    Wang, Xuan; Zheng, Feng; Liu, Ousheng; Zheng, Shutao; Liu, Yishan; Wang, Yuehong; Tang, Zhangui; Zhong, Liangjun

    2013-12-01

    Bone marrow-derived mesenchymal stem cells have become an attractive cell source for periodontal ligament regeneration treatment because of their potential to engraft to several tissue types after injury. Most researchers have focused on the transplantation process, but few have paid attention to cell safety concerns and rapid proliferation before transplantation. Using serum-free medium to culture stem cells may be an effective method to avoid problems associated with exogenous serum and the addition of growth factors to promote cell proliferation. Here, we randomly divided our serum-free cultures and treated them with different levels of epidermal growth factor (EGF). We then evaluated changes in rates of cell adhesion, proliferation, apoptosis, and cell cycle ratio as well as their differentiation potential. The data showed that all of these parameters were significantly different when comparing serum-free cultures with and without 10 nM/L EGF (p 0.05). In summary, our results demonstrate that 10 nM/L EGF was the optimal dose for serum-free culture, which can replace traditional standard serum medium for in vitro expansion of miniature pig bone marrow-derived mesenchymal stem cells.

  2. Influence of epidermal growth factor (EGF) and hydrocortisone on the co-culture of mature adipocytes and endothelial cells for vascularized adipose tissue engineering.

    Science.gov (United States)

    Huber, Birgit; Czaja, Alina Maria; Kluger, Petra Juliane

    2016-05-01

    The composition of vascularized adipose tissue is still an ongoing challenge as no culture medium is available to supply adipocytes and endothelial cells appropriately. Endothelial cell medium is typically supplemented with epidermal growth factor (EGF) as well as hydrocortisone (HC). The effect of EGF on adipocytes is discussed controversially. Some studies say it inhibits adipocyte differentiation while others reported of improved adipocyte lipogenesis. HC is known to have lipolytic activities, which might result in mature adipocyte dedifferentiation. In this study, we evaluated the influence of EGF and HC on the co-culture of endothelial cells and mature adipocytes regarding their cell morphology and functionality. We showed in mono-culture that high levels of HC promoted dedifferentiation and proliferation of mature adipocytes, whereas EGF seemed to have no negative influence. Endothelial cells kept their typical cobblestone morphology and showed a proliferation rate comparable to the control independent of EGF and HC concentration. In co-culture, HC promoted dedifferentiation of mature adipocytes, which was shown by a higher glycerol release. EGF had no negative impact on adipocyte morphology. No negative impact on endothelial cell morphology and functionality could be seen with reduced EGF and HC supplementation in co-culture with mature adipocytes. Taken together, our results demonstrate that reduced levels of HC are needed for co-culturing mature adipocytes and endothelial cells. In co-culture, EGF had no influence on mature adipocytes. Therefore, for the composition of vascularized adipose tissue constructs, the media with low levels of HC and high or low levels of EGF can be used. © 2016 International Federation for Cell Biology.

  3. Transforming growth factor-beta isoforms regulate the surface expression of membrane cofactor protein (CD46) and CD59 on human keratinocytes [corrected

    NARCIS (Netherlands)

    Pasch, M. C.; Bos, J. D.; Daha, M. R.; Asghar, S. S.

    1999-01-01

    We studied the regulation of the expression of complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF) and CD59, on human keratinocytes by supernatant of activated mononuclear cells and by some individual cytokines present therein. Cultured keratinocytes

  4. Knockdown of filaggrin in a three-dimensional reconstructed human epidermis impairs keratinocyte differentiation

    NARCIS (Netherlands)

    Pendaries, Valérie; Malaisse, Jeremy; Pellerin, Laurence; Le Lamer, Marina; Nachat, Rachida; Kezic, Sanja; Schmitt, Anne-Marie; Paul, Carle; Poumay, Yves; Serre, Guy; Simon, Michel

    2014-01-01

    Atopic dermatitis is a chronic inflammatory skin disorder characterized by defects in the epidermal barrier and keratinocyte differentiation. The expression of filaggrin, a protein thought to have a major role in the function of the epidermis, is downregulated. However, the impact of this deficiency

  5. Derivation of keratinocytes from chicken embryonic stem cells: Establishment and characterization of differentiated proliferative cell populations

    Directory of Open Access Journals (Sweden)

    Mathilde Couteaudier

    2015-03-01

    Full Text Available A common challenge in avian cell biology is the generation of differentiated cell-lines, especially in the keratinocyte lineage. Only a few avian cell-lines are available and very few of them show an interesting differentiation profile. During the last decade, mammalian embryonic stem cell-lines were shown to differentiate into almost all lineages, including keratinocytes. Although chicken embryonic stem cells had been obtained in the 1990s, few differentiation studies toward the ectodermal lineage were reported. Consequently, we explored the differentiation of chicken embryonic stem cells toward the keratinocyte lineage by using a combination of stromal induction, ascorbic acid, BMP4 and chicken serum. During the induction period, we observed a downregulation of pluripotency markers and an upregulation of epidermal markers. Three homogenous cell populations were derived, which were morphologically similar to chicken primary keratinocytes, displaying intracellular lipid droplets in almost every pavimentous cell. These cells could be serially passaged without alteration of their morphology and showed gene and protein expression profiles of epidermal markers similar to chicken primary keratinocytes. These cells represent an alternative to the isolation of chicken primary keratinocytes, being less cumbersome to handle and reducing the number of experimental animals used for the preparation of primary cells.

  6. B-cell maturation antigen (BCMA) activation exerts specific proinflammatory effects in normal human keratinocytes and is preferentially expressed in inflammatory skin pathologies.

    Science.gov (United States)

    Alexaki, Vassilia-Ismini; Pelekanou, Vassiliki; Notas, George; Venihaki, Maria; Kampa, Marilena; Dessirier, Valérie; Sabour-Alaoui, Sanaa; Stathopoulos, Efstathios N; Tsapis, Andreas; Castanas, Elias

    2012-02-01

    TNFα is known to be expressed in human skin, regulating immune-related responses. Here we report that human normal skin keratinocytes express the members of the TNF superfamily members A proliferation-inducing ligand (APRIL; TNFSF13), B cell-activating factor (BAFF; TNFSF13B), and their receptors, B cell maturation antigen (BCMA; TNFRSF17) and transmembrane activator, calcium-modulator, and cyclophilin ligand interactor (TACI; TNFRSF13B), in a distinct spatial pattern. Our data show a differential expression of these molecules within epidermal layers and skin appendages, whereas the BAFF-specific receptor BAFFR (TNFRSF13C) is absent. Importantly, APRIL and BCMA but not BAFF or TACI are up-regulated in inflammatory skin lesions of psoriasis and squamous cell carcinomas. To explore the functional significance of this system in the skin, we assayed these receptors and ligands in cultured primary keratinocytes and HaCaT cells. We show that both cell types express BAFF, APRIL, BCMA, and TACI. Furthermore, APRIL and/or BAFF trigger nuclear factor-κB activation and IL-6 and granulocyte macrophage colony-stimulating factor (GM-CSF) expression through functional BCMA receptors, an activation inhibited by anti-BCMA short hairpin RNA. However, BAFF and/or APRIL do not induce IL-8 or TNFα production. Our data advance BCMA as an inflammation-related TNFSFR member in keratinocytes, of potential importance in the management of inflammatory skin conditions.

  7. Promoting effect of lactoferrin on barrier function and epithelial differentiation of human keratinocytes.

    Science.gov (United States)

    Uchida, Ryo; Aoki, Reiji; Aoki-Yoshida, Ayako; Tajima, Atsushi; Takayama, Yoshiharu

    2017-02-01

    The purpose of this study was to elucidate the effects of bovine lactoferrin on keratinocyte differentiation and barrier function. Addition of bovine lactoferrin to differentiating HaCaT human keratinocytes led to increased transepithelial electrical resistance (TER), a marker of epithelial barrier function. This elevation was followed by upregulation of two differentiation markers, involucrin and filaggrin. The expression level of sterol regulatory element-binding protein-1 was also enhanced by bovine lactoferrin. The lactoferrin-induced upregulation of involucrin and filaggrin expression were confirmed in normal human epidermal keratinocytes (NHEK). Treatment with SB203580, a p38 mitogen-activated protein kinase (MAPK) α inhibitor, impaired the upregulation of involucrin and filaggrin expression in response to lactoferrin. The elevation of p38 MAPK phosphorylation was further enhanced by lactoferrin in the initial stage of differentiation of HaCaT keratinocytes. The findings suggest that bovine lactoferrin promotes epithelial differentiation by a p38-MAPK-dependent mechanism.

  8. Adult Murine Pancreatic Progenitors Require Epidermal Growth Factor and Nicotinamide for Self-Renewal and Differentiation in a Serum- and Conditioned Medium-Free Culture.

    Science.gov (United States)

    Wedeken, Lena; Luo, Angela; Tremblay, Jacob R; Rawson, Jeffrey; Jin, Liang; Gao, Dan; Quijano, Janine; Ku, Hsun Teresa

    2017-04-15

    Adult pancreatic stem and progenitor cells may serve as an alternative source of insulin-secreting endocrine cells in cell replacement therapy for type 1 diabetes, but much remained unknown about these cells. We previously identified adult murine pancreatic progenitor-like cells that displayed in vitro self-renewal and tri-lineage differentiation activities in a three-dimensional colony/organoid assay containing 1% methylcellulose and 5% Matrigel. However, the presence of other undefined culture components, such as serum and conditioned medium, has prevented a complete understanding of the signals required for progenitor cell growth. Here, we have established a serum-free, conditioned medium-free colony assay with the inclusion of seven defined factors: epidermal growth factor (EGF), R-Spondin 1 (RSPO1), Noggin, nicotinamide, exendin-4, activin B, and vascular endothelial growth factor (VEGF)-A. The requirements for colony growth were characterized and we found that EGF and nicotinamide were necessary and sufficient for the colony growth and long-term self-renewal of these progenitors. However, the seven factor (7F) culture medium better induced colony size and self-renewal in long-term culture than EGF plus nicotinamide alone. Individual 3-week-old colonies grown in the 7F culture medium expressed ductal, acinar, and endocrine lineage markers, suggesting that tri-lineage differentiation of the tri-potent progenitors was occurring without genetic manipulation. A delayed inhibition of Notch signaling using small molecules in 2-week-old cultures enhanced endocrine gene expression in 3-week-old colonies. This better-defined colony assay system will enable our and other laboratories for in-depth mechanistic studies on the biology of these progenitor cells.

  9. In situ localization of epidermal stem cells using a novel multi epitope ligand cartography approach.

    Science.gov (United States)

    Ruetze, Martin; Gallinat, Stefan; Wenck, Horst; Deppert, Wolfgang; Knott, Anja

    2010-06-01

    Precise knowledge of the frequency and localization of epidermal stem cells within skin tissue would further our understanding of their role in maintaining skin homeostasis. As a novel approach we used the recently developed method of multi epitope ligand cartography, applying a set of described putative epidermal stem cell markers. Bioinformatic evaluation of the data led to the identification of several discrete basal keratinocyte populations, but none of them displayed the complete stem cell marker set. The distribution of the keratinocyte populations within the tissue was remarkably heterogeneous, but determination of distance relationships revealed a population of quiescent cells highly expressing p63 and the integrins alpha(6)/beta(1) that represent origins of a gradual differentiation lineage. This population comprises about 6% of all basal cells, shows a scattered distribution pattern and could also be found in keratinocyte holoclone colonies. The data suggest that this population identifies interfollicular epidermal stem cells.

  10. Combination of low calcium with Y-27632 rock inhibitor increases the proliferative capacity, expansion potential and lifespan of primary human keratinocytes while retaining their capacity to differentiate into stratified epidermis in a 3D skin model.

    Directory of Open Access Journals (Sweden)

    Xanthe L Strudwick

    Full Text Available Human keratinocytes are difficult to isolate and have a limited lifespan. Traditionally, immortalised keratinocyte cell lines are used in vitro due to their ability to bypass senescence and survive indefinitely. However these cells do not fully retain their ability to differentiate in vitro and they are unable to form a normal stratum corneum in organotypic culture. Here we aimed to generate a pool of phenotypically similar keratinocytes from human donors that could be used in monolayer culture, without a fibroblast feeder layer, and in 3D human skin equivalent models. Primary human neonatal epidermal keratinocytes (HEKn were cultured in low calcium, (0.07 mM media, +/-10 μM Y-27632 ROCK inhibitor (HEKn-CaY. mRNA and protein was extracted and expression of differentiation markers Keratin 14 (K14, Keratin 10 (K10 and Involucrin (Inv assessed by qRT-PCR and Western blotting. The differentiation potential of the HEKn-CaY cultures was assessed by increasing calcium levels and removing the Y-27632 for 72 hrs prior to assessment of K14, K10 and Inv. The ability of the HEKn-CaY, to form a stratified epithelium was assessed using a human skin equivalent (HSE model in the absence of Y-27632. Increased proliferative capacity, expansion potential and lifespan of HEKn was observed with the combination of low calcium and 10 μM ROCK inhibitor Y-27632. The removal of Y-27632 and the addition of high calcium to induce differentiation allowed the cells to behave as primary keratinocytes even after extended serial passaging. Prolonged lifespan HEK-CaYs were capable of forming an organised stratified epidermis in 3D HSE cultures, demonstrating their ability to fully stratify and retain their original, primary characteristics. In conclusion, the use of 0.07 mM Calcium and 10 μM Y-27632 in HEKn monocultures provides the opportunity to culture primary human keratinocytes without a cell feeder layer for extended periods of culture whilst retaining their ability to

  11. Viability and growth of feline preantral follicles in vitro cultured with insulin growth factor and epidermal growth factor supplemented medium.

    Science.gov (United States)

    Alves, A E; Padilha-Nakaghi, L C; Pires-Butler, E A; Apparicio, M; Silva, Nam; Motheo, T F; Vicente, Wrr; Luvoni, G C

    2017-04-01

    In vitro culture of ovarian preantral follicles has emerged as a reproductive technology aimed at obtaining large amount of oocytes for in vitro embryo production. The addition of growth factors (GF) in the in vitro culture of preantral follicles of different species has provided superior results of follicular development, antrum formation and proliferation of granulosa cells. However, there are only few reports regarding the use of these factors on feline preantral follicle in vitro culture. Thus, the aim of this study was to investigate the effect of a combination of IGF-1 and EGF on in vitro viability and growth of preantral follicles and enclosed oocytes collected from domestic cats. A total of 64 follicles characterized by multilayer granulosa cells were isolated and individually cultured for 6 days (T6) in minimum essential medium supplemented with IGF-1+ EGF (100 ng/ml each) or without (control). A higher percentage of follicles were viable after culture with GF than without, and an increase in size when IGF-1+ EGF were added to the medium (170 ± 32.4 μm (T0) vs. 201 ± 22.3 μm (T6); p  .05). These data suggest that the addition of IGF-1 and EGF to the culture medium promotes the in vitro development of preantral follicles of cats. © 2016 Blackwell Verlag GmbH.

  12. Genetically programmed differences in epidermal host defense between psoriasis and atopic dermatitis patients.

    Directory of Open Access Journals (Sweden)

    Patrick L J M Zeeuwen

    Full Text Available In the past decades, chronic inflammatory diseases such as psoriasis, atopic dermatitis, asthma, Crohn's disease and celiac disease were generally regarded as immune-mediated conditions involving activated T-cells and proinflammatory cytokines produced by these cells. This paradigm has recently been challenged by the finding that mutations and polymorphisms in epithelium-expressed genes involved in physical barrier function or innate immunity, are risk factors of these conditions. We used a functional genomics approach to analyze cultured keratinocytes from patients with psoriasis or atopic dermatitis and healthy controls. First passage primary cells derived from non-lesional skin were stimulated with pro-inflammatory cytokines, and expression of a panel of 55 genes associated with epidermal differentiation and cutaneous inflammation was measured by quantitative PCR. A subset of these genes was analyzed at the protein level. Using cluster analysis and multivariate analysis of variance we identified groups of genes that were differentially expressed, and could, depending on the stimulus, provide a disease-specific gene expression signature. We found particularly large differences in expression levels of innate immunity genes between keratinocytes from psoriasis patients and atopic dermatitis patients. Our findings indicate that cell-autonomous differences exist between cultured keratinocytes of psoriasis and atopic dermatitis patients, which we interpret to be genetically determined. We hypothesize that polymorphisms of innate immunity genes both with signaling and effector functions are coadapted, each with balancing advantages and disadvantages. In the case of psoriasis, high expression levels of antimicrobial proteins genes putatively confer increased protection against microbial infection, but the biological cost could be a beneficial system gone awry, leading to overt inflammatory disease.

  13. TLR4 as a negative regulator of keratinocyte proliferation.

    Directory of Open Access Journals (Sweden)

    Guergana Iotzova-Weiss

    Full Text Available TLR4 is an innate immune receptor with expression in human skin, keratinocytes as well as squamous cell carcinoma (SCC of the skin. In the present study we investigate the role of TLR4 as a negative regulator of keratinocyte proliferation. We present here that the expression of TLR4 increased with the differentiation of cultured keratinocytes in a passage-dependent manner or under calcium-rich conditions. Moreover, the down-regulation of TLR4 by specific knockdown increased the proliferation of HaCaT keratinocytes in vitro. In addition, subcutaneously injected HaCaT keratinocytes with shTLR4 formed growing tumors in nude mice. In contrast, we observed lower proliferation and increased migration in vitro of the SCC13 cell line stably overexpressing TLR4 in comparison to SCC13 TLR4 negative cells. In vivo, SCC13 TLR4-overexpressing tumors showed delayed growth in comparison to TLR4 negative tumors. The overexpression of TLR4 in SCC13 tumor cells was followed by phosphorylation of ERK1/2 and JNK and increased expression of ATF3. In gene expression arrays, the overexpression of TLR4 in tumor cells correlated with gene expression of ATF-3, IL-6, CDH13, CXCL-1 and TFPI. In summary, TLR4 negatively regulates the proliferation of keratinocytes and its overexpression reduces tumor growth of SCC cells.

  14. TLR4 as a negative regulator of keratinocyte proliferation.

    Science.gov (United States)

    Iotzova-Weiss, Guergana; Freiberger, Sandra N; Johansen, Pål; Kamarachev, Jivko; Guenova, Emmanuella; Dziunycz, Piotr J; Roux, Guillaume A; Neu, Johannes; Hofbauer, Günther F L

    2017-01-01

    TLR4 is an innate immune receptor with expression in human skin, keratinocytes as well as squamous cell carcinoma (SCC) of the skin. In the present study we investigate the role of TLR4 as a negative regulator of keratinocyte proliferation. We present here that the expression of TLR4 increased with the differentiation of cultured keratinocytes in a passage-dependent manner or under calcium-rich conditions. Moreover, the down-regulation of TLR4 by specific knockdown increased the proliferation of HaCaT keratinocytes in vitro. In addition, subcutaneously injected HaCaT keratinocytes with shTLR4 formed growing tumors in nude mice. In contrast, we observed lower proliferation and increased migration in vitro of the SCC13 cell line stably overexpressing TLR4 in comparison to SCC13 TLR4 negative cells. In vivo, SCC13 TLR4-overexpressing tumors showed delayed growth in comparison to TLR4 negative tumors. The overexpression of TLR4 in SCC13 tumor cells was followed by phosphorylation of ERK1/2 and JNK and increased expression of ATF3. In gene expression arrays, the overexpression of TLR4 in tumor cells correlated with gene expression of ATF-3, IL-6, CDH13, CXCL-1 and TFPI. In summary, TLR4 negatively regulates the proliferation of keratinocytes and its overexpression reduces tumor growth of SCC cells.

  15. Surface electrical capacitance as an index of epidermal barrier properties of composite skin substitutes and skin autografts.

    Science.gov (United States)

    Goretsky, M J; Supp, A P; Greenhalgh, D G; Warden, G D; Boyce, S T

    1995-01-01

    Restoration of the epidermal barrier is a requirement for burn wound closure. A rapid, reliable, and noninvasive measure of the rate of restoration of the epidermal barrier is not readily available. To monitor the reformation of the epidermal barrier, we measured surface electrical capacitance on cultured skin substitutes (human keratinocytes and fibroblasts attached to collagen-glycosaminoglycan substrates) and split-thickness skin autografts grafted to patients. Data were collected from four patients with burns and one pediatric patient with a congenital hairy nevus comprising > 60% total body surface area. Capacitance measurements were performed at days 7, 10, 12, 14, and 28 by direct contact of the capacitance probe for 10 seconds to the cultured skin substitutes or split-thickness autograft. On postoperative days 7, 10, 12, 14, 21, and 28, the surface electrical capacitance of cultured skin substitutes after 10 seconds of sampling was 2468 +/- 268, 1443 +/- 439, 129 +/- 43, 200 +/- 44, 88 +/- 20, and 74 +/- 19 picofarads (mean +/- standard error of the mean), respectively. Surface electrical capacitance for split-thickness autograft on the same days was 1699 +/- 371, 1914 +/- 433, 125 +/- 16, 175 +/- 63, 110 +/- 26, 271 +/- 77 picofarads, respectively. Surface electrical capacitance in all of the grafts decreased with time. Cultured skin substitutes had approximately the same 10-second capacitance values as split-thickness autograft during 3 weeks of healing and approached values for uninjured skin (32 +/- 5 picofarads) by 12 days. Measurement of surface electrical capacitance is a direct, inexpensive, and convenient index for noninvasive monitoring of epidermal barrier formation.

  16. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  17. Photo-oxidation products of skin surface squalene mediate metabolic and inflammatory responses to solar UV in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Vladimir Kostyuk

    Full Text Available The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL or to primary cultures of normal human epidermal keratinocytes (NHEK. The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq, and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx were quantitatively isolated from irradiated SSL. When administered directly to NHEK, low-dose solar UVA+UVB induced time-dependent inflammatory and metabolic responses. To mimic UVA+UVB action, NHEK were exposed to intact or photo-oxidised SSL, Sq or SqPx, 4-hydroxy-2-nonenal (4-HNE, and the product of tryptophan photo-oxidation 6-formylindolo[3,2-b]carbazole (FICZ. FICZ activated exclusively metabolic responses characteristic for UV, i.e. the aryl hydrocarbon receptor (AhR machinery and downstream CYP1A1/CYP1B1 gene expression, while 4-HNE slightly stimulated inflammatory UV markers IL-6, COX-2, and iNOS genes. On contrast, SqPx induced the majority of metabolic and inflammatory responses characteristic for UVA+UVB, acting via AhR, EGFR, and G-protein-coupled arachidonic acid receptor (G2A.Our findings indicate that Sq could be a primary sensor of solar UV irradiation in human SSL, and products of its photo-oxidation mediate/induce metabolic and inflammatory responses of keratinocytes to UVA+UVB, which could be relevant for skin inflammation in the sun-exposed oily skin.

  18. Measurement of anti-inflammatory effects of glucocorticoids on human keratinocytes in vitro. Comparison of normal human keratinocytes with the keratinocyte cell line HaCaT.

    Science.gov (United States)

    Stein, M; Bernd, A; Ramirez-Bosca, A; Kippenberger, S; Holzmann, H

    1997-11-01

    There are only few objective in vitro methods available for the testing of anti-inflammatory pharmaceutical products. One possibility is in the stimulation of cytokine production in cultivated human keratinocytes by UV light and the subsequent testing of suppressing activities. From the dermatological aspect the interleukins 6 and 8 are especially interesting because they are elevated in psoriatic skin. In the present work three glucocorticoids were tested in cultures of normal human keratinocytes and in the permanent keratinocyte cell line HaCaT. Both cell species produced IL-6 and IL-8 spontaneously, albeit in very small amounts. After UV irradiation the interleukin production increased in a dose dependent manner. The IL-6 and IL-8 induction could be suppressed by each of the glucocorticoids tested. The thymidine incorporation rate of the cells was not affected by the glucocorticoids indicating that the observed suppression of cytokine induction was not the result of a generalised cell damage. The response of both HaCaT keratinocytes and primary human keratinocytes to UV irradiation and glucocorticoid application was similar indicating the possible use of the generally available HaCaT cells for the pharmacological testing of anti-inflammatory activities in vitro.

  19. Topical Glucose Induces Claudin-1 and Filaggrin Expression in a Mouse Model of Atopic Dermatitis and in Keratinocyte Culture, Exerting Anti-inflammatory Effects by Repairing Skin Barrier Function

    Directory of Open Access Journals (Sweden)

    Kiyoko Yamada

    2017-10-01

    Full Text Available Atopic dermatitis (AD is a chronic inflammatory skin disease. Corticosteroids, which are widely used for AD treatment, have adverse effects, and alternative treatments are urgently needed. This study examined the effect of topical application of high-dose glucose on inflamed skin in a murine model of AD. High-dose glucose treatment on the ear reduced dermatitis scores and ear thicknesses in mite antigen-treated NC/Nga mice. The levels of thymus and activation-regulated chemokine (TARC, Th cytokines (interleukin (IL-4, IL-5, IL-12, IL-13, and (interferon IFN-γ, and IgE were decreased in the serum of high-dose glucose-treated mice. Expression of claudin-1 and filaggrin was reduced in the ear epithelium in the NC/Nga mice. However, the reduced expression was restored by topical treatment with high-dose glucose. High-dose glucose also induced the expression of claudin-1 and filaggrin in cultured human skin keratinocytes. Co-stimulation with IL-4, IL-13, and thymic stromal lymphoprotein downregulated the expression of filaggrin in culture. However, high-dose glucose treatment restored the reduced expression of filaggrin. These results suggest that high-dose glucose treatment suppresses inflammation in the skin lesions by improving the skin barrier function.

  20. Frontiers in epidermal barrier homeostasis--an approach to mathematical modelling of epidermal calcium dynamics.

    Science.gov (United States)

    Denda, Mitsuhiro; Denda, Sumiko; Tsutsumi, Moe; Goto, Makiko; Kumamoto, Junichi; Nakatani, Masashi; Takei, Kentaro; Kitahata, Hiroyuki; Nakata, Satoshi; Sawabu, Yusuke; Kobayashi, Yasuaki; Nagayama, Masaharu

    2014-02-01

    Intact epidermal barrier function is crucial for survival and is associated with the presence of gradients of both calcium ion concentration and electric potential. Although many molecules, including ion channels and pumps, are known to contribute to maintenance of these gradients, the mechanisms involved in epidermal calcium ion dynamics have not been clarified. We have established that a variety of neurotransmitters and their receptors, originally found in the brain, are expressed in keratinocytes and are also associated with barrier homeostasis. Moreover, keratinocytes and neurons show some similarities of electrochemical behaviour. As mathematical modelling and computer simulation have been employed to understand electrochemical phenomena in brain science, we considered that a similar approach might be applicable to describe the dynamics of epidermal electrochemical phenomena associated with barrier homeostasis. Such methodology would also be potentially useful to address a number of difficult problems in clinical dermatology, such as ageing and itching. Although this work is at a very early stage, in this essay, we discuss the background to our approach and we present some preliminary results of simulation of barrier recovery. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Epidermal and dermal characteristics in skin equivalent after systemic and topical application of skin care ingredients.

    Science.gov (United States)

    Vicanova, Jana; Bouez, Charbel; Lacroix, Sophie; Lindmark, Lars; Damour, Odile

    2006-05-01

    Effects of active ingredients from topical and systemic skincare products on structure and organization of epidermis, dermal-epidermal junction (DEJ), and dermis were examined using an in vitro reconstructed skin equivalent (SE). Imedeen Time Perfection (ITP) ingredients (a mixture of BioMarine Complex, grape seed extract, tomato extract, vitamin C) were supplemented systemically into culture medium. Kinetin, an active ingredient from Imedeen Expression Line Control Serum, was applied topically. Both treatments were tested separately or combined. In epidermis, all treatments stimulated keratinocyte proliferation, showing a significant increase of Ki67-positive keratinocytes (P treatments. In dermis, only ITP increased the amount of collagen type I. Both kinetin and ITP stimulated formation of fibrillin-1 and elastin deposition. The effect of kinetin was seen in upper dermis. It stimulated not only the amount of deposited fibrillin-1 and elastin fibers but also their organization perpendicularly to the DEJ. ITP stimulated formation of fibrillin-1 in deeper dermis. In summary, the combination of topical treatment with kinetin and systemic treatment with ITP had complementary beneficial effects in the formation and development of epidermis and dermis.

  2. The Potential of Menstrual Blood-Derived Stem Cells in Differentiation to Epidermal Lineage: A Preliminary Report.

    Science.gov (United States)

    Faramarzi, Hossein; Mehrabani, Davood; Fard, Maryam; Akhavan, Maryam; Zare, Sona; Bakhshalizadeh, Shabnam; Manafi, Amir; Kazemnejad, Somaieh; Shirazi, Reza

    2016-01-01

    Menstrual blood-derived stem cells (MenSCs) are a novel source of stem cells that can be easily isolated non-invasively from female volunteered donor without ethical consideration. These mesenchymal-like stem cells have high rate of proliferation and possess multi lineage differentiation potency. This study was undertaken to isolate the MenSCs and assess their potential in differentiation into epidermal lineage. About 5-10 ml of menstrual blood (MB) was collected using sterile Diva cups inserted into vagina during menstruation from volunteered healthy fertile women aged between 22-30 years. MB was transferred into Falcon tubes containing phosphate buffered saline (PBS) without Ca2(+) or Mg2(+) supplemented with 2.5 µg/ml fungizone, 100 µg/mL streptomycin, 100 U/mL penicillin and 0.5 mM EDTA. Mononuclear cells were separated using Ficoll-Hypaque density gradient centrifugation and washed out in PBS. The cell pellet was suspended in DMEM-F12 medium supplemented with 10% FBS and cultured in tissue culture plates. The isolated cells were co-cultured with keratinocytes derived from the foreskin of healthy newborn male aged 2-10 months who was a candidate for circumcision for differentiation into epidermal lineage. The isolated MenSCs were adhered to the plate and exhibited spindle-shaped morphology. Flow cytometric analysis revealed the expression of mesenchymal markers of CD10, CD29, CD73, and CD105 and lack of hematopoietic stem cells markers. An early success in derivation of epidermal lineage from MenSCs was visible. The MenSCs are a real source to design differentiation to epidermal cells that can be used non-invasively in various dermatological lesions and diseases.

  3. The mechanism of melanocyte dendrite formation: the impact of differentiating keratinocytes.

    Science.gov (United States)

    Kippenberger, S; Bernd, A; Bereiter-Hahn, J; Ramirez-Bosca, A; Kaufmann, R

    1998-02-01

    In human epidermis one dendritic melanocyte interacts with about 36 keratinocytes and supplies them with melanin. In contrast to the vivo situation melanocytes in culture are far less dendritic. In the present study different culture systems were tested in order to observe the mechanism of melanocyte dendrite formation. In particular, we focused on the role of keratinocytes in this process. Time lapse studies revealed that only differentiated keratinocytes enhance melanocyte dendricity. Differentiated keratinocytes form connected cell sheets, which attach to part of the melanocyte plasma membrane. By contraction and retraction of keratinocyte units, new dendrites were drawn out from the melanocytes. Melanocytes remain passive during this process, which is indicated by the observation that sometimes extended dendrites could not withstand the tension and shear.

  4. Topical Hesperidin Improves Epidermal Permeability Barrier Function and Epidermal Differentiation in Normal Murine Skin

    Science.gov (United States)

    Hou, Maihua; Man, Mona; Man, Wenyan; Zhu, Wenyuan; Hupe, Melanie; Park, Kyungho; Crumrine, Debra; Elias, Peter M.; Man, Mao-Qiang

    2012-01-01

    Orange peel extract appears to exhibit beneficial effects on skin whitening, inflammation, UVB protection, as well as keratinocyte proliferation. In the present study, we determine whether topical hesperidin influences epidermal permeability barrier function and its underlying mechanisms. Hairless mice were treated topically with 2% hesperidin or 70% ethanol alone twice daily for 6 days. At the end of treatment, basal barrier function as well as transepidermal water loss (TEWL) was measured 2 and 4 hours post barrier disruption. Epidermal proliferation and differentiation were evaluated by immunohistochemical staining and Western blot analysis. Additionally, lamellar body density and secretion were assessed by electron microscopy. Although there were no significant differences in basal barrier function, in comparison to control animals, topical hesperidin significantly accelerated barrier recovery at both 2 and 4 hours after acute barrier abrogation. Enhanced barrier function in hesperidin-treated skin correlated with stimulation of both epidermal proliferation and differentiation, as well as enhanced lamellar body secretion. These results indicate that topical hesperidin enhances epidermal permeability barrier homeostasis at least in part due to stimulation of epidermal proliferation, differentiation, as well as lamellar body secretion. PMID:22509829

  5. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  6. Basal keratinocytes contribute to all strata of the adult zebrafish epidermis.

    Science.gov (United States)

    Lee, Raymond T H; Asharani, P V; Carney, Thomas J

    2014-01-01

    The epidermis of terrestrial vertebrates is a stratified epithelium and forms an essential protective barrier. It is continually renewed, with dead corneocytes shed from the surface and replaced from a basal keratinocyte stem cell population. Whilst mouse is the prime model system used for epidermal studies, there is increasing employment of the zebrafish to analyse epidermis development and homeostasis, however the architecture and ontogeny of the epidermis in this system are incompletely described. In particular, it is unclear if adult zebrafish epidermis is derived entirely from the basal epidermal stem cell layer, as in the mouse, or if the most superficial keratinocyte layer is a remnant of the embryonic periderm. Furthermore, a relative paucity of cellular markers and genetic reagents to label and manipulate the basal epidermal stem cell compartment has hampered research. Here we show that the type I keratin, krtt1c19e, is a suitable marker of the basal epidermal layer and identify a krtt1c19e promoter fragment able to drive strong and specific expression in this cell type. Use of this promoter to express an inducible Cre recombinase allowed permanent labelling of basal cells during embryogenesis, and demonstrated that these cells do indeed generate keratinocytes of all strata in the adult epidermis. Further deployment of the Cre-Lox system highlighted the transient nature of the embryonic periderm. We thus show that the epidermis of adult zebrafish, as in the mouse, derives from basal stem cells, further expanding the similarities of epidermal ontogeny across vertebrates. Future use of this promoter will assist genetic analysis of basal keratinocyte biology in zebrafish.

  7. Phosphorylation of epidermal growth factor receptor at serine 1047 in cultured lung alveolar epithelial cells by bradykinin B2 receptor stimulation.

    Science.gov (United States)

    Izumi, Shunsuke; Higa-Nakamine, Sayomi; Nishi, Hiroyuki; Torihara, Hidetsugu; Uehara, Ayako; Sugahara, Kazuhiro; Kakinohana, Manabu; Yamamoto, Hideyuki

    2017-09-09

    Accumulating evidence indicates that epidermal growth factor receptor (EGFR) is desensitized by phosphorylation of serine 1047 (Ser1047). We and other groups have reported that stimulation of a receptor of tumor-necrosis factor α (TNFα) and Toll-like receptor 5 (TLR5) induced the phosphorylation of Ser1047 through activation of p38 mitogen-activated protein kinase (p38 MAPK) in cultured lung alveolar epithelial A549 cells. However, phosphorylation of EGFR at Ser1047 by stimulation of any G-protein coupled receptors (GPCRs) has not been reported in any cultured cells. In the present study, we first confirmed that A549 cells expressed bradykinin (BK) B2 receptor, and then, we examined whether BK treatment of A549 cells activated MAPKs and induced the phosphorylation of EGFR at Ser1047. Immunoblotting analysis and reporter gene assays indicated that BK activated the pathways of extracellular signal-regulated kinase (ERK) and p38 MAPK. Inhibitor studies suggested that Gq/11 was mainly involved in the activation of ERK and p38 MAPK. We found that stimulation of the BK B2 receptor, but not the BK B1 receptor, induced phosphorylation of EGFR at Ser1047. Pharmacological experiments indicated that both ERK and p38 MAPK were involved in the phosphorylation of EGFR. These results strongly suggested that BK regulates EGFR functions in lung alveolar epithelial cells. In addition, we found that BK treatment increased the mRNA level of dual specificity MAPK phosphatase 5 (DUSP5) in an ERK-dependent manner, which suggested that a negative feedback mechanism of ERK existed in the cells. Copyright © 2017. Published by Elsevier Ltd.

  8. Reciprocal interactions between Beta1-integrin and epidermal growth factor in three-dimensional basement membrane breast cultures: A different perspective in epithelial biology

    Energy Technology Data Exchange (ETDEWEB)

    Wang, F.; Weaver, V.M.; Petersen, O.W.; Larabell, C.A.; Dedhar, S.; Briand, P.; Lupu, R.; Bissell, M.J.

    1998-09-30

    Anchorage and growth factor independence are cardinal features of the transformed phenotype. Although it is logical that the two pathways must be coregulated in normal tissues to maintain homeostasis, this has not been demonstrated directly. We showed previously that down-modulation of {beta}1-integrin signaling reverted the malignant behavior of a human breast tumor cell line (T4-2) derived from phenotypically normal cells (HMT-3522) and led to growth arrest in a threedimensional (3D) basement membrane assay in which the cells formed tissue-like acini (14). Here, we show that there is a bidirectional cross-modulation of {beta}1-integrin and epidermal growth factor receptor (EGFR) signaling via the mitogenactivated protein kinase (MAPK) pathway. The reciprocal modulation does not occur in monolayer (2D) cultures. Antibodymediated inhibition of either of these receptors in the tumor cells, or inhibition of MAPK kinase, induced a concomitant downregulation of both receptors, followed by growth-arrest and restoration of normal breast tissue morphogenesis. Crossmodulation and tissue morphogenesis were associated with attenuation of EGF-induced transient MAPK activation. To specifically test EGFR and {beta}1-integrin interdependency, EGFR was overexpressed in nonmalignant cells, leading to disruption of morphogenesis and a compensatory up-regulation of {beta}1-integrin expression, again only in 3D. Our results indicate that when breast cells are spatially organized as a result of contact with basement membrane, the signaling pathways become coupled and bidirectional. They further explain why breast cells fail to differentiate in monolayer cultures in which these events are mostly uncoupled. Moreover, in a subset of tumor cells in which these pathways are misregulated but functional, the cells could be 'normalized' by manipulating either pathway.

  9. Protective effect of matrix metalloproteinase inhibitors against epidermal basement membrane damage: skin equivalents partially mimic photoageing process.

    Science.gov (United States)

    Amano, S; Ogura, Y; Akutsu, N; Matsunaga, Y; Kadoya, K; Adachi, E; Nishiyama, T

    2005-12-01

    The epidermal basement membrane (BM) plays important roles in adhesion between epidermis and dermis, and in controlling epidermal differentiation. The BM has been reported to be damaged in sun-exposed skin. Although matrix metalloproteinases (MMPs) are believed to be involved in the BM damage, there is no good in vitro model for examining BM damage by MMPs or for exploring methods to protect the BM. To examine the involvement of MMPs in BM damage and approaches to protect the BM from such damage by using an in vitro skin-equivalent (SE) model. SE was prepared by culturing human keratinocytes on contracted collagen gel including human fibroblasts. MMP-1, -2, -3 and -9, laminin 5 and type IV and VII collagens were determined by specific sandwich ELISAs, and MMP-2 and MMP-9 were analysed by gelatin zymography. Histological examination of SE was also carried out. Despite production of BM components such as laminin 5 and type IV and VII collagens in SEs, BM was rarely observed at the dermal-epidermal junction. Several MMPs, such as MMP-1, -2, -3 and -9, were observed to be present in conditioned media and some of them were in active forms. Tissue inhibitor of metalloproteinase (TIMP)-2 was not detected, although TIMP-1 was present. Synthetic MMP inhibitors, CGS27023A and MMP-inhibitor I, which inhibit MMP-1, -2, -3 and -9, markedly augmented deposition of laminin 5 and type IV and VII collagens at the dermal-epidermal junction, resulting in the formation of continuous epidermal BM. Our results indicate that MMPs are involved in the degradation of BM in SEs, and that MMP inhibitors exert a protective effect against BM damage.

  10. Cryopreserved lip mucosa tissue derived keratinocytes can fabricate tissue engineered palatal mucosa equivalent.

    Science.gov (United States)

    Xiong, Xuepeng; Jia, Jun; He, Sangang; Zhao, Yifang

    2010-07-01

    Clinical application of tissue engineered palatal mucosa is hampered by unavailability of suitable oral keratinocytes as seeding cells. The aim of this study is to fabricate a tissue engineered palatal mucosa equivalent from the oral keratinocytes which cultured from cryopreserved lip mucosa tissues. Abundant lip mucosa tissues during cheilorrhaphy were firstly cryopreserved in liquid nitrogen for four to six months, and then recovered to culture oral keratinocytes for the fabrication of oral mucosa equivalent. In the control groups, oral keratinocytes cultured from fresh lip mucosa, fresh palate mucosa, and cryopreserved palate mucosa were used to fabricate oral mucosa equivalents. Attachment rate of the oral keratinocytes derived from cryopreserved lip mucosa was lower than that of the keratinocytes from fresh lip mucosa samples, however, the cell cycle distribution of oral keratinocytes cultured from all four groups of mucosa samples were similar. Histologically, the fabricated mucosa equivalents from these four groups had four- to six epithelial layers, the basal cells were cubic and the outmost cells were flatten with narrow nuclei which paralleled to the surface of the dermal matrix. Additionally, Ki-67 positive stained cells were mainly located in the basal layer of the epithelium of these equivalents. These characteristics disclosed that the oral mucosa equivalent cultured from the cryopreserved lip mucosa tissue was not different with the equivalents from other groups and similar to the native palate mucosa tissue. It suggested that the cryopreserved lip mucosa tissues could be used for the construction of palatal mucosal equivalent for clinical application. (c) 2010 Wiley Periodicals, Inc.

  11. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Itoi, Saori; Terao, Mika, E-mail: mterao@derma.med.osaka-u.ac.jp; Murota, Hiroyuki; Katayama, Ichiro

    2013-10-18

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10{sup −13} M cortisol, whereas 1 × 10{sup −5} M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol

  12. Photocrosslinkable Gelatin Hydrogel for Epidermal Tissue Engineering.

    Science.gov (United States)

    Zhao, Xin; Lang, Qi; Yildirimer, Lara; Lin, Zhi Yuan; Cui, Wenguo; Annabi, Nasim; Ng, Kee Woei; Dokmeci, Mehmet R; Ghaemmaghami, Amir M; Khademhosseini, Ali

    2016-01-07

    Natural hydrogels are promising scaffolds to engineer epidermis. Currently, natural hydrogels used to support epidermal regeneration are mainly collagen- or gelatin-based, which mimic the natural dermal extracellular matrix but often suffer from insufficient and uncontrollable mechanical and degradation properties. In this study, a photocrosslinkable gelatin (i.e., gelatin methacrylamide (GelMA)) with tunable mechanical, degradation, and biological properties is used to engineer the epidermis for skin tissue engineering applications. The results reveal that the mechanical and degradation properties of the developed hydrogels can be readily modified by varying the hydrogel concentration, with elastic and compressive moduli tuned from a few kPa to a few hundred kPa, and the degradation times varied from a few days to several months. Additionally, hydrogels of all concentrations displayed excellent cell viability (>90%) with increasing cell adhesion and proliferation corresponding to increases in hydrogel concentrations. Furthermore, the hydrogels are found to support keratinocyte growth, differentiation, and stratification into a reconstructed multilayered epidermis with adequate barrier functions. The robust and tunable properties of GelMA hydrogels suggest that the keratinocyte laden hydrogels can be used as epidermal substitutes, wound dressings, or substrates to construct various in vitro skin models. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Differential Regulation of Galectin Expression/Reactivity during Wound Healing in Porcine Skin and in Cultures if Epidermal Cells with Functional Impact on Migration

    Czech Academy of Sciences Publication Activity Database

    Klíma, Jiří; Lacina, L.; Dvořánková, B.; Hermann, D.; Carnwath, J. W.; Niemann, H.; Kaltner, H.; André, S.; Motlík, Jan; Gabius, H. J.; Smetana Jr., K.

    2009-01-01

    Roč. 58, č. 6 (2009), s. 873-884 ISSN 0862-8408 R&D Projects: GA MŠk 1M0538 Institutional research plan: CEZ:AV0Z50450515 Keywords : Epidermis * Keratinocytes * Lecitin Subject RIV: FH - Neurology Impact factor: 1.430, year: 2009

  14. Steven-Johnson Syndrome (SJS and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Erkan Alpsoy

    2010-12-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are rare, life-threatening conditions with a high mortality rate. SJS and TEN are used to denote a group of disorders closely related to each other, characterized by extensive epidermal necrolysis, and usually induced by drugs. Keratinocyte apoptosis is the main reason for widespread epidermal detachment. Drugs or their methobolites can act as a hapten after binding to the keratinocyte surface and initiate cytotoxic immunological attack. Drug-specific CD8+cytotoxic T cells mediate keratinocyte apoptosis by the Fas/FasL pathway and perforin/granzyme pathway. Although numerous drugs have been noted as responsible, sulfonamide class of antibiotics, anticonvulsants, beta-lactam antibiotics, allopurinol, nonsteroidal anti-inflammatory drugs, nevirapine and thiacetazone are the most frequently reported causative ones. Early diagnosis and withdrawal of suspected drug or drugs are one of the most important steps in the treatment. Other diseases resembling SJS/TEN should be excluded as soon as possible. Although various topical and systemic treatments have recently been used, ideal supportive care is still the most important and effective therapeutic approach. SCORTEN, a scoring system used to predict mortality in TEN, has been widely used in recent years. Transfer to a burn unit or intensive care unit is recommended for patients with a SCORTEN 3 (mortality rate; 35.3% or over. In this paper, we aimed to review clinical findings, aetiopathogenesis and treatment of these syndromes in the light of current literature.

  15. Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter

    2012-01-01

    the mRNA expression by real time PCR of the 4 receptors and 12 ligands from the EGF-system in paired normoxic and hypoxic biopsies isolated from human hearts during coronary artery bypass operation. Compared to normoxic biopsies, hypoxic samples showed down-regulation of HER2 (P = 0.0005) and NRG1 (both......2 down-regulation seen in the human heart in cultured cardiomyocytes inhibited their proliferation under hypoxic conditions. Interestingly, HB-EGF is induced in the hypoxic human hearts, and rescues hypoxic cardiomyocytes from the effect of HER2 inhibition in the in vitro model. The results have...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

  16. Notch Cooperates with Survivin to Maintain Stemness and to Stimulate Proliferation in Human Keratinocytes during Ageing

    Directory of Open Access Journals (Sweden)

    Elisabetta Palazzo

    2015-11-01

    Full Text Available The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though to a different degree of intensity, with a dramatic decrease during ageing. Notch1 intracellular domain (N1ICD levels are decreased during transit from keratinocyte stem cells (KSC to transit amplifying (TA cells, mimicking survivin expression in samples from donors of all ages. Calcium markedly reduces N1ICD levels in keratinocytes. N1ICD overexpression induces the up-regulation of survivin and the down-regulation of keratin 10 and involucrin, while increasing the S phase of the cell cycle. On the other hand, Notch1 inhibition (DAPT dose-dependently decreases survivin, stimulates differentiation, and reduces keratinocyte proliferation in samples from donors of all ages. Silencing Notch downgrades survivin and increases keratin 10. In addition, Notch1 inhibition decreases survivin levels and proliferation both in KSC and TA cells. Finally, while survivin overexpression decreases keratinocyte differentiation and increases N1ICD expression both in KSC and TA cells, silencing survivin results in N1ICD down-regulation and an increase in differentiation markers. These results suggest that the Notch1/survivin crosstalk contributes to the maintenance of stemness in human keratinocytes.

  17. Locomotion of human skin keratinocytes on polystyrene, fibrin, and collagen substrata and its modification by cell-to-cell contacts.

    Science.gov (United States)

    Drukała, J; Bandura, L; Cieślik, K; Korohoda, W

    2001-01-01

    Epithelial wound repair assures the recovery of the epithelial barrier after wounding. During wound healing epithelial cells migrate to cover the wound surface. The presented experiments were carried out to compare the migration of human keratinocytes from primary and secondary culture on polystyrene, collagen, and fibrin glue used in clinical techniques. The images of migrating keratinocytes were recorded and analyzed using computer-aided methods. The results show that the character of the substrate strongly affects the speed and turning behavior of keratinocytes locomoting over it. The highest motile activity of human skin keratinocytes was found on fibrin glue substratum. It was found that locomotion of freely moving isolated cells was much faster than that of cell sheets. The autologous keratinocytes cultured in vitro were applied with fibrin glue to cover trophic wounds. The transplantation of human autologous keratinocyte suspension in fibrin glue upon long-lasting trophic wounds appeared to induce rapid and permanent wound healing.

  18. Characterization of pigmented dermo-epidermal skin substitutes in a long-term in vivo assay.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Klar, Agnieszka S; Widmer, Daniel S; Neuhaus, Kathrin; Schiestl, Clemens; Meuli, Martin; Reichmann, Ernst

    2015-01-01

    In our laboratory, we have been using human pigmented dermo-epidermal skin substitutes for short-term experiments since several years. Little is known, however, about the long-term biology of such constructs after transplantation. We constructed human, melanocyte-containing dermo-epidermal skin substitutes of different (light and dark) pigmentation types and studied them in a long-term animal experiment. Developmental and maturational stages of the epidermal and dermal compartment as well as signs of homoeostasis were analysed 15 weeks after transplantation. Keratinocytes, melanocytes and fibroblasts from human skin biopsies were isolated and assembled into dermo-epidermal skin substitutes. These were transplanted onto immuno-incompetent rats and investigated 15 weeks after transplantation. Chromameter evaluation showed a consistent skin colour between 3 and 4 months after transplantation. Melanocytes resided in the epidermal basal layer in physiological numbers and melanin accumulated in keratinocytes in a supranuclear position. Skin substitutes showed a mature epidermis in a homoeostatic state and the presence of dermal components such as Fibrillin and Tropoelastin suggested advanced maturation. Overall, pigmented dermo-epidermal skin substitutes show a promising development towards achieving near-normal skin characteristics and epidermal and dermal tissue homoeostasis. In particular, melanocytes function correctly over several months whilst remaining in a physiological, epidermal position and yield a pigmentation resembling original donor skin colour. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular......Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  20. Cobertura de grandes quemados con cultivo de queratinocitos: casuística de nuestra Unidad y protocolo de tratamiento Massive burn coverage with keratinocytes cultured: our casuistry and treatment protocol

    Directory of Open Access Journals (Sweden)

    I. González Alaña

    2012-09-01

    Full Text Available El paciente gran quemado sigue siendo hoy en día un difícil reto al que se enfrentan múltiples profesionales sanitarios. La elevada mortalidad de estos pacientes se justifica por la severa alteración del estado general que sufren, las múltiples complicaciones que se asocian y por la ausencia de piel válida para cubrir las quemaduras, como sucede en el caso de los quemados de gran extensión. Este último inconveniente se solventa de diferentes maneras, siendo una de las más importantes el cultivo de queratinocitos. En la Unidad de Quemados del Hospital Universitario de Cruces en Baracaldo (Vizcaya, España, iniciamos la aplicación de esta técnica en 2001, con una experiencia acumulada en esta década de 14 pacientes. El objetivo de este artículo es mostrar nuestro protocolo de aplicación del procedimiento para la cobertura de quemados extensos, los criterios de inclusión y la terapéutica pre y postaplicación de las láminas de queratinocitos que empleamos en nuestra Unidad. Así mismo, presentamos las características de los pacientes tratados y nuestra propia experiencia en la aplicación de esta técnica que, a pesar de lograr resultados cada vez más satisfactorios y ser en ocasiones la única alternativa para un paciente extensamente quemado, tiene todavía hoy en día tantos detractores.The severe burn patient continues being nowadays a difficult challenge which multiple sanitary professionals face. The high mortality of these patients justifies itself by the severe alteration of the general condition, the multiple complications that they suffer and the absence of skin for their coverage, as is the case of extensive burns. This last disadvantage is settled in different ways, being one of the most important the treatment with keratinocytes culture. In the Cruces Universitary Hospital Burn Unit in Baracaldo (Vizcaya, Spain, we began the clinical application of this technique in 2001, with a 14 patients accumulated experience in

  1. Reorganization of the interchromosomal network during keratinocyte differentiation.

    Science.gov (United States)

    Sehgal, Nitasha; Seifert, Brandon; Ding, Hu; Chen, Zihe; Stojkovic, Branislav; Bhattacharya, Sambit; Xu, Jinhui; Berezney, Ronald

    2016-06-01

    The well-established human epidermal keratinocyte (HEK) differentiation model was investigated to determine possible alterations in chromosome territory (CT) association during differentiation. The seven human chromosomes (1, 4, 11, 12, 16, 17, and 18) selected for this analysis are representative of the chromosome size and gene density range of the overall human genome as well as including a majority of genes involved in epidermal development and differentiation (CT1, 12, and 17). Induction with calcium chloride (Ca(2+)) resulted in morphological changes characteristic of keratinocyte differentiation. Combined multi-fluorescence in situ hybridization (FISH) and computational image analysis on the undifferentiated (0 h) and differentiated (24 h after Ca(2+) treatment) HEK revealed that (a) increases in CT volumes correspond to overall nuclear volume increases, (b) radial positioning is gene density-dependent at 0 h but neither gene density- nor size-dependent at 24 h, (c) the average number of interchromosomal associations for each CT is gene density-dependent and similar at both time points, and (d) there are striking differences in the single and multiple pairwise interchromosomal association profiles. Probabilistic network models of the overall interchromosomal associations demonstrate major reorganization of the network during differentiation. Only ~40 % of the CT pairwise connections in the networks are common to both 0 and 24 h HEK. We propose that there is a probabilistic chromosome positional code which can be significantly altered during cell differentiation in coordination with reprogramming of gene expression.

  2. Radioprotective effects of dimethyl sulfoxide in the artificial skin reconstructed with cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Young Ha; Choi, Karp Shik [College of Dentistry, Kyungpook National University, Daegu (Korea, Republic of); Song, In Hwan [Department of Anatomy, College of Medicine, Yeungnam University, Daegu (Korea, Republic of)

    2002-03-15

    To evaluate cultured human artificial skin as an experimental model for studying radiation effects in vitro. The skin was constructed by culturing keratinocytes over collagen lattice which made by culturing fibroblasts. Two groups were irradiated to gamma rays at single dose of 25 Gy with or without 3.5% of DMSO. Ultrastructures were investigated by electron microscopy after irradiation. The number of epidermal layers and expression of cytokeratin (CK) 14 and 10 were also seem by light microscopy. At 2 days after irradiation in experimental group without DMSO, necrotic cells were rarely found in the spinosal layer and undercornified cells were visible in the horney layer. Similar findings were also found in experimental group with DMSO but in mild form. The number of epidermal layers in experimental group without DMSO were significantly fewer than other group. CK 14 expressed in all the layer excluding horney layer but CK 10 expressed over 3-4 basal layers. Such patterns of CK expression were similar to all groups. It is suggested that structures of the keratinocytes and epidermal formation could be disturbed by irradiation in artificial skin and that DMSO can protect these damages. Therefore this work could be used as an organotypic experimental model in vitro using human cells for studying radiation effect in skin. Furthermore structural findings provided in this study could be used as useful basic data in further study using this model.

  3. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  4. Impaired epidermal wound healing in vivo upon inhibition or deletion of Rac1

    DEFF Research Database (Denmark)

    Tscharntke, Michael; Pofahl, Ruth; Chrostek-Grashoff, Anna

    2007-01-01

    To address the functions of Rac1 in keratinocytes of the basal epidermal layer and in the outer root sheath of hair follicles, we generated transgenic mice expressing a dominant inhibitory mutant of Rac, N17Rac1, under the control of the keratin 14 promoter. These mice do not exhibit an overt ski...

  5. AKT1-mediated Lamin A/C degradation is required for nuclear degradation and normal epidermal terminal differentiation

    OpenAIRE

    Naeem, A S; Zhu, Y.; Di, W L; Marmiroli, S.; O Shaughnessy, R. F. L.

    2015-01-01

    Nuclear degradation is a key stage in keratinocyte terminal differentiation and the formation of the cornified envelope that comprises the majority of epidermal barrier function. Parakeratosis, the retention of nuclear material in the cornified layer of the epidermis, is a common histological observation in many skin diseases, notably in atopic dermatitis and psoriasis. Keratinocyte nuclear degradation is not well characterised, and it is unclear whether the retained nuclei contribute to the ...

  6. Enrichment of oral mucosa and skin keratinocyte progenitor/stem cells.

    Science.gov (United States)

    Izumi, Kenji; Marcelo, Cynthia L; Feinberg, Stephen E

    2013-01-01

    The isolation of human oral mucosa/skin keratinocytes progenitor/stem cells is clinically important to regenerate epithelial tissues for the treatment of oral mucosa/skin defects. Researchers have attempted to isolate a keratinocyte progenitor/stem cell population using cell markers, rapid adherence to collagen type IV, and other methods. In this regard, one of the specific characteristics of keratinocyte progenitor/stem cells is that these cells have a smaller diameter than differentiated cells. This chapter describes methods used in our laboratory to set up primary human oral mucosa and skin keratinocytes in a chemically defined culture system devoid of animal derived products. We utilized the cells in a FDA-approved human clinical trial that involved the intraoral grafting of an ex vivo produced oral mucosa equivalent to increase keratinized tissue around teeth. We also provide two protocols on how to sort keratinocytes using physical criterion, cell size, using a cell sorter and a serial filtration system.

  7. Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuaki Kobayashi

    Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

  8. Expression of IL-10, TGF-beta(1) and TNF-alpha in Cultured Keratinocytes (HaCaT Cells) after IPL Treatment or ALA-IPL Photodynamic Treatment.

    Science.gov (United States)

    Byun, Ji Yeon; Choi, Hae Young; Myung, Ki Bum; Choi, You Won

    2009-02-01

    Depending on the light dose and concentration of photosensitizer for photodynamic treatment (PDT), a multitude of dose-related events are demonstrable in PDT-treated cells. Sublethal doses may result in the alteration of cytokine release and consequently modify immune actions, rather than cause cell death. The purpose of this study was to investigate cytokine expression in cultured HaCaT cells after intense pulse light (IPL) treatment or PDT utilizing 5-aminolevulinic acid (ALA) and IPL at sublethal doses. Cultured HaCaT cells were treated with either IPL only (4, 8 and 12 J/cm(2)) or ALA-IPL PDT (100micromol/L of ALA; 0, 4, 8, and 12 J/cm(2) of IPL). The expression of IL-10, TGF-beta(1) and TNF-alpha was investigated by reverse transcription-polymerase chain reaction and enzyme linked immunosorbent assay. IL-10 protein increased up to 5.95-fold after IPL treatment and up to 2.85-fold after PDT. TGF-beta(1) mRNA and protein showed slight increases after both IPL treatment and PDT, of which the latter induced slightly larger increases. TNF-alpha mRNA and protein showed no induction or reduction after PDT. Increased expressions of IL-10 and TGF-beta(1) was observed after PDT. The induction of IL-10 may contribute to the anti-inflammatory effect, which explains the therapeutic benefit of PDT for inflammatory dermatoses, and that of TGF-beta(1) may be related to the therapeutic effect for psoriasis. The finding that IL-10 induction was more marked after IPL treatment than after PDT suggests that other mechanisms than IL-10 induction in keratinocytes after PDT may participate in the anti-inflammatory effect of PDT.

  9. Testosterone Stimulates Duox1 Activity through GPRC6A in Skin Keratinocytes*

    Science.gov (United States)

    Ko, Eunbi; Choi, Hyun; Kim, Borim; Kim, Minsun; Park, Kkot-Nara; Bae, Il-Hong; Sung, Young Kwan; Lee, Tae Ryong; Shin, Dong Wook; Bae, Yun Soo

    2014-01-01

    Testosterone is an endocrine hormone with functions in reproductive organs, anabolic events, and skin homeostasis. We report here that GPRC6A serves as a sensor and mediator of the rapid action of testosterone in epidermal keratinocytes. The silencing of GPRC6A inhibited testosterone-induced intracellular calcium ([Ca2+]i) mobilization and H2O2 generation. These results indicated that a testosterone-GPRC6A complex is required for activation of Gq protein, IP3 generation, and [Ca2+]i mobilization, leading to Duox1 activation. H2O2 generation by testosterone stimulated the apoptosis of keratinocytes through the activation of caspase-3. The application of testosterone into three-dimensional skin equivalents increased the apoptosis of keratinocytes between the granular and stratified corneum layers. These results support an understanding of the molecular mechanism of testosterone-dependent apoptosis in which testosterone stimulates H2O2 generation through the activation of Duox1. PMID:25164816

  10. RNA-seq analysis of host and viral gene expression highlights interaction between varicella zoster virus and keratinocyte differentiation.

    Directory of Open Access Journals (Sweden)

    Meleri Jones

    2014-01-01

    Full Text Available Varicella zoster virus (VZV is the etiological agent of chickenpox and shingles, diseases characterized by epidermal skin blistering. Using a calcium-induced keratinocyte differentiation model we investigated the interaction between epidermal differentiation and VZV infection. RNA-seq analysis showed that VZV infection has a profound effect on differentiating keratinocytes, altering the normal process of epidermal gene expression to generate a signature that resembles patterns of gene expression seen in both heritable and acquired skin-blistering disorders. Further investigation by real-time PCR, protein analysis and electron microscopy revealed that VZV specifically reduced expression of specific suprabasal cytokeratins and desmosomal proteins, leading to disruption of epidermal structure and function. These changes were accompanied by an upregulation of kallikreins and serine proteases. Taken together VZV infection promotes blistering and desquamation of the epidermis, both of which are necessary to the viral spread and pathogenesis. At the same time, analysis of the viral transcriptome provided evidence that VZV gene expression was significantly increased following calcium treatment of keratinocytes. Using reporter viruses and immunohistochemistry we confirmed that VZV gene and protein expression in skin is linked with cellular differentiation. These studies highlight the intimate host-pathogen interaction following VZV infection of skin and provide insight into the mechanisms by which VZV remodels the epidermal environment to promote its own replication and spread.

  11. p63/p51-induced Onset of Keratinocyte Differentiation via the c-Jun N-terminal Kinase Pathway Is Counteracted by Keratinocyte Growth Factor*

    OpenAIRE

    Ogawa, Eisaku; Okuyama, Ryuhei; Egawa, Teie; Nagoshi, Hirokazu; Obinata, Masuo; Tagami, Hachiro; Ikawa, Shuntaro; Aiba, Setsuya

    2008-01-01

    p63/p51, a homolog of the tumor suppressor protein p53, is chiefly expressed in epithelial tissues, including the epidermis. p63 affects cell death similar to p53, and also plays important roles in the development of epithelial tissues and the maintenance of epithelial stem cells. Because it remains unclear how p63 regulates epithelial cell differentiation, we examined the function(s) of p63 in keratinocyte differentiation through the use of a keratinocyte culture syst...

  12. Review of Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Victoria Harris

    2016-12-01

    Full Text Available Toxic epidermal necrolysis (TEN is a rare but life threatening mucocutaneous reaction to drugs or their metabolites. It is characterised by widespread keratinocyte apoptosis and sloughing of the skin, erosions of the mucous membranes, painful blistering, and severe systemic disturbance. The pathophysiology of TEN is incompletely understood. Historically, it has been regarded as a drug-induced immune reaction initiated by cytotoxic lymphocytes via a human leukocyte antigen (HLA-restricted pathway. Several mediators have been identified as contributors to the cell death seen in TEN, including; granulysin, soluble Fas ligand, perforin/granzyme, tumour necrosis factor-α (TNF-α, and TNF-related apoptosis-inducing ligand. Currently, granulysin is accepted as the most important mediator of T cell proliferation. There is uncertainty around the accepted management of TEN. The lack of definitive management guidelines for TEN is explained in part by the rarity of the disease and its high mortality rate, which makes it difficult to conduct randomised control trials on emerging therapies. Developments have been made in pharmacogenomics, with numerous HLA alleles identified; however, these have largely been ethnically specific. These associations have translated into screening recommendations for Han Chinese.

  13. Grainyhead-like 2 (GRHL2) inhibits keratinocyte differentiation through epigenetic mechanism.

    Science.gov (United States)

    Chen, W; Xiao Liu, Z; Oh, J-E; Shin, K-H; Kim, R H; Jiang, M; Park, N-H; Kang, M K

    2012-12-20

    We recently identified Grainyhead-like 2 (GRHL2), a mammalian homolog of Grainyhead in Drosophila, to be a novel transcription factor that regulates hTERT gene expression and enhances proliferation of normal human epidermal keratinocytes (NHEK). In the current study, we show that GRHL2 impairs keratinocyte differentiation through transcriptional inhibition of the genes clustered at the epidermal differentiation complex (EDC), located at chromosome 1q21. Gene expression profiling and subsequent in vitro assays revealed consistent downregulation of EDC genes, for example, IVL, KRT1, FLG, LCEs, and SPRRs, in NHEK expressing exogenous GRHL2. In vivo binding assay by chromatin immunoprecipitation revealed GRHL2 association at the promoter regions of its target genes, many of which belong to EDC. Exogenous GRHL2 expression also inhibited recruitment of histone demethylase Jmjd3 to the EDC gene promoters and enhanced the level of histone 3 Lys 27 trimethylation enrichment at these promoters. Survey of GRHL2 expression in human skin tissues demonstrated enhanced protein and mRNA levels in chronic skin lesions with impaired keratinocyte differentiation, for example, atopic dermatitis and psoriasis, compared with normal epidermis. These data indicate that GRHL2 impairs epidermal differentiation by inhibiting EDC gene expression through epigenetic mechanisms and support its role in the hyperproliferative skin diseases.

  14. Towards a quantitative theory of epidermal calcium profile formation in unwounded skin.

    Directory of Open Access Journals (Sweden)

    Matthew P Adams

    Full Text Available We propose and mathematically examine a theory of calcium profile formation in unwounded mammalian epidermis based on: changes in keratinocyte proliferation, fluid and calcium exchange with the extracellular fluid during these cells' passage through the epidermal sublayers, and the barrier functions of both the stratum corneum and tight junctions localised in the stratum granulosum. Using this theory, we develop a mathematical model that predicts epidermal sublayer transit times, partitioning of the epidermal calcium gradient between intracellular and extracellular domains, and the permeability of the tight junction barrier to calcium ions. Comparison of our model's predictions of epidermal transit times with experimental data indicates that keratinocytes lose at least 87% of their volume during their disintegration to become corneocytes. Intracellular calcium is suggested as the main contributor to the epidermal calcium gradient, with its distribution actively regulated by a phenotypic switch in calcium exchange between keratinocytes and extracellular fluid present at the boundary between the stratum spinosum and the stratum granulosum. Formation of the extracellular calcium distribution, which rises in concentration through the stratum granulosum towards the skin surface, is attributed to a tight junction barrier in this sublayer possessing permeability to calcium ions that is less than 15 nm s-1 in human epidermis and less than 37 nm s-1 in murine epidermis. Future experimental work may refine the presented theory and reduce the mathematical uncertainty present in the model predictions.

  15. Towards a quantitative theory of epidermal calcium profile formation in unwounded skin.

    Science.gov (United States)

    Adams, Matthew P; Mallet, Daniel G; Pettet, Graeme J

    2015-01-01

    We propose and mathematically examine a theory of calcium profile formation in unwounded mammalian epidermis based on: changes in keratinocyte proliferation, fluid and calcium exchange with the extracellular fluid during these cells' passage through the epidermal sublayers, and the barrier functions of both the stratum corneum and tight junctions localised in the stratum granulosum. Using this theory, we develop a mathematical model that predicts epidermal sublayer transit times, partitioning of the epidermal calcium gradient between intracellular and extracellular domains, and the permeability of the tight junction barrier to calcium ions. Comparison of our model's predictions of epidermal transit times with experimental data indicates that keratinocytes lose at least 87% of their volume during their disintegration to become corneocytes. Intracellular calcium is suggested as the main contributor to the epidermal calcium gradient, with its distribution actively regulated by a phenotypic switch in calcium exchange between keratinocytes and extracellular fluid present at the boundary between the stratum spinosum and the stratum granulosum. Formation of the extracellular calcium distribution, which rises in concentration through the stratum granulosum towards the skin surface, is attributed to a tight junction barrier in this sublayer possessing permeability to calcium ions that is less than 15 nm s-1 in human epidermis and less than 37 nm s-1 in murine epidermis. Future experimental work may refine the presented theory and reduce the mathematical uncertainty present in the model predictions.

  16. Cultures of skin fragments of Salamandra salamandra salamandra (L.) larvae.

    Science.gov (United States)

    Pederzoli, A; Restani, C

    1998-04-01

    As part of a study on the pigmentary system of Salamandra salamandra salamandra (L.), we cultured skin fragments of 7-10-day-old larvae in order to examine the expression of molecules implicated in cellular adhesion and migration and in regulating cell-cell relationships. Keratinocytes, fibroblasts, Leydig cells, xanthophores, and melanophores migrated from the fragments and were observed in the outgrowth. Keratinocytes and fibroblasts organized into an epidermal layer and an underlying "dermal portion." The chromatophores were always located below the epithelial cells, often with fibroblasts. We examined by immunocytochemistry the expression of fibronectin, beta1-integrin, L-CAM, and A-CAM in the cultures. Many keratinocytes, fibroblasts, and Leydig cells expressed all the signal molecules tested. Xanthophores and melanophores were only immunoreactive to the anti-adhesion molecules antisera. Since the molecules tested are known to play a role in cell adhesion, growth, and spreading, as well as in regulating tissue differentiation and in maintaining normal tissue morphology, we may hypothesize that in Salamandra salamandra salamandra fibronectin, beta1-integrin, L-, and A-CAMs concertedly act to stabilize the architecture of the outgrowth and regulate the relationships between chromatophores and those between chromatophores and the other elements of the skin culture.

  17. Phenylpropanoid glycosides from plant cell cultures induce heme oxygenase 1 gene expression in a human keratinocyte cell line by affecting the balance of NRF2 and BACH1 transcription factors.

    Science.gov (United States)

    Sgarbossa, Anna; Dal Bosco, Martina; Pressi, Giovanna; Cuzzocrea, Salvatore; Dal Toso, Roberto; Menegazzi, Marta

    2012-08-30

    Phenylpropanoids have several highly significant biological properties in both plants and animals. Four phenylpropanoid glycosides (PPGs), verbascoside (VB), forsythoside B (FB), echinacoside (EC) and campneoside I (CP), were purified and tested for their capability to activate NRF2 and induce phase II cytoprotective enzymes in a human keratinocyte cell line (HaCaT). All four substances showed similar strong antioxidant and radical-scavenging activities as determined by diphenylpicrylhydrazyl assay. Furthermore, in HaCaT cells, FB and EC are strong activators of NRF2, the nuclear transcription factor regulating many phase II detoxifying and cytoprotective enzymes, such as heme oxygenase 1 (HMOX1). In HaCaT cells, FB and EC (200 μM) induced nuclear translocation of NRF2 protein after 24 h and reduced nuclear protein levels of BACH1, a repressor of the antioxidant response element. FB and EC greatly HMOX1 mRNA levels by more than 40-fold in 72 h. Cytoplasmic HMOX1 protein levels were also increased at 48 h after treatment. VB was less active compared to FB and EC, and CP was slightly active only at later times of treatment. We suggest that hydroxytyrosol (HYD) could be a potential bioactive metabolite of PPGs since HYD, in equimolar amounts to PGGs, is able to both activate HO-1 transcription and modify Nrf2/Bach1 nuclear protein levels. This is in agreement with the poor activity of CP, which contains a HYD moiety modified by an O-methyl group. In conclusion, FB and EC from plant cell cultures may provide long-lasting skin protection by induction of phase II cytoprotective capabilities. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  19. Scanning Ion Conductance Microscopy of Live Keratinocytes

    Science.gov (United States)

    Hegde, V.; Mason, A.; Saliev, T.; Smith, F. J. D.; McLean, W. H. I.; Campbell, P. A.

    2012-07-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (monitoring the most delicate living structures with attendant high spatial resolutions.

  20. Keratins as the main component for the mechanical integrity of keratinocytes.

    Science.gov (United States)

    Ramms, Lena; Fabris, Gloria; Windoffer, Reinhard; Schwarz, Nicole; Springer, Ronald; Zhou, Chen; Lazar, Jaroslav; Stiefel, Simone; Hersch, Nils; Schnakenberg, Uwe; Magin, Thomas M; Leube, Rudolf E; Merkel, Rudolf; Hoffmann, Bernd

    2013-11-12

    Keratins are major components of the epithelial cytoskeleton and are believed to play a vital role for mechanical integrity at the cellular and tissue level. Keratinocytes as the main cell type of the epidermis express a differentiation-specific set of type I and type II keratins forming a stable network and are major contributors of keratinocyte mechanical properties. However, owing to compensatory keratin expression, the overall contribution of keratins to cell mechanics was difficult to examine in vivo on deletion of single keratin genes. To overcome this problem, we used keratinocytes lacking all keratins. The mechanical properties of these cells were analyzed by atomic force microscopy (AFM) and magnetic tweezers experiments. We found a strong and highly significant softening of keratin-deficient keratinocytes when analyzed by AFM on the cell body and above the nucleus. Magnetic tweezers experiments fully confirmed these results showing, in addition, high viscous contributions to magnetic bead displacement in keratin-lacking cells. Keratin loss neither affected actin or microtubule networks nor their overall protein concentration. Furthermore, depolymerization of actin preserves cell softening in the absence of keratin. On reexpression of the sole basal epidermal keratin pair K5/14, the keratin filament network was reestablished, and mechanical properties were restored almost to WT levels in both experimental setups. The data presented here demonstrate the importance of keratin filaments for mechanical resilience of keratinocytes and indicate that expression of a single keratin pair is sufficient for almost complete reconstitution of their mechanical properties.

  1. Effective inhibition of melanosome transfer to keratinocytes by lectins and niacinamide is reversible.

    Science.gov (United States)

    Greatens, Amanda; Hakozaki, Tomohiro; Koshoffer, Amy; Epstein, Howard; Schwemberger, Sandy; Babcock, George; Bissett, Donald; Takiwaki, Hirotsugu; Arase, Seiji; Wickett, R Randall; Boissy, Raymond E

    2005-07-01

    Skin pigmentation results in part from the transfer of melanized melanosomes synthesized by melanocytes to neighboring keratinocytes. Plasma membrane lectins and their glycoconjugates expressed by these epidermal cells are critical molecules involved in this transfer process. In addition, the derivative of vitamin B(3), niacinamide, can inhibit melanosome transfer and induce skin lightening. We investigated the effects of these molecules on the viability of melanocytes and keratinocytes and on the reversibility of melanosome-transfer inhibition induced by these agents using an in vitro melanocyte-keratinocyte coculture model system. While lectins and neoglycoproteins could induce apoptosis in a dose-dependent manner to melanocytes or keratinocytes in monoculture, similar dosages of the lectins, as opposed to neoglycoproteins, did not induce apoptosis to either cell type when treated in coculture. The dosages of lectins and niacinamide not affecting cell viability produced an inhibitory effect on melanosome transfer, when used either alone or together in cocultures of melanocytes-keratinocytes. Cocultures treated with lectins or niacinamide resumed normal melanosome transfer in 3 days after removal of the inhibitor, while cocultures treated with a combination of lectins and niacinamide demonstrated a lag in this recovery. Subsequently, we assessed the effect of niacinamide on facial hyperpigmented spots using a vehicle-controlled, split-faced design human clinical trial. Topical application of niacinamide resulted in a dose-dependent and reversible reduction in hyperpigmented lesions. These results suggest that lectins and niacinamide at concentrations that do not affect cell viability are reversible inhibitors of melanosome transfer.

  2. Grading keratinocyte atypia in actinic keratosis: a correlation of reflectance confocal microscopy and histopathology.

    Science.gov (United States)

    Pellacani, G; Ulrich, M; Casari, A; Prow, T W; Cannillo, F; Benati, E; Losi, A; Cesinaro, A M; Longo, C; Argenziano, G; Soyer, H P

    2015-11-01

    Actinic Keratosis (AK) is the clinical manifestation of cutaneous dysplasia of epidermal keratinocytes, with progressive trend towards squamous cell carcinoma. To evaluate the strength of the correlation between keratinocyte atypia, as detected by Reflectance Confocal Microscopy (RCM) and histopathology, and to develop a more objective atypia grading scale for RCM quantification, through a discrete ranking. A total of 48 AKs and two control areas (photodamaged and non-photodamaged skin) were selected for this study. All these areas were documented by RCM and biopsied for histopathology. One representative image of the epidermis was selected for RCM and for histopathology and used for side-by-side comparison with purpose written software. The assessor chose which of two images displayed more keratinocyte atypia, and an ordered list from the image showing the least to the most keratinocyte atypia was generated. Three evaluations were obtained for RCM and two for histopathology. Good interobserver correlation was obtained for RCM and histopathology grading, with high concordance between RCM and histopathology grading. Expert rater scan consistently distinguish different grades of cytological atypia. Non-invasive RCM data from in vivo imaging can be graded for keratinocyte atypia, comparable to histopathological grading. © 2015 European Academy of Dermatology and Venereology.

  3. A Glutathione-Nrf2-Thioredoxin Cross-Talk Ensures Keratinocyte Survival and Efficient Wound Repair.

    Directory of Open Access Journals (Sweden)

    Michèle Telorack

    2016-01-01

    Full Text Available The tripeptide glutathione is the most abundant cellular antioxidant with high medical relevance, and it is also required as a co-factor for various enzymes involved in the detoxification of reactive oxygen species and toxic compounds. However, its cell-type specific functions and its interaction with other cytoprotective molecules are largely unknown. Using a combination of mouse genetics, functional cell biology and pharmacology, we unraveled the function of glutathione in keratinocytes and its cross-talk with other antioxidant defense systems. Mice with keratinocyte-specific deficiency in glutamate cysteine ligase, which catalyzes the rate-limiting step in glutathione biosynthesis, showed a strong reduction in keratinocyte viability in vitro and in the skin in vivo. The cells died predominantly by apoptosis, but also showed features of ferroptosis and necroptosis. The increased cell death was associated with increased levels of reactive oxygen and nitrogen species, which caused DNA and mitochondrial damage. However, epidermal architecture, and even healing of excisional skin wounds were only mildly affected in the mutant mice. The cytoprotective transcription factor Nrf2 was strongly activated in glutathione-deficient keratinocytes, but additional loss of Nrf2 did not aggravate the phenotype, demonstrating that the cytoprotective effect of Nrf2 is glutathione dependent. However, we show that deficiency in glutathione biosynthesis is efficiently compensated in keratinocytes by the cysteine/cystine and thioredoxin systems. Therefore, our study highlights a remarkable antioxidant capacity of the epidermis that ensures skin integrity and efficient wound healing.

  4. Astilbin decreases proliferation and improves differentiation in HaCaT keratinocytes.

    Science.gov (United States)

    Zhang, Chunhong; Xu, Qingqing; Tan, Xi; Meng, Liya; Wei, Guo; Liu, Ying; Zhang, Chunmin

    2017-09-01

    Psoriasis is a common chronic dermatosis characterized by keratinocyte hyperproliferation accompanied by inflammatory reactions. Pathological changes upset the balance between keratinocyte proliferation, differentiation, and death in psoriatic lesions, suggesting that molecules with topical anti-inflammatory, anti-proliferation and anti-angiogenesis abilities may be useful for its treatment. The flavonoid astilbin is the major active component extracted from the rhizome of Smilax glabra, which has been widely used in China to treat inflammatory and autoimmune diseases. Here, we investigate the potential of astilbin as a treatment for psoriasis. We reveal that astilbin inhibits the growth of HaCaT keratinocytes. Detailed study shows that astilbin leads to S phase arrest of the cell cycle by induction of p53 and p21 and activated-AMPK. Additionally, astilbin induced keratinocyte differentiation correlated with suppression of keratin 5 (KRT5) and KRT14 proteins (the markers of epidermal basal layer) and induction KRT1 and KRT10 proteins (occurring in the upper layers). Moreover, astilbin regulates the expression of VEGF in human HaCaT keratinocytes. These results suggest that astilbin may be a promising agent for psoriasis treatment. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts

    Directory of Open Access Journals (Sweden)

    Maria del R. Ramos-Jerz

    2013-01-01

    Full Text Available Methanolic avocado (Persea americana Mill., Lauraceae seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK and normal human dermal fibroblasts (NHDF. The methanol-water partition (M from avocado seeds and HSCCC fraction 3 (M.3 were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  6. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts.

    Science.gov (United States)

    Ramos-Jerz, Maria Del R; Villanueva, Socorro; Jerz, Gerold; Winterhalter, Peter; Deters, Alexandra M

    2013-01-01

    Methanolic avocado (Persea americana Mill., Lauraceae) seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF). The methanol-water partition (M) from avocado seeds and HSCCC fraction 3 (M.3) were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  7. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  8. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  9. Activin controls skin morphogenesis and wound repair predominantly via stromal cells and in a concentration-dependent manner via keratinocytes.

    Science.gov (United States)

    Bamberger, Casimir; Schärer, Agnes; Antsiferova, Maria; Tychsen, Birte; Pankow, Sandra; Müller, Mischa; Rülicke, Thomas; Paus, Ralf; Werner, Sabine

    2005-09-01

    The transforming growth factor-beta family member activin is a potent regulator of skin morphogenesis and repair. Transgenic mice overexpressing activin in keratinocytes display epidermal hyper-thickening and dermal fibrosis in normal skin and enhanced granulation tissue formation after wounding. Mice overexpressing the secreted activin antagonist follistatin, however, have the opposite wound-healing phenotype. To determine whether activin affects skin morphogenesis and repair via activation of keratinocytes and/or stromal cells, we generated transgenic mice expressing a dominant-negative activin receptor IB mutant (dnActRIB) in keratinocytes. The architecture of adult skin was unaltered in these mice, but delays were observed in postnatal pelage hair follicle morphogenesis and in the first catagen-telogen transformation of hair follicles. Although dnActRIB-transgenic mice showed slightly delayed wound re-epithelialization after skin injury, the strong inhibition of granulation tissue formation seen in follistatin-transgenic mice was not observed. Therefore, although endogenous activin appeared to affect skin morphogenesis and repair predominantly via stromal cells, overexpressed activin strongly affected the epidermis. The epidermal phenotype of activin-overexpressing mice was partially rescued by breeding these animals with dnActRIB-transgenic mice. These results demonstrate that activin affects both stromal cells and keratinocytes in normal and wounded skin and that the effect on keratinocytes is dose-dependent in vivo.

  10. Epidermal hairs of Acanthaceae

    NARCIS (Netherlands)

    Ahmad, Khwaja J.

    1978-01-01

    Structure and distribution of the foliar epidermal hairs of 109 species and two varieties belonging to 39 genera of the family Acanthaceae have been studied. Both glandular and non-glandular epidermal hairs have been recorded in the investigated taxa. The glandular hairs may be subsessile or

  11. Mechanotransduction in epidermal Merkel cells.

    Science.gov (United States)

    Nakatani, Masashi; Maksimovic, Srdjan; Baba, Yoshichika; Lumpkin, Ellen A

    2015-01-01

    The cellular and molecular basis of vertebrate touch reception remains least understood among the traditional five senses. Somatosensory afferents that innervate the skin encode distinct tactile qualities, such as flutter, slip, and pressure. Gentle touch is thought to be transduced by somatosensory afferents whose tactile end organs selectively filter mechanical stimuli. These tactile end organs comprise afferent terminals in association with non-neuronal cell types such as Merkel cells, keratinocytes, and Schwann cells. An open question is whether these non-neuronal cells serve primarily as passive mechanical filters or whether they actively participate in mechanosensory transduction. This question has been most extensively studied in Merkel cells, which are epidermal cells that complex with sensory afferents in regions of high tactile acuity such as fingertips, whisker follicles, and touch domes. Merkel cell-neurite complexes mediate slowly adapting type I (SAI) responses, which encode sustained pressure and represent object features with high fidelity. How Merkel cells contribute to unique SAI firing patterns has been debated for decades; however, three recent studies in rodent models provide some direct answers. First, whole-cell recordings demonstrate that Merkel cells are touch-sensitive cells with fast, mechanically activated currents that require Piezo2. Second, optogenetics and intact recordings show that Merkel cells mediate sustained SAI firing. Finally, loss-of-function studies in transgenic mouse models reveal that SAI afferents are also touch sensitive. Together, these studies identify molecular mechanisms of mechanotransduction in Merkel cells, reveal unexpected functions for these cells in touch, and support a revised, two-receptor site model of mechanosensory transduction.

  12. Potential applications of keratinocytes derived from human embryonic stem cells.

    Science.gov (United States)

    Movahednia, Mohammad M; Kidwai, Fahad K; Jokhun, Doorgesh S; Squier, Christopher A; Toh, Wei Seong; Cao, Tong

    2016-01-01

    Although skin grafting is one of the most advanced cell therapy technique, wide application of skin substitutes is hampered by the difficulty in securing sufficient amount of epidermal substitute. Additionally, in understanding the progression of skin aging and disease, and in screening the cosmetic and pharmaceutical products, there is lack of a satisfactory human skin-specific in vitro model. Recently, human embryonic stem cells (hESCs) have been proposed as an unlimited and reliable cell source to obtain almost all cell types present in the human body. This review focuses on the potential off-the-shelf use of hESC-derived keratinocytes for future clinical applications as well as a powerful in vitro skin model to study skin function and integrity, host-pathogen interactions and disease pathogenesis. Furthermore, we discuss the industrial applications of hESC-derived keratinized multi-layer epithelium which provides a human-like test platform for understanding disease pathogenesis, evaluation of new therapeutic modalities and assessment of the safety and efficacy of skin cosmetics and therapeutics. Overall, we conclude that the hESC-derived keratinocytes have great potential for clinical, research and industrial applications. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  14. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Manwaring, John, E-mail: manwaring.jd@pg.com [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Rothe, Helga [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany); Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A. [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Hewitt, Nicola J. [SWS, Erzhausen (Germany); Goebel, Carsten [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany)

    2015-09-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K{sub m} and V{sub max} values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C{sub max} was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human

  15. Myelinated and unmyelinated nerve fibers reinnervate tissue-engineered dermo-epidermal human skin analogs in an in vivo model.

    Science.gov (United States)

    Biedermann, T; Klar, A S; Böttcher-Haberzeth, S; Reichmann, E; Meuli, M

    2016-12-01

    The clinical application of autologous tissue-engineered skin analogs is an important strategy to cover large skin defects. Investigating biological dynamics, such as reinnervation after transplantation, is essential to improve the quality of such skin analogs. Previously, we have examined that our skin substitutes are reinnervated by host peripheral nerve fibers as early as 8 weeks after transplantation. Here, we wanted to investigate the presence and possible differences regarding myelinated and unmyelinated host nerve fibers 15 weeks after the transplantation of light and dark human tissue-engineered skin analogs. Human epidermal keratinocytes, melanocytes, and dermal fibroblasts were isolated from human light and dark skin biopsies. Keratinocytes and melanocytes were seeded on fibroblast-containing collagen type I hydrogels after expansion in culture. After additional culturing, the tissue-engineered dermo-epidermal skin analogs were transplanted onto full-thickness skin wounds created on the back of immuno-incompetent rats. Skin substitutes were excised and analyzed 15 weeks after transplantation. Histological sections were examined with regard to the ingrowth pattern of myelinated and unmyelinated nerve fibers into the skin analogs using markers, such as Substance P, NF200, and S100-Beta. We found myelinated and unmyelinated peripheral host nerve fibers 15 weeks after transplantation in the dermal part of our human skin substitutes. In particular, we identified large-diameter-myelinated Aβ- and Aδ-fibers, and small-diameter C-fibers. Furthermore, we observed myelinated nerves in close proximity to CD31-positive blood capillaries. In the long run, both types of ingrown host fibers showed an identical pattern in both light and dark skin analogs. Our data suggest that myelinated and unmyelinated peripheral nerves reinnervate human skin substitutes in a long-term in vivo transplantation assay. Our tissue-engineered skin analogs attract A- and C-fibers to

  16. Studies on the foliar epidermal tissues of three species of Digitaria ...

    African Journals Online (AJOL)

    Foliar epidermal studies were carried out on Digitaria iburua Stapf, Digitaria exilis Stapf and Digitaria barbinodis Henr. with the aim of determining the patterns of variation in their epidermal characteristics and assessing the value of leaf epidermal characters in the identification of these culturally important species.

  17. Active G protein-coupled receptors (GPCR), matrix metalloproteinases 2/9 (MMP2/9), heparin-binding epidermal growth factor (hbEGF), epidermal growth factor receptor (EGFR), erbB2, and insulin-like growth factor 1 receptor (IGF-1R) are necessary for trenbolone acetate-induced alterations in protein turnover rate of fused bovine satellite cell cultures.

    Science.gov (United States)

    Thornton, K J; Kamanga-Sollo, E; White, M E; Dayton, W R

    2016-06-01

    Trenbolone acetate (TBA), a testosterone analog, increases protein synthesis and decreases protein degradation in fused bovine satellite cell (BSC) cultures. However, the mechanism through which TBA alters these processes remains unknown. Recent studies indicate that androgens improve rate and extent of muscle growth through a nongenomic mechanism involving G protein-coupled receptors (GPCR), matrix metalloproteinases (MMP), heparin-binding epidermal growth factor (hbEGF), the epidermal growth factor receptor (EGFR), erbB2, and the insulin-like growth factor-1 receptor (IGF-1R). We hypothesized that TBA activates GPCR, resulting in activation of MMP2/9 that releases hbEGF, which activates the EGFR and/or erbB2. To determine whether the proposed nongenomic pathway is involved in TBA-mediated alterations in protein turnover, fused BSC cultures were treated with TBA in the presence or absence of inhibitors for GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R, and resultant protein synthesis and degradation rates were analyzed. Assays were replicated at least 9 times for each inhibitor experiment utilizing BSC cultures obtained from at least 3 different steers that had no previous exposure to steroid compounds. As expected, fused BSC cultures treated with 10 n TBA exhibited increased ( GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R suppressed ( GPCR, MMP2/9, hbEGF, EGFR, erbB2, or IGF-1R in the presence of 10 n TBA each had no ( > 0.05) effect on TBA-mediated decreases in protein degradation. However, inhibition of both EGFR and erbB2 in the presence of 10 n TBA resulted in decreased ( GPCR, MMP2/9, hbEGF, EGFR, erbB2, and IGF-1R. However, the mechanism through which TBA mediates changes in protein degradation is different and appears to involve only the EGFR and erbB2. Furthermore, it appears the protein kinase B pathway is involved in TBA's effects on fused BSC cultures.

  18. MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation

    Energy Technology Data Exchange (ETDEWEB)

    Lena, A.M.; Mancini, M.; Rivetti di Val Cervo, P. [University of ' Tor Vergata' , Department of Experimental Medicine and Biochemical Sciences, Via Montpellier 1, Rome 00133 (Italy); Istituto Dermopatico dell' Immacolata-Istituto di Ricovero e Cura a Carattere Scientifico (IDI-IRCCS), Laboratory of Biochemistry c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); Saintigny, G.; Mahe, C. [CHANEL Parfums Beaute, 135 av. Charles de Gaulle, F 92521, Neuilly/Seine (France); Melino, G., E-mail: gerry.melino@uniroma2.it [University of ' Tor Vergata' , Department of Experimental Medicine and Biochemical Sciences, Via Montpellier 1, Rome 00133 (Italy); Istituto Dermopatico dell' Immacolata-Istituto di Ricovero e Cura a Carattere Scientifico (IDI-IRCCS), Laboratory of Biochemistry c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); Association Cell Death and Differentiation c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); and others

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer miR-191 expression is upregulated in senescencent human epidermal keratinocytes. Black-Right-Pointing-Pointer miR-191 overexpression is sufficient per se to induce senescence in keratinocytes. Black-Right-Pointing-Pointer SATB1 and CDK6 are downregulated in senescence and are direct miR-191 targets. Black-Right-Pointing-Pointer SATB1 and CDK6 silencing by siRNA triggers senescence in HEKn cells. -- Abstract: Keratinocyte replicative senescence has an important role in time-dependent changes of the epidermis, a tissue with high turnover. Senescence encompasses growth arrest during which cells remain metabolically active but acquire a typical enlarged, vacuolar and flattened morphology. It is also accompanied by the expression of endogenous senescence-associated-{beta}-galactosidase and specific gene expression profiles. MicroRNAs levels have been shown to be modulated during keratinocytes senescence, playing key roles in inhibiting proliferation and in the acquisition of senescent markers. Here, we identify miR-191 as an anti-proliferative and replicative senescence-associated miRNA in primary human keratinocytes. Its overexpression is sufficient per se to induce senescence, as evaluated by induction of several senescence-associated markers. We show that SATB1 and CDK6 3 Prime UTRs are two miR-191 direct targets involved in this pathway. Cdk6 and Satb1 protein levels decrease during keratinocytes replicative senescence and their silencing by siRNA is able to induce a G1 block in cell cycle, accompanied by an increase in senescence-associated markers.

  19. Vitamin D derivatives enhance cytotoxic effects of H2O2 or cisplatin on human keratinocytes.

    Science.gov (United States)

    Piotrowska, Anna; Wierzbicka, Justyna; Ślebioda, Tomasz; Woźniak, Michał; Tuckey, Robert C; Slominski, Andrzej T; Żmijewski, Michał A

    2016-06-01

    Although the skin production of vitamin D is initiated by ultraviolet radiation type B (UVB), the role vitamin D plays in antioxidative or pro-oxidative responses remains to be elucidated. We have used immortalized human HaCaT keratinocytes as a model of proliferating epidermal cells to test the influence of vitamin D on cellular response to H2O2 or the anti-cancer drug, cisplatin. Incubation of keratinocytes with 1,25(OH)2D3 or its low calcemic analogues, 20(OH)D3, 21(OH)pD or calcipotriol, sensitized cells to ROS resulting in more potent inhibition of keratinocyte proliferation by H2O2 in the presence of vitamin D compounds. These results were supported by cell cycle and apoptosis analyses, and measurement of the mitochondrial transmembrane potentials (MMP), however some unique properties of individual secosteroids were observed. Furthermore, in HaCaT keratinocytes treated with H2O2, 1,25(OH)2D3, 21(OH)pD and calcipotriol stimulated the expression of SOD1 and CAT genes, but not SOD2, indicating a possible role of mitochondria in ROS-modulated cell death. 1,25(OH)2D3 also showed a short-term, protective effect on HaCaT keratinocytes, as exemplified by the inhibition of apoptosis and the maintenance of MMP. However, with prolonged incubation with H2O2 or cisplatin, 1,25(OH)2D3 caused an acceleration in the death of the keratinocytes. Therefore, we propose that lead vitamin D derivatives can protect the epidermis against neoplastic transformation secondary to oxidative or UV-induced stress through activation of vitamin D-signaling. Furthermore, our data suggest that treatment with low calcemic vitamin D analogues or the maintenance of optimal level of vitamin D by proper supplementation, can enhance the anticancer efficacy of cisplatin. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Antithrombin regulates matriptase activity involved in plasmin generation, syndecan shedding, and HGF activation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Ya-Wen Chen

    Full Text Available Matriptase, a membrane-associated serine protease, plays an essential role in epidermal barrier function through activation of the glycosylphosphatidylinositol (GPI-anchored serine protease prostasin. The matriptase-prostasin proteolytic cascade is tightly regulated by hepatocyte growth factor activator inhibitor (HAI-1 such that matriptase autoactivation and prostasin activation occur simultaneously and are followed immediately by the inhibition of both enzymes by HAI-1. However, the mechanisms whereby matriptase acts on extracellular substrates remain elusive. Here we report that some active matriptase can escape HAI-1 inhibition by being rapidly shed from the cell surface. In the pericellular environment, shed active matriptase is able to activate hepatocyte growth factor (HGF, accelerate plasminogen activation, and shed syndecan 1. The amount of active matriptase shed is inversely correlated with the amount of antithrombin (AT bound to the surface of the keratinocytes. Binding of AT to the surface of keratinocytes is dependent on a functional heparin binding site, Lys-125, and that the N-glycosylation site Asn-135 be unglycosylated. This suggests that β-AT, and not α-AT, is responsible for regulation of pericellular matriptase activity in keratinocytes. Keratinocytes appear to rely on AT to regulate the level of pericellular active matriptase much more than breast and prostate epithelial cells in which AT regulation of matriptase activity occurs at much lower levels than keratinocytes. These results suggest that keratinocytes employ two distinct serine protease inhibitors to control the activation and processing of two different sets of matriptase substrates leading to different biological events: 1 HAI-1 for prostasin activation/inhibition, and 2 AT for the pericellular proteolysis involved in HGF activation, accelerating plasminogen activation, and shedding of syndecans.

  1. In vitro bioartificial skin culture model of tissue rejection and inflammatory/immune mechanisms.

    Science.gov (United States)

    Strande, L F; Foley, S T; Doolin, E J; Hewitt, C W

    1997-06-01

    We hypothesized that an in vitro bioartificial skin rejection model using living LSEs grown in tissue culture could be developed for the study of autologous, allogenic, and/or xenogeneic inflammatory/immune mechanisms and topical immunosuppressive drugs. Human fibroblasts were mixed with type 1 rat-tail collagen to form a matrix (4 to 5 days), on which human keratinocytes were seeded. After a keratinocyte monolayer formed, CT cultures were raised to the air-liquid interface for continued growth. In the REJ LSE model, immunocytes isolated from human blood were seeded on top of the NHEK monolayer at the time of air-lifting. Thickness measurements of the acellular keratin and keratinocyte layers, and nuclear/cytoplasmic ratios, in both CT and REJ were made using digital image analysis. Immunostaining with anticytokeratin demonstrated a viable, keratin-producing epidermal layer; staining with anti-TGF-beta suggested a role for this cytokine in the rejection or wound-healing process. The LSE appeared histologically similar to normal human epidermis. Immunocytes added to the REJ cultures caused an obvious rejection response and were clearly identifiable in the gels as CD45+ staining cells. The LSE model appears promising for the study of immune/inflammatory mechanisms, thermal injury, screening antirejection agents that might be applied topically and as an in vitro replacement for skin graft studies in animals.

  2. A review of epidermal maturation arrest: a unique entity or another description of persistent granulation tissue?

    Science.gov (United States)

    Kessides, Maria C; Khachemoune, Amor

    2014-12-01

    To conduct a review of reported cases of epidermal maturation arrest and to compare their clinical and histological descriptions with that of persistent granulation tissue with a focus on diagnostic methods and response to treatment. The authors performed a literature search within Pubmed, Embase, Google Scholar, and Web of Science for all reported cases of epidermal maturation arrest under the terms "epidermal maturation arrest," "epidermal arrest," "epidermal maturation," and "re-epithelialization maturation arrest." They reviewed the clinical and histological presentation of hypergranulation tissue as well as the evidence for the most widely used treatments. There is only one case series and one case report of epidermal maturation arrest, and the former gives the most detailed clinical and histological description including response to treatment. The clinical description, histological findings, and response to treatment of all cases are comparable to that of persistent granulation tissue and there is no histological or cytological data provided to support that epidermal maturation arrest exists as a distinct entity. Among the cases of epidermal maturation arrest reported in the literature, there is insufficient evidence that keratinocytes acquired a state of arrest in their migration. Rather, the described cases appear to have been complicated by persistent granulation tissue, a well-known aberration in wound healing.

  3. Expression of microRNA-184 in keratinocytes represses argonaute 2.

    Science.gov (United States)

    Roberts, Julian C; Warren, Richard B; Griffiths, Christopher E M; Ross, Kehinde

    2013-12-01

    Interleukin-22 (IL-22) is a proinflammatory cytokine that has been associated with the pathogenesis of inflammatory skin disorders. However, the impact of IL-22 on microRNA (miRNA) expression in epidermal keratinocytes is unknown. Here we show that IL-22 induces miR-184 in reconstituted human epidermis (RHE) and in the HaCaT keratinocyte cell line. Exposure to IL-22 increased miR-184 expression 8- and 15-fold in RHE and HaCaT cells, respectively. Oncostatin M, an unrelated proinflammatory cytokine, also raised miR-184 expression in RHE and HaCaT keratinocytes. Pharmacologic and genetic inhibition demonstrated that cytokine-induced expression of miR-184 was mediated by signal transducer and activation of transcription 3 (STAT3). Argonaute 2 (AGO2), a member of the RNA-induced silencing complex (RISC), is a predicted miR-184 target. Using protein, messenger RNA and reporter analyses, we found that miR-184 regulates the expression of AGO2. We conclude that cytokine-induced miR-184 attenuates AGO2 expression in keratinocytes. Copyright © 2013 Wiley Periodicals, Inc.

  4. Gene Editing for the Efficient Correction of a Recurrent COL7A1 Mutation in Recessive Dystrophic Epidermolysis Bullosa Keratinocytes

    Directory of Open Access Journals (Sweden)

    Cristina Chamorro

    2016-01-01

    Full Text Available Clonal gene therapy protocols based on the precise manipulation of epidermal stem cells require highly efficient gene-editing molecular tools. We have combined adeno-associated virus (AAV-mediated delivery of donor template DNA with transcription activator-like nucleases (TALE expressed by adenoviral vectors to address the correction of the c.6527insC mutation in the COL7A1 gene, causing recessive dystrophic epidermolysis bullosa in a high percentage of Spanish patients. After transduction with these viral vectors, high frequencies of homology-directed repair were found in clones of keratinocytes derived from a recessive dystrophic epidermolysis bullosa (RDEB patient homozygous for the c.6527insC mutation. Gene-edited clones recovered the expression of the COL7A1 transcript and collagen VII protein at physiological levels. In addition, treatment of patient keratinocytes with TALE nucleases in the absence of a donor template DNA resulted in nonhomologous end joining (NHEJ-mediated indel generation in the vicinity of the c.6527insC mutation site in a large proportion of keratinocyte clones. A subset of these indels restored the reading frame of COL7A1 and resulted in abundant, supraphysiological expression levels of mutant or truncated collagen VII protein. Keratinocyte clones corrected both by homology-directed repair (HDR or NHEJ were used to regenerate skin displaying collagen VII in the dermo-epidermal junction.

  5. Retinoid X receptor ablation in adult mouse keratinocytes generates an atopic dermatitis triggered by thymic stromal lymphopoietin

    Science.gov (United States)

    Li, Mei; Messaddeq, Nadia; Teletin, Marius; Pasquali, Jean-Louis; Metzger, Daniel; Chambon, Pierre

    2005-01-01

    To investigate the role of retinoid X receptors (RXRs) in epidermal homeostasis, we generated RXRαβep-/- somatic mutants in which both RXRα and RXRβ are selectively ablated in epidermal keratinocytes of adult mice. These mice develop a chronic dermatitis mimicking that observed in atopic dermatitis (AD) patients. In addition, they exhibit immunological abnormalities including elevated serum levels of IgE and IgG, associated with blood and tissue eosinophilia, indicating that keratinocyte-selective ablation of RXRs also generates a systemic syndrome similar to that found in AD patients. Furthermore, the profile of increased expression of cytokines and chemokines in skin of keratinocyte-selective RXRαβ-ablated mutants was typical of a T helper 2-type inflammation, known to be crucially involved in human AD pathogenesis. Finally, we demonstrate that thymic stromal lymphopoietin, whose expression is rapidly and strongly induced in RXRαβ-ablated keratinocytes, plays a key role in initiating the skin and systemic AD-like pathologies. PMID:16199515

  6. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  7. gamma-Aminobutyric acid (A) receptor agonists accelerate cutaneous barrier recovery and prevent epidermal hyperplasia induced by barrier disruption.

    Science.gov (United States)

    Denda, Mitsuhiro; Inoue, Kaori; Inomata, Shinji; Denda, Sumiko

    2002-11-01

    gamma-Aminobutyric acid, is an amino acid transmitter, which mediates rapid inhibition in the central nervous system. gamma-Aminobutyric acid (A) receptor is a ligand-gated chloride ion channel playing an important part in polarizing the cell membrane and reducing neuronal excitability in the neuron. In this study, we demonstrated the effects of gamma-aminobutyric acid (A) receptor agonists on the cutaneous barrier repair process after the barrier disruption of hairless mice. Topical application of gamma-aminobutyric acid and gamma-aminobutyric acid (A) receptor-specific agonists, musimol and isoguvacine, after barrier disruption accelerated the barrier recovery. The gamma-aminobutyric acid (B)-specific agonist, baclofen, did not affect the barrier recovery rate. The effect of gamma-aminobutyric acid on the barrier recovery was blocked by the gamma-aminobutyric acid (A)-receptor antagonist, bicuculline methobromide, but gamma-aminobutyric acid (B) receptor antagonist, saclofen, did not affect the effect of gamma-aminobutyric acid. Topical application of gamma-aminobutyric acid also prevented epidermal hyperplasia, which was induced by the barrier insults under low environmental humidity and bicuculline methobromide blocked the effect of gamma-aminobutyric acid on the epidermal hyperplasia. Immunoreactivity against gamma-aminobutyric acid (A) polyclonal antibody was observed in hairless mouse epidermis. The fluorescent probe of gamma-aminobutyric acid (A) receptor, TXR-musimol showed the localization of gamma-aminobutyric acid (A) receptor in the epidermis of the hairless mice. Elevation of intracellular chloride ion was induced by gamma-aminobutyric acid in cultured human keratinocytes and it was blocked by bicuculline methobromide. These results suggest that the gamma-aminobutyric acid (A)-like receptor is associated with skin barrier homeostasis and regulation of the receptor clinically effective for barrier dysfunctional or epidermal hyperproliferative diseases.

  8. Myofibroblast keratinocyte growth factor reduces tight junctional integrity and increases claudin-2 levels in polarized Caco-2 cells

    Science.gov (United States)

    Kim, Tae Il; Poulin, Emily J.; Blask, Elliot; Bukhalid, Raghida; Whitehead, Robert H.; Franklin, Jeffrey L.; Coffey, Robert J.

    2013-01-01

    The colonic epithelium is composed of a polarized monolayer sheathed by a layer of pericryptal myofibroblasts (PCMFs). We mimicked these cellular compartments in vitro to assess the effects of paracrine-acting PCMF-derived factors on tight junction (TJ) integrity, as measured by transepithelial electrical resistance (TER). Co-culture with 18Co PCMFs, or basolateral administration of 18Co conditioned medium (CM), significantly reduced TER of polarized Caco-2 cells. Amongst candidate paracrine factors, only keratinocyte growth factor (KGF) reduced Caco-2 TER; basolateral KGF treatment led to time- and concentration-dependent increases in claudin-2 levels. We also demonstrate amphiregulin (AREG), produced largely by Caco-2 cells, increased claudin-2 levels, leading to epidermal growth factor receptor-mediated TER reduction. We propose that colonic epithelial TJ integrity can be modulated by paracrine KGF and autocrine AREG through increased claudin-2 levels. KGF-regulated claudin-2 induction may have implications for inflammatory bowel disease, where both KGF and claudin-2 are upregulated. PMID:22946653

  9. Garcia-Hafner-Happle syndrome: A case report and review of a rare sub-type of epidermal nevus syndrome.

    Science.gov (United States)

    Desai, Soaham Dilip; Vora, Rita; Bharani, Sheela

    2014-01-01

    Garcia-Hafner-Happle syndrome, also known as Fibroblast growth factor receptor 3 epidermal nevus syndrome, is a new neurocutaneous phenotype, which has been identified in 2008 by Garcı'a-Vargas et al. The disorder is caused by a mosaic R248C mutation of the FGFR3 gene, which is characterized by a keratinocytic epidermal nevus, acanthosis nigricans, and neurological abnormalities like seizures, intellectual impairment, cortical atrophy, and underdevelopment of corpus callosum. The epidermal nevus syndromes represent a group of distinct disorders in which an epidermal nevus is associated with abnormalities in other organ systems like central nervous system, cardiovascular system, genitourinary system, eyes, and bone. Recently, nine well-defined different epidermal nevus syndromes (ENSs) have been identified on clinical, histopathologic, and molecular basis. We present here the details of a patient with the clinical features and skin biopsy findings suggestive of Garcia-Hafner-Happle syndrome.

  10. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  11. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Science.gov (United States)

    Tao, Heng; Berno, Anthony J; Cox, David R; Frazer, Kelly A

    2007-08-01

    Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1) locus for association with migration rates of human epidermal keratinocytes (HEK) isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  12. Bullous pemphigoid and linear IgA dermatosis sera recognize a similar 120-kDa keratinocyte collagenous glycoprotein with antigenic cross-reactivity to BP180

    NARCIS (Netherlands)

    Pas, HH; Kloosterhuis, GJ; Heeres, K; vanderMeer, JB; Jonkman, MF

    Circulating IgG from a large subset of bullous pein; phigoid (SP) patients reacted on immunoblot with a 120-kDa protein in conditioned keratinocyte culture medium and in keratinocyte cell extracts, A protein with a similar molecular weight was recognized by circulating IgA from a subset of patients

  13. Upregulation of epidermal growth factor receptor 4 in oral leukoplakia

    Science.gov (United States)

    Kobayashi, Hiroshi; Kumagai, Kenichi; Gotoh, Akito; Eguchi, Takanori; Yamada, Hiroyuki; Hamada, Yoshiki; Suzuki, Satsuki; Suzuki, Ryuji

    2013-01-01

    In the present study, we investigate the expression profile of the epidermal growth factor receptor family, which comprises EGFR/ErbB1, HER2/ErbB2, HER3/ErbB3 and HER4/ErbB4 in oral leukoplakia (LP). The expression of four epidermal growth factor receptor (EGFR) family genes and their ligands were measured in LP tissues from 14 patients and compared with levels in 10 patients with oral lichen planus (OLP) and normal oral mucosa (NOM) from 14 healthy donors by real-time polymerase chain reaction (PCR) and immunohistochemistry. Synchronous mRNA coexpression of ErbB1, ErbB2, ErbB3 and ErbB4 was detected in LP lesions. Out of the receptors, only ErbB4 mRNA and protein was more highly expressed in LP compared with NOM tissues. These were strongly expressed by epithelial keratinocytes in LP lesions, as shown by immunohistochemistry. Regarding the ligands, the mRNA of Neuregulin2 and 4 were more highly expressed in OLP compared with NOM tissues. Therefore, enhanced ErbB4 on the keratinocytes and synchronous modulation of EGFR family genes may contribute to the pathogenesis and carcinogenesis of LP. PMID:23492901

  14. Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

    Directory of Open Access Journals (Sweden)

    Naser Tayyebi Meibodi

    2011-01-01

    Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

  15. Ecto-nucleoside triphosphate diphosphohydrolase 2 modulates local ATP-induced calcium signaling in human HaCaT keratinocytes.

    Directory of Open Access Journals (Sweden)

    Chia-Lin Ho

    Full Text Available Keratinocytes are the major building blocks of the human epidermis. In many physiological and pathophysiological conditions, keratinocytes release adenosine triphosphate (ATP as an autocrine/paracrine mediator that regulates cell proliferation, differentiation, and migration. ATP receptors have been identified in various epidermal cell types; therefore, extracellular ATP homeostasis likely determines its long-term, trophic effects on skin health. We investigated the possibility that human keratinocytes express surface-located enzymes that modulate ATP concentration, as well as the corresponding receptor activation, in the pericellular microenvironment. We observed that the human keratinocyte cell line HaCaT released ATP and hydrolyzed extracellular ATP. Interestingly, ATP hydrolysis resulted in adenosine diphosphate (ADP accumulation in the extracellular space. Pharmacological inhibition by ARL 67156 or gene silencing of the endogenous ecto-nucleoside triphosphate diphosphohydrolase (NTPDase isoform 2 resulted in a 25% reduction in both ATP hydrolysis and ADP formation. Using intracellular calcium as a reporter, we found that although NTPDase2 hydrolyzed ATP and generated sustainable ADP levels, only ATP contributed to increased intracellular calcium via P2Y2 receptor activation. Furthermore, knocking down NTPDase2 potentiated the nanomolar ATP-induced intracellular calcium increase, suggesting that NTPDase2 globally attenuates nucleotide concentration in the pericellular microenvironment as well as locally shields receptors in the vicinity from being activated by extracellular ATP. Our findings reveal an important role of human keratinocyte NTPDase2 in modulating nucleotide signaling in the extracellular milieu of human epidermis.

  16. Nrf2 Promotes Keratinocyte Proliferation in Psoriasis through Up-Regulation of Keratin 6, Keratin 16, and Keratin 17.

    Science.gov (United States)

    Yang, Luting; Fan, Xueli; Cui, Tingting; Dang, Erle; Wang, Gang

    2017-10-01

    Psoriasis is a chronic inflammatory skin disease characterized by keratinocyte hyperproliferation of epidermis. Although hyperproliferation-associated keratins K6, K16, and K17 are considered to be the hallmarks of psoriasis, the molecular basis underlying the overexpression of these keratins remains unclear. Nrf2 regulates cell proliferation. Therefore, we investigated whether Nrf2 regulates keratinocyte proliferation via promoting expression of K6, K16, and K17 in psoriasis. We initially found that psoriatic epidermis exhibited elevated expression of Nrf2. Furthermore, Nrf2 promoted expression of K6, K16, and K17 in both HaCaT cells and primary human keratinocytes by binding to the ARE domains located in the promoter of these genes. Additionally, upon stimulation with IL-17 or IL-22, Nrf2 translocated to the nucleus and initiated expression of targeted keratins. In mice of imiquimod-induced psoriasis-like dermatitis, topical application of Nrf2 small interfering RNA alleviated the epidermal hyperplasia with reduced expression of these keratins. More importantly, Nrf2 promoted the proliferation of human keratinocytes through up-regulation of K6, K16, or K17. These data suggested that inflammatory cytokines promoted Nrf2 nuclear translocation in psoriatic epidermis, which led to elevated expression of K6, K16, and K17, thus promoting keratinocyte proliferation and contributing to the pathogenesis of psoriasis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. A novel model of wound healing in the SCID mouse using a cultured human skin substitute.

    Science.gov (United States)

    Windsor, Martin L; Eisenberg, Mark; Gordon-Thomson, Clare; Moore, Geoffrey P M

    2009-02-01

    Studies of skin graft behaviour in rodent excisional wound models are limited by the dominance of wound contracture and graft sloughing as primary healing responses. To slow skin contraction, polytetrafluoroethylene (Teflon) rings were inserted into dorso-lateral full-thickness wounds in SCID mice. Cultured skin substitutes (OrCel), composed of cultured human keratinocytes and fibroblasts in a bovine collagen sponge, were implanted within the rings. Examination and histology of grafts 14 days later showed graft take in four of six recipients, with 90% epithelialization and wound contraction of 31-47%. Immunohistochemical studies, using human-specific antisera to distinguish graft from host tissues, showed that regenerated tissue was predominantly human. Staining with anticytokeratin, revealed a multilayered, stratified neoepidermis. HBG were identified in keratinocytes in all epidermal layers. Langerhans cells were absent. Antihuman vimentin, used as a fibroblast marker, confirmed that cells of the neodermis were primarily of human origin. Neoepidermal keratinocytes, primarily in the basal and suprabasal layers, were also stained. Results suggest that the poly(tetrafluoroethylene) ring inhibited graft sloughing and provided a more favourable environment for the skin substitute to regenerate a substantially normal human skin.

  18. Development and Characterization of an Engraftable Tissue-Cultured Skin Autograft: Alternative Treatment for Severe Electrical Injuries.

    Science.gov (United States)

    Golinski, Peter; Menke, Henrik; Hofmann, Matthias; Valesky, Eva; Butting, Manuel; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland; Zoeller, Nadja N

    2014-01-01

    Optimizing the treatment regimens of extensive or nonhealing defects is a constant challenge. Tissue-cultured skin autografts may be an alternative to mesh grafts and keratinocyte suspensions that are applied during surgical defect coverage. Autologous epidermal and dermal cells were isolated, in vitro expanded and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically and electron microscopically characterized. Subsequently, it was transplanted onto lesions of a severely burned patient. Comparability of the skin equivalent to healthy human skin could be shown due to the epidermal strata, differentiation, proliferation markers and development of characteristics of a functional basal lamina. Approximately 2 weeks after skin equivalent transplantation the emerging new skin correlated closely to the adjacent normal skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and its versatility for clinical applications. © 2015 S. Karger AG, Basel.

  19. Characterization of a unique technique for culturing primary adult human epithelial progenitor/“stem cells”

    Directory of Open Access Journals (Sweden)

    Marcelo Cynthia

    2012-06-01

    Full Text Available Abstract Background Primary keratinocytes derived from epidermis, oral mucosa, and urothelium are used in construction of cell based wound healing devices and in regenerative medicine. This study presents in vitro technology that rapidly expands keratinocytes in culture by growing monolayers under large volumes of serum-free, essential fatty acid free, low calcium medium that is replaced every 24 hrs. Methods Primary cell cultures were produced from epidermal skin, oral mucosa and ureter by trypsinization of tissue. Cells were grown using Epilife medium with growth factors under high medium volumes. Once densely confluent, the keratinocyte monolayer produced cells in suspension in the overlying medium that can be harvested every 24 hrs. over a 7–10 day period. The cell suspension (approximately 8 X 105 cells/ml is poured into a new flask to form another confluent monolayer over 2–4 days. This new culture, in turn produced additional cell suspensions that when serially passed expand the cell strain over 2–3 months, without the use of enzymes to split the cultures. The cell suspension, called epithelial Pop Up Keratinocytes (ePUKs were analyzed for culture expansion, cell size and glucose utilization, attachment to carrier beads, micro-spheroid formation, induction of keratinocyte differentiation, and characterized by immunohistochemistry. Results The ePUKs expanded greatly in culture, attached to carrier beads, did not form micro-spheroids, used approximately 50% of medium glucose over 24 hrs., contained a greater portion of smaller diameter cells (8–10 microns, reverted to classical appearing cultures when returned to routine feeding schedules (48 hrs. and 15 ml/T-75 flask and can be differentiated by either adding 1.2 mM medium calcium, or essential fatty acids. The ePUK cells are identified as cycling (Ki67 expressing basal cells (p63, K14 expressing. Conclusions Using this primary culture technique, large quantities

  20. The Effect of Titanium Dioxide Nanoparticles on Keratinocyte Cell (KC) and Squamous Cell Carcinoma (SCC-13)

    Science.gov (United States)

    Lin, Chienhsiu; Simon, Marcia; Jurukovski, Vladimir; Lee, Wilson; Rafailovich, Miriam

    2009-03-01

    We have studied the effects of TiO2 nanoparticles on cell keratinocyte and SCC (Squamous Cell Carcinoma) cells. We found that the concentration of particles required to adversely affect the cells was many times higher for keratinocyte than SCC cells. Confocal microscope shows that the particles in keratinocyte culture are sequestered in membranes between the cell colonies. The particles penetrated into the cells in the case of the SCC cells. TEM images revealed very few particles in the keratinocyte, many more particles were observed sequestered in vacuole of the SCC cells. These results indicate that the keratinocyte layer behaves very different from the fibroblast layers which are much more sensate to TiO2 nanoparticle damage and may suggest a protection mechanism of the dermal tissue. The effect of UV exposure in the presence of DNA was also investigated. We found that adsorbed proteins, as well as grafted polymer provided a measure of protection against free radical formation. The effects of low level UV exposure when the particles are near in-vitro cell culture will be presented.

  1. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio

    2017-01-01

    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  2. Remifentanil protects human keratinocytes against hypoxia-reoxygenation injury through activation of autophagy.

    Directory of Open Access Journals (Sweden)

    Jae-Young Kwon

    Full Text Available The proliferation, differentiation, and migration of keratinocytes are essential in the early stages of wound healing. Hypoxia-Reoxygenation (H/R injury to keratinocytes can occur in various stressful environments such as surgery, trauma, and various forms of ulcers. The effects of remifentanil on human keratinocytes under hypoxia-reoxygenation have not been fully studied. Therefore, we investigated the effects of remifentanil on the proliferation, apoptosis, and autophagic activation of human keratinocytes during hypoxic-reoxygenation. Human keratinocytes were cultured under 1% oxygen tension for 24 h. The cells were then treated with various concentrations of remifentanil (0.01, 0.1, 0.5, and 1 ng/mL for 2 h. Thereafter, the cells were reoxygenated for 12 h at 37°C. We measured cell viability via MTT assay. Using quantitative real-time PCR and western blot analysis, we measured the expression levels of proteins associated with apoptosis and autophagy. Quantification of apoptotic cells was performed using flow cytometer analysis and autophagic vacuoles were observed under a fluorescence microscope. Remifentanil treatment brought about an increase in the proliferation of human keratinocytes damaged by hypoxia-reoxygenation and decreased the apoptotic cell death, enhancing autophagic activity. However, the autophagy pathway inhibitor 3-MA inhibited the protective effect of remifentanil in hypoxia-reoxygenation injury. In conclusion, the current study demonstrated that remifentanil treatment stimulated autophagy and reduced apoptotic cell death in a hypoxia-reoxygenation model of human keratinocytes. Our results provide additional insights into the relationship between apoptosis and autophagy.

  3. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    OpenAIRE

    Ana Maria Abreu Velez; Juliana Calle; Howard, Michael S.

    2013-01-01

    Autoimmune bullous skin diseases (ABDs) are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ). These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Er...

  4. The effect of different biologic and biosynthetic wound covers on keratinocyte growth, stratification and differentiation in vitro

    Directory of Open Access Journals (Sweden)

    Eva Matoušková

    2014-10-01

    Full Text Available The purpose of this study was to compare, by means of in vitro cultivation technique, five marketed brands of wound covers used in the treatment of burns and other skin defects (Biobrane®, Suprathel®, Veloderm®, Xe-Derma®, and Xenoderm® for their ability to stimulate the keratinocyte growth, stratification, and differentiation. In three independent experiments, human keratinocytes were grown on the tested covers in organotypic cultures by the 3T3 feeder layer technique. Vertical paraffin sections of the wound covers with keratinocytes were processed using hematoxylin–eosin staining and immunostaining for involucrin. Keratinocyte populations on the dressings were assessed for (1 number of keratinocyte strata (primary variable, (2 quantitative growth, (3 thickness of the keratinocyte layer, and (4 cell differentiation. The Xe-Derma wound cover provided the best support to keratinocyte proliferation and stratification, with the number of keratinocyte strata significantly (p < 0.05 higher in comparison to all products studied, except Xenoderm. However, in contrast to Xe-Derma, Xenoderm did not significantly differ from the other dressings. The results of this in vitro study show that the brands based on porcine dermal matrix possess the strongest effect on keratinocyte proliferation and stratification. The distinctive position of Xe-Derma may be related to its composition, where natural dermal fibers form a smooth surface, similar to the basement membrane. Furthermore, the results indicate that in vitro evaluation of effects on epithelial growth may accelerate the development of new bio-engineering-based wound covers.

  5. P. gingivalis modulates keratinocytes through FOXO transcription factors.

    Directory of Open Access Journals (Sweden)

    Shuai Li

    Full Text Available P. gingivalis is a prominent periodontal pathogen that has potent effects on host cells. In this study we challenged gingival epithelial cells with P. gingivalis with the aim of assessing how mRNA levels of key target genes were modulated by P. gingivalis via the transcription factors FOXO1 and FOXO3. Primary mono- and multi-layer cultures of gingival epithelial cells were challenged and barrier function was examined by fluorescent dextran and apoptosis was measured by cytoplasmic histone associated DNA. Gene expression levels were measured by real-time PCR with and without FOXO1 and FOXO3 siRNA compared to scrambled siRNA. P. gingivalis induced a loss of barrier function and stimulated gingival epithelial cell apoptosis in multilayer cultures that was in part gingipain dependent. P. gingivalis stimulated an increase in FOXO1 and FOXO3 mRNA, enhanced mRNA levels of genes associated with differentiated keratinocyte function (keratin-1, -10, -14, and involucrin, increased mRNA levels of apoptotic genes (BID and TRADD, reduced mRNA levels of genes that regulate inflammation (TLR-2 and -4 and reduced those associated with barrier function (integrin beta-1, -3 and -6. The ability of P. gingivalis to modulate these genes was predominantly FOXO1 and FOXO3 dependent. The results indicate that P. gingivalis has pronounced effects on gingival keratinocytes and modulates mRNA levels of genes that affect host response, differentiation, apoptosis and barrier function. Moreover, this modulation is dependent upon the transcription factors FOXO1 or FOXO3. In addition, a new function for FOXO1 was identified, that of suppressing TLR-2 and TLR-4 and maintaining integrin beta -1, beta -3 and beta -6 basal mRNA levels in keratinocytes.

  6. Evaluation of cultured human dermal- and dermo-epidermal substitutes focusing on extracellular matrix components: Comparison of protein and RNA analysis

    NARCIS (Netherlands)

    Oostendorp, C.; Meyer, S.; Sobrio, M.; Arendonk, J. van; Reichmann, E.; Daamen, W.F.; Kuppevelt, T.H. van

    2017-01-01

    Treatment of full-thickness skin defects with split-thickness skin grafts is generally associated with contraction and scar formation and cellular skin substitutes have been developed to improve skin regeneration. The evaluation of cultured skin substitutes is generally based on qualitative

  7. Clinical application of a tissue-cultured skin autograft: an alternative for the treatment of non-healing or slowly healing wounds?

    Science.gov (United States)

    Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland

    2014-01-01

    The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.

  8. Stevens-Johnson syndrome and toxic epidermal necrolysis: a review

    Directory of Open Access Journals (Sweden)

    Anthony Wong

    Full Text Available SUMMARY Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are uncommon, acute and potentially life-threatening adverse cutaneous drug reactions. These pathologies are considered a hypersensitivity reaction and can be triggered by drugs, infections and malignancies. The drugs most often involved are allopurinol, some antibiotics, including sulfonamides, anticonvulsants such as carbamazepine, and some non-steroid anti-inflammatory drugs (NSAIDs. Necrosis of keratinocytes is manifested clinically by epidermal detachment, leading to scalded skin appearance. The rash begins on the trunk with subsequent generalization, usually sparing the palmoplantar areas. Macular lesions become purplish, and epidermal detachment occurs, resulting in flaccid blisters that converge and break, resulting in extensive sloughing of necrotic skin. Nikolsky's sign is positive in perilesional skin. SJS and TEN are considered to be two ends of the spectrum of one disease, differing only by their extent of skin detachment. Management of patients with SJS or TEN requires three measures: removal of the offending drug, particularly drugs known to be high-risk; supportive measures and active interventions. Early diagnosis of the disease, recognition of the causal agent and the immediate withdrawal of the drug are the most important actions, as the course of the disease is often rapid and fatal.

  9. Regulation of migratory activity of human keratinocytes by topography of multiscale collagen-containing nanofibrous matrices.

    Science.gov (United States)

    Fu, Xiaoling; Xu, Meng; Liu, Jie; Qi, Yanmei; Li, Shaohua; Wang, Hongjun

    2014-02-01

    Nanofibrous matrices hold great promise in skin wound repair partially due to their capability of recapturing the essential attributes of native extracellular matrix (ECM). With regard to limited studies on the effect of nanofibrous matrices on keratinocytes, the present study was aimed to understand how the topographical feature of nanofibrous matrices regulates keratinocyte motility by culturing keratinocytes on polycaprolactone (PCL)/collagen nanofibrous matrices (rough surface with fiber diameters of 331 ± 112 nm) or the matrices coated with a thin layer of collagen gel to form a secondary ultrafine fibrous network (smooth surface with ultrafine fiber diameters of 55 ± 26 nm). It was found that the PCL/collagen nanofibrous matrices alone did not stimulate cell migration, while collagen gel coating could significantly increase cell motility. Further studies demonstrated that the ultrafine fibrous network of collagen gel coating significantly activated integrin β1, Rac1 and Cdc42, facilitated the deposition of laminin-332 (formerly called laminin-5), and promoted the expression of active matrix metalloproteinases (MMPs) (i.e., MMP-2 and 9). Neutralization of integrin β1 activity abrogated the gel coating-induced keratinocyte migration. These findings provide important evidence on the role of topographical features of nanofibrous matrices in regulating the phenotypic alteration of keratinocytes and suggest the possible utility of collagen-containing nanofibrous matrices for skin regeneration especially in re-epithelialization. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. AP1-dependent repression of TGFα-mediated MMP9 upregulation by PPARδ agonists in keratinocytes.

    Science.gov (United States)

    Meissner, Markus; Berlinski, Barbara; Doll, Monika; Hrgovic, Igor; Laubach, Vesselina; Reichenbach, Gabi; Kippenberger, Stefan; Gille, Jens; Kaufmann, Roland

    2011-05-01

    Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors that function mainly in the regulation of glucose and lipid homeostasis. PPAR agonists have been shown to control inflammation by inhibition of distinct proinflammatory genes. Aberrant activation of the epidermal growth factor receptor and/or overexpression of its ligand, transforming growth factor-α (TGFα), are key features of both neoplastic and inflammatory hyperproliferative epithelia. Matrix metalloproteinase 9 (MMP9) belongs to the set of genes that are effectively induced by TGFα in keratinocytes. Induction of MMP9 expression is strongly linked to regenerative skin repair mechanisms, inflammatory skin diseases and tumor metastasis. We explored whether the known anti-inflammatory effects of PPARδ ligands involve inhibiting the TGFα-mediated upregulation of MMP9. The PPARδ agonists potently inhibited TGFα-induced MMP9 expression in human keratinocytes. This inhibition was observed at both the protein and mRNA levels. Transcriptional activation studies with deletion constructs of a reporter gene revealed that PPARδ agonists mediate their inhibitory effects via an AP1-binding site. Electromobility shift assay analysis indicated that MMP9 gene expression is inhibited by repressing site-dependent DNA binding and transactivation by c-fos. In conclusion, our data provide the first evidence that MMP9 expression induced by TGFα is a valid target of PPARδ ligands in keratinocytes. © 2011 John Wiley & Sons A/S.

  11. N-glycosylation of ß4 integrin controls the adhesion and motility of keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yoshinobu Kariya

    Full Text Available α6ß4 integrin is an essential component of hemidesmosomes and modulates cell migration in wound healing and cancer invasion. To elucidate the role of N-glycosylation on ß4 integrin, we investigated keratinocyte adhesion and migration through the re-expression of wild-type or N-glycosylation-defective ß4 integrin (ΔNß4 in ß4 integrin null keratinocytes. N-glycosylation of ß4 integrin was not essential for the heterodimer formation of ß4 integrin with α6 integrin and its expression on a cell surface, but N-glycosylation was required for integrin-mediated cell adhesion and migration. Concomitantly with the reduction of ß4 integrin in the membrane microdomain, the intracellular signals of Akt and ERK activation were decreased in cells expressing ΔNß4 integrin. Forced cross-linking of ß4 integrin rescued the decreased ERK activation in ΔNß4 integrin-expressing cells to a similar extent in wild-type ß4 integrin-expressing cells. Surprisingly, compared with cells expressing wild-type ß4 integrin, an alternation in N-glycan structures expressed on epidermal growth factor receptor (EGFR, and the induction of a stronger association between EGFR and ß4 integrin were observed in ΔNß4 integrin-expressing cells. These results clearly demonstrated that N-glycosylation on ß4 integrin plays an essential role in keratinocyte cellular function by allowing the appropriate complex formation on cell surfaces.

  12. [Effector function of CLA(+) T lymphocytes on autologous keratinocytes in psoriasis].

    Science.gov (United States)

    Ferran, M; Giménez-Arnau, A M; Bellosillo, B; Pujol, R M; Santamaría-Babi, L F

    2008-11-01

    Cutaneous lymphocyte antigen (CLA) is expressed by a subgroup of memory T cells that exhibit skin homing and are implicated in cutaneous T-cell-mediated diseases. Expression of genes associated with psoriasis was analyzed in keratinocytes taken from patients and healthy individuals and cultured under different conditions, including activation using supernatants from CLA(+) T lymphocytes activated with anti-CD3 and anti-CD28 antibodies. Keratinocytes from psoriasis patients activated by CLA(+)T lymphocytes expressed higher levels of interferon-inducible protein 10, HLA-DR, intercellular cell adhesion molecule 1, and inducible nitric oxide synthase. Our results suggest that we have developed an in vitro model that will allow analysis of the effector role of CLA(+) T lymphocytes on keratinocytes in psoriasis. This model may allow the identification of genes involved in the pathology of psoriasis through induction by CLA(+) T lymphocytes.

  13. Clinical, microscopic and microbial characterization of exfoliative superficial pyoderma-associated epidermal collarettes in dogs.

    Science.gov (United States)

    Banovic, Frane; Linder, Keith; Olivry, Thierry

    2017-02-01

    The microscopic and microbial features of the spreading epidermal collarettes of canine exfoliative superficial pyodermas are poorly characterized. To characterize the clinical, cytological, microbial and histopathological features of epidermal collarettes in five dogs. Cytology from the margins of collarettes identified neutrophils, extracellular and intracellular cocci within neutrophils but no acantholytic keratinocytes. Phenotypic and genotypic analyses identified all bacterial isolates from the centre and margin of five epidermal collarettes as Staphylococcus pseudintermedius. PCRs of collarette-associated Staphylococcus strains did not amplify genes encoding for the known exfoliative toxins expA and expB, whereas the predicted siet and speta amplification products were detected in all isolates. Microscopically, epidermal collarettes consisted of interfollicular, epidermal spongiotic pustules. Advancing edges of lesions consisted of peripheral intracorneal clefts in the deep stratum disjunctum above an intact stratum compactum; they contained lytic neutrophil debris, bacterial cocci and fluid, but no acantholytic keratinocytes. This intracorneal location of bacteria was confirmed using Gram stains and fluorescent in situ hybridization with eubacterial- and Staphylococcus-specific probes. The indirect immunofluorescence staining patterns of desmoglein-1, desmocollin-1, claudin-1, E-cadherin and corneodesmosin were discontinuous and patchy in areas of spongiotic pustules, whereas only that of corneodesmosin was weaker and patchy in advancing collarette edges. Epidermal collarettes represent unique clinical and histological lesions of exfoliative superficial pyodermas that are distinct from those of impetigo and superficial bacterial folliculitis. The characterization of possible causative staphylococcal exfoliatin proteases and the role of corneodesmosin in collarette pathogenesis deserve further investigation. © 2016 ESVD and ACVD.

  14. Mitochondrial and glycolytic activity of UV-irradiated human keratinocytes and its stimulation by a Saccharomyces cerevisiae autolysate.

    Science.gov (United States)

    Schütz, Rolf; Kuratli, Karin; Richard, Nathalie; Stoll, Clarissa; Schwager, Joseph

    2016-06-01

    Cutaneous aging is correlated with mitochondrial dysfunction and a concomitant decline in energy metabolism that can be accelerated by extrinsic factors such as UV radiation (UVR). In this study we compared cellular bioenergetics of normal and UV-irradiated primary human epidermal keratinocytes. Moreover, we investigated the influence of a Saccharomyces cerevisiae autolysate (SCA) on stressed keratinocytes to regain cellular homeostasis. Cellular metabolism was assessed by extracellular flux analysis which measures oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) as well as by ATP quantification. The expression level of ten mitochondria related genes in normal and UVR-stimulated (60mJ/cm(2) UVB) keratinocytes was quantified by real-time PCR and the impact of SCA addition was determined. Sublethal UV stress increased mitochondrial dysfunction in keratinocytes which resulted in reduced viability, uncoupled oxidative phosphorylation, and down-regulated mitochondrial gene expression. Particularly, gene expression of SHDA, UPC2, BID, and ATP5A1 was reduced about twofold within 4h. Treatment of keratinocytes with SCA shifted cellular metabolism towards a more energetic status by increasing the respiratory rate and glycolysis. SCA also stimulated cellular ATP production after short (4h) and prolonged (22h) incubations and induced the expression of genes related to mitochondrial function towards normal expression levels upon UV irradiation. The decreased respiratory capacity of UV-irradiated keratinocytes was partially compensated by the addition of SCA which enhanced glycolytic activity and thereby increased cellular resistance to environmental stress. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms.

    Science.gov (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette

    2017-04-15

    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  16. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  17. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  18. Cytochrome P450 4A11 expression in human keratinocytes: effects of ultraviolet irradiation.

    Science.gov (United States)

    Gonzalez, M C; Marteau, C; Franchi, J; Migliore-Samour, D

    2001-11-01

    The skin is the major interface between the body and its environment. Directly and continuously exposed to a large variety of foreign agents and stimuli such as ultraviolet radiation (UVR), cutaneous cells are active sites of intense metabolism. The cytochromes P450 (P450) are a group of enzymes that play an important part in the protective role of the skin; they are a family of microsomal membrane-bound mono-oxygenases. These haem-containing proteins catalyse the insertion of an atom of molecular oxygen into the substrate. Although generally present at low levels, a certain number of these enzymes have now been characterized in mammalian skin as constitutive or inducible isoforms. To test the effects of UVR, a source of oxidative stress, on the expression of mRNA coding for several P450 isoforms (CYP), with particular reference to the CYP2E1 and CYP4A11 isoforms, which might play a role in lipid metabolism in human keratinocytes. Human keratinocytes were cultured, irradiated and mRNA expression was analysed by gel electrophoresis after reverse transcriptase polymerase chain reactions. CYP proteins were determined from keratinocyte microsomal fractions by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and immunoperoxidase staining. Thin layer chromatography was used to detect (omega-1)- and (omega)-hydroxylation of lauric acid in the microsomal fractions. mRNAs for CYP2E1, CYP1A1 and CYP3A5 were expressed in all the keratinocyte preparations tested; however, neither CYP3A4 nor CYP3A7 were detected, either in the presence or absence of UVR treatment. CYP19Aro, CYP2C19 and CYP26 were not expressed constitutively, although some induction of CYP19Aro was seen after combined UVB and UVA irradiation. CYP4A11 mRNA was not detected in any keratinocyte preparations either under control conditions or after UVB treatment. Nevertheless, in non-irradiated keratinocyte microsomes, two protein bands were immunoreactive with anti-CYP4A11 enzyme antibodies, one of which

  19. The MEK Inhibitors Trametinib and Cobimetinib Induce a Type I Interferon Response in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Daniela Lulli

    2017-10-01

    Full Text Available Mitogen-activated protein kinase kinases (MEK 1 and 2 have crucial roles in tumorigenesis, cell proliferation, and protection from apoptosis, and their inhibition is therefore an attractive therapeutic strategy in cancer. Orally available and highly selective MEK inhibitors have been developed and assessed in numerous clinical trials, either alone or in combination with cytotoxic chemotherapy and/or other targeted agents. Of note, a complex picture of class-specific adverse effects associates with these drugs, frequently including inflammatory skin rash. Here, we investigated the response of normal human keratinocytes to the MEK inhibitors trametinib and cobimetinib, alone and in combination with the v-Raf murine sarcoma viral oncogene homolog B (BRAF inhibitors dabrafenib and vemurafenib, in terms of signal transduction and de novo gene expression. MEK inhibitors triggered enhanced expression of interferon regulatory factor 1 (IRF1 and phosphorylation of signal transducer and activator of transcription 1 (STAT1, and up-regulated the keratinocyte-specific type I interferon κ (IFN-κ, the anti-viral effectors interferon-induced tetratricopeptide repeats (IFIT 1 and 2, and the pro-inflammatory chemokine (C-C motif ligand 2 (CCL2 and the C-X-C motif chemokine 10 (CXCL10, both at the mRNA and protein level. Impairment of IRF1 expression, or abrogation of STAT1 phosphorylation due to IFN-κ gene silencing, suppressed anti-viral and pro-inflammatory gene expression. These data suggest that, similar to what we observed for epidermal growth factor receptor (EGFR blockade, MEK inhibition activates a type I interferon response, which is now recognized as an effective anti-cancer response, in human epidermal keratinocytes.

  20. Cholinergic Transactivation of the EGFR in HaCaT Keratinocytes Stimulates a Flotillin-1 Dependent MAPK-Mediated Transcriptional Response

    Directory of Open Access Journals (Sweden)

    Sina Kühne

    2015-03-01

    Full Text Available Acetylcholine and its receptors regulate numerous cellular processes in keratinocytes and other non-neuronal cells. Muscarinic acetylcholine receptors are capable of transactivating the epidermal growth factor receptor (EGFR and, downstream thereof, the mitogen-activated protein kinase (MAPK cascade, which in turn regulates transcription of genes involved in cell proliferation and migration. We here show that cholinergic stimulation of human HaCaT keratinocytes results in increased transcription of matrix metalloproteinase MMP-3 as well as several ligands of the epidermal growth factor family. Since both metalloproteinases and the said ligands are involved in the transactivation of the EGFR, this transcriptional upregulation may provide a positive feed-forward loop for EGFR/MAPK activation. We here also show that the cholinergic EGFR and MAPK activation and the upregulation of MMP-3 and EGF-like ligands are dependent on the expression of flotillin-1 which we have previously shown to be a regulator of MAPK signaling.

  1. Photo-pollution stress in skin: Traces of pollutants (PAH and particulate matter) impair redox homeostasis in keratinocytes exposed to UVA1.

    Science.gov (United States)

    Soeur, Jérémie; Belaïdi, Jean-Philippe; Chollet, Christel; Denat, Laurence; Dimitrov, Ariane; Jones, Christophe; Perez, Philippe; Zanini, Martine; Zobiri, Olivia; Mezzache, Sakina; Erdmann, Dominique; Lereaux, Guillaume; Eilstein, Joan; Marrot, Laurent

    2017-05-01

    It is likely that skin is exposed to low concentrations of pollutants such as Polycyclic Aromatic Hydrocarbons (PAH) either through topical penetration by ultrafine particles or by systemic distribution. No precise estimation of pollutants in living skin is available, but literature has reported contamination of blood by PAH at concentrations in the nanomolar range. Some pollutants (PAH for example) are photo-reactive and phototoxic: sunlight and pollution might thus synergistically compromise skin health. Here, the biological effects of particulate matter, PM extract and various PAH were compared in normal human epidermal keratinocytes (NHEK) and reconstructed skin model exposed to either daily UV (d-UV 300-400nm) or UVA1 (350-400nm). Impact of pollutants (PM, PAH or PM extract) combined to UV was studied on NHEK by measuring toxicity, redox homeostasis and GSH metabolism in NHEK. NHEK were exposed to UV from solar simulator (either d-UV or UVA1) combined with pollutants. Viability, clonogenic efficiency, redox homeostasis and GSH metabolism were assessed. Pollutants (PAH, PM or PM extract) ±UVA1 irradiation was associated with a significant phototoxic effect that was equal to or greater than that produced by d-UV. This result is interesting considering that UVA1 represents around 80% of daily UV and reaches the dermal-epidermal junction with ease. Moreover, among PAH studied, benzo[a]pyrene and indeno[1,2,3-cd]pyrene were phototoxic at very low concentrations (nanomolar range) on cultured cells or in reconstructed epidermis and also impaired keratinocyte clonogenic potential at sub-toxic doses. ROS generation within cells and in the inner mitochondrial compartment, mitochondrial membrane depolarization and/or reduced ATP production were also noted. Meanwhile, intracellular glutathione concentrations transiently decreased several hours post-treatment and reduction of its synthesis by buthionine sulfoximine potentiated PAH phototoxicity. Consequently, expression

  2. Epidermal hyperproliferation in mice lacking fatty acid transport protein 4 (FATP4) involves ectopic EGF receptor and STAT3 signaling

    OpenAIRE

    Lin, Meei-Hua; Chang, Kuo-Wei; Lin, Shu-Chun; Miner, Jeffrey H.

    2010-01-01

    Fatty acid transport protein (FATP) 4 is one of a family of six FATPs that facilitate long- and very long-chain fatty acid uptake. Mice lacking FATP4 are born with tight, thick skin and a defective epidermal barrier; they die neonatally due to dehydration and restricted movements. Both the skin phenotype and the lethality are rescued by transgene-driven expression of FATP4 solely in suprabasal keratinocytes. Here we show that Fatp4 mutants exhibit epidermal hyperplasia resulting from an incre...

  3. Arsenite suppression of BMP signaling in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Marjorie A.; Qin, Qin [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States); Hu, Qin; Zhao, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Rice, Robert H., E-mail: rhrice@ucdavis.edu [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States)

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  4. Keratinocyte specific markers isolated using phage display

    DEFF Research Database (Denmark)

    Jensen, K.B.; Jensen, Ole Nørregaard; Ravn, P.

    2003-01-01

    Specific molecular markers for various normal and pathogenic cell states and cell types provide knowledge of basic biological systems and have a direct application in targeted therapy. We describe a proteomic method based on the combination of new and improved phage display antibody technologies...... display method was applied to analysis of human skin keratinocytes resulting in the isolation of a panel of antibodies. Fourteen of these antibodies were further characterized, half of which predominantly recognized keratinocytes in a screen of a range of different cell types. Three cognate keratinocyte...... antigens were subsequently identified by mass spectrometry as laminin-5, plectin, and fibronectin. The combination of phage display technology with mass spectrometry methods for protein identification is a general and promising approach for proteomic analysis of cell surface complexity....

  5. Epidermal Expression of Intercellular Adhesion Molecule 1 is Not a Primary Inducer of Cutaneous Inflammation in Transgenic Mice

    Science.gov (United States)

    Williams, Ifor R.; Kupper, Thomas S.

    1994-10-01

    Keratinocytes at sites of cutaneous inflammation have increased expression of intercellular adhesion molecule 1 (ICAM-1), a cytokine-inducible adhesion molecule which binds the leukocyte integrins LFA-1 and Mac-1. Transgenic mice were prepared in which the expression of mouse ICAM-1 was targeted to basal keratinocytes by using the human K14 keratin promoter. The level of constitutive expression attained in the transgenic mice exceeded the peak level of ICAM-1 expression induced on nontransgenic mouse keratinocytes in vitro by optimal combinations of interferon γ and tumor necrosis factor α or in vivo by proinflammatory stimuli such as phorbol 12-myristate 13-acetate. In vitro adhesion assays demonstrated that cultured transgenic keratinocytes were superior to normal keratinocytes as a substrate for the LFA-1-dependent binding of mouse T cells, confirming that the transgene-encoded ICAM-1 was expressed in a functional form. However, the high level of constitutive ICAM-1 expression achieved on keratinocytes in vivo in these transgenic mice did not result in additional recruitment of CD45^+ leukocytes into transgenic epidermis, nor did it elicit dermal inflammation. Keratinocyte ICAM-1 expression also did not potentiate contact-hypersensitivity reactions to epicutaneous application of haptens. The absence of a spontaneous phenotype in these transgenic mice was not the result of increased levels of soluble ICAM-1, since serum levels of soluble ICAM-1 were equal in transgenic mice and controls. We conclude that elevated ICAM-1 expression on keratinocytes cannot act independently to influence leukocyte trafficking and elicit cutaneous inflammation.

  6. The δ-Opioid Receptor Affects Epidermal Homeostasis via ERK-Dependent Inhibition of Transcription Factor POU2F3

    Science.gov (United States)

    Neumann, Christine; Bigliardi-Qi, Mei; Widmann, Christian; Bigliardi, Paul L

    2015-01-01

    Neuropeptides and their receptors are present in human skin, and their importance for cutaneous homeostasis and during wound healing is increasingly appreciated. However, there is currently a lack of understanding of the molecular mechanisms by which their signaling modulates keratinocyte function. Here, we show that δ-opioid receptor (DOPr) activation inhibits proliferation of human keratinocytes, resulting in decreased epidermal thickness in an organotypic skin model. DOPr signaling markedly delayed induction of keratin intermediate filament (KRT10) during in vitro differentiation and abolished its induction in the organotypic skin model. This was accompanied by deregulation of involucrin (IVL), loricrin, and filaggrin. Analysis of the transcription factor POU2F3, which is involved in regulation of KRT10, IVL, and profilaggrin expression, revealed a DOPr-mediated extracellular signal-regulated kinase (ERK)-dependent downregulation of this factor. We propose that DOPr signaling specifically activates the ERK 1/2 mitogen-activated protein kinase pathway to regulate keratinocyte functions. Complementing our earlier studies in DOPr-deficient mice, these data suggest that DOPr activation in human keratinocytes profoundly influences epidermal morphogenesis and homeostasis. PMID:25178105

  7. CRM1 and chromosomal passenger complex component survivin are essential to normal mitosis progress and to preserve keratinocytes from mitotic abnormalities.

    Science.gov (United States)

    Labarrade, F; Botto, J-M; Domloge, N

    2016-10-01

    Human epidermis provides the body a barrier against environmental assaults. To assume this function, the epidermis needs the renewal of keratinocytes allowed by constant mitosis, which replace the exfoliating corneocytes. Keratinocyte stem cells (KSCs) located in the basal epidermis are mitotically active, self-renewing and govern the epithelial stratification by producing renewed source of keratinocytes. Protein complex such as the chromosomal passenger complex (CPC) allows the correct development of this process. The CPC is composed of four members: INCENP, survivin, borealin and aurora kinase B, and the disruption of the CPC during cell division induces mitotic spindle defects and improper repartition of chromosomes. The aim of our study was to investigate the implication of CRM1 and survivin in the progress of mitosis in skin keratinocytes. Cultured human keratinocytes and skin biopsies were used in this study. KSCs-enriched population of keratinocytes was isolated from total keratinocytes by differential attachment to a type IV collagen matrix. Survivin and CRM1 expression levels were assessed by immunofluorescence and immunoblotting. Specific siRNAs for each CPC member and for CRM1 were used to determine the relationship between these proteins. Survivin-specific siRNA was used to induce the apparition of mitotic abnormalities in cultured keratinocytes. We demonstrated the ability of our compound 'IV08.009' to modulate the expression level of survivin and CRM1 in keratinocytes and in skin biopsies. We observed that members of the CPC are interdependent: siRNA-induced inhibition of one component caused a decrease in the expression of all other CPC members. Downregulation of survivin or CRM1 induced mitotic abnormalities in keratinocytes. However, decreased number of mitotic abnormalities was observed in keratinocytes after 'IV08.009' application. Basal keratinocytes may divide frequently during skin lifespan, and signs of deterioration could appear such as loss

  8. Ultrastructural evaluation of human keratinocyte growth and differentiation on a fibrin substrate Avaliação ultraestrutural do crescimento e da diferenciação de queratinócitos sobre um substrato de fibrina

    Directory of Open Access Journals (Sweden)

    Daniela Yukie Sakai Tanikawa

    2010-12-01

    Full Text Available PURPOSE: In order to circumvent several difficulties that have been met in the routine use of the in vitro keratinocyte cultures using the standard procedure described by Rheinwald and Green, and obtain a more resilient and the least possible immunogeneic skin substitute for a future clinical application, this work studied a new keratinocyte culture system, which envisages the utilization of a fibrin substrate in association with high densities of human keratinocytes. METHODS: Through light and transmission electron microscopy and immunohistochemical assays, long-term proliferative and differentiative characteristics of keratinocytes cultured onto a fibrin gel under immerse and air-liquid interface culture conditions were evaluated. RESULTS: Despite the absence of a dermal substitute, the results demonstrated that the proposed composite was constituted of a transparent and elastic fibrin film covered by a well-attached, multistratified epithelium with morphological characteristics that resemble human epidermis, including the neoformation, albeit incomplete, of the basement membrane. CONCLUSIONS: Increased mechanical resistance due to the presence of an easy handling substrate, the delivery of nonclonfluent keratinocytes as well as the removal of animal-derived cells from the culture system suggest its potential use for future transplantation purposes.OBJETIVO: Com o intuito de contornar diversas dificuldades encontradas no uso rotineiro de queratinócitos cultivados in vitro pela técnica descrita por Rheinwald e Green, e obter um substituto cutâneo mais resistente e o menos imunogênico possível para futuras aplicações clínicas, este trabalho avaliou um novo sistema de cultura de queratinócitos que prevê a utilização de um substrato de fibrina em associação com queratinócitos humanos em alta densidade. MÉTODOS: Através de microscopia óptica e eletrônica e análise imunohistoquímica, foram avaliadas as caracter

  9. The NF2 tumor suppressor, Merlin, regulates epidermal development through the establishment of a junctional polarity complex.

    Science.gov (United States)

    Gladden, Andrew B; Hebert, Alan M; Schneeberger, Eveline E; McClatchey, Andrea I

    2010-11-16

    The neurofibromatosis type 2 (NF2) tumor suppressor, Merlin, is a FERM (Four point one, Ezrin, Radixin, Moesin) domain-containing protein whose loss results in defective morphogenesis and tumorigenesis in multiple tissues. Like the closely related ERM proteins (Ezrin, Radixin, and Moesin), Merlin may organize the plasma membrane by assembling membrane protein complexes and linking them to the cortical actin cytoskeleton. We previously found that Merlin is a critical mediator of contact-dependent inhibition of proliferation and is required for the establishment of stable adherens junctions (AJs) in cultured cells. Here, we delineate the molecular function of Merlin in AJ establishment in epidermal keratinocytes in vitro and confirm that a role in AJ establishment is an essential function of Merlin in vivo. Our studies reveal that Merlin can associate directly with α-catenin and link it to Par3, thereby providing an essential link between the AJ and the Par3 polarity complex during junctional maturation. Copyright © 2010 Elsevier Inc. All rights reserved.

  10. Lysyl Hydroxylase 3 Localizes to Epidermal Basement Membrane and Is Reduced in Patients with Recessive Dystrophic Epidermolysis Bullosa.

    Directory of Open Access Journals (Sweden)

    Stephen A Watt

    Full Text Available Recessive dystrophic epidermolysis bullosa (RDEB is caused by mutations in COL7A1 resulting in reduced or absent type VII collagen, aberrant anchoring fibril formation and subsequent dermal-epidermal fragility. Here, we identify a significant decrease in PLOD3 expression and its encoded protein, the collagen modifying enzyme lysyl hydroxylase 3 (LH3, in RDEB. We show abundant LH3 localising to the basement membrane in normal skin which is severely depleted in RDEB patient skin. We demonstrate expression is in-part regulated by endogenous type VII collagen and that, in agreement with previous studies, even small reductions in LH3 expression lead to significantly less secreted LH3 protein. Exogenous type VII collagen did not alter LH3 expression in cultured RDEB keratinocytes and we show that RDEB patients receiving bone marrow transplantation who demonstrate significant increase in type VII collagen do not show increased levels of LH3 at the basement membrane. Our data report a direct link between LH3 and endogenous type VII collagen expression concluding that reduction of LH3 at the basement membrane in patients with RDEB will likely have significant implications for disease progression and therapeutic intervention.

  11. Dual role of Act1 in keratinocyte differentiation and host defense: TRAF3IP2 silencing alters keratinocyte differentiation while inhibiting IL-17 responses

    Science.gov (United States)

    Lambert, Sylviane; Swindell, William R.; Tsoi, Lam C.; Stoll, Stefan W.; Elder, James T.

    2017-01-01

    TRAF3IP2 is a candidate psoriasis susceptibility gene encoding Act1, an adaptor protein with ubiquitin ligase activity that couples the IL-17 receptor to downstream signaling pathways. We investigated the role of Act1 in keratinocyte responses to IL-17 using a tetracycline inducible shRNA targeting TRAF3IP2. Tet exposure for seven days effectively silenced TRAF3IP2 mRNA and Act1 protein, resulting in 761 genes with significant changes in expression (495 down, 266 up, >1.5-fold, pKRT1, KRT10, DSC1, DSG1) being downregulated and late differentiation genes (SPRR2, SPRR3, LCE3) being upregulated. AP1 binding sites were enriched upstream of genes up-regulated by TRAF3IP2 silencing. Correspondingly, nuclear expression of FosB and Fra1 was increased in TRAF3IP2-silenced cells. Many genes involved in host defense were induced by IL-17 in a TRAF3IP2-dependent fashion. Inflammatory differentiation conditions (serum addition for 4 days postconfluence) markedly amplified these IL-17 responses, while increasing basal levels and TRAF3IP2 silencing-dependent upregulation of multiple late differentiation genes. These findings suggest that TRAF3IP2 may alter both epidermal homeostasis and keratinocyte defense responses to influence psoriasis risk. PMID:28274739

  12. Dual Role of Act1 in Keratinocyte Differentiation and Host Defense: TRAF3IP2 Silencing Alters Keratinocyte Differentiation and Inhibits IL-17 Responses.

    Science.gov (United States)

    Lambert, Sylviane; Swindell, William R; Tsoi, Lam C; Stoll, Stefan W; Elder, James T

    2017-07-01

    TRAF3IP2 is a candidate psoriasis susceptibility gene encoding Act1, an adaptor protein with ubiquitin ligase activity that couples the IL-17 receptor to downstream signaling pathways. We investigated the role of Act1 in keratinocyte responses to IL-17 using a tetracycline inducible short hairpin RNA targeting TRAF3IP2. Tetracycline exposure for 7 days effectively silenced TRAF3IP2 mRNA and Act1 protein, resulting in 761 genes with significant changes in expression (495 down, 266 up; >1.5-fold, P KRT1, KRT10, DSC1, DSG1) being down-regulated and late differentiation genes (SPRR2, SPRR3, LCE3) being up-regulated. AP1 binding sites were enriched upstream of genes up-regulated by TRAF3IP2 silencing. Correspondingly, nuclear expression of FosB and Fra1 was increased in TRAF3IP2-silenced cells. Many genes involved in host defense were induced by IL-17 in a TRAF3IP2-dependent fashion. Inflammatory differentiation conditions (serum addition for 4 days postconfluence) markedly amplified these IL-17 responses and increased basal levels and TRAF3IP2 silencing-dependent up-regulation of multiple late differentiation genes. These findings suggest that TRAF3IP2 may alter both epidermal homeostasis and keratinocyte defense responses to influence psoriasis risk. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. The role of oncogenic Ras in human skin tumorigenesis depends on the clonogenic potential of the founding keratinocytes.

    Science.gov (United States)

    Maurelli, Riccardo; Tinaburri, Lavinia; Gangi, Fabio; Bondanza, Sergio; Severi, Anna Lisa; Scarponi, Claudia; Albanesi, Cristina; Mesiti, Giuseppe; Guerra, Liliana; Capogrossi, Maurizio C; Dellambra, Elena

    2016-03-01

    The role of Ras in human skin tumorigenesis induction is still ambiguous. Overexpression of oncogenic Ras causes premature senescence in cultured human cells and hyperplasia in transgenic mice. Here, we investigated whether the oncogenic insult outcome might depend on the nature of the founding keratinocyte. We demonstrate that overexpression of the constitutively active Ras-V12 induces senescence in primary human keratinocyte cultures, but that some cells escape senescence and proliferate indefinitely. Ras overexpression in transient-amplifying- or stem-cell-enriched cultures shows that p16 (encoded by CDKN2A) levels are crucial for the final result. Indeed, transient-amplifying keratinocytes expressing high levels of p16 are sensitive to Ras-V12-induced senescence, whereas cells with high proliferative potential, but that do not display p16, are resistant. The subpopulation that sustains the indefinite culture growth exhibits stem cell features. Bypass of senescence correlates with inhibition of the pRb (also known as RB1) pathway and resumption of telomerase reverse transcriptase (TERT) activity. Immortalization is also sustained by activation of the ERK1 and ERK2 (ERK1/2, also known as MAPK3 and MAPK1) and Akt pathways. Moreover, only transduced cultures originating from cultures bearing stem cells induce tumors in nude mice. Our findings demonstrate that the Ras overexpression outcome depends on the clonogenic potential of the recipient keratinocyte and that only the stem cell compartment is competent to initiate tumorigenesis. © 2016. Published by The Company of Biologists Ltd.

  14. Decreased Migration of Langerhans Precursor-Like Cells in Response to Human Keratinocytes Expressing HPV-16 E6/E7 is Related to Reduced Macrophage Inflammatory Protein-3Alpha Production

    Science.gov (United States)

    2005-01-01

    keratinocytes and its role in atopic dermatitis . Int Immunol 13:95-103. 47. Pahl, H. L. 1999. Activators and target genes of Rel/NF-kappaB transcription...neonatal foreskins and cultured in EpiLife medium supplemented with human keratinocyte growth supplement (bovine pituitary extract , bovine insulin...were cultured in EpiLife medium supplemented without bovine pituitary extract and hydrocortisone (hereafter called minimal EpiLife) when culture

  15. Auto- and cross-induction within the mammalian epidermal growth factor-related peptide family.

    Science.gov (United States)

    Barnard, J A; Graves-Deal, R; Pittelkow, M R; DuBois, R; Cook, P; Ramsey, G W; Bishop, P R; Damstrup, L; Coffey, R J

    1994-09-09

    Several polypeptide growth factors related to epidermal growth factor (EGF) have been identified recently, including transforming growth factor-alpha (TGF-alpha), amphiregulin (AR), heparin-binding EGF-like growth factor (HB-EGF), and betacellulin (BTC). These peptides all bind to the EGF receptor (EGFr). In an effort to understand redundancy within this peptide family and interactions among these related peptides, we compared the biological activities of EGF, TGF-alpha, AR, and HB-EGF in an EGF-responsive, nontransformed intestinal epithelial line (RIE-1) and also determined the effect of individual EGF-related peptides on the expression of related family members in these cells. TGF-alpha, AR, HB-EGF, and EGF were equipotent in stimulating [3H]thymidine incorporation by RIE-1 cells and bound the EGFr with equivalent affinity. Each EGF-related peptide induced the mRNA expression of the remaining family members, including BTC. HB-EGF and AR mRNAs were induced rapidly (within 30 min) and to a greater extent than TGF-alpha and BTC mRNAs, suggesting heterogeneity in the molecular mechanisms for induction. This same pattern was observed for all EGF-related peptides tested. A similar pattern of mRNA induction was observed in secondary cultures of human keratinocytes and in LIM1215 colon adenocarcinoma cells. Nuclear run-on analysis showed that induction of AR and HB-EGF is, at least in part, regulated at the level of gene transcription. Concurrent treatment with HB-EGF and cycloheximide resulted in superinduction of HB-EGF and AR, suggesting that these peptides are immediate early genes in RIE-1 cells. Our results demonstrate an equivalent biological response to EGF-related peptides in RIE-1 cells and further indicate that extensive auto-induction and cross-induction occur within the EGF-related peptide family in several EGF-responsive epithelial cell types.

  16. Immune sensitization against epidermal antigens in polymorphous light eruption

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B. (Univ. of San Luis Potosi (Mexico))

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption.

  17. Epidermal Healing in Burns: Autologous Keratinocyte Transplantation as a Standard Procedure: Update and Perspective

    Directory of Open Access Journals (Sweden)

    Jiad N. Mcheik, MD, PhD

    2014-09-01

    Conclusions: Cell suspensions transplanted directly to the wound is an attractive process, removing the need for attachment to a membrane before transfer and avoiding one potential source of inefficiency. Choosing an optimal donor site containing cells with high proliferative capacity is essential for graft success in burns.

  18. Candida albicans phospholipomannan triggers inflammatory responses of human keratinocytes through Toll-like receptor 2.

    Science.gov (United States)

    Li, Min; Chen, Qing; Shen, Yongnian; Liu, Weida

    2009-07-01

    The Toll-like receptors (TLRs) play an important role in the recognition of Candida albicans components and activation of innate immunity. Phospholipomannan (PLM), a glycolipid, is expressed at the surface of C. albicans cell wall, which acts as a member of the pathogen-associated molecular patterns family. In this study, we sought to clarify whether C. albicans-native PLM could induce an inflammation response in human keratinocytes and to determine the underlying mechanisms. Exposure of cultured human primary keratinocytes to PLM led to the increased gene expression and secretion of proinflammatory cytokines (IL-6) and chemokines (IL-8). PLM hydrolysed with beta-d-mannoside mannohydrolase failed to induce gene expression and secretion of IL-6 and IL-8. PLM up-regulated the mRNA and protein levels of TLR2, whereas the mRNA level of TLR4 was not altered. Keratinocytes challenged with PLM resulted in the activation of NF-kappaB and mitogen-activated protein kinase (MAPKs) including p38. Anti-TLR2 neutralizing antibody, NFkappaB and p38MAPK inhibitors blocked the PLM-induced secretion of IL-6, IL-8 in keratinocytes, but no such effect was observed in pretreatment with anti-TLR4-neutralizing antibody and lipopolysaccharide inhibitor (polymyxin B). These data suggest C. albicans-native PLM may contribute to the inflammatory responses of cutaneous candidiasis in the TLR2-NF-kappaB and p38MAPK signalling pathway dependent manner.

  19. miR-155 promotes cutaneous wound healing through enhanced keratinocytes migration by MMP-2.

    Science.gov (United States)

    Yang, Longlong; Zheng, Zhao; Zhou, Qin; Bai, Xiaozhi; Fan, Lei; Yang, Chen; Su, Linlin; Hu, Dahai

    2017-04-01

    Inflammation, re-epithelization and tissue remodeling are three essential steps during wound healing. The re-epithelization process plays the most important role which mainly involves keratinocyte proliferation and migration. miR-155 has been reported to participate in cell migration and transformation, however, its function in skin wound healing is largely unknown. Here we hypothesize that overexpression of miR-155 at wound edges could accelerate wound healing mediated by enhanced keratinocyte migration. To test this hypothesis, direct local injection of miR-155 expression plasmid to wound edges was conducted to overexpress miR-155 in vivo. Results shown that miR-155 significantly promoted wound healing and re-epithelization compared to control, while did not affect wound contraction. Also, miR-155 overexpression accelerated primarily cultured keratinocyte migration in vitro, but had no effect on cell proliferation. Importantly, western blot analysis shown that MMP-2 was significantly upregulated whiles its inhibitor TIMP-1 downregulated after miR-155 treatment. Moreover, the use of ARP-101, an MMP-2 inhibitor, effectively attenuated the accelerative effects on cell migration induced by miR-155. Taken together, our results suggest that miR-155 has the promote effect on wound healing that is probably mediated by accelerating keratinocyte migration via upregulated MMP-2 level. This study provides a rationale for the therapeutic effect of miR-155 on wound healing.

  20. Current evidence of epidermal barrier dysfunction and thymic stromal lymphopoietin in the atopic march

    Directory of Open Access Journals (Sweden)

    Mei Li

    2014-09-01

    Full Text Available It has long been observed that the development of asthma, allergic rhinitis and food allergy are frequently preceded by atopic dermatitis, a phenomenon known as the “atopic march”. Clinical, genetic and experimental studies have supported the fact that atopic dermatitis could be the initial step of the atopic march, leading to the subsequent development of other atopic diseases. This brief review will focus on the current evidence showing that epidermal barrier dysfunction and the keratinocyte-derived cytokine thymic stromal lymphopoietin play critical roles in the onset of the atopic march.

  1. Long-range enhancer associated with chromatin looping allows AP-1 regulation of the peptidylarginine deiminase 3 gene in differentiated keratinocyte.

    Directory of Open Access Journals (Sweden)

    Stéphane Chavanas

    Full Text Available Transcription control at a distance is a critical mechanism, particularly for contiguous genes. The peptidylarginine deiminases (PADs catalyse the conversion of protein-bound arginine into citrulline (deimination, a critical reaction in the pathophysiology of multiple sclerosis, Alzheimer's disease and rheumatoid arthritis, and in the metabolism of the major epidermal barrier protein filaggrin, a strong predisposing factor for atopic dermatitis. PADs are encoded by 5 clustered PADI genes (1p35-6. Unclear are the mechanisms controlling the expression of the gene PADI3 encoding the PAD3 isoform, a strong candidate for the deimination of filaggrin in the terminally differentiating epidermal keratinocyte. We describe the first PAD Intergenic Enhancer (PIE, an evolutionary conserved non coding segment located 86-kb from the PADI3 promoter. PIE is a strong enhancer of the PADI3 promoter in Ca2+-differentiated epidermal keratinocytes, and requires bound AP-1 factors, namely c-Jun and c-Fos. As compared to proliferative keratinocytes, calcium stimulation specifically associates with increased local DNase I hypersensitivity around PIE, and increased physical proximity of PIE and PADI3 as assessed by Chromosome Conformation Capture. The specific AP-1 inhibitor nordihydroguaiaretic acid suppresses the calcium-induced increase of PADI3 mRNA levels in keratinocytes. Our findings pave the way to the exploration of deimination control during tumorigenesis and wound healing, two conditions for which AP-1 factors are critical, and disclose that long-range transcription control has a role in the regulation of the gene PADI3. Since invalidation of distant regulators causes a variety of human diseases, PIE results to be a plausible candidate in association studies on deimination-related disorders or atopic disease.

  2. Keratinocyte antiviral response to Poly(dA:dT stimulation and papillomavirus infection in a canine model of X-linked severe combined immunodeficiency.

    Directory of Open Access Journals (Sweden)

    Jennifer A Luff

    Full Text Available X-linked severe combined immunodeficiency (XSCID is caused by a genetic mutation within the common gamma chain (γc, an essential component of the cytokine receptors for interleukin (IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. XSCID patients are most commonly treated with bone marrow transplants (BMT to restore systemic immune function. However, BMT-XSCID humans and dogs remain at an increased risk for development of cutaneous papillomavirus (PV infections and their associated neoplasms, most typically cutaneous papillomas. Since basal keratinocytes are the target cell for the initial PV infection, we wanted to determine if canine XSCID keratinocytes have a diminished antiviral cytokine response to poly(dA:dT and canine papillomavirus-2 (CPV-2 upon initial infection. We performed quantitative RT-PCR for antiviral cytokines and downstream interferon stimulated genes (ISG on poly(dA:dT stimulated and CPV-2 infected monolayer keratinocyte cultures derived from XSCID and normal control dogs. We found that XSCID keratinocytes responded similarly to poly(dA:dT as normal keratinocytes by upregulating antiviral cytokines and ISGs. CPV-2 infection of both XSCID and normal keratinocytes did not result in upregulation of antiviral cytokines or ISGs at 2, 4, or 6 days post infection. These data suggest that the antiviral response to initial PV infection of basal keratinocytes is similar between XSCID and normal patients, and is not the likely source for the remaining immunodeficiency in XSCID patients.

  3. Ratite oils promote keratinocyte cell growth and inhibit leukocyte activation.

    Science.gov (United States)

    Bennett, Darin C; Leung, Gigi; Wang, Eddy; Ma, Sam; Lo, Blanche K K; McElwee, Kevin J; Cheng, Kimberly M

    2015-09-01

    Traditionally, native Australian aborigines have used emu oil for the treatment of inflammation and to accelerate wound healing. Studies on mice suggest that topically applied emu oil may have anti-inflammatory properties and may promote wound healing. We investigated the effects of ratite oils (6 emu, 3 ostrich, 1 rhea) on immortalized human keratinocytes (HaCaT cells) in vitro by culturing the cells in media with oil concentrations of 0%, 0.5%, and 1.0%. Peking duck, tea tree, and olive oils were used as comparative controls. The same oils at 0.5% concentration were evaluated for their influence on peripheral blood mononuclear cell (PBMC) survival over 48 hr and their ability to inhibit IFNγ production in PBMCs activated by phytohemagglutinin (PHA) in ELISpot assays. Compared to no oil control, significantly shorter population doubling time durations were observed for HaCaT cells cultured in emu oil (1.51×faster), ostrich oil (1.46×faster), and rhea oil (1.64×faster). Tea tree oil demonstrated significant antiproliferative activity and olive oil significantly prolonged (1.35×slower) cell population doubling time. In contrast, almost all oils, particularly tea tree oil, significantly reduced PBMC viability. Different oils had different levels of inhibitory effect on IFNγ production with individual emu, ostrich, rhea, and duck oil samples conferring full inhibition. This preliminary investigation suggests that emu oil might promote wound healing by accelerating the growth rate of keratinocytes. Combined with anti-inflammatory properties, ratite oil may serve as a useful component in bandages and ointments for the treatment of wounds and inflammatory skin conditions. © 2015 Poultry Science Association Inc.

  4. Using organotypic (raft) epithelial tissue cultures for the biosynthesis and isolation of infectious human papillomaviruses.

    Science.gov (United States)

    Ozbun, Michelle A; Patterson, Nicole A

    2014-08-01

    Papillomaviruses have a strict tropism for epithelial cells, and they are fully reliant on cellular differentiation for completion of their life cycles, resulting in the production of progeny virions. Thus, a permissive environment for full viral replication in vitro-wherein virion morphogenesis occurs under cooperative viral and cellular cues-requires the cultivation of epithelium. Presented in the first section of this unit is a protocol to grow differentiating epithelial tissues that mimic many important morphological and biochemical aspects of normal skin. The technique involves growing epidermal cells atop a dermal equivalent consisting of live fibroblasts and a collagen lattice. Epithelial stratification and differentiation ensues when the keratinocyte-dermal equivalent is placed at the air-liquid interface. The apparent floating nature of the cell-matrix in this method led to the nickname "raft" cultures. The general technique can be applied to normal low passage keratinocytes, to cells stably transfected with papillomavirus genes or genomes, or keratinocytes established from neoplastic lesions. However, infectious papillomavirus particles have only been isolated from organotypic epithelial cultures initiated with cells that maintain oncogenic human papillomavirus genomes in an extrachomosomal replicative form. The second section of this unit is dedicated to a virion isolation method that minimizes aerosol and skin exposure to these human carcinogens. Although the focus of the protocols is on the growth of tissues that yields infectious papillomavirus progeny, this culture system facilitates the investigation of these fastidious viruses during their complex replicative cycles, and raft tissues can be manipulated and harvested at any point during the process. Importantly, a single-step virus growth cycle is achieved in this process, as it is unlikely that progeny virions are released to initiate subsequent rounds of infection. Copyright © 2014 John Wiley

  5. Nicotinamide inhibits Propionibacterium acnes-induced IL-8 production in keratinocytes through the NF-kappaB and MAPK pathways.

    Science.gov (United States)

    Grange, Philippe A; Raingeaud, Joël; Calvez, Vincent; Dupin, Nicolas

    2009-11-01

    Propionibacterium acnes (P. acnes) has been implicated in the inflammatory phase of acne vulgaris. It has been shown to activate interleukin-8 (IL-8) secretion by interacting with Toll-like receptor 2 (TLR-2) on the surface of keratinocytes. Nicotinamide has been shown to be an effective treatment for skin inflammation in various conditions, including acne vulgaris. To investigate the molecular mechanisms underlying the anti-inflammatory properties of nicotinamide in keratinocytes stimulated by P. acnes. HaCaT cells and primary keratinocyte cell lines were stimulated by P. acnes in the presence of nicotinamide. IL-8 production was monitored by ELISA on the cell culture supernatant and by qRT-PCR on total RNA extract. A luciferase reporter system assay was used to assess nicotinamide activity with the IL-8 promoter in transfected keratinocytes. We used western blotting to analyze the effect of nicotinamide on activation of the NF-kappaB and MAPK pathways. Nicotinamide significantly decreased IL-8 production in a dose-dependent manner, decreasing both mRNA and protein levels for this chemokine in immortalized HaCaT cells and primary keratinocytes. P. acnes-induced IL-8 promoter activation seemed to be downregulated by nicotinamide, which inhibited IkappaB degradation and the phosphorylation of ERK and JNK MAP kinases. Our results indicate that nicotinamide inhibits IL-8 production through the NF-kappaB and MAPK pathways in an in vitro keratinocytes/P. acnes model of inflammation. Keratinocytes involved in the innate immune response may be a suitable target for treatment during the early phase of inflammation.

  6. Cdc42 expression in keratinocytes is required for the maintenance of the basement membrane in skin

    DEFF Research Database (Denmark)

    Wu, Xunwei; Quondamatteo, Fabio; Brakebusch, Cord

    2006-01-01

    Cdc42 is a small GTPase, which acts as a molecular switch to regulate a wide variety of cellular functions, such as actin cytoskeleton organization, cell proliferation, apoptosis, cell migration and in particular, cell polarity. Formation and maintenance of the basement membrane is a polarized...... process, which requires directed secretion, deposition and organization of basement membrane components at the basal side of epithelial cells. In the current study, we analyzed the maintenance of skin basement membrane in mice with a keratinocyte-restricted deletion of the Cdc42 gene. In the absence...... of Cdc42, basement membrane components became aberrantly deposited and the processing of laminin 5 was impaired in parts of the dermal-epidermal junction. These impairments became more severe with age and corresponded to local defects of the basement membrane in 4.5-month-old mutant mice. However, both...

  7. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  8. Distinct functions of epidermal and myeloid-derived VEGF-A in skin tumorigenesis mediated by HPV8.

    Science.gov (United States)

    Ding, Xiaolei; Lucas, Tina; Marcuzzi, Gian P; Pfister, Herbert; Eming, Sabine A

    2015-01-15

    Beta human papillomaviruses (HPV) have been suspected to be carcinogenic in nonmelanoma skin cancers (NMSC), but the basis for potential viral contributions to these cancers is poorly understood. In particular, it is unresolved how HPV-infected keratinocytes escape cell-cycle control and whether their cross-talk with immune cells is critical for tumorigenesis. In nonviral preclinical models, the angiogenic cytokine VEGF-A has been identified as a critical regulator of NMSC. In this study, we dissected the contribution of epidermal versus myeloid cell-derived VEGF-A in HPV-mediated skin cancer by interbreeding an HPV8 transgenic mouse model with a conditional disruption of VEGF-A restricted to either epidermal or myeloid cells. Although only epidermal-derived VEGF-A was essential for initiation of skin tumor development, both spontaneously and UV-light triggered, both epidermal and myeloid cell-derived VEGF-A contributed to regeneration-induced tumorigenesis upon HPV8 overexpression, partly not only through a paracrine effect on endothelial cells, but also most probably through an additional autocrine effect on epidermal cells. Our findings offer new mechanistic insights into distinct functions of epidermal versus myeloid cell-derived VEGF-A during HPV-mediated tumorigenesis, with possible implications for preventing this disease. ©2014 American Association for Cancer Research.

  9. Anomalous features of EMT during keratinocyte transformation.

    Directory of Open Access Journals (Sweden)

    Tamar Geiger

    Full Text Available During the evolution of epithelial cancers, cells often lose their characteristic features and acquire a mesenchymal phenotype, in a process known as epithelial-mesenchymal transition (EMT. In the present study we followed early stages of keratinocyte transformation by HPV16, and observed diverse cellular changes, associated with EMT. We compared primary keratinocytes with early and late passages of HF1 cells, a cell line of HPV16-transformed keratinocytes. We have previously shown that during the progression from the normal cells to early HF1 cells, immortalization is acquired, while in the progression to late HF1, cells become anchorage independent. We show here that during the transition from the normal state to late HF1 cells, there is a progressive reduction in cytokeratin expression, desmosome formation, adherens junctions and focal adhesions, ultimately leading to poorly adhesive phenotype, which is associated with anchorage-independence. Surprisingly, unlike "conventional EMT", these changes are associated with reduced Rac1-dependent cell migration. We monitored reduced Rac1-dependent migration also in the cervical cancer cell line SiHa. Therefore we can conclude that up to the stage of tumor formation migratory activity is eliminated.

  10. In vitro effects of fungi isolated from equine hooves on primary human keratinocytes.

    Science.gov (United States)

    Apprich, Veronika; Spergser, Joachim; Rosengarten, Renate; Stanek, Christian

    2006-12-01

    The effects of two dermatophytes (Microsporum gypseum and Trichophyton mentagrophytes) and four moulds (Scopulariopsis brevicaulis, Alternaria alternata, Geotrichum candidum and Penicillium spp.) on living keratinocyte cultures were examined in vitro using primary human keratinocytes. Rates of apoptosis of infected cells were determined using a colorimetric TUNEL system which detects the characteristic nuclear DNA fragmentation of apoptotic cells. The cytotoxicity of the individual fungi was tested by quantitatively measuring cytosolic enzyme lactate dehydrogenase, released upon cell lysis, in culture supernatants. Additionally, the cell structures within the infected keratinocytes in cultures were examined by scanning electron microscopy. All of the fungi exhibited high cytotoxicity, whereas the development of only the two dermatophytes and the mould Scopulariopsis brevicaulis resulted in distinctly increased apoptosis. Electron microscopy showed that all fungi studied caused similar alterations in the cell structure, with Microsporum gypseum being the most harmful. Increasing loss of cell adhesion as a consequence of a decreasing number of reticulating cell appendices and a reduced cell plasticity were the most evident alterations.

  11. Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells

    Directory of Open Access Journals (Sweden)

    Giacaman Rodrigo A

    2008-07-01

    Full Text Available Abstract Background Oral keratinocytes on the mucosal surface are frequently exposed to HIV-1 through contact with infected sexual partners or nursing mothers. To determine the plausibility that oral keratinocytes are primary targets of HIV-1, we tested the hypothesis that HIV-1 infects oral keratinocytes in a restricted manner. Results To study the fate of HIV-1, immortalized oral keratinocytes (OKF6/TERT-2; TERT-2 cells were characterized for the fate of HIV-specific RNA and DNA. At 6 h post inoculation with X4 or R5-tropic HIV-1, HIV-1gag RNA was detected maximally within TERT-2 cells. Reverse transcriptase activity in TERT-2 cells was confirmed by VSV-G-mediated infection with HIV-NL4-3Δenv-EGFP. AZT inhibited EGFP expression in a dose-dependent manner, suggesting that viral replication can be supported if receptors are bypassed. Within 3 h post inoculation, integrated HIV-1 DNA was detected in TERT-2 cell nuclei and persisted after subculture. Multiply spliced and unspliced HIV-1 mRNAs were not detectable up to 72 h post inoculation, suggesting that HIV replication may abort and that infection is non-productive. Within 48 h post inoculation, however, virus harbored by CD4 negative TERT-2 cells trans infected co-cultured peripheral blood mononuclear cells (PBMCs or MOLT4 cells (CD4+ CCR5+ by direct cell-to-cell transfer or by releasing low levels of infectious virions. Primary tonsil epithelial cells also trans infected HIV-1 to permissive cells in a donor-specific manner. Conclusion Oral keratinocytes appear, therefore, to support stable non-replicative integration, while harboring and transmitting infectious X4- or R5-tropic HIV-1 to permissive cells for up to 48 h.

  12. Distinct Impact of Two Keratin Mutations Causing Epidermolysis Bullosa Simplex on Keratinocyte Adhesion and Stiffness.

    Science.gov (United States)

    Homberg, Melanie; Ramms, Lena; Schwarz, Nicole; Dreissen, Georg; Leube, Rudolf E; Merkel, Rudolf; Hoffmann, Bernd; Magin, Thomas M

    2015-10-01

    Keratin filaments constitute the major component of the epidermal cytoskeleton from heterodimers of type I and type II keratin subunits. Missense mutations in keratin 5 or keratin 14, highly expressed in the basal epidermis, cause the severe skin blistering disease epidermolysis bullosa simplex (EBS) in humans by rendering the keratin cytoskeleton sensitive to mechanical stress; yet, the mechanisms by which individual mutations cause cell fragility are incompletely understood. Here, we compared the K14p.Arg125Pro with the K5p.Glu477Asp mutation, both giving rise to severe generalized EBS, by stable expression in keratin-free keratinocytes. This revealed distinctly different effects on keratin cytoskeletal organization, in agreement with in vivo observations, thus validating the cell system. Although the K14p.Arg125Pro mutation led to impaired desmosomes, downregulation of desmosomal proteins, and weakened epithelial sheet integrity upon shear stress, the K5p.Glu477Asp mutation did not impair these functions, although causing EBS with squamous cell carcinoma in vivo. Atomic force microscopy demonstrated that K14 mutant cells were even less resistant against deformation compared with keratin-free keratinocytes. Thus, a keratin mutation causing EBS compromises cell stiffness to a greater extent than the lack of keratins. Finally, re-expression of K14 in K14 mutant cells did not rescue the above defects. Collectively, our findings have implications for EBS therapy approaches.

  13. Foxn1 promotes keratinocyte differentiation by regulating the activity of protein kinase C.

    Science.gov (United States)

    Li, Jian; Baxter, Ruth M; Weiner, Lorin; Goetinck, Paul F; Calautti, Enzo; Brissette, Janice L

    2007-10-01

    The transcription factor Foxn1 (the product of the nude locus) promotes the terminal differentiation of epithelial cells in the epidermis and hair follicles. Activated early in terminal differentiation, Foxn1 can modulate the timing or order of trait acquisition, as it induces early features of epidermal differentiation while suppressing late features. Here, we identify protein kinase C (PKC) as a key target of Foxn1 in keratinocyte differentiation control. Foxn1 has broad negative effects on the PKC family, as the loss of Foxn1 function leads to higher levels of total, primed, and activated PKC. Phosphorylated PKC substrates (the mediators of PKC function) rise when Foxn1 is inactivated and fall when Foxn1 is overproduced, suggesting that Foxn1 antagonizes PKC's effects. When PKC inhibitors are applied to nude (Foxn1 null) keratinocytes, nude defects are normalized or suppressed, as the inhibitors prevent nude cells from underproducing early differentiation markers and overproducing late markers. Taken together, the results suggest that Foxn1 acts as a restraint or brake on PKC signaling and that without this brake PKC disrupts differentiation. The results further suggest that Foxn1 modulates stage-specific markers by modulating PKC activity, providing control over the timing of steps in the differentiation program.

  14. Traceless Targeting and Isolation of Gene-Edited Immortalized Keratinocytes from Epidermolysis Bullosa Simplex Patients

    Directory of Open Access Journals (Sweden)

    Magomet Aushev

    2017-09-01

    Full Text Available Epidermolysis bullosa simplex (EBS is a blistering skin disease caused by dominant-negative mutations in either KRT5 or KRT14, resulting in impairment of keratin filament structure and epidermal fragility. Currently, nearly 200 mutations distributed across the entire length of these genes are known to cause EBS. Genome editing using programmable nucleases enables the development of ex vivo gene therapies for dominant-negative genetic diseases. A clinically feasible strategy involves the disruption of the mutant allele while leaving the wild-type allele unaffected. Our aim was to develop a traceless approach to efficiently disrupt KRT5 alleles using TALENs displaying unbiased monoallelic disruption events and devise a strategy that allows for subsequent screening and isolation of correctly modified keratinocyte clones without the need for selection markers. Here we report on TALENs that efficiently disrupt the KRT5 locus in immortalized patient-derived EBS keratinocytes. Inactivation of the mutant allele using a TALEN working at sub-optimal levels resulted in restoration of intermediate filament architecture. This approach can be used for the functional inactivation of any mutant keratin allele regardless of the position of the mutation within the gene and is furthermore applicable to the treatment of other inherited skin disorders.

  15. Accumulation and activation of epidermal γδ T cells in a mouse model of chronic dermatitis is not required for the inflammatory phenotype.

    Science.gov (United States)

    Sulcova, Jitka; Maddaluno, Luigi; Meyer, Michael; Werner, Sabine

    2015-09-01

    Chronic skin inflammation resulting from a defective epidermal barrier is a hallmark of atopic dermatitis (AD). We previously demonstrated that mice lacking FGF receptors 1 and 2 in keratinocytes (K5-R1/R2 mice) develop an AD-like chronic dermatitis as a result of an impaired epidermal barrier. Here, we show that γδ T cells, which rapidly respond to various insults, accumulate in the epidermis of K5-R1/R2 mice before the development of histological abnormalities. Their number and activation further increase as the phenotype progresses, most likely as a consequence of increased expression of Il-2 and Il-7 and the stress-induced proteins Rae-1, H60c, Mult1, PlexinB2, and Skint1. To determine the role of γδ T cells in the skin phenotype, we generated quadruple mutant K5-R1/-R2 mice lacking γδ T cells. Surprisingly, loss of γδ T cells did not or only marginally affect keratinocyte proliferation, epidermal thickness, epidermal barrier function, and accumulation and activation of different immune cells in the skin of K5-R1/R2 mice, possibly due to partial compensation by αβ T cells. These results demonstrate that γδ T cells do not contribute to the development or maintenance of chronic inflammation in response to a defect in the epidermal barrier. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Cyclin D1 localizes in the cytoplasm of keratinocytes during skin differentiation and regulates cell–matrix adhesion

    Science.gov (United States)

    Fernández-Hernández, Rita; Rafel, Marta; Fusté, Noel P; Aguayo, Rafael S; Casanova, Josep M; Egea, Joaquim; Ferrezuelo, Francisco; Garí, Eloi

    2013-01-01

    The function of Cyclin D1 (CycD1) has been widely studied in the cell nucleus as a regulatory subunit of the cyclin-dependent kinases Cdk4/6 involved in the control of proliferation and development in mammals. CycD1 has been also localized in the cytoplasm, where its function nevertheless is poorly characterized. In this work we have observed that in normal skin as well as in primary cultures of human keratinocytes, cytoplasmic localization of CycD1 correlated with the degree of differentiation of the keratinocyte. In these conditions, CycD1 co-localized in cytoplasmic foci with exocyst components (Sec6) and regulators (RalA), and with β1 integrin, suggesting a role for CycD1 in the regulation of keratinocyte adhesion during differentiation. Consistent with this hypothesis, CycD1 overexpression increased β1 integrin recycling and drastically reduced the ability of keratinocytes to adhere to the extracellular matrix. We propose that localization of CycD1 in the cytoplasm during skin differentiation could be related to the changes in detachment ability of keratinocytes committed to differentiation. PMID:23839032

  17. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    injection of the human AD skin-derived T cells resulted in migration of the human T cells from subcutis to the papillary dermis followed by development of erythema and edema in the mouse skin. Furthermore, the human T cells induced a transient proliferative response in the mouse keratinocytes shown......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  18. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  19. File list: Oth.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.05.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Epd.05.AllAg.Keratinocytes.bed ...

  20. File list: Oth.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.10.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Epd.10.AllAg.Keratinocytes.bed ...

  1. File list: Unc.Epd.50.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.50.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.50.AllAg.Keratinocytes.bed ...

  2. File list: ALL.Epd.50.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.50.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.50.AllAg.Keratinocytes.bed ...

  3. File list: Unc.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.20.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.20.AllAg.Keratinocytes.bed ...

  4. File list: ALL.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.20.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.20.AllAg.Keratinocytes.bed ...

  5. File list: Unc.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.05.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.05.AllAg.Keratinocytes.bed ...

  6. File list: ALL.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.10.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.10.AllAg.Keratinocytes.bed ...

  7. File list: ALL.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.05.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.05.AllAg.Keratinocytes.bed ...

  8. File list: Unc.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.10.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.10.AllAg.Keratinocytes.bed ...

  9. File list: Oth.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.20.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Epd.20.AllAg.Keratinocytes.bed ...

  10. In vitro assessment of IL-4- or IL-13-mediated changes in the structural components of keratinocytes in mice and humans.

    Science.gov (United States)

    Omori-Miyake, Miyuki; Yamashita, Masakatsu; Tsunemi, Yuichiro; Kawashima, Makoto; Yagi, Junji

    2014-05-01

    T helper type 2 (Th2) cytokines, IL-4 and IL-13, attenuate the expression of genes that regulate epidermal cellular structures and the barrier function at the terminal stage of keratinocyte differentiation. However, whether these Th2 cytokines act at earlier stages remains unknown. We investigated the roles of cytokines in expression levels of mRNAs and/or proteins in primary mouse keratinocytes and human keratinocyte HaCaT cells at earlier stages. We showed that IL-4 downregulated the expression levels of Krt1, Krt10, Dsg1, and Dsc1 via IL-4Rα- and signal transducer and activator of transcription factor 6 (STAT6)-dependent mechanisms in differentiating mouse keratinocytes at early stages. As the expression levels of keratin-1 and -10 in the keratinocytes transiently expressing an active form of STAT6 were not downregulated, STAT6 and other IL-4-induced molecules may synergistically regulate this expression. The restoration of the downregulated expression levels of Krt1 and Krt10 induced by IL-4 with the MEK (mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase kinase) inhibitor U0126 indicated the involvement of the p44/42 MAPK signaling pathway in the attenuated expression. IL-13 also downregulated the expression of the four genes. Furthermore, IL-4 or IL-13 caused the downregulation of these genes in HaCaT cells and promoted the fragmentation of cell sheets with mechanical stress. Our results showed that IL-4 or IL-13 acted on differentiating keratinocytes in vitro at early stages to attenuate the gene expression.

  11. Epidermal changes in human skin following irradiation with either UVB or UVA

    Energy Technology Data Exchange (ETDEWEB)

    Pearse, A.D.; Gaskell, S.A.; Marks, R.

    1987-01-01

    We have demonstrated previously that following UVB irradiation to normal volunteers there is an increase in epidermal and stratum corneum thickness and an increase in the thymidine autoradiographic labeling index. These changes are coupled with alterations in epidermal glucose-6-phosphate dehydrogenase and succinic dehydrogenase activities, despite the absence of erythema clinically. The use of a sunscreen did not completely prevent these changes. In this study, we have examined the effects of repeated irradiation of human skin with either UVB or UVA alone in order to compare the changes produced in the epidermis and to ascertain whether UVA irradiation could cause these. Irradiation with either UVB or UVA alone was found to increase the mean epidermal thickness, the mean stratum corneum thickness, and mean keratinocyte height significantly. Glucose-6-phosphate dehydrogenase activity was significantly increased throughout the epidermis, and succinic dehydrogenase activity was significantly decreased. The autoradiographic labeling index was significantly increased following UVB irradiation but not following UVA irradiation. These results demonstrate that UVA alone can have a direct effect on epidermal morphology and metabolism, suggesting that protection of skin from UV radiation should include adequate protection from UVA.

  12. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    Energy Technology Data Exchange (ETDEWEB)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Elmets, Craig A. [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)

    2014-08-29

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34{sup +}/K15{sup +}/p63{sup +} keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in

  13. Layer-by-Layer Thin Films for Co-Delivery of TGF-β siRNA and Epidermal Growth Factor to Improve Excisional Wound Healing.

    Science.gov (United States)

    Mandapalli, Praveen Kumar; Labala, Suman; Jose, Anup; Bhatnagar, Shubhmita; Janupally, Renuka; Sriram, Dharmarajan; Venuganti, Venkata Vamsi Krishna

    2017-04-01

    The major challenge with treatment of dermal wounds is accelerating healing process, while preventing the scar formation. Herein, we have fabricated layer-by-layer (LbL) polyelectrolyte multilayer films containing epidermal growth factor (EGF) and TGF-β siRNA to improve excisional wound healing and decrease scar formation. The chitosan and sodium alginate LbL thin films showed 13.0 MPa tensile strength and 2.22 N/cm 2 skin adhesion strength. The LbL thin films were found to be cytocompatible, where A431 epidermal keratinocytes adhered to the film and showed 86.2 ± 0.8% cell growth compared with cells cultured in the absence of LbL thin film. In contrast, LbL thin film did not promote the Escherichia coli and Staphylococcus aureus bacterial colony formation. In a C57BL/6 mouse excisional wound model, application of LbL thin films containing TGF-β siRNA significantly (p < 0.05) reduced the TGF-β protein expression and collagen production. The LbL thin films containing EGF showed improved wound contraction (<9 days post excision). The co-delivery of TGF-β siRNA and EGF using LbL thin films resulted in accelerated wound healing and decreased collagen deposition. Furthermore, the LbL thin films with TGF-β siRNA and EGF combination showed greater reepithelialization. Taken together, we have successfully demonstrated the co-delivery of TGF-β siRNA and EGF peptide using LbL thin films to promote wound healing and decrease scar formation.

  14. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  15. Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Wen-Hung Chung

    2010-01-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

  16. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  17. FOXM1 allows human keratinocytes to bypass the oncogene-induced differentiation checkpoint in response to gain of MYC or loss of p53.

    Science.gov (United States)

    Molinuevo, R; Freije, A; de Pedro, I; Stoll, S W; Elder, J T; Gandarillas, A

    2017-02-16

    Tumour suppressor p53 or proto-oncogene MYC is frequently altered in squamous carcinomas, but this is insufficient to drive carcinogenesis. We have shown that overactivation of MYC or loss of p53 via DNA damage triggers an anti-oncogenic differentiation-mitosis checkpoint in human epidermal keratinocytes, resulting in impaired cell division and squamous differentiation. Forkhead box M1 (FOXM1) is a transcription factor recently proposed to govern the expression of a set of mitotic genes. Deregulation of FOXM1 occurs in a wide variety of epithelial malignancies. We have ectopically expressed FOXM1 in keratinocytes of the skin after overexpression of MYC or inactivation of endogenous p53. Ectopic FOXM1 rescues the proliferative capacity of MYC- or p53-mutant cells in spite of higher genetic damage and a larger cell size typical of differentiation. As a consequence, differentiation induced by loss of p53 or MYC is converted into increased proliferation and keratinocytes displaying genomic instability are maintained within the proliferative compartment. The results demonstrate that keratinocyte oncogene-induced differentiation is caused by mitosis control and provide new insight into the mechanisms driving malignant progression in squamous cancer.

  18. Keratinocyte transcriptional regulation of the human c-Myc promoter occurs via a novel Lef/Tcf binding element distinct from neoplastic cells.

    Science.gov (United States)

    Kolly, Carine; Zakher, Antony; Strauss, Christian; Suter, Maja M; Müller, Eliane J

    2007-05-15

    The proto-oncogene c-Myc is involved in early neoplastic transformations. Two consensus Lef/Tcf binding elements (TBE) were found to be prerequisite for transcriptional transactivation by the armadillo proteins beta-catenin and plakoglobin (PG) together with Tcf4 in human neoplastic cells. In epidermal keratinocytes, c-Myc was reported to be repressed by Lef-1 and PG. Using reporter gene assays, here we demonstrate that deletion of the two consensus TBE fails to abrogate transcriptional regulation by Lef-1/PG in wildtype and beta-catenin-/- keratinocytes, while it reduces transcription in pre-neoplastic PG-/- keratinocytes. We identified a TBE sequence variant downstream of the major transcriptional initiation site that binds Lef-1 in vitro and in vivo, and its mutation compromised transcriptional regulation by Lef-1/PG. Collectively, this study demonstrates that the two consensus TBE's reported in neoplastic cells are dispensable for c-Myc regulation in normal keratinocytes, which instead use a novel TBE sequence variant. This unprecedented finding may have important implications for armadillo target genes involved in carcinogenesis.

  19. Functional interplay between p63 and p53 controls RUNX1 function in the transition from proliferation to differentiation in human keratinocytes.

    Science.gov (United States)

    Masse, I; Barbollat-Boutrand, L; Molina, M; Berthier-Vergnes, O; Joly-Tonetti, N; Martin, M T; Caron de Fromentel, C; Kanitakis, J; Lamartine, J

    2012-06-07

    The interfollicular epidermis is continuously renewed, thanks to a regulated balance between proliferation and differentiation. The ΔNp63 transcription factor has a key role in the control of this process. It has been shown that ΔNp63 directly regulates Runt-related transcription factor 1 (RUNX1) transcription factor expression in mouse keratinocytes. The present study showed for the first time that RUNX1 is expressed in normal human interfollicular epidermis and that its expression is tightly regulated during the transition from proliferation to differentiation. It demonstrated that ΔNp63 directly binds two different RUNX1 regulatory DNA sequences and modulates RUNX1 expression differentially in proliferative or differentiated human keratinocytes. It also showed that the regulation of RUNX1 expression by ΔNp63 is dependent on p53 and that this coregulation relies on differential binding and activation of RUNX1 regulatory sequences by ΔNp63 and p53. We also found that RUNX1 inhibits keratinocyte proliferation and activates directly the expression of KRT1, a critical actor in early keratinocyte differentiation. Finally, we described that RUNX1 expression, similar to ΔNp63 and p53, was strongly expressed and downregulated in basal cell carcinomas and squamous cell carcinomas respectively. Taken together, these data shed light on the importance of tight control of the functional interplay between ΔNp63 and p53 in regulating RUNX1 transcription factor expression for proper regulation of interfollicular epidermal homeostasis.

  20. Epidermal growth factor causes hypocalcemia in sheep.

    Science.gov (United States)

    Moore, G P; Wilkinson, M; Panaretto, B A; Delbridge, L W; Posen, S

    1986-04-01

    During iv infusions of epidermal growth factor into sheep, serum calcium concentrations fell, whereas serum magnesium and serum immunoreactive PTH levels increased. Urinary calcium and magnesium decreased significantly. The role of epidermal growth factor in calcium homeostasis is discussed.

  1. Langerhans Cells Prevent Autoimmunity via Expansion of Keratinocyte Antigen-Specific Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Daniela Y. Kitashima

    2018-01-01

    Full Text Available Langerhans cells (LCs are antigen-presenting cells in the epidermis whose roles in antigen-specific immune regulation remain incompletely understood. Desmoglein 3 (Dsg3 is a keratinocyte cell-cell adhesion molecule critical for epidermal integrity and an autoantigen in the autoimmune blistering disease pemphigus. Although antibody-mediated disease mechanisms in pemphigus are extensively characterized, the T cell aspect of this autoimmune disease still remains poorly understood. Herein, we utilized a mouse model of CD4+ T cell-mediated autoimmunity against Dsg3 to show that acquisition of Dsg3 and subsequent presentation to T cells by LCs depended on the C-type lectin langerin. The lack of LCs led to enhanced autoimmunity with impaired Dsg3-specific regulatory T cell expansion. LCs expressed the IL-2 receptor complex and the disruption of IL-2 signaling in LCs attenuated LC-mediated regulatory T cell expansion in vitro, demonstrating that direct IL-2 signaling shapes LC function. These data establish that LCs mediate peripheral tolerance against an epidermal autoantigen and point to langerin and IL-2 signaling pathways as attractive targets for achieving tolerogenic responses particularly in autoimmune blistering diseases such as pemphigus.

  2. Typha latifolia L. fruit polysaccharides induce the differentiation and stimulate the proliferation of human keratinocytes in vitro.

    Science.gov (United States)

    Gescher, Kirsten; Deters, Alexandra M

    2011-09-01

    In Northern America Typha latifolia L. (Typhaceae) fruits are used for more than 4000 years for treatment of skin disorders, burns and as wound dressing to absorb the ichors. The following studies attempted to characterize water-soluble polysaccharides from aqueous Typha latifolia extracts and to investigate the influence of the polymers on cell physiology of human dermal fibroblasts (NHDF) and epidermal keratinocytes (NHEK). Water-soluble raw polysaccharides (RPS) were isolated from Typha latifolia fruits and fractionated by anion exchange chromatography (AEC) and size exclusion chromatography (GPC). Fractions obtained were characterized concerning monosaccharide composition by HPAEC-PAD. The bioactivity of the polysaccharides was investigated on cell viability, proliferation, differentiation and gene expression NHDF of NHEK. RPS was fractionated into 5 heterodisperse fractions (TL1-TL5). The polysaccharides were composed mainly of glucose (more than 50% in RPS and TL4), galactose, xylose, mannose, glucuronic acid, galacturonic acid, arabinose, ribose, fucose, rhamnose, and fructose with differing amounts concerning to RPS and AEC-fractions. Proteins were detected in the RPS (10%) and to a less extend in TL1-TL3 (1-3%). TL1-TL3 significantly increased the proliferation of keratinocytes, whereas TL4 was shown to be a potent inductor of the early differentiation process of keratinocytes. Gene expression analysis supported these results since Smad3 and PKC-α, known to be part of signal pathways leading to cell differentiation, were significantly up regulated. Effects on fibroblasts were not observed, indicating cell specific activity of the polysaccharides. The results clearly indicate a rationale for the traditional use of Typha latifolia fruits extracts for wound healing to the strong stimulatory activity of the polysaccharides on keratinocytes proliferation and early differentiation, major activities necessary for potent wound-healing agents. Copyright © 2011

  3. Ultraviolet B radiation down-regulates ULK1 and ATG7 expression and impairs the autophagy response in human keratinocytes.

    Science.gov (United States)

    Chen, Xu; Li, Li; Xu, Song; Bu, Wenbo; Chen, Kun; Li, Min; Gu, Heng

    2017-09-04

    Autophagy is a self-digestive pathway that helps to maintain cellular homeostasis, and many autophagy-related gene (ATG)s involved the regulation of the autophagy process. Ultraviolet light is a common stressor of skin, but it is unclear how autophagy is regulated after ultraviolet exposure in epidermal keratinocytes. Here, we found that the mRNAs of some key ATG genes such as ULK1, ATG5 and ATG7 exhibited significantly lower levels in the skin tissues of the face and chest with solar ultraviolet exposure, compared with perineal skin. Interestingly, UVB radiation down-regulated the expression of ULK1, ATG3 and ATG7, and it inhibited the autophagy flux via a mechanistic target of rapamycin (MTOR)-independent pathway in human keratinocytes. The inhibition of autophagy in UVB-treated keratinocytes cannot be restored by treatment with the MTOR-dependent autophagy inducer rapamycin. Importantly, UVB treatment perturbs the conversion of microtubule-associated protein 1 light chain 3 (LC3)-I to LC3-II and LC3-II turnover in response to treatment with MTOR inhibitors (Torin 1 and pp242), as well as endoplasmic reticular stress (A23187 and tunicamycin), inositol pathway (L690,330) and autophagy inducers (resveratrol and STF62247). Our study demonstrates that UVB radiation down-regulates several key autophagy-related proteins and impairs the autophagy response in keratinocytes. This study demonstrates a linkage between autophagy and skin disorders associated with ultraviolet exposure. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Honey bee (Apis mellifera) venom induces AIM2 inflammasome activation in human keratinocytes.

    Science.gov (United States)

    Dombrowski, Y; Peric, M; Koglin, S; Kaymakanov, N; Schmezer, V; Reinholz, M; Ruzicka, T; Schauber, J

    2012-11-01

    Following allergen exposure, cytokines and other pro-inflammatory signals play an important role in the immunological cascade leading to allergic sensitization. Inflammasomes sense exogenous and endogenous danger signals and trigger IL-1β and IL-18 activation which in turn shape Th2 responses. Honey bee venom (BV) allergies are very common; however, the local inflammatory cascade leading to the initiation of allergic sensitization is poorly understood. In this study, the local inflammatory cascades in skin after exposure to BV were investigated. The mechanisms of inflammasome activation in human skin and in cultured keratinocytes upon BV exposure were analyzed by ELISA, Western blot, flow cytometry, siRNA techniques, and immunofluorescence. In an ex vivo bee sting model, BV induced IL-1β release suggesting the activation of inflammasomes. Indeed, in cultured keratinocytes, the BV component melittin triggered IL-1β and IL-18 release via the AIM2 inflammasome. AIM2 is a cytosolic DNA receptor, and mitochondrial as well as genomic DNA was detected in the cytosol of melittin-treated keratinocytes as triggers of inflammasome activation. As a mechanism, melittin mediated destruction of mitochondrial membranes leading to the leakage of mitochondrial DNA into the cytosolic compartment. These data suggest that upon BV exposure, keratinocytes are involved in an innate immune response by the activation of the AIM2 inflammasome and subsequent IL-1β and IL-18 release triggered by endogenous DNA. As IL-1β and IL-18 are involved in Th2- and IgE-mediated immune reactions, these results could add to the understanding of the role of the tissue microenvironment to subsequent allergic responses. © 2012 John Wiley & Sons A/S.

  5. on skin keratinocytes by nuclear factor-kappa B

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-21

    Jun 21, 2012 ... and keratinocytes. AGE content was higher and NF-κB expression was more localized in the nuclear of keratinocytes in diabetic skins. AGE could inhibit normal cell growth by inducing apoptosis and arresting cell division cycle, inhibiting cell adhesion and promoting migration which might be mediated.

  6. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Science.gov (United States)

    2010-01-01

    Toxic epidermal necrolysis (TEN) and Stevens Johnson Syndrome (SJS) are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP), disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS). Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis using SCORTEN

  7. Methicillin-resistant Staphylococcus aureus adaptation to human keratinocytes.

    Science.gov (United States)

    Soong, Grace; Paulino, Franklin; Wachtel, Sarah; Parker, Dane; Wickersham, Matthew; Zhang, Dongni; Brown, Armand; Lauren, Christine; Dowd, Margaret; West, Emily; Horst, Basil; Planet, Paul; Prince, Alice

    2015-04-21

    Skin is the most common site of Staphylococcus aureus infection. While most of these infections are self-limited, recurrent infections are common. Keratinocytes and recruited immune cells participate in skin defense against infection. We postulated that S. aureus is able to adapt to the milieu within human keratinocytes to avoid keratinocyte-mediated clearance. From a collection of S. aureus isolated from chronically infected patients with atopic dermatitis, we noted 22% had an agr mutant-like phenotype. Using several models of human skin infection, we demonstrate that toxin-deficient, agr mutants of methicillin-resistant S. aureus (MRSA) USA300 are able to persist within keratinocytes by stimulating autophagy and evading caspase-1 and inflammasome activation. MRSA infection induced keratinocyte autophagy, as evidenced by galectin-8 and LC3 accumulation. Autophagy promoted the degradation of inflammasome components and facilitated staphylococcal survival. The recovery of more than 58% agr or RNAIII mutants (P Soong et al.

  8. Increased capsaicin receptor TRPV1 in skin nerve fibres and related vanilloid receptors TRPV3 and TRPV4 in keratinocytes in human breast pain

    Directory of Open Access Journals (Sweden)

    Facer Paul

    2005-03-01

    Full Text Available Abstract Background Breast pain and tenderness affects 70% of women at some time. These symptoms have been attributed to stretching of the nerves with increase in breast size, but tissue mechanisms are poorly understood. Methods Eighteen patients (n = 12 breast reduction and n = 6 breast reconstruction were recruited and assessed for breast pain by clinical questionnaire. Breast skin biopsies from each patient were examined using immunohistological methods with specific antibodies to the capsaicin receptor TRPV1, related vanilloid thermoreceptors TRPV3 and TRPV4, and nerve growth factor (NGF. Results TRPV1-positive intra-epidermal nerve fibres were significantly increased in patients with breast pain and tenderness (TRPV1 fibres / mm epidermis, median [range] – no pain group, n = 8, 0.69 [0–1.27]; pain group, n = 10, 2.15 [0.77–4.38]; p = 0.0009. Nerve Growth Factor, which up-regulates TRPV1 and induces nerve sprouting, was present basal keratinocytes: some breast pain specimens also showed NGF staining in supra-basal keratinocytes. TRPV4-immunoreactive fibres were present in sub-epidermis but not significantly changed in painful breast tissue. Both TRPV3 and TRPV4 were significantly increased in keratinocytes in breast pain tissues; TRPV3, median [range] – no pain group, n = 6, 0.75 [0–2]; pain group, n = 11, 2 123, p = 0.008; TRPV4, median [range] – no pain group, n = 6, [0–1]; pain group, n = 11, 1 [0.5–2], p = 0.014. Conclusion Increased TRPV1 intra-epidermal nerve fibres could represent collateral sprouts, or re-innervation following nerve stretch and damage by polymodal nociceptors. Selective TRPV1-blockers may provide new therapy in breast pain. The role of TRPV3 and TRPV4 changes in keratinocytes deserve further study.

  9. Differences in the melanosome distribution within the epidermal melanin units and its association with the impairing background of leukoderma in vitiligo and halo nevi: a retrospective study.

    Science.gov (United States)

    Xiong, Xi-Xi; Ding, Gao-Zhong; Zhao, Wen-E; Li, Xue; Ling, Yu-Ting; Sun, Li; Gong, Qing-Li; Lu, Yan

    2017-07-01

    Skin color is determined by the number of melanin granules produced by melanocytes that are transferred to keratinocytes. Melanin synthesis and the distribution of melanosomes to keratinocytes within the epidermal melanin unit (EMU) within the skin of vitiligo patients have been poorly studied. The ultrastructure and distribution of melanosomes in melanocytes and surrounding keratinocytes in perilesional vitiligo and normal skin were investigated using transmission electron microscopy (TEM). Furthermore, we performed a quantitative analysis of melanosome distribution within the EMUs with scatter plot. Melanosome count within keratinocytes increased significantly compared with melanocytes in perilesional stable vitiligo (P < 0.001), perilesional halo nevi (P < 0.01) and the controls (P < 0.01), but not in perilesional active vitiligo. Furthermore, melanosome counts within melanocytes and their surrounding keratinocytes in perilesional active vitiligo skin decreased significantly compared with the other groups. In addition, taking the means-standard error of melanosome count within melanocytes and keratinocytes in healthy controls as a normal lower limit, EMUs were graded into 3 stages (I-III). Perilesional active vitiligo presented a significantly different constitution in stages compared to other groups (P < 0.001). The distribution and constitution of melanosomes were normal in halo nevi. Impaired melanin synthesis and melanosome transfer are involved in the pathogenesis of vitiligo. Active vitiligo varies in stages and in stage II, EMUs are slightly impaired, but can be resuscitated, providing a golden opportunity with the potential to achieve desired repigmentation with an appropriate therapeutic choice. Adverse milieu may also contribute to the low melanosome count in keratinocytes.

  10. Staphylococcus hyicus virulence in relation to exudative epidermitis in pigs

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Andresen, Lars Ole; Bille-Hansen, Vivi

    1993-01-01

    Staphylococcus hyicus strains with different phage types, plasmid profiles, and antibiotic resistance patterns were isolated from piglets with exudative epidermitis. The strains could be divided into virulent strains, producing exudative epidermitis, and avirulent strains, producing no dermal...... changes when injected in experimental piglets. The results showed that both virulent and avirulent strains were present simultaneously on diseased piglets. This constitutes a diagnostic problem. Concentrated culture supernatants from nine virulent strains injected in the skin of healthy piglets produced...... a crusting reaction in all piglets. Acanthosis was observed in the histopathological examination of the crustaceous skin. Concentrated culture supernatants from nine avirulent strains produced no macroscopic or microscopic skin changes. Protein profiles from all virulent strains and seven out of nine...

  11. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  12. Sculpting Skin Appendages Out of Epidermal Layers Via Temporally and Spatially Regulated Apoptotic Events

    Science.gov (United States)

    Chang, Chung-Hsing; Yu, Mingke; Wu, Ping; Jiang, Ting-Xin; Yu, Hsin-Su; Widelitz, Randall B.; Chuong, Cheng-Ming

    2015-01-01

    Complex skin appendages are built from the epidermal cells through induction, cell fate specification, proliferation, apoptosis, and differentiation, etc. Here we used the TUNEL assay and caspase-3 immuno-localization to examine apoptotic events in different stages of feather morphogenesis. We deduced three modes through which apoptosis may impact morphogenesis. In Mode 1A, apoptosis occurs within the localized growth zone to regulate growth as seen in growing buds. In Mode 1B, morphogen secreting cells are present adjacent to localized growth zones and apoptosis may work as a mechanism to remove such signaling centers. This was seen in marginal / barbule plate interactions. In Mode 2, keratinocytes apoptosed before terminal differentiation and left spaces between branches, as seen in the marginal plate epithelia. In Mode 3A, keratinocytes cornified and flaked off between two epidermal layers, thus helping to free skin appendages as seen in the feather sheath and pulp epithelium. In Mode 3B, keratinized apoptosed epithelial cells became permanent structures as seen in the rachis and barbs. Thus, the mode of death has a major impact on epithelial morphogenesis. We further tested the effects of imbalanced Shh on apoptosis with retroviral mediated transgenic feathers. Shh suppression not only reduces marginal plate apoptosis and caspase-3 expression, but also causes abnormal differentiation of barbule plates. Expression of Patched in the barbules, but not the marginal plates, implied that the previously shown Shh dependent marginal plate apoptosis is mediated through a paracrine mechanism. New Shh over-expression data showed enhanced proliferation and reduced apoptosis in barb ridges. This work complements our recent work on the role of shifting localized growth zones in feather morphogenesis (Chodankar et al., 2003; J. Invest. Dermatol. 120:20), and shows how adding and removing cell masses in temporally and spatially specific ways are coordinated to sculpt skin

  13. Outside-in signaling through integrins and cadherins: a central mechanism to control epidermal growth and differentiation?

    Science.gov (United States)

    Müller, Eliane J; Williamson, Lina; Kolly, Carine; Suter, Maja M

    2008-03-01

    The process of epidermal renewal persists throughout the entire life of an organism. It begins when a keratinocyte progenitor leaves the stem cell compartment, undergoes a limited number of mitotic divisions, exits the cell cycle, and commits to terminal differentiation. At the end of this phase, the postmitotic keratinocytes detach from the basement membrane to build up the overlaying stratified epithelium. Although highly coordinated, this sequence of events is endowed with a remarkable versatility, which enables the quiescent keratinocyte to reintegrate into the cell cycle and become migratory when necessary, for example after wounding. It is this versatility that represents the Achilles heel of epithelial cells allowing for the development of severe pathologies. Over the past decade, compelling evidence has been provided that epithelial cancer cells achieve uncontrolled proliferation following hijacking of a "survival program" with PI3K/Akt and a "proliferation program" with growth factor receptor signaling at its core. Recent insights into adhesion receptor signaling now propose that integrins, but also cadherins, can centrally control these programs. It is suggested that the two types of adhesion receptors act as sensors to transmit extracellular stimuli in an outside-in mode, to inversely modulate epidermal growth factor receptor signaling and ensure cell survival. Hence, cell-matrix and cell-cell adhesion receptors likely play a more powerful and wide-ranging role than initially anticipated. This Perspective article discusses the relevance of this emerging field for epidermal growth and differentiation, which can be of importance for severe pathologies such as tumorigenesis and invasive metastasis, as well as psoriasis and Pemphigus vulgaris.

  14. In Vitro Cytotoxicity and Phototoxicity Assessment of Acylglutamate Surfactants Using a Human Keratinocyte Cell Line

    Directory of Open Access Journals (Sweden)

    Abhay Kyadarkunte

    2014-07-01

    Full Text Available In the current study, human keratinocyte cell line was used as in vitro cell culture model to elucidate the effects of the fatty acid chain length of acylglutamate (amino acid-based surfactant namely, sodium cocoyl glutamate, sodium lauroyl glutamate, and sodium myristoyl glutamate on their cytotoxicity and the ultraviolet B induced phototoxicity. The endpoint used to assess toxicity was a tetrazolium-based assay whereas, the phototoxic potential of acylglutamate surfactants was predicted using two models namely, the Photo-Irritation Factor and Mean Photo Effect. The results of this study showed that the fatty acid chain length of acylglutamate greatly influences toxic effects on human keratinocyte cells. In addition, all the acylglutamate surfactants tested on human keratinocyte cells demonstrated significantly less cytotoxicity (when irradiated and non-irradiated with ultraviolet B light; p < 0.05 and no phototoxic potential was observed in any of the acylglutamate surfactants, when compared with the positive control chlorpromazine. In conclusion, the in vitro studies confirm the suitability of sodium lauroyl glutamate destined for the synthesis and stabilization of lipid nanoparticles.

  15. In vitro 3-D model based on extending time of culture for studying chronological epidermis aging.

    Science.gov (United States)

    Dos Santos, Morgan; Metral, Elodie; Boher, Aurélie; Rousselle, Patricia; Thepot, Amélie; Damour, Odile

    2015-09-01

    Skin aging is a complex phenomenon in which several mechanisms operate simultaneously. Among them, intrinsic aging is a time-dependent process, which leads to gradual skin changes affecting its structure and function such as thinning down of both epidermal and dermal compartments and a flattening and fragility of the dermo-epidermal junction. Today, several approaches have been proposed for the generation of aged skin in vitro, including skin explants from aged donors and three-dimensional skin equivalent treated by aging-inducing chemical compounds or engineered with human cells isolated from aged donors. The aim of this study was to develop and validate a new in vitro model of aging based on skin equivalent demonstrating the same phenotypic changes that were observed in chronological aging. By using prolonged culture as a proxy for cellular aging, we extended to 120 days the culture time of a skin equivalent model based on collagen-glycosaminoglycan-chitosan porous polymer and engineered with human skin cells from photo-protected sites of young donors. Morphological, immunohistological and ultrastructural analysis at different time points of the culture allowed characterizing the phenotypic changes observed in our model in comparison to samples of non photo-exposed normal human skin from different ages. We firstly confirmed that long-term cultured skin equivalents are still morphologically consistent and functionally active even after 120 days of culture. However, similar to in vivo chronological skin aging a significant decrease of the epidermis thickness as well as the number of keratinocyte expressing proliferation marker Ki67 are observed in extended culture time skin equivalent. Epidermal differentiation markers loricrin, filaggrin, involucrin and transglutaminase, also strongly decreased. Ultrastructural analysis of basement membrane showed typical features of aged skin such as duplication of lamina densa and alterations of hemidesmosomes. Moreover, the

  16. Novel dermo-epidermal equivalents on silk fibroin-based formic acid-crosslinked three-dimensional nonwoven devices with prospective applications in human tissue engineering/regeneration/repair.

    Science.gov (United States)

    Dal Pra, Ilaria; Chiarini, Anna; Boschi, Alessandra; Freddi, Giuliano; Armato, Ubaldo

    2006-08-01

    Biologically well-tolerated materials are at the core of intense research. In this study, we report both the intrinsic features of formic acid (FA)-crosslinked three-dimensional (3D) nonwoven scaffolds consisting of sericin-deprived, Bombyx mori silk fibroin (SF) in beta-sheet form and the long-term co-culture of adult human epidermal keratinocytes (HEKs) and dermal fibroblasts (HDFs) on them. The results of scanning electron microscopy, differential scanning calorimetry, and thermogravimetric and tensile strength studies showed that such scaffolds are made by a composite material, in which anisotropic SF fibres are enclosed within an isotropic matrix of SF in film form. Both fibres and films are firmly crosslinked by FA treatment and water-insoluble owing to their beta-sheet crystalline structure. Moreover, while a certain strength of the material in the dry state may favour its manufacturing, handling, and shaping, the dramatic loss of hardiness under wet conditions renders the scaffolds softer, mechanically more compliant and, hence, more apt for implantation. Normal HEKs and HDFs could be successfully co-cultured on such nonwovens for up to 75-95 days in vitro, thus forming a novel kind of dermo-epidermal equivalent, in which the cells were metabolically active and performed specific functions (e.g. the de novo production and assembly of collagen fibres), but never released urea nitrogen (an index of protein catabolism) or proinflammatory interleukin-1beta (IL-1beta). In keeping with the results of previous studies in animals (Dal Pra I, et al, Biomaterials 26: 1987-1989, 2005), these findings support the view that 3D SF-based nonwovens may be excellent candidates for beneficial applications in the field of human tissue engineering/regeneration/repair.

  17. Melanin Transferred to Keratinocytes Resides in Nondegradative Endocytic Compartments.

    Science.gov (United States)

    Correia, Maria S; Moreiras, Hugo; Pereira, Francisco J C; Neto, Matilde V; Festas, Tiago C; Tarafder, Abul K; Ramalho, José S; Seabra, Miguel C; Barral, Duarte C

    2018-03-01

    Melanin transfer from melanocytes to keratinocytes and subsequent accumulation in the supranuclear region is a critical process in skin pigmentation and protection against UVR. We have previously proposed that the main mode of transfer between melanocytes and keratinocytes is through exo/endocytosis of the melanosome core, termed melanocore. In this study, we developed an in vitro uptake assay using melanocores secreted by melanocytes. We show that the uptake of melanocores, but not melanosomes, by keratinocytes is protease-activated receptor-2-dependent. Furthermore, we found that the silencing of the early endocytic regulator Rab5b, but not the late endocytic regulators Rab7a or Rab9a, significantly impairs melanocore uptake by keratinocytes. After uptake, we observed that melanin accumulates in compartments that are positive for both early and late endocytic markers. We found that melanin does not localize to either highly degradative or acidic organelles, as assessed by LysoTracker and DQ-BSA staining, despite the abundance of these types of organelles within keratinocytes. Therefore, we propose that melanocore uptake leads to storage of melanin within keratinocytes in hybrid endocytic compartments that are not highly acidic or degradative. By avoiding lysosomal degradation, these specialized endosomes may allow melanin to persist within keratinocytes for long periods. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  19. Toxic Epidermal Necrolysis Clinical Guidelines

    Science.gov (United States)

    2008-10-01

    compli- cations and identify at-risk patients for post- discharge mortality 8) Ophthalmologic consultation is highly recommended for patients with...gastrointestinal tract, vaginal mucosa, anal canal and the eyes and mouth. TEN does not affect columnar or cuboidal epithelium. Sloughing of the epidermal-dermal...proven infection may select for resistant organisms and may contribute to increased mortality.24 The principal of skin care in TENS is to prevent

  20. Substance P restores normal skin architecture and reduces epidermal infiltration of sensory nerve fiber in TNCB-induced atopic dermatitis-like lesions in NC/Nga mice.

    Science.gov (United States)

    Choi, Hyeongwon; Kim, Dong-Jin; Nam, Seungwoo; Lim, Sunki; Hwang, Jae-Sung; Park, Ki Sook; Hong, Hyun Sook; Won, Younsun; Shin, Min Kyung; Chung, Eunkyung; Son, Youngsook

    2018-03-01

    Atopic dermatitis (AD) is a chronic inflammatory skin disorder characterized by intense pruritus and eczematous lesion. Substance P (SP) is an 11-amino-acid endogenous neuropeptide that belongs to the tachykinin family and several reports recently have supported the anti-inflammatory and tissue repairing roles of SP. In this study, we investigated whether SP can improve AD symptoms, especially the impaired skin barrier function, in 2, 4, 6-trinitrochlorobenzene (TNCB)-induced chronic dermatitis of NC/Nga mice or not. AD-like dermatitis was induced in NC/Nga mice by repeated sensitization with TNCB for 5 weeks. The experimental group designations and topical treatments were as follows: vehicle group (AD-VE); SP group (AD-SP); and SP with NK1R antagonist CP99994 (AD-SP-A) group. Histological analysis was performed to evaluate epidermal differentiation, dermal integrity, and epidermal nerve innervation in AD-like lesions. The skin barrier functions and pruritus of NC/Nga mice were evaluated by measuring transepidermal water loss (TEWL) and scratching behavior, respectively. Topical SP treatment resulted in significant down-regulation of Ki67 and the abnormal-type keratins (K) K6, K16, and K17, restoration of filaggrin and claudin-1, marked reduction of TEWL, and restoration of basement membrane and dermal collagen deposition, even under continuous sensitization of low dose TNCB. In addition, SP significantly reduced innervation of itch-evoking nerve fibers, gelatinase activity and nerve growth factor (NGF) expression in the epidermis but upregulated semaphorin-3A (Sema3A) expression in the epidermis, along with reduced scratching behavior in TNCB-treated NC/Nga mice. All of these effects were completely reversed by co-treatment with the NK1R antagonist CP99994. In cultured human keratinocytes, SP treatment reduced expression of TGF-α, but upregulated TGF-β and Sema3A. Topically administered SP can restore normal skin barrier function, reduce epidermal infiltration

  1. Evolutionary re-wiring of p63 and the epigenomic regulatory landscape in keratinocytes and its potential implications on species-specific gene expression and phenotypes

    Science.gov (United States)

    Sethi, Isha; Gluck, Christian; Zhou, Huiqing

    2017-01-01

    Abstract Although epidermal keratinocyte development and differentiation proceeds in similar fashion between humans and mice, evolutionary pressures have also wrought significant species-specific physiological differences. These differences between species could arise in part, by the rewiring of regulatory network due to changes in the global targets of lineage-specific transcriptional master regulators such as p63. Here we have performed a systematic and comparative analysis of the p63 target gene network within the integrated framework of the transcriptomic and epigenomic landscape of mouse and human keratinocytes. We determined that there exists a core set of ∼1600 genomic regions distributed among enhancers and super-enhancers, which are conserved and occupied by p63 in keratinocytes from both species. Notably, these DNA segments are typified by consensus p63 binding motifs under purifying selection and are associated with genes involved in key keratinocyte and skin-centric biological processes. However, the majority of the p63-bound mouse target regions consist of either murine-specific DNA elements that are not alignable to the human genome or exhibit no p63 binding in the orthologous syntenic regions, typifying an occupancy lost subset. Our results suggest that these evolutionarily divergent regions have undergone significant turnover of p63 binding sites and are associated with an underlying inactive and inaccessible chromatin state, indicative of their selective functional activity in the transcriptional regulatory network in mouse but not human. Furthermore, we demonstrate that this selective targeting of genes by p63 correlates with subtle, but measurable transcriptional differences in mouse and human keratinocytes that converges on major metabolic processes, which often exhibit species-specific trends. Collectively our study offers possible molecular explanation for the observable phenotypic differences between the mouse and human skin and broadly

  2. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  3. Streptococcus induces circulating CLA(+) memory T-cell-dependent epidermal cell activation in psoriasis.

    Science.gov (United States)

    Ferran, Marta; Galván, Ana B; Rincón, Catalina; Romeu, Ester R; Sacrista, Marc; Barboza, Erika; Giménez-Arnau, Ana; Celada, Antonio; Pujol, Ramon M; Santamaria-Babí, Luis F

    2013-04-01

    Streptococcal throat infection is associated with a specific variant of psoriasis and with HLA-Cw6 expression. In this study, activation of circulating psoriatic cutaneous lymphocyte-associated antigen (CLA)(+) memory T cells cultured together with epidermal cells occurred only when streptococcal throat extracts were added. This triggered the production of Th1, Th17, and Th22 cytokines, as well as epidermal cell mediators (CXCL8, CXCL9, CXCL10, and CXCL11). Streptococcal extracts (SEs) did not induce any activation with either CLA(-) cells or memory T cells cultured together with epidermal cells from healthy subjects. Intradermal injection of activated culture supernatants into mouse skin induced epidermal hyperplasia. SEs also induced activation when we used epidermal cells from nonlesional skin of psoriatic patients with CLA(+) memory T cells. Significant correlations were found between SE induced upregulation of mRNA expression for ifn-γ, il-17, il-22, ip-10, and serum level of antistreptolysin O in psoriatic patients. This study demonstrates the direct involvement of streptococcal infection in pathological mechanisms of psoriasis, such as IL-17 production and epidermal cell activation.

  4. An active role of the DeltaN isoform of p63 in regulating basal keratin genes K5 and K14 and directing epidermal cell fate.

    Directory of Open Access Journals (Sweden)

    Rose-Anne Romano

    Full Text Available BACKGROUND: One major defining characteristic of the basal keratinocytes of the stratified epithelium is the expression of the keratin genes K5 and K14. The temporal and spatial expression of these two genes is usually tightly and coordinately regulated at the transcriptional level. This ensures the obligate pairing of K5 and K14 proteins to generate an intermediate filament (IF network that is essential for the structure and function of the proliferative keratinocytes. Our previous studies have shown that the basal-keratinocyte restricted transcription factor p63 is a direct regulator of K14 gene. METHODOLOGY/PRINCIPAL FINDINGS: Here we provide evidence that p63, specifically the DeltaN isoform also regulates the expression of the K5 gene by binding to a conserved enhancer within the 5' upstream region. By using specific antibodies against DeltaNp63, we show a concordance in the expression between basal keratins and DeltaNp63 proteins but not the TAp63 isoforms during early embryonic skin development. We demonstrate, that contrary to a previous report, transgenic mice expressing DeltaNp63 in lung epithelium exhibit squamous metaplasia with de novo induction of K5 and K14 as well as transdifferentiation to the epidermal cell lineage. Interestingly, the in vivo epidermal inductive properties of DeltaNp63 do not require the C-terminal SAM domain. Finally, we show that DeltaNp63 alone can restore the expression of the basal keratins and reinitiate the failed epidermal differentiation program in the skin of p63 null animals. SIGNIFICANCE: DeltaNp63 is a critical mediator of keratinocyte stratification program and directly regulates the basal keratin genes.

  5. FGF7/KGF regulates autophagy in keratinocytes

    Science.gov (United States)

    Belleudi, Francesca; Purpura, Valeria; Caputo, Silvia; Torrisi, Maria Rosaria

    2014-01-01

    Autophagy is a degradative pathway through which cells overcome stressful conditions and rapidly change their phenotype during differentiation. Despite its protective role, when exacerbated, autophagy may lead to cell death. Several growth factors involved in cell survival and in preventing differentiation are able to inhibit autophagy. Here we investigated the autophagic role of FGF7/KGF, an important player in epithelial cell protection and differentiation. Biochemical and quantitative fluorescence approaches showed that FGF7 and its signaling induce autophagy in human keratinocytes and the use of specific inhibitors indicated that this effect is independent of the PI3K-AKT-MTOR pathway. The selective block of autophagosome-to-lysosome fusion clarified that FGF7 induces autophagy stimulating autophagosome formation. However, quantitative fluorescence approaches also indicated that, upon a prolonged autophagic stimulus, FGF7 is able to accelerate autophagosome turnover. Moreover, in differentiating keratinocytes, the use of the autophagic inhibitor 3-MA as well as the depletion of BECN1 and ATG5, 2 essential regulators of the process, counteracted the FGF7-induced increase of the differentiation marker KRT1/K1, suggesting that autophagy is required for the FGF7-mediated early differentiation. These results provide the first evidence of a role of FGF7 in the regulation of sequential steps of the autophagic process and strengthen the hypothesis of a direct interplay between autophagy and differentiation. On the other hand, the ability of FGF7 to accelerate autophagosome turnover, preventing their dangerous accumulation, is consistent with the well-established protective role played by the growth factor in epithelial cells. PMID:24577098

  6. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  7. Astragaloside IV Downregulates β-Catenin in Rat Keratinocytes to Counter LiCl-Induced Inhibition of Proliferation and Migration

    Directory of Open Access Journals (Sweden)

    Fu-Lun Li

    2012-01-01

    Full Text Available Re-epithelialization is a crucial step towards wound healing. The traditional Chinese medicine, Astragalus membranaceus (Fisch Bge, has been used for hundreds of years for many kinds of ulcerated wounds. Recent research has identified the active compound in this drug as astragaloside IV (AS-IV, but the underlying molecular mechanisms of its therapeutic action on keratinocytes remain poorly understood. In this study, we used an in vitro model of ulcer-like wound processes, lithium chloride (LiCl-induced cultured mouse keratinocytes, to investigate the effects of AS-IV treatment. The effects on cell proliferation were evaluated by the MTS/PMS colorimetric assay, effects on cell migration were determined by a wound-healing scratch experiment, effects on the cell cycle were analyzed by flow cytometry, and effects on protein expression were analyzed by immunoblotting and immunofluorescence. LiCl strongly inhibited cell proliferation and migration, up-regulated β-catenin expression, and down-regulated proliferating cell nuclear antigen (PCNA expression. AS-IV treatment attenuat the inhibition of proliferation and migration, significantly reducing the enhanced β-catenin expression, and recovering PCNA and β-tubulin expression. Thus, AS-IV mediates mouse keratinocyte proliferation and migration via regulation of the Wnt signaling pathway. Down-regulating β-catenin to increase keratinocyte migration and proliferation is one mechanism by which AS-IV can promote ulcerated wound healing.

  8. Honey Extracted Polyphenolics Reduce Experimental Hypoxia in Human Keratinocytes Culture.

    Science.gov (United States)

    Chaudhary, Amrita; Bag, Swarnendu; Banerjee, Provas; Chatterjee, Jyotirmoy

    2017-05-03

    Hypoxic assault affects fundamental cellular processes and generates oxidative stress on healthy cells/molecules. Honey extracted polyphenolics (HEP) as a natural antioxidant reduced hypoxic cytotoxicity in this study. Different honey samples were physicochemically characterized to identify preferred (jamun) honey [pH 3.55 ± 0.04, conductivity (μs/cm) = 6.66 ± 0.14, water content % (w/w) = 14.70 ± 0.35, total solid content % (w/w) = 85.30 ± 0.35, phenol content (mg GAE/100 g) = 403.55 ± 0.35, flavonoid content (mg QE/100 g) = 276.76 ± 4.10, radical scavenging activity (% 500 μL) = 147.75 ± 3.13, catalase activity (absorbance at 620 nm) = 0.226 ± 0.01]. HEP was tested in different doses on hypoxic and normoxic cells (HaCaT) using viability and antioxidant assays. Cardinal molecular expressions such as cadherin-catenin-cytoskeleton complex (namely, E-cadherin, β-catenin, and F-actin), hypoxia marker (Hif 1 α), proliferation marker (Ki67), and epithelial master regulator (p63) were studied by immuno-cytochemisty (ICC) and qRT-PCR. The 0.063 mg/mL HEP demonstrated better vitality and functionality of HaCaT cells as per viability assay (*, P < 0.01) even under hypoxia. ICC and qRT-PCR observations indicated restoration of cellular survival and homeostasis under 0.063 mg/mL HEP after hypoxic assault. Furthermore, major spectral changes for nucleic acid and membrane phospholipid reorganizations by Fourier transform infrared spectroscopy illustrated a positive impact of 0.063 mg/mL HEP on hypoxic cells considering proliferation and cellular integrity. It was concluded that a specific dose of jamun HEP reduces hypoxic cytotoxicity.

  9. Epidermal nevus syndrome and dysplatic kidney disease.

    Directory of Open Access Journals (Sweden)

    Azar Nickavar

    2014-08-01

    Full Text Available Epidermal nevus syndrome is a rare congenital disorder, characterized by epidermal nevi and multiple organ involvement. Multicystic kidney disease has been very rarely reported in this syndrome. Here is the report of a boy presented with multiple epidermal nevi, cardiac anomaly, seizure attack, hemi hypertrophy, and multicystic dysplastic kidney complicated with Wilms' tumor. According to this association, it is suggested to search for dysplastic kidney disease in patients with neurocutaneous disorders.

  10. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    Science.gov (United States)

    2008-03-01

    you performed and the hours you dedicated to the girls while I toiled away at homework, projects, and papers. To the girls , without your quiet, and...Germany). HaCaT keratinocytes do not produce tumors when passaged/grown indefinitely. When transplanted onto nude mice, HaCaT keratinocytes...Marie, John Breton, John Lee, Peter Young , and Don E. Griswold. “Interleukin-8 Production Is Regulated by Protein Kinase C in Human

  11. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  12. UV fluorescence excitation spectroscopy as a non-invasive predictor of epidermal proliferation and clinical performance of cosmetic formulations

    Science.gov (United States)

    Maidhof, Robert; Liebel, Frank; Hwang, Cheng; Ruvolo, Eduardo; Lyga, John

    2017-02-01

    The epidermis is the outermost layer of skin and is composed of cells primarily containing keratin. It consists of about ten layers of living cells (keratinocytes) and ten layers of dead cells (corneocytes). These cells are continually shed from the outside and replaced from the inside in a process called desquamation which is controlled by two biological events - proliferation and differentiation. One method to non-invasively study biological changes in the skin is using fluorescence excitation spectroscopy. Several characteristic excitation-emission peaks occur in skin that have been related to the epidermal and dermal composition. The magnitude of the peak that occurs at 295nm excitation (F295) has been linked to changes in skin proliferation, cell turnover, epidermal thickening, and skin aging. We hypothesize that changes in this fluorescent signal could be used to assess the potential activity of cosmetic anti-aging compounds to deliver a benefit to skin. Previous work with retinol and glycolic acid, two commonly used actives that effect epidermal proliferation and exfoliation, has demonstrated an increase in F295 (attributed to tryptophan excitation fluorescence). In this study we present the results of a placebo controlled study that aims to correlate changes in F295 with biological performance (epidermal thickening and Ki67 expression).

  13. Epidermal hyperproliferation in mice lacking fatty acid transport protein 4 (FATP4) involves ectopic EGF receptor and STAT3 signaling.

    Science.gov (United States)

    Lin, Meei-Hua; Chang, Kuo-Wei; Lin, Shu-Chun; Miner, Jeffrey H

    2010-08-15

    Fatty acid transport protein (FATP) 4 is one of a family of six FATPs that facilitate long- and very long-chain fatty acid uptake. Mice lacking FATP4 are born with tight, thick skin and a defective epidermal barrier; they die neonatally due to dehydration and restricted movements. Both the skin phenotype and the lethality are rescued by transgene-driven expression of FATP4 solely in suprabasal keratinocytes. Here we show that Fatp4 mutants exhibit epidermal hyperplasia resulting from an increased number of proliferating suprabasal cells. In addition, barrier formation initiates precociously but never progresses to completion. To investigate possible mechanisms whereby Fatp4 influences skin development, we identified misregulated genes in Fatp4 mutants. Remarkably, three members of the epidermal growth factor (EGF) family (Ereg, Areg, and Epgn) showed increased expression that was associated with elevated epidermal activation of the EGF receptor (EGFR) and STAT3, a downstream effector of EGFR signaling. Both Tyrphostin AG1478, an EGFR tyrosine kinase inhibitor, and curcumin, an inhibitor of both STAT3 and EGFR, attenuated STAT3 activation/nuclear translocation, reduced skin thickening, and partially suppressed the barrier abnormalities. These data identify FATP4 activity as negatively influencing EGFR activation and the resulting STAT3 signaling during normal skin development. These findings have important implications for understanding the pathogenesis of ichthyosis prematurity syndrome, a disease recently shown to be caused by FATP4 mutations. Copyright 2010 Elsevier Inc. All rights reserved.

  14. Cytotoxic effects of sodium dodecyl benzene sulfonate on human keratinocytes are not associated with proinflammatory cytokines expression.

    Science.gov (United States)

    Mu, Zhanglei; Liu, Xiaojing; Zhao, Yan; Zhang, Jianzhong

    2014-01-01

    Keratinocytes play a crucial role in the biological function of skin barrier. The relationship between sodium lauryl sulfate (SLS) and keratinocytes has been studied. However, the cytotoxicity and effects of sodium dodecyl benzene sulfonate (SDBS), a common detergent similar to SLS, on keratinocytes are still not known. This study aimed to investigate the effects of SDBS on cytotoxicity and expression of proinflammatory cytokines in cultured human keratinocytes. This study was carried out using the keratinocytes cell line, HaCaT cells. The cytotoxicity of SDBS on HaCaT cells was evaluated with cell counting kit-8 (CCK-8) and phase-contrast microscopy. After exposure to different concentrations of SDBS, the total RNA of the HaCaT cells was extracted for evaluating the relative mRNA expression of IL-1α, IL-6, IL-8, and TNF-α by qPCR. The supernatants of cells were collected for measuring the levels of IL-6 and IL-8 by enzyme-linked immunosorbent assay (ELISA). SDBS at concentrations of 20 µg/ml and over showed direct cytotoxicity and induced morphological changes of the HaCaT cells. The mRNA expressions of IL-1α, IL-6, IL-8, and TNF-a in different concentrations of SDBS at different time were comparable with that of controls. SDBS at concentrations of 5, 10, and 15 µg/ml had no significant effects on IL-6 and IL-8 excretion from HaCaT cells after 24-hour exposure. Moreover, no significant effects on the IL-6 and IL-8 excretion were found after 10 and 15 µg/ml SDBS stimulations for 6, 12, and 24 hours, respectively. SDBS at higher concentrations had cytotoxicity on HaCaT cells but had no effects on the mRNA expression of IL-1α, IL-6, IL-8, and TNF-a, that was different from SLS.

  15. Test system for evaluating the influence of polymer properties on primary human keratinocytes and fibroblasts in mono- and coculture.

    Science.gov (United States)

    Trescher, Karoline; Roch, Toralf; Cui, Jing; Kratz, Karl; Lendlein, Andreas; Jung, Friedrich

    2013-06-20

    Interactions of cells with polymer-based biomaterials are influenced by properties of the substrate. Polymers, which are able to induce cell specific effects, gain increasing importance for biotechnology and regenerative therapies. A test system was developed, which allows studying primary human keratinocytes and fibroblasts in mono- and cocultures to analyze and operate the effect of polymer properties. This system offers to identify polymers for keratinocyte cultivation or wound dressings, since adherence, viability and functionality can be analyzed. Especially the coculture system enables the characterization of potential cell specific effects of polymer-based biomaterials. To establish a coculture test system, it is challenging to find a suitable culture medium, to identify initial seeding densities for comparable cell growth and to develop methods to distinguish and characterize both cell types. Poly(n-butyl acrylate) networks (cPnBAs) as model biomaterials were used to demonstrate the applicability of our newly developed coculture screening system for differential cell growth. The apparent Young's modulus of the cPnBAs differentially regulated fibroblasts and keratinocytes. Particularly, cPnBA73 with an apparent Young's modulus of 930±140 kPa measured in phosphate buffered saline (PBS) solution at ambient temperature seemed to have favoring properties for keratinocyte adhesion, while fibroblast adhesion was not affected. For keratinocytes the concentration of some pro-inflammatory cytokines was lower on cPnBA73 and a decreased deposition of collagen, elastin and fibronectin was observed in the coculture. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Characterization of a human epidermis model reconstructed from hair follicle keratinocytes and comparison with two commercially models and native skin.

    Science.gov (United States)

    Guiraud, B; Hernandez-Pigeon, H; Ceruti, I; Mas, S; Palvadeau, Y; Saint-Martory, C; Castex-Rizzi, N; Duplan, H; Bessou-Touya, S

    2014-10-01

    Outer root sheath (ORS) cells of human hair follicles are a readily available, non-invasive source of keratinocytes for epidermis reconstruction. The aim of this study was to characterize a model of epidermis reconstructed from ORS cells (ORS-derived model) and to evaluate its reproducibility, in comparison with native human skin and two marketed reconstructed skin models (model A, Episkin(®) and model B, Skinethic(®) ). Cell morphology and tissue architecture of the three models were analysed histologically and proliferation and differentiation marker expression by immunohistochemistry and mRNA quantification. All models displayed the same general epidermal architecture as native epidermis, but with a thicker stratum corneum in models A and B. Compared with native epidermis, Ki67 was correctly localized in epidermal basal cells in all models, as K10 in suprabasal layers. In all skin models, transglutaminase 1 (TGM1) was prematurely expressed in suprabasal layers. However, this expression was only observed from the upper stratum spinosum in the ORS-derived model. In this model, filaggrin and loricrin were correctly located in the stratum granulosum. Filaggrin, involucrin, loricrin and TGM1 mRNAs (markers of keratinocyte terminal differentiation) were transcriptionally expressed in all models. In the ORS-derived model, transcriptional expression level was similar to that of native skin. ORS cell-based reconstructed epidermis is a valid and reproducible model for human epidermis and it may be used to evaluate the effects of active substances and cosmetic formulations. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  17. [Staphylococcal epidermal exfoliation (Ritter's disease)].

    Science.gov (United States)

    Ruiz Maldonado, R; Tamayo, L; Vazquez, V; Dominguez, J

    1976-01-01

    According to the authors the best designation of Ritter's disease would be "staphilococcic epidermal exfoliation" SEE. The physiopathological and agnoslogical basis for this denomination could be the following: 1st The "S. aureus" is the ehtiological agent of the SSE in man. The Koch postulates necessary to confirm this hypothesis have been accomplished. 2nd "Staphylococcus aureus" produces a thermostable toxin that is active indepently of the staphilococcus and gives rise to the separation of the cells of the stratum granulosus of the epidermis and eventually exfoliation in suckling babies and in the newborn mouse. 3rd The "Staphylococcus aureus" may be present on the skin or in other localisations such as the bowel or pharinx. 4th The viable "S. aureus" when administered subcutaneously to the adult mice gives rise to lesions clinically and histologically similar to the impetigo observed in children. 5th The "S. aureus" killed by means of autoclave (that is, the staphylococcic toxine by itself does not give rise to any lesion when administered to the healthy adult mouse). Neijther has the SEE been observed in healthy adult man. The authors reach the conclusion that the SSE and the toxic epidermal necrolysis are basically different according to the histopathology therapeutic response and prognosis and they must be considered as independant entities.

  18. Different oxidative stress response in keratinocytes and fibroblasts of reconstructed skin exposed to non extreme daily-ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Claire Marionnet

    Full Text Available Experiments characterizing the biological effects of sun exposure have usually involved solar simulators. However, they addressed the worst case scenario i.e. zenithal sun, rarely found in common outdoor activities. A non-extreme ultraviolet radiation (UV spectrum referred as "daily UV radiation" (DUVR with a higher UVA (320-400 nm to UVB (280-320 nm irradiance ratio has therefore been defined. In this study, the biological impact of an acute exposure to low physiological doses of DUVR (corresponding to 10 and 20% of the dose received per day in Paris mid-April on a 3 dimensional reconstructed skin model, was analysed. In such conditions, epidermal and dermal morphological alterations could only be detected after the highest dose of DUVR. We then focused on oxidative stress response induced by DUVR, by analyzing the modulation of mRNA level of 24 markers in parallel in fibroblasts and keratinocytes. DUVR significantly modulated mRNA levels of these markers in both cell types. A cell type differential response was noticed: it was faster in fibroblasts, with a majority of inductions and high levels of modulation in contrast to keratinocyte response. Our results thus revealed a higher sensitivity in response to oxidative stress of dermal fibroblasts although located deeper in the skin, giving new insights into the skin biological events occurring in everyday UV exposure.

  19. Suppression of Ultraviolet B Exposure-Mediated Activation of NF-κB in Normal Human Keratinocytes by Resveratrol

    Directory of Open Access Journals (Sweden)

    Vaqar Mustafa Adhami

    2003-01-01

    Full Text Available Chemoprevention by naturally occurring agents is a newer dimension in the management of neoplasia, including skin cancer. Solar ultraviolet (UV radiation is the major cause of skin cancer. We recently demonstrated that resveratrol (3,5,4'-trihydroxystilbene, a polyphenolic antioxidant found in grapes and red wine, imparts protection from UVB-mediated cutaneous damages in SKH-1 hairless mice. The mechanism of action of resveratrol is not clearly understood. Here, we investigated the involvement of nuclear factor kappa B (NF-κB, which is known to play a critical role in skin biology and the development of skin cancer, as the mechanism of chemoprevention of UV damage by resveratrol. In the normal human epidermal keratinocytes, resveratrol blocked UVB-mediated (40 mJ/cm2 activation of NF-κB in a dose-dependent (5, 10, and 25μM resveratrol for 24 hours as well as time-dependent (5μ/M resveratrol for 12, 24, and 48 hours fashion. Resveratrol treatment of keratinocytes also inhibited UVB-mediated 1 phosphorylation and degradation of IκBα, and 2 activation of IKKα. We suggest that NF-κB pathway plays a critical role in the chemopreventive effects of resveratrol against the adverse effects of UV radiation including photocarcinogenesis.

  20. Voriconazole N-oxide and its UVB photoproduct sensitize keratinocytes to UVA

    Science.gov (United States)

    Ona-Vu, K.; Oh, D.H.

    2015-01-01

    Background The antifungal agent, voriconazole, is associated with phototoxicity and photocarcinogenicity. Prior work has indicated that voriconazole and its hepatic N-oxide metabolite do not sensitize keratinocytes to ultraviolet B (UVB). Clinical observations have suggested ultraviolet A (UVA) may be involved. Objectives To determine the photochemistry and photobiology of voriconazole and its major hepatic metabolite, voriconazole N-oxide. Methods Voriconazole and voriconazole N-oxide were spectrophotometrically monitored following various doses of UVB. Cultured human keratinocytes were treated with parental drugs or with their UVB photoproducts, and survival following UVA irradiation was measured by thiazolyl blue metabolism. Reactive oxygen species and 8-oxoguanine were monitored by fluorescence microscopy. Results Voriconazole and voriconazole N-oxide have varying ultraviolet B (UVB) absorption but do not acutely sensitize cultured human keratinocytes following UVB exposure. However, sustained UVB exposures produced notable dose- and solvent-dependent changes in the absorption spectra of voriconazole N-oxide which in aqueous solution acquires a prominent ultraviolet A (UVA) absorption band, suggesting formation of a discrete photoproduct. Neither the parental drugs nor their photoproducts sensitized cells to UVB though all but voriconazole N-oxide were moderately toxic to cells in the dark. Notably, both voriconazole N-oxide and its UVB photoproduct, but not voriconazole or its photoproduct, additionally sensitized cells to UVA by >3-fold relative to controls in association with UVA-induced reactive oxygen species and 8-oxoguanine levels. Conclusions Voriconazole N-oxide and its UVB-photoproduct act as UVA-sensitizers that generate reactive oxygen species and that produce oxidative DNA damage. These results suggest a mechanism for the phototoxicity and photocarcinogenicity observed with voriconazole treatment. PMID:25919127

  1. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  2. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  3. Increased endogenous DNA oxidation correlates to increased iron levels in melanocytes relative to keratinocytes.

    Science.gov (United States)

    Pelle, Edward; Huang, Xi; Zhang, Qi; Pernodet, Nadine; Yarosh, Daniel B; Frenkel, Krystyna

    2014-01-01

    The endogenous oxidative state of normal human epidermal melanocytes was investigated and compared to normal human epidermal keratinocytes (NHEKs) in order to gain new insight into melanocyte biology. Previously, we showed that NHEKs contain higher levels of hydrogen peroxide (H2O2) than melanocytes and that it can migrate from NHEKs to melanocytes by passive permeation. Nevertheless, despite lower concentrations of H2O2, we now report higher levels of oxidative DNA in melanocytes as indicated by increased levels of 8-oxo-2'-deoxyguanosine (8-oxo-dG): 4.49 (±0.55 SEM) 8-oxo-dG/10(6) dG compared to 1.49 (±0.11 SEM) 8-oxo-dG/10(6) dG for NHEKs. An antioxidant biomarker, glutathione (GSH), was also lower in melanocytes (3.14 nmoles (±0.15 SEM)/cell) in comparison to NHEKs (5.98 nmoles (±0.33 SEM)/cell). Intriguingly, cellular bioavailable iron as measured in ferritin was found to be nearly fourfold higher in melanocytes than in NHEKs. Further, ferritin levels in melanocytes were also higher than in hepatocarcinoma cells, an iron-rich cell, and it indicates that higher relative iron levels may be characteristic of melanocytes. To account for the increased oxidative DNA and lower GSH and H2O2 levels that we observe, we propose that iron may contribute to higher levels of oxidation by reacting with H2O2 through a Fenton reaction leading to the generation of DNA-reactive hydroxyl radicals. In conclusion, our data support the concept of elevated oxidation and high iron levels as normal parameters of melanocytic activity. We present new evidence that may contribute to our understanding of the melanogenic process and lead to the development of new skin care products.

  4. Inactivation of mitogen-activated protein kinase signaling pathway reduces caspase-14 expression in impaired keratinocytes

    Directory of Open Access Journals (Sweden)

    Ningning Dang

    2016-01-01

    Full Text Available Objective(s:Several investigations have revealed that caspase-14 is responsible for the epidermal differentiation and cornification, as well as the regulation of moisturizing effect. However, the precise regulation mechanism is still not clear. This study was aimed to investigate the expression of caspase-14 in filaggrin-deficient normal human epidermal keratinocytes (NHEKs and to explore the possible mechanism that contributes to the regulation of caspase-14. Materials and Methods:The filaggrin-deficient NHEKs were induced by transfection with lentivirus (LV vector encoding small hairpin RNAs (shRNA. The inhibitors SB203580, PD98059 and SP600125 were used for suppressing the expression of p38 mitogen-activated protein kinase (MAPK, p44/42 MAPK and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK. The expression of filaggrin, p38 MAPK, p44/42 MAPK and SAPK/JNK, caspase-14, keratin1and keratin2 were detected by western blot.  Results:In filaggrin-deficient NHEKs, the expression of p38, p44/42 MAPK and SAPK/JNK and caspase-14 were significantly decreased. The inhibition of p38 and SAPK/JNK reduced the expression of caspase-14, while the p44/42 MAPK showed no consistent effects. Moreover, the filaggrin knockdown decreased the expression of keratin2, but had no effects on the level of keratin1. Conclusion: The decreased expression of caspase-14 in filaggrin-deficient NHEKs may be induced by the inactivation of MAPK signaling pathway. These provide a novel perspective to understand the mechanism for the protective effects of filaggrin and caspase-14 on skin barrier function.

  5. Inactivation of mitogen-activated protein kinase signaling pathway reduces caspase-14 expression in impaired keratinocytes.

    Science.gov (United States)

    Dang, Ningning; Pang, Shuguang; Song, Haiyan; An, Liguo; Ma, Xiaoli

    2016-01-01

    Several investigations have revealed that caspase-14 is responsible for the epidermal differentiation and cornification, as well as the regulation of moisturizing effect. However, the precise regulation mechanism is still not clear. This study was aimed to investigate the expression of caspase-14 in filaggrin-deficient normal human epidermal keratinocytes (NHEKs) and to explore the possible mechanism that contributes to the regulation of caspase-14. The filaggrin-deficient NHEKs were induced by transfection with lentivirus (LV) vector encoding small hairpin RNAs (shRNA). The inhibitors SB203580, PD98059 and SP600125 were used for suppressing the expression of p38 mitogen-activated protein kinase (MAPK), p44/42 MAPK and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK). The expression of filaggrin, p38 MAPK, p44/42 MAPK and SAPK/JNK, caspase-14, keratin1and keratin2 were detected by western blot. In filaggrin-deficient NHEKs, the expression of p38, p44/42 MAPK and SAPK/JNK and caspase-14 were significantly decreased. The inhibition of p38 and SAPK/JNK reduced the expression of caspase-14, while the p44/42 MAPK showed no consistent effects. Moreover, the filaggrin knockdown decreased the expression of keratin2, but had no effects on the level of keratin1. The decreased expression of caspase-14 in filaggrin-deficient NHEKs may be induced by the inactivation of MAPK signaling pathway. These provide a novel perspective to understand the mechanism for the protective effects of filaggrin and caspase-14 on skin barrier function.

  6. GATA3 expression is decreased in psoriasis and during epidermal regeneration; induction by narrow-band UVB and IL-4.

    Directory of Open Access Journals (Sweden)

    Emoke Rácz

    Full Text Available Psoriasis is characterized by hyperproliferation of keratinocytes and by infiltration of activated Th1 and Th17 cells in the (epidermis. By expression microarray, we previously found the GATA3 transcription factor significantly downregulated in lesional psoriatic skin. Since GATA3 serves as a key switch in both epidermal and T helper cell differentiation, we investigated its function in psoriasis. Because psoriatic skin inflammation shares many characteristics of epidermal regeneration during wound healing, we also studied GATA3 expression under such conditions.Psoriatic lesional skin showed decreased GATA3 mRNA and protein expression compared to non-lesional skin. GATA3 expression was also markedly decreased in inflamed skin of mice with a psoriasiform dermatitis induced with imiquimod. Tape-stripping of non-lesional skin of patients with psoriasis, a standardized psoriasis-triggering and skin regeneration-inducing technique, reduced the expression of GATA3. In wounded skin of mice, low GATA3 mRNA and protein expression was detected. Taken together, GATA3 expression is downregulated under regenerative and inflammatory hyperproliferative skin conditions. GATA3 expression could be re-induced by successful narrow-band UVB treatment of both human psoriasis and imiquimod-induced psoriasiform dermatitis in mice. The prototypic Th2 cytokine IL-4 was the only cytokine capable of inducing GATA3 in skin explants from healthy donors. Based on these findings we argue that GATA3 serves as a key regulator in psoriatic inflammation, keratinocyte hyperproliferation and skin barrier dysfunction.

  7. Epidermal Stem Cells in Orthopaedic Regenerative Medicine

    Science.gov (United States)

    Li, Jin; Zhen, Gehua; Tsai, Shin-Yi; Jia, Xiaofeng

    2013-01-01

    In the last decade, great advances have been made in epidermal stem cell studies at the cellular and molecular level. These studies reported various subpopulations and differentiations existing in the epidermal stem cell. Although controversies and unknown issues remain, epidermal stem cells possess an immune-privileged property in transplantation together with easy accessibility, which is favorable for future clinical application. In this review, we will summarize the biological characteristics of epidermal stem cells, and their potential in orthopedic regenerative medicine. Epidermal stem cells play a critical role via cell replacement, and demonstrate significant translational potential in the treatment of orthopedic injuries and diseases, including treatment for wound healing, peripheral nerve and spinal cord injury, and even muscle and bone remodeling. PMID:23727934

  8. Delayed Hepatic Adaptation to Weaning in ACBP(-/-) Mice Is Caused by Disruption of the Epidermal Barrier

    DEFF Research Database (Denmark)

    Neess, Ditte; Bek, Signe; Bloksgaard, Maria

    2013-01-01

    in the skin rather than in the liver. Similarly to ACBP(-/-) mice, K14-ACBP(-/-) mice exhibit an increased transepidermal water loss, and we show that the hepatic phenotype is caused specifically by the epidermal barrier defect, which leads to increased lipolysis in white adipose tissue. Our data demonstrate......We previously reported that mice deficient in acyl-CoA-binding protein (ACBP) display a delayed metabolic adaptation to weaning. This includes a delayed activation of the hepatic lipogenic gene program, which may result from hepatic accumulation of triacylglycerol and/or cholesteryl esters...... in the late suckling period. To further investigate the basis for this phenotype, we generated mice deficient in ACBP in hepatocytes (Alb-ACBP(-/-)) and keratinocytes (K14-ACBP(-/-)). Surprisingly, the delayed adaptation to weaning, including hepatic lipid accumulation, is caused by ACBP deficiency...

  9. Skin Pigmentation and Pigmentary Disorders: Focus on Epidermal/Dermal Cross-Talk.

    Science.gov (United States)

    Bastonini, Emanuela; Kovacs, Daniela; Picardo, Mauro

    2016-06-01

    Variation in human skin and hair color is the most notable aspect of human variability and several studies in evolution, genetics and developmental biology contributed to explain the mechanisms underlying human skin pigmentation, which is responsible for differences in skin color across the world's populations. Despite skin pigmentation is primarily related to melanocytes functionality, the surrounding keratinocytes and extracellular matrix proteins and fibroblasts in the underlying dermal compartment actively contribute to cutaneous homeostasis. Many autocrine/paracrine secreted factors and cell adhesion mechanisms involving both epidermal and dermal constituents determine constitutive skin pigmentation and, whenever deregulated, the occurrence of pigmentary disorders. In particular, an increased expression of such mediators and their specific receptors frequently lead to hyperpigmentary conditions, such as in melasma and in solar lentigo, whereas a defect in their expression/release is related to hypopigmented disorders, as seen in vitiligo. All these interactions underline the relevant role of pigmentation on human evolution and biology.

  10. Low-fluence CO2 laser irradiation: selective epidermal damage to human skin.

    Science.gov (United States)

    Kamat, B R; Tang, S V; Arndt, K A; Stern, R S; Noe, J M; Rosen, S

    1985-09-01

    The interaction of normal human skin with low-fluence CO2 laser irradiation was studied using a three-phase approach. In phase one, freshly excised skin was observed immediately after impact. In phase two, skin irradiated 2 h prior to excision was studied. In phase three, human volunteers were irradiated and biopsied at time zero, 24 h and 48 h. Seventy-five sites were exposed and 60 biopsies were performed. The earliest histologic changes were observed in the 6-10 J/cm2 fluence (radiant exposure) range and these changes included spindle and vacuolar changes in the basal layer of the epidermis. Papillary dermal coagulation was present to a maximum of 0.03 mm. At fluences of 10-25 J/cm2, superficial dermal necrosis (0.06-0.08 mm) was observed. At fluences above 25 J/cm2, transepidermal necrosis was present with increasing papillary dermal necrosis that was in proportion to the energy density delivered. At 2h, basal vacuolar changes were accompanied by diffuse keratinocytic cell death where contact was maintained between the epidermis and dermis, while where separation occurred limited keratinocytic death was observed. The earliest changes occurred at lower threshold fluences (4-6 J/cm2). After 24 h, these doses resulted in extensive epidermal necrosis with focal acute inflammatory infiltrates. At 48 h, the degree of epidermal "slough" was proportional to the energy density delivered and was maximal with a fluence of 5.7 J/cm2 delivered whereas with a fluence of 3.8 J/cm2 thin slough (0.02 mm) was observed. These findings suggest that low-dose CO2 laser irradiation may provide a new approach to selectively damage the epidermis with minimal dermal damage.

  11. Antioxidants protect keratinocytes against M. ulcerans mycolactone cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Alvar Grönberg

    Full Text Available BACKGROUND: Mycobacterium ulcerans is the causative agent of necrotizing skin ulcerations in distinctive geographical areas. M. ulcerans produces a macrolide toxin, mycolactone, which has been identified as an important virulence factor in ulcer formation. Mycolactone is cytotoxic to fibroblasts and adipocytes in vitro and has modulating activity on immune cell functions. The effect of mycolactone on keratinocytes has not been reported previously and the mechanism of mycolactone toxicity is presently unknown. Many other macrolide substances have cytotoxic and immunosuppressive activities and mediate some of their effects via production of reactive oxygen species (ROS. We have studied the effect of mycolactone in vitro on human keratinocytes--key cells in wound healing--and tested the hypothesis that the cytotoxic effect of mycolactone is mediated by ROS. METHODOLOGY/PRINCIPAL FINDINGS: The effect of mycolactone on primary skin keratinocyte growth and cell numbers was investigated in serum free growth medium in the presence of different antioxidants. A concentration and time dependent reduction in keratinocyte cell numbers was observed after exposure to mycolactone. Several different antioxidants inhibited this effect partly. The ROS inhibiting substance deferoxamine, which acts via chelation of Fe(2+, completely prevented mycolactone mediated cytotoxicity. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that mycolactone mediated cytotoxicity can be inhibited by deferoxamine, suggesting a role of iron and ROS in mycolactone induced cytotoxicity of keratinocytes. The data provide a basis for the understanding of Buruli ulcer pathology and the development of improved therapies for this disease.

  12. Metabolic Stress Drives Keratinocyte Defenses against Staphylococcus aureus Infection

    Directory of Open Access Journals (Sweden)

    Matthew Wickersham

    2017-03-01

    Full Text Available Human skin is commonly colonized and infected by Staphylococcus aureus. Exactly how these organisms are sensed by keratinocytes has not been clearly delineated. Using a combination of metabolic and transcriptomic methodologies, we found that S. aureus infection is sensed as a metabolic stress by the hypoxic keratinocytes. This induces HIF1α signaling, which promotes IL-1β production and stimulates aerobic glycolysis to meet the metabolic requirements of infection. We demonstrate that staphylococci capable of glycolysis, including WT and agr mutants, readily induce HIF1α responses. In contrast, Δpyk glycolytic mutants fail to compete with keratinocytes for their metabolic needs. Suppression of glycolysis using 2-DG blocked keratinocyte production of IL-1β in vitro and significantly exacerbated the S. aureus cutaneous infection in a murine model. Our data suggest that S. aureus impose a metabolic stress on keratinocytes that initiates signaling necessary to promote both glycolysis and the proinflammatory response to infection.

  13. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2017-12-07

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Cooperative Synthesis of Ultra Long-Chain Fatty Acid and Ceramide during Keratinocyte Differentiation.

    Directory of Open Access Journals (Sweden)

    Yukiko Mizutani

    Full Text Available The lipid lamellae in the stratum corneum is important for the epidermal permeability barrier. The lipid lamellae component ceramide (CER, comprising an ultra long-chain (ULC fatty acid (FA of ≥26 carbons (ULC CER, plays an essential role in barrier formation. ULC acyl-CoAs, produced by the FA elongase ELOVL4, are converted to ULC CERs by the CER synthase CERS3. In the presented study, we observed that ELOVL4 and CERS3 mRNAs increased during keratinocyte differentiation in vivo and in vitro. We also determined that peroxisome proliferator-activated receptor β/δ is involved in the up-regulation of the mRNAs. Knockdown of CERS3 caused a reduction in the elongase activities toward ULC acyl-CoAs, suggesting that CERS3 positively regulates ULCFA. Thus, we reveal that the two key players in ULC CER production in epidermis, CERS3 and ELOVL4, are coordinately regulated at both the transcriptional and enzymatic levels.

  15. Proteomic analysis of low dose arsenic and ionizing radiation exposure on keratinocytes.

    Science.gov (United States)

    Berglund, Susanne R; Santana, Alison R; Li, Dan; Rice, Robert H; Rocke, David M; Goldberg, Zelanna

    2009-04-01

    Human exposure to arsenic and ionizing radiation (IR) occur environmentally at low levels. While the human health effects of arsenic and IR have been examined separately, there is little information regarding their combined effects at doses approaching environmental levels. Arsenic toxicity may be affected by concurrent IR especially given their known individual carcinogenic actions at higher doses. We found that keratinocytes responded to either low dose arsenic and/or low dose IR exposure, resulting in differential proteomic expression based on 2-DE, immunoblotting and statistical analysis. Seven proteins were identified that passed a rigorous statistical screen for differential expression in 2-DE and also passed a strict statistical screen for follow-up immunoblotting. These included: alpha-enolase, epidermal-fatty acid binding protein, heat shock protein 27, histidine triad nucleotide-binding protein 1, lactate dehydrogenase A, protein disulfide isomerase precursor, and S100A9. Four proteins had combined effects that were different than would be expected based on the response to either individual toxicant. These data demonstrate a possible reaction to the combined insult that is substantially different from that of either separate treatment. Several proteins had different responses than what has been seen from high dose exposures, adding to the growing literature suggesting that the cellular responses to low dose exposures are distinct.

  16. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  17. Identification of TROP2 (TACSTD2), an EpCAM-like molecule, as a specific marker for TGF-β1-dependent human epidermal Langerhans cells.

    Science.gov (United States)

    Eisenwort, Gregor; Jurkin, Jennifer; Yasmin, Nighat; Bauer, Thomas; Gesslbauer, Bernhard; Strobl, Herbert

    2011-10-01

    Langerin (CD207) expression is a hallmark of epidermal Langerhans cells (LCs); however, CD207(+) cells comprise several functional subsets. Murine studies showed that epidermal, but not dermal, CD207(+) cells require transforming growth factor-β 1 (TGF-β1) for development, whereas human data are lacking. Using gene profiling, we found that the surface molecule TROP2 (TACSTD2) is strongly and rapidly induced during TGF-β1-dependent LC commitment of human CD34(+) hematopoietic progenitor cells or monocytes. TROP2 is conserved between mouse and human, and shares substantial amino-acid identity with EpCAM, a marker for murine epidermal LCs. To our knowledge, neither TROP2 nor EpCAM expression has been analyzed in human dendritic cell (DC) subsets. We found that (i) all human epidermal LCs are TROP2(+)EpCAM(+); (ii) human dermis lacks CD207(+)EpCAM(-) or CD207(+)TROP2(-) DCs, i.e., equivalents of murine dermal CD207(+) DCs; and (iii) pulmonary CD207(+) cells are TROP2(-)EpCAM(-). Moreover, although EpCAM was broadly expressed by pulmonary and intestinal epithelial cells, as well as by bone marrow erythroid progenitor cells, these cells lacked TROP2. However, although TROP2 is expressed by human LCs as well as by human and murine keratinocytes, most murine LCs, except of a small subset, lacked TROP2. Therefore, TROP2 is a marker for human TGF-β1-dependent epidermal LCs.

  18. Epidermal electronic systems for sensing and therapy

    Science.gov (United States)

    Lu, Nanshu; Ameri, Shideh K.; Ha, Taewoo; Nicolini, Luke; Stier, Andrew; Wang, Pulin

    2017-04-01

    Epidermal electronic system is a class of hair thin, skin soft, stretchable sensors and electronics capable of continuous and long-term physiological sensing and clinical therapy when applied on human skin. The high cost of manpower, materials, and photolithographic facilities associated with its manufacture limit the availability of disposable epidermal electronics. We have invented a cost and time effective, completely dry, benchtop "cut-and-paste" method for the green, freeform and portable manufacture of epidermal electronics within minutes. We have applied the "cut-and-paste" method to manufacture epidermal electrodes, hydration and temperature sensors, conformable power-efficient heaters, as well as cuffless continuous blood pressure monitors out of metal thin films, two-dimensional (2D) materials, and piezoelectric polymer sheets. For demonstration purpose, we will discuss three examples of "cut-and-pasted" epidermal electronic systems in this paper. The first will be submicron thick, transparent epidermal graphene electrodes that can be directly transferred to human skin like a temporary transfer tattoo and can measure electrocardiogram (ECG) with signal-to-noise ratio and motion artifacts on par with conventional gel electrodes. The second will be a chest patch which houses both electrodes and pressure sensors for the synchronous measurements of ECG and seismocardiogram (SCG) such that beat-to-beat blood pressure can be inferred from the time interval between the R peak of the ECG and the AC peak of the SCG. The last example will be a highly conformable, low power consumption epidermal heater for thermal therapy.

  19. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ERT2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ERT2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  20. Effects of lunar and mars dust simulants on HaCaT keratinocytes and CHO-K1 fibroblasts

    Science.gov (United States)

    Rehders, Maren; Grosshäuser, Bianka B.; Smarandache, Anita; Sadhukhan, Annapurna; Mirastschijski, Ursula; Kempf, Jürgen; Dünne, Matthias; Slenzka, Klaus; Brix, Klaudia

    2011-04-01

    Exposure to lunar dust during Apollo missions resulted in occasional reports of oc