WorldWideScience

Sample records for epidermal keratinocytes cultured

  1. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  2. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  3. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  4. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  5. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  6. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  7. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  8. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  9. Frozen cultured sheets of epidermal keratinocytes in reepithelialization and repair of the cornea after photorefractive keratectomy.

    Science.gov (United States)

    Castro-Muñozledo, Federico; Ozorno-Zarate, Jorge; Naranjo-Tackman, Ramon; Kuri-Harcuch, Walid

    2002-09-01

    To determine whether frozen cultured sheets of human allogeneic epidermal keratinocytes (CEAK) improved wound repair after experimental corneal ablation by photorefractive keratectomy (PRK). Hospital "Luis Sanchez Bulnes" de la Asociación para Evitar la Ceguera en Mexico, I.A.P, and Department of Cell Biology, CINVESTAV-IPN, Mexico City, Mexico. Transepithelial PRK was performed in the right eye of male albino rabbits to obtain a 112 microm deep and 6.0 mm diameter ablation zone. In 17 eyes, the ablations were covered with frozen CEAK; in 11 eyes, the ablations were covered with a disposable contact lens without the cultured sheets; and in the control group (13 eyes), the ablations were not covered. Subepithelial fibrosis and reepithelialization of the ablated zone were evaluated in serial paraffin-embedded tissue sections from all wounds. Treatment with CEAK reduced fibroblast proliferation and the inflammatory response beneath the ablated zone and produced better organization of the newly formed epithelium by eliminating significant hyperplasia or discontinuities in the periodic acid Shiff-stained basement membrane. It also led to accelerated reepithelialization. The use of frozen CEAK as a biologically active wound dressing improved tissue repair at 1 month in corneas ablated by transepithelial PRK in the male albino rabbit model. Treatment with CEAK could improve the outcome of PRK in humans.

  10. The control of epidermal stem cells (holoclones) in the treatment of massive full-thickness burns with autologous keratinocytes cultured on fibrin.

    Science.gov (United States)

    Pellegrini, G; Ranno, R; Stracuzzi, G; Bondanza, S; Guerra, L; Zambruno, G; Micali, G; De Luca, M

    1999-09-27

    Cell therapy is an emerging therapeutic strategy aimed at replacing or repairing severely damaged tissues with cultured cells. Epidermal regeneration obtained with autologous cultured keratinocytes (cultured autografts) can be life-saving for patients suffering from massive full-thickness burns. However, the widespread use of cultured autografts has been hampered by poor clinical results that have been consistently reported by different burn units, even when cells were applied on properly prepared wound beds. This might arise from the depletion of epidermal stem cells (holoclones) in culture. Depletion of holoclones can occur because of (i) incorrect culture conditions, (ii) environmental damage of the exposed basal layer of cultured grafts, or (iii) use of new substrates or culture technologies not pretested for holoclone preservation. The aim of this study was to show that, if new keratinocyte culture technologies and/or "delivery systems" are proposed, a careful evaluation of epidermal stem cell preservation is essential for the clinical performance of this life-saving technology. Fibrin was chosen as a potential substrate for keratinocyte cultivation. Stem cells were monitored by clonal analysis using the culture system originally described by Rheinwald and Green as a reference. Massive full-thickness burns were treated with the composite allodermis/cultured autograft technique. We show that: (i) the relative percentage of holoclones, meroclones, and paraclones is maintained when keratinocytes are cultivated on fibrin, proving that fibrin does not induce clonal conversion and consequent loss of epidermal stem cells; (ii) the clonogenic ability, growth rate, and long-term proliferative potential are not affected by the new culture system; (iii) when fibrin-cultured autografts bearing stem cells are applied on massive full-thickness burns, the "take" of keratinocytes is high, reproducible, and permanent; and (iv) fibrin allows a significant reduction of the cost

  11. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  12. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Differentiation of human scalp hair follicle keratinocytes in culture.

    Science.gov (United States)

    Weterings, P J; Verhagen, H; Wirtz, P; Vermorken, A J

    1984-01-01

    The morphology of human scalp hair follicle keratinocytes, cultured on the bovine eye lens capsule, is studied by light and electron microscopy. The hair follicle keratinocytes in the stratified cultures are characterized by the presence of numerous tonofilaments, desmosomes and lysosomes and by the presence of glycogen accumulations. The cells in the upper layers develop a cornified envelope. Moreover, an incomplete basal lamina is found between the capsule and the basal cells. However, some features of epidermal keratinocytes in vivo, such as keratohyalin granules and stratum corneum formation, are absent. Analysis of the polypeptides by sodium dodecylsulfate polyacrylamide gel electrophoresis also reveals differences between the cultured hair follicle cells and epidermis, whilst the patterns of cultured cells and hair follicle sheaths are similar. The morphological and protein biosynthetic aspects of terminal differentiation of the keratinocytes in vitro are correlated. These results are discussed in the light of the findings with cultured epidermal keratinocytes, reported in the literature.

  14. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  15. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  16. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  17. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  18. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  19. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  20. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  1. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  2. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  4. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    International Nuclear Information System (INIS)

    Shi, Ge; Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin; Ou, Bai-sheng; Kim, Sooil; Lee, Young Ho; Yoon, Tae-Jin; Kim, Seong-Jin; Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon; Kim, Chang Deok

    2010-01-01

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  5. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Ge [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Ou, Bai-sheng [Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Kim, Sooil; Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Kim, Seong-Jin [Department of Dermatology, Chonnam National University Medical School, Gwangju, 501-757 (Korea, Republic of); Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Kim, Chang Deok, E-mail: cdkimd@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of)

    2010-11-15

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  6. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  7. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  8. Gelatin for purification and proliferation of primary keratinocyte culture for use in chronic wounds and burns.

    Science.gov (United States)

    Rahsaz, Marjan; Geramizadeh, Bita; Kaviani, Maryam; Marzban, Saeed

    2015-04-01

    Human epidermal keratinocytes are currently established as a treatment for burns and wounds and have laboratory applications. Keratinocyte culture contamination by unwanted cells and inhibition of cell proliferation are barriers in primary keratinocyte culture. According to the recent literature, these cells are hard to culture. The present study was conducted to evaluate the efficacy of gelatin-coated surfaces in keratinocyte cultures. After enzymatic isolation of keratinocytes from normal epidermis by trypsin, the cells were cultured on gelatin-coated flasks in serum-free medium. Another group of cells were cultured as a control group without gelatin coating. We showed positive effects of surface coating with gelatin on the primary culture of keratinocytes. Culture of these cells on a gelatincoated surface showed better proliferation with suitable morphology. By using gelatin, adhesion of these cells to the surface was more efficient and without contamination by small round cells. Successful primary culture of keratinocytes on a gelatin-coated surface may provide better yield and optimal number of cells for research and clinical applications.

  9. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  10. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  12. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  13. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  14. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  15. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  16. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  17. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  18. Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J.; Cruickshank, Sheena M.

    2014-01-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion. PMID:25015889

  19. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  20. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  1. Markedly diminished epidermal keratinocyte expression of intercellular adhesion molecule-1 (ICAM-1) in Sezary syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))

    1989-04-21

    In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.

  2. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  3. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  4. Extracellular calcium alters the effects of retinoic acid on DNA synthesis in cultured murine keratinocytes

    International Nuclear Information System (INIS)

    Tong, P.; Mayes, D.; Wheeler, L.

    1986-01-01

    The rate of proliferation of epidermal keratinocytes was manipulated by growing the cells in medium containing high or low concentrations of calcium. Keratinocytes cultured in high extracellular Ca ++ (1.4 mM and 2.8 mM) proliferated twice as fast as those grown in low Ca ++ medium (0.09 mM) as measured by incorporation of [ 3 H] thymidine into DNA. Exposure of high calcium keratinocytes to all-trans retinoic acid for 4 days caused a dose-related inhibition of DNA synthesis with an IC 50 of about 10 μM. In contrast, incubating low calcium keratinocytes with all-trans retinoic acid caused a dose-related stimulation of DNA synthesis with maximum increase of 278% over control at 10 μM. This increase was accompanied by increases in culture confluency with maximum increase of 109% in cell number of control at 10 μM. These results are of importance since they suggest Ca ++ may influence the effect of retinoids on keratinocytes

  5. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  6. Interleukin 1 gene expression in cultured human keratinocytes is augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Kupper, T.S.; Chua, A.O.; Flood, P.; McGuire, J.; Gubler, U.

    1987-01-01

    Interleukin 1 (IL-1) is a family of polypeptides initially found to be produced by activated monocytes and macrophages that mediate a wide variety of cellular responses to injury and infection. Epidermal epithelial cells (keratinocytes) produce ''epidermal cell-derived thymocyte activating factor'' or ETAF, which has been recently shown to be identical to IL-1. Human epidermis is normally exposed to significant amounts of solar ultraviolet radiation. Certain ultraviolet wavelengths (UVB, 290-320 nm) are thought to be responsible for most of the immediate and long-term pathological consequences of excessive exposure to sunlight. In this study, we asked whether exposure to UVB irradiation induced IL-1 gene expression in cultured human keratinocytes. Cultured human keratinocytes contain detectable amounts of IL-1 alpha and beta mRNA and protein in the absence of apparent stimulation; these levels could be significantly enhanced 6 h after exposure to 10 ng/ml of 12-O-tetradecanoyl-phorbol-13-acetate (TPA). Exposure to UVB irradiation with an emission spectrum comparable to that of sunlight (as opposed to that of an unfiltered artificial UV light source) significantly increased the steady state levels IL-1 alpha and beta mRNA in identical populations of human keratinocytes. This was reflected in the production of increased IL-1 activity by these cultures in vitro. In the same cell population, exposures to UVB irradiation did not alter the level of actin mRNA; therefore, the effect of UV irradiation on IL-1 represents a specific enhancement of IL-1 gene expression. Local increases of IL-1 may mediate the inflammation and vasodilation characteristic of acute UVB-injured skin, and systemic release of this epidermal IL-1 may account for fever, leukocytosis, and the acute phase response seen after excessive sun exposure

  7. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  8. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  9. Cytoskeleton and pericellular matrix organization of pure adult human keratinocytes cultured from suction-blister roof epidermis.

    Science.gov (United States)

    Kariniemi, A L; Lehto, V P; Vartio, T; Virtanen, I

    1982-12-01

    Pure adult human keratinocyte cultures were raised from suction-blister roof epidermis and cultured in MCDB-151 medium. In primary culture the epidermal cells rapidly adhered, spread and began to proliferate on collagen-coated growth substrata but not on uncoated plastic or glass substrata. A fibrillar keratin-specific fluorescence, showing a typical cell-cell arrangement, was seen in all cells in indirect immunofluorescence microscopy, whereas only some cells also showed vimentin-specific staining. A fine fibrillar fibronectin-specific surface staining was seen at the margin of attaching cells and in marginal cells of spreading cell islands, whereas no fluorescence could be seen in epidermal cells, with antibodies against type IV collagen or laminin. Interestingly, the marginal cells also showed intracellular fibronectin. The synthesis of fibronectin in epidermal cell cultures could also be revealed by metabolic labelling experiments with [35S]methionine. In contrast to primary cultures, subcultivated keratinocytes also adhered to uncoated plastic and glass substrata. After subcultivation, keratin and surface fibronectin distribution remained unaltered but after some subcultivations, most of the cells also showed fibrillar vimentin and expressed fibronectin intracellularly. The results show that the suction-blister method provides an easy way to obtain pure epidermal cell cultures without contaminating mesenchymal cells. Our results also suggest a direct role for fibronectin but not for collagen type IV or laminin in adhesion and spreading of epidermal cells in vitro.

  10. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  11. Micronucleus formation in cultured human keratinocytes: Involvement of intercellular bioactivation.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Weterings, P J

    1991-01-01

    Micronucleus formation in cultured human keratinocytes was studied after exposure to benzo[a]pyrene, cyclophosphamide and 12-O-tetradecanoylphorbol-13-acetate without the addition of an exogenous metabolizing system. The first two agents need bioactivation by specific isoenzymes of cytochrome P-450 to form genotoxic intermediates. Benzo[a]pyrene induced the micronucleus formation in both uninduced and Aroclor 1254-pretreated cultures. Clastogenic effects of cyclophosphamide were observed only in Aroclor 1254-pretreated cells. The tumour promotor 12-O-tetradecanoylphorbol-13-acetate did not affect the frequency of micronuclei in human keratinocytes. The data indicate that cultured human keratinocytes can be used to study the tissue-specific response to genotoxic agents as well as interindividual variation in biotransformation capacity.

  12. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  13. AMPK regulation of the growth of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Saha, Asish K.; Persons, Kelly; Safer, Joshua D.; Luo Zhijun; Holick, Michael F.; Ruderman, Neil B.

    2006-01-01

    AMP kinase (AMPK) is a fuel sensing enzyme that responds to cellular energy depletion by increasing processes that generate ATP and inhibiting others that require ATP but are not acutely necessary for survival. In the present study, we examined the relationship between AMPK activation and the growth (proliferation) of cultured human keratinocytes and assessed whether the inhibition of keratinocyte growth by vitamin D involves AMPK activation. In addition, we explored whether the inhibition of keratinocyte proliferation as they approach confluence could be AMPK-related. Keratinocytes were incubated for 12 h with the AMPK activator, 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR). At concentrations of 10 -4 and 10 -3 M, AICAR inhibited keratinocyte growth by 50% and 95%, respectively, based on measurements of thymidine incorporation into DNA. It also increased AMPK and acetyl CoA carboxylase phosphorylation (P-AMPK and P-ACC) and decreased the concentration of malonyl CoA confirming that AMPK activation had occurred. Incubation with the thiazolidinedione, troglitazone (10 -6 M) caused similar alterations in P-AMPK, P-ACC, and cell growth. In contrast, the well known inhibition of keratinocyte growth by 1,25-dihydroxyvitamin D 3 (10 -7 and 10 -6 M) was not associated with changes in P-AMPK or P-ACC. Like most cells, the growth of keratinocytes diminished as they approached confluence. Thus, it was of note that we found a progressive increase in P-AMPK (1.5- to 2-fold, p 3 is AMPK-independent

  14. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  15. Photodynamic toxicity of hematoporphyrin derivatives to human keratinocytes in culture.

    Science.gov (United States)

    Kappus, H; Reinhold, C; Artuc, M

    Human keratinocytes in culture were able to take up hematoporphyrin derivatives (HPDs) used during photodynamic chemotherapy of tumors. In the absence of light, HPDs showed no cytotoxic effects to keratinocytes. However, after irradiation with visible light, HPDs induced immediate cytotoxicity as measured by the neutral red uptake assay. On the other hand, cell attachment as measured by protein estimation was not affected. When the cells treated with HPDs and irradiated with light were cultured for a further 72 h, they partially lost their ability to attach to the collagen surface. Most of the cells remaining attached after 72 h were no longer viable following treatment with HPDs and light. All parameters measured depended on the intracellular concentration of HPDs used (7-50 ng/10(5) cells) and the time of irradiation (0-30 min). These results suggest that human keratinocytes are a good model to study cytotoxic effects of photodynamically active drugs. Further, keratinocytes were unable to recover after damage caused by HPDs and light.

  16. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  17. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  18. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  19. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  20. Characterization of A Three-Dimensional Organotypic Co-Culture Skin Model for Epidermal Differentiation of Rat Adipose-Derived Stem Cells.

    Science.gov (United States)

    Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar

    2016-01-01

    The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.

  1. Allogeneic cultured keratinocytes vs. cadaveric skin to cover wide-mesh autogenous split-thickness skin grafts.

    Science.gov (United States)

    Monstrey, S; Beele, H; Kettler, M; Van Landuyt, K; Blondeel, P; Matton, G; Naeyaert, J M

    1999-09-01

    Improved shock therapy has extended the limits of survival in patients with massive burns, and nowadays skin coverage has become the major problem in burn management. The use of mesh skin grafts is still the simplest technique to expand the amount of available donor skin. However, very wide-mesh skin grafts take a very long time to heal, often resulting in unaesthetic scar formation. On the other hand, allogeneic cultured keratinocytes have been reported as a natural source of growth factors and thus could be useful to improve wound healing of these wide-mesh grafts. A clinical study was performed to compare the use of cryopreserved allogeneic cultured keratinocytes vs. the traditional cadaveric skin as a double layer over widely expanded autogenous skin grafts. This procedure was performed in 18 pairs of full-thickness burn wounds (with similar depth and location) in 11 severely burned patients. Early clinical evaluation was made at 2, 3, and 4 to 5 weeks. Parameters such as epithelialization, granulation tissue formation, infection, and scar formation were evaluated. Biopsies were taken to compare the histological characteristics of the epidermis, the epidermal-dermal junction, and the dermis. Late evaluations were performed at 6 and 12 months regarding color, softness, thickness, and subjective feeling of the scar tissue. Aside from a faster (p keratinocyte group at 2 weeks, there were no statistically different results in any of the early evaluated parameters, neither clinically nor histologically. At long-term follow-up, clinical results and scar characteristics were not significantly different in the two compared groups. It is concluded from the results of this study that, during the early phase, epithelialization was faster with allogeneic cultured keratinocytes compared with cadaveric skin. However, taking into account the substantial difference in costs, the described use of cryopreserved allogeneic cultured keratinocytes as a double layer on meshed

  2. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  3. Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model.

    Directory of Open Access Journals (Sweden)

    Rebecca Lamb

    Full Text Available Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.

  4. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  5. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  6. Generation of organotypic raft cultures from primary human keratinocytes.

    Science.gov (United States)

    Anacker, Daniel; Moody, Cary

    2012-02-22

    The development of organotypic epithelial raft cultures has provided researchers with an efficient in vitro system that faithfully recapitulates epithelial differentiation. There are many uses for this system. For instance, the ability to grow three-dimensional organotypic raft cultures of keratinocytes has been an important milestone in the study of human papillomavirus (HPV)(1). The life cycle of HPV is tightly linked to the differentiation of squamous epithelium(2). Organotypic epithelial raft cultures as demonstrated here reproduce the entire papillomavirus life cycle, including virus production(3,4,5). In addition, these raft cultures exhibit dysplastic lesions similar to those observed upon in vivo infection with HPV. Hence this system can also be used to study epithelial cell cancers, as well as the effect of drugs on epithelial cell differentiation in general. Originally developed by Asselineau and Prunieras(6) and modified by Kopan et al.(7), the organotypic epithelial raft culture system has matured into a general, relatively easy culture model, which involves the growth of cells on collagen plugs maintained at an air-liquid interface (Figure 1A). Over the course of 10-14 days, the cells stratify and differentiate, forming a full thickness epithelium that produces differentiation-specific cytokeratins. Harvested rafts can be examined histologically, as well as by standard molecular and biochemical techniques. In this article, we describe a method for the generation of raft cultures from primary human keratinocytes. The same technique can be used with established epithelial cell lines, and can easily be adapted for use with epithelial tissue from normal or diseased biopsies(8). Many viruses target either the cutaneous or mucosal epithelium as part of their replicative life cycle. Over the past several years, the feasibility of using organotypic raft cultures as a method of studying virus-host cell interactions has been shown for several herpesviruses, as

  7. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  8. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

  9. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872 ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  10. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Keratinocytes at the uppermost layer of epidermis might act as sensors of atmospheric pressure change.

    Science.gov (United States)

    Denda, Mitsuhiro

    2016-01-01

    It has long been suggested that climate, especially atmospheric pressure change, can cause health problems ranging from migraine to myocardial infarction. Here, I hypothesize that the sensory system of epidermal keratinocytes mediates the influence of atmospheric pressure change on the human physiological condition. We previously demonstrated that even subtle changes of atmospheric pressure (5-20 hPa) induce elevation of intracellular calcium level in cultured human keratinocytes (excitation of keratinocytes). It is also established that communication occurs between epidermal keratinocytes and peripheral nerve systems. Moreover, various neurotransmitters and hormones that influence multiple systems (nervous, cardiovascular, endocrine, and immune systems) are generated and released from epidermal keratinocytes in response to various external stimuli. Thus, I suggest that pathophysiological phenomena induced by atmospheric pressure changes might be triggered by epidermal keratinocytes.

  12. Comparative studies of types 1 and 2 herpes simplex virus infection of cultured normal keratinocytes.

    OpenAIRE

    Su, S J; Wu, H H; Lin, Y H; Lin, H Y

    1995-01-01

    AIMS--To investigate the differences in biological properties, multiplication patterns, and cytopathic effects between type 1 and type 2 herpes simplex virus (HSV) through the replication of HSV in cultured normal human keratinocytes. METHODS--Keratinocytes were obtained from surgical specimens of normal gingiva, cervix, trunk skin, and newborn foreskin. They were cultured in serum free, chemically defined, culture medium and infected with a pool of HSV collected from clinical specimens. RESU...

  13. Making more matrix: enhancing the deposition of dermal-epidermal junction components in vitro and accelerating organotypic skin culture development, using macromolecular crowding.

    Science.gov (United States)

    Benny, Paula; Badowski, Cedric; Lane, E Birgitte; Raghunath, Michael

    2015-01-01

    Skin is one of the most accessible tissues for experimental biomedical sciences, and cultured skin cells represent one of the longest-running clinical applications of stem cell therapy. However, culture-generated skin mimetic multicellular structures are still limited in their application by the time taken to develop these constructs in vitro and by their incomplete differentiation. The development of a functional dermal-epidermal junction (DEJ) is one of the most sought after aspects of cultured skin, and one of the hardest to recreate in vitro. At the DEJ, dermal fibroblasts and epidermal keratinocytes interact to form an interlinked basement membrane of extracellular matrix (ECM), which forms as a concerted action of both keratinocytes and fibroblasts. Successful formation of this basement membrane is essential for take and stability of cultured skin autografts. We studied interactive matrix production by monocultures and cocultures of primary human keratinocytes and fibroblasts in an attempt to improve the efficiency of basement membrane production in culture using mixed macromolecular crowding (mMMC); resulting ECM were enriched with the deposition of collagens I, IV, fibronectin, and laminin 332 (laminin 5) and also in collagen VII, the anchoring fibril component. Our in vitro data point to fibroblasts, rather than keratinocytes, as the major cellular contributors of the DEJ. Not only did we find more collagen VII production and deposition by fibroblasts in comparison to keratinocytes, but also observed that decellularized fibroblast ECM stimulated the production and deposition of collagen VII by keratinocytes, over and above that of keratinocyte monocultures. In confrontation cultures, keratinocytes and fibroblasts showed spontaneous segregation and demarcation of cell boundaries by DEJ protein deposition. Finally, mMMC was used in a classical organotypic coculture protocol with keratinocytes seeded over fibroblast-containing collagen gels. Applied during

  14. Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

    DEFF Research Database (Denmark)

    Kuntsche, Judith; Herre, Angela; Fahr, Alfred

    2013-01-01

    barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

  15. Acellular porcine xenodermis as a temporary wound cover and substratum for cultured keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Stehlíček, P.; Veselý, Pavel

    2002-01-01

    Roč. 4, - (2002), s. 83-85 ISSN 1473-2262 Institutional research plan: CEZ:AV0Z5052915 Keywords : wound healing * cultured keratinocytes * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  16. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

    Directory of Open Access Journals (Sweden)

    Santosh K Katiyar

    Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

  17. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  18. Toll like receptors gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Cornick, Sarita Mac; Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Cezillo, Marcus V B; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    To evaluate the expression profile of genes related to Toll Like Receptors (TLR) pathways of human Primary Epidermal keratinocytes of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific TLR pathways PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 21% of these genes were differentially expressed, of which 100% were repressed or hyporegulated. Among these, the following genes (fold decrease): HSPA1A (-58), HRAS (-36), MAP2K3 (-23), TOLLIP (-23), RELA (-18), FOS (-16), and TLR1 (-6.0). This study contributes to the understanding of the molecular mechanisms related to TLR pathways and underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  19. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  20. Epidermal growth factor induction of front–rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2

    Science.gov (United States)

    Ho, Ernest; Dagnino, Lina

    2012-01-01

    Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front–rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front–rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front–rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front–rear polarity and forward movement. PMID:22160594

  1. Epidermal growth factor induction of front-rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2.

    Science.gov (United States)

    Ho, Ernest; Dagnino, Lina

    2012-02-01

    Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front-rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front-rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front-rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front-rear polarity and forward movement.

  2. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  3. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed

  4. Correlation of initiating potency of skin carcinogens with potency to induce resistance to terminal differentiation in cultured mouse keratinocytes

    International Nuclear Information System (INIS)

    Kilkenny, A.E.; Morgan, D.; Spangler, E.F.; Yuspa, S.H.

    1985-01-01

    The induction by chemical carcinogens of resistance to terminal differentiation in cultured mouse keratinocytes has been proposed to represent a cellular change associated with the initiation phase of skin carcinogenesis. Previous results with this culture model indicated that the number of differentiation-resistant foci was correlated with the dose and known potency for several chemical carcinogens. Assay conditions were optimized to provide quantitative results for screening a variety of carcinogens for their potency as inducers of foci resistant to terminal differentiation. Eight skin initiators of varying potency and from different chemical classes and ultraviolet light were studied for their activity to induce this alteration in cultured epidermal cells from newborn BALB/c mice. There was an excellent positive correlation for the potency of these agents as initiators in vivo and as inducers of altered differentiation in vitro. The induction of resistant foci was independent of the relative cytotoxic effects of each agent except where cytotoxicity was extensive and reduced the number of foci. The results support the hypothesis that initiation of carcinogenesis in skin results in an alteration in the program of epidermal cell differentiation. The results also suggest that the assay is useful for identifying relative potency classes (strong, moderate, weak) of initiating agents

  5. Serially cultured keratinocytes from human scalp hair follicles: a tool for cytogenetic studies.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Jansen, B A; Vermorken, A J

    1983-01-01

    Keratinocytes originating from adult human hair follicles, the most convenient biopsy tissue, can be serially cultured using a combination of two techniques. Primary cultures are established using plucked scalp hair follicles and the bovine eye lens capsule as a growth substrate. Subsequently, cells from these cultures are serially cultivated in the presence of irradiated 3T3 cells as feeders. By this combination of techniques many keratinocytes can be generated from one single hair follicle. These cultures, appropriately treated with colchicine, can provide an adequate number of metaphases suitable for chromosome studies.

  6. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  7. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  8. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  9. Outcome of burns treated with autologous cultured proliferating epidermal cells: a prospective randomized multicenter intrapatient comparative trial

    NARCIS (Netherlands)

    Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.

    2016-01-01

    Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  12. Micronucleus formation in cultured human keratinocytes following exposure to mitomycin C and cyclophosphamide.

    Science.gov (United States)

    van Pelt, F N; Haring, R M; Overkamp, M J; Weterings, P J

    1991-02-01

    A method is described to investigate the induction of micronuclei in cultured human keratinocytes after short-term exposure to known clastogenic agents. The cytokinesis-block method was applied to facilitate the scoring of micronucleated cells. Mitomycin C, a direct-acting compound, caused a 5-20-fold increase in micronuclei over the controls at the highest concentration tested (1 microgram/ml). Cyclophosphamide, an agent requiring metabolic activation, did not induce the formation of micronuclei in cultured keratinocytes. However, after pretreatment of the keratinocyte cultures with Aroclor 1254 for 72 h, exposure to cyclophosphamide resulted in a 3-fold increase in micronucleus frequency over the controls. No cytogenetic effect of Aroclor 1254 was observed in control experiments.

  13. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  14. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  15. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  16. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  17. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  18. The tryptophan-derived endogenous arylhydrocarbon receptor ligand 6-formylindolo[3,2-b]carbazole (FICZ) is a nanomolar UVA-photosensitizer in epidermal keratinocytes

    Science.gov (United States)

    Williams, Joshua D.; Cabello, Christopher M.; Qiao, Shuxi; Wondrak, Georg T.

    2014-01-01

    Endogenous UVA-chromophores may act as sensitizers of oxidative stress underlying cutaneous photoaging and photocarcinogenesis, but the molecular identity of non-DNA key chromophores displaying UVA-driven photodyamic activity in human skin remains largely undefined. Here we report that 6-formylindolo[3,2-b]carbazole (FICZ), a tryptophan photoproduct and endogenous high affinity aryl hydrocarbon receptor (AhR) agonist, acts as a nanomolar photosensitizer potentiating UVA-induced oxidative stress irrespective of AhR ligand activity. In human HaCaT and primary epidermal keratinocytes, photodynamic induction of apoptosis was elicited by the combined action of solar simulated UVA and FICZ, whereas exposure to the isolated action of UVA or FICZ did not impair viability. In a human epidermal tissue reconstruct, FICZ/UVA-cotreatment caused pronounced phototoxicity inducing keratinocyte cell death, and FICZ photodynamic activity was also substantiated in a murine skin exposure model. Array analysis revealed pronounced potentiation of cellular heat shock, ER stress, and oxidative stress response gene expression observed only upon FICZ/UVA-cotreatment. FICZ photosensitization caused intracellular oxidative stress, and comet analysis revealed introduction of formamidopyrimidine-DNA glycosylase (FPG)-sensitive oxidative DNA lesions suppressible by antioxidant cotreatment. Taken together, our data demonstrate that the endogenous AhR ligand FICZ displays nanomolar photodynamic activity representing a molecular mechanism of UVA-induced photooxidative stress potentially operative in human skin. PMID:25431849

  19. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  20. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  1. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    International Nuclear Information System (INIS)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao

    1996-01-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0 o C for 20 min and at 5 o C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0 o C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0 o C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author)

  2. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao [Hirosaki Univ., Aomori (Japan). School of Medicine

    1996-12-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0{sup o}C for 20 min and at 5{sup o}C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0{sup o}C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0{sup o}C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author).

  3. Eradication of damaged keratinocytes in cutaneous lichen planus forms demonstrated by evaluation of epidermal and follicular expression of CK15, indices of apoptosis and regulatory protein S100.

    Science.gov (United States)

    Upeniece, Ilze; Groma, Valerie; Skuja, Sandra; Cauce, Vinita

    The study of cytoskeleton arrangement and its contribution to survival of cell-to-cell contacts appears to be essential for understanding of numerous cellular and tissue processes. Applying CK15, S100 labeling and TUNEL reaction to cutaneous lichen planus subtypes, we found CK15 expression in the outer and inner root sheath of hair follicles, the basal epidermal layer, and eccrine glands. Its follicular expression was decreased in nearby inflammatory infiltrates. The CK15 immunopositivity was mostly described as weak (92.3%) for lichen planus but equally subdivided into weak, moderate and strong in lichen planopilaris (2 = 32.514; df = 4; p lichen planopilaris involving the scalp: 81.2 ±10.7; 87.8 ±10.7 and 88.0 ±10.5 for the basal, spinous and upper epidermal layers, respectively. S100 positive epidermal and follicular cells did not differ in the lesions demonstrated in the study groups; still immunoreactivity was more pronounced in the scalp region of lichen planopilaris. Damage of cell-to-cell contacts was confirmed by electron microscopy. Apart from immunocyte-mediated keratinocyte death, cytoskeleton-based injury and loss of cell-to-cell and matrix contacts may be of great importance, leading to eradication of degrading cells and thus contributing to the pathogenesis of lichen planus.

  4. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  5. Experimental model of cultured keratinocytes Modelo experimental de cultura de queratinócitos

    Directory of Open Access Journals (Sweden)

    Alfredo Gragnani

    2003-01-01

    Full Text Available The bioengineering research is essential in the development of ideal combination of biomaterials and cultured cells to produce the permanent wound coverage. The experimental model of cultured keratinocytes presents all steps of the culture, since the isolation of the keratinocytes, preparation of the human acellular dermis, preparation of the composite skin graft and their elevation to the air-liquid interface. The research in cultured keratinocytes model advances in two main ways: 1. optimization of the methods in vitro to the skin cells culture and proliferation and 2. developing biomaterials that present similar skin properties.A pesquisa em bioengenharia é primordial no desenvolvimento da combinação ideal de biomateriais e células cultivadas para produzir a cobertura definitiva das lesões. O modelo experimental da cultura de queratinócitos apresenta toda as etapas do cultivo, desde o isolamento dos queratinócitos, preparação da derme acelular humana, do enxerto composto e da sua elevação à interface ar-líquido. A pesquisa em modelo de cultura de queratinócitos desenvolve-se em duas vias principais: 1. otimização dos métodos in vitro para cultivo e proliferação de células da pele e 2. desenvolvimento de biomateriais que mimetizem as propriedades da pele.

  6. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  7. Ultraviolet radiation induces changes in membrane metabolism of human keratinocytes in culture

    International Nuclear Information System (INIS)

    De Leo, V.A.; Horlick, H.; Hanson, D.; Eisinger, M.; Harber, L.C.

    1984-01-01

    Human keratinocytes in culture were prelabeled with [ 3 H]arachidonic acid (AA) and then exposed to ultraviolet B radiation. Irradiated cells released labeled AA metabolites into media in a dose-dependent manner when compared to sham-irradiated cells. The response began immediately and continued for 24 h. Extracts from media were examined by high-performance liquid chromatography for identification of specific AA metabolites. Irradiated cells were stimulated to produce prostaglandin-like material (PGE2 and PGF2 alpha). These findings support the concept that the cell membrane of keratinocytes participates directly or indirectly in initiating the sunburn response. It is also felt that the metabolites formed following injury to the membrane are an integral component in the mediation of that response

  8. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  9. H-Ras activation promotes cytoplasmic accumulation and phosphoinositide 3-OH kinase association of beta-catenin in epidermal keratinocytes

    DEFF Research Database (Denmark)

    Espada, J; Pérez-Moreno, M; Braga, V M

    1999-01-01

    The mechanisms underlying downregulation of the cadherin/catenin complexes and beta-catenin signaling during tumor progression are not fully understood. We have analyzed the effect of oncogenic H-Ras on E-cadherin/catenin complex formation/stabilization and beta-catenin distribution in epidermal ...

  10. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    Klingbeil, Maria Fatima Guarizo

    2006-01-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  11. Wound-Healing Potential of Cultured Epidermal Sheets Is Unaltered after Lyophilization: A Preclinical Study in Comparison to Cryopreserved CES

    Directory of Open Access Journals (Sweden)

    H. Jang

    2013-01-01

    Full Text Available Lyophilized Cultured Epidermal Sheets (L-CES have been reported to be as effective as the cryopreserved CES (F-CES in treating skin ulcers. However, unlike F-CES, no preclinical study assessing wound-healing effects has been conducted for L-CES. The present study was set out to investigate the microstructure, cytokine profile, and wound-healing effects of L-CES in comparison to those of F-CES. Keratinocytes were cultured to prepare CES, followed by cryopreservation at −70°C and lyophilization. Under microscopic observation, intact cells with apparent intracellular junctions were observed in L-CES. The L-CES, like fresh CES, consisted of three to four well-maintained epidermal layers, as shown by the expression of keratins, involucrin, and p63. There were no differences in the epidermal layer or protein expression between L-CES and F-CES, and both CES were comparable to fresh CES. TGF-α, EGF, VEGF, IL-1α, and MMPs were detected in L-CES at levels similar to those in F-CES. In a mouse study, wounds treated with L-CES or F-CES completely healed at least 4 days faster than untreated wounds. CES-treated wounds completely healed by day 10, while the untreated wounds did not heal by day 14. Masson’s trichrome staining showed that collagen deposition in the CES-treated wounds was highly increased in the dermis of the wound center compared to that in the control wounds. Thus, this study demonstrates that L-CES is as clinically effective as F-CES for wound treatment.

  12. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  13. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  14. RNA-Seq Analysis of IL-1B and IL-36 Responses in Epidermal Keratinocytes Identifies a Shared MyD88-Dependent Gene Signature.

    Science.gov (United States)

    Swindell, William R; Beamer, Maria A; Sarkar, Mrinal K; Loftus, Shannon; Fullmer, Joseph; Xing, Xianying; Ward, Nicole L; Tsoi, Lam C; Kahlenberg, Michelle J; Liang, Yun; Gudjonsson, Johann E

    2018-01-01

    IL-36 cytokines have recently emerged as mediators of inflammation in autoimmune conditions including psoriasis vulgaris (PsV) and generalized pustular psoriasis (GPP). This study used RNA-seq to profile the transcriptome of primary epidermal keratinocytes (KCs) treated with IL-1B, IL-36A, IL-36B, or IL-36G. We identified some early IL-1B-specific responses (8 h posttreatment), but nearly all late IL-1B responses were replicated by IL-36 cytokines (24 h posttreatment). Type I and II interferon genes exhibited time-dependent response patterns, with early induction (8 h) followed by no response or repression (24 h). Altogether, we identified 225 differentially expressed genes (DEGs) with shared responses to all 4 cytokines at both time points (8 and 24 h). These involved upregulation of ligands ( IL1A, IL1B , and IL36G ) and activating proteases ( CTSS ) but also upregulation of inhibitors such as IL1RN and IL36RN . Shared IL-1B/IL-36 DEGs overlapped significantly with genes altered in PsV and GPP skin lesions, as well as genes near GWAS loci linked to autoimmune and autoinflammatory diseases (e.g., PsV, psoriatic arthritis, inflammatory bowel disease, and primary biliary cholangitis). Inactivation of MyD88 adapter protein using CRISPR/Cas9 completely abolished expression responses of such DEGs to IL-1B and IL-36G stimulation. These results provide a global view of IL-1B and IL-36 expression responses in epidermal KCs with fine-scale characterization of time-dependent and cytokine-specific response patterns. Our findings support an important role for IL-1B and IL-36 in autoimmune or autoinflammatory conditions and show that MyD88 adaptor protein mediates shared IL-1B/IL-36 responses.

  15. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  16. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  17. Significance of Ubiad1 for Epidermal Keratinocytes Involves More Than CoQ10 Synthesis: Implications for Skin Aging

    Directory of Open Access Journals (Sweden)

    Florian Labarrade

    2018-01-01

    Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.

  18. A hyaluronic acid membrane delivery system for cultured keratinocytes: clinical "take" rates in the porcine kerato-dermal model.

    Science.gov (United States)

    Myers, S R; Grady, J; Soranzo, C; Sanders, R; Green, C; Leigh, I M; Navsaria, H A

    1997-01-01

    The clinical take rates of cultured keratinocyte autografts are poor on a full-thickness wound unless a dermal bed is provided. Even under these circumstances two important problems are the time delay in growing autografts and the fragility of the grafts. A laser-perforated hyaluronic acid membrane delivery system allows grafting at early confluence without requiring dispase digestion to release grafts from their culture dishes. We designed this study to investigate the influence of this membrane on clinical take rates in an established porcine kerato-dermal grafting model. The study demonstrated a significant reduction in take as a result of halving the keratinocyte seeding density onto the membrane. The take rates, however, of grafts grown on the membrane at half or full conventional seeding density and transplanted to a dermal wound bed were comparable, if not better, than those of keratinocyte sheet grafts.

  19. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  20. Ultraviolet radiation can either suppress or induce expression of intercellular adhesion molecule 1 (ICAM-1) on the surface of cultured human keratinocytes

    International Nuclear Information System (INIS)

    Norris, D.A.; Lyons, M.B.; Middleton, M.H.; Yohn, J.J.; Kashihara-Sawami, M.

    1990-01-01

    Interactions of the ligand/receptor pair LFA-1(CD11a/CD18) and ICAM-1(CD54) initiate and control the cell-cell interactions of leukocytes and interactions of leukocytes with parenchymal cells in all phases of the immune response. Induction of the intercellular adhesion molecule 1 (ICAM-1) on the surface of epidermal keratinocytes has been proposed as an important regulator of contact-dependent aspects of cutaneous inflammation. Ultraviolet radiation (UVR) also modifies cutaneous inflammation, producing both up- and down-regulation of contact hypersensitivity. We have found that UVR has a biphasic effect on the induction of keratinocyte CD54. Using immunofluorescence and FACS techniques to quantitate cell-surface CD54 staining, we have shown that UVR significantly (p less than 0.01) inhibits keratinocyte CD54 induction by gamma interferon 24 h after irradiation. However, at 48, 72, and 96 h after UVR, CD54 expression is significantly induced to levels even greater than are induced by gamma interferon (20 U/ml). In addition, at 48, 72, or 96 h following UVR (30-100 mJ/cm2), the gamma-interferon-induced CD54 expression on human keratinocytes is also strongly (p less than 0.05 to p less than 0.001) enhanced. In this cell-culture system, gamma interferon and TNF-alpha are both strong CD54 inducers and are synergistic, but GM-CSF, TFG-beta, and IL-1 have no direct CD54-inducing effects. Thus the effects of UVR on CD54 induction are biphasic, producing inhibition at 24 h and induction at 48, 72, and 96 h. This effect on CD54 may contribute to the biphasic effects of UVR on delayed hypersensitivity in vivo. The early inhibition of ICAM-1 by UVR may also contribute to the therapeutic effects of UVR. We also speculate that the late induction of ICAM-1 by UVR might be an important step in the induction of photosensitive diseases such as lupus erythematosus

  1. Reconstruction of epidermis by grafting of keratinocytes cultured on polymer support--clinical study.

    Science.gov (United States)

    Dvoránková, Barbora; Holíková, Zuzana; Vacík, Jirí; Königová, Radana; Kapounková, Zuzana; Michálek, Jirí; Prádn, Martin; Smetana, Karel

    2003-03-01

    Extensive wound coverage still represents a challenge for contemporary medicine. We demonstrate the results of a clinical trial of the grafting of cultured keratinocytes directly on a polymer cultivation support in the treatment of skin defects in seriously burned patients and in patients with trophic ulcers. Wound closure was evaluated clinically. The morphology and phenotypic pattern of the reconstructed epidermis, including the basal lamina, as well as the presence of Langerhans cells, were evaluated immunocytochemically using a panel of monoclonal antibodies. All layers of the reconstructed epidermis were normally differentiated (cytokeratin immunocytochemistry). The basal lamina contained collagen type IV and laminin. The reconstructed epidermis was extensively colonized by Langerhans cells. The results of the described technology are encouraging, especially in patients after a burn injury. The described procedure is suitable for the treatment of skin defects in clinical practice.

  2. Laminin-5 Degradation Due to Mustard in Cultured Normal Human Epidermal Keratinocytes (NHEK)

    National Research Council Canada - National Science Library

    Ray, Prabhati; Jin, Xiannu; Leng, Yan; Li, Zhuangwu; Ray, Radharaman

    2003-01-01

    .... We observed that in NHEK, mustards degrade laminin-5. Calmodulin antagonist, W7 or the serine protease inhibitor, TLCK prior to mustard exposure prevented mustard-induced degradation of laminin-5...

  3. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  4. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2011-01-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  5. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  6. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  7. A flexible thermoresponsive cell culture substrate for direct transfer of keratinocyte cell sheets.

    Science.gov (United States)

    Praveen, Wulligundam; Madathil, Bernadette K; Sajin Raj, R S; Kumary, T V; Anil Kumar, P R

    2017-10-25

    Most cell sheet engineering systems require a support or carrier to handle the harvested cell sheets. In this study, polyethylene terephthalate-based overhead projection transparency sheets (OHPS) were subjected to surface hydrolysis by alkali treatment to increase pliability and hydrophilicity and enable poly(N-isopropylacrylamide-co-glycidylmethacrylate) copolymer (NGMA) coating to impart thermoresponsiveness. NGMA was applied on the modified OHPS by the technique of spin coating using an indigenously designed spin coater. The spin coating had the advantage of using low volumes of the polymer and a reduced coating time. The surface chemistry and thermoresponsive coating was analyzed by Fourier transform infrared spectroscopy and water contact angle. Human keratinocyte cells were cultured on the spin coated surface and scaffold-free cell sheets were successfully harvested by simple variation of temperature. These cell sheets were found to be viable, exhibited epithelial characteristic and cell-cell contact as confirmed by positive immunostaining for ZO-1. The integrity and morphology of the cell sheet was confirmed by stereomicroscopy and E-SEM. These results highlight the potential of the NGMA spin coated modified OHPS to serve as a thermoresponsive culture surface-cum-flexible transfer tool.

  8. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10.

    Science.gov (United States)

    Lee, Jeong-Won; Seok, Jin Kyung; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter can cause oxidative stress, inflammation, and premature skin aging. Marine plants such as Ecklonia cava Kjellman contain high amounts of polyphenolic antioxidants. The purpose of this study was to examine the antioxidative effects of E. cava extract in cultured keratinocytes exposed to airborne particulate matter with a diameter of <10  μ m (PM10). After the exposure of cultured HaCaT keratinocytes to PM10 in the absence and presence of E. cava extract and its constituents, cell viability and cellular lipid peroxidation were assessed. The effects of eckol and dieckol on cellular lipid peroxidation and cytokine expression were examined in human epidermal keratinocytes exposed to PM10. The total phenolic content of E. cava extract was the highest among the 50 marine plant extracts examined. The exposure of HaCaT cells to PM10 decreased cell viability and increased lipid peroxidation. The PM10-induced cellular lipid peroxidation was attenuated by E. cava extract and its ethyl acetate fraction. Dieckol more effectively attenuated cellular lipid peroxidation than eckol in both HaCaT cells and human epidermal keratinocytes. Dieckol and eckol attenuated the expression of inflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1 β , IL-6, and IL-8 in human epidermal keratinocytes stimulated with PM10. This study suggested that the polyphenolic constituents of E. cava , such as dieckol, attenuated the oxidative and inflammatory reactions in skin cells exposed to airborne particulate matter.

  9. Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1986-01-01

    Human keratinocytes in culture were labelled with 14 C-dihomo-gamma-linolenic acid, 14 C-arachidonic acid or 14 C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes

  10. Osteo-/odontogenic differentiation of induced mesenchymal stem cells generated through epithelial-mesenchyme transition of cultured human keratinocytes.

    Science.gov (United States)

    Yi, Jin-Kyu; Mehrazarin, Shebli; Oh, Ju-Eun; Bhalla, Anu; Oo, Jenessa; Chen, Wei; Lee, Min; Kim, Reuben H; Shin, Ki-Hyuk; Park, No-Hee; Kang, Mo K

    2014-11-01

    Revascularization of necrotic pulp has been successful in the resolution of periradicular inflammation; yet, several case studies suggest the need for cell-based therapies using mesenchymal stem cells (MSCs) as an alternative for de novo pulp regeneration. Because the availability of MSCs may be limited, especially in an aged population, the current study reports an alternative approach in generating MSCs from epidermal keratinocytes through a process called epithelial-mesenchymal transition (EMT). We induced EMT in primary normal human epidermal keratinocytes (NHEKs) by transient transfection of small interfering RNA targeting the p63 gene. The resulting cells were assayed for their mesenchymal marker expression, proliferation capacities as a monolayer and in a 3-dimensional collagen scaffold, and differentiation capacities. Transient transfection of p63 small-interfering RNA successfully abolished the expression of endogenous p63 in NHEKs and induced the expression of mesenchymal markers (eg, vimentin and fibronectin), whereas epithelial markers (eg, E-cadherin and involucrin) were lost. The NHEKs exhibiting the EMT phenotype acquired extended replicative potential and an increased telomere length compared with the control cells. Similar to the established MSCs, the NHEKs with p63 knockdown showed attachment onto the 3-dimensional collagen scaffold and underwent progressive proliferation and differentiation. Upon differentiation, these EMT cells expressed alkaline phosphatase activity, osteocalcin, and osteonectin and readily formed mineralized nodules detected by alizarin S red staining, showing osteo-/odontogenic differentiation. The induction of EMT in primary NHEKs by means of transient p63 knockdown allows the generation of induced MSCs from autologous sources. These cells may be used for tissues engineering purposes, including that of dental pulp. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  11. Marked stimulation of growth and motility of human keratinocytes by hepatocyte growth factor

    International Nuclear Information System (INIS)

    Matsumoto, K.; Hashimoto, K.; Yoshikawa, K.; Nakamura, T.

    1991-01-01

    Effect of hepatocyte growth factor (HGF) on normal human epidermal keratinocytes cultured under conditions of low Ca2+ (0.1 mM, growth-promoting condition) and physiological Ca2+ (1.8 mM, differentiation-promoting condition) was investigated. In low Ca2+, HGF markedly enhanced the migration of keratinocytes while it suppressed cell growth and DNA synthesis in a dose-dependent manner. In contrast, HGF enhanced the migration, cell growth, and DNA synthesis of keratinocytes cultured under conditions of physiological Ca2+. The maximal stimulation of DNA synthesis (2.4-fold stimulation) in physiological Ca2+ was seen at 2.5-5 ng/ml HGF and the stimulatory effect of HGF was suppressed by transforming growth factor-beta 1. Analysis of the HGF receptor using 125I-HGF as a ligand showed that human keratinocytes expressed a single class of specific, saturable receptor for HGF in both low and physiological Ca2+ conditions, exhibiting a Kd = 17.3 pM and approximately 690 binding sites/cell under physiological Ca2+. Thus, HGF is a potent factor which enhances growth and migration of normal human keratinocytes under conditions of physiological Ca2+. HGF may play an important role in epidermal tissue repair as it enhances both the migration and growth of keratinocytes

  12. Cultured allogenic keratinocytes for extensive burns: a retrospective study over 15 years.

    Science.gov (United States)

    Auxenfans, Celine; Shipkov, Hristo; Bach, Christine; Catherine, Zulma; Lacroix, Pierre; Bertin-Maghit, Marc; Damour, Odile; Braye, Fabienne

    2014-02-01

    The aim was to review the use and indications of cultured allogenic keratinocytes (CAlloK) in extensive burns and their efficiency. This retrospective study comprised 15 years (1997-2012). all patients who received CAlloK. patients who died before complete healing. Evaluation criteria were clinical. Time and success of wound healing after CAlloK use were evaluated. The CAlloK were used for 2 indications - STSG donor sites and deep 2nd degree burns in extensively burned patients. A total of 70 patients were included with severity Baux score of 99.2 (from 51 to 144) and mean percentage of TBSA of 63.49% (from 21 to 96%). Fifty nine patients received CAlloK for STSG donor sites with a mean number of applications of 4 and mean surface of 3800 cm(2) per patient. Treated donor sites were re-harvested 2.5 times. The mean time of complete epithelialization was 7 days. In 11 patients, CAlloK were used for deep 2nd degree burns. The mean percentage of burned surface was 73.7%. The mean surface of CAlloK per patient was 2545 cm(2). Complete healing was achieved in 6.4 days. The CAlloK allow rapid healing of STSG donor-sites and deep 2nd second degree burns in extensively burned patients. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  13. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  14. Prevention of burn wound conversion by allogeneic keratinocytes cultured on acellular xenodermis

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Pokorná, Eva; Königová, R.

    2002-01-01

    Roč. 3, č. 1 (2002), s. 29-35 ISSN 1389-9333 Institutional research plan: CEZ:AV0Z5052915 Keywords : human keratinocytes * tissue engineered skin * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  15. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  16. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  17. Ca2+-dependent localization of integrin-linked kinase to cell junctions in differentiating keratinocytes.

    Science.gov (United States)

    Vespa, Alisa; Darmon, Alison J; Turner, Christopher E; D'Souza, Sudhir J A; Dagnino, Lina

    2003-03-28

    Integrin complexes are necessary for proper proliferation and differentiation of epidermal keratinocytes. Differentiation of these cells is accompanied by down-regulation of integrins and focal adhesions as well as formation of intercellular adherens junctions through E-cadherin homodimerization. A central component of integrin adhesion complexes is integrin-linked kinase (ILK), which can induce loss of E-cadherin expression and epithelial-mesenchymal transformation when ectopically expressed in intestinal and mammary epithelia. In cultured primary mouse keratinocytes, we find that ILK protein levels are independent of integrin expression and signaling, since they remain constant during Ca(2+)-induced differentiation. In contrast, keratinocyte differentiation is accompanied by marked reduction in kinase activity in ILK immunoprecipitates and altered ILK subcellular distribution. Specifically, ILK distributes in close apposition to actin fibers along intercellular junctions in differentiated but not in undifferentiated keratinocytes. ILK localization to cell-cell borders occurs independently of integrin signaling and requires Ca(2+) as well as an intact actin cytoskeleton. Further, and in contrast to what is observed in other epithelial cells, ILK overexpression in differentiated keratinocytes does not promote E-cadherin down-regulation and epithelial-mesenchymal transition. Thus, novel tissue-specific mechanisms control the formation of ILK complexes associated with cell-cell junctions in differentiating murine epidermal keratinocytes.

  18. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W. [Kaohsiung Medical College (Taiwan). Dept. of Dermatology; Chiang, L.-C. [Kaohsiung Medical College (Taiwan). Dept. of Microbiology and Immunology; Yu, C.-L. [National Yang-Ming University School of Medicine (Taiwan). Veterans General Hospital-Taipei

    1996-08-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm{sup 2} UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author).

  19. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W.; Chiang, L.-C.; Yu, C.-L.

    1996-01-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm 2 UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author)

  20. Transfer of a two-tiered keratinocyte assay: IL-18 production by NCTC2544 to determine the skin sensitizing capacity and epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2013-01-01

    . The two tiered approach may offer an unique opportunity to provide an alternative method to the Local Lymph Node Assay (LLNA). These assays are both based on the use of human keratinocytes, which have been shown over the last two decades, to play a key role in all phases of skin sensitization....

  1. [Cultivated keratinocytes on micro-carriers: in vitro studies of a new carrier system].

    Science.gov (United States)

    Hecht, J; Hoefter, E A; Hecht, J; Haraida, S; Nerlich, A; Hartinger, A; Mühlbauer, W; Dimoudis, N

    1997-03-01

    Epidermal grafts from confluently cultivated keratinocytes have been used since the early eighties for the treatment of severe burns, where the shortage of donor sites for split-thickness skin grafts did not allow for adequate wound coverage. The difficult handling of these grafts as well as the advanced differentiation of their epithelial cells into a multilayer sheet poses a problem for their clinical application. The aim of the study was to characterize cultivated keratinocytes, as well as to observe their migration and proliferation from the MC onto a surface. Keratinocytes were isolated from human foreskin and cultivated in serum-free and serum-containing medium according to a modified method by Rheinwald and Green. Collagen-coated Dextran beads were used as MC. The MC were colonized with keratinocytes using the Spinner culture technique. After seeding the colonized MC into culture flasks, their migration and proliferation was monitored regularly through immunohistochemical studies and measurement of the metabolic cell activity. Immunohistological staining proved that the cells isolated from human foreskin represent keratinocytes of the basal type. Keratinocytes, cultivated with serum-containing and serum free medium, both adhered to the surface of the MC, then migrated onto the surface of the flasks and proliferated to form a multilayer of epithelial cells. In the long-term, a flexible epithelial graft consisting of poorly differentiated keratinocytes should be available, which is simple to produce and easy to handle. This would be an alternative method for treating wounds, where the conventional multilayer epithelial graft (ET) is insufficient.

  2. Simplified non-cultured non-trypsinised epidermal cell graft technique followed by psoralen and ultraviolet a light therapy for stable vitiligo

    Directory of Open Access Journals (Sweden)

    Dilip Kachhawa

    2017-01-01

    Full Text Available Background and Aims: Stable vitiligo can be treated by various surgical procedures. Non-cultured melanocyte grafting techniques were developed to overcome the time-consuming process of culture while at the same time providing acceptable results. All the techniques using non-cultured melanocyte transfer involve trypsinisation as an integral step. Jodhpur technique used by the author is autologous, non-cultured, non-trypsinised, epidermal cell grafting. Settings and Design: The study was conducted on patients visiting the dermatology outpatient department of a tertiary health centre in Western Rajasthan. Materials and Methods: At the donor site, mupirocin ointment was applied and dermabrasion was done with the help of micromotor dermabrader till pinpoint bleeding was seen. The paste-like material obtained by this procedure containing melanocytes and keratinocytes admixed with the ointment base was harvested with spatula and was subsequently spread over the recipient area. Recipient site was prepared in the same manner by dermabrasion. After 10 days, dressing at both sites was removed taking utmost care at the recipient site as there was a theoretical risk of dislodging epidermal cells. Results: In a study of 437 vitiligo patches, more than 75% re-pigmentation (excellent improvement was seen in 41% of the patches. Lesions on thigh (100%, face (75% and trunk (50% showed maximal excellent improvement, whereas patches on joints and acral areas did not show much improvement. Conclusions: This technique is a simplified, cost effective, less time-consuming alternative to other techniques which involve tryspsinisation of melanocytes and at the same time provides satisfactory uniform pigmentation.

  3. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Ansel, J.C.; Luger, T.A.; Green, I.

    1983-01-01

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  4. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  5. A study to evaluate primary dressings for the application of cultured keratinocytes.

    Science.gov (United States)

    Price, R D; Das-Gupta, V; Frame, J D; Navsaria, H A

    2001-12-01

    Despite the recent improvements in cell culture and dermal regeneration methods, tissue engineering of skin has yet to receive widespread acceptance in the management of burn injuries. The reasons for this are complex and include not only the inherent costs of (particularly) setting up and running such a system but also the continuing difficulties in achieving successful engraftment of the neoepidermis. The latter has previously been addressed in a number of ways, including improving the recipient bed and using pre-confluent delivery systems to allow earlier application of cells to that wound bed. One area that has received little attention is that of the optimal wound dressing to use with this technology; the cells are very poorly attached at early time points, and, in this context, the traditional dressing of paraffin gauze has never been formally assessed in comparison with newer materials. Using a porcine acute wound chamber model, we performed a prospective randomised trial to assess four different wound dressings with reference to the amount of epidermal cover gained and the histological quality of the regenerated skin after 3 weeks. Out of the four materials tested, polyurethane foam (Allevyn) was superior histologically (although equal in take rate with paraffin gauze), whilst polythene sheet (Opsite) and silicone sheet were substantially inferior. We conclude that the traditional dressing used with this technology should be compared with polyurethane foam in a clinical trial. In the future, novel dressings should be formally tested against traditional methods before being adopted. Copyright 2001 The British Association of Plastic Surgeons.

  6. Long-term organ culture of rabbit skin: Effect of EGF on epidermal structure in vitro

    International Nuclear Information System (INIS)

    Kondo, S.; Hozumi, Y.; Aso, K.

    1990-01-01

    A method is described for maintaining the epidermal structure of normal rabbit ear skin explants in organ culture for up to 12 weeks. Split-thickness skin specimens were put in diffusion chambers made of either millipore filters or bovine collagen membranes, and then submitted to a roller tube culture at 15 rpm and 36 degrees C. The culture medium was Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal calf serum (FCS) + 0.4 micrograms/ml hydrocortisone. The gas used in the culture tube was air + 5% CO2. Autoradiography revealed the incorporation of [3H]-glycine into the 68-kD keratin band of explants for up to 12 weeks, indicating that normal keratinization was maintained throughout the entire culture period. The turnover time of the epidermis from basal layer to granular layer was around 7 d in both the early and late stages of culture. The addition of epidermal growth factor (EGF) to the culture caused the epidermis to become acanthotic with orthokeratosis, but with high concentrations of EGF (greater than or equal to 10 ng/ml) parakeratosis and increased proliferation of the epidermis occurred. Dexamethasone (DMS) strongly inhibited the EGF effect

  7. Keratinocytes from APP/APLP2-deficient mice are impaired in proliferation, adhesion and migration in vitro

    International Nuclear Information System (INIS)

    Siemes, Christina; Quast, Thomas; Kummer, Christiane; Wehner, Sven; Kirfel, Gregor; Mueller, Ulrike; Herzog, Volker

    2006-01-01

    Growing evidence shows that the soluble N-terminal form (sAPPα) of the amyloid precursor protein (APP) represents an epidermal growth factor fostering keratinocyte proliferation, migration and adhesion. APP is a member of a protein family including the two mammalian amyloid precursor-like proteins APLP1 and APLP2. In the mammalian epidermis, only APP and APLP2 are expressed. APP and APLP2-deficient mice die shortly after birth but do not display a specific epidermal phenotype. In this report, we investigated the epidermis of APP and/or APLP2 knockout mice. Basal keratinocytes showed reduced proliferation in vivo by about 40%. Likewise, isolated keratinocytes exhibited reduced proliferation rates in vitro, which could be completely rescued by either exogenously added recombinant sAPPα, or by co-culture with dermal fibroblasts derived from APP knockout mice. Moreover, APP-knockout keratinocytes revealed reduced migration velocity resulting from severely compromised cell substrate adhesion. Keratinocytes from double knockout mice died within the first week of culture, indicating essential functions of APP-family members for survival in vitro. Our data indicate that sAPPα has to be considered as an essential epidermal growth factor which, however, in vivo can be functionally compensated to a certain extent by other growth factors, e.g., factors released from dermal fibroblasts

  8. Enhancement of keratinocyte performance in the production of tissue-engineered skin using a low-calcium medium.

    Science.gov (United States)

    Hernon, Catherine A; Harrison, Caroline A; Thornton, Daniel J A; MacNeil, Sheila

    2007-01-01

    The success of laboratory-expanded autologous keratinocytes for the treatment of severe burn injuries is often compromised by their lack of dermal remnants and failure to establish a secure dermo-epidermal junction on the wound bed. We have developed a tissue-engineered skin substitute for in vivo use, based on a sterilized donor human dermis seeded with autologous keratinocytes and fibroblasts. However, culture rates are currently too slow for clinical use in acute burns. Our aim in this study was to increase the rate of production of tissue-engineered skin. Two approaches were explored: one using a commercial low-calcium media and the other supplementing well-established media for keratinocyte culture with the calcium-chelating agent ethylene glutamine tetra-acetic acid (EGTA). Using commercial low-calcium media for both the initial cell culture and subsequent culture of tissue-engineered skin did not produce tissue suitable for clinical use. However, it was possible to enhance the initial proliferation of keratinocytes and to increase their horizontal migration in tissue-engineered skin by supplementing established culture medium with 0.04 mM EGTA without sacrificing epidermal attachment and differentiation. Enhancement of keratinocyte migration with EGTA was also maximal in the absence of fibroblasts or basement membrane.

  9. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  10. Platelets Regulate the Migration of Keratinocytes via Podoplanin/CLEC-2 Signaling during Cutaneous Wound Healing in Mice.

    Science.gov (United States)

    Asai, Jun; Hirakawa, Satoshi; Sakabe, Jun-ichi; Kishida, Tsunao; Wada, Makoto; Nakamura, Naomi; Takenaka, Hideya; Mazda, Osam; Urano, Tetsumei; Suzuki-Inoue, Katsue; Tokura, Yoshiki; Katoh, Norito

    2016-01-01

    Podoplanin is an endogenous ligand for C-type lectin-like receptor 2 (CLEC-2), which is expressed on platelets. Recent evidence indicates that this specific marker of lymphatic endothelial cells is also expressed by keratinocytes at the edge of wounds. However, whether podoplanin or platelets play a role in keratinocyte activity during wound healing remains unknown. We evaluated the effect of podoplanin expression levels on keratinocyte motility using cultured primary normal human epidermal keratinocytes (NHEKs). Down-regulation of podoplanin in NHEKs via transfection with podoplanin siRNA inhibited their migration, indicating that podoplanin plays a mandatory role in this process. In addition, down-regulation of podoplanin was correlated with up-regulation of E-cadherin, suggesting that podoplanin-mediated stimulation of keratinocyte migration is associated with a loss of E-cadherin. Both the addition of platelets and treatment with CLEC-2 inhibited the migration of NHEKs. The down-regulation of RhoA activity and the up-regulation of E-cadherin in keratinocytes were also induced by CLEC-2. In conclusion, these results suggest that podoplanin/CLEC-2 signaling regulates keratinocyte migration via modulating E-cadherin expression through RhoA signaling. Altering the regulation of keratinocyte migration by podoplanin might be a novel therapeutic approach to improve wound healing. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  11. Two-tiered keratinocyte assay: IL-18 production by NCTC2544 cells to determine the skin sensitizing capacity and an epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2012-01-01

    the use of animals. The aim of the EU FP6 Integrated Project Sens-it-iv was to develop and optimize an integrated testing strategy consisting of in vitro, human cell based assays which will closely mimic sensitization mechanisms in vivo. These assays should be an alternative approach to the LLNA. The NCTC...... method to the LLNA. Both assays are based on the use of human keratinocytes, which have been shown, over the last two decades, to play a key role in all phases of skin sensitization. First, 4 known chemicals were tested during a transferability study in which 6 laboratories participated. Three...

  12. Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

    International Nuclear Information System (INIS)

    Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

    2008-01-01

    The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

  13. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  14. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  15. Isolation, Culture, and Motility Measurements of Epidermal Melanocytes from GFP-Expressing Reporter Mice.

    Science.gov (United States)

    Dagnino, Lina; Crawford, Melissa

    2018-03-27

    In this article, we provide a method to isolate primary epidermal melanocytes from reporter mice, which also allow targeted gene inactivation. The mice from which these cells are isolated are bred into a Rosa26 mT/mG reporter background, which results in GFP expression in the targeted melanocytic cell population. These cells are isolated and cultured to >95% purity. The cells can be used for gene expression studies, clonogenic experiments, and biological assays, such as capacity for migration. Melanocytes are slow moving cells, and we also provide a method to measure motility using individual cell tracking and data analysis.

  16. Effects of epidermal growth factor on neural crest cells in tissue culture

    International Nuclear Information System (INIS)

    Erickson, C.A.; Turley, E.A.

    1987-01-01

    Epidermal growth factor (EGF) stimulates the release of hyaluronic acid (HA) and chondroitin sulfate proteoglycan (CSPG) from quail trunk neural crest cultures in a dose-dependent fashion. It also promotes the expression of cell-associated heparan sulfate proteoglycan (HSPG) as detected by immunofluorescence and immunoprecipitation of the 3 H-labeled proteoglycan. Furthermore, EGF stimulates [ 3 H]thymidine incorporation into total cell DNA. These results raise the possibility that EGF or an analogous growth factor is involved in regulation of neural crest cell morphogenesis

  17. BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

    International Nuclear Information System (INIS)

    Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

    2010-01-01

    Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

  18. Differential effect of extracellular matrix derived from papillary and reticular fibroblasts on epidermal development in vitro.

    Science.gov (United States)

    Janson, David; Rietveld, Marion; Mahé, Christian; Saintigny, Gaëlle; El Ghalbzouri, Abdoelwaheb

    2017-06-01

    Papillary and reticular fibroblasts have different effects on keratinocyte proliferation and differentiation. The aim of this study was to investigate whether these effects are caused by differential secretion of soluble factors or by differential generation of extracellular matrix from papillary and reticular fibroblasts. To study the effect of soluble factors, keratinocyte monolayer cultures were grown in papillary or reticular fibroblast-conditioned medium. To study the effect of extracellular matrix, keratinocytes were grown on papillary or reticular-derived matrix. Conditioned medium from papillary or reticular fibroblasts did not differentially affect keratinocyte viability or epidermal development. However, keratinocyte viability was increased when grown on matrix derived from papillary, compared with reticular, fibroblasts. In addition, the longevity of the epidermis was increased when cultured on papillary fibroblast-derived matrix skin equivalents compared with reticular-derived matrix skin equivalents. The findings indicate that the matrix secreted by papillary and reticular fibroblasts is the main causal factor to account for the differences in keratinocyte growth and viability observed in our study. Differences in response to soluble factors between both populations were less significant. Matrix components specific to the papillary dermis may account for the preferential growth of keratinocytes on papillary dermis.

  19. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  20. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  1. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  2. Enhanced constitutive invasion activity in human nontumorigenic keratinocytes exposed to a low level of barium for a long time.

    Science.gov (United States)

    Thang, Nguyen D; Yajima, Ichiro; Ohnuma, Shoko; Ohgami, Nobutaka; Kumasaka, Mayuko Y; Ichihara, Gaku; Kato, Masashi

    2015-02-01

    We have recently demonstrated that exposure to barium for a short time (≤4 days) and at a low level (5 µM = 687 µg/L) promotes invasion of human nontumorigenic HaCaT cells, which have characteristics similar to those of normal keratinocytes, suggesting that exposure to barium for a short time enhances malignant characteristics. Here we examined the effect of exposure to low level of barium for a long time, a condition mimicking the exposure to barium through well water, on malignant characteristics of HaCaT keratinocytes. Constitutive invasion activity, focal adhesion kinase (FAK) protein expression and activity, and matrix metalloproteinase 14 (MMP14) protein expression in primary cultured normal human epidermal keratinocytes, HaCaT keratinocytes, and HSC5 and A431 human squamous cell carcinoma cells were augmented following an increase in malignancy grade of the cells. Constitutive invasion activity, FAK phosphorylation, and MMP14 expression levels of HaCaT keratinocytes after treatment with 5 µM barium for 4 months were significantly higher than those of control untreated HaCaT keratinocytes. Taken together, our results suggest that exposure to a low level of barium for a long time enhances constitutive malignant characteristics of HaCaT keratinocytes via regulatory molecules (FAK and MMP14) for invasion. © 2013 Wiley Periodicals, Inc.

  3. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  4. Development of a co-culture of keratinocytes and immune cells for in vitro investigation of cutaneous sulfur mustard toxicity.

    Science.gov (United States)

    Balszuweit, Frank; Menacher, Georg; Bloemeke, Brunhilde; Schmidt, Annette; Worek, Franz; Thiermann, Horst; Steinritz, Dirk

    2014-11-05

    Sulfur mustard (SM) is a chemical warfare agent causing skin blistering, ulceration and delayed wound healing. Inflammation and extrinsic apoptosis are known to have an important role in SM-induced cytotoxicity. As immune cells are involved in those processes, they may significantly modulate SM toxicity, but the extent of those effects is unknown. We adapted a co-culture model of immortalized keratinocytes (HaCaT) and immune cells (THP-1) and exposed this model to SM. Changes in necrosis, apoptosis and inflammation, depending on SM challenge, absence or presence and number of THP-1 cells were investigated. THP-1 were co-cultured for 24h prior to SM exposure in order to model SM effects on immune cells continuously present in the skin. Our results indicate that the presence of THP-1 strongly increased necrosis, apoptosis and inflammation. This effect was already significant when the ratio of THP-1 and HaCaT cells was similar to the ratio of Langerhans immune cells and keratinocytes in vivo. Any further increases in the number of THP-1 had only slight additional effects on SM-induced cytotoxicity. In order to assess the effects of immune cells migrating into skin areas damaged by SM, we added non-exposed THP-1 to SM-exposed HaCaT. Those THP-1 had only slight effects on SM-induced cytotoxicity. Notably, in HaCaT exposed to 300μM SM, necrosis and inflammation were slightly reduced by adding intact THP-1. This effect was dependent on the number of immune cells, steadily increasing with the number of unexposed THP-1 added. In summary, we have demonstrated that (a) the presented co-culture is a robust model to assess SM toxicity and can be used to test the efficacy of potential antidotes in vitro; (b) immune cells, damaged by SM strongly amplified cytotoxicity, (c) in contrast, unexposed THP-1 (simulating migration of immune cells into affected areas after exposure in vivo) had no pronounced adverse, but exhibited some protective effects. Thus, protecting immune cells

  5. Radiation-induced genomic instability is associated with DNA methylation changes in cultured human keratinocytes

    International Nuclear Information System (INIS)

    Kaup, Sahana; Grandjean, Valerie; Mukherjee, Rajarshi; Kapoor, Aparna; Keyes, Edward; Seymour, Colin B.; Mothersill, Carmel E.; Schofield, Paul N.

    2006-01-01

    The mechanism by which radiation-induced genomic instability is initiated, propagated and effected is currently under intense scrutiny. We have investigated the potential role of altered genomic methylation patterns in the cellular response to irradiation and have found evidence for widespread dysregulation of CpG methylation persisting up to 20 population doublings post-irradiation. Similar effects are seen with cells treated with medium from irradiated cells (the 'bystander effect') rather than subjected to direct irradiation. Using an arbitrarily primed methylation sensitive PCR screening method we have demonstrated that irradiation causes reproducible alterations in the methylation profile of a human keratinocyte cell line, HPV-G, and have further characterised one of these sequences as being a member of a retrotransposon element derived sequence family on chromosome 7; MLT1A. Multiple changes were also detected in the screen, which indicate that although the response of cells is predominantly hypermethylation, specific hypomethylation occurs as well. Sequence specific changes are also reported in the methylation of the pericentromeric SAT2 satellite sequence. This is the first demonstration that irradiation results in the induction of heritable methylation changes in mammalian cells, and provides a link between the various non-radiological instigators of genomic instability, the perpetuation of the unstable state and several of its manifestations

  6. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  7. Air-Stimulated ATP Release from Keratinocytes Occurs through Connexin Hemichannels

    Science.gov (United States)

    Barr, Travis P.; Albrecht, Phillip J.; Hou, Quanzhi; Mongin, Alexander A.; Strichartz, Gary R.; Rice, Frank L.

    2013-01-01

    Cutaneous ATP release plays an important role in both epidermal stratification and chronic pain, but little is known about ATP release mechanisms in keratinocytes that comprise the epidermis. In this study, we analyzed ATP release from cultured human neonatal keratinocytes briefly exposed to air, a process previously demonstrated to trigger ATP release from these cells. We show that exposing keratinocytes to air by removing media for 15 seconds causes a robust, long-lasting ATP release. This air-stimulated ATP release was increased in calcium differentiated cultures which showed a corresponding increase in connexin 43 mRNA, a major component of keratinocyte hemichannels. The known connexin hemichannel inhibitors 1-octanol and carbenoxolone both significantly reduced air-stimulated ATP release, as did two drugs traditionally used as ABC transporter inhibitors (glibenclamide and verapamil). These same 4 inhibitors also prevented an increase in the uptake of a connexin permeable dye induced by air exposure, confirming that connexin hemichannels are open during air-stimulated ATP release. In contrast, activity of the MDR1 ABC transporter was reduced by air exposure and the drugs that inhibited air-stimulated ATP release had differential effects on this transporter. These results indicate that air exposure elicits non-vesicular release of ATP from keratinocytes through connexin hemichannels and that drugs used to target connexin hemichannels and ABC transporters may cross-inhibit. Connexins represent a novel, peripheral target for the treatment of chronic pain and dermatological disease. PMID:23457608

  8. α6 Integrin and CD44 enrich for a primary keratinocyte population that displays resistance to UV-induced apoptosis.

    Directory of Open Access Journals (Sweden)

    Helen Wray

    Full Text Available Epidermal human keratinocytes are exposed to a wide range of environmental genotoxic insults, including the UV component of solar radiation. Epidermal homeostasis in response to cellular or tissue damage is maintained by a population of keratinocyte stem cells (KSC that reside in the basal layer of the epithelium. Using cell sorting based on cell-surface markers, we have identified a novel α6 integrin(high+/CD44(+ sub-population of basal keratinocytes. These α6 integrin(high+/CD44(+ keratinocytes have both high proliferative potential, form colonies in culture that have characteristics of holoclones and have a unique pattern of resistance to apoptosis induced by UVB radiation or by agents that induce single- or double strand DNA breaks. Resistance to UVB induced apoptosis in the α6 integrin(high+/CD44(+ cells involved increased expression of TAp63 and was overcome by PI-3 kinase inhibition. In marked contrast, the α6 integrin(high+/CD44(+ cells were sensitive to apoptosis induced by the cross-linking agent cisplatin, and imatinib inhibition of c-Abl blocked the ability of cisplatin to kill α6 integrin(high+/CD44(+ cells. Our findings reveal a population of basal keratinocytes with long-term proliferative properties that display specific patterns of apoptotic resistance that is dependent upon the genotoxic stimulus, and provide insights into how these cells can be targeted with chemotherapeutic agents.

  9. Application of the cultured epidermal autograft "JACE(®") for treatment of severe burns: Results of a 6-year multicenter surveillance in Japan.

    Science.gov (United States)

    Matsumura, Hajime; Matsushima, Asako; Ueyama, Masashi; Kumagai, Norio

    2016-06-01

    In the 1970s, Green et al. developed a method that involved culturing keratinocyte sheets and used for treatment of burns. Since then, the take rate of cultured epidermal autograft (CEA) onto fascia, granulation tissue, or allografts has been extensively reported, while that on an artificial dermis in a large case series is not. Moreover, the contribution of CEA to patient survival has not been analyzed in a multicenter study. We conducted a 6-year multicenter surveillance on the application of the CEA "JACE(®") for treatment of burns >30% total body surface area (TBSA) across 118 Japanese hospitals. This surveillance included 216 patients and 718 graft sites for efficacy analysis. The CEA take rate at 4 weeks after grafting was evaluated, and safety was monitored until 52 weeks. In addition, the survival curve obtained in this study and the data obtained from the Tokyo Burn Unit Association (TBUA) were compared. The mean CEA take rates at week 4 were 66% (sites) and 68% (patients), and the rate on the artificial dermis was 65% for 226 sites. CEA application combined with wide split-thickness auto or patch autograft increased the CEA take rate. On comparison with the data obtained from the TBUA, which included data on individuals with burns of the same severity, CEA application was found to contribute to patient survival until 7 weeks after burn. We reported the take rate of CEA based on a 6-year multicenter surveillance. From our results, we found that the application of CEA is a useful treatment for the patients with extensive burns. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  10. Ultraviolet-evoked prostaglandin biosynthesis in varying stages of keratinocyte differentiation in guinea pig skin

    Energy Technology Data Exchange (ETDEWEB)

    Karmali, R A; Safai, B

    1984-09-01

    Prostaglandin (PG) production by guinea pig epidermal cells was evaluated at various incubation intervals in normal and UV-exposed cultures. Prostaglandins have been implicated as mediators of the early phase of erythema in skin exposed to sunlight or UV-radiation. Using a density gradient centrifugation procedure, the epidermal cells were fractionated according to the various maturation stages of epidermal keratinocytes: high-density epidermal cells (HDEC) consisting of round, less mature cells; low-density epidermal cells (LDEC) consisting of polygonal keratinized cells; and intermediate-density epidermal cells (IDEC) consisting of both HDEC and LDEC. When cultures of 1 X 10(6) cells were incubated at 37 degrees C in 5% CO/sub 2/ the highest concentrations of five PG moieties measured were present in supernatants from the LDEC cultures as compared to those of IDEC or HDEC. Levels of PGF 2 alpha were much higher than the rest, which were found in the order PGF2 alpha greater than PGE2 greater than PGE1 greater than 6-keto-PGF1 alpha greater than thromboxane (TX)B2. UV-irradiation induced increases in all but TXA2 production. These results identify and quantitate five compounds produced as a result of exaggerated activity of the cyclooxygenase induced by UV-irradiation.

  11. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

  12. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  13. Modulation of cultured porcine granulosa cell responsiveness to follicle stimulating hormone and epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Buck, P.A.

    1986-01-01

    Ovarian follicular development is dependent upon the coordinated growth and differentiation of the granulosa cells which line the follicle. Follicle stimulating hormone (FSH) induces granulosa cell differentiation both in vivo and in vitro. Epidermal growth factor (EGF) stimulates granulosa cell proliferation in vitro. The interaction of these two effectors upon selected parameters of growth and differentiation was examined in monolayer cultures of porcine granulose cells. Analysis of the EGF receptor by /sup 125/I-EGF binding revealed that the receptor was of high affinity with an apparent dissociation constant of 4-6 x 10/sup -10/ M. The average number of receptors per cell varied with the state of differentiation both in vivo and in vitro; highly differentiated cells bound two-fold less /sup 125/I-EGF and this effect was at least partially induced by FSH in vitro. EGF receptor function was examined by assessing EGF effects on cell number and /sup 3/H-thymidine incorporation. EGF stimulated thymidine incorporation in both serum-free and serum-supplemented culture, but only in serum-supplemented conditions was cell number increased. EGF receptor function was inversely related to the state of differentiation and was attenuated by FSH. The FSH receptor was examined by /sup 125/I-FSH binding. EGF increased FSH receptor number, and lowered the affinity of the receptor. The function of these receptors was assessed by /sup 125/I-hCG binding and progesterone radioimmunoassay. If EGF was present continuously in the cultures. FSH receptor function was attenuated regardless of FSH receptor number. A preliminary effort to examine the mechanism of this interaction was performed by analyzing hormonally controlled protein synthesis with /sup 35/S-methionine labeling, SDS polyacrylamide gel electrophoresis and fluorography. FSH promoted the expression of a 27,000 dalton protein. This effect was attenuated by EGF.

  14. Cultured autologous keratinocytes in the treatment of large and deep burns: a retrospective study over 15 years.

    Science.gov (United States)

    Auxenfans, Celine; Menet, Veronique; Catherine, Zulma; Shipkov, Hristo; Lacroix, Pierre; Bertin-Maghit, Marc; Damour, Odile; Braye, Fabienne

    2015-02-01

    The aim was to review the use and indications of cultured autologous epidermis (CAE) in extensive burns and to evaluate the efficiency of our strategy of burn treatment. This retrospective study comprised 15 years (1997-2012). all patients who received CAE. patients who died before complete healing and patients who received exclusively cultured allogeneic keratinocytes. Evaluation criteria were clinical. Time and success of wound healing after CAE graft were evaluated. A total of 63 patients were included with severity Baux score of 107 (from 70 to 140) and mean percentage of TBSA of 71% (from 40% to 97%). The CAE were used as Cuono method, in STSG donor sites and deep 2nd degree burns and in combination with large-meshed STSG (1:6-1:12) in extensively burned patients. Cuono method was used in 6 patients. The final take was 16% (0-30) because of the great fragility of the obtained epidermis. Nine patients with deep 2nd degree burns (mean TBSA 81%, from 60 to 97%) were successfully treated with only CAE without skin grafting. Combined technique (STSG meshed at 1:6-1:12 covered with CAE) was used in 27 patients (mean TBSA 69%, from 49% to 96%) with 85% success rate. Finally, donor sites treated with CAE in 49 patients could be harvested several times thanks to rapid epithelialization (time of wound healing was 7 days (from 5 to 10 days)). The CAE allow rapid healing of STSG donor sites and deep 2nd second degree burns in extensively burned patients. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  15. In vitro transformation of primary cultures of neonatal BALB/c mouse epidermal cells with ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Ananthaswamy, H.N.; Kripke, M.L.

    1981-01-01

    Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients

  16. A clinical trial designed to evaluate the safety and effectiveness of a thermosensitive hydrogel-type cultured epidermal allograft for deep second-degree burns.

    Science.gov (United States)

    Yim, Haejun; Yang, Hyeong-Tae; Cho, Yong-Suk; Kim, Dohern; Kim, Jong-Hyun; Chun, Wook; Hur, Jun

    2014-12-01

    This study is a phase 1 and 2 clinical trial for investigating the safety profile, effective treatment dose and effectiveness of the newly developed thermosensitive hydrogel-type cultured epidermal allograft. For phase 1, the keratinocytes were divided into 3 groups as follows, with 5 patients in each group: (1) low-dose group (6.7×10(6)/1.5mL), (2) medium-dose group (2×10(7)/1.5mL), and (3) high-dose group (6.0×10(7)/1.5mL). The second phase of the trial proceeded with 10 cases after choosing the most effective dose based on the analysis of the first phase. When comparing re-epithelialization time, medium- and high-dose group showed significantly shorter re-epithelialization time than low-dose group (p=0.003 and p=0.002). A total of 15 cases, 5 cases selected from phase 1 and 10 cases test in phase 2 with the medium dose, were compared with the re-epithelialization period. The re-epithelialization period was 9.6±4.0 days in the test site and 12.4±4.8 days in the control site. In the test site, re-epithelialization was 2.8±1.8 days faster than in the control site (pclinical trial. In conclusion, this new type of CEAllo accelerates wound healing time and shows the safety. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  17. Stereotyped distribution of proliferating keratinocytes in disorders affecting the epidermis

    International Nuclear Information System (INIS)

    Pierard-Franchimont, C.; Pierard, G.E.

    1989-01-01

    We used the technique of autoradiography after incorporation of tritiated thymidine ( 3 H-TdR) to evaluate keratinocyte proliferation in basal, epibasal, and other epidermal layers in 30 diseases affecting the epidermis. The number and proportion of 3 H-TdR-labeled keratinocytes were counted in the different layers of the epidermis. Significant correlations were found between the proliferative indices of the different epidermal layers. Such links indicate that the epidermis responds in a rather stereotyped way to various pathological conditions. There exists some regulation in the distribution, number, and proportion of 3 H-TdR-labeled keratinocytes in the various layers of the epidermis

  18. DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi

    Directory of Open Access Journals (Sweden)

    Lila Gardenia

    2014-06-01

    Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.

  19. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  20. Wnt signaling induces differentiation of progenitor cells in organotypic keratinocyte cultures

    Directory of Open Access Journals (Sweden)

    Liu Bob Y

    2007-02-01

    Full Text Available Abstract Background Interfollicular skin develops normally only when the activity of the progenitor cells in the basal layer is counterbalanced by the exit of cells into the suprabasal layers, where they differentiate and cornify to establish barrier function. Distinct stem and progenitor compartments have been demonstrated in hair follicles and sebaceous glands, but there are few data to describe the control of interfollicular progenitor cell activity. Wnt signaling has been shown to be an important growth-inducer of stem cell compartments in skin and many other tissues. Results Here, we test the effect of ectopic Wnt1 expression on the behavior of interfollicular progenitor cells in an organotypic culture model, and find that Wnt1 signaling inhibits their growth and promotes terminal differentiation. Conclusion These results are consistent with the phenotypes reported for transgenic mice engineered to have gain or loss of function of Wnt signaling in skin, which would recommend our culture model as an accurate one for molecular analysis. Since it is known that canonical ligands are expressed in skin, it is likely that this pathway normally regulates the balance of growth and differentiation, and suggests it could be important to pathogenesis.

  1. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  2. Protective effect of indole-3-pyruvate against ultraviolet b-induced damage to cultured HaCaT keratinocytes and the skin of hairless mice.

    Directory of Open Access Journals (Sweden)

    Reiji Aoki

    Full Text Available Previous investigations demonstrated that pyruvate protects human keratinocytes against cell damage stemming from exposure to ultraviolet B (UVB radiation. This study endeavoured to elucidate the protective capacity of aromatic pyruvates (e.g., phenylpyruvate (PPyr, 4-hydroxyphenylpyruvate (HPPyr, and indole-3-pyruvate (IPyr against UVB-induced injury to skin cells, both in vitro and in vivo. Cultured human HaCaT keratinocytes were irradiated with UVB light (60 mJ/cm2 and maintained with or without test compounds (1-25 mM.In addition, the dorsal skin of hairless mice (HR-1 was treated with test compounds (10 μmol and exposed to UVB light (1 J/cm2 twice [corrected]. The ability of the test compounds to ameliorate UVB-induced cytotoxicity and inflammation was then assessed. Aromatic pyruvates reduced cytotoxicity in UVB-irradiated HaCaT keratinocytes, and also diminished the expression of interleukin 1β (IL-1β and interleukin 6 (IL-6. IPyr was more efficacious than either PPyr or HPPyr. Furthermore, only IPyr inhibited cyclooxygenase-2 (Cox-2 expression at both the mRNA and the protein level in UVB-treated keratinocytes. Topical application of IPyr to the dorsal skin of hairless mice reduced the severity of UVB-induced skin lesions, the augmentation of dermal thickness, and transepithelial water loss. Overproduction of IL-1β and IL-6 in response to UVB radiation was also suppressed in vivo by the topical administration of IPyr. These data strongly suggest that IPyr might find utility as a UVB-blocking reagent in therapeutic strategies to lessen UVB-induced inflammatory skin damage.

  3. Dihydroceramide Desaturase Inhibition by a Cyclopropanated Dihydroceramide Analog in Cultured Keratinocytes

    Directory of Open Access Journals (Sweden)

    Susanne Brodesser

    2011-01-01

    Full Text Available Most mammalian sphingolipids contain a 4,5-(E-double bond. We report on the chemical synthesis of a dihydroceramide derivative that prevents the introduction of the double bond into sphingolipids. Minimal alteration of the parent structure by formally replacing the hydrogen atoms in the 5- and in the 6-position of the sphinganine backbone by a methylene group leads to an inhibitor of dihydroceramide desaturase in cultured cells. In the presence of 10–50 μM of compound (1, levels of biosynthetically formed dihydroceramide and—surprisingly—also of phytoceramide are elevated at the expense of ceramide. The cells respond to the lack of unsaturated sphingolipids by an elevation of mRNAs of enzymes required for sphingosine formation. At the same time, the analysis of proliferation and differentiation markers indicates that the sphingolipid double bond is required to keep the cells in a differentiated state.

  4. Dihydroceramide desaturase inhibition by a cyclopropanated dihydroceramide analog in cultured keratinocytes.

    Science.gov (United States)

    Brodesser, Susanne; Kolter, Thomas

    2011-01-01

    Most mammalian sphingolipids contain a 4,5-(E)-double bond. We report on the chemical synthesis of a dihydroceramide derivative that prevents the introduction of the double bond into sphingolipids. Minimal alteration of the parent structure by formally replacing the hydrogen atoms in the 5- and in the 6-position of the sphinganine backbone by a methylene group leads to an inhibitor of dihydroceramide desaturase in cultured cells. In the presence of 10-50 μM of compound (1), levels of biosynthetically formed dihydroceramide and-surprisingly-also of phytoceramide are elevated at the expense of ceramide. The cells respond to the lack of unsaturated sphingolipids by an elevation of mRNAs of enzymes required for sphingosine formation. At the same time, the analysis of proliferation and differentiation markers indicates that the sphingolipid double bond is required to keep the cells in a differentiated state.

  5. Attachment and growth of human keratinocytes in a serum-free environment.

    Science.gov (United States)

    Gilchrest, B A; Calhoun, J K; Maciag, T

    1982-08-01

    Using a serum-free system, we have investigated the influence of human fibronectin (HFN) and selected growth factors (GF) on the attachment and growth of normal human keratinocytes in vitro. Single-cell suspensions of keratinocytes from near-confluent primary plates, plated on 5-10 microgram/cm2 HFN, showed approximately 30-40% attachment after 2-24 hours of incubation at 37 degrees C, compared with 4-6% attachment on uncoated platic plates. Percentage of attached cells was independent of seed density, tissue donor age, in vitro culture age, or medium composition, while subsequent cellular proliferation was strongly dependent on these factors. Keratinocytes grown on an adequate HFN matrix in a previously described hormone-supplemented medium (Maciag et al., 1981a) achieved four to eight population doubling over 7-12 days at densities greater than or equal to 104 cell/cm2. Removal of most GF individually from the medium had little or no effect on growth, while removal of epidermal growth factor (EGF) alone reduced growth by 30-35% and removal of bovine brain extract (BE) alone reduced growth by approximately 90%. Conversely, EGF alone in basal medium supported approximately 10% control growth, BE alone supported 30-40% control growth, and the combination of EGF and BE approximately 70%. In addition to its major effect on proliferation in this system, BE was necessary to preserve normal keratinocyte morphology and protein production. These findings expand earlier observations that HFN facilitates keratinocyte attachment in vitro and that a brain-derived extract can exert a major positive influence on cultured keratinocytes.

  6. Studies on acute toxic effects to keratinocytes induced by hematoporphyrin derivatives and laser light.

    Science.gov (United States)

    Artuc, M; Ramshad, M; Kappus, H

    1989-01-01

    Human epidermal keratinocytes were grown in culture and the uptake of hematoporphyrin derivatives (HPDs) used in photodynamic therapy was estimated. Keratinocytes loaded with HPDs were irradiated with laser light of 632 nm generated by a helium-neon laser and cell toxicity was determined by the trypan blue exclusion test and the measurement of enzyme release. With increasing intracellular concentration of HPDs and with increasing intensity of the laser light, an increasing number of cells took up trypan blue and released the cytosolic enzyme lactate dehydrogenase and the lysosomal enzyme acid phosphatase after 1 h incubation of the irradiated cells at 37 degrees C. Cytotoxicity was less pronounced when the irradiated cells were incubated at 0 degree C indicating the involvement of enzyme reactions in cell death. No lipid peroxidation as measured by malondialdehyde and ethane formation was detectable. Our results suggest that during photodynamic therapy with HPDs and laser light epidermal keratinocytes may be seriously damaged. The data indicate that not lipid peroxidation but rather the activation of lysosomal enzymes is responsible for the cytotoxicity observed.

  7. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  8. Inability of keratinocytes lacking their specific transglutaminase to form cross-linked envelopes: Absence of envelopes as a simple diagnostic test for lamellar ichthyosis

    OpenAIRE

    Jeon, Saewha; Djian, Philippe; Green, Howard

    1998-01-01

    Epidermal keratinocytes, late in their terminal differentiation, form cross-linked envelopes resistant to ionic detergent and reducing agent. Because the cross-linking process is catalyzed by the keratinocyte transglutaminase, the absence of active transglutaminase should result in failure of the keratinocyte to form a cross-linked envelope. Three keratinocyte strains bearing mutations in the keratinocyte transglutaminase were examined: two contained no detectable transglutaminase mRNA and no...

  9. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  10. An evaluation of the choice of feeder cell growth arrest for the production of cultured epidermis.

    Science.gov (United States)

    Chugh, Rishi Man; Chaturvedi, Madhusudan; Yerneni, Lakshmana Kumar

    2015-12-01

    Growth arrested 3T3 cells have been used as feeder cells in human epidermal keratinocyte cultures to produce cultured epidermal autografts for the treatment of burns. The feeder cells were ideally growth-arrested by gamma-irradiation. Alternatively, growth arrest by mitomycin C treatment is a cost effective option. We compared the functional efficacy of these two approaches in keratinocyte cultures by colony forming efficiency, the net growth area of colonies, BrdU labeling and histological features of cultured epidermal sheets. The growth area estimation involved a semi-automated digital technique using the Adobe Photoshop and comprised of isolation and enumeration of red pixels in Rhodamine B-stained keratinocyte colonies. A further refinement of the technique led to the identification of critical steps to increasing the degree of accuracy and enabling its application as an extension of colony formation assay. The results on feeder cell functionality revealed that the gamma irradiated feeders influenced significantly higher colony forming efficiency and larger growth area than the mitomycin C treated feeders. The BrdU labeling study indicated significant stimulation of the overall keratinocyte proliferation by the gamma irradiated feeders. The cultured epidermal sheets produced by gamma feeders were relatively thicker than those produced by mitomycin C feeders. We discussed the clinical utility of mitomycin C feeders from the viewpoint of cost-effective burn care in developing countries. Copyright © 2015 Elsevier Ltd and ISBI. All rights reserved.

  11. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  12. The effect of the antipsoriatic drug metabolite etretin (Ro 10-1670) on UVB irradiation induced changes in the metabolism of arachidonic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, Kari; Jansen, C.T.; Puustinen, Tapio

    1986-01-01

    [ 14 C]Arachidonic acid was avidly incorporated into human keratinocytes in culture and following exposure to UVB irradiation of 9 mJ/cm 2 (erythemally effective, EE) substantial amounts of 14 C-radiolabel were released from the cells. The release of radiolabel was accompanied by a decrease in the labelling of phosphatidylethanolamine whereas the labelling of triacylglycerols and cholesteryl esters was increased. Keratinocytes produced significant amounts of prostaglandin E 2 (PGE 2 ) and following UVB irradiation of 9 mJ/cm 2 (EE) the formation of prostaglandin E 2 was increased. Etretin (Ro 10-1670), the active metabolite of the antipsoriatic drug etretinate (Ro 10-9359), affected significantly neither the total release of radiolabel induced by UVB nor the formation of prostaglandin E 2 . However, in the presence of etretin the UVB irradiation induced transfer of [ 14 C]arachidonic acid into triacylglycerols and cholesteryl esters was not increased as much as in the corresponding experiments without etretin. On the basis of the present study it appears that etretin dose not interfere with the release of arachidonic acid in amounts which could be related to the therapeutic effects of the combination of retinoids with UVB irradiation (Re-UVB) in the treatment of psoriasis. (author)

  13. Impaired hair follicle morphogenesis and polarized keratinocyte movement upon conditional inactivation of integrin-linked kinase in the epidermis.

    Science.gov (United States)

    Nakrieko, Kerry-Ann; Welch, Ian; Dupuis, Holly; Bryce, Dawn; Pajak, Agnieszka; St Arnaud, René; Dedhar, Shoukat; D'Souza, Sudhir J A; Dagnino, Lina

    2008-04-01

    Integrin-linked kinase (ILK) is key for cell survival, migration, and adhesion, but little is known about its role in epidermal development and homeostasis in vivo. We generated mice with conditional inactivation of the Ilk gene in squamous epithelia. These mice die perinatally and exhibit skin blistering and severe defects in hair follicle morphogenesis, including greatly reduced follicle numbers, failure to progress beyond very early developmental stages, and pronounced defects in follicular keratinocyte proliferation. ILK-deficient epidermis shows abnormalities in adhesion to the basement membrane and in differentiation. ILK-deficient cultured keratinocytes fail to attach and spread efficiently and exhibit multiple abnormalities in actin cytoskeletal organization. Ilk gene inactivation in cultured keratinocytes causes impaired ability to form stable lamellipodia, to directionally migrate, and to polarize. These defects are accompanied by abnormal distribution of active Cdc42 to cell protrusions, as well as reduced activation of Rac1 upon induction of cell migration in scraped keratinocyte monolayers. Significantly, alterations in cell spreading and forward movement in single cells can be rescued by expression of constitutively active Rac1 or RhoG. Our studies underscore a central and distinct role for ILK in hair follicle development and in polarized cell movements, two key aspects of epithelial morphogenesis and function.

  14. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  15. Differential effects of the extracellular microenvironment on human embryonic stem cell differentiation into keratinocytes and their subsequent replicative life span.

    Science.gov (United States)

    Movahednia, Mohammad Mehdi; Kidwai, Fahad Karim; Zou, Yu; Tong, Huei Jinn; Liu, Xiaochen; Islam, Intekhab; Toh, Wei Seong; Raghunath, Michael; Cao, Tong

    2015-04-01

    Culture microenvironment plays a critical role in the propagation and differentiation of human embryonic stem cells (hESCs) and their differentiated progenies. Although high efficiency of hESC differentiation to keratinocytes (hESC-Kert) has been achieved, little is known regarding the effects of early culture microenvironment and pertinent extracellular matrix (ECM) interactions during epidermal commitment on subsequent proliferative capacity of hESC-Kert. The aim of this study is to evaluate the effects of the different ECM microenvironments during hESC differentiation on subsequent replicative life span of hESC-Kert. In doing so, H1-hESCs were differentiated to keratinocytes (H1-Kert) in two differentiation systems. The first system employed autologous fibroblast feeder support, in which keratinocytes (H1-Kert(ACC)) were derived by coculture of hESCs with hESC-derived fibroblasts (H1-ebFs). The second system employed a novel decellularized matrix from H1-ebFs to create a dermoepidermal junction-like (DEJ) matrix. H1-Kert(AFF) were derived by differentiation of hESCs on the feeder-free system employing the DEJ matrix. Our study indicated that the feeder-free system with the use of DEJ matrix was more efficient in differentiation of hESCs toward epidermal progenitors. However, the feeder-free system was not sufficient to support the subsequent replicative capacity of differentiated keratinocytes. Of note, H1-Kert(AFF) showed limited replicative capacity with reduced telomere length and early cellular senescence. We further showed that the lack of cell-cell interactions during epidermal commitment led to heightened production of TGF-β1 by hESC-Kert during extended culture, which in turn was responsible for resulting in the limited replicative life span with cellular senescence of hESC-Kert derived under the feeder-free culture system. This study highlights for the first time the importance of the culture microenvironment and cell-ECM interactions during

  16. Epidermal Expression and Regulation of Interleukin-33 during Homeostasis and Inflammation: Strong Species Differences.

    Science.gov (United States)

    Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis

    2015-07-01

    IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.

  17. UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling.

    Science.gov (United States)

    Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B

    2013-08-20

    At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.

  18. A secretome analysis reveals that PPARα is upregulated by fractionated-dose γ-irradiation in three-dimensional keratinocyte cultures

    International Nuclear Information System (INIS)

    Lee, Jee Yong; Kim, Hyun Ji; Yi, Jae Youn

    2016-01-01

    A three-dimensional (3D) environment composed of properly interconnected and differentiated cells that allows communication and cooperation among cells via secreted molecules would be expected to more accurately reflect cellular responses. Here, we investigated γ-irradiation-induced changes in the secretome of 3D-cultured keratinocytes. An analysis of keratinocyte secretome profiles following fractionated-dose γ-irradiation revealed changes in genes involved in cell adhesion, angiogenesis, and the immune system. Notably, peroxisome proliferator-activated receptor-(PPARα) was upregulated in response to fractionated-dose γ-irradiation. This upregulation was associated with an increase in the transcription of known PPARα target genes, including angiopoietin-like protein 4, dermokine and kallikrein-related peptide 12, which were differentially regulated by fractionated-dose γ-irradiation. Collectively, our data imply a mechanism linking γ-irradiation and secretome changes, and suggest that these changes could play a significant role in the coordinated cellular responses to harmful ionizing radiation, such as those associated with radiation therapy. This extension of our understanding of γ-irradiation-induced secretome changes has the potential to improve radiation therapy strategies. Control of inflammatory waves, improved wound healing, and stabilization of the skin barrier are imperative for minimizing such injuries. Therefore, PPARα agonists and antagonists have the potential to become important therapeutic agents for the treatment of γ-irradiation induced skin damage. Specifically, our analysis suggests that the undesirable consequences of long-term exposure to ionizing radiation could be alleviated by PPARα agonists

  19. A secretome analysis reveals that PPARα is upregulated by fractionated-dose γ-irradiation in three-dimensional keratinocyte cultures

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jee Yong; Kim, Hyun Ji; Yi, Jae Youn [Korea Institute of Radiation and Medical Sciences, Daejeon (Korea, Republic of)

    2016-05-15

    A three-dimensional (3D) environment composed of properly interconnected and differentiated cells that allows communication and cooperation among cells via secreted molecules would be expected to more accurately reflect cellular responses. Here, we investigated γ-irradiation-induced changes in the secretome of 3D-cultured keratinocytes. An analysis of keratinocyte secretome profiles following fractionated-dose γ-irradiation revealed changes in genes involved in cell adhesion, angiogenesis, and the immune system. Notably, peroxisome proliferator-activated receptor-(PPARα) was upregulated in response to fractionated-dose γ-irradiation. This upregulation was associated with an increase in the transcription of known PPARα target genes, including angiopoietin-like protein 4, dermokine and kallikrein-related peptide 12, which were differentially regulated by fractionated-dose γ-irradiation. Collectively, our data imply a mechanism linking γ-irradiation and secretome changes, and suggest that these changes could play a significant role in the coordinated cellular responses to harmful ionizing radiation, such as those associated with radiation therapy. This extension of our understanding of γ-irradiation-induced secretome changes has the potential to improve radiation therapy strategies. Control of inflammatory waves, improved wound healing, and stabilization of the skin barrier are imperative for minimizing such injuries. Therefore, PPARα agonists and antagonists have the potential to become important therapeutic agents for the treatment of γ-irradiation induced skin damage. Specifically, our analysis suggests that the undesirable consequences of long-term exposure to ionizing radiation could be alleviated by PPARα agonists.

  20. Analysis of E2F factors during epidermal differentiation.

    Science.gov (United States)

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  1. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  2. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  3. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  4. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    International Nuclear Information System (INIS)

    Berkers, J.A.M.; Hassing, I.; Spenkelink, B.; Brouwer, A.; Blaauboer, B.J.

    1995-01-01

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the 35 S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC 50 ) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca 2+ -dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10 -8 M TCDD, 10 -6 M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  5. Dermal matrix proteins initiate re-epithelialization but are not sufficient for coordinated epidermal outgrowth in a new fish skin culture model.

    Science.gov (United States)

    Matsumoto, Reiko; Sugimoto, Masazumi

    2007-02-01

    We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.

  6. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  7. Cellular responses in primary epidermal cultures from oncorhynchus mykiss following the combined exposure of ionising radiation and a heavy metal

    International Nuclear Information System (INIS)

    Lyng, F.M.; Ni Shuilleabhain, S.; Davoren, M.

    2004-01-01

    Mechanisms of toxicant action on biological systems are difficult to identify when more than one contaminant is involved due to potential synergistic and antagonistic effects. There is a general paucity of research into the effect of radiation exposure in tandem with common environmental contaminants due to the inherent difficulties involved. In vitro cell cultures are particularly suited to the study of toxic mechanisms due to their proximity to toxic modes of action and the absence of the multiple defence mechanisms present in intact organisms. Primary cell cultures are particularly beneficial in this area of research as they still maintain many of their tissue specific functions. The objective of this study was to distinguish different mechanisms of cell death (growth arrest, apoptosis, primary and secondary necrosis and proliferation), following combination exposure to ionising radiation and a heavy metal (ZnCl 2 ). The model system employed was a primary cell culture of rainbow trout (Oncorhynchus mykiss) epidermal tissue which has been previously used to study the effects of various environmental agents in this laboratory. Apoptosis and necrosis were quantified morphologically while proliferation was assessed immuno-cyto-chemically using an anti PCNA (proliferating cell nuclear antigen) antibody. While radiation doses up to and including 10 Gy had no effect on growth, exposure to ZnCl 2 produced a significant dose dependent reduction in growth (10, 50, 75, 100 and 200 ppm ZnCl 2 ). Preliminary results indicate no significant effect on growth following a combined exposure of 5 Gy + 50 ppm ZnCl 2 . These results may have important implications for understanding the mechanisms underlying cellular responses to multiple contaminant exposures. (author)

  8. Integrin β4 Regulates Migratory Behavior of Keratinocytes by Determining Laminin-332 Organization*s

    Science.gov (United States)

    Sehgal, Bernd U.; DeBiase, Phillip J.; Matzno, Sumio; Chew, Teng-Leong; Claiborne, Jessica N.; Hopkinson, Susan B.; Russell, Alan; Marinkovich, M. Peter; Jones, Jonathan C. R.

    2010-01-01

    Whether α6β4 integrin regulates migration remains controversial. β4 integrin-deficient (JEB) keratinocytes display aberrant migration in that they move in circles, a behavior that mirrors the circular arrays of laminin (LM)-332 in their matrix. In contrast, wild-type keratinocytes and JEB keratinocytes, induced to express β4 integrin, assemble laminin-332 in linear tracks over which they migrate. Moreover, laminin-332-dependent migration of JEB keratinocytes along linear tracks is restored when cells are plated on wild-type keratinocyte matrix, whereas wild-type keratinocytes show rotation over circular arrays of laminn-332 in JEB keratinocyte matrix. The activities of Rac1 and the actin cytoskeleton-severing protein cofilin are low in JEB keratinocytes compared with wild-type cells but are rescued following expression of wild-type β4 integrin in JEB cells. Additionally, in wild-type keratinocytes Rac1 is complexed with α6β4 integrin. Moreover, Rac1 or cofilin inactivation induces wild-type keratinocytes to move in circles over rings of laminin-332 in their matrix. Together these data indicate that laminin-332 matrix organization is determined by the α6β4 integrin/actin cytoskeleton via Rac1/cofilin signaling. Furthermore, our results imply that the organizational state of laminin-332 is a key determinant of the motility behavior of keratinocytes, an essential element of skin wound healing and the successful invasion of epidermal-derived tumor cells. PMID:16973601

  9. Ultraviolet B irradiation induces changes in the distribution and release of arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture

    International Nuclear Information System (INIS)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1987-01-01

    There is increasing evidence that derivatives of 20-carbon polyunsaturated fatty acids, the eicosanoids, play an important role in the inflammatory responses of the human skin. To better understand the metabolic fate of fatty acids in the skin, the effect of ultraviolet B (UVB) irradiation (280-320 nm) on the distribution and release of 14 C-labeled arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture was investigated. Ultraviolet B irradiation induced the release of all three 14 C-labeled fatty acids from the phospholipids, especially from phosphatidylethanolamine, and this was accompanied by increased labeling of the nonphosphorus lipids. This finding suggests that UVB induces a significant liberation of eicosanoid precursor fatty acids from cellular phospholipids, but the liberated fatty acids are largely reincorporated into the nonphosphorus lipids. In conclusion, the present study suggests that not only arachidonic acid but also dihomo-gamma-linolenic acid, and eicosapentaenoic acid might be involved in the UVB irradiation-induced inflammatory reactions of human skin

  10. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  11. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  12. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  13. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    International Nuclear Information System (INIS)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A.

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs

  14. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  15. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  16. Measure of O(6)-Alkylguanine-DNA Alkyltransferase Activity in Normal Human Epidermal Keratinocytes in Culture and Effects of Bis-(2-chloroethyl)sulfide in the Activity

    National Research Council Canada - National Science Library

    Kurt, Ellen

    1999-01-01

    ...)-alkylguanine in DNA. AGT may be important in DNA repair following injury induced by bis-(2-chloroethyl)sulfide (sulfur mustard, HD), since O(sup 6)-alkylguanine is one of the HD alkylation products...

  17. A chemically defined culture medium containing Rho kinase inhibitor Y-27632 for the fabrication of stratified squamous epithelial cell grafts

    Energy Technology Data Exchange (ETDEWEB)

    Aslanova, Afag [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Takagi, Ryo; Yamato, Masayuki; Okano, Teruo [Institute of Advanced Biomedical Engineering and Science, Tokyo Women' s Medical University, TWIns, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan); Yamamoto, Masakazu, E-mail: yamamoto.ige@twmu.ac.jp [Department of Surgery, Institute of Gastroenterology, Tokyo Women' s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666 (Japan)

    2015-05-01

    With the development of a culture method for stratified squamous epithelial cells, tissue-engineered epithelial cell sheets have been successfully applied as clinical cell grafts. However, the implementation of these cell sheets without the use of any animal-derived materials is highly desirable. In this study, Rho-associated protein kinase inhibitor Y-27632 was used to develop a chemically defined culture medium for the fabrication of stratified epithelial cell grafts consisting of human epidermal and oral keratinocytes, and the proliferation activity, cell morphology, and gene expressions of the keratinocytes were analyzed. The results of a colorimetric assay indicated that Y-27632 significantly promoted the proliferation of the keratinocytes in culture media both with and without fetal bovine serum (FBS), although there were no indications of Y-27632 efficacy on cell morphology and stratification of the keratinocytes in culture medium without any animal-derived materials. The results of quantitative RT-PCR revealed that gene expressions correlated with cell adhesion, cell–cell junction, proliferation markers, and stem/progenitor markers in cultured keratinocytes were not strongly affected by the addition of Y-27632 to the culture medium. Moreover, gene expressions of differentiation markers in stratified keratinocytes cultured in medium without FBS were nearly identical to those of keratinocytes co-cultured with 3T3 feeder cells. Interestingly, the expressions of differentiation markers in cultured stratified keratinocytes were suppressed by FBS, whereas they were reconstructed by either co-culture of a 3T3 feeder layer or addition of Y-27632 into the culture medium containing FBS. These findings indicate that Y-27632 is a useful supplement for the development of a chemically defined culture medium for fabrication of stratified epithelial cell grafts for clinical applications for the purpose of developing the culture medium with a lower risk of pathogen

  18. A chemically defined culture medium containing Rho kinase inhibitor Y-27632 for the fabrication of stratified squamous epithelial cell grafts

    International Nuclear Information System (INIS)

    Aslanova, Afag; Takagi, Ryo; Yamato, Masayuki; Okano, Teruo; Yamamoto, Masakazu

    2015-01-01

    With the development of a culture method for stratified squamous epithelial cells, tissue-engineered epithelial cell sheets have been successfully applied as clinical cell grafts. However, the implementation of these cell sheets without the use of any animal-derived materials is highly desirable. In this study, Rho-associated protein kinase inhibitor Y-27632 was used to develop a chemically defined culture medium for the fabrication of stratified epithelial cell grafts consisting of human epidermal and oral keratinocytes, and the proliferation activity, cell morphology, and gene expressions of the keratinocytes were analyzed. The results of a colorimetric assay indicated that Y-27632 significantly promoted the proliferation of the keratinocytes in culture media both with and without fetal bovine serum (FBS), although there were no indications of Y-27632 efficacy on cell morphology and stratification of the keratinocytes in culture medium without any animal-derived materials. The results of quantitative RT-PCR revealed that gene expressions correlated with cell adhesion, cell–cell junction, proliferation markers, and stem/progenitor markers in cultured keratinocytes were not strongly affected by the addition of Y-27632 to the culture medium. Moreover, gene expressions of differentiation markers in stratified keratinocytes cultured in medium without FBS were nearly identical to those of keratinocytes co-cultured with 3T3 feeder cells. Interestingly, the expressions of differentiation markers in cultured stratified keratinocytes were suppressed by FBS, whereas they were reconstructed by either co-culture of a 3T3 feeder layer or addition of Y-27632 into the culture medium containing FBS. These findings indicate that Y-27632 is a useful supplement for the development of a chemically defined culture medium for fabrication of stratified epithelial cell grafts for clinical applications for the purpose of developing the culture medium with a lower risk of pathogen

  19. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  20. Generation of Genetically Modified Organotypic Skin Cultures Using Devitalized Human Dermis.

    Science.gov (United States)

    Li, Jingting; Sen, George L

    2015-12-14

    Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function and physiology of their in vivo tissue counterparts. This is exemplified by organotypic skin cultures which faithfully recapitulates the epidermal differentiation and stratification program. Primary human epidermal keratinocytes are genetically manipulable through retroviruses where genes can be easily overexpressed or knocked down. These genetically modified keratinocytes can then be used to regenerate human epidermis in organotypic skin cultures providing a powerful model to study genetic pathways impacting epidermal growth, differentiation, and disease progression. The protocols presented here describe methods to prepare devitalized human dermis as well as to genetically manipulate primary human keratinocytes in order to generate organotypic skin cultures. Regenerated human skin can be used in downstream applications such as gene expression profiling, immunostaining, and chromatin immunoprecipitations followed by high throughput sequencing. Thus, generation of these genetically modified organotypic skin cultures will allow the determination of genes that are critical for maintaining skin homeostasis.

  1. Combined Stimulation with the Tumor Necrosis Factor α and the Epidermal Growth Factor Promotes the Proliferation of Hepatocytes in Rat Liver Cultured Slices

    Directory of Open Access Journals (Sweden)

    Francis Finot

    2012-01-01

    Full Text Available The culture liver slices are mainly used to investigate drug metabolism and xenobiotic-mediated liver injuries while apoptosis and proliferation remain unexplored in this culture model. Here, we show a transient increase in LDH release and caspase activities indicating an ischemic injury during the slicing procedure. Then, caspase activities decrease and remain low in cultured slices demonstrating a low level of apoptosis. The slicing procedure is also associated with the G0/G1 transition of hepatocytes demonstrated by the activation of stress and proliferation signalling pathways including the ERK1/2 and JNK1/2/3 MAPKinases and the transient upregulation of c-fos. The cells further progress up to mid-G1 phase as indicated by the sequential induction of c-myc and p53 mRNA levels after the slicing procedure and at 24 h of culture, respectively. The stimulation by epidermal growth factor induces the ERK1/2 phosphorylation but fails to activate expression of late G1 and S phase markers such as cyclin D1 and Cdk1 indicating that hepatocytes are arrested in mid-G1 phase of the cell cycle. However, we found that combined stimulation by the proinflammatory cytokine tumor necrosis factor α and the epidermal growth factor promotes the commitment to DNA replication as observed in vivo during the liver regeneration.

  2. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  3. Heterogeneity of [3H]phorbol 12,13-dibutyrate binding in primary mouse keratinocytes at different stages of maturation

    International Nuclear Information System (INIS)

    Dunn, J.A.; Jeng, A.Y.; Yuspa, S.H.; Blumberg, P.M.

    1985-01-01

    Mouse keratinocytes respond heterogeneously to phorbol esters with distinct subpopulations stimulated to proliferate or induced to differentiate. The maturation state of the epidermal cell at the time of exposure may determine its response. The binding of phorbol esters to primary mouse keratinocytes was studied under culture conditions selecting for proliferating cells or differentiating cells. [20- 3 H]-12-Deoxyphorbol 13-isobutyrate ([ 3 H]-DPB) bound to both types of cells at one class of binding sites. The dissociation constant (Kd) for [ 3 H]DPB in the proliferative cells was 69 nM and the binding at saturation (Bmax) was 1.3 pmol/mg of protein. The corresponding values in the differentiative cells were 96 nM and 1.5 pmol/mg of protein, respectively. In contrast to the results obtained with [ 3 H]DPB, [20- 3 H]phorbol 12,13-dibutyrate ([ 3 H]PDBU) bound to both cell types in a heterogeneous fashion. The site for [ 3 H]DPB binding seemed to correspond to the higher affinity [ 3 H]PDBU binding site. The major difference in the cells grown in the medium containing 1.2 mM CaCl 2 was an increase in the Bmax of the lower affinity binding site with the other three parameters remaining similar. The state of epidermal differentiation thus appears to modulate the amount of the lower affinity binding sites for phorbol esters

  4. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Platelet-released growth factors (PRGF and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF® contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3 is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR. In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds.

  5. The Antimicrobial Peptide Human Beta-Defensin-3 Is Induced by Platelet-Released Growth Factors in Primary Keratinocytes

    Science.gov (United States)

    Lammel, Justus; Tohidnezhad, Mersedeh; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Cremer, Jochen; Jahr, Holger; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Platelet-released growth factors (PRGF) and its related clinically used formulations (e.g., Vivostat Platelet-Rich Fibrin (PRF®)) contain a variety of chemokines, cytokines, and growth factors and are therefore used to support healing of chronic, hard-to-heal, or infected wounds. Human beta-defensin-3 (hBD-3) is an antimicrobial peptide inducibly expressed in human keratinocytes especially upon wounding. The potent antimicrobial activity of hBD-3 together with its wound closure-promoting activities suggests that hBD-3 may play a crucial role in wound healing. Therefore, we analyzed the influence of PRGF on hBD-3 expression in human primary keratinocytes in vitro. In addition, we investigated the influence of Vivostat PRF on hBD-3 expression in artificially generated human skin wounds in vivo. PRGF treatment of primary keratinocytes induced a significant, concentration- and time-dependent increase in hBD-3 gene expression which was partially mediated by the epidermal growth factor receptor (EGFR). In line with these cell culture data, in vivo experiments revealed an enhanced hBD-3 expression in experimentally produced human wounds after the treatment with Vivostat PRF. Thus, the induction of hBD-3 may contribute to the beneficial effects of thrombocyte concentrate lysates in the treatment of chronic or infected wounds. PMID:28811680

  6. Keratinocyte-Melanocyte graft technique followed by PUVA therapy for stable vitiligo

    Directory of Open Access Journals (Sweden)

    Kachhawa Dilip

    2008-01-01

    Full Text Available Background: Various surgical procedures for correcting stable vitiligo exist but these have their own limitations. Autologous, non-cultured, non-trypsinized, melanocyte plus keratinocyte grafting is a new and simple method of vitiligo surgery. Objective: The study aimed to evaluate efficacy of a new grafting technique in vitiligo patches. Methods: Eighteen vitiligo patches underwent this procedure. The upper layer of epidermis was removed by superficial dermabrasion using a dermabrader micromotor until the epidermis appeared wet and shiny. Then, antibiotic ointment was applied and dermabrasion was continued up to the whitish area of the upper dermis. The paste-like material (ointment with entangled epidermal particles was collected and spread over the dermabraded recipient site. Results: Pigmentation usually started at 4-6 weeks. Complete uniform pigmentation took 16-20 weeks. Conclusion: For smaller vitiligo patches this method gives cosmetically acceptable results. It is easy to perform and does not require specific laboratory setup.

  7. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  8. Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

    Science.gov (United States)

    Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

    1999-01-01

    Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

  9. Staphylococcus aureus keratinocyte invasion is mediated by integrin-linked kinase and Rac1.

    Science.gov (United States)

    Sayedyahossein, Samar; Xu, Stacey X; Rudkouskaya, Alena; McGavin, Martin J; McCormick, John K; Dagnino, Lina

    2015-02-01

    Staphylococcus aureus is a major component of the skin microbiota and causes a large number of serious infections. S. aureus first interacts with epidermal keratinocytes to breach the epidermal barrier through mechanisms not fully understood. By use of primary keratinocytes from mice with epidermis-restricted Ilk gene inactivation and control integrin-linked kinase (ILK)-expressing littermates, we investigated the role of ILK in epidermal S. aureus invasion. Heat-killed, but not live, bacteria were internalized to Rab5- and Rab7-positive phagosomes, and incubation with keratinocyte growth factor increased their uptake 2.5-fold. ILK-deficient mouse keratinocytes internalized bacteria 2- to 4-fold less efficiently than normal cells. The reduced invasion by live S. aureus of ILK-deficient cells was restored in the presence of exogenous, constitutively active Rac1. Thus, Rac1 functions downstream from ILK during invasion. Further, invasion by S. aureus of Rac1-deficient cells was 2.5-fold lower than in normal cells. Paradoxically, staphylococcal cutaneous penetration of mouse skin explants with ILK-deficient epidermis was 35-fold higher than that of normal skin, indicating defects in epidermal barrier function in the absence of ILK. Thus, we identified an ILK-Rac1 pathway essential for bacterial invasion of keratinocytes, and established ILK as a key contributor to prevent invasive staphylococcal cutaneous infection. © FASEB.

  10. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  11. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    OpenAIRE

    Bayer, Andreas; Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF?) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiatio...

  12. A novel DLX3-PKC integrated signaling network drives keratinocyte differentiation.

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-Wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-04-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  13. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  14. Response of Primary Human Bone Marrow Mesenchymal Stromal Cells and Dermal Keratinocytes to Thermal Printer Materials In Vitro.

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Gridelli, Bruno; Gerlach, Jörg C

    Advancement in thermal three-dimensional printing techniques has greatly increased the possible applications of various materials in medical applications and tissue engineering. Yet, potential toxic effects on primary human cells have been rarely investigated. Therefore, we compared four materials commonly used in thermal printing for bioengineering, namely thermally printed acrylonitrile butadiene styrene, MED610, polycarbonate, and polylactic acid, and investigated their effects on primary human adult skin epidermal keratinocytes and bone marrow mesenchymal stromal cells (BM-MSCs) in vitro. We investigated indirect effects on both cell types caused by potential liberation of soluble substances from the materials, and also analyzed BM-MSCs in direct contact with the materials. We found that even in culture without direct contact with the materials, the culture with MED610 (and to a lesser extent acrylonitrile butadiene styrene) significantly affected keratinocytes, reducing cell numbers and proliferation marker Ki67 expression, and increasing glucose consumption, lactate secretion, and expression of differentiation-associated genes. BM-MSCs had decreased metabolic activity, and exhibited increased cell death in direct culture on the materials. MED610 and acrylonitrile butadiene styrene induced the strongest expression of genes associated to differentiation and estrogen receptor activation. In conclusion, we found strong cell-type-specific effects of the materials, suggesting that materials for applications in regenerative medicine should be carefully selected not only based on their mechanical properties but also based on their cell-type-specific biological effects.

  15. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  16. Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells

    Science.gov (United States)

    Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan

    2016-01-01

    Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify keratinocyte differentiation, we performed western blots using a specific antibody for involucrin, which is a precursor protein of the keratinocyte cornified envelope and a marker for keratinocyte terminal differentiation. We also performed quantitative polymerase chain reaction. We examined whether LDR induces changes in involucrin messenger RNA (mRNA) and protein levels in calcium-induced keratinocyte differentiation. Results Exposure of HaCaT cells to LDR (0.1 Gy) induced p21 expression. p21 is a key regulator that induces growth arrest and represses stemness, which accelerates keratinocyte differentiation. We correlated involucrin expression with keratinocyte differentiation, and examined the effects of LDR on involucrin levels and keratinocyte development. LDR significantly increased involucrin mRNA and protein levels during calcium-induced keratinocyte differentiation. Conclusion These studies provide new evidence for the biological role of LDR, and identify the potential to utilize LDR to regulate or induce keratinocyte differentiation. PMID:27489424

  17. A co-cultured skin model based on cell support membranes

    International Nuclear Information System (INIS)

    Dai, N.-T.; Yeh, M.-K.; Liu, Demeral David; Adams, E.F.; Chiang, C.-H.; Yen, C.-Y.; Shih, C.-M.; Sytwu, H.-K.; Chen, Tim-Mo; Wang, H.-J.; Williamson, M.R.; Coombes, A.G.A.

    2005-01-01

    Tissue engineering of skin based on collagen: PCL biocomposites using a designed co-culture system is reported. The collagen: PCL biocomposites having collagen: PCL (w/w) ratios of 1:4, 1:8, and 1:20 have been proven to be biocompatible materials to support both adult normal human epidermal Keratinocyte (NHEK) and mouse 3T3 fibroblast growth in cell culture, respectively, by Dai, Coombes, et al. in 2004. Films of collagen: PCL biocomposites were prepared using non-crosslinking method by impregnation of lyophilized collagen mats with PCL/dichloromethane solutions followed by solvent evaporation. To mimic the dermal/epidermal structure of skin, the 1:20 collagen: PCL biocomposites were selected for a feasibility study of a designed co-culture technique that would subsequently be used for preparing fibroblast/biocomposite/keratinocyte skin models. A 55.3% increase in cell number was measured in the designed co-culture system when fibroblasts were seeded on both sides of a biocomposite film compared with cell culture on one surface of the biocomposite in the feasibility study. The co-culture of human keratinocytes and 3T3 fibroblasts on each side of the membrane was therefore studied using the same co-culture system by growing keratinocytes on the top surface of membrane for 3 days and 3T3 fibroblasts underneath the membrane for 6 days. Scanning electron microscopy (SEM) and immunohistochemistry assay revealed good cell attachment and proliferation of both human keratinocytes and 3T3 fibroblasts with these two types of cells isolated well on each side of the membrane. Using a modified co-culture technique, a co-cultured skin model presenting a confluent epidermal sheet on one side of the biocomposite film and fibroblasts populated on the other side of the film was developed successfully in co-culture system for 28 days under investigations by SEM and immunohistochemistry assay. Thus, the design of a co-culture system based on 1:20 (w/w) collagen: PCL biocomposite

  18. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  19. Sustainability of keratinocyte gene transfer and cell survival in vivo.

    Science.gov (United States)

    Choate, K A; Khavari, P A

    1997-05-20

    The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.

  20. Essential role of integrin-linked kinase in regulation of phagocytosis in keratinocytes.

    Science.gov (United States)

    Sayedyahossein, Samar; Nini, Lylia; Irvine, Timothy S; Dagnino, Lina

    2012-10-01

    Phagocytic melanosome uptake by epidermal keratinocytes is a central protective mechanism against damage induced by ultraviolet radiation. Phagocytosis requires formation of pseudopodia via actin cytoskeleton rearrangements. Integrin-linked kinase (ILK) is an important modulator of actin cytoskeletal dynamics. We have examined the role of ILK in regulation of phagocytosis, using epidermal keratinocytes isolated from mice with epidermis-restricted Ilk gene inactivation. ILK-deficient cells exhibited severely impaired capacity to engulf fluorescent microspheres in response to stimulation of the keratinocyte growth factor (KGF) receptor or the protease-activated receptor-2. KGF induced ERK phosphorylation in ILK-expressing and ILK-deficient cells, suggesting that ILK is not essential for KGF receptor signaling. In contrast, KGF promoted activation of Rac1 and formation of pseudopodia in ILK-expressing, but not in ILK-deficient cells. Rac1-deficient keratinocytes also showed substantially impaired phagocytic ability, underlining the importance of ILK-dependent Rac1 function for particle engulfment. Finally, cross-modulation of KGF receptors by integrins may be another important element, as integrin β1-deficient keratinocytes also fail to show significant phagocytosis in response to KGF. Thus, we have identified a novel signaling pathway essential for phagocytosis in keratinocytes, which involves ILK-dependent activation of Rac1 in response to KGF, resulting in the formation of pseudopodia and particle uptake.

  1. Derivation of keratinocytes from chicken embryonic stem cells: Establishment and characterization of differentiated proliferative cell populations

    Directory of Open Access Journals (Sweden)

    Mathilde Couteaudier

    2015-03-01

    Full Text Available A common challenge in avian cell biology is the generation of differentiated cell-lines, especially in the keratinocyte lineage. Only a few avian cell-lines are available and very few of them show an interesting differentiation profile. During the last decade, mammalian embryonic stem cell-lines were shown to differentiate into almost all lineages, including keratinocytes. Although chicken embryonic stem cells had been obtained in the 1990s, few differentiation studies toward the ectodermal lineage were reported. Consequently, we explored the differentiation of chicken embryonic stem cells toward the keratinocyte lineage by using a combination of stromal induction, ascorbic acid, BMP4 and chicken serum. During the induction period, we observed a downregulation of pluripotency markers and an upregulation of epidermal markers. Three homogenous cell populations were derived, which were morphologically similar to chicken primary keratinocytes, displaying intracellular lipid droplets in almost every pavimentous cell. These cells could be serially passaged without alteration of their morphology and showed gene and protein expression profiles of epidermal markers similar to chicken primary keratinocytes. These cells represent an alternative to the isolation of chicken primary keratinocytes, being less cumbersome to handle and reducing the number of experimental animals used for the preparation of primary cells.

  2. Influence of epidermal growth factor (EGF) and hydrocortisone on the co-culture of mature adipocytes and endothelial cells for vascularized adipose tissue engineering.

    Science.gov (United States)

    Huber, Birgit; Czaja, Alina Maria; Kluger, Petra Juliane

    2016-05-01

    The composition of vascularized adipose tissue is still an ongoing challenge as no culture medium is available to supply adipocytes and endothelial cells appropriately. Endothelial cell medium is typically supplemented with epidermal growth factor (EGF) as well as hydrocortisone (HC). The effect of EGF on adipocytes is discussed controversially. Some studies say it inhibits adipocyte differentiation while others reported of improved adipocyte lipogenesis. HC is known to have lipolytic activities, which might result in mature adipocyte dedifferentiation. In this study, we evaluated the influence of EGF and HC on the co-culture of endothelial cells and mature adipocytes regarding their cell morphology and functionality. We showed in mono-culture that high levels of HC promoted dedifferentiation and proliferation of mature adipocytes, whereas EGF seemed to have no negative influence. Endothelial cells kept their typical cobblestone morphology and showed a proliferation rate comparable to the control independent of EGF and HC concentration. In co-culture, HC promoted dedifferentiation of mature adipocytes, which was shown by a higher glycerol release. EGF had no negative impact on adipocyte morphology. No negative impact on endothelial cell morphology and functionality could be seen with reduced EGF and HC supplementation in co-culture with mature adipocytes. Taken together, our results demonstrate that reduced levels of HC are needed for co-culturing mature adipocytes and endothelial cells. In co-culture, EGF had no influence on mature adipocytes. Therefore, for the composition of vascularized adipose tissue constructs, the media with low levels of HC and high or low levels of EGF can be used. © 2016 International Federation for Cell Biology.

  3. Melanoma cells influence the differentiation pattern of human epidermal keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Kodet, O.; Lacina, L.; Krejčí, E.; Dvořáková, B.; Grim, M.; Štork, J.; Kodetová, D.; Vlček, Čestmír; Šáchová, Jana; Kolář, Michal; Strnad, Hynek; Smetana, K.

    2015-01-01

    Roč. 14, č. 1 (2015), s. 1-1 ISSN 1476-4598 R&D Projects: GA ČR GAP304/12/1333; GA MZd(CZ) NT13488; GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:Charles University in Prague(CZ) PRVOUK 27 – 1; Charles University in Prague(CZ) UNCE 204013 Institutional support: RVO:68378050 Keywords : Melanoma * Cancer microenvironment * Melanocyte Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.888, year: 2015

  4. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  5. Abnormalities in the basement membrane structure promote basal keratinocytes in the epidermis of hypertrophic scars to adopt a proliferative phenotype.

    Science.gov (United States)

    Yang, Shaowei; Sun, Yexiao; Geng, Zhijun; Ma, Kui; Sun, Xiaoyan; Fu, Xiaobing

    2016-05-01

    The majority of studies on scar formation have mainly focused on the dermis and little is known of the involvement of the epidermis. Previous research has demonstrated that the scar tissue-derived keratinocytes are different from normal cells at both the genetic and cell biological levels; however, the mechanisms responsible for the fundamental abnormalities in keratinocytes during scar development remain elusive. For this purpose, in this study, we used normal, wound edge and hypertrophic scar tissue to examine the morphological changes which occur during epidermal regeneration as part of the wound healing process and found that the histological structure of hypertrophic scar tissues differed from that of normal skin, with a significant increase in epidermal thickness. Notably, staining of the basement membrane (BM) appeared to be absent in the scar tissues. Moreover, immunofluorescence staining for cytokeratin (CK)10, CK14, CK5, CK19 and integrin-β1 indicated the differential expression of cell markers in the epidermal keratinocytes among the normal, wound edge and hypertrophic scar tissues, which corresponded with the altered BM structures. By using a panel of proteins associated with BM components, we validated our hypothesis that the BM plays a significant role in regulating the cell fate decision of epidermal keratinocytes during skin wound healing. Alterations in the structure of the BM promote basal keratinocytes to adopt a proliferative phenotype both in vivo and in vitro.

  6. Cultivating technique for human keratinocyte under laboratory condition%实验室条件下人角质形成细胞的培养技术

    Institute of Scientific and Technical Information of China (English)

    卢宁; 朱平; 刘玉峰; 王刚; 张海龙; 赵小东

    2006-01-01

    Two step digestion technique was used for the isolation of epidermal cells: Firstly the skin flap was digested with dispase of mass concentration of 2.5 g/L at 4 ℃ for overnight, followed by separating epidermis the next day; Secondly it was dipped in trypsin and EDTA mixture for subsequent digestion. ② Improved serum-free cultivating technology was applied to the culture of human keratinocytes. The culture medium is composed of human keratinocyte serum free culture medium +2.5 mg/L bovine pituitary lixivium +5 μg/L epidermal growth factor+438 mg/L glutamine, glutamine can promote the growth of the keratinocyte. ③Human keratinocyte in exponential phase were cryopreserved and rewarmed, then made into cell suspension with additional serum free medium, cells were incubated in culture bottle of 75 cm2 by density of 5×105/mL for subculture. Cell morphological changes were observed under microscope and transmission electron microscope.MAIN OUTCOME MEASURES: ① The growth of primary cells and passage cells. ② The cryopreservation and resuscitation of human keratinocyte from different passages. ③ Morphological observation of Keratinocytes RESULTS: ①The growing state of the primary cells and passage cells:cells suspended primarily and gradually adhered to bottom of the culture dish at about 6-24 hours, most of cells were round and gradually stretched to ellipse shape, at about day 3, some keratinocyte clones and clusters can be observed with satellite-like proliferating epidermal cells scattered around, most of them were polygon and cell homogeneity and transparency became strengthened. Cell fusion amount to 70% at around 5 days, reaching to 90% at day 9 and even completely fused into cell diaphragm at day 1 1. Keratinocyte cultured in vitro can survive 2-3 months without obvious changes in cell morphology and growth speed. ② The cryopreservation and resuscitation of human keratinocyte in different passages: Different passage keratinocytes were separately

  7. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  8. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal α-toxin-induced keratinocyte death.

    Science.gov (United States)

    Brauweiler, Anne M; Bin, Lianghua; Kim, Byung Eui; Oyoshi, Michiko K; Geha, Raif S; Goleva, Elena; Leung, Donald Y M

    2013-02-01

    The skin of patients with atopic dermatitis (AD) has defects in keratinocyte differentiation, particularly in expression of the epidermal barrier protein filaggrin. AD skin lesions are often exacerbated by Staphylococcus aureus-mediated secretion of the virulence factor α-toxin. It is unknown whether lack of keratinocyte differentiation predisposes to enhanced lethality from staphylococcal toxins. We investigated whether keratinocyte differentiation and filaggrin expression protect against cell death induced by staphylococcal α-toxin. Filaggrin-deficient primary keratinocytes were generated through small interfering RNA gene knockdown. RNA expression was determined by using real-time PCR. Cell death was determined by using the lactate dehydrogenase assay. Keratinocyte cell survival in filaggrin-deficient (ft/ft) mouse skin biopsies was determined based on Keratin 5 staining. α-Toxin heptamer formation and acid sphingomyelinase expression were determined by means of immunoblotting. We found that filaggrin expression, occurring as the result of keratinocyte differentiation, significantly inhibits staphylococcal α-toxin-mediated pathogenicity. Furthermore, filaggrin plays a crucial role in protecting cells by mediating the secretion of sphingomyelinase, an enzyme that reduces the number of α-toxin binding sites on the keratinocyte surface. Finally, we determined that sphingomyelinase enzymatic activity directly prevents α-toxin binding and protects keratinocytes against α-toxin-induced cytotoxicity. The current study introduces the novel concept that S aureus α-toxin preferentially targets and destroys filaggrin-deficient keratinocytes. It also provides a mechanism to explain the increased propensity for S aureus-mediated exacerbation of AD skin disease. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  9. Enhanced expression of IL-8 in normal human keratinocytes and human keratinocyte cell line HaCaT in vitro after stimulation with contact sensitizers, tolerogens and irritants.

    Science.gov (United States)

    Mohamadzadeh, M; Müller, M; Hultsch, T; Enk, A; Saloga, J; Knop, J

    1994-12-01

    To investigate the interleukin-8 production of keratinocytes after stimulation in vitro we have used various agents: (i) contact sensitizer (2,4-dinitrofluorobenzene, 3-n-pentadecylcatechol); (ii) tolerogen (5-methyl-3-n-pentadecylcatechol); (iii) irritant (sodium lauryl sulfate). Interleukin-8 gene expression was assessed by northern blot hybridization of the total cytoplasmic RNA extracted from subconfluent normal human keratinocyte cultures and the keratinocyte cell line HaCaT using a radiolabeled DNA probe specific for human interleukin-8. Interleukin-8 gene expression was markedly increased upon in vitro stimulation after 1-6 h with contact sensitizers, tolerogen and the irritant. In contrast, interleukin-8 production was not detectable in unstimulated normal human keratinocytes or the HaCaT keratinocyte cell line. These results suggest that the induction and production of interleukin-8 is a response to nonspecific stimuli and may play a critical role in the early response to immunogenic or inflammatory signals in man.

  10. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  11. [Origins and selection of epidermal progenitors and stem cells: a challenge for tissue engineering].

    Science.gov (United States)

    Deshayes, Nathalie; Rathman-Josserand, Michelle

    2008-01-01

    The use of epidermal stem cells and their progeny for tissue engineering and cell therapy represents a source of hope and major interest in view of applications such as replacing the loss of functionality in failing tissues or obtaining physiologic skin equivalents for skin grafting. The use of such cells necessitates the isolation and purification of rare populations of keratinocytes and then increasing their numbers by mass culture. This is not currently possible since part of the specific phenotype of these cells is lost once the cells are placed in culture. Furthermore, few techniques are available to unequivocally detect the presence of skin stem cells and/or their progeny in culture and thus quantify them. Two different sources of stem cells are currently being studied for skin research and clinical applications: skin progenitors either obtained from embryonic stem cells (ESC) or from selection from adult skin tissue. It has been shown that "keratinocyte-like" cells can be derived from ESC; however, the culturing processes must still be optimized to allow for the mass culture of homogeneous populations at a controlled stage of differentiation. The functional characterization of such populations must also be more thoroughly achieved. In order to use stem cells from adult tissues, improvements must be made in order to obtain a satisfactory degree of purification and characterization of this rare population. Distinguishing stem cells from progenitor cells at the molecular level also remains a challenge. Furthermore, stem cell research inevitably requires cultivating these cells outside their physiological environment or niche. It will thus be necessary to better understand the impact of this specific environmental niche on the preservation of the cellular phenotypes of interest.

  12. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  13. First experience using cultured epidermal autografts in Taiwan for burn victims of the Formosa Fun Coast Water Park explosion, as part of Japanese medical assistance.

    Science.gov (United States)

    Matsumura, Hajime; Harunari, Nobuyuki; Ikeda, Hiroto

    2016-05-01

    On June 27, 2015, a flammable starch-based powder exploded at Formosa Fun Coast in Taipei, Taiwan, injuring 499 people, and more than 200 people were in critical condition with severe burns. Although a cultured epidermal autograft (CEA) was not approved or used in clinical practice, the Taiwan Food and Drug Administration requested a Japanese CEA manufacturer to donate CEA for the burn victims as part of international medical assistance. The authors cooperated in this project and participated in the patient selection, wound bed management for CEA, and technical assistance for CEA use. Here, we provide an overview of the project. Nine patients were enrolled, and two patients were excluded from the skin biopsy; seven skin biopsies were collected approximately 1 month after the disaster. The average TBSA% burned was 81.0%, and the mean age was 20.1 years. CEA was grafted in five patients; wound closure had been obtained in one patient, and one patient was severely ill at the time of grafting. The CEA was combined with a wide split auto mesh graft or patch graft. The mean re-epithelization rate at 4 weeks after the grafting was 84.2% by patient, and all of the patients survived. Although this project had many obstacles to overcome, CEA grafting was successful and contributed to wound closure and survival. Copyright © 2015 Elsevier Ltd and ISBI. All rights reserved.

  14. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  15. Evaluation of Permacol as a cultured skin equivalent.

    Science.gov (United States)

    MacLeod, T M; Cambrey, A; Williams, G; Sanders, R; Green, C J

    2008-12-01

    Skin loss following severe burn requires prompt wound closure to avoid such complications as fluid and electrolyte imbalance, infection, immune suppression, and pain. In clinical situations in which insufficient donor skin is available, the development of cultured skin equivalents (dermal matrices seeded with keratinocytes and fibroblasts) may provide a useful alternative. The aim of this study was to assess the suitability of a porcine-derived dermal collagen matrix (Permacol) to function as a cultured skin equivalent in supporting the growth of keratinocytes in vitro and providing cover to full thickness wounds in the BALB C/nude mouse model. A histological comparison was against Glycerol treated-Ethylene Oxide Sterilised Porcine Dermis (Gly-EO Dermis) which has successfully been used as a cultured skin equivalent in previous studies. Both Gly-EO Dermis and to a lesser extent Permacol were able to support the growth of cultured keratinocytes following a 16-day period of cell culture, however, this study was only able to demonstrate the presence of an epidermal layer on Gly-EO dermis 2 weeks after grafting onto full-thickness wounds in the BALB C/nude mouse model.

  16. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Itoi, Saori; Terao, Mika, E-mail: mterao@derma.med.osaka-u.ac.jp; Murota, Hiroyuki; Katayama, Ichiro

    2013-10-18

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10{sup −13} M cortisol, whereas 1 × 10{sup −5} M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol

  17. 11β-Hydroxysteroid dehydrogenase 1 contributes to the pro-inflammatory response of keratinocytes

    International Nuclear Information System (INIS)

    Itoi, Saori; Terao, Mika; Murota, Hiroyuki; Katayama, Ichiro

    2013-01-01

    Highlights: •We investigate the role of 11β-HSD1 in skin inflammation. •Various stimuli increase expression of 11β-HSD1 in keratinocytes. •11β-HSD1 knockdown by siRNA decreases cortisol levels in media. •11β-HSD1 knockdown abrogates the response to pro-inflammatory cytokines. •Low-dose versus high-dose cortisol has opposing effects on keratinocyte inflammation. -- Abstract: The endogenous glucocorticoid, cortisol, is released from the adrenal gland in response to various stress stimuli. Extra-adrenal cortisol production has recently been reported to occur in various tissues. Skin is known to synthesize cortisol through a de novo pathway and through an activating enzyme. The enzyme that catalyzes the intracellular conversion of hormonally-inactive cortisone into active cortisol is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is expressed in normal human epidermal keratinocytes (NHEKs) and negatively regulates proliferation of NHEKs. In this study, we investigated the role of 11β-HSD1 in skin inflammation. Expression of 11β-HSD1 was induced by UV-B irradiation and in response to the pro-inflammatory cytokines, IL-1β and TNFα. Increased cortisol concentrations in culture media also increased in response to these stimuli. To investigate the function of increased 11β-HSD1 in response to pro-inflammatory cytokines, we knocked down 11β-HSD1 by transfecting siRNA. Production of IL-6 and IL-8 in response to IL-1β or TNFα stimulation was attenuated in NHEKs transfected with si11β-HSD1 compared with control cells. In addition, IL-1β-induced IL-6 production was enhanced in cultures containing 1 × 10 −13 M cortisol, whereas 1 × 10 −5 M cortisol attenuated production of IL-6. Thus, cortisol showed immunostimulatory and immunosuppressive activities depending on its concentration. Our results indicate that 11β-HSD1 expression is increased by various stimuli. Thus, regulation of cytosolic cortisol concentrations

  18. Differential Regulation of Galectin Expression/Reactivity during Wound Healing in Porcine Skin and in Cultures if Epidermal Cells with Functional Impact on Migration

    Czech Academy of Sciences Publication Activity Database

    Klíma, Jiří; Lacina, L.; Dvořánková, B.; Hermann, D.; Carnwath, J. W.; Niemann, H.; Kaltner, H.; André, S.; Motlík, Jan; Gabius, H. J.; Smetana Jr., K.

    2009-01-01

    Roč. 58, č. 6 (2009), s. 873-884 ISSN 0862-8408 R&D Projects: GA MŠk 1M0538 Institutional research plan: CEZ:AV0Z50450515 Keywords : Epidermis * Keratinocytes * Lecitin Subject RIV: FH - Neurology Impact factor: 1.430, year: 2009

  19. Internalization of EGF receptor following lipid rafts disruption in keratinocytes is delayed and dependent on p38 MAPK activation

    DEFF Research Database (Denmark)

    Lambert, S.; Ameels, H.; Gniadecki, R.

    2008-01-01

    The receptor for epidermal growth factor (EGF) plays an important role in epidermal keratinocytes and is known to move out of lipid raft after cholesterol depletion, leading to ligand-independent activation. Accumulation of evidence indicates the ability of EGF receptor (EGFR) to undergo internal......The receptor for epidermal growth factor (EGF) plays an important role in epidermal keratinocytes and is known to move out of lipid raft after cholesterol depletion, leading to ligand-independent activation. Accumulation of evidence indicates the ability of EGF receptor (EGFR) to undergo...... internalization without participation of the ligand under the control of p38 MAPK during stress conditions. Since cholesterol depletion using methyl-beta-cyclodextrin is known to induce ligand-independent activation of EGFR in keratinocytes, we investigated by confocal microscopy and ligand-binding tests...... the process of internalization, which can be considered as a protective response to stress. Moreover, cholesterol-depleted keratinocytes recover their ability to proliferate during the recovery period that follows lipid raft disruption Udgivelsesdato: 2008/12...

  20. A novel DLX3–PKC integrated signaling network drives keratinocyte differentiation

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-01-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  1. Exploratory Study on the Stability Characteristics of Commercial Human Keratinocytes

    Science.gov (United States)

    1990-04-01

    Invest. Dermatol. 75:176- 182; 1980. 16. Hayflick , L. The limited in vitro lifetime of huiran diploid strains. Exp. Cell Res. 37:614-636; 1965. 17...culture keratinocytes were considered by some investigators to have limited proliferative potential, so they used third and fourth passage commercial

  2. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  3. Interactions Between Epidermal Keratinocytes, Dendritic Epidermal T-Cells, and Hair Follicle Stem Cells.

    Science.gov (United States)

    Badarinath, Krithika; Dutta, Abhik; Hegde, Akshay; Pincha, Neha; Gund, Rupali; Jamora, Colin

    2018-06-13

    The interplay of immune cells and stem cells in maintaining skin homeostasis and repair is an exciting new frontier in cutaneous biology. With the growing appreciation of the importance of this new crosstalk comes the requirement of methods to interrogate the molecular underpinnings of these leukocyte-stem cell interactions. Here we describe how a combination of FACS, cellular coculture assays, and conditioned media treatments can be utilized to advance our understanding of this emerging area of intercellular communication between immune cells and stem cells.

  4. Aldefluor protocol to sort keratinocytes stem cells from skin

    OpenAIRE

    Noronha, Samuel Marcos Ribeiro; Gragnani, Alfredo; Pereira, Thiago Antônio Calado; Correa, Silvana Aparecida Alves; Bonucci, Jessica; Ferreira, Lydia Masako

    2017-01-01

    Abstract Purpose: To investigate the use Aldefluor® and N, N - Dimethylaminobenzaldehyde (DEAB) to design a protocol to sort keratinocyte stem cells from cultured keratinocytes from burned patients. Methods: Activated Aldefluor® aliquots were prepared and maintained at temperature between 2 to 8°C, or stored at -20°C. Next, the cells were collected following the standard protocol of sample preparation. Results: Best results were obtained with Aldefluor® 1.5µl and DEAB 15 µl for 1 x 106 c...

  5. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  6. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  7. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  8. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  9. Neurohumoral mechanisms of keratinocytes regulation in diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Ekaterina Viktorovna Artemova

    2016-12-01

    Full Text Available The extent of damage to the nervous, vascular and microcirculatory systems in diabetic patients determine the regulation of physiological events that lead to the formation of chronic wounds, reduction of patient quality of life and increase of the financial value of medical care. Successful physiological repair is impossible without the successive phases of inflammation, proliferation and wound healing. Keratinocytes are the major cellular barrier components of the epidermis. These cells play an important role in physiological repair, as suggested by recent research, with many cells able to secrete steroid hormones de novo. Damage to the integrity of the skin leads to keratinocyte activation, triggering a cascade of reactions that contribute to changes in epidermal cell phenotype and lead to their proliferation and migration, analogous to changes in cellular adhesion and configuration of the cytoskeleton. An open question remains as to how the keratinocyte cell cycle, which is altered under conditions of hyperglycemia, and neurotransmitter metabolism during different stages of physiological repair are regulated. Understanding these processes will provide a scientific basis for the development of new targets for pharmacotherapies.

  10. UVA Irradiation of Dysplastic Keratinocytes: Oxidative Damage versus Antioxidant Defense

    Science.gov (United States)

    Nechifor, Marina T.; Niculiţe, Cristina M.; Urs, Andreea O.; Regalia, Teodor; Mocanu, Mihaela; Popescu, Alexandra; Manda, Gina; Dinu, Diana; Leabu, Mircea

    2012-01-01

    UVA affects epidermal cell physiology in a complex manner, but the harmful effects have been studied mainly in terms of DNA damage, mutagenesis and carcinogenesis. We investigated UVA effects on membrane integrity and antioxidant defense of dysplastic keratinocytes after one and two hours of irradiation, both immediately after exposure, and 24 h post-irradiation. To determine the UVA oxidative stress on cell membrane, lipid peroxidation was correlated with changes in fatty acid levels. Membrane permeability and integrity were assessed by propidium iodide staining and lactate dehydrogenase release. The effects on keratinocyte antioxidant protection were investigated in terms of catalase activity and expression. Lipid peroxidation increased in an exposure time-dependent manner. UVA exposure decreased the level of polyunsaturated fatty acids, which gradually returned to its initial value. Lactate dehydrogenase release showed a dramatic loss in membrane integrity after 2 h minimum of exposure. The cell ability to restore membrane permeability was noted at 24 h post-irradiation (for one hour exposure). Catalase activity decreased in an exposure time-dependent manner. UVA-irradiated dysplastic keratinocytes developed mechanisms leading to cell protection and survival, following a non-lethal exposure. The surviving cells gained an increased resistance to apoptosis, suggesting that their pre-malignant status harbors an abnormal ability to control their fate. PMID:23222638

  11. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  12. Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

    NARCIS (Netherlands)

    Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.

    2015-01-01

    Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis

  13. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  14. Cobertura de grandes quemados con cultivo de queratinocitos: casuística de nuestra Unidad y protocolo de tratamiento Massive burn coverage with keratinocytes cultured: our casuistry and treatment protocol

    Directory of Open Access Journals (Sweden)

    I. González Alaña

    2012-09-01

    Full Text Available El paciente gran quemado sigue siendo hoy en día un difícil reto al que se enfrentan múltiples profesionales sanitarios. La elevada mortalidad de estos pacientes se justifica por la severa alteración del estado general que sufren, las múltiples complicaciones que se asocian y por la ausencia de piel válida para cubrir las quemaduras, como sucede en el caso de los quemados de gran extensión. Este último inconveniente se solventa de diferentes maneras, siendo una de las más importantes el cultivo de queratinocitos. En la Unidad de Quemados del Hospital Universitario de Cruces en Baracaldo (Vizcaya, España, iniciamos la aplicación de esta técnica en 2001, con una experiencia acumulada en esta década de 14 pacientes. El objetivo de este artículo es mostrar nuestro protocolo de aplicación del procedimiento para la cobertura de quemados extensos, los criterios de inclusión y la terapéutica pre y postaplicación de las láminas de queratinocitos que empleamos en nuestra Unidad. Así mismo, presentamos las características de los pacientes tratados y nuestra propia experiencia en la aplicación de esta técnica que, a pesar de lograr resultados cada vez más satisfactorios y ser en ocasiones la única alternativa para un paciente extensamente quemado, tiene todavía hoy en día tantos detractores.The severe burn patient continues being nowadays a difficult challenge which multiple sanitary professionals face. The high mortality of these patients justifies itself by the severe alteration of the general condition, the multiple complications that they suffer and the absence of skin for their coverage, as is the case of extensive burns. This last disadvantage is settled in different ways, being one of the most important the treatment with keratinocytes culture. In the Cruces Universitary Hospital Burn Unit in Baracaldo (Vizcaya, Spain, we began the clinical application of this technique in 2001, with a 14 patients accumulated experience in

  15. Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuaki Kobayashi

    Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

  16. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  17. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  18. Interference by 2,3,7,8-tetrachlorodibenzo-p-dioxin with cultured mouse submandibular gland branching morphogenesis involves reduced epidermal growth factor receptor signaling

    International Nuclear Information System (INIS)

    Kiukkonen, Anu; Sahlberg, Carin; Partanen, Anna-Maija; Alaluusua, Satu; Pohjanvirta, Raimo; Tuomisto, Jouko; Lukinmaa, Pirjo-Liisa

    2006-01-01

    Toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) to mouse embryonic teeth, sharing features of early development with salivary glands in common, involves enhanced apoptosis and depends on the expression of epidermal growth factor (EGF) receptor. EGF receptor signaling, on the other hand, is essential for salivary gland branching morphogenesis. To see if TCDD impairs salivary gland morphogenesis and if the impairment is associated with EGF receptor signaling, we cultured mouse (NMRI) E13 submandibular glands with TCDD or TCDD in combination with EGF or fibronectin (FN), both previously found to enhance branching morphogenesis. Explants were examined stereomicroscopically and processed to paraffin sections. TCDD exposure impaired epithelial branching and cleft formation, resulting in enlarged buds. The glands were smaller than normal. EGF and FN alone concentration-dependently stimulated or inhibited branching morphogenesis but when co-administered with TCDD, failed to compensate for its effect. TCDD induced cytochrome P4501A1 expression in the glandular epithelium, indicating activation of the aryl hydrocarbon receptor. TCDD somewhat increased epithelial apoptosis as observed by terminal deoxynucleotidyl transferase (TdT)-mediated nick end-labeling method but the increase could not be correlated with morphological changes. The frequency of proliferating cells was not altered. Corresponding to the reduced cleft sites in TCDD-exposed explants, FN immunoreactivity in the epithelium was reduced. The results show that TCDD, comparably with EGF and FN at morphogenesis-inhibiting concentrations, impaired salivary gland branching morphogenesis in vitro. Together with the failure of EGF and FN at morphogenesis-stimulating concentrations to compensate for the effect of TCDD this implies that TCDD toxicity to developing salivary gland involves reduced EGF receptor signaling

  19. Potential involvement of oxygen intermediates and glutathione depletion in UV-induced epidermal cell injury in vitro

    International Nuclear Information System (INIS)

    Hsieh, G.C.; Acosta, D.

    1991-01-01

    Generation of reactive oxygen species (ROS) and depletion of glutathione (GSH) are suggested as the cytotoxic mechanisms for UVB-induced cellular damage. Primary monolayer cultures of epidermal keratinocytes (KCs) prepared from the skin of neonatal rats were irradiated with UVB at levels of 0.25-3.0 J/cm 2 . Cytotoxicity was measured at 3, 6, and 12 hr after UVB radiation. Exposure of KCs to UVB resulted in time- and dose-related toxic responses as determined by plasma membrane integrity, lysosomal function and mitochondrial metabolic activity. Irradiated KCs generated superoxide in a dose-dependent manner when compared to sham-irradiated cells. Superoxide formation, which occurred before and concomitant with cell injury, was decreased by superoxide dismutase (SOD). Cell injury was also significantly prevented by ROS scavengers, SOD and catalase. Pretreatment of cells with endocytosis inhibitors, cytochalasin B and methylamine, suppressed the ability of SOD and catalase to protect keratinocytes from UVB-induced toxicity. Irradiation of cells with UVB caused rapid depletion of GSH to about 30% of unirradiated levels within 15 min. UVB-irradiation led to a rapid transient increase in GSH peroxidase activity, concomitant with a marked decrease in the GSH/GSSG ratio. After 1 hr., while the GSH/GSSG ratio remained low, the GSH peroxidase activity declined below the control levels in UVB-treated epidermal cells. Following extensive GSH depletion in cells preincubated with 0.1 mM buthiomine sulfoximine, KCs became strongly sensitized to the cytotoxic action of UVB. These results indicate that UVB-induced cell injury in cultured KCs may be mediated by ROs and that endogenous GSH may play an important protective role against the cytotoxic action of UVB

  20. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Mathor, Monica Beatriz.

    1994-01-01

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10 6 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10 6 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn +2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  1. Comparison of the rate of uptake and biologic effects of retinol added to human keratinocytes either directly to the culture medium or bound to serum retinol-binding protein

    International Nuclear Information System (INIS)

    Hodam, J.R.; St Hilaire, P.; Creek, K.E.

    1991-01-01

    Retinol circulates in the plasma bound to retinol-binding protein (RBP), but the mechanism by which retinol is transferred from RBP to target cells is not known. To study retinol delivery, human keratinocytes (HKc) were incubated with [3H]retinol added directly to the culture medium or bound to RBP and the uptake of [3H]retinol was determined at various times. During the first hour of incubation, the rate of [3H]retinol accumulation by HKc was about 40 times greater when the vitamin was added directly to the media rather than bound to RBP. Although maximal uptake of [3H]retinol added directly to the culture medium occurred at 3 h, the uptake of [3H]retinol from RBP was linear with time for at least 72 h. By 57 h, cell-associated [3H]retinol was the same whether it was added directly to the culture medium or bound to RBP. Excess unlabeled retinol or pretreatment of HKc with retinol had no effect on the uptake of [3H]retinol added directly to the culture medium or bound to RBP. Apo- but not holo-RBP was capable of competing with HKc for the uptake of [3H]retinol from RBP. No specific or saturable binding of 125I-labeled RBP to HKc cultured in the absence or the presence of retinol was found. The dose response of retinol inhibition of cholesterol sulfate synthesis and phorbol ester-induced ornithine decarboxylase activity or retinol modulation of keratin expression was the same whether the retinol was delivered to HKc bound to RBP or added directly to the medium. Our data support a mechanism for retinol delivery from RBP to HKc that does not involve cell-surface RBP receptors but instead suggest that the vitamin is first slowly released from RBP and then becomes cell-associated from the aqueous phase. This mechanism is consistent with the finding that HKc respond identically to retinol whether or not it is delivered to them bound to RBP

  2. Characterization and evaluation of whey protein-based biofilms as substrates for in vitro cell cultures.

    Science.gov (United States)

    Gilbert, Vanessa; Rouabhia, Mahmoud; Wang, Hongxum; Arnould, Anne-Lise; Remondetto, Gabriel; Subirade, Muriel

    2005-12-01

    Whey proteins-based biofilms were prepared using different plasticizers in order to obtain a biomaterial for the human keratinocytes and fibroblasts in vitro culture. The film properties were evaluated by Fourier Transform Infrared Spectroscopy (FTIR) technique and mechanical tests. A relationship was found between the decrease of intermolecular hydrogen bond strength and film mechanical behavior changes, expressed by a breaking stress and Young modulus values diminishing. These results allow stating that the film molecular configuration could induce dissimilarities in its mechanical properties. The films toxicity was assessed by evaluating the cutaneous cells adherence, growth, proliferation and structural stratification. Microscopic observation demonstrated that both keratinocytes and fibroblasts adhered to the biofilms. The trypan blue exclusion test showed that keratinocytes grew at a significantly high rate on all the biofilms. Structural analysis demonstrated that keratinocytes stratified when cultured on the whey protein-based biofilms and gave rise to multi-layered epidermal structures. The most organized epidermis was obtained with whey protein isolate/DEG biofilm. This structure had a well-organized basal layer under supra-basal and corneous layers. This study demonstrated that whey proteins, an inexpensive renewable resource which can be obtained readily, were non-toxic to cutaneous cells and thus they could be useful substrates for a variety of biomedical applications, including tissue engineering.

  3. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  4. Intermittent pressure decreases human keratinocyte proliferation in vitro.

    Science.gov (United States)

    Nasca, Maria R; Shih, Alan T; West, Dennis P; Martinez, Wanda M; Micali, Giuseppe; Landsman, Adam S

    2007-01-01

    The aim of this study was to investigate the correlation between pressure changes and keratinocyte proliferation by determining whether keratinocytes exposed to altered mechanical pressures would proliferate at different rates compared to control cells not subjected to pressure changes. Tissue culture flasks of human keratinocytes plated at an approximate density of 15,000 cells/cm(2) undergoing an intermittent cyclic pressure of 362 mm Hg at a frequency of 2.28 or 5.16 cycles/min (0.038 or 0.086 Hz) for 8 h were compared to control flasks grown at ambient room pressure. An in-line pressure transducer was used to monitor and adjust pressure within the cell chambers, using a solenoid valve. A thymidine incorporation assay assessed the amount of cell proliferation in each set of experiments. Differences in proliferation between keratinocytes subjected to cyclic pressure changes and control cells were found to be statistically significant (p < 0.05) in 4 out of 5 proliferation assays. Also, a higher frequency of pressure changes consistently generated a reduced proliferation rate compared to that seen in cells exposed to a lower frequency of pressure changes. These data indicate that keratinocytes undergoing intermittent pressure changes exhibit decreased proliferation rates compared to controls. Furthermore, an increased frequency rate seems to have a greater effect on proliferation than low-frequency rate pressure changes, suggesting that the stress caused by frequently changed pressure may play a greater role in reducing keratinocyte proliferation than the actual magnitude of load applied to the cells. Our results support the current treatment protocol of reducing speed and duration of walking on the site of the wound to promote healing of foot ulcers. (c) 2007 S. Karger AG, Basel.

  5. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  6. Integrin-linked kinase and ELMO2 modulate recycling endosomes in keratinocytes.

    Science.gov (United States)

    Ho, Ernest; Ivanova, Iordanka A; Dagnino, Lina

    2016-12-01

    The formation of tight cell-cell junctions is essential in the epidermis for its barrier properties. In this tissue, keratinocytes follow a differentiation program tightly associated with their movement from the innermost basal to the outer suprabasal layers, and with changes in their cell-cell adhesion profile. Intercellular adhesion in keratinocytes is mediated through cell-cell contacts, including E-cadherin-based adherens junctions. Although the mechanisms that mediate E-cadherin delivery to the plasma membrane have been widely studied in simple epithelia, this process is less well understood in the stratified epidermis. In this study, we have investigated the role of Engulfment and Cell Motility 2 (ELMO2) and integrin-linked kinase (ILK) in the positioning of E-cadherin-containing recycling endosomes during establishment of cell-cell contacts in differentiating keratinocytes. We now show that induction of keratinocyte differentiation by Ca 2+ is accompanied by localization of ELMO2 and ILK to Rab4- and Rab11a-containing recycling endosomes. The positioning of long-loop Rab11a-positive endosomes at areas adjacent to cell-cell contacts is disrupted in ELMO2- or ILK-deficient keratinocytes, and is associated with impaired localization of E-cadherin to cell borders. Our studies show a previously unrecognized role for ELMO2 and ILK in modulation of endosomal positioning, which may play key roles in epidermal sheet maintenance and permeability barrier function. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  8. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  9. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  10. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro.

    Science.gov (United States)

    Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J; Baker, Timothy R; Troutman, John A; Hewitt, Nicola J; Goebel, Carsten

    2015-09-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis-Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte Km and Vmax values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and Cmax was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. Copyright © 2015. Published by Elsevier Inc.

  11. Secretion of human epidermal growth factor (EGF) in autotrophic culture by a recombinant hydrogen-utilizing bacterium, Pseudomonas pseudoflava, carrying broad-host-range EGF secretion vector pKSEGF2.

    OpenAIRE

    Hayase, N; Ishiyama, A; Niwano, M

    1994-01-01

    We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...

  12. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

    Directory of Open Access Journals (Sweden)

    Aleksandra Piwko-Czuchra

    Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

  13. Rab11b mediates melanin transfer between donor melanocytes and acceptor keratinocytes via coupled exo/endocytosis.

    Science.gov (United States)

    Tarafder, Abul K; Bolasco, Giulia; Correia, Maria S; Pereira, Francisco J C; Iannone, Lucio; Hume, Alistair N; Kirkpatrick, Niall; Picardo, Mauro; Torrisi, Maria R; Rodrigues, Inês P; Ramalho, José S; Futter, Clare E; Barral, Duarte C; Seabra, Miguel C

    2014-04-01

    The transfer of melanin from melanocytes to keratinocytes is a crucial process underlying maintenance of skin pigmentation and photoprotection against UV damage. Here, we present evidence supporting coupled exocytosis of the melanin core, or melanocore, by melanocytes and subsequent endocytosis by keratinocytes as a predominant mechanism of melanin transfer. Electron microscopy analysis of human skin samples revealed three lines of evidence supporting this: (1) the presence of melanocores in the extracellular space; (2) within keratinocytes, melanin was surrounded by a single membrane; and (3) this membrane lacked the melanosomal membrane protein tyrosinase-related protein 1 (TYRP1). Moreover, co-culture of melanocytes and keratinocytes suggests that melanin exocytosis is specifically induced by keratinocytes. Furthermore, depletion of Rab11b, but not Rab27a, caused a marked decrease in both keratinocyte-stimulated melanin exocytosis and transfer to keratinocytes. Thus, we propose that the predominant mechanism of melanin transfer is keratinocyte-induced exocytosis, mediated by Rab11b through remodeling of the melanosome membrane, followed by subsequent endocytosis by keratinocytes.

  14. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  15. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  16. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  17. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  18. The caspase-1 inhibitor CARD18 is specifically expressed during late differentiation of keratinocytes and its expression is lost in lichen planus.

    Science.gov (United States)

    Qin, Haihong; Jin, Jiang; Fischer, Heinz; Mildner, Michael; Gschwandtner, Maria; Mlitz, Veronika; Eckhart, Leopold; Tschachler, Erwin

    2017-08-01

    CARD18 contains a caspase recruitment domain (CARD) via which it binds to caspase-1 and thereby inhibits caspase-1-mediated activation of the pro-inflammatory cytokine interleukin (IL)-1β. To determine the expression profile and the role of CARD18 during differentiation of keratinocytes and to compare the expression of CARD18 in normal skin and in inflammatory skin diseases. Human keratinocytes were induced to differentiate in monolayer and in 3D skin equivalent cultures. In some experiments, CARD18-specific siRNAs were used to knock down expression of CARD18. CARD18 mRNA levels were determined by quantitative real-time PCR, and CARD18 protein was detected by Western blot and immunofluorescence analyses. In situ expression was analyzed in skin biopsies obtained from healthy donors and patients with psoriasis and lichen planus. CARD18 mRNA was expressed in the epidermis at more than 100-fold higher levels than in any other human tissue. Within the epidermis, CARD18 was specifically expressed in the granular layer. In vitro CARD18 was strongly upregulated at both mRNA and protein levels in keratinocytes undergoing terminal differentiation. In skin equivalent cultures the expression of CARD18 was efficiently suppressed by siRNAs without impairing stratum corneum formation. Epidermal expression of CARD18 was increased after ultraviolet (UV)B irradiation of skin explants. In skin biopsies of patients with psoriasis no consistent regulation of CARD18 expression was observed, however, in lesional epidermis of patients with lichen planus, CARD18 expression was either greatly diminished or entirely absent whereas in non-lesional areas expression was comparable to normal skin. Our results identify CARD18 as a differentiation-associated keratinocyte protein that is altered in abundance by UV stress. Its downregulation in lichen planus indicates a potential role in inflammatory reactions of the epidermis in this disease. Copyright © 2017 Japanese Society for Investigative

  19. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Manwaring, John, E-mail: manwaring.jd@pg.com [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Rothe, Helga [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany); Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A. [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Hewitt, Nicola J. [SWS, Erzhausen (Germany); Goebel, Carsten [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany)

    2015-09-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K{sub m} and V{sub max} values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C{sub max} was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human

  20. Extrapolation of systemic bioavailability assessing skin absorption and epidermal and hepatic metabolism of aromatic amine hair dyes in vitro

    International Nuclear Information System (INIS)

    Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A.; Hewitt, Nicola J.; Goebel, Carsten

    2015-01-01

    Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K m and V max values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C max was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human skin explants and

  1. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  2. Adherence of human oral keratinocytes and gingival fibroblasts to nano-structured titanium surfaces.

    Science.gov (United States)

    Dorkhan, Marjan; Yücel-Lindberg, Tülay; Hall, Jan; Svensäter, Gunnel; Davies, Julia R

    2014-06-21

    A key element for long-term success of dental implants is integration of the implant surface with the surrounding host tissues. Modification of titanium implant surfaces can enhance osteoblast activity but their effects on soft-tissue cells are unclear. Adherence of human keratinocytes and gingival fibroblasts to control commercially pure titanium (CpTi) and two surfaces prepared by anodic oxidation was therefore investigated. Since implant abutments are exposed to a bacteria-rich environment in vivo, the effect of oral bacteria on keratinocyte adhesion was also evaluated. The surfaces were characterized using scanning electron microscopy (SEM). The number of adhered cells and binding strength, as well as vitality of fibroblasts and keratinocytes were evaluated using confocal scanning laser microscopy after staining with Live/Dead Baclight. To evaluate the effect of bacteria on adherence and vitality, keratinocytes were co-cultured with a four-species streptococcal consortium. SEM analysis showed the two anodically oxidized surfaces to be nano-structured with differing degrees of pore-density. Over 24 hours, both fibroblasts and keratinocytes adhered well to the nano-structured surfaces, although to a somewhat lesser degree than to CpTi (range 42-89% of the levels on CpTi). The strength of keratinocyte adhesion was greater than that of the fibroblasts but no differences in adhesion strength could be observed between the two nano-structured surfaces and the CpTi. The consortium of commensal streptococci markedly reduced keratinocyte adherence on all the surfaces as well as compromising membrane integrity of the adhered cells. Both the vitality and level of adherence of soft-tissue cells to the nano-structured surfaces was similar to that on CpTi. Co-culture with streptococci reduced the number of keratinocytes on all the surfaces to approximately the same level and caused cell damage, suggesting that commensal bacteria could affect adherence of soft-tissue cells to

  3. Scanning Ion Conductance Microscopy of Live Keratinocytes

    International Nuclear Information System (INIS)

    Hegde, V; Mason, A; Saliev, T; Smith, F J D; McLean, W H I; Campbell, P A

    2012-01-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (< nN), could not routinely image microvilli: rather, an apparently convolved image of the underlying cytoskeleton was instead prevalent. We note that the present incarnation of the commercial instrument falls some way behind the market leading SPMs in terms of technical prowess and scanning speed, however, the intrinsic non-obtrusive nature of

  4. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    Science.gov (United States)

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  5. Single Low-Dose Radiation Induced Regulation of Keratinocyte Differentiation in Calcium-Induced HaCaT Cells

    OpenAIRE

    Hahn, Hyung Jin; Youn, Hae Jeong; Cha, Hwa Jun; Kim, Karam; An, Sungkwan; Ahn, Kyu Joong

    2016-01-01

    Background We are continually exposed to low-dose radiation (LDR) in the range 0.1 Gy from natural sources, medical devices, nuclear energy plants, and other industrial sources of ionizing radiation. There are three models for the biological mechanism of LDR: the linear no-threshold model, the hormetic model, and the threshold model. Objective We used keratinocytes as a model system to investigate the molecular genetic effects of LDR on epidermal cell differentiation. Methods To identify kera...

  6. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  7. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  8. Exposure to carbon ions triggers pro-inflammatory signals, changes in homeostasis and epidermal tissue organization to a similar extent as photons

    Directory of Open Access Journals (Sweden)

    Palma eSimoniello

    2016-01-01

    Full Text Available The increasing application of charged particles in radiotherapy requires a deeper understanding of early and late side effects occurring in skin, which is exposed in all radiation treatments. We measured cellular and molecular changes related to the early inflammatory response of human skin irradiated with carbon ions, in particular cell death induction and changes in differentiation and proliferation of epidermal cells during the first days after exposure.Model systems for human skin from healthy donors of different complexity, i.e. keratinocytes, co-culture of skin cells, 3D skin equivalent and skin explants, were used to investigate the alterations induced by carbon ions (spread-out Bragg-peak, dose averaged LET 100 keV/µm in comparison to X-ray and UV-B exposure. After exposure to ionizing radiation, in none of the model systems apoptosis/necrosis was observed. Carbon ions triggered inflammatory signalling and accelerated differentiation of keratinocytes to a similar extent as X-rays at the same doses. High doses of carbon ions were more effective than X-rays in reducing proliferation and inducing abnormal differentiation. In contrast, changes identified following low dose exposure (≤ 0.5 Gy were induced more effectively after X-ray exposure, i.e. enhanced proliferation and change in the polarity of basal cells.

  9. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  10. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta.

    Science.gov (United States)

    McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle

    2017-11-01

    SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  11. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  12. The epithelial-mesenchymal transition induced by keratinocyte growth conditions is overcome by E6 and E7 from HPV16, but not HPV8 and HPV38: Characterization of global transcription profiles

    International Nuclear Information System (INIS)

    Azzimonti, Barbara; Dell'Oste, Valentina; Borgogna, Cinzia; Mondini, Michele; Gugliesi, Francesca; De Andrea, Marco; Chiorino, Giovanna; Scatolini, Maria; Ghimenti, Chiara; Landolfo, Santo; Gariglio, Marisa

    2009-01-01

    The aim of this study was to evaluate the growth properties of primary human keratinocytes expressing E6 and E7 proteins, which are from either the β- or α-genotypes, under different culture conditions. We demonstrated that keratinocytes expressing E6 and E7, from both HPV8 and 38, irreversibly underwent the epithelial-mesenchymal transition (EMT) when grown on plastic with FAD medium (F12/DMEM/5%FBS). Expression of E6/E7 from HPV16 was capable of fully overcoming the FAD-induced EMT. Immortalization was only observed in HPV16-transduced cell lines, while the more proliferating phenotype of both KerHPV8 and 38 was mainly related to FAD-induced EMT. Microarray analysis of exponentially growing cells identified 146 cellular genes that were differentially regulated in HPV16 compared to HPV8- and 38-transduced cells. A large accumulation of transcripts associated with epidermal development and differentiation was observed in HPV16-transduced cells, whereas transcripts of genes involved in the extracellular matrix, multicellular organismal processes, and inflammatory response were affected in HPV8 and 38-transduced cells.

  13. Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

    Directory of Open Access Journals (Sweden)

    Naser Tayyebi Meibodi

    2011-01-01

    Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

  14. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.

    Science.gov (United States)

    Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F

    2005-09-15

    Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.

  15. TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

    Directory of Open Access Journals (Sweden)

    Aurélie Hayez

    Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

  16. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

    DEFF Research Database (Denmark)

    Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

    2009-01-01

    BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

  17. Activation of endogenous opioid gene expression in human keratinocytes and fibroblasts by pulsed radiofrequency energy fields

    Directory of Open Access Journals (Sweden)

    Moffett J

    2012-09-01

    Full Text Available John Moffett,1 Linley M Fray,1 Nicole J Kubat21Life Science Department, 2Independent Consultant, Regenesis Biomedical Inc, Scottsdale, AZ, USABackground: Pulsed radiofrequency energy (PRFE fields are being used increasingly for the treatment of pain arising from dermal trauma. However, despite their increased use, little is known about the biological and molecular mechanism(s responsible for PRFE-mediated analgesia. In general, current therapeutics used for analgesia target either endogenous factors involved in inflammation, or act on endogenous opioid pathways.Methods and Results: Using cultured human dermal fibroblasts (HDF and human epidermal keratinocytes (HEK, we investigated the effect of PRFE treatment on factors, which are involved in modulating peripheral analgesia in vivo. We found that PRFE treatment did not inhibit cyclooxygenase enzyme activity, but instead had a positive effect on levels of endogenous opioid precursor mRNA (proenkephalin, pro-opiomelanocortin, prodynorphin and corresponding opioid peptide. In HEK cells, increases in opioid mRNA were dependent, at least in part, on endothelin-1. In HDF cells, additional pathways also appear to be involved. PRFE treatment was also followed by changes in endogenous expression of several cytokines, including increased levels of interleukin-10 mRNA and decreased levels of interleukin-1β mRNA in both cell types.Conclusion: These findings provide a new insight into the molecular mechanism underlying PRFE-mediated analgesia reported in the clinical setting.Keywords: peripheral analgesia, endogenous opioids, endothelin-1, endothelin receptor A, endothelin receptor B, pulsed radiofrequency energy field, cyclooxygenase

  18. Concentration-dependent effect of platelet-rich plasma on keratinocyte and fibroblast wound healing.

    Science.gov (United States)

    Xian, Law Jia; Chowdhury, Shiplu Roy; Bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2015-03-01

    Platelet-rich plasma (PRP) has been found to contain a high concentration of growth factors that are present during the process of healing. Studies conducted found that application of PRP accelerates wound healing. In this study, we characterized the skin cell suspension harvested using the co-isolation technique and evaluated the effects of PRP (10% and 20%, v/v) on co-cultured keratinocytes and fibroblasts in terms of wound healing. Human keratinocytes and fibroblasts were harvested via co-isolation technique and separated via differential trypsinization. These cells were then indirectly co-cultured in medium supplemented with 10% or 20% PRP for 3 days without medium change for analysis of wound-healing potential. The wound-healing potential of keratinocytes and fibroblasts was evaluated in terms of growth property, migratory property, extracellular matrix gene expression and soluble factor secretion. The co-isolation technique yielded a skin cell population dominated by fibroblasts and keratinocytes, with a small amount of melanocytes. Comparison between the 10% and 20% PRP cultures showed that the 10% PRP culture exhibited higher keratinocyte apparent specific growth rate, and secretion of hepatocyte growth factor, monocyte chemoattractant protein-1, epithelial-derived neutrophil-activating protein 78 and vascular endothelial growth factor A, whereas the 20% PRP culture has significantly higher collagen type 1 and collagen type 3 expressions and produced more granulocyte-macrophage colony-stimulating factor. PRP concentration modulates keratinocyte and fibroblast wound healing potential, whereby the 10% PRP promotes wound remodeling, whereas the 20% PRP enhances inflammation and collagen deposition. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  19. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Keratinocyte proliferation, differentiation, and apoptosis-Differential mechanisms of regulation by curcumin, EGCG and apigenin

    International Nuclear Information System (INIS)

    Balasubramanian, Sivaprakasam; Eckert, Richard L.

    2007-01-01

    We have proposed that it is important to examine the impact of chemopreventive agents on the function of normal human epidermal keratinocytes since these cells comprise the barrier that protects the body from a range of environmental insults. In this context, it is widely appreciated that cancer may be retarded by consumption or topical application of naturally occurring food-derived chemopreventive agents. Our studies show that (-)-epigallocatechin-3-gallate (EGCG), a green tea-derived polyphenol, acts to enhance the differentiation of normal human keratinocytes as evidenced by its ability to increase involucrin (hINV), transglutaminase type 1 (TG1) and caspase-14 gene expression. EGCG also stimulates keratinocyte morphological differentiation. These actions of EGCG are mediated via activation of a nPKC, Ras, MEKK1, MEK3, p38δ-ERK1/2 signaling cascade which leads to increased activator protein 1 (AP1) and CAATT enhancer binding protein (C/EBP) transcription factor expression, increased binding of these factors to DNA, and increased gene transcription. In contrast, apigenin, a dietary flavonoid derived from plants and vegetables, and curcumin, an agent derived from turmeric, inhibit differentiation by suppressing MAPK signal transduction and reducing API transcription factor level. Curcumin also acts to enhance apoptosis, although EGCG and apigenin do not stimulate apoptosis. In addition, all of these agents inhibit keratinocyte proliferation. These findings indicate that each of these diet-derived chemopreventive agents has a profound impact on normal human keratinocyte function and that they operate via distinct and sometimes opposing mechanisms. However, all are expected to act as chemopreventive agents

  1. CDH1 regulates E2F1 degradation in response to differentiation signals in keratinocytes.

    Science.gov (United States)

    Singh, Randeep K; Dagnino, Lina

    2017-01-17

    The E2F1 transcription factor plays key roles in skin homeostasis. In the epidermis, E2F1 expression is essential for normal proliferation of undifferentiated keratinocytes, regeneration after injury and DNA repair following UV radiation-induced photodamage. Abnormal E2F1 expression promotes nonmelanoma skin carcinoma. In addition, E2F1 must be downregulated for proper keratinocyte differentiation, but the relevant mechanisms involved remain poorly understood. We show that differentiation signals induce a series of post-translational modifications in E2F1 that are jointly required for its downregulation. Analysis of the structural determinants that govern these processes revealed a central role for S403 and T433. In particular, substitution of these two amino acid residues with non-phosphorylatable alanine (E2F1 ST/A) interferes with E2F1 nuclear export, K11- and K48-linked polyubiquitylation and degradation in differentiated keratinocytes. In contrast, replacement of S403 and T433 with phosphomimetic aspartic acid to generate a pseudophosphorylated E2F1 mutant protein (E2F1 ST/D) generates a protein that is regulated in a manner indistinguishable from that of wild type E2F1. Cdh1 is an activating cofactor that interacts with the anaphase-promoting complex/cyclosome (APC/C) ubiquitin E3 ligase, promoting proteasomal degradation of various substrates. We found that Cdh1 associates with E2F1 in keratinocytes. Inhibition or RNAi-mediated silencing of Cdh1 prevents E2F1 degradation in response to differentiation signals. Our results reveal novel regulatory mechanisms that jointly modulate post-translational modifications and downregulation of E2F1, which are necessary for proper epidermal keratinocyte differentiation.

  2. Rapid adhesion and proliferation of keratinocytes on the gold colloid/chitosan film scaffold

    International Nuclear Information System (INIS)

    Zhang Yi; He Hong; Gao Wenjuan; Lu Shuangyun; Liu Yang; Gu Haiying

    2009-01-01

    The gold colloid/chitosan film scaffold, which could enhance the attached ratio and accelerate proliferation of newborn mice keratinocytes, was fabricated by nanotechnology and self-assembly technology. This nanometer scaffold was characterized by atomic force microscopy (AFM) and scanning electron microscopy (SEM). The keratinocytes were cultured and observed on three different extracellular matrices (ECM): gold colloid/chitosan film scaffold, chitosan film and cell culture plastic (control groups). 6 h, 12 h, 24 h after inoculation, the cell attached ratios were calculated respectively. In comparison to control groups, this scaffold could significantly (P < 0.01) increase the attached ratio of keratinocytes and promote their growth. Meanwhile, there were not any fusiform fibroblasts growing on this scaffold. The rapidly proliferating keratinocytes were indentified and characterized by immunohistochemistry and transmissive electron microscope (TEM), which showed the cells maintain their biological activity well. The results indicated that gold colloid/chitosan film scaffold was nontoxic to keratinocytes, and was a good candidate for wound dressing in skin tissue engineering.

  3. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes.

    Science.gov (United States)

    Sancilio, Silvia; Di Staso, Silvio; Sebastiani, Stefano; Centurione, Lucia; Di Girolamo, Nick; Ciancaglini, Marco; Di Pietro, Roberta

    2017-01-01

    Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody) and CD140 (anti-fibroblast transmembrane glycoprotein antibody) expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  4. Curcuma longa Is Able to Induce Apoptotic Cell Death of Pterygium-Derived Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Silvia Sancilio

    2017-01-01

    Full Text Available Pterygium is a relatively common eye disease that can display an aggressive clinical behaviour. To evaluate the in vitro effects of Curcuma longa on human pterygium-derived keratinocytes, specimens of pterygium from 20 patients undergoing pterygium surgical excision were collected. Pterygium explants were put into culture and derived keratinocytes were treated with an alcoholic extract of 1.3% Curcuma longa in 0.001% Benzalkonium Chloride for 3, 6, and 24 h. Cultured cells were examined for CAM5.2 (anti-cytokeratin antibody and CD140 (anti-fibroblast transmembrane glycoprotein antibody expression between 3th and 16th passage to assess cell homogeneity. TUNEL technique and Annexin-V/PI staining in flow cytometry were used to detect keratinocyte apoptosis. We showed that Curcuma longa exerts a proapoptotic effect on pterygium-derived keratinocytes already after 3 h treatment. Moreover, after 24 h treatment, Curcuma longa induces a significant increase in TUNEL as well as Annexin-V/PI positive cells in comparison to untreated samples. Our study confirms previous observations highlighting the expression, in pterygium keratinocytes, of nuclear VEGF and gives evidence for the first time to the expression of nuclear and cytoplasmic VEGF-R1. All in all, these findings suggest that Curcuma longa could have some therapeutic potential in the treatment and prevention of human pterygium.

  5. Influence of extracellular matrix proteins on human keratinocyte attachment, proliferation and transfer to a dermal wound model.

    Science.gov (United States)

    Dawson, R A; Goberdhan, N J; Freedlander, E; MacNeil, S

    1996-03-01

    The aim of this study was to investigate whether prior culture of cells on ECM proteins might positively influence the performance of keratinocytes when cells are transferred to a dermal in vitro wound bed model. Keratinocytes were cultured using a method for producing cultured epithelial autografts for severely burned patients (essentially using Green's medium, a mitogen-rich medium containing fetal calf serum, cholera toxin, EGF, insulin, transferrin and triiodothyronine). Cells were cultured either on irradiated 3T3 fibroblasts (as in the standard Rheinwald and Green technique) or, alternatively, on collagen I, collagen IV, matrigel, RGD, vitronectin or fibronectin. Under these conditions matrigel, collagen I and IV enhanced initial attachment, RGD, vitronectin, fibronectin and irradiated 3T3 fibroblasts did not. Proliferation of cells was positively influenced by matrigel, collagen I and IV and irradiated 3T3 fibroblasts; of these, however, only matrigel and 3T3 fibroblasts had sustained significant effects on keratinocyte proliferation over 4 days. Cells on fibronectin showed significantly reduced proliferation. An acellular non-viable dermis was then used to mimic the homograft allodermis onto which cultured epithelial autograft sheets are grafted clinically and cells cultured on the various ECM proteins for 96 h were transferred to this in vitro wound model. None of the substrates enhanced keratinocyte performance on this model. It was concluded that under these conditions some ECM proteins can significantly affect keratinocyte attachment and, to a lesser extent, proliferation but that the culture of keratinocytes on these ECM proteins does not appear to confer any lasting benefit to the attachment of these keratinocytes to an in vitro wound-bed model.

  6. Chafuroside B, an Oolong tea polyphenol, ameliorates UVB-induced DNA damage and generation of photo-immunosuppression related mediators in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Tatsuya Hasegawa

    Full Text Available Chafuroside B was recently isolated as a new polyphenolic constituent of oolong tea leaves. However, the effects of chafuroside B on skin function have not been examined. In this study, we investigated the protective effects of chafuroside B against UVB-induced DNA damage, apoptosis and generation of photo-immunosuppression related mediators in cultured normal human epidermal keratinocytes (NHEK. Chafuroside B at 1 µM attenuated both UVB-induced apoptosis, evaluated in terms of caspase-3/7 activity, and UVB-induced DNA damage, evaluated in terms of formation of cyclobutane pyrimidine dimers (CPD, in NHEK exposed to UVB (20 mJ/cm2. In addition, chafuroside B at 0.3 or 1 µM suppressed the UVB-induced production of interleukin (IL-10, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2, as determined by ELISA, and conversely enhanced IL-12 mRNA expression and production, as measured by RT-PCR and ELISA. Further, chafuroside B at 1 µM also suppressed UVB-induced expression of receptor activator of nuclear factor κB ligand (RANKL mRNA. These results indicate that chafuroside B promotes repair of UVB-induced DNA damage and ameliorates the generation of IL-10, TNF-α, PGE2, and RANKL, all of which are UVB-induced immunosuppression related mediators. These effects of chafuroside B may be mediated at least in part through induction of IL-12 synthesis in human keratinocytes. Because chafuroside B might have practical value as a photoprotective agent, a further study of the in vivo effects of chafuroside B seems warranted.

  7. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  8. Clinical application of a tissue-cultured skin autograft: an alternative for the treatment of non-healing or slowly healing wounds?

    Science.gov (United States)

    Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland

    2014-01-01

    The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.

  9. IKKα regulates human keratinocyte migration through surveillance of the redox environment.

    Science.gov (United States)

    Lisse, Thomas S; Rieger, Sandra

    2017-03-01

    Although the functions of H 2 O 2 in epidermal wound repair are conserved throughout evolution, the underlying signaling mechanisms are largely unknown. In this study we used human keratinocytes (HEK001) to investigate H 2 O 2 -dependent wound repair mechanisms. Scratch wounding led to H 2 O 2 production in two or three cell layers at the wound margin within ∼30 min and subsequent cysteine modification of proteins via sulfenylation. Intriguingly, exogenous H 2 O 2 treatment resulted in preferential sulfenylation of keratinocytes that adopted a migratory phenotype and detached from neighboring cells, suggesting that one of the primary functions of H 2 O 2 is to stimulate signaling factors involved in cell migration. Based on previous findings that revealed epidermal growth factor receptor (EGFR) involvement in H 2 O 2 -dependent cell migration, we analyzed oxidation of a candidate upstream target, the inhibitor of κB kinase α (IKKα; encoded by CHUK ), as a mechanism of action. We show that IKKα is sulfenylated at a conserved cysteine residue in the kinase domain, which correlates with de-repression of EGF promoter activity and increased EGF expression. Thus, this indicates that IKKα promotes migration through dynamic interactions with the EGF promoter depending on the redox state within cells. © 2017. Published by The Company of Biologists Ltd.

  10. Keratinocyte Motility Is Affected by UVA Radiation—A Comparison between Normal and Dysplastic Cells

    Directory of Open Access Journals (Sweden)

    Cristina M. Niculiţe

    2018-06-01

    Full Text Available UVA radiation induces multiple and complex changes in the skin, affecting epidermal cell behavior. This study reports the effects of UVA exposure on normal (HaCaT and dysplastic (DOK keratinocytes. The adherence, spreading and proliferation were investigated by time-lapse measurement of cell layer impedance on different matrix proteins. Prior to UVA exposure, the time required for adherence and spreading did not differ significantly for HaCaT and DOK cells, while spreading areas were larger for HaCaT cells. Under UVA exposure, HaCaT and DOK cells behavior differed in terms of movement and proliferation. The cells’ ability to cover the denuded surface and individual cell trajectories were recorded by time-lapse videomicroscopy, during wound healing experiments. Dysplastic keratinocytes showed more sensitivity to UVA, exhibiting transient deficiencies in directionality of movement and a delay in re-coating the denuded area. The actin cytoskeleton displayed a cortical organization immediately after irradiation, in both cell lines, similar to mock-irradiated cells. Post-irradiation, DOK cells displayed a better organization of stress fibers, persistent filopodia, and new, stronger focal contacts. In conclusion, after UVA exposure HaCaT and DOK cells showed a different behavior in terms of adherence, spreading, motility, proliferation, and actin cytoskeleton dynamics, with the dyplastic keratinocytes being more sensitive.

  11. Hydrogen-enriched water restoration of impaired calcium propagation by arsenic in primary keratinocytes

    Science.gov (United States)

    Yu, Wei-Tai; Chiu, Yi-Ching; Lee, Chih-Hung; Yoshioka, Tohru; Yu, Hsin-Su

    2013-11-01

    Endemic contamination of artesian water for drinking by arsenic is known to cause several human cancers, including cancers of the skin, bladder, and lungs. In skin, multiple arsenic-induced Bowen's disease (As-BD) can develop into invasive cancers after decades of arsenic exposure. The characteristic histological features of As-BD include full-layer epidermal dysplasia, apoptosis, and abnormal proliferation. Calcium propagation is an essential cellular event contributing to keratinocyte differentiation, proliferation, and apoptosis, all of which occur in As-BD. This study investigated how arsenic interferes calcium propagation of skin keratinocytes through ROS production and whether hydrogen-enriched water would restore arsenic-impaired calcium propagation. Arsenic was found to induce oxidative stress and inhibit ATP- and thapsigaragin-induced calcium propagation. Pretreatment of arsenic-treated keratinocytes by hydrogen-enriched water or beta-mercaptoethanol with potent anti-oxidative effects partially restored the propagation of calcium by ATP and by thapsigaragin. It was concluded that arsenic may impair calcium propagation, likely through oxidative stress and interactions with thiol groups in membrane proteins.

  12. Intercellular Communication between Keratinocytes and Fibroblasts Induces Local Osteoclast Differentiation: a Mechanism Underlying Cholesteatoma-Induced Bone Destruction.

    Science.gov (United States)

    Iwamoto, Yoriko; Nishikawa, Keizo; Imai, Ryusuke; Furuya, Masayuki; Uenaka, Maki; Ohta, Yumi; Morihana, Tetsuo; Itoi-Ochi, Saori; Penninger, Josef M; Katayama, Ichiro; Inohara, Hidenori; Ishii, Masaru

    2016-06-01

    Bone homeostasis is maintained by a balance in activity between bone-resorbing osteoclasts and bone-forming osteoblasts. Shifting the balance toward bone resorption causes osteolytic bone diseases such as rheumatoid arthritis and periodontitis. Osteoclast differentiation is regulated by receptor activator of nuclear factor κB ligand (RANKL), which, under some pathological conditions, is produced by T and B lymphocytes and synoviocytes. However, the mechanism underlying bone destruction in other diseases is little understood. Bone destruction caused by cholesteatoma, an epidermal cyst in the middle ear resulting from hyperproliferation of keratinizing squamous epithelium, can lead to lethal complications. In this study, we succeeded in generating a model for cholesteatoma, epidermal cyst-like tissue, which has the potential for inducing osteoclastogenesis in mice. Furthermore, an in vitro coculture system composed of keratinocytes, fibroblasts, and osteoclast precursors was used to demonstrate that keratinocytes stimulate osteoclast differentiation through the induction of RANKL in fibroblasts. Thus, this study demonstrates that intercellular communication between keratinocytes and fibroblasts is involved in the differentiation and function of osteoclasts, which may provide the molecular basis of a new therapeutic strategy for cholesteatoma-induced bone destruction. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  14. Cellular interactions of a lipid-based nanocarrier model with human keratinocytes: Unravelling transport mechanisms.

    Science.gov (United States)

    Silva, Elisabete; Barreiros, Luísa; Segundo, Marcela A; Costa Lima, Sofia A; Reis, Salette

    2017-04-15

    Knowledge of delivery system transport through epidermal cell monolayer is vital to improve skin permeation and bioavailability. Recently, nanostructured lipid carriers (NLCs) have gained great attention for transdermal delivery due to their biocompatibility, high drug payload, occlusive properties and skin hydration effect. However, the nanocarriers transport related mechanisms in epidermal epithelial cells are not yet understood. In this research, the internalization and transport pathways of the NLCs across the epidermal epithelial cell monolayer (HaCaT cells) were investigated. The 250nm sized witepsol/miglyol NLCs, prepared by hot homogenization had reduced cytotoxicity and no effect on the integrity of cell membrane in human HaCaT keratinocytes. The internalization was time-, concentration- and energy-dependent, and the uptake of NLCs was a vesicle-mediated process by macropinocytosis and clathrin-mediated pathways. 3% of NLCs were found at the apical membrane side of the HaCaT monolayer through exocytosis mechanism. Additionally, the endoplasmic reticulum, Golgi apparatus and microtubules played crucial roles in the transport of NLCs out of HaCaT cells. NLCs were transported intact across the human keratinocytes monolayer, without disturbing the tight junction's structure. From the transcytosis data only approximately 12% of the internalized NLCs were passed from the apical to the basolateral side. The transcytosis of NLCs throughout the HaCaT cell monolayer towards the basolateral membrane side requires the involvement of the endoplasmic reticulum, Golgi apparatus and microtubules. Our findings may contribute to a systematic understanding of NLCs transport across epidermal epithelial cell monolayers and their optimization for clinical transdermal application. Transdermal drug delivery is a challenging and growing area of clinical application. Lipid nanoparticles such as nanostructured lipid carriers (NLCs) have gained wide interest for transdermal drug

  15. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  16. Modulation of interferon-gamma-induced HLA-DR expression on the human keratinocyte cell line SCC-13 by ultraviolet radiation

    International Nuclear Information System (INIS)

    Khan, I.U.; Boehm, K.D.; Elmets, C.A.

    1993-01-01

    Cell surface expression of major histocompatibility determinants on epidermal keratinocytes is a characteristic feature of a number of inflammatory dermatoses and in all likelihood is caused by diffusion of human leukocyte antigen (HLA)-DR-inducing cytokines from cells present in the dermal mononuclear cell infiltrate. Many of these same disorders respond to ultraviolet (UV) radiation phototherapy. Using the human SCC-13 keratinocyte cell line as a model, UV radiation was found to inhibit interferon-gamma-induced HLA-DR expression. Inhibition correlated closely with decreased steady-state levels of HLA-DR mRNA. These findings provide evidence that the therapeutic effect of UV radiation phototherapy may be mediated by its capacity to down-regulate cytokine-induced keratinocyte HLA-DR expression. (Author)

  17. Differences in the melanosome distribution within the epidermal melanin units and its association with the impairing background of leukoderma in vitiligo and halo nevi: a retrospective study.

    Science.gov (United States)

    Xiong, Xi-Xi; Ding, Gao-Zhong; Zhao, Wen-E; Li, Xue; Ling, Yu-Ting; Sun, Li; Gong, Qing-Li; Lu, Yan

    2017-07-01

    Skin color is determined by the number of melanin granules produced by melanocytes that are transferred to keratinocytes. Melanin synthesis and the distribution of melanosomes to keratinocytes within the epidermal melanin unit (EMU) within the skin of vitiligo patients have been poorly studied. The ultrastructure and distribution of melanosomes in melanocytes and surrounding keratinocytes in perilesional vitiligo and normal skin were investigated using transmission electron microscopy (TEM). Furthermore, we performed a quantitative analysis of melanosome distribution within the EMUs with scatter plot. Melanosome count within keratinocytes increased significantly compared with melanocytes in perilesional stable vitiligo (P vitiligo. Furthermore, melanosome counts within melanocytes and their surrounding keratinocytes in perilesional active vitiligo skin decreased significantly compared with the other groups. In addition, taking the means-standard error of melanosome count within melanocytes and keratinocytes in healthy controls as a normal lower limit, EMUs were graded into 3 stages (I-III). Perilesional active vitiligo presented a significantly different constitution in stages compared to other groups (P vitiligo. Active vitiligo varies in stages and in stage II, EMUs are slightly impaired, but can be resuscitated, providing a golden opportunity with the potential to achieve desired repigmentation with an appropriate therapeutic choice. Adverse milieu may also contribute to the low melanosome count in keratinocytes.

  18. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  19. Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

    International Nuclear Information System (INIS)

    Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del; Larcher, Fernando; Guaguere, Eric; Danos, Olivier; Meneguzzi, Guerrino

    2006-01-01

    Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 (α3β3γ2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the α3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretion of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials

  20. Changes in localization of human discs large (hDlg) during keratinocyte differentiation is associated with expression of alternatively spliced hDlg variants

    International Nuclear Information System (INIS)

    Roberts, S.; Calautti, E.; Vanderweil, S.; Nguyen, H.O.; Foley, A.; Baden, H.P.; Viel, A.

    2007-01-01

    Alternative spliced variants of the human discs large (hDlg) tumour suppressor are characterized by combinations of insertions. Here, using insertions I2- and I3-specific antibodies, we show that I2 and I3 variants have distinct distributions in epidermal and cervical epithelia. In skin and cervix, I3 variants are found in the cytoplasm. Cytoplasmic localization of I3 variants decreases as cervical keratinocytes differentiate, concomitant with relocalization to the cell periphery. I2 variants are found at the cell periphery of differentiated epidermal and cervical keratinocytes. Nuclear localization of I2 variants was evident in both tissues, with concentration of nuclear I2 variants in basal and parabasal cervical keratinocytes. A prominent nuclear localization of hDlg in cells of hyperproliferative layers of psoriatic lesions, but not in mature differentiated keratinocytes, together with I2 redistribution in differentiating keratinocytes, suggests that nuclear hDlg functions may be pertinent to growth of undifferentiated cells. Supporting our findings in squamous tissues, a decrease of nuclear hDlg and an increase of membrane-bound and cytoplasmic hDlg upon calcium-induced keratinocyte differentiation were not concomitant processes. Furthermore, we confirm that the exit of I2 variants from the nucleus is linked to stimulation of epithelial differentiation. The dynamic redistribution of hDlg also correlated with a marked increase in the expression of I3 variants while the level of I2 variants showed only a moderate decrease. Because changes in the intracellular distribution of hDlg splice variants, and in their expression levels, correlate with changes in differentiation state we hypothesize that the different hDlg isoforms play distinct roles at various stages of epithelial differentiation

  1. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  2. Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

    Directory of Open Access Journals (Sweden)

    Shadmehr Demehri

    2008-05-01

    Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

  3. In vitro induction of matrix metalloproteinase-2 and matrix metalloproteinase-9 expression in keratinocytes by boron and manganese.

    Science.gov (United States)

    Chebassier, Nathalie; El Houssein, Ouijja; Viegas, Isabelle; Dréno, Brigitte

    2004-08-01

    Matrix metalloproteinase (MMP)-2 and MMP-9 are involved in keratinocyte migration and granulation tissue remodeling during wound healing. Thermal water cures are sometimes proposed as complementary treatment for accelerating healing of wounds resulting from burns and/or surgery, but their mechanisms of action remain unknown. Some thermal waters are rich in trace elements such as boron and manganese. Interestingly, clinical studies have shown the beneficial effects of trace elements such as boron and manganese for human wound healing. To try to specify the role of trace elements in cutaneous healing, the present study investigated the effects of these trace elements on the production of MMP-2 and MMP-9 by normal human keratinocytes cultured in vitro. Immunohistochemistry and Western blot showed that intracellular MMP-9 expression in keratinocytes was induced when incubated for 6 h with boron at 10 micro g/ml or manganese at 0.2 micro g/ml. Moreover, gelatin zymography on keratinocyte supernatants showed an increase of gelatinase secretion after 24 h of incubation of keratinocytes with boron or manganese, regardless of concentration. Gelatinase secretion was not associated with keratinocyte proliferation induced by trace elements. Thus, our results suggest that boron and manganese could play a role in the clinical efficiency of thermal water on wound healing.

  4. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  5. Isolation and culture of melanocytes from the arctic fox (Alopex lagopus

    Directory of Open Access Journals (Sweden)

    Jiarong Bao

    2015-09-01

    Full Text Available Coat colour is a phenotypic marker of fur animal species, which was determined by the pigment generated from melanocytes. In this study, we developed and validated a method for isolation, purification and passage culture of melanocytes from the arctic fox (Alopex lagopus. Skin biopsies were harvested from the dorsal region of adult foxes and enzyme digestion by Dispase II. The primary culture of melanocytes from arctic fox skin was obtained by using keratinocyte serum-free medium supplemented with epidermal growth factor and bovine pituitary extract with/without phorbol- 12-myristate-13-acetate, and by carrying out a medium change strategy. After serial passages, it yielded pure population of melanocytes, which become efficient tools for investigating the function of colour genes and unraveling the process of melanin synthesis.

  6. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  7. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  8. Interaction of urokinase A chain with the receptor of human keratinocytes stimulates release of urokinase-like plasminogen activator

    Energy Technology Data Exchange (ETDEWEB)

    Fibbi, G.; Magnelli, L.; Pucci, M.; Del Rosso, M. (Florence Univ. (Italy))

    1990-03-01

    On the basis of a fibrinolytic assay with {sup 125}I-fibrin, zymography, and immunoprobing with anti-human urokinase antibody, the authors have observed that the in vitro established NCTC human keratinocyte cell line releases into the culture medium a 54,000-Da plasminogen activator which is indistinguishable from human urokinase. Only the early release following the washing of keratinocyte monolayers is accounted for by secretion of preformed enzyme, while late secretory events require the de novo synthesis of urokinase. The released enzyme can interact by autocriny with its own receptor present on keratinocytes. The addition to the keratinocyte culture medium of the urokinase A chain can stimulate a concentration-dependent urokinase oversecretion, which is not paralleled by oversecretion of plasminogen activator inhibitor-1. Since stimulation of urokinase production can be obtained by an A chain concentration which was previously shown to be efficient in inducing keratinocyte mobilization in an in vitro migration model system, they hypothesize that this mechanism may be important in vivo during the process of wound repair.

  9. Immune sensitization against epidermal antigens in polymorphous light eruption

    International Nuclear Information System (INIS)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

  10. Pimecrolimus enhances TLR2/6-induced expression of antimicrobial peptides in keratinocytes.

    Science.gov (United States)

    Büchau, Amanda S; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Gallo, Richard L

    2008-11-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrolimus enhances distinct expression of cathelicidin, CD14, and human beta-defensin-2 and beta-defensin-3 in response to TLR2/6 ligands. Some of these responses were further enhanced by 1,25 vitamin D3. Pimecrolimus also increased the functional capacity of keratinocytes to inhibit growth of Staphylococcus aureus and decreased TLR2/6-induced expression of IL-10 and IL-1beta. Furthermore, pimecrolimus inhibited nuclear translocation of NFAT and NF-kappaB in keratinocytes. These observations uncover a previously unreported function for pimecrolimus in cutaneous innate host defense.

  11. Keratinocytes express fibrillin and assemble microfibrils: implications for dermal matrix organization.

    Science.gov (United States)

    Haynes, S L; Shuttleworth, C A; Kielty, C M

    1997-07-01

    Fibrillin-containing microfibrils are key architectural structures of the upper dermis and integral components of the dermal elastic fibre network. Microfibril bundles intercalate into the dermal-epithelial junction and provide an elastic connection between the dermal elastic fibre network and the epidermis. Immunohistochemical studies have suggested that they are laid down both at the dermal-epithelial junction and in the deep dermis. While dermal fibroblasts are responsible for deposition of the elastin and microfibrillar components that comprise the elastic fibres of the deep dermis, the cellular origin of the microfibril bundles that extrude from the dermal-epithelial junction is not well defined. We have used fresh tissues, freshly isolated epidermis and primary human and porcine keratinocyte cultures to investigate the possibility that keratinocytes are responsible for deposition of these microfibrils. We have shown that keratinocytes in vivo and in vitro synthesize both fibrillin-1 and fibrillin-2, and assemble beaded microfibrils concurrently with expression of basement membrane collagen. These observations suggest that keratinocytes co-ordinate the secretion, deposition and assembly of these distinct structural elements of the dermal matrix, and have important implications for skin remodelling.

  12. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  13. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Koeck, A.S.; Schwarz, T.; Kirnbauer, R.; Urbanski, A.; Perry, P.; Ansel, J.C.; Luger, T.A.

    1990-01-01

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  14. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...

  15. Aqueous extract from Vitis vinifera tendrils is able to enrich keratinocyte antioxidant defences.

    Science.gov (United States)

    Fraternale, Daniele; De Bellis, Roberta; Calcabrini, Cinzia; Potenza, Lucia; Cucchiarini, Luigi; Mancini, Umberto; Dachà, Marina; Ricci, Donata

    2011-09-01

    An aqueous extract of V. vinifera L. tendrils was evaluated for its ability to enrich the antioxidant capacity of cultured cells. The long-time antioxidant capability of the extract was measured by in vitro chemical methods, and its influence on reduced glutathione levels and plasma membrane oxido reductase activity was determined in cultured human keratinocytes (NCTC 2544). Keratinocytes are cells normally exposed to oxidative stress, and for this reason adequately equipped with antioxidant defences. However, it has long been suggested that exogenous antioxidants may play an important role in minimizing the adverse effects of oxidative stress on skin.We demonstrated that V. vinifera tendril aqueous extract was able to increase, in a time- and dose-dependent manner, the reduced glutathione concentration and activity of trans plasma membrane oxido reductase as an indirect evaluation of the intracellular redox status of the cells demonstrating a relevant antioxidant activity of this phytocomplex.

  16. Using organotypic (raft) epithelial tissue cultures for the biosynthesis and isolation of infectious human papillomaviruses.

    Science.gov (United States)

    Ozbun, Michelle A; Patterson, Nicole A

    2014-08-01

    Papillomaviruses have a strict tropism for epithelial cells, and they are fully reliant on cellular differentiation for completion of their life cycles, resulting in the production of progeny virions. Thus, a permissive environment for full viral replication in vitro-wherein virion morphogenesis occurs under cooperative viral and cellular cues-requires the cultivation of epithelium. Presented in the first section of this unit is a protocol to grow differentiating epithelial tissues that mimic many important morphological and biochemical aspects of normal skin. The technique involves growing epidermal cells atop a dermal equivalent consisting of live fibroblasts and a collagen lattice. Epithelial stratification and differentiation ensues when the keratinocyte-dermal equivalent is placed at the air-liquid interface. The apparent floating nature of the cell-matrix in this method led to the nickname "raft" cultures. The general technique can be applied to normal low passage keratinocytes, to cells stably transfected with papillomavirus genes or genomes, or keratinocytes established from neoplastic lesions. However, infectious papillomavirus particles have only been isolated from organotypic epithelial cultures initiated with cells that maintain oncogenic human papillomavirus genomes in an extrachomosomal replicative form. The second section of this unit is dedicated to a virion isolation method that minimizes aerosol and skin exposure to these human carcinogens. Although the focus of the protocols is on the growth of tissues that yields infectious papillomavirus progeny, this culture system facilitates the investigation of these fastidious viruses during their complex replicative cycles, and raft tissues can be manipulated and harvested at any point during the process. Importantly, a single-step virus growth cycle is achieved in this process, as it is unlikely that progeny virions are released to initiate subsequent rounds of infection. Copyright © 2014 John Wiley

  17. Anti-epidermal growth factor receptor skin toxicity: a matter of topical hydration.

    Science.gov (United States)

    Ferrari, Daris; Codecà, Carla; Bocci, Barbara; Crepaldi, Francesca; Violati, Martina; Viale, Giulia; Careri, Carmela; Caldiera, Sarah; Bordin, Veronica; Luciani, Andrea; Zonato, Sabrina; Cassinelli, Gabriela; Foa, Paolo

    2016-02-01

    Skin toxicity is a frequent complication of anti-epidermal growth factor receptor therapy, which can be an obstacle in maintaining the dose intensity and may negatively impact on the clinical outcome of cancer patients. Skin lesions depend on the disruption of the keratinocyte development pathways and no treatment is clearly effective in resolving the cutaneous alterations frequently found during anti-epidermal growth factor receptor therapy. Among systemic treatments, oral tetracycline proved to be useful in preventing skin manifestations. We describe the case of a patient affected by metastatic colorectal cancer, for whom a combination of chemotherapy and cetuximab was used as second-line treatment. The patient developed a symptomatic papulopustular skin rash that disappeared completely after a twice-daily application of a hydrating and moisturizing cream, mainly consisting of a mixture of paraffin, silicone compounds, and macrogol. The marked cutaneous amelioration allowed the patient to continue cetuximab without any further symptoms and was associated with a partial radiological response.

  18. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Directory of Open Access Journals (Sweden)

    David Judah

    Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  19. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Science.gov (United States)

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  20. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  1. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays

    International Nuclear Information System (INIS)

    Walter, M.N.M.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E.B.

    2010-01-01

    We have used in vitro scratch assays to examine the relative contribution of dermal fibroblasts and keratinocytes in the wound repair process and to test the influence of mesenchymal stem cell (MSC) secreted factors on both skin cell types. Scratch assays were established using single cell and co-cultures of L929 fibroblasts and HaCaT keratinocytes, with wound closure monitored via time-lapse microscopy. Both in serum supplemented and serum free conditions, wound closure was faster in L929 fibroblast than HaCaT keratinocyte scratch assays, and in co-culture the L929 fibroblasts lead the way in closing the scratches. MSC-CM generated under serum free conditions significantly enhanced the wound closure rate of both skin cell types separately and in co-culture, whereas conditioned medium from L929 or HaCaT cultures had no significant effect. This enhancement of wound closure in the presence of MSC-CM was due to accelerated cell migration rather than increased cell proliferation. A number of wound healing mediators were identified in MSC-CM, including TGF-β1, the chemokines IL-6, IL-8, MCP-1 and RANTES, and collagen type I, fibronectin, SPARC and IGFBP-7. This study suggests that the trophic activity of MSC may play a role in skin wound closure by affecting both dermal fibroblast and keratinocyte migration, along with a contribution to the formation of extracellular matrix.

  2. Chitosan modified poly(lactic-co-glycolic acid nanoparticles interaction with normal, precancerous keratinocytes and dental pulp cells

    Directory of Open Access Journals (Sweden)

    Maria Justina Roxana Virlan

    2017-03-01

    Conclusion: Chitosan-coated PLGAChi NPs proved to be able to cross the cellular membrane of oral keratinocytes, in 2D as well as in 3D cultures. The polymeric NPs used in the present study seem not to be suitable for applications that require NPs uptake by DPCs, as no evidence of uptake in these cells was found in this study. The finding that PLGAChi NPs showed significant internalization by human keratinocytes indicate that they could be used for drug delivery purposes to oral mucosa.

  3. Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells.

    Science.gov (United States)

    Vacharaksa, Anjalee; Asrani, Anil C; Gebhard, Kristin H; Fasching, Claudine E; Giacaman, Rodrigo A; Janoff, Edward N; Ross, Karen F; Herzberg, Mark C

    2008-07-17

    Oral keratinocytes on the mucosal surface are frequently exposed to HIV-1 through contact with infected sexual partners or nursing mothers. To determine the plausibility that oral keratinocytes are primary targets of HIV-1, we tested the hypothesis that HIV-1 infects oral keratinocytes in a restricted manner. To study the fate of HIV-1, immortalized oral keratinocytes (OKF6/TERT-2; TERT-2 cells) were characterized for the fate of HIV-specific RNA and DNA. At 6 h post inoculation with X4 or R5-tropic HIV-1, HIV-1gag RNA was detected maximally within TERT-2 cells. Reverse transcriptase activity in TERT-2 cells was confirmed by VSV-G-mediated infection with HIV-NL4-3Deltaenv-EGFP. AZT inhibited EGFP expression in a dose-dependent manner, suggesting that viral replication can be supported if receptors are bypassed. Within 3 h post inoculation, integrated HIV-1 DNA was detected in TERT-2 cell nuclei and persisted after subculture. Multiply spliced and unspliced HIV-1 mRNAs were not detectable up to 72 h post inoculation, suggesting that HIV replication may abort and that infection is non-productive. Within 48 h post inoculation, however, virus harbored by CD4 negative TERT-2 cells trans infected co-cultured peripheral blood mononuclear cells (PBMCs) or MOLT4 cells (CD4+ CCR5+) by direct cell-to-cell transfer or by releasing low levels of infectious virions. Primary tonsil epithelial cells also trans infected HIV-1 to permissive cells in a donor-specific manner. Oral keratinocytes appear, therefore, to support stable non-replicative integration, while harboring and transmitting infectious X4- or R5-tropic HIV-1 to permissive cells for up to 48 h.

  4. Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells

    Directory of Open Access Journals (Sweden)

    Giacaman Rodrigo A

    2008-07-01

    Full Text Available Abstract Background Oral keratinocytes on the mucosal surface are frequently exposed to HIV-1 through contact with infected sexual partners or nursing mothers. To determine the plausibility that oral keratinocytes are primary targets of HIV-1, we tested the hypothesis that HIV-1 infects oral keratinocytes in a restricted manner. Results To study the fate of HIV-1, immortalized oral keratinocytes (OKF6/TERT-2; TERT-2 cells were characterized for the fate of HIV-specific RNA and DNA. At 6 h post inoculation with X4 or R5-tropic HIV-1, HIV-1gag RNA was detected maximally within TERT-2 cells. Reverse transcriptase activity in TERT-2 cells was confirmed by VSV-G-mediated infection with HIV-NL4-3Δenv-EGFP. AZT inhibited EGFP expression in a dose-dependent manner, suggesting that viral replication can be supported if receptors are bypassed. Within 3 h post inoculation, integrated HIV-1 DNA was detected in TERT-2 cell nuclei and persisted after subculture. Multiply spliced and unspliced HIV-1 mRNAs were not detectable up to 72 h post inoculation, suggesting that HIV replication may abort and that infection is non-productive. Within 48 h post inoculation, however, virus harbored by CD4 negative TERT-2 cells trans infected co-cultured peripheral blood mononuclear cells (PBMCs or MOLT4 cells (CD4+ CCR5+ by direct cell-to-cell transfer or by releasing low levels of infectious virions. Primary tonsil epithelial cells also trans infected HIV-1 to permissive cells in a donor-specific manner. Conclusion Oral keratinocytes appear, therefore, to support stable non-replicative integration, while harboring and transmitting infectious X4- or R5-tropic HIV-1 to permissive cells for up to 48 h.

  5. Vitamin D receptor-mediated control of Soggy, Wise, and Hairless gene expression in keratinocytes.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Estess, Rudolf C; Kaneko, Ichiro; Whitfield, G Kerr; Jurutka, Peter W; Haussler, Mark R

    2014-02-01

    The vitamin D receptor (VDR), but not its hormonal ligand, 1,25-dihydroxyvitamin D3 (1,25D), is required for the progression of the mammalian hair cycle. We studied three genes relevant to hair cycle signaling, DKKL1 (Soggy), SOSTDC1 (Wise), and HR (Hairless), to determine whether their expression is regulated by VDR and/or its 1,25D ligand. DKKL1 mRNA was repressed 49-72% by 1,25D in primary human and CCD-1106 KERTr keratinocytes; a functional vitamin D responsive element (VDRE) was identified at -9590 bp in murine Soggy. Similarly, SOSTDC1 mRNA was repressed 41-59% by 1,25D in KERTr and primary human keratinocytes; a functional VDRE was located at -6215 bp in human Wise. In contrast, HR mRNA was upregulated 1.56- to 2.77-fold by 1,25D in primary human and KERTr keratinocytes; a VDRE (TGGTGAgtgAGGACA) consisting of an imperfect direct repeat separated by three nucleotides (DR3) was identified at -7269 bp in the human Hairless gene that mediated dramatic induction, even in the absence of 1,25D ligand. In parallel, a DR4 thyroid hormone responsive element, TGGTGAggccAGGACA, was identified at +1304 bp in the human HR gene that conferred tri-iodothyronine (T3)-independent transcriptional activation. Because the thyroid hormone receptor controls HR expression in the CNS, whereas VDR functions in concert with the HR corepressor specifically in skin, a model is proposed wherein unliganded VDR upregulates the expression of HR, the gene product of which acts as a downstream comodulator to feedback-repress DKKL1 and SOSTDC1, resulting in integration of bone morphogenic protein and Wnt signaling to drive the mammalian hair cycle and/or influencing epidermal function.

  6. Alteration of keratinocyte differentiation and senescence by the tumor promoter dioxin

    International Nuclear Information System (INIS)

    Ray, Soma S.; Swanson, Hollie I.

    2003-01-01

    Exposure to the environmental contaminant dioxin, elicits a variety of responses, which includes tumor promotion, embryotoxicity/teratogenesis, and carcinogenesis in both animals and humans. Many of the effects of dioxin are mediated by the aryl hydrocarbon receptor (AHR), a ligand-activated bHLH (basic helix-loop-helix)/PAS transcription factor. We initiated this study to determine whether dioxin's tumor-promoting activities may lie in its ability to alter proliferation, differentiation, and/or senescence using normal human epidermal keratinocytes (HEKs). Here, we report that dioxin appears to accelerate differentiation as measured by flow cytometry and by increased expression of the differentiation markers involucrin and filaggrin. In addition, dioxin appears to increase proliferation as indicated by an increase in NADH/NADPH production and changes in cell cycle. Finally, dioxin decreases SA (senescence associated) β-galactosidase staining, an indicator of senescence, in the differentiating keratinocytes. These changes were accompanied by decreases in the expression levels of key cell cycle regulatory proteins p53, p16 INK4a , and p14 ARF . Our findings support the idea that dioxin may exert its tumor-promoting actions, in part, by downregulating the expression levels of key tumor suppressor proteins, which may impair the cell's ability to maintain its appropriate cellular status

  7. In vivo relative quantitative proteomics reveals HMGB1 as a downstream mediator of oestrogen-stimulated keratinocyte migration.

    Science.gov (United States)

    Shin, Jung U; Noh, Ji Yeon; Lee, Ju Hee; Lee, Won Jai; Yoo, Jong Shin; Kim, Jin Young; Kim, Hyeran; Jung, Inhee; Jin, Shan; Lee, Kwang Hoon

    2015-06-01

    It is known that oestrogen influences skin wound healing by modulating the inflammatory response, cytokine expression and extracellular matrix deposition; accelerating re-epithelialization; and stimulating angiogenesis. To identify novel proteins associated with effects of oestrogen on keratinocyte, stable isotope labelling by amino acids in cell culture (SILAC)-based mass spectrometry was performed. Using SILAC, quantification of 1085 proteins was achieved. Among these proteins, 60 proteins were upregulated and 32 proteins were downregulated. Among significantly upregulated proteins, high-mobility group protein B1 (HMGB1) has been further evaluated for its role in the effect of oestrogen on keratinocytes. HMGB1 expression was strongly induced in oestrogen-treated keratinocytes in dose- and time-dependent manner. Further, HMGB1 was able to significantly accelerate the rate of HaCaT cell migration. To determine whether HMGB1 is involved in E2-induced HaCaT cell migration, cells were transfected with HMGB1 siRNA. Knockdown of HMGB1 blocked oestrogen-induced keratinocyte migration. Collectively, these experiments demonstrate that HMGB1 is a novel downstream mediator of oestrogen-stimulated keratinocyte migration. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Comparative transcriptomic profiling of hydrogen peroxide signaling networks in zebrafish and human keratinocytes: Implications toward conservation, migration and wound healing.

    Science.gov (United States)

    Lisse, Thomas S; King, Benjamin L; Rieger, Sandra

    2016-02-05

    Skin wounds need to be repaired rapidly after injury to restore proper skin barrier function. Hydrogen peroxide (H2O2) is a conserved signaling factor that has been shown to promote a variety of skin wound repair processes, including immune cell migration, angiogenesis and sensory axon repair. Despite growing research on H2O2 functions in wound repair, the downstream signaling pathways activated by this reactive oxygen species in the context of injury remain largely unknown. The goal of this study was to provide a comprehensive analysis of gene expression changes in the epidermis upon exposure to H2O2 concentrations known to promote wound repair. Comparative transcriptome analysis using RNA-seq data from larval zebrafish and previously reported microarray data from a human epidermal keratinocyte line shows that H2O2 activates conserved cell migration, adhesion, cytoprotective and anti-apoptotic programs in both zebrafish and human keratinocytes. Further assessment of expression characteristics and signaling pathways revealed the activation of three major H2O2-dependent pathways, EGF, FOXO1, and IKKα. This study expands on our current understanding of the clinical potential of low-level H2O2 for the promotion of epidermal wound repair and provides potential candidates in the treatment of wound healing deficits.

  9. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  10. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  11. Grhl3 and Lmo4 play coordinate roles in epidermal migration.

    Science.gov (United States)

    Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M

    2008-09-01

    In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.

  12. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    Energy Technology Data Exchange (ETDEWEB)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Elmets, Craig A. [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)

    2014-08-29

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34{sup +}/K15{sup +}/p63{sup +} keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in

  13. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    International Nuclear Information System (INIS)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh; Elmets, Craig A.; Athar, Mohammad

    2014-01-01

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34 + /K15 + /p63 + keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in tumors induced

  14. Ultraviolet radiation induction of ornithine decarboxylase in rat keratinocytes

    International Nuclear Information System (INIS)

    Rosen, C.F.; Gajic, D.; Drucker, D.J.

    1990-01-01

    UV radiation plays an important role in the induction of cutaneous malignancy, including basal cell and squamous cell carcinomas and malignant melanoma. In addition to its effects on DNA damage and repair mechanisms, UV radiation has been shown to modulate the expression of specific genes, altering the levels of their mRNAs and the synthesis of their corresponding proteins. In order to gain further information about the molecular effects of UV radiation, we have studied the regulation of ornithine decarboxylase (ODC) gene expression in response to UVB radiation. ODC is the rate-limiting enzyme in polyamine biosynthesis, is involved in growth and differentiation, and has been implicated in carcinogenesis. Keratinocytes grown in culture were either sham-irradiated or exposed to increasing doses of UVB (1-5 mJ/cm2). Northern blot analysis of keratinocyte RNA under basal conditions demonstrated the presence of two ODC mRNA transcripts. Increasing exposure to UVB resulted in a dose-dependent increase in the levels of both ODC mRNA transcripts. The induction of ODC gene expression following UVB was noted 2 h after UVB exposure, and ODC mRNA levels continued to increase up to 24 h after UVB exposure. The UVB-induced increase in ODC gene expression was not serum dependent, despite the ability of serum alone to induce ODC gene expression. The mRNA transcripts for actin and hexosaminidase A were not induced after UVB exposure. These studies show that the UVB-induced increase in ODC activity is due, at least in part, to an increase in ODC gene expression and they provide a useful model for the analysis of the molecular effects of UVB radiation

  15. Ultraviolet radiation induction of ornithine decarboxylase in rat keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Rosen, C.F.; Gajic, D.; Drucker, D.J. (Women' s College Hospital, Toronto, Ontario (Canada))

    1990-05-01

    UV radiation plays an important role in the induction of cutaneous malignancy, including basal cell and squamous cell carcinomas and malignant melanoma. In addition to its effects on DNA damage and repair mechanisms, UV radiation has been shown to modulate the expression of specific genes, altering the levels of their mRNAs and the synthesis of their corresponding proteins. In order to gain further information about the molecular effects of UV radiation, we have studied the regulation of ornithine decarboxylase (ODC) gene expression in response to UVB radiation. ODC is the rate-limiting enzyme in polyamine biosynthesis, is involved in growth and differentiation, and has been implicated in carcinogenesis. Keratinocytes grown in culture were either sham-irradiated or exposed to increasing doses of UVB (1-5 mJ/cm2). Northern blot analysis of keratinocyte RNA under basal conditions demonstrated the presence of two ODC mRNA transcripts. Increasing exposure to UVB resulted in a dose-dependent increase in the levels of both ODC mRNA transcripts. The induction of ODC gene expression following UVB was noted 2 h after UVB exposure, and ODC mRNA levels continued to increase up to 24 h after UVB exposure. The UVB-induced increase in ODC gene expression was not serum dependent, despite the ability of serum alone to induce ODC gene expression. The mRNA transcripts for actin and hexosaminidase A were not induced after UVB exposure. These studies show that the UVB-induced increase in ODC activity is due, at least in part, to an increase in ODC gene expression and they provide a useful model for the analysis of the molecular effects of UVB radiation.

  16. Genetic Markers and Danger Signals in Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    Wen-Hung Chung

    2010-01-01

    Full Text Available Stevens-Johnson syndrome (SJS and toxic epidermal necrolysis (TEN are life-threatening adverse reactions, which could be induced by a variety of drugs. It was proposed that human leukocyte antigen (HLA-restricted presentation of antigens (drugs or their metabolites to T lymphocytes initiates the immune reactions of SJS/ TEN. However, the genetic susceptibility and the exact pathogenesis were not clear until the recent studies. We first identified that HLA-B*1502 is strongly associated with carbamazepine (CBZ-induced SJS/TEN and HLA-B*5801 with allopurinol-SJS/TEN in Han Chinese. The same associations had been validated across different human populations. For the downstream danger signals, Fas-Fas ligand (FasL and perforin/granzyme B had been advocated as cytotoxic mediators for keratinocyte death in SJS/TEN. However, expression levels of these cytotoxic proteins from the skin lesions were too low to explain the distinct and extensive epidermal necrosis. Our recent study identified that the granulysin, a cytotoxic protein released from cytotoxic T cells or natural killer (NK cells, is a key mediator for disseminated keratinocyte death in SJS/TEN. This article aims to provide an overview of both of the genomic and immunologic perspectives of SJS/TEN. These studies give us a better understanding of the immune mechanisms, biomarkers for disease prevention and early diagnosis, as well as providing the therapeutic targets for the treatments of SJS/TEN.

  17. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  18. Effect of Absolute From Hibiscus syriacus L. Flower on Wound Healing in Keratinocytes

    Science.gov (United States)

    Yoon, Seok Won; Lee, Kang Pa; Kim, Do-Yoon; Hwang, Dae Il; Won, Kyung-Jong; Lee, Dae Won; Lee, Hwan Myung

    2017-01-01

    Background: Proliferation and migration of keratinocytes are essential for the repair of cutaneous wounds. Hibiscus syriacus L. has been used in Asian medicine; however, research on keratinocytes is inadequate. Objective: To establish the dermatological properties of absolute from Hibiscus syriacus L. flower (HSF) and to provide fundamental research for alternative medicine. Materials and Methods: We identified the composition of HSF absolute using gas chromatography-mass spectrometry analysis. We also examined the effect of HSF absolute in HaCaT cells using the XTT assay, Boyden chamber assay, sprout-out growth assay, and western blotting. We conducted an in-vivo wound healing assay in rat tail-skin. Results: Ten major active compounds were identified from HSF absolute. As determined by the XTT assay, Boyden chamber assay, and sprout-out growth assay results, HSF absolute exhibited similar effects as that of epidermal growth factor on the proliferation and migration patterns of keratinocytes (HaCaT cells), which were significantly increased after HSF absolute treatment. The expression levels of the phosphorylated signaling proteins relevant to proliferation, including extracellular signal-regulated kinase 1/2 (Erk 1/2) and Akt, were also determined by western blot analysis. Conclusion: These results of our in-vitro and ex-vivo studies indicate that HSF absolute induced cell growth and migration of HaCaT cells by phosphorylating both Erk 1/2 and Akt. Moreover, we confirmed the wound-healing effect of HSF on injury of the rat tail-skin. Therefore, our results suggest that HSF absolute is promising for use in cosmetics and alternative medicine. SUMMARY Hisbiscus syriacus L. flower absolute increases HaCaT cell migration and proliferation.Hisbiscus syriacus L. flower absolute regulates phosphorylation of ERK 1/2 and Akt in HaCaT cell.Treatment with Hisbiscus syriacus L. flower induced sprout outgrowth.The wound in the tail-skin of rat was reduced by Hisbiscus syriacus

  19. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  20. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  1. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  2. The involvement of Gab1 and PI 3-kinase in β1 integrin signaling in keratinocytes

    International Nuclear Information System (INIS)

    Kuwano, Yoshihiro; Fujimoto, Manabu; Watanabe, Rei; Ishiura, Nobuko; Nakashima, Hiroko; Komine, Mayumi; Hamazaki, Tatsuo S.; Tamaki, Kunihiko; Okochi, Hitoshi

    2007-01-01

    The control of the stem cell compartment in epidermis is closely linked to the regulation of keratinocyte proliferation and differentiation. β1 integrins are expressed 2-fold higher by stem cells than transit-amplifying cells. Signaling from these β1 integrins is critical for the regulation of the epidermal stem cell compartment. To clarify the functional relevance of this differential expression of β1 integrins, we established HaCaT cells with high β1integrin expression by repeated flow cytometric sorting of this population from the parental cell line. In these obtained cells expressing β1 integrins by 5-fold, MAPK activation was markedly increased. Regarding the upstream of MAPK, Gab1 phosphorylation was also higher with high β1 integrin expression, while Shc phosphorylation was not altered. In addition, enhanced phosphatidylinositol 3-kinase activation was also observed. These observations suggest that Gab1 and phosphatidylinositol 3-kinase play pivotal roles in the β1 integrin-mediated regulation of the epidermal stem cell compartment

  3. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  4. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  5. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA......-FABP as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... with epidermal growth factor (EGF), pituitary extract, and 10% fetal calf serum] revealed a strong up-regulation of PA-FABP, psoriasin, calgranulins A and B, and a few other proteins that are highly expressed in psoriatic skin. The levels of these proteins exceeded by far those observed in non-cultured normal...

  6. Cyr61/CCN1 induces CCL20 production by keratinocyte via activating p38 and JNK/AP-1 pathway in psoriasis.

    Science.gov (United States)

    Li, Huidan; Li, Haichuan; Huo, Rongfen; Wu, Pinru; Shen, Zhengyu; Xu, Hui; Shen, Baihua; Li, Ningli

    2017-10-01

    Psoriasis is a common chronic skin disease characterized by epidermal hyperplasia and inflammation. Cysteine-rich angiogenic inducer 61 (Cyr61/CCN1) has recently been implicated in psoriasis pathogenesis by promoting keratinocyte activation. However, the mechanisms by which CCN1 enhances cutaneous inflammation are not fully understood. In this study, we investigated the role of CCN1 on the expression of CCL20 in human keratinocyte. By double-label immunofluorescence staining, we first identified that the expression of CCN1 colocalized well with CCL20 production in the epidermis of psoriasis skin lesion. Furthermore, in vivo, blocking or knockdown CCN1 expression ameliorated skin inflammation and reduced the expression of CCL20 in both imiquimod and IL-23-induced psoriasis-like mouse models, which indicated that CCN1 might be involved in the regulation of CCL20 production in psoriasis. Next, in vitro, we stimulated primary normal human epidermal keratinocyte (NHEK) with exogenous protein CCN1 and found that CCN1 directly upregulated CCL20 production independent of TNF-α, IL-22 and IL-17 pathway. Lastly, the signaling pathway study showed that CCN1 enhanced the binding of AP-1 to the CCL20 promoter via crosstalk with p38 and JNK. Our study demonstrates that CCN1 stimulates CCL20 production in vitro and in vivo, and thus supports the notion that overexpressed CCN1 in hyperproliferating keratinocyte is functionally involved in the recruitment of inflammatory cells to skin lesions affected by psoriasis. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  7. N-Acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191): an anti-inflammatory molecule that increases the expression of the aquaglyceroporin, aquaporin-3, in human keratinocytes.

    Science.gov (United States)

    Fernández, José R; Webb, Corey; Rouzard, Karl; Voronkov, Michael; Huber, Kristen L; Stock, Jeffry B; Stock, Maxwell; Gordon, Joel S; Perez, Eduardo

    2017-03-01

    Isoprenylcysteine (IPC) small molecules were discovered as signal transduction modulating compounds ~25 years ago. More recently, IPC molecules have demonstrated antioxidant and anti-inflammatory properties in a variety of dermal cells as well as antimicrobial activity, representing a novel class of compounds to ameliorate skin conditions and disease. Here, we demonstrate a new IPC compound, N-acetylglutaminoyl-S-farnesyl-L-cysteine (SIG-1191), which inhibits UVB-induced inflammation blocking pro-inflammatory cytokine interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) production. To investigate further the previously reported hydrating potential of IPC compounds, SIG-1191 was tested for its ability to modulate aquaporin expression. Specifically, aquaporin 3 (AQP3) the most abundant aquaporin found in skin has been reported to play a key role in skin hydration, elasticity and barrier repair. Results show here for the first time that SIG-1191 increases AQP3 expression in both cultured normal human epidermal keratinocytes as well as when applied topically in a three-dimensional (3D) reconstructed human skin equivalent. Additionally, SIG-1191 dose dependently increased AQP3 protein levels, as determined by specific antibody staining, in the epidermis of the 3D skin equivalents. To begin to elucidate which signaling pathways SIG-1191 may be modulating to increase AQP3 levels, we used several pharmacological pathway inhibitors and determined that AQP3 expression is mediated by the Mitogen-activated protein kinase/Extracellular signal-regulated kinase kinase (MEK) pathway. Altogether, these data suggest SIG-1191 represents a new IPC derivative with anti-inflammatory activity that may also promote increased skin hydration based on its ability to increase AQP3 levels.

  8. Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

    Science.gov (United States)

    Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

    2013-06-01

    In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  9. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    .... The research we have conducted during the first and second year of the grant has allowed us to conclude that human keratinocytes in vitro can be engineered to express a chimeric cell surface receptor...

  10. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    .... The research we have conducted has allowed us to conclude that human keratinocytes in vitro can be engineered to express a chimeric cell surface receptor and that these modified cells could recognize...

  11. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  12. SORBS2 and TLR3 induce premature senescence in primary human fibroblasts and keratinocytes

    International Nuclear Information System (INIS)

    Liesenfeld, Melanie; Mosig, Sandy; Funke, Harald; Jansen, Lars; Runnebaum, Ingo B; Dürst, Matthias; Backsch, Claudia

    2013-01-01

    Genetic aberrations are required for the progression of HPV-induced cervical precancers. A prerequisite for clonal expansion of cancer cells is unlimited proliferative capacity. In a cell culture model for cervical carcinogenesis loss of genes located on chromosome 4q35→qter and chromosome 10p14-p15 were found to be associated with escape from senescence. Moreover, by LOH and I-FISH analyses a higher frequency of allele loss of these regions was also observed in cervical carcinomas as compared to CIN3. The aim of this study was to identify candidate senescence-related genes located on chromosome 4q35→qter and chromosome 10p14-p15 which may contribute to clonal expansion at the transition of CIN3 to cancer. Microarray expression analyses were used to identify candidate genes down-regulated in cervical carcinomas as compared to CIN3. In order to relate these genes with the process of senescence their respective cDNAs were overexpressed in HPV16-immortalized keratinocytes as well as in primary human fibroblasts and keratinocytes using lentivirus mediated gene transduction. Overall fifteen genes located on chromosome 4q35→qter and chromosome 10p14-p15 were identified. Ten of these genes could be validated in biopsies by RT-PCR. Of interest is the novel finding that SORBS2 and TLR3 can induce senescence in primary human fibroblasts and keratinocytes but not in HPV-immortalized cell lines. Intriguingly, the endogenous expression of both genes increases during finite passaging of primary keratinocytes in vitro. The relevance of the genes SORBS2 and TLR3 in the process of cellular senescence warrants further investigation. In ongoing experiments we are investigating whether this increase in gene expression is also characteristic of replicative senescence

  13. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  15. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  16. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  17. Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

    Science.gov (United States)

    Crawford, Melissa; Dagnino, Lina

    2017-10-02

    The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

  18. TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.

    Science.gov (United States)

    Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina

    2012-10-01

    Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.

  19. Roles of p63 in epidermal development and tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeng-Yuan Yao

    2012-12-01

    Full Text Available pidermis is composed mainly of keratinocytes and is the ma­jor barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcrip­tion factor p63. The p63 gene encodes proteins with structures simi­lar to that of p53, including an N-terminal transacti­vation (TA domain, a DNA-binding domain and a car­boxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epider­mal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis re­mains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.

  20. Rho kinase inhibitor Y-27632 promotes the differentiation of human bone marrow mesenchymal stem cells into keratinocyte-like cells in xeno-free conditioned medium.

    Science.gov (United States)

    Li, Zhenzhen; Han, Shichao; Wang, Xingqin; Han, Fu; Zhu, Xiongxiang; Zheng, Zhao; Wang, Hongtao; Zhou, Qin; Wang, Yunchuan; Su, Linlin; Shi, Jihong; Tang, Chaowu; Hu, Dahai

    2015-03-11

    Bone marrow mesenchymal stem cells (BMSCs), which have the ability to self-renew and to differentiate into multiple cell types, have recently become a novel strategy for cell-based therapies. The differentiation of BMSCs into keratinocytes may be beneficial for patients with burns, disease, or trauma. However, the currently available cells are exposed to animal materials during their cultivation and induction. These xeno-contaminations severely limit their clinical outcomes. Previous studies have shown that the Rho kinase (ROCK) inhibitor Y-27632 can promote induction efficiency and regulate the self-renewal and differentiation of stem cells. In the present study, we attempted to establish a xeno-free system for the differentiation of BMSCs into keratinocytes and to investigate whether Y-27632 can facilitate this differentiation. BMSCs isolated from patients were cultured by using a xeno-free system and characterised by using flow cytometric analysis and adipogenic and osteogenic differentiation assays. Human primary keratinocytes were also isolated from patients. Then, the morphology, population doubling time, and β-galactosidase staining level of these cells were evaluated in the presence or absence of Y-27632 to determine the effects of Y-27632 on the state of the keratinocytes. Keratinocyte-like cells (KLCs) were detected at different time points by immunocytofluorescence analysis. Moreover, the efficiency of BMSC differentiation under different conditions was measured by quantitative real-time-polymerase chain reaction (RT-PCR) and Western blot analyses. The ROCK inhibitor Y-27632 promoted the proliferation and lifespan of human primary keratinocytes. In addition, we showed that keratinocyte-specific markers could be detected in BMSCs cultured in a xeno-free system using keratinocyte-conditioned medium (KCM) independent of the presence of Y-27632. However, the efficiency of the differentiation of BMSCs into KLCs was significantly higher in the presence of Y

  1. Astragaloside IV Downregulates β-Catenin in Rat Keratinocytes to Counter LiCl-Induced Inhibition of Proliferation and Migration

    Directory of Open Access Journals (Sweden)

    Fu-Lun Li

    2012-01-01

    Full Text Available Re-epithelialization is a crucial step towards wound healing. The traditional Chinese medicine, Astragalus membranaceus (Fisch Bge, has been used for hundreds of years for many kinds of ulcerated wounds. Recent research has identified the active compound in this drug as astragaloside IV (AS-IV, but the underlying molecular mechanisms of its therapeutic action on keratinocytes remain poorly understood. In this study, we used an in vitro model of ulcer-like wound processes, lithium chloride (LiCl-induced cultured mouse keratinocytes, to investigate the effects of AS-IV treatment. The effects on cell proliferation were evaluated by the MTS/PMS colorimetric assay, effects on cell migration were determined by a wound-healing scratch experiment, effects on the cell cycle were analyzed by flow cytometry, and effects on protein expression were analyzed by immunoblotting and immunofluorescence. LiCl strongly inhibited cell proliferation and migration, up-regulated β-catenin expression, and down-regulated proliferating cell nuclear antigen (PCNA expression. AS-IV treatment attenuat the inhibition of proliferation and migration, significantly reducing the enhanced β-catenin expression, and recovering PCNA and β-tubulin expression. Thus, AS-IV mediates mouse keratinocyte proliferation and migration via regulation of the Wnt signaling pathway. Down-regulating β-catenin to increase keratinocyte migration and proliferation is one mechanism by which AS-IV can promote ulcerated wound healing.

  2. Differentiation and injury-repair signals modulate the interaction of E2F and pRB proteins with novel target genes in keratinocytes.

    Science.gov (United States)

    Chang, Wing Y; Andrews, Joseph; Carter, David E; Dagnino, Lina

    2006-08-01

    E2F transcription factors are central to epidermal morphogenesis and regeneration after injury. The precise nature of E2F target genes involved in epidermal formation and repair has yet to be determined. Identification of these genes is essential to understand how E2F proteins regulate fundamental aspects of epidermal homeostasis and transformation. We have conducted a genome-wide screen using CpG island microarray analysis to identify novel promoters bound by E2F3 and E2F5 in human keratinocytes. We further characterized several of these genes, and determined that multiple E2F and retinoblastoma (pRb) family proteins associate with them in exponentially proliferating cells. We also assessed the effect on E2F and pRb binding to those genes in response to differentiation induced by bone morphogenetic protein-6 (BMP-6), or to activation of repair mechanisms induced by transforming growth factor-beta (TGF-beta). These studies demonstrate promoter- and cytokine-specific changes in binding profiles of E2F and/or pRb family proteins. For example, E2F1, 3, 4 and p107 were recruited to the N-myc promoter in cells treated with BMP-6, whereas E2F1, 3, 4, 5, p107 and p130 were bound to this promoter in the presence of TGF-beta. Functionally, these different interactions resulted in transcriptional repression by BMP-6 and TGF-beta of the N-myc gene, via mechanisms that involved E2F binding to the promoter and association with pRb-family proteins. Thus, multiple combinations of E2F and pRb family proteins may associate with and transcriptionally regulate a given target promoter in response to differentiation and injury-repair stimuli in epidermal keratinocytes.

  3. Platelet-rich plasma with keratinocytes and fibroblasts enhance healing of full-thickness wounds.

    Science.gov (United States)

    Law, Jia Xian; Chowdhury, Shiplu Roy; Saim, Aminuddin Bin; Idrus, Ruszymah Bt Hj

    2017-08-01

    Advances in tissue engineering led to the development of various tissue-engineered skin substitutes (TESS) for the treatment of skin injuries. The majority of the autologous TESS required lengthy and costly cell expansion process to fabricate. In this study, we determine the possibility of using a low density of human skin cells suspended in platelet-rich plasma (PRP)-enriched medium to promote the healing of full-thickness skin wounds. To achieve this, full-thickness wounds of size 1.767 cm 2 were created at the dorsum part of nude mice and treated with keratinocytes (2 × 10 4  cells/cm 2 ) and fibroblasts (3 × 10 4  cells/cm 2 ) suspended in 10% PRP-enriched medium. Wound examination was conducted weekly and the animals were euthanized after 2 weeks. Gross examination showed that re-epithelialization was fastest in the PRP+cells group at both day 7 and 14, followed by the PRP group and NT group receiving no treatment. Only the PRP+cells group achieved complete wound closure by 2 weeks. Epidermal layer was presence in the central region of the wound of the PRP+cells and PRP groups but absence in the NT group. Comparison between the PRP+cells and PRP groups showed that the PRP+cells-treated wound was more mature as indicated by the presence of thinner epidermis with single cell layer thick basal keratinocytes and less cellular dermis. In summary, the combination of low cell density and diluted PRP creates a synergistic effect which expedites the healing of full-thickness wounds. This combination has the potential to be developed as a rapid wound therapy via the direct application of freshly harvested skin cells in diluted PRP. Copyright © 2017 Tissue Viability Society. Published by Elsevier Ltd. All rights reserved.

  4. Evaluation of gene expression profile of keratinocytes in response to JP-8 jet fuel

    International Nuclear Information System (INIS)

    Espinoza, Luis A.; Li Peijun; Lee, Richard Y.; Wang Yue; Boulares, A. Hamid; Clarke, Robert; Smulson, Mark E.

    2004-01-01

    The skin is the principal barrier against any environmental insult. Therefore, there is a high risk for a large number of military and civilian personnel exposed to jet fuel JP-8 to suffer percutaneous absorption of this fuel. This paper reports the use of cDNA microarray to identify the gene expression profile in normal human epidermal keratinocytes exposed to JP-8 for 24-h and 7-day periods. The effects of JP-8 exposure on keratinocytes at these two different periods induced a set of genes with altered expression in response to this type of insult. Microarray data were visualized using a novel algorithm based on simple statistical analyses to reduce data dimensionality and identify subsets of discriminant genes. Predictive neural networks were built using a multiplayer perceptron to carry out a proper classification task in microarray data in the untreated versus JP-8-treated samples. The pattern of expressions in response to JP-8 provides evidences that detoxificant-related and cell growth regulator genes with the most variability in the level of expression may be useful genetic markers in adverse health effects of personnel exposed to JP-8. The approaches in our analysis provide a simple, safe, novel, and effective method that is reliable in identifying and analyzing gene expression in samples treated with JP-8 or over potential toxic agents. Gene expression data from these studies can be used to build accurate predictive models that separate different molecular profiles. The data establish the use and effectiveness of these approaches for future prospective studies

  5. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  6. Serial cultivation of human scalp hair follicle keratinocytes.

    Science.gov (United States)

    Weterings, P J; Roelofs, H M; Vermorken, A J; Bloemendal, H

    1983-01-01

    A method is described for the serial cultivation of adult human hair follicle keratinocytes. Plucked scalp hair follicles, placed on bovine eye lens capsules as a growth substrate, give rise to quickly expanding colonies within a few days. After trypsinization, the cells are replated with irradiated 3T3 cells as 'feeders'. Using this combination of techniques the keratinocytes can be subcultured up to four times. In this way about 10(7) keratinocytes can be generated from one single hair follicle. Moreover, the technique enables cryogenic storage of the cells, allowing for instance, convenient transportation. Subcultured hair follicle keratinocytes can be plated on glass coverslips. This allows immunofluorescence studies. The keratin cytoskeletons visualized using an antiserum against human keratin.

  7. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

    International Nuclear Information System (INIS)

    Wakshull, E.; Kraemer, P.M.; Wharton, W.

    1985-01-01

    Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

  9. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  10. Noncultured keratinocyte/melanocyte cosuspension: effect on reepithelialization and repigmentation--a randomized, placebo-controlled study.

    Science.gov (United States)

    Back, Christopher; Dearman, Bronwyn; Li, Amy; Neild, Tim; Greenwood, John E

    2009-01-01

    Randomized controlled trials in the literature investigating the efficacy of noncultured keratinocyte/melanocyte suspensions are scarce; however, the advocates of such techniques press the value of their application based largely on case studies and anecdote. Caucasian patients with burn hypopigmentation seldom request cosmetic revision making worthwhile clinical trials difficult so that informal case treatments with new therapies generate anecdotal results. A randomized, placebo-controlled trial was carried out to evaluate whether cosuspensions of noncultured skin cells are capable of (1) decreasing the time to reepithelialization and (2) reestablishing pigmentation in vitiligo leukoderma following epidermal/superficial dermal ablation (in the knowledge that a positive result would make the technique likely to be successful in burn hypopigmentation). Vitiligo is common and is socially more debilitating such that suitable trial subjects for new therapies from this pool are more forthcoming. This study demonstrated that suspensions of noncultured keratinocytes and melanocytes do not decrease the time to epithelialization of superficial partial thickness wounds compared with controls. It also suggested that the achievement, quality, and duration of any pigmentation were unpredictable and largely disappointing. Some pigmentation was recorded in placebo-treated areas indicating an effect of the method of epidermal ablation in these patients. These findings have mandated a complete review of the use of these techniques in burn care at the Royal Adelaide Hospital; they have been omitted from surgical protocols where the aim of use was to speed reepithelialization. Their infrequent use in burns hypopigmentation will continue contingent on the successful repigmentation of a test patch.

  11. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  12. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  13. Tumor necrosis factor alpha inhibitors in the treatment of toxic epidermal necrolysis.

    Science.gov (United States)

    Woolridge, Katelyn F; Boler, Patrick L; Lee, Brian D

    2018-01-01

    Toxic epidermal necrolysis (TEN) is a rare, life-threatening adverse drug reaction for which there is no standardized or consistently effective treatment. Due to a greater understanding of disease pathogenesis and the identification of tumor necrosis factor (TNF) α as a mediator of keratinocyte death, TNF-α antagonists have been used in the treatment of TEN. Specifically, infliximab and etanercept have been shown to be effective at halting disease progression. The objective of this study is to review published case reports and case series using anti-TNF-α medications in the treatment of TEN. Results of many of the articles reviewed support the use of TNF-α inhibitors in TEN in both adult and pediatric populations; however, the risks caused by these potent immunosuppressants must be weighed, and if administered, patients must be closely monitored for infections. Additional studies are needed to further characterize the role of TNF-α inhibition in the treatment of TEN.

  14. Delayed Hepatic Adaptation to Weaning in ACBP(-/-) Mice Is Caused by Disruption of the Epidermal Barrier

    DEFF Research Database (Denmark)

    Neess, Ditte; Bek, Signe; Bloksgaard, Maria

    2013-01-01

    in the skin rather than in the liver. Similarly to ACBP(-/-) mice, K14-ACBP(-/-) mice exhibit an increased transepidermal water loss, and we show that the hepatic phenotype is caused specifically by the epidermal barrier defect, which leads to increased lipolysis in white adipose tissue. Our data demonstrate......We previously reported that mice deficient in acyl-CoA-binding protein (ACBP) display a delayed metabolic adaptation to weaning. This includes a delayed activation of the hepatic lipogenic gene program, which may result from hepatic accumulation of triacylglycerol and/or cholesteryl esters...... in the late suckling period. To further investigate the basis for this phenotype, we generated mice deficient in ACBP in hepatocytes (Alb-ACBP(-/-)) and keratinocytes (K14-ACBP(-/-)). Surprisingly, the delayed adaptation to weaning, including hepatic lipid accumulation, is caused by ACBP deficiency...

  15. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  16. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Culture.

    Science.gov (United States)

    Smith, Timothy B; Rodríguez, Melanie Domenech; Bernal, Guillermo

    2011-02-01

    This article summarizes the definitions, means, and research of adapting psychotherapy to clients' cultural backgrounds. We begin by reviewing the prevailing definitions of cultural adaptation and providing a clinical example. We present an original meta-analysis of 65 experimental and quasi-experimental studies involving 8,620 participants. The omnibus effect size of d = .46 indicates that treatments specifically adapted for clients of color were moderately more effective with that clientele than traditional treatments. The most effective treatments tended to be those with greater numbers of cultural adaptations. Mental health services targeted to a specific cultural group were several times more effective than those provided to clients from a variety of cultural backgrounds. We recommend a series of research-supported therapeutic practices that account for clients' culture, with culture-specific treatments being more effective than generally culture-sensitive treatments. © 2010 Wiley Periodicals, Inc.

  18. The radiosensitivity of human keratinocytes: influence of activated c-H-ras oncogene expression and tumorigenicity

    International Nuclear Information System (INIS)

    Mendonca, M.S.; Redpath, J.L.; Stanbridge, E.J.

    1991-01-01

    The authors investigated γ-ray sensitivity of several activated c-H-ras (EJ) containing clones established after transfection of the spontaneously immortalized non-tumorigenic human keratinocyte cell line HaCaT. The clones were grouped according to tumorigenic potential after subcutaneous injection into nude mice, and fell into three classes: Class I clones A-4 and I-6 are non-tumorigenic and express very low levels of c-H-ras mRNA and no mutated ras protein (p 21 ); Class II clones I-5 and I-7 grow to large (benign) epidermal cysts, express intermediate to high c-H-ras mRNA and variable levels of mutated ras p 21 protein with clone I-5 expressing little and clone I-7 expressing high levels of p 21 ; Class III clones II-3 and II-4 grow to solid squamous cell carcinomas, express high c-H-ras mRNA and high level of mutated p 21 ras protein similar to clone I-7. Comparison of single-hit multitarget or linear-quadratic survival curve parameters, and survival at 2Gy (S 2 ) indicate no general correlation with either activated c-H-ras expression level or tumorigenic potential, and increased radioresistance. (author)

  19. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  20. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation

    International Nuclear Information System (INIS)

    Cario-Andre, M.

    2000-11-01

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  1. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  2. Increased oxidative stress and antioxidant expression in mouse keratinocytes following exposure to paraquat

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Gray, Joshua P.; Shakarjian, Michael P.; Laskin, Debra L.; Heck, Diane E.; Laskin, Jeffrey D.

    2008-01-01

    Paraquat (1,1'-dimethyl-4,4'-bipyridinium) is a widely used herbicide known to induce skin toxicity. This is thought to be due to oxidative stress resulting from the generation of cytotoxic reactive oxygen intermediates (ROI) during paraquat redox cycling. The skin contains a diverse array of antioxidant enzymes which protect against oxidative stress including superoxide dismutase (SOD), catalase, glutathione peroxidase-1 (GPx-1), heme oxygenase-1 (HO-1), metallothionein-2 (MT-2), and glutathione-S-transferases (GST). In the present studies we compared paraquat redox cycling in primary cultures of undifferentiated and differentiated mouse keratinocytes and determined if this was associated with oxidative stress and altered expression of antioxidant enzymes. We found that paraquat readily undergoes redox cycling in both undifferentiated and differentiated keratinocytes, generating superoxide anion and hydrogen peroxide as well as increased protein oxidation which was greater in differentiated cells. Paraquat treatment also resulted in increased expression of HO-1, Cu,Zn-SOD, catalase, GSTP1, GSTA3 and GSTA4. However, no major differences in expression of these enzymes were evident between undifferentiated and differentiated cells. In contrast, expression of GSTA1-2 was significantly greater in differentiated relative to undifferentiated cells after paraquat treatment. No changes in expression of MT-2, Mn-SOD, GPx-1, GSTM1 or the microsomal GST's mGST1, mGST2 and mGST3, were observed in response to paraquat. These data demonstrate that paraquat induces oxidative stress in keratinocytes leading to increased expression of antioxidant genes. These intracellular proteins may be important in protecting the skin from paraquat-mediated cytotoxicity

  3. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  4. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  5. The incidence and multiplicity rates of keratinocyte cancers in Australia.

    Science.gov (United States)

    Pandeya, Nirmala; Olsen, Catherine M; Whiteman, David C

    2017-10-16

    To assess the incidence and multiplicity of keratinocyte cancers (basal cell carcinoma [BCC] and squamous cell carcinoma [SCC]) excised in Australia, and to examine variations by age, sex, state, and prior skin cancer history. Analysis of individual-level Medicare data for keratinocyte cancer treatments (identified by eight specific MBS item codes) during 2011-2014. Histological data from the QSkin prospective cohort study were analysed to estimate BCC and SCC incidence. A 10% systematic random sample of all people registered with Medicare during 1997-2014. People aged at least 20 years in 2011 who made at least one claim for any MBS medical service during 2011-2014 (1 704 193 individuals). Age-standardised incidence rates (ASRs) and standardised incidence ratios (SIRs). The person-based incidence of keratinocyte cancer excisions in Australia was 1531 per 100 000 person-years; incidence increased with age, and was higher for men than women (SIR, 1.43; 95% CI, 1.42-1.45). Lesion-based incidence was 3154 per 100 000 person-years. The estimated ASRs for BCC and SCC were 770 per 100 000 and 270 per 100 000 person-years respectively. During 2011-2014, 3.9% of Australians had one keratinocyte cancer excised, 2.7% had more than one excised; 74% of skin cancers were excised from patients who had two or more lesions removed. Multiplicity was strongly correlated with age; most male patients over 70 were treated for multiple lesions. Keratinocyte cancer incidence was eight times as high among people with a prior history of excisions as among those without. The incidence and multiplicity of keratinocyte cancer in Australia are very high, causing a large disease burden that has not previously been quantified.

  6. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  7. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  8. In vitro dermal and epidermal cellular response to titanium alloy implants fabricated with electron beam melting.

    Science.gov (United States)

    Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H

    2014-10-01

    Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  9. Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis

    International Nuclear Information System (INIS)

    Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.

    1986-01-01

    Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers

  10. Functional Role of Cyclin-Dependent Kinase 5 in the Regulation of Melanogenesis and Epidermal Structure.

    Science.gov (United States)

    Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren

    2017-10-23

    The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.

  11. Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

    Science.gov (United States)

    Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

    2010-07-20

    The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.

  12. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  13. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  14. Hyperthermia-induced micronucleus formation in a human keratinocyte cell line

    International Nuclear Information System (INIS)

    Hintzsche, Henning; Riese, Thorsten; Stopper, Helga

    2012-01-01

    Elevated temperature can cause biological effects in vitro and in vivo. Many studies on effects of hypo- and hyperthermia have been conducted, but only few studies systematically investigated the formation of genomic damage in the micronucleus test in human cells in vitro as a consequence of different temperatures. In the present study, HaCaT human keratinocytes were exposed to different temperatures from 37 °C to 42 °C for 24 h in a regular cell culture incubator. Micronucleus frequency as a marker of genomic damage was elevated in a temperature-dependent and statistically significant manner. Apoptosis occurred at temperatures of 39 °C or higher. Cell proliferation was unaffected up to 40 °C and decreased at 41 °C and 42 °C. Expression of the heat shock protein Hsp70 was elevated, particularly at temperatures of 40 °C and higher. These findings are in agreement with several in vivo studies and some in vitro studies looking at single, specific temperatures, but a systematically investigated temperature-dependent increase of genomic damage in human keratinocytes in vitro is demonstrated for the first time here.

  15. Inhibition of inflammatory gene expression in keratinocytes using a composition containing carnitine, thioctic Acid and saw palmetto extract.

    Science.gov (United States)

    Chittur, Sridar; Parr, Brian; Marcovici, Geno

    2011-01-01

    Chronic inflammation of the hair follicle (HF) is considered a contributing factor in the pathogenesis of androgenetic alopecia (AGA). Previously, we clinically tested liposterolic extract of Serenoa repens (LSESr) and its glycoside, β-sitosterol, in subjects with AGA and showed a highly positive response to treatment. In this study, we sought to determine whether blockade of inflammation using a composition containing LSESr as well as two anti-inflammatory agents (carnitine and thioctic acid) could alter the expression of molecular markers of inflammation in a well-established in vitro system. Using a well-validated assay representative of HF keratinocytes, specifically, stimulation of cultured human keratinocyte cells in vitro, we measured changes in gene expression of a spectrum of well-known inflammatory markers. Lipopolysaccharide (LPS) provided an inflammatory stimulus. In particular, we found that the composition effectively suppressed LPS-activated gene expression of chemokines, including CCL17, CXCL6 and LTB(4) associated with pathways involved in inflammation and apoptosis. Our data support the hypothesis that the test compound exhibits anti-inflammatory characteristics in a well-established in vitro assay representing HF keratinocyte gene expression. These findings suggest that 5-alpha reductase inhibitors combined with blockade of inflammatory processes could represent a novel two-pronged approach in the treatment of AGA with improved efficacy over current modalities.

  16. Inhibition of Inflammatory Gene Expression in Keratinocytes Using a Composition Containing Carnitine, Thioctic Acid and Saw Palmetto Extract

    Directory of Open Access Journals (Sweden)

    Sridar Chittur

    2011-01-01

    Full Text Available Chronic inflammation of the hair follicle (HF is considered a contributing factor in the pathogenesis of androgenetic alo