WorldWideScience

Sample records for epidermal barrier influenced

  1. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  2. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  3. Effects of topical application of aqueous solutions of hexoses on epidermal permeability barrier recovery rate after barrier disruption.

    Science.gov (United States)

    Denda, Mitsuhiro

    2011-11-01

    Previous studies have suggested that hexose molecules influence the stability of phospholipid bilayers. Therefore, the effects of topical application of all 12 stereoisomers of dextro-hexose on the epidermal barrier recovery rate after barrier disruption were evaluated. Immediately after tape stripping, 0.1 m aqueous solution of each hexose was applied on hairless mouse skin. Among the eight dextro-aldohexoses, topical application of altose, idose, mannose and talose accelerated the barrier recovery, while allose, galactose, glucose and gulose had no effect. Among the four dextro-ketohexoses, psicose, fructose, sorbose and tagatose all accelerated the barrier recovery. As the effects of hexoses on the barrier recovery rate appeared within 1 h, the mechanism is unlikely to be genomic. Instead, these hexoses may influence phase transition of the lipid bilayers of lamellar bodies and cell membrane, a crucial step in epidermal permeability barrier homeostasis. © 2011 John Wiley & Sons A/S.

  4. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  5. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  6. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  8. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  9. Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics

    OpenAIRE

    Henrique Silva; Sara Aguiar Silva; Hugo Ferreira; L. Monteiro Rodrigues

    2015-01-01

    Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu). The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young ad...

  10. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  11. Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

    Science.gov (United States)

    Crawford, Melissa; Dagnino, Lina

    2017-10-02

    The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

  12. Epidermal transglutaminase (TGase 3 is required for proper hair development, but not the formation of the epidermal barrier.

    Directory of Open Access Journals (Sweden)

    Susan John

    Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.

  13. TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

    Directory of Open Access Journals (Sweden)

    Aurélie Hayez

    Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

  14. Integrin-Linked Kinase Is Indispensable for Keratinocyte Differentiation and Epidermal Barrier Function.

    Science.gov (United States)

    Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina

    2016-02-01

    A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  15. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  16. Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics

    Directory of Open Access Journals (Sweden)

    Henrique Silva

    2015-03-01

    Full Text Available Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu. The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young adult subjects (21.6 ± 2.6 years old were selected after informed consent. Subjects were asked to apply a commercially available alcohol gel sanitizer to one hand for 15 days. TEWL absolute values were measured on days 1, 8 and 15 and a plastic occlusion stress test (POST applied. Evaporation half-life (t1/2 evap and dynamic water mass (DWM values increased significantly on day 15 on the treated hand compared to the control hand suggesting that, in the present experimental conditions, the regular use of an alcohol-based gel sanitizer does changes the epidermal barrier. This study also confirms the usefulness of this kinetic model to detect subtle changes on in vivo TEWL dynamics.

  17. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  18. Compromised epidermal barrier stimulates Harderian gland activity and hypertrophy in ACBP-/- mice

    DEFF Research Database (Denmark)

    Sørensen, Signe Bek; Neess, Ditte; Dixen, Karen

    2015-01-01

    of the eye lid. We show that disruption of the Acbp gene leads to a significant enlargement of this gland with hypertrophy of the acinar cells and increased de novo synthesis of monoalkyl diacylglycerol, the main lipid species produced by the gland. Mice with conditional targeting of the Acbp gene......Acyl-CoA binding protein (ACBP) is a small, ubiquitously expressed intracellular protein that binds C14-C22 acyl-CoA esters with very high affinity and specificity. We have recently shown that targeted disruption of the Acbp gene leads to a compromised epidermal barrier and that this causes delayed...

  19. Epicutaneous aeroallergen sensitization in atopic dermatitis infants - determining the role of epidermal barrier impairment.

    Science.gov (United States)

    Boralevi, F; Hubiche, T; Léauté-Labrèze, C; Saubusse, E; Fayon, M; Roul, S; Maurice-Tison, S; Taïeb, A

    2008-02-01

    Sensitization to atopens is an early phenomenon that overlaps with the onset of atopic dermatitis (AD) in infancy. Early epidermal barrier impairment may facilitate the epicutaneous penetration of atopens. To correlate transepidermal water loss (TEWL) and aeroallergen sensitization in infants with AD. In this cross-sectional study we enrolled 59 AD children and 30 controls aged 3-12 months. Transepidermal water loss in uninvolved skin, specific immunoglobulin E, atopy patch test (APT) and skin prick tests were performed with respect to seven aeroallergens, i.e., Dermatophagoides pteronyssinus, D. farinae, cat, dog, birch pollen, ambrosia, and cockroach. Environmental conditions were assessed by a questionnaire, and the house dust mite (HDM) concentration was determined in dust samples. Eighty-nine percent of AD infants had a positive APT vs one out of eleven controls. AD infants had a significantly higher mean TEWL than controls (27.4 vs 11.1 g/m(2)/h, P cats, and dogs at home. This study confirms the high prevalence of delayed sensitization to indoor and outdoor aeroallergens in AD infants, and shows that the higher the TEWL, the higher the prevalence of sensitization to aeroallergens. These data are in favor of a major role of a constitutive epidermal barrier impairment in determining early atopen sensitization in infants with AD.

  20. Delayed Hepatic Adaptation to Weaning in ACBP(-/-) Mice Is Caused by Disruption of the Epidermal Barrier

    DEFF Research Database (Denmark)

    Neess, Ditte; Bek, Signe; Bloksgaard, Maria

    2013-01-01

    in the skin rather than in the liver. Similarly to ACBP(-/-) mice, K14-ACBP(-/-) mice exhibit an increased transepidermal water loss, and we show that the hepatic phenotype is caused specifically by the epidermal barrier defect, which leads to increased lipolysis in white adipose tissue. Our data demonstrate......We previously reported that mice deficient in acyl-CoA-binding protein (ACBP) display a delayed metabolic adaptation to weaning. This includes a delayed activation of the hepatic lipogenic gene program, which may result from hepatic accumulation of triacylglycerol and/or cholesteryl esters...... in the late suckling period. To further investigate the basis for this phenotype, we generated mice deficient in ACBP in hepatocytes (Alb-ACBP(-/-)) and keratinocytes (K14-ACBP(-/-)). Surprisingly, the delayed adaptation to weaning, including hepatic lipid accumulation, is caused by ACBP deficiency...

  1. Enterocyte-specific epidermal growth factor prevents barrier dysfunction and improves mortality in murine peritonitis.

    Science.gov (United States)

    Clark, Jessica A; Gan, Heng; Samocha, Alexandr J; Fox, Amy C; Buchman, Timothy G; Coopersmith, Craig M

    2009-09-01

    Systemic administration of epidermal growth factor (EGF) decreases mortality in a murine model of septic peritonitis. Although EGF can have direct healing effects on the intestinal mucosa, it is unknown whether the benefits of systemic EGF in peritonitis are mediated through the intestine. Here, we demonstrate that enterocyte-specific overexpression of EGF is sufficient to prevent intestinal barrier dysfunction and improve survival in peritonitis. Transgenic FVB/N mice that overexpress EGF exclusively in enterocytes (IFABP-EGF) and wild-type (WT) mice were subjected to either sham laparotomy or cecal ligation and puncture (CLP). Intestinal permeability, expression of the tight junction proteins claudins-1, -2, -3, -4, -5, -7, and -8, occludin, and zonula occludens-1; villus length; intestinal epithelial proliferation; and epithelial apoptosis were evaluated. A separate cohort of mice was followed for survival. Peritonitis induced a threefold increase in intestinal permeability in WT mice. This was associated with increased claudin-2 expression and a change in subcellular localization. Permeability decreased to basal levels in IFABP-EGF septic mice, and claudin-2 expression and localization were similar to those of sham animals. Claudin-4 expression was decreased following CLP but was not different between WT septic mice and IFABP-EGF septic mice. Peritonitis-induced decreases in villus length and proliferation and increases in apoptosis seen in WT septic mice did not occur in IFABP-EGF septic mice. IFABP-EGF mice had improved 7-day mortality compared with WT septic mice (6% vs. 64%). Since enterocyte-specific overexpression of EGF is sufficient to prevent peritonitis-induced intestinal barrier dysfunction and confers a survival advantage, the protective effects of systemic EGF in septic peritonitis appear to be mediated in an intestine-specific fashion.

  2. [Impact of wet work on epidermal barrier (tewl and stratum corneum hydration) and skin viscoelasticity in nurses].

    Science.gov (United States)

    Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata

    2014-01-01

    Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.

  3. THE ROLE OF EPIDERMAL BARRIER IMPAIRMENTS IN ATOPIC DERMATITIS: MODERN CONCEPTS OF DISEASE PATHOGENESIS

    Directory of Open Access Journals (Sweden)

    Nikolay N. Murashkin

    2018-01-01

    Full Text Available Atopic dermatitis is a common chronic inflammatory skin disease characterized by a recurring course and progressive decrease in the quality of life. Recent studies in this area demonstrate the multifaceted pathogenesis of atopic dermatitis. Interaction of such factors as epidermal dysfunction, immune system disorders, and the consequences of genetic mutations contributes not only to the development of the disease but also to its progression and chronic course. The article presents various components of the etiopathogenesis of atopic dermatitis, describes the role of lipids, thereby the new therapeutic targets are revealed to specialists.

  4. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  5. Simultaneous cell death and desquamation of the embryonic diffusion barrier during epidermal development

    International Nuclear Information System (INIS)

    Saathoff, Manuela; Blum, Barbara; Quast, Thomas; Kirfel, Gregor; Herzog, Volker

    2004-01-01

    The periderm is an epithelial layer covering the emerging epidermis in early embryogenesis of vertebrates. In the chicken embryo, an additional cellular layer, the subperiderm, occurs at later embryonic stages underneath the periderm. The questions arose what is the function of both epithelial layers and, as they are transitory structures, by which mechanism are they removed. By immunocytochemistry, the tight junction (TJ) proteins occludin and claudin-1 were localized in the periderm and in the subperiderm, and sites of close contact between adjacent cells were detected by electron microscopy. Using horseradish peroxidase (HRP) as tracer, these contacts were identified as tight junctions involved in the formation of the embryonic diffusion barrier. This barrier was lost by desquamation at the end of the embryonic period, when the cornified envelope of the emerging epidermis was formed. By TUNEL and DNA ladder assays, we detected simultaneous cell death in the periderm and the subperiderm shortly before hatching. The absence of caspases-3, -6, and -7 activity, key enzymes of apoptosis, and the lack of typical morphological criteria of apoptosis such as cell fragmentation or membrane blebbing point to a special form of programmed cell death (PCD) leading to the desquamation of the embryonic diffusion barrier

  6. Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

    DEFF Research Database (Denmark)

    Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

    2013-01-01

    The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

  7. Sebaceous gland, hair shaft, and epidermal barrier abnormalities in keratosis pilaris with and without filaggrin deficiency

    DEFF Research Database (Denmark)

    Gruber, Robert; Sugarman, Jeffrey L; Crumrine, Debra

    2015-01-01

    were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular...... and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial...

  8. Sebaceous Gland, Hair Shaft, and Epidermal Barrier Abnormalities in Keratosis Pilaris with and without Filaggrin Deficiency

    Science.gov (United States)

    Gruber, Robert; Sugarman, Jeffrey L.; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M.; Mauldin, Elizabeth A.; Thyssen, Jacob P.; Brandner, Johanna M.; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M.

    2016-01-01

    Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities. PMID:25660180

  9. Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.

    Science.gov (United States)

    Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna

    2018-01-21

    Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Crossing safety barriers: influence of children's morphological and functional variables.

    Science.gov (United States)

    Cordovil, Rita; Vieira, Filomena; Barreiros, João

    2012-05-01

    Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  11. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  12. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  13. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  14. Essential function of linoleic acid esterified in acylglucosylceramide and acylceramide in maintaining the epidermal water permeability barrier. Evidence from feeding studies with oleate, linoleate, arachidonate, columbinate and a-linolenate

    DEFF Research Database (Denmark)

    Hansen, Harald S.; Jensen, B.

    1985-01-01

    sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...

  15. Epidermal hydration levels in rosacea patients improve after minocycline therapy.

    LENUS (Irish Health Repository)

    Ní Raghallaigh, S

    2013-12-06

    Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.

  16. The influence of tethered epidermal growth factor on connective tissue progenitor colony formation

    OpenAIRE

    Marcantonio, Nicholas A.; Boehm, Cynthia A.; Rozic, Richard J.; Au, Ada; Wells, Alan; Muschler, George F.; Griffith, Linda G.

    2009-01-01

    Strategies to combine aspirated marrow cells with scaffolds to treat connective tissue defects are gaining increasing clinical attention and use. In situations such as large defects where initial survival and proliferation of transplanted connective tissue progenitors (CTPs) are limiting, therapeutic outcomes might be improved by using the scaffold to deliver growth factors that promote the early stages of cell function in the graft. Signaling by the epidermal growth factor receptor (EGFR) pl...

  17. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  18. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

    DEFF Research Database (Denmark)

    Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

    2006-01-01

    most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

  19. Skin dose rate conversion factors after contamination with radiopharmaceuticals: influence of contamination area, epidermal thickness and percutaneous absorption

    International Nuclear Information System (INIS)

    Covens, P; Berus, D; Caveliers, V; Struelens, L; Vanhavere, F; Verellen, D

    2013-01-01

    Skin contamination with radiopharmaceuticals can occur during biomedical research and daily nuclear medicine practice as a result of accidental spills, after contact with bodily fluids of patients or by inattentively touching contaminated materials. Skin dose assessment should be carried out by repeated quantification to map the course of the contamination together with the use of appropriate skin dose rate conversion factors. Contamination is generally characterised by local spots on the palmar surface of the hand and complete decontamination is difficult as a result of percutaneous absorption. This specific issue requires special consideration as to the skin dose rate conversion factors as a measure for the absorbed dose rate to the basal layer of the epidermis. In this work we used Monte Carlo simulations to study the influence of the contamination area, the epidermal thickness and the percutaneous absorption on the absorbed skin dose rate conversion factors for a set of 39 medical radionuclides. The results show that the absorbed dose to the basal layer of the epidermis can differ by up to two orders of magnitude from the operational quantity H p (0.07) when using an appropriate epidermal thickness in combination with the effect of percutaneous absorption. (paper)

  20. Using organizational influence processes to overcome IS implementation barriers

    DEFF Research Database (Denmark)

    Ngwenyama, Ojelanki; Nielsen, Peter Axel

    2014-01-01

    A fundamental tenet of the information systems (IS) discipline holds that: (a) a lack of formal power and influence over the organization targeted for change, (b) weak support from top management, and (c) organizational memories of prior failures are barriers to implementation success. Our research......, informed by organization influence, compellingly illustrates that such conditions do not necessarily doom a project to failure. In this paper, we present an analysis of how an IS implementation team designed and enacted a coordinated strategy of organizational influence to achieve implementation success...... despite these barriers. Our empirical analysis also found that technology implementation and change is largely an organizational influence process (OIP), and thus technical-rational approaches alone are inadequate for achieving success. Our findings offer managers important insights into how they can...

  1. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  2. A plant oil-containing pH 4 emulsion improves epidermal barrier structure and enhances ceramide levels in aged skin.

    Science.gov (United States)

    Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P

    2017-06-01

    Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  3. Influence of creep and cyclic oxidation in thermal barrier coatings

    Energy Technology Data Exchange (ETDEWEB)

    Seiler, Philipp; Baeker, Martin; Roesler, Joachim [Technische Univ. Braunschweig (Germany). Inst. fuer Werkstoffe

    2012-01-15

    The lifetime of thermal barrier coating systems is limited by cracks close to the interfaces, causing delamination. To study the failure mechanisms, a simplified model system is analysed which consists of a bond-coat bulk material, a thermally grown oxide, and an yttria-stabilised zirconia topcoat. The stresses in the model system are calculated using a finite element model which covers the simulation of full thermal cycles, creep in all layers, and the anisotropic oxidation during dwelling. Creep in the oxide and the thermal barrier coating is varied with the use of different creep parameter sets. The influence of creep in the bondcoat is analysed by using two different bond-coat materials: fast creeping Fecralloy and slow creeping oxide dispersion strengthened MA956. It is shown that creep in the bondcoat influences the lifetime of the coatings. Furthermore, a fast creeping thermally grown oxide benefits the lifetime of the coating system. (orig.)

  4. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  5. A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

    Science.gov (United States)

    Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

    2015-08-01

    The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

  6. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation

    International Nuclear Information System (INIS)

    Cario-Andre, M.

    2000-11-01

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  7. Barriers and facilitators influencing ethical evaluation in health technology assessment.

    Science.gov (United States)

    Assasi, Nazila; Schwartz, Lisa; Tarride, Jean-Eric; O'Reilly, Daria; Goeree, Ron

    2015-01-01

    The objective of this study was to explore barriers and facilitators influencing the integration of ethical considerations in health technology assessment (HTA). The study consisted of two complementary approaches: (a) a systematic review of the literature; and (b) an eighteen-item online survey that was distributed to fifty-six HTA agencies affiliated with the International Network of Agencies for Health Technology Assessment. The review identified twenty-six relevant articles. The most often cited barriers in the literature were: scarcity, heterogeneity and complexity of ethical analysis methods; challenges in translating ethical analysis results into knowledge that is useful for decision makers; and lack of organizational support in terms of required expertise, time and financial resources. The most frequently cited facilitators included: usage of value-based appraisal methods, stakeholder and public engagement, enhancement of practice guidelines, ethical expertise, and educational interventions. Representatives of twenty-six (46.5 percent) agencies from nineteen countries completed the survey. A median of 10 percent (interquartile range, 5 percent to 50 percent) of the HTA products produced by the agencies was reported to include an assessment of ethical aspects. The most commonly perceived barriers were: limited ethical knowledge and expertise, insufficient time and resources, and difficulties in finding ethical evidence or using ethical guidelines. Educational interventions, demand by policy makers, and involvement of ethicists in HTA were the most commonly perceived facilitators. Our results emphasize the importance of simplification of ethics methodology and development of good practice guidelines in HTA, as well as capacity building for engaging HTA practitioners in ethical analyses.

  8. Effects of in Utero Exposure of C57BL/6J Mice to 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Epidermal Permeability Barrier Development and Function

    Science.gov (United States)

    Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.

    2014-01-01

    Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982

  9. On the physics of laser-induced selective photothermolysis of hair follicles: Influence of wavelength, pulse duration, and epidermal cooling.

    Science.gov (United States)

    Svaasand, Lars O; Nelson, J Stuart

    2004-01-01

    The physical basis for optimization of wavelength, pulse duration, and cooling for laser-induced selective photothermolysis of hair follicles in human skin is discussed. The results indicate that the most important optimization parameter is the cooling efficiency of the technique utilized for epidermal protection. The optical penetration is approximately the same for lasers at 694, 755, and 800 nm. The penetration of radiation from Nd:yttrium-aluminum-garnet lasers at 1064 nm is, however, somewhat larger. Photothermal damage to the follicle is shown to be almost independent of laser pulse duration up to 100 ms. The results reveal that epidermal cooling by a 30-80-ms-long cryogen spurt immediately before laser exposure is the only efficient technique for laser pulse durations less than 10 ms. For longer pulse durations in the 30-100 ms range, protection can be done efficiently by skin cooling during laser exposure. For laser pulses of 100 ms, an extended precooling period, e.g., by bringing a cold object into good thermal contact with the skin for about 1 s, can be of value. Thermal quenching of laser induced epidermal temperature rise after pulsed exposure can most efficiently be done with a 20 ms cryogen spurt applied immediately after irradiation. (c) 2004 Society of Photo-Optical Instrumentation Engineers.

  10. Conformational stability of the epidermal growth factor (EGF) receptor as influenced by glycosylation, dimerization and EGF hormone binding.

    Science.gov (United States)

    Taylor, Eric S; Pol-Fachin, Laercio; Lins, Roberto D; Lower, Steven K

    2017-04-01

    The epidermal growth factor receptor (EGFR) is an important transmembrane glycoprotein kinase involved the initiation or perpetuation of signal transduction cascades within cells. These processes occur after EGFR binds to a ligand [epidermal growth factor (EGF)], thus inducing its dimerization and tyrosine autophosphorylation. Previous publications have highlighted the importance of glycosylation and dimerization for promoting proper function of the receptor and conformation in membranes; however, the effects of these associations on the protein conformational stability have not yet been described. Molecular dynamics simulations were performed to characterize the conformational preferences of the monomeric and dimeric forms of the EGFR extracellular domain upon binding to EGF in the presence and absence of N-glycan moieties. Structural stability analyses revealed that EGF provides the most conformational stability to EGFR, followed by glycosylation and dimerization, respectively. The findings also support that EGF-EGFR binding takes place through a large-scale induced-fitting mechanism. Proteins 2017; 85:561-570. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. Influence of solid noise barriers on near-road and on-road air quality

    Science.gov (United States)

    Baldauf, Richard W.; Isakov, Vlad; Deshmukh, Parikshit; Venkatram, Akula; Yang, Bo; Zhang, K. Max

    2016-03-01

    Public health concerns regarding adverse health effects for populations spending significant amounts of time near high traffic roadways has increased substantially in recent years. Roadside features, including solid noise barriers, have been investigated as potential methods that can be implemented in a relatively short time period to reduce air pollution exposures from nearby traffic. A field study was conducted to determine the influence of noise barriers on both on-road and downwind pollutant concentrations near a large highway in Phoenix, Arizona, USA. Concentrations of nitrogen dioxide, carbon monoxide, ultrafine particles, and black carbon were measured using a mobile platform and fixed sites along two limited-access stretches of highway that contained a section of noise barrier and a section with no noise barrier at-grade with the surrounding terrain. Results of the study showed that pollutant concentrations behind the roadside barriers were significantly lower relative to those measured in the absence of barriers. The reductions ranged from 50% within 50 m from the barrier to about 30% as far as 300 m from the barrier. Reductions in pollutant concentrations generally began within the first 50 m of the barrier edge; however, concentrations were highly variable due to vehicle activity behind the barrier and along nearby urban arterial roadways. The concentrations on the highway, upwind of the barrier, varied depending on wind direction. Overall, the on-road concentrations in front of the noise barrier were similar to those measured in the absence of the barrier, contradicting previous modeling results that suggested roadside barriers increase pollutant levels on the road. Thus, this study suggests that noise barriers do reduce potential pollutant exposures for populations downwind of the road, and do not likely increase exposures to traffic-related pollutants for vehicle passengers on the highway.

  12. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  14. Influence of the geometry of protective barriers on the propagation of shock waves

    Science.gov (United States)

    Sochet, I.; Eveillard, S.; Vinçont, J. Y.; Piserchia, P. F.; Rocourt, X.

    2017-03-01

    The protection of industrial facilities, classified as hazardous, against accidental or intentional explosions represents a major challenge for the prevention of personal injury and property damage, which also involves social and economic issues. We consider here the use of physical barriers against the effects of these explosions, which include the pressure wave, the projection of fragments and the thermal flash. This approach can be recommended for the control of major industrial risks, but no specific instructions are available for its implementation. The influence of a protective barrier against a detonation-type explosion is studied in small-scale experiments. The effects of overpressure are examined over the entire path of the shock wave across the barrier and in the downstream zone to be protected. Two series of barrier structures are studied. The first series (A) of experiments investigates two types of barrier geometry with dimensions based on NATO recommendations. These recommendations stipulate that the barrier should be 2 m higher than the charge height, the thickness at the crest should be more than 0.5 m, while its length should be equal to twice the protected structure length and the bank slope should be equivalent to the angle of repose of the soil. The second series (B) of experiments investigates the influence of geometrical parameters of the barrier (thickness at the crest and inclination angles of the front and rear faces) on its protective effects. This project leads to an advance in our understanding of the physical phenomena involved in the propagation of blast waves resulting from an external explosion, in the area around a protective physical barrier. The study focuses on the dimensioning of protective barriers against overpressure effects arising from detonation and shows the advantage of using a barrier with a vertical front or rear face.

  15. Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

    Directory of Open Access Journals (Sweden)

    Kyounghwan Lee

    2015-04-01

    Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

  16. Does weight status influence perceptions of physical activity barriers among African-American women?

    Science.gov (United States)

    Genkinger, Jeanine M; Jehn, Megan L; Sapun, Marcella; Mabry, Iris; Young, Deborah Rohm

    2006-01-01

    Many African-American women fail to participate in regular physical activity. Weight status may influence physical activity barriers. This study examined the frequency and type of barriers. Participants in this study were enrolled in Project EXE-L (Exercising Ladies Excel), a six-month, church-based, randomized trial of moderate-intensity physical activity based in Baltimore city and county in Maryland. Participants were composed of African-American women who attended one of the participating churches, had friends who were church members, or who lived in neighborhoods surrounding one of the churches. Individuals who were between the ages of 25 and 70 years, were not regularly physically active (defined as not engaging in moderate-intensity activity more than three times per week), and were able to participate in moderate-intensity activity met eligibility criteria to participate in the trial. Barriers to physical activity were evaluated with the Steinhardt/Dishman Barriers for Habitual Physical Activity Scale at baseline. One hundred twenty women were classified as normal weight (body mass index [BMI]: or = 30 kg/m2). Obese participants were more likely to report "lack of motivation" as a barrier compared with normal-weight participants (63% vs 31%). Normal-weight and overweight participants were more likely to report no barriers compared with the obese (31%, 0%, 5%, respectively, P<.05). Barriers for African-American women may vary by BMI status. By defining these unique barriers, effective physical activity interventions can be developed.

  17. Relationship between serum carcinoembryonic antigen level and epidermal growth factor receptor mutations with the influence on the prognosis of non-small-cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Cai ZX

    2016-06-01

    Full Text Available Zuxun Cai Department of Thoracic Surgery, Henan Provincial Chest Hospital, Zhengzhou City, People’s Republic of China Objective: To investigate the relationship between serum carcinoembryonic antigen (CEA level and epidermal growth factor receptor (EGFR gene mutations in non-small-cell lung cancer (NSCLC patients and to analyze the influence of CEA level on postoperative survival time in lung cancer patients. Methods: A total of 296 patients who were treated in Thoracic Surgery Department of Henan Provincial Chest Hospital from September 2011 to September 2013 were recruited. The level of tumor markers, such as CEA, was determined before the surgery, and EGFR gene mutations were detected after surgery. Thereby, the relationship between tumor makers, including CEA, and EGFR mutation and its influence on prognosis could be investigated. Results: Among 296 patients, the positive rate of EGFR gene mutation was 37.84% (112/296; the mutation occurred more frequently in nonsmokers, adenocarcinoma patients, women, and patients aged <60 years (P<0.05. Both tumor markers and chemosensitivity indicators were related to the profile of EGFR mutations. Elevated squamous cell carcinoma and Cyfra21-1 as well as positively expressed ERCC1 were more common in patients with wild-type EGFR (P<0.05, whereas increased CEA level was observed more frequently in patients with EGFR gene mutation (P=0.012. The positive rate of EGFR gene mutations was higher as the serum CEA level increased, that is, the positive rate in patients with serum CEA level <5, 5–20, and >20 µg/L was 39.81%, 45.32%, and 65.47%, respectively (P=0.004. Logistic regression analysis showed that CEA level was an independent factor in predicting EGFR gene mutations, and serum CEA level was also an independent factor in affecting the prognosis of NSCLC patients, as the overall 2-year survival rate was 73.86% in elevated CEA group and 86.43% in normal group (P<0.01. Conclusion: The prognosis of

  18. Influence of epidermal growth factor (EGF) and hydrocortisone on the co-culture of mature adipocytes and endothelial cells for vascularized adipose tissue engineering.

    Science.gov (United States)

    Huber, Birgit; Czaja, Alina Maria; Kluger, Petra Juliane

    2016-05-01

    The composition of vascularized adipose tissue is still an ongoing challenge as no culture medium is available to supply adipocytes and endothelial cells appropriately. Endothelial cell medium is typically supplemented with epidermal growth factor (EGF) as well as hydrocortisone (HC). The effect of EGF on adipocytes is discussed controversially. Some studies say it inhibits adipocyte differentiation while others reported of improved adipocyte lipogenesis. HC is known to have lipolytic activities, which might result in mature adipocyte dedifferentiation. In this study, we evaluated the influence of EGF and HC on the co-culture of endothelial cells and mature adipocytes regarding their cell morphology and functionality. We showed in mono-culture that high levels of HC promoted dedifferentiation and proliferation of mature adipocytes, whereas EGF seemed to have no negative influence. Endothelial cells kept their typical cobblestone morphology and showed a proliferation rate comparable to the control independent of EGF and HC concentration. In co-culture, HC promoted dedifferentiation of mature adipocytes, which was shown by a higher glycerol release. EGF had no negative impact on adipocyte morphology. No negative impact on endothelial cell morphology and functionality could be seen with reduced EGF and HC supplementation in co-culture with mature adipocytes. Taken together, our results demonstrate that reduced levels of HC are needed for co-culturing mature adipocytes and endothelial cells. In co-culture, EGF had no influence on mature adipocytes. Therefore, for the composition of vascularized adipose tissue constructs, the media with low levels of HC and high or low levels of EGF can be used. © 2016 International Federation for Cell Biology.

  19. The influence of roadside solid and vegetation barriers on near-road air quality

    Science.gov (United States)

    Ghasemian, Masoud; Amini, Seyedmorteza; Princevac, Marko

    2017-12-01

    The current study evaluates the influence of roadside solid and vegetation barriers on the near-road air quality. Reynolds Averaged Navier-Stokes (RANS) technique coupled with the k - ε realizable turbulence model is utilized to investigate the flow pattern and pollutant concentration. A scalar transport equation is solved for a tracer gas to represent the roadway pollutant emissions. In addition, a broad range of turbulent Schmidt numbers are tested to calibrate the scalar transport equation. Three main scenarios including flat terrain, solid barrier, and vegetative barrier are studied. To validate numerical methodology, predicted pollutant concentration is compared with published wind tunnel data. Results show that the solid barrier induces an updraft motion and lofts the vehicle emission plume. Therefore, the ground-level pollutant concentration decreases compared to the flat terrain. For the vegetation barrier, different sub-scenarios with different vegetation densities ranging from approximately flat terrain to nearly solid barrier are examined. Dense canopies act in a similar manner as a solid barrier and mitigate the pollutant concentration through vertical mixing. On the other hand, the high porosity vegetation barriers reduce the wind speed and lead to a higher pollutant concentration. As the vegetation density increases, i.e. the barrier porosity decreases, the recirculation zone behind the canopy becomes larger and moves toward the canopy. The dense plant canopy with LAD = 3.33m-2m3 can improve the near-road air quality by 10% and high porosity canopy with LAD = 1m-2m3 deteriorates near-road air quality by 15%. The results of this study can be implemented as green infrastructure design strategies by urban planners and forestry organizations.

  20. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  1. Review on technical issues influencing the performance of chemical barriers of TRU waste repository

    International Nuclear Information System (INIS)

    Fujita, Tomonari; Sugiyama, Daisuke; Tsukamoto, Masaki; Yokoyama, Hayaichi

    1997-01-01

    Studies of technical issues influencing the performance assessment of TRU waste disposal which is occurred from the nuclear fuel reprocessing were reviewed in related to the development of safety analysis method. Especially, the chemical containment was investigated as a key barrier to radionuclide migration. TRU waste including long-lived radionuclides need long-term performance assessment which could be assumed only by the chemical barrier. The description of technical issues concerned with the performance of TRU waste repository has been divided into the following categories: long-term degradation of cementitious materials as engineered barrier for radionuclide migration, effect of colloids, organic macromolecules and organic degradation products on chemical behavior of radionuclides, gas generation by corrosion of metallic wastes, and effects of microbial activity. Preliminary performance assessment indicated that important factors affecting performance of chemical barriers in near-field were the distribution coefficient and the solubility of radionuclides in near-field groundwater. Therefore, it was identified that key issues associated with performance of chemical barrier were evaluation of (a) the long-term change of distribution coefficient of cementitious material through the degradation under repository condition and (b) chemical speciation change of radionuclides such as increase of solubility by the presence of colloidal-size materials. (author)

  2. Influence of Nitrate on the Hanford 100D Area In Situ Redox Manipulation Barrier Longevity

    International Nuclear Information System (INIS)

    Szecsody, Jim E.; Phillips, Jerry L.; Vermeul, Vince R.; Fruchter, Jonathan S.; Williams, Mark D.

    2005-01-01

    The purpose of this laboratory study is to determine the influence of nitrate on the Hanford 100D Area in situ redox manipulation (ISRM) barrier longevity. There is a wide spread groundwater plume of 60 mg/L nitrate upgradient of the ISRM barrier with lower nitrate concentrations downgradient, suggestive of nitrate reduction occurring. Batch and 1-D column experiments showed that nitrate is being slowly reduced to nitrite and ammonia. These nitrate reduction reactions are predominantly abiotic, as experiments with and without bactericides present showed no difference in nitrate degradation rates. Nitrogen species transformation rates determined in experiments covered a range of ferrous iron/nitrate ratios such that the data can be used to predict rates in field scale conditions. Field scale reaction rate estimates for 100% reduced sediment (16 C) are: (a) nitrate degradation = 202 ± 50 h (half-life), (b) nitrite production = 850 ± 300 h, and (c) ammonia production = 650 ± 300 h. Calculation of the influence of nitrate reduction on the 100D Area reductive capacity requires consideration of mass balance and reaction rate effects. While dissolved oxygen and chromate reduction rates are rapid and essentially at equilibrium in the aquifer, nitrate transformation reactions are slow (100s of hours). In the limited (20-40 day) residence time in the ISRM barrier, only a portion of the nitrate will be reduced, whereas dissolved oxygen and chromate are reduced to completion. Assuming a groundwater flow rate of 1 ft/day, it is estimated that the ISRM barrier reductive capacity is 160 pore volumes (with no nitrate), and 85 pore volumes if 60 mg/L nitrate is present (i.e., a 47% decrease in the ISRM barrier longevity). Zones with more rapid groundwater flow will be less influenced by nitrate reduction. For example, a zone with a groundwater flow rate of 3 ft/day and 60 mg/L nitrate will have a reductive capacity of 130 pore volumes. Finally, long-term column experiments

  3. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  4. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  5. Homogeneous dielectric barrier discharges in atmospheric air and its influencing factor

    Science.gov (United States)

    Ran, Junxia; Li, Caixia; Ma, Dong; Luo, Haiyun; Li, Xiaowei

    2018-03-01

    The stable homogeneous dielectric barrier discharge (DBD) is obtained in atmospheric 2-3 mm air gap. It is generated using center frequency 1 kHz high voltage power supply between two plane parallel electrodes with specific alumina ceramic plates as the dielectric barriers. The discharge characteristics are studied by a measurement of its electrical discharge parameters and observation of its light emission phenomena. The results show that a large single current pulse of about 200 μs duration appearing in each voltage pulse, and its light emission is radially homogeneous and covers the entire surface of the two electrodes. The homogeneous discharge generated is a Townsend discharge during discharge. The influences of applied barrier, its thickness, and surface roughness on the transition of discharge modes are studied. The results show that it is difficult to produce a homogeneous discharge using smooth plates or alumina plate surface roughness Ra material, dielectric thickness, and dielectric surface roughness should be used, and proper applied voltage amplitude and frequency should also be used.

  6. How hormones influence composition and physiological function of the brain-blood barrier.

    Science.gov (United States)

    Hampl, R; Bičíková, M; Sosvorová, L

    2015-01-01

    Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.

  7. Making time for family meals: Parental influences, home eating environments, barriers and protective factors.

    Science.gov (United States)

    Jones, Blake L

    2018-04-06

    Frequent family mealtimes have been associated with numerous positive dietary, health, and behavioral outcomes for children and families. This review article summarizes some of the beneficial outcomes associated with having frequent family dinners. Current trends in family dinner frequency are discussed in the context of barriers that influence how often families eat dinner together, including time issues, work issues, and distractions in the home environment. Next, several parental influences and home environment factors that promote healthy and consistent family dinners are outlined. Finally, limitations are discussed and a few practical suggestions are mentioned to help encourage families, employers, and policy-makers to make family mealtimes a regular practice for as many families as possible. Copyright © 2018. Published by Elsevier Inc.

  8. Factors influencing the movement biology of migrant songbirds confronted with an ecological barrier

    Science.gov (United States)

    Smolinsky, J. A.; Diehl, Robert H.; Radzio, T. A.; Delaney, D. K.; Moore, F. R

    2013-01-01

    Whether or not a migratory songbird embarks on a long-distance flight across an ecological barrier is likely a response to a number of endogenous and exogenous factors. During autumn 2008 and 2009, we used automated radio tracking to investigate how energetic condition, age, and weather influenced the departure timing and direction of Swainson’s thrushes (Catharus ustulatus) during migratory stopover along the northern coast of the Gulf of Mexico. Most birds left within 1 h after sunset on the evening following capture. Those birds that departed later on the first night or remained longer than 1 day were lean. Birds that carried fat loads sufficient to cross the Gulf of Mexico generally departed in a seasonally appropriate southerly direction, whereas lean birds nearly always flew inland in a northerly direction. We did not detect an effect of age or weather on departures. The decision by lean birds to reorient movement inland may reflect the suitability of the coastal stopover site for deposition of fuel stores and the motivation to seek food among more extensive forested habitat away from the barrier.

  9. Influence of ion transport on discharge propagation of nanosecond dielectric barrier discharge plasma actuator

    Science.gov (United States)

    Hua, Weizhuo; Koji, Fukagata

    2017-11-01

    A numerical study has been conducted to understand the streamer formation and propagation of nanosecond pulsed surface dielectric barrier discharge of positive polarity. First we compared the result of different grid configuration to investigate the influence of x and y direction grid spacing on the streamer propagation. The streamer propagation is sensitive to y grid spacing especially at the dielectric surface. The streamer propagation velocity can reach 0.2 cm/ns when the voltage magnitude is 12 kV. A narrow gap was found between the streamer and dielectric barrier, where the plasma density is several orders of magnitude smaller than the streamer region. Analyses on the ion transport in the gap and streamer regions show the different ion transport mechanisms in the two different region. In the gap region, the diffusion of electron toward the dielectric layer decreases the seed electron in the beginning of voltage pulse, resulting that ionization avalanche does not occur. The streamer region is not significantly affected by the diffusion flux toward the dielectric layer, so that ionization avalanche takes place and leads to dramatic increase of plasma density.

  10. Influence of dielectric barrier discharge treatment on mechanical and dyeing properties of wool

    Science.gov (United States)

    Rahul, NAVIK; Sameera, SHAFI; Md Miskatul, ALAM; Md Amjad, FAROOQ; Lina, LIN; Yingjie, CAI

    2018-06-01

    Physical and chemical properties of wool surface significantly affect the absorbency, rate of dye bath exhaustion and fixation of the industrial dyes. Hence, surface modification is a necessary operation prior to coloration process in wool wet processing industries. Plasma treatment is an effective alternative for physiochemical modification of wool surface. However, optimum processing parameters to get the expected modification are still under investigation, hence this technology is still under development in the wool wet processing industries. Therefore, in this paper, treatment parameters with the help of simple dielectric barrier discharge plasma reactor and air as a plasma gas, which could be a promising combination for treatment of wool substrate at industrial scale were schematically studied, and their influence on the water absorbency, mechanical, and dyeing properties of twill woven wool fabric samples are reported. It is expected that the results will assist to the wool coloration industries to improve the dyeing processes.

  11. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  12. Genistein-mediated inhibition of glycosaminoglycan synthesis, which corrects storage in cells of patients suffering from mucopolysaccharidoses, acts by influencing an epidermal growth factor-dependent pathway

    Directory of Open Access Journals (Sweden)

    Barańska Sylwia

    2009-03-01

    Full Text Available Abstract Background Mucopolysaccharidoses (MPS are inherited metabolic disorders caused by mutations leading to dysfunction of one of enzymes involved in degradation of glycosaminoglycans (GAGs. Due to their impaired degradation, GAGs accumulate in cells of patients, which results in dysfunction of tissues and organs. Substrate reduction therapy is one of potential treatment of these diseases. It was demonstrated previously that genistein (4', 5, 7-trihydroxyisoflavone inhibits synthesis and reduces levels of GAGs in cultures of fibroblasts of MPS patients. Recent pilot clinical study indicated that such a therapy may be effective in MPS III (Sanfilippo syndrome. Methods To learn on details of the molecular mechanism of genistein-mediated inhibition of GAG synthesis, efficiency of this process was studied by measuring of incorporation of labeled sulfate, storage of GAGs in lysosomes was estimated by using electron microscopic techniques, and efficiency of phosphorylation of epidermal growth factor (EGF receptor was determined by using an ELISA-based assay with fluorogenic substrates. Results Effects of genistein on inhibition of GAG synthesis and accumulation in fibroblasts from patients suffering from various MPS types were abolished in the presence of an excess of EGF, and were partially reversed by an increased concentration of genistein. No such effects were observed when an excess of 17β-estradiol was used instead of EGF. Moreover, EGF-mediated stimulation of phsophorylation of the EGF receptor was impaired in the presence of genistein in both wild-type and MPS fibroblasts. Conclusion The results presented in this report indicate that the mechanism of genistein-mediated inhibition of GAG synthesis operates through epidermal growth factor (EGF-dependent pathway.

  13. The Influence of Relative Humidity on Dielectric Barrier Discharge Plasma Flow Control Actuator Performance

    Science.gov (United States)

    Wicks, M.; Thomas, F. O.; Corke, T. C.; Patel, M.

    2012-11-01

    Dielectric barrier discharge (DBD) plasma actuators possess numerous advantages for flow control applications and have been the focus of several previous studies. Most work has been performed in relatively pristine laboratory settings. In actual flow control applications, however, it is essential to assess the impact of various environmental influences on actuator performance. As a first effort toward assessing a broad range of environmental effects on DBD actuator performance, the influence of relative humidity (RH) is considered. Actuator performance is quantified by force balance measurements of reactive thrust while RH is systematically varied via an ultrasonic humidifier. The DBD plasma actuator assembly, force balance, and ultrasonic humidifier are all contained inside a large, closed test chamber instrumented with RH and temperature sensors in order to accurately estimate the average RH at the actuator. Measurements of DBD actuator thrust as a function of RH for several different applied voltage regimes and dielectric materials and thicknesses are presented. Based on these results, several important design recommendations are made. This work was supported by Innovative Technology Applications Company (ITAC), LLC under a Small Business Innovation Research (SBIR) Phase II Contract No. N00014-11-C-0267 issued by the U.S. Department of the Navy.

  14. Influence of shock wave propagation on dielectric barrier discharge plasma actuator performance

    International Nuclear Information System (INIS)

    Erfani, Rasool; Zare-Behtash, Hossein; Kontis, Konstantinos

    2012-01-01

    Interest in plasma actuators as active flow control devices is growing rapidly due to their lack of mechanical parts, light weight and high response frequency. Although the flow induced by these actuators has received much attention, the effect that the external flow has on the performance of the actuator itself must also be considered, especially the influence of unsteady high-speed flows which are fast becoming a norm in the operating flight envelopes. The primary objective of this study is to examine the characteristics of a dielectric barrier discharge (DBD) plasma actuator when exposed to an unsteady flow generated by a shock tube. This type of flow, which is often used in different studies, contains a range of flow regimes from sudden pressure and density changes to relatively uniform high-speed flow regions. A small circular shock tube is employed along with the schlieren photography technique to visualize the flow. The voltage and current traces of the plasma actuator are monitored throughout, and using the well-established shock tube theory the change in the actuator characteristics are related to the physical processes which occur inside the shock tube. The results show that not only is the shear layer outside of the shock tube affected by the plasma but the passage of the shock front and high-speed flow behind it also greatly influences the properties of the plasma. (paper)

  15. [Effects of hypoxia inducible factor-1α on P311 and its influence on the migration of murine epidermal stem cells].

    Science.gov (United States)

    Xu, Z D; Li, H S; Wang, S; He, W F; Wu, J; Luo, G X

    2017-05-20

    Objective: To explore the effects of hypoxia inducible factor-1α (HIF-1α) on P311 and its influence on the migration of murine epidermal stem cells (ESCs) under hypoxia in vitro. Methods: Two kinds of murine ESCs were isolated and obtained from 15 neonatal wild-type C57BL/6J mice and 5 congeneric source P311 gene knock-out mice, respectively. The first passage of cells were used in the following experiments after morphologic observation and detection of expression of cell surface markers CD71 and CD49f with flow cytometer. (1) After cell scratch assay, according to the random number table (the same dividing method below), ESCs of P311 gene knock-out mice were divided into normoxia group (cells were cultured with complete medium in normoxic carbon dioxide incubator, and the subsequent normoxic treatments were the same) and hypoxia group (cells were cultured in hypoxic carbon dioxide incubator containing 1% oxygen, and the subsequent hypoxic treatments were the same), with 12 inserts in each group. ESCs of wild-type mice were divided into normoxia group, pure hypoxia group, dimethyl sulfoxide (DMSO) control group (2 μL DMSO solvent was added for 1 h of normoxia treatment before hypoxia treatment), HIF-1α inhibitor group (cells were treated with 11 μmol/L HIF-1 inhibitor of 2 μL under normoxia condition for 1 h before hypoxia treatment), HIF-1α stabilizer group (the cells were treated with 2 μmol/L FG-4592 of 2 μL under normoxia condition for 1 h before hypoxia treatment), with 12 inserts in each group. Three inserts of each time point in each group were adopted respectively to measure the residual width of scratch under inverted phase contrast microscope at post scratch hour (PSH) 0 (immediately), 12, 24, and 48. (2) After hypoxia treatment, the protein level of HIF-1α in ESCs of wild-type mice was detected by Western blotting at post hypoxia hour (PHH) 0, 12, 24, and 48. (3) ESCs of wild-type mice were divided into pure hypoxia group, DMSO control group

  16. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. The Influence of Creativity Level on Overcoming the Barriers of Teachers’ Professional Development

    OpenAIRE

    E. F. Zeer; L. S. Popova

    2012-01-01

    The paper summarizes the research findings concerning the influence of creativity on overcoming the barriers of teachers’ professional development. The re- search subject includes defining the interrelations between the creativity and profes- sional burn-out. The aim of the studies is to find out the influencing factors of creativ- ity eliminating the destructive trends of professional pedagogic activity. The methodology is based on the E. E. Simanyuk’s concept describing the de- structive te...

  18. Human epidermal growth factor receptor 2 testing in invasive breast cancer: should histological grade, type and oestrogen receptor status influence the decision to repeat testing?

    Science.gov (United States)

    Rakha, Emad A; Pigera, Marian; Shin, Sandra J; D'Alfonso, Timothy; Ellis, Ian O; Lee, Andrew H S

    2016-07-01

    The recent American Society of Clinical Oncology/College of American Pathologists guidelines for human epidermal growth factor receptor 2 (HER2) testing in breast cancer recommend repeat testing based on tumour grade, tumour type, and hormone receptor status. The aim of this study was to test the value of these criteria. HER2 status was concordant in the core biopsies and excision specimens in 392 of 400 invasive carcinomas. The major reasons for discordance were amplification around the cut-off for positivity and tumour heterogeneity. Of 116 grade 3 carcinomas that were HER2-negative in the core biopsy, four were HER2-positive in the excision specimen. Three of these four either showed borderline negative amplification in the core biopsy or were heterogeneous. None of the 55 grade 1 carcinomas were HER2-positive. Review of repeat testing of HER2 in routine practice suggested that it may also be of value for multifocal tumours and if recommended by the person assessing the in-situ hybridization. Mandatory repeat HER2 testing of grade 3 HER2-negative carcinomas is not appropriate. This is particularly true if repeat testing is performed after borderline negative amplification in the core biopsy or in HER2-negative heterogeneous carcinomas. © 2015 John Wiley & Sons Ltd.

  19. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  20. Therapeutic benefits of enhancing permeability barrier for atopic eczema

    Directory of Open Access Journals (Sweden)

    George Man

    2015-06-01

    Full Text Available The regulatory role of epidermal permeability barrier function in cutaneous inflammation has been well appreciated. While barrier disruption induces cutaneous inflammation, improvement of permeability barrier function alleviates inflammation. Studies have demonstrated that improvement of epidermal permeability barrier function not only prevents the development of atopic eczema, but also delays the relapse of these diseases. Moreover, enhancing the epidermal permeability barrier also alleviates atopic eczema. Furthermore, co-applications of barrier enhancing products with glucocorticoids can increase the therapeutic efficacy and reduce the adverse effects of glucocorticoids in the treatment of atopic eczema. Therefore, utilization of permeability barrier enhancing products alone or in combination with glucocorticoids could be a valuable approach in the treatment of atopic eczema. In this review, we discuss the benefits of improving the epidermal permeability barrier in the management of atopic eczema.

  1. Perceived barriers and facilitators to physical activity in men with prostate cancer: possible influence of androgen deprivation therapy.

    Science.gov (United States)

    Keogh, J W L; Patel, A; MacLeod, R D; Masters, J

    2014-03-01

    While physical activity is beneficial for men with prostate cancer, too few perform sufficient activity for such benefit. This study examined perceptions of men with prostate cancer of their barriers and facilitators to physical activity, and how androgen deprivation therapy (ADT) may influence these perceptions. Two focus groups were conducted, involving six ADT and eight non-ADT patients respectively. Data were transcribed verbatim and themes developed using a general inductive thematic approach. Facilitators to physical activity common to both groups of cancer survivors included clinician and spousal involvement, with pre-existing co-morbidities and increased age cited as barriers by both groups. The ADT subgroup cited personal involvement as a facilitator to physical activity, with fatigue, reduced motivation and a relative lack of specific advice from their clinician as additional barriers. The non-ADT subgroup had no additional facilitators to physical activity but cited time constraints as a barrier. These results highlight the important role that cancer clinicians and spouses play in promoting physical activity for men with prostate cancer and how ADT may influence their other facilitators and barriers. As physical activity is beneficial for prostate cancer survivors, especially those on ADT, cancer clinicians should regularly discuss physical activity with their patients. © 2013 John Wiley & Sons Ltd.

  2. Influence of Ni Catalyst Layer and TiN Diffusion Barrier on Carbon Nanotube Growth Rate

    Directory of Open Access Journals (Sweden)

    Mérel Philippe

    2010-01-01

    Full Text Available Abstract Dense, vertically aligned multiwall carbon nanotubes were synthesized on TiN electrode layers for infrared sensing applications. Microwave plasma-enhanced chemical vapor deposition and Ni catalyst were used for the nanotubes synthesis. The resultant nanotubes were characterized by SEM, AFM, and TEM. Since the length of the nanotubes influences sensor characteristics, we study in details the effects of changing Ni and TiN thickness on the physical properties of the nanotubes. In this paper, we report the observation of a threshold Ni thickness of about 4 nm, when the average CNT growth rate switches from an increasing to a decreasing function of increasing Ni thickness, for a process temperature of 700°C. This behavior is likely related to a transition in the growth mode from a predominantly “base growth” to that of a “tip growth.” For Ni layer greater than 9 nm the growth rate, as well as the CNT diameter, variations become insignificant. We have also observed that a TiN barrier layer appears to favor the growth of thinner CNTs compared to a SiO2 layer.

  3. Characterization of surface dielectric barrier discharge influenced by intermediate frequency for ozone production

    Science.gov (United States)

    Abdelaziz, Ayman A.; Ishijima, Tatsuo; Seto, Takafumi; Osawa, Naoki; Wedaa, Hassan; Otani, Yoshio

    2016-06-01

    The aim of this study is to investigate the effect of the intermediate frequency (1-10 kHz) of the sinusoidal driving voltage on the characteristics of a developed surface dielectric barrier discharge (SDBD)-based reactor having spikes on its discharge electrode. Moreover, its influence on the production of ozone and nitrogen oxide byproducts is evaluated. The results show that SDBD is operated in the filamentary mode at all the frequencies. Nevertheless, the pulses of the discharge current at high frequencies are much denser and have higher amplitudes than those at low frequencies. The analysis of the power consumed in the reactor shows that a small portion of the input power is dissipated in the dielectric material of SDBD source, whereas the major part of the power is consumed in the plasma discharge. The results of the ozone production show that higher frequencies have a slightly adverse effect on the ozone production at relatively high energy density values, where the ozone concentration is slightly decreased when the frequency is increased at the same energy density. The temperature of the discharge channels and gas is not a crucial factor for the decomposition of ozone in this reactor, while the results of the measurements of nitrogen oxides characteristics indicate that the formation of NO and NO2 has a significant adverse effect on the production efficiency of ozone due to their oxidation to another nitrogen oxides and their catalytic effect.

  4. Influence of Bondcoat Spray Process on Lifetime of Suspension Plasma-Sprayed Thermal Barrier Coatings

    Science.gov (United States)

    Gupta, M.; Markocsan, N.; Li, X.-H.; Östergren, L.

    2018-01-01

    Development of thermal barrier coatings (TBCs) manufactured by suspension plasma spraying (SPS) is of high commercial interest as SPS has been shown capable of producing highly porous columnar microstructures similar to the conventionally used electron beam-physical vapor deposition. However, lifetime of SPS coatings needs to be improved further to be used in commercial applications. The bondcoat microstructure as well as topcoat-bondcoat interface topography affects the TBC lifetime significantly. The objective of this work was to investigate the influence of different bondcoat deposition processes for SPS topcoats. In this work, a NiCoCrAlY bondcoat deposited by high velocity air fuel (HVAF) was compared to commercial vacuum plasma-sprayed NiCoCrAlY and PtAl diffusion bondcoats. All bondcoat variations were prepared with and without grit blasting the bondcoat surface. SPS was used to deposit the topcoats on all samples using the same spray parameters. Lifetime of these samples was examined by thermal cyclic fatigue testing. Isothermal heat treatment was performed to study bondcoat oxidation over time. The effect of bondcoat deposition process and interface topography on lifetime in each case has been discussed. The results show that HVAF could be a suitable process for bondcoat deposition in SPS TBCs.

  5. Characterization of surface dielectric barrier discharge influenced by intermediate frequency for ozone production

    International Nuclear Information System (INIS)

    Abdelaziz, Ayman A; Ishijima, Tatsuo; Seto, Takafumi; Otani, Yoshio; Osawa, Naoki; Wedaa, Hassan

    2016-01-01

    The aim of this study is to investigate the effect of the intermediate frequency (1–10 kHz) of the sinusoidal driving voltage on the characteristics of a developed surface dielectric barrier discharge (SDBD)-based reactor having spikes on its discharge electrode. Moreover, its influence on the production of ozone and nitrogen oxide byproducts is evaluated. The results show that SDBD is operated in the filamentary mode at all the frequencies. Nevertheless, the pulses of the discharge current at high frequencies are much denser and have higher amplitudes than those at low frequencies. The analysis of the power consumed in the reactor shows that a small portion of the input power is dissipated in the dielectric material of SDBD source, whereas the major part of the power is consumed in the plasma discharge. The results of the ozone production show that higher frequencies have a slightly adverse effect on the ozone production at relatively high energy density values, where the ozone concentration is slightly decreased when the frequency is increased at the same energy density. The temperature of the discharge channels and gas is not a crucial factor for the decomposition of ozone in this reactor, while the results of the measurements of nitrogen oxides characteristics indicate that the formation of NO and NO 2 has a significant adverse effect on the production efficiency of ozone due to their oxidation to another nitrogen oxides and their catalytic effect. (paper)

  6. Perceived barriers and motivating factors influencing student midwives' acceptance of rural postings in Ghana.

    Science.gov (United States)

    Lori, Jody R; Rominski, Sarah D; Gyakobo, Mawuli; Muriu, Eunice W; Kweku, Nakua E; Agyei-Baffour, Peter

    2012-07-24

    Research on the mal-distribution of health care workers has focused mainly on physicians and nurses. To meet the Millennium Development Goal Five and the reproductive needs of all women, it is predicted that an additional 334,000 midwives are needed. Despite the on-going efforts to increase this cadre of health workers there are still glaring gaps and inequities in distribution. The objectives of this study are to determine the perceived barriers and motivators influencing final year midwifery students' acceptance of rural postings in Ghana, West Africa. An exploratory qualitative study using focus group interviews as the data collection strategy was conducted in two of the largest midwifery training schools in Ghana. All final year midwifery students from the two training schools were invited to participate in the focus groups. A purposive sample of 49 final year midwifery students participated in 6 focus groups. All students were women. Average age was 23.2 years. Glaser's constant comparative method of analysis was used to identify patterns or themes from the data. Three themes were identified through a broad inductive process: 1) social amenities; 2) professional life; and 3) further education/career advancement. Together they create the overarching theme, quality of life, we use to describe the influences on midwifery students' decision to accept a rural posting following graduation. In countries where there are too few health workers, deployment of midwives to rural postings is a continuing challenge. Until more midwives are attracted to work in rural, remote areas health inequities will exist and the targeted reduction for maternal mortality will remain elusive.

  7. Perceived barriers and motivating factors influencing student midwives’ acceptance of rural postings in Ghana

    Directory of Open Access Journals (Sweden)

    Lori Jody R

    2012-07-01

    Full Text Available Abstract Background Research on the mal-distribution of health care workers has focused mainly on physicians and nurses. To meet the Millennium Development Goal Five and the reproductive needs of all women, it is predicted that an additional 334,000 midwives are needed. Despite the on-going efforts to increase this cadre of health workers there are still glaring gaps and inequities in distribution. The objectives of this study are to determine the perceived barriers and motivators influencing final year midwifery students’ acceptance of rural postings in Ghana, West Africa. Methods An exploratory qualitative study using focus group interviews as the data collection strategy was conducted in two of the largest midwifery training schools in Ghana. All final year midwifery students from the two training schools were invited to participate in the focus groups. A purposive sample of 49 final year midwifery students participated in 6 focus groups. All students were women. Average age was 23.2 years. Glaser’s constant comparative method of analysis was used to identify patterns or themes from the data. Results Three themes were identified through a broad inductive process: 1 social amenities; 2 professional life; and 3 further education/career advancement. Together they create the overarching theme, quality of life, we use to describe the influences on midwifery students’ decision to accept a rural posting following graduation. Conclusions In countries where there are too few health workers, deployment of midwives to rural postings is a continuing challenge. Until more midwives are attracted to work in rural, remote areas health inequities will exist and the targeted reduction for maternal mortality will remain elusive.

  8. Influence of grid resolution in fluid-model simulation of nanosecond dielectric barrier discharge plasma actuator

    Science.gov (United States)

    Hua, Weizhuo; Fukagata, Koji

    2018-04-01

    Two-dimensional numerical simulation of a surface dielectric barrier discharge (SDBD) plasma actuator, driven by a nanosecond voltage pulse, is conducted. A special focus is laid upon the influence of grid resolution on the computational result. It is found that the computational result is not very sensitive to the streamwise grid spacing, whereas the wall-normal grid spacing has a critical influence. In particular, the computed propagation velocity changes discontinuously around the wall-normal grid spacing about 2 μm due to a qualitative change of discharge structure. The present result suggests that a computational grid finer than that was used in most of previous studies is required to correctly capture the structure and dynamics of streamer: when a positive nanosecond voltage pulse is applied to the upper electrode, a streamer forms in the vicinity of upper electrode and propagates along the dielectric surface with a maximum propagation velocity of 2 × 108 cm/s, and a gap with low electron and ion density (i.e., plasma sheath) exists between the streamer and dielectric surface. Difference between the results obtained using the finer and the coarser grid is discussed in detail in terms of the electron transport at a position near the surface. When the finer grid is used, the low electron density near the surface is caused by the absence of ionization avalanche: in that region, the electrons generated by ionization is compensated by drift-diffusion flux. In contrast, when the coarser grid is used, underestimated drift-diffusion flux cannot compensate the electrons generated by ionization, and it leads to an incorrect increase of electron density.

  9. Guided bone regeneration : the influence of barrier membranes on bone grafts and bone defects

    NARCIS (Netherlands)

    Gielkens, Pepijn Frans Marie

    2008-01-01

    Guided bone regeneration (GBR) can be described as the use of a barrier membrane to provide a space available for new bone formation in a bony defect. The barrier membrane protects the defect from in-growth of soft tissue cells and allows bone progenitor cells to develop bone within a blood clot

  10. Influence of horizontally curved roadway section characteristics on motorcycle-to-barrier crash frequency.

    Science.gov (United States)

    Gabauer, Douglas J; Li, Xiaolong

    2015-04-01

    The purpose of this study was to investigate motorcycle-to-barrier crash frequency on horizontally curved roadway sections in Washington State using police-reported crash data linked with roadway data and augmented with barrier presence information. Data included 4915 horizontal curved roadway sections with 252 of these sections experiencing 329 motorcycle-to-barrier crashes between 2002 and 2011. Negative binomial regression was used to predict motorcycle-to-barrier crash frequency using horizontal curvature and other roadway characteristics. Based on the model results, the strongest predictor of crash frequency was found to be curve radius. This supports a motorcycle-to-barrier crash countermeasure placement criterion based, at the very least, on horizontal curve radius. With respect to the existing horizontal curve criterion of 820 feet or less, curves meeting this criterion were found to increase motorcycle-to-barrier crash frequency rate by a factor of 10 compared to curves not meeting this criterion. Other statistically significant predictors were curve length, traffic volume and the location of adjacent curves. Assuming curves of identical radius, the model results suggest that longer curves, those with higher traffic volume, and those that have no adjacent curved sections within 300 feet of either curve end would likely be better candidates for a motorcycle-to-barrier crash countermeasure. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  12. Influence of the voltage polarity on the properties of a nanosecond surface barrier discharge in atmospheric-pressure air

    International Nuclear Information System (INIS)

    Nudnova, M. M.; Aleksandrov, N. L.; Starikovskii, A. Yu.

    2010-01-01

    The properties of a surface barrier discharge in atmospheric-pressure air at different polarities of applied voltage were studied experimentally. The influence of the voltage polarity on the spatial structure of the discharge and the electric field in the discharge plasma was determined by means of spectroscopic measurements. It is found that the energy deposited in the discharge does not depend on the voltage polarity and that discharges of positive polarity are more homogenous and the electric fields in them are higher.

  13. Transport of Poly(n-butylcyano-acrylate) nanoparticles across the blood-brain barrier in vitro and their influence on barrier integrity

    Energy Technology Data Exchange (ETDEWEB)

    Rempe, Ralf; Cramer, Sandra; Huewel, Sabine [Department of Biochemistry, University of Muenster, Wilhelm-Klemm-Strasse 2, D-48149 Muenster (Germany); Galla, Hans-Joachim, E-mail: gallah@uni-muenster.de [Department of Biochemistry, University of Muenster, Wilhelm-Klemm-Strasse 2, D-48149 Muenster (Germany)

    2011-03-04

    Research highlights: {yields} Poly(n-butylcyano-acrylate) (PBCA) nanoparticles may be promising drug carriers. {yields} Influence of PBCA nanoparticles on the integrity of the blood-brain barrier in vitro. {yields} PBCA nanoparticles lead to a reversible disruption of the BBB in vitro after 4 h. {yields} Potential application as time-dependent and specific opener of the BBB. -- Abstract: In previous studies it was shown that polysorbate 80(PS80)-coated poly(n-butylcyano-acrylate) nanoparticles (PBCA-NP) are able to cross the blood-brain barrier (BBB) in vitro and in vivo. In order to explore and extend the potential applications of PBCA-NP as drug carriers, it is important to ascertain their effect on the BBB. The objective of the present study was to determine the effect of PS80-coated PBCA-NP on the BBB integrity of a porcine in vitro model. This has been investigated by monitoring the development of the transendothelial electrical resistance (TEER) after the addition of PBCA-NP employing impedance spectroscopy. Additionally, the integrity of the BBB in vitro was verified by measuring the passage of the reference substances {sup 14}C-sucrose and FITC-BSA after addition of PBCA-NP. In this study we will show that the application of PS80-coated PBCA-NP leads to a reversible disruption of the barrier after 4 h. The observed disruption of the barrier could also be confirmed by {sup 14}C-sucrose and FITC-BSA permeability studies. Comparing the TEER and permeability studies the lowest resistances and maximal values for permeabilities were both observed after 4 h. These results indicate that PS80-coated PBCA-NP might be suitable for the use as drug carriers. The reversible disruption also offers the possibility to use these particles as specific opener of the BBB. Instead of incorporating the therapeutic agents into the NP, the drugs may cross the BBB after being applied simultaneously with the PBCA-NP.

  14. The Influence of Visibility Conditions in Horizontal Road Curves on the Efficiency of Noise Protection Barriers

    Directory of Open Access Journals (Sweden)

    Džambas Tamara

    2013-12-01

    Full Text Available Ensuring sufficient visibility on planned roads by sight distance testing is an integral part of every project, but problems with visibility can emerge when noise barriers are erected on existing roads. Namely, in order to provide sufficient noise protection, high noise barriers are often placed at minimum distance from the carriageway edge, and additional visibility testing in most cases is not carried out.

  15. The Influence of Low-Barrier and Voluntary Service Policies on Survivor Empowerment in a Domestic Violence Housing Organization.

    Science.gov (United States)

    Nnawulezi, Nkiru; Godsay, Surbhi; Sullivan, Cris M; Marcus, Suzanne; Hacskaylo, Margaret

    2018-01-18

    The purpose of community-based domestic violence crisis housing programs (e.g., shelters) is to provide a safe setting that promotes empowerment for survivors of intimate partner violence. For staff to reach this aim, the program must have formal structures and processes in place to support such efforts. This study explored how low-barrier and voluntary service policies influenced staff practices and survivor empowerment. Low-barrier policies require that programs remove barriers that prevent survivors, particularly those who have mental health concerns and/or addictions, from being able to access services. A voluntary service policy states that survivors have the right to choose which services, if any, they would like to engage in during their stay at the program. Survivors' ability to stay at the housing program is not contingent on their participation in program services. This exploratory-sequential (QUAL→ quan) mixed-method study examined how low-barrier and voluntary service policies influenced staff behavior and how these behaviors then related to survivor empowerment. Qualitative results revealed that low-barrier and voluntary service were guided by cultural values of justice and access, encouraged survivor-centered practices among staff, and were believed to promote survivor autonomy. Quantitative results suggested that when survivors perceived they had a choice to engage in program services or meet with an advocate, their empowerment increased. This study has implications for domestic violence organizational practice and provides evidence about the contextual factors that support individual empowerment. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  16. Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

    Science.gov (United States)

    Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

    2016-01-01

    Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

  17. The protective influence of the locus ceruleus on the blood-brain barrier

    International Nuclear Information System (INIS)

    Harik, S.I.; McGunigal, T. Jr.

    1984-01-01

    The functions of the putative noradrenergic innervation of cerebral microvessels from the nucleus locus ceruleus remain ambiguous. Although most evidence indicates that such innervation does not have a major role in the control of cerebral blood flow, there are increasing indications that it modulates transport and permeability functions of the blood-brain barrier. In this study we investigated the effect of unilateral chemical lesioning of the locus ceruleus on the leakage of radioiodinated human serum albumin across the blood-brain barrier. Experiments were performed in awake and restrained rats under steady-state conditions and during drug-induced systemic arterial hypertension, and in anesthetized and paralyzed rats during bicuculline-induced seizures. Both hypertension and seizures are known to be associated with increased leakage of macromolecules across the blood-brain barrier. Albumin leakage into norepinephrine-depleted forebrain structures ipsilateral to the locus ceruleus lesion was compared with that of the contralateral side. There were no side-to-side differences in blood-brain barrier permeability to albumin under steady-state conditions, the stress of restraint, or angiotensin-induced hypertension, or after isoproterenol administration. Norepinephrine-induced hypertension and seizures, however, caused significant increases in albumin leakage into forebrain structures ipsilateral to the lesion. These results suggest that noradrenergic innervation of cerebral microvessels from the locus ceruleus helps preserve the integrity of the blood-brain barrier during pathophysiological states associated with hypertension and increased circulating catecholamines

  18. Influence of sunflower seed oil or baby lotion on the skin barrier function of newborns: A pilot study.

    Science.gov (United States)

    Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie

    2017-12-01

    Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.

  19. Influence of the potential well and the potential barrier on the density distribution of confined-model fluids

    CERN Document Server

    Lee, B H; Lee, C H; Seong Baek Seok

    2000-01-01

    A density functional perturbative approximation, which is based on the density functional expansion of the one-particle direct correlation function of model fluids with respect to the bulk density, has been employed to investigate the influence of the potential well and the potential barrier on the density behavior of confined-model fluids. The mean spherical approximation has been used to calculate the two-particle direct correlation function of the model fluids. At lower densities, the density distributions are strongly affected by the barrier height and the well depth of the model potential, the contribution from the short-range repulsive part being especially important. However, the effects of the barrier height and the well depth of the model potential decrease with increasing bulk density. The calculated results also show that in the region where the effect of the wall-fluid interaction is relatively weak, the square-barrier part of the model potential leads to a nonuniformity in the density distributio...

  20. Influence of gel/LED-laser application on cervical microleakage of two barrier materials used for endodontically treated teeth whitening

    Science.gov (United States)

    Marchesan, Melissa Andréia; Barros, Felipe; Porto, Saulo; Zaitter, Suellen; Brugnera, Aldo, Jr.; Sousa-Neto, Manoel D.

    2007-02-01

    This study evaluated ex vivo the influence of the number of gel/LED-laser applications/activations on cervical microleakage of two different barrier materials used for protection during whitening of endodontically treated teeth. Eighty-four canines were instrumented and obturated with epoxy resin sealer. The seal was removed 2 mm beyond the cemento-enamel junction for barrier placement and the teeth were divided into two groups of 40 teeth each: G1, zinc phosphate cement; G2, glass ionomer cement. The two groups were subdivided into 4 subgroups (n=10 each): I) no gel or LED-laser application; II) one gel application and two LED-laser activations; III) two gel applications and four LED-laser activations; IV) three gel applications and six LED-laser activations. The teeth were immersed in India ink for 7 days, decalcified and cleared. Cervical microleakage was quantified with a measurement microscope. Statistical analysis showed that zinc phosphate caused significantly lower microleakage than glass ionomer cement (presented microleakage in all subgroups). However, after two (p<0.01) and three (p<0.001) applications of gel, there was statistially significant microleakage in zinc phosphate barriers. Based on the present results, it can be concluded that cervical barriers with zinc phosphate cement show less cervical microleakage and that two or more applications/activations of gel/LED-laser significantly increase microleakage.

  1. Influences of engineered barrier systems on low-level radioactive waste disposal

    Energy Technology Data Exchange (ETDEWEB)

    Buckley, L. P.

    1987-09-15

    There are major differences between the current practices of shallow land burial and alternative concepts for the disposal of low-level radioactive wastes. Additional protection provided with engineered barrier systems can overcome major concerns the public has with shallow land burial: subsidence; percolating ground waters; radionuclide migration; and the vulnerability of shallow trenches to intrusion. The presence of a variety of engineered barriers to restrict water movement, retain radionuclides and to prevent plant animal or human intrusion leads to significant changes to input data for performance assessment models. Several programs which are underway to more accurately predict the long-term performance of engineered barriers for low-level waste will be described.

  2. Influences of engineered barrier systems on low-level radioactive waste disposal

    International Nuclear Information System (INIS)

    Buckley, L.P.

    1987-09-01

    There are major differences between the current practices of shallow land burial and alternative concepts for the disposal of low-level radioactive wastes. Additional protection provided with engineered barrier systems can overcome major concerns the public has with shallow land burial: subsidence; percolating ground waters; radionuclide migration; and the vulnerability of shallow trenches to intrusion. The presence of a variety of engineered barriers to restrict water movement, retain radionuclides and to prevent plant animal or human intrusion leads to significant changes to input data for performance assessment models. Several programs which are underway to more accurately predict the long-term performance of engineered barriers for low-level waste will be described

  3. Physical activity practice among children and adolescents with visual impairment--influence of parental support and perceived barriers.

    Science.gov (United States)

    Greguol, Márcia; Gobbi, Erica; Carraro, Attilio

    2015-01-01

    To analyze the practice of physical activity among children and adolescents with visual impairments (VI), regarding the possible influence of parental support and perceived barriers. Twenty-two young people with VIs (10 + 2.74 years old) and one of each of their parents were evaluated. They responded to the Physical Activity Questionnaire for Older Children (PAQ-C), Baecke Questionnaire, the Parental Support Scale and a questionnaire about perceived barriers to physical activity. The independent samples t-test, pearson correlation test and chi-square test were performed. Blind young people showed lower physical activity levels. There were significant correlations both between parents' physical activity and the support offered to children and between the PAQ-C results and the importance given by young people to physical activity, but only for those aged between 8 and 10 years old. The main perceived barriers were lack of security, motivation, professional training and information about available physical activity programs. The influence of parental support seems to be an important factor in the adoption of a physically active lifestyle for young people with VI. Parents and children should have more information about the benefits and opportunities of physical activity. Implications for Rehabilitation Young people with visual impairment should be encouraged by parents to practice physical activity. More information should be provided on the benefits of physical activity to both parents and children. Professional training should be available to help support this group become more active.

  4. Indispensable factors influence the quasi-bound levels of biased multi-barrier quantum well structures

    International Nuclear Information System (INIS)

    Wang Hongmei; Xu Huaizhe; Zhang Yafei

    2005-01-01

    A few of mistakes made in transfer matrix method of Airy functions in previous literatures have been identified and corrected in this work. By using our improved transfer matrix method of Airy functions, quasi-bound level dependence upon carrier effective masses, bias, well width, barrier width and height has been investigated systematically for several biased/unbiased double/triple-barrier quantum well structures. Its validity and accuracy has been proved by comparisons with other currently used techniques. It is shown that our improved transfer matrix method of Airy functions is more promising for evaluating and designing intra-band transition far-infrared detectors and quantum cascade lasers

  5. Influence of thermal barrier effect of grain boundaries on bulk cascades in alpha-zirconium revealed by molecular dynamics simulation

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Yanan; Lai, Wensheng, E-mail: wslai@tsinghua.edu.cn

    2016-03-15

    The effect of grain boundaries (GBs) on bulk cascades in nano-structured alpha-zirconium has been studied by molecular dynamics (MD) simulations. It turns out that the existence of GBs increases the defect productivity in grains, suggesting that the GBs may act as a thermal barrier and postpone the annihilation of defects within grains. Moreover, it is found that the thermal barrier effect of GBs facilitates the shift of symmetric tilt GBs to the grain with higher temperature, and the smaller the tilt angle is, the easier the boundary shift will be. Thus, the influence of GBs on radiation damage in the nano-structured materials comes from the competition between damage increase in grains and defect annihilation at GBs.

  6. Influence of ultrasonic irradiation on ozone generation in a dielectric barrier discharge

    DEFF Research Database (Denmark)

    Kusano, Yukihiro; Drews, J.; Leipold, Frank

    2012-01-01

    An atmospheric pressure dielectric barrier discharge (DBD) was generated in an N2/O2 gas mixture at room temperature with and without ultrasonic irradiation to investigate ozone production. Powerful ultrasonic irradiation with the sound pressure level of approximately 150 dB into the DBD can...

  7. Influence of ultrasonic irradiation on ozone generation in a dielectric barrier discharge

    International Nuclear Information System (INIS)

    Kusano, Y; Drews, J; Leipold, F; Fateev, A; Bardenshtein, A; Krebs, N

    2012-01-01

    An atmospheric pressure dielectric barrier discharge (DBD) was generated in an N 2 /O 2 gas mixture at room temperature with and without ultrasonic irradiation to investigate ozone production. Powerful ultrasonic irradiation with the sound pressure level of approximately 150 dB into the DBD can enhance ozone production especially when the DBD was driven at a frequency of 15 kHz.

  8. Barriers and enablers that influence sustainable interprofessional education: a literature review.

    Science.gov (United States)

    Lawlis, Tanya Rechael; Anson, Judith; Greenfield, David

    2014-07-01

    The effective incorporation of interprofessional education (IPE) within health professional curricula requires the synchronised and systematic collaboration between and within the various stakeholders. Higher education institutions, as primary health education providers, have the capacity to advocate and facilitate this collaboration. However, due to the diversity of stakeholders, facilitating the pedagogical change can be challenging and complex, and brings a degree of uncertainty and resistance. This review, through an analysis of the barriers and enablers investigates the involvement of stakeholders in higher education IPE through three primary stakeholder levels: Government and Professional, Institutional and Individual. A review of eight primary databases using 21 search terms resulted in 40 papers for review. While the barriers to IPE are widely reported within the higher education IPE literature, little is documented about the enablers of IPE. Similarly, the specific identification and importance of enablers for IPE sustainability and the dual nature of some barriers and enablers have not been previously reported. An analysis of the barriers and enablers of IPE across the different stakeholder levels reveals five key "fundamental elements" critical to achieving sustainable IPE in higher education curricula.

  9. Influence of Closing Storm Surge Barrier on Extreme Water Levels and Water Exchange; The Limfjord, Denmark

    DEFF Research Database (Denmark)

    Nørgaard, Jørgen Quvang Harck; Bentzen, Thomas Ruby; Larsen, Torben

    2014-01-01

    the increased risk of flooding in the estuary has revitalized the discussion whether this connection should be closed. In this paper, it is shown by numerical simulation that the establishment of a storm surge barrier across Thyborøn Channel can significantly reduce the peak water levels in the central...

  10. Assessment of the Developmental Toxicity of Epidermal Growth ...

    African Journals Online (AJOL)

    Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

  11. Investigating the influence on safety of retrofitting Italian motorways with barriers meeting a new EU standard.

    Science.gov (United States)

    Cafiso, Salvatore; D'Agostino, Carmelo; Persaud, Bhagwant

    2017-04-03

    A new European Union (EU) regulation for safety barriers, which is based on performance, has encouraged road agencies to perform an upgrade of old barriers, with the expectation that there will be safety benefits at the retrofitted sites. The new class of barriers was designed and installed in compliance with the 1998 (European Norm) EN 1317 standards for road restraint systems, which lays down common requirements for the testing and certification of road restraint systems in all countries of the European Committee for Standardization (CEN). Both the older and new barriers are made of steel and are installed in such a way as to avoid vehicle intrusion, but the older ones are thought to be only effective at low speeds and large angles of impact. The new standard seeks to remedy this by providing better protection at higher speeds. This article seeks to quantify the effect on the frequency of fatal and injury crashes of retrofitting motorways with barriers meeting the new standards. The estimation of the crash modification was carried out by performing an empirical Bayes before-after analysis based on data from the A18 Messina-Catania motorway in Italy. The methodology has the great advantage to account for the regression to the mean effects. Besides, to account for time trend effects and dispersion of crash data, a modified calibration methodology of safety performance was used. This study, based on data collected on 76 km of motorway in the period 2000-2012, derived Crash Modification Factor point estimates that indicate reductions of 72% for run-off-road fatal and injury crashes and 38% in total fatal and injury crashes that could be expected by upgrading an old safety barrier by complying with new EU 1317 standards. The estimated benefit-cost ratio of 5.57 for total crashes indicates that the treatment is cost effective. The magnitude of this benefit indicates that the retrofits are cost-effective even for total crashes and should continue in any European country

  12. Influence of Asymmetric Contact Form on Contact Resistance and Schottky Barrier, and Corresponding Applications of Diode.

    Science.gov (United States)

    Zhao, Yudan; Xiao, Xiaoyang; Huo, Yujia; Wang, Yingcheng; Zhang, Tianfu; Jiang, Kaili; Wang, Jiaping; Fan, Shoushan; Li, Qunqing

    2017-06-07

    We have fabricated carbon nanotube and MoS 2 field-effect transistors with asymmetric contact forms of source-drain electrodes, from which we found the current directionality of the devices and different contact resistances under the two current directions. By designing various structures, we can conclude that the asymmetric electrical performance was caused by the difference in the effective Schottky barrier height (Φ SB ) caused by the different contact forms. A detailed temperature-dependent study was used to extract and compare the Φ SB for both contact forms of CNT and MoS 2 devices; we found that the Φ SB for the metal-on-semiconductor form was much lower than that of the semiconductor-on-metal form and is suitable for all p-type, n-type, or ambipolar semiconductors. This conclusion is meaningful with respect to the design and application of nanomaterial electronic devices. Additionally, using the difference in barrier height caused by the contact forms, we have also proposed and fabricated Schottky barrier diodes with a current ratio up to 10 4 ; rectifying circuits consisting of these diodes were able to work in a wide frequency range. This design avoided the use of complex chemical doping or heterojunction methods to achieve fundamental diodes that are relatively simple and use only a single material; these may be suitable for future application in nanoelectronic radio frequency or integrated circuits.

  13. Situated influences on perceived barriers to health behavior change: cultural identity and context in Kazakhstan.

    Science.gov (United States)

    Craig, Brett J; Kapysheva, Aizhan

    2017-02-23

    The objective of this study was to identify the perceived barriers to lifestyle changes citizens of Kazakhstan suffering from cardiovascular disease and type II diabetes were experiencing. 14 focus groups were conducted with patients across two regions of Kazakhstan. Topics of discussion included accessing medical care, communicating with health care providers, and following doctor's recommendations. The text of the discussions were analysed for trends and themes across the different groups. Patients identified a series of external and internal barriers to lifestyle changes, including the environment, a dependency on health care providers, a health care system they feel powerless to change, and a low level of self-efficacy. Most notable, however, was a constructed ethnic identity whose boundaries included unhealthy behaviors, specifically diet and untimely access of health care. This identity both was blamed as a cause for the patient's condition and seen as an unchangeable barrier to health behavior change. Current provider efforts to encourage lifestyle changes to manage disease are not taking into account the broader issue of ethnic identity, namely negotiating a fragile and previously suppressed identity that mostly exists alongside other ethnicities. Therefore, maintaining distinctiveness may be a greater need than modifying health behaviors. Efforts towards healthier lifestyles for the public must include not only messages regarding health but also constructions of a Kazakh identity that allows for such lifestyles to fit within the identity framework.

  14. Influence of Trash-Barriering on Operation of Pumping Station with Wet-Pits

    Directory of Open Access Journals (Sweden)

    Baoyun Qiu

    2014-04-01

    Full Text Available Trash racks are set before inlet sumps of a pumping station with wet-pits in order to block trash. The flow fields before and behind the trash rack were numerically simulated and flow fields in the inlet sump were calculated using the simulated velocity distribution of the section behind the trash rack as the inlet boundary condition. Local head loss of trash-barriering increases with the increase of blockage ratio of the trash rack. When waterweeds block upper part of the trash rack, flow pattern behind the trash rack will be extremely turbulent, flow velocity of lower part of inlet section of inlet sump will increase, flow velocity of the upper part will decrease, and even backflow appears, which will deteriorate the flow pattern and increase head loss in the inlet sump. Trash-barriering has little effect on velocity distribution of impeller inlet section. Trash-barriering will not only increase head and power of the pump but also decrease the flow. For the example of the pumping station: when blockage ratios of the trash racks are 0.3, 0.5, and 0.7, operating cost will increase by 13%~43% than that of without trash racks. Therefore, the trash rack should be cleaned up timely.

  15. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation; Role des melanocytes dans l'unite epidermique de melanisation reconstruite ex-vivo apres une irradiation UV aigue

    Energy Technology Data Exchange (ETDEWEB)

    Cario-Andre, M

    2000-11-15

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  16. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation; Role des melanocytes dans l'unite epidermique de melanisation reconstruite ex-vivo apres une irradiation UV aigue

    Energy Technology Data Exchange (ETDEWEB)

    Cario-Andre, M

    2000-11-15

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  17. Barriers, facilitators and attitudes influencing health promotion activities in general practice: an explorative pilot study

    Directory of Open Access Journals (Sweden)

    Geense Wytske W

    2013-02-01

    Full Text Available Abstract Background The number of chronically ill patients increases every year. This is partly due to an unhealthy lifestyle. However, the frequency and quality of (evidence-based health promotion activities conducted by Dutch general practitioners (GPs and practice nurses (PNs are limited. The aim of this pilot study was to explore which lifestyle interventions Dutch GPs and PNs carry out in primary care, which barriers and facilitators can be identified and what main topics are with respect to attitudes towards health promoting activities. These topic areas will be identified for a future, larger scale study. Method This qualitative study consisted of 25 semi-structured interviews with sixteen GPs and nine PNs. ATLAS.ti was used to analyse the transcripts of the interviews. Results All GPs and PNs said they discuss lifestyle with their patients. Next to this, GPs and PNs counsel patients, and/or refer them to other disciplines. Only few said they refer patients to specific lifestyle programs or interventions in their own practice or in the neighbourhood. Several barriers and facilitators were identified. The main topics as barriers are: a lack of patients’ motivation to make lifestyle changes, insufficient reimbursement, a lack of proven effectiveness of interventions and a lack of overview of health promoting programs in their neighbourhood. The most cited facilitators are availability of a PN, collaboration with other disciplines and availability of interventions in their own practice. With respect to attitudes, six different types of GPs were identified reflecting the main topics that relate to attitudes, varying from ‘ignorer’ to ‘nurturer’. The topics relating to PNs attitudes towards health promotion activities, were almost unanimously positive. Conclusion GPs and PNs all say they discuss lifestyle issues with their patients, but the health promotion activities that are organized in their practice vary. Main topics that hinder

  18. Influence of Duty Cycle on Ozone Generation and Discharge Using Volume Dielectric Barrier Discharge

    Czech Academy of Sciences Publication Activity Database

    Wei, L.S.; Pongrác, Branislav; Zhang, Y.F.; Liang, X.; Prukner, Václav; Šimek, Milan

    2018-01-01

    Roč. 38, č. 2 (2018), s. 355-364 ISSN 0272-4324 R&D Projects: GA ČR(CZ) GA15-04023S Institutional support: RVO:61389021 Keywords : Ozone generation * Volume dielectric barrier discharge * Electrical characteristics * Duty cycle * Adjustable ozone concentration Subject RIV: BL - Plasma and Gas Discharge Physics OBOR OECD: Fluids and plasma physics (including surface physics) Impact factor: 2.355, year: 2016 https://link.springer.com/article/10.1007%2Fs11090-017-9866-y

  19. The influence of fast neutron irradiation on the noise properties of silicon surface-barrier detectors

    International Nuclear Information System (INIS)

    Dabrowski, W.; Korbel, K.

    1988-01-01

    The susceptibility to the fast neutron irradiation of silicon surface-barrier detectors has been investigated. It was shown that the 1/f-noise decreases substantially with increasing fluence in the range from 10 10 n/cm 2 to 10 11 n/cm 2 . The deterioration of the detector performance is caused mainly by the positively-charged defects induced by the radiation. The critical value of the neutron fluence, at which the detector performance begins to be worsened was also determined. 5 refs., 5 figs. (author)

  20. An integrative review of facilitators and barriers influencing collaboration and teamwork between general practitioners and nurses working in general practice.

    Science.gov (United States)

    McInnes, Susan; Peters, Kath; Bonney, Andrew; Halcomb, Elizabeth

    2015-09-01

    To identify facilitators and barriers influencing collaboration and teamwork between general practitioners and nurses working in general (family) practice. Internationally, a shortage of doctors entering and remaining in general practice and an increasing burden of chronic disease has diversified the nurse's role in this setting. Despite a well-established general practice nursing workforce, little attention has been paid to the ways doctors and nurses collaborate in this setting. Integrative literature review. CINAHL, Scopus, Web of Life, Cochrane Library, Joanna Briggs Institute Library of Systematic Reviews and Trove (dissertation and theses) were searched for papers published between 2000 and May 2014. This review was informed by the approach of Whittemore and Knafl (2005). All included papers were assessed for methodological quality. Findings were extracted, critically examined and grouped into themes. Eleven papers met the inclusion criteria. Thematic analysis revealed three themes common to the facilitators of and barriers to collaboration and teamwork between GPs in general practice: (1) roles and responsibilities; (2) respect, trust and communication; and (3) hierarchy, education and liability. This integrative review has provided insight into issues around role definition, communication and organizational constraints which influence the way nurses and general practitioners collaborate in a team environment. Future research should investigate in more detail the ways doctors and nurses work together in general practice and the impact of collaboration on nursing leadership and staff retention. © 2015 John Wiley & Sons Ltd.

  1. Influence of ionizing radiation and use of plasticizers on the mechanical properties and barrier properties of biodegradable films

    International Nuclear Information System (INIS)

    Ponce, Patricia; Parra, Duclerc F.; Carr, Laura G.; Sato, Juliana S.; Lugao, Ademar B.

    2005-01-01

    This work reports the influence of radiation and plasticizers on the barrier properties [water vapour permeability (WVP)] and mechanical properties (tensile strength and elongation) of edible films made of starch. These films were prepared with 4 g of starch/100 mL of water; 2-10 g polyethylene glycol (PEG)/100 g starch; and at natural pH. Tensile strength and percentage elongation were measured using a Mechanical Universal Testing Machine Instron 4400R and the water vapour permeability was determined according to ASTM E96-80 (ASTM, 1989). The mechanical properties of starch films are influenced by the plasticizer concentration. An increase in PEG content showed a considerable increase in elongation percentage and a decrease in the tensile strength of the films, also increase the permeability of the films in water. After irradiation, the barrier properties [water vapour permeability (WVP)] and mechanical properties (tensile strength and elongation) of the films were improved due to chemical reactions among polymer molecules. The films were irradiated at room temperature with gamma radiation. Irradiated starch cassava films with polyethylene glycol (PEG) as plasticizer have good flexibility and low water permeability, which indicate potential application as edible films (author)

  2. Volatile anesthetics influence blood-brain barrier integrity by modulation of tight junction protein expression in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Serge C Thal

    Full Text Available Disruption of the blood-brain barrier (BBB results in cerebral edema formation, which is a major cause for high mortality after traumatic brain injury (TBI. As anesthetic care is mandatory in patients suffering from severe TBI it may be important to elucidate the effect of different anesthetics on cerebral edema formation. Tight junction proteins (TJ such as zonula occludens-1 (ZO-1 and claudin-5 (cl5 play a central role for BBB stability. First, the influence of the volatile anesthetics sevoflurane and isoflurane on in-vitro BBB integrity was investigated by quantification of the electrical resistance (TEER in murine brain endothelial monolayers and neurovascular co-cultures of the BBB. Secondly brain edema and TJ expression of ZO-1 and cl5 were measured in-vivo after exposure towards volatile anesthetics in native mice and after controlled cortical impact (CCI. In in-vitro endothelial monocultures, both anesthetics significantly reduced TEER within 24 hours after exposure. In BBB co-cultures mimicking the neurovascular unit (NVU volatile anesthetics had no impact on TEER. In healthy mice, anesthesia did not influence brain water content and TJ expression, while 24 hours after CCI brain water content increased significantly stronger with isoflurane compared to sevoflurane. In line with the brain edema data, ZO-1 expression was significantly higher in sevoflurane compared to isoflurane exposed CCI animals. Immunohistochemical analyses revealed disruption of ZO-1 at the cerebrovascular level, while cl5 was less affected in the pericontusional area. The study demonstrates that anesthetics influence brain edema formation after experimental TBI. This effect may be attributed to modulation of BBB permeability by differential TJ protein expression. Therefore, selection of anesthetics may influence the barrier function and introduce a strong bias in experimental research on pathophysiology of BBB dysfunction. Future research is required to investigate

  3. Epidermal growth factor in alkali-burned corneal epithelial wound healing.

    Science.gov (United States)

    Singh, G; Foster, C S

    1987-06-15

    We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

  4. Influence of gas discharge parameters on emissions from a dielectric barrier discharge excited argon excimer lamp

    Directory of Open Access Journals (Sweden)

    Mike Collier

    2011-11-01

    Full Text Available A dielectric barrier discharge excited neutral argon (Ar I excimer lamp has been developed and characterised. The aim of this study was to develop an excimer lamp operating at atmospheric pressure that can replace mercury lamps and vacuum equipment used in the sterilisation of medical equipment and in the food industry. The effects of discharge gas pressure, flow rate, excitation frequency and pulse width on the intensity of the Ar I vacuum ultraviolet (VUV emission at 126 nm and near infrared (NIR lines at 750.4 nm and 811.5 nm have been investigated. These three lines were chosen as they represent emissions resulting from de-excitation of excimer states that emit energetic photons with an energy of 9.8 eV. We observed that the intensity of the VUV Ar2* excimer emission at 126 nm increased with increasing gas pressure, but decreased with increasing excitation pulse frequency and pulse width. In contrast, the intensities of the NIR lines decreased with increasing gas pressure and increased with increasing pulse frequency and pulse width. We have demonstrated that energetic VUV photons of 9.8 eV can be efficiently generated in a dielectric barrier discharge in Ar.

  5. Influence of oxygen concentration on ethylene removal using dielectric barrier discharge

    Science.gov (United States)

    Takahashi, Katsuyuki; Motodate, Takuma; Takaki, Koichi; Koide, Shoji

    2018-01-01

    Ethylene gas is decomposed using a dielectric barrier discharge plasma reactor for long-period preservation of fruits and vegetables. The oxygen concentration in ambient gas is varied from 2 to 20% to simulate the fruit and vegetable transport container. The experimental results show that the efficiency of ethylene gas decomposition increases with decreasing oxygen concentration. The reactions of ethylene molecules with ozone are analyzed by Fourier transform infrared spectrometry. The analysis results show that the oxidization process by ozone is later than that by oxygen atoms. The amount of oxygen atoms that contribute to ethylene removal increases with decreasing oxygen concentration because the reaction between oxygen radicals and oxygen molecules is suppressed at low oxygen concentrations. Ozone is completely removed and the energy efficiency of C2H4 removal is increased using manganese dioxide as a catalyst.

  6. The Analysis of Low Noise Protection Barriers Influence on Tram Traffic Noise Levels

    Directory of Open Access Journals (Sweden)

    Ahac Maja

    2013-07-01

    Full Text Available The paper describes the analysis of tram traffic noise situation in residential areas in the vicinity of Drzic Avenue, one of the major routes between the northern and southern part of the Croatian capital city Zagreb, and the effect of low barriers placed by the tracks on tram noise mitigation. In order to evaluate the effect of planned protection measure, noise models were produced and verified with short-term field measurements. Calculations were conducted by means of noise prediction software, using European interim noise prediction method and 3D model of analyzed area. Finally, the results of noise calculations for existing tram traffic situation and planned measure of protection are presented on noise maps.

  7. Influence of the male ejaculate on post-mating prezygotic barriers in field crickets.

    Directory of Open Access Journals (Sweden)

    Erica L Larson

    Full Text Available Post-copulatory interactions between males and females involve highly coordinated, complex traits that are often rapidly evolving and divergent between species. Failure to produce and deposit eggs may be a common post-mating prezygotic barrier, yet little is known about what prevents the induction of egg-laying between species. The field crickets, Gryllus firmus and G. pennsylvanicus are isolated by a one-way reproductive incompatibility; G. pennsylvanicus males fail to fertilize G. firmus eggs or to induce normal egg-laying in G. firmus females. We use experimental crosses to elucidate the role of accessory gland-derived vs. testis-derived components of the G. firmus male ejaculate on egg-laying in conspecific and heterospecific crosses. Using surgical castrations to create 'spermless' males that transfer only seminal fluid proteins (SFPs we test whether G. firmus male SFPs can induce egg-laying in conspecific crosses and rescue egg-laying in crosses between G. pennsylvanicus males and G. firmus females. We find G. firmus SFPs induce only a small short-term egg-laying response and that SFPs alone cannot explain the normal induction of egg-laying. Gryllus firmus SFPs also do not rescue the heterospecific cross. Testis-derived components, such as sperm or prostaglandins, most likely stimulate egg-laying or act as transporters for SFPs to targets in the female reproductive tract. These results highlight the utility of experimental approaches for investigating the phenotypes that act as barriers between species and suggest that future work on the molecular basis of the one-way incompatibility between G. firmus and G. pennsylvanicus should focus on divergent testis-derived compounds or proteins in addition to SFPs.

  8. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  9. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  10. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  11. A homolog of Drosophila grainy head is essential for epidermal integrity in mice.

    Science.gov (United States)

    Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M

    2005-04-15

    The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.

  12. Public Health Agency Accreditation Among Rural Local Health Departments: Influencers and Barriers.

    Science.gov (United States)

    Beatty, Kate E; Erwin, Paul Campbell; Brownson, Ross C; Meit, Michael; Fey, James

    Health department accreditation is a crucial strategy for strengthening public health infrastructure. The purpose of this study was to investigate local health department (LHD) characteristics that are associated with accreditation-seeking behavior. This study sought to ascertain the effects of rurality on the likelihood of seeking accreditation through the Public Health Accreditation Board (PHAB). Cross-sectional study using secondary data from the 2013 National Association of County & City Health Officials (NACCHO) National Profile of Local Health Departments Study (Profile Study). United States. LHDs (n = 490) that responded to the 2013 NACCHO Profile Survey. LHDs decision to seek PHAB accreditation. Significantly more accreditation-seeking LHDs were located in urban areas (87.0%) than in micropolition (8.9%) or rural areas (4.1%) (P < .001). LHDs residing in urban communities were 16.6 times (95% confidence interval [CI], 5.3-52.3) and micropolitan LHDs were 3.4 times (95% CI, 1.1-11.3) more likely to seek PHAB accreditation than rural LHDs (RLHDs). LHDs that had completed an agency-wide strategic plan were 8.5 times (95% CI, 4.0-17.9), LHDs with a local board of health were 3.3 times (95% CI, 1.5-7.0), and LHDs governed by their state health department were 12.9 times (95% CI, 3.3-50.0) more likely to seek accreditation. The most commonly cited barrier was time and effort required for accreditation application exceeded benefits (73.5%). The strongest predictor for seeking PHAB accreditation was serving an urban jurisdiction. Micropolitan LHDs were more likely to seek accreditation than smaller RLHDs, which are typically understaffed and underfunded. Major barriers identified by the RLHDs included fees being too high and the time and effort needed for accreditation exceeded their perceived benefits. RLHDs will need additional financial and technical support to achieve accreditation. Even with additional funds, clear messaging of the benefits of accreditation

  13. Assessing the Motivators and Barriers Influencing Undergraduate Students' Choices to Participate in International Experiences

    Science.gov (United States)

    Bunch, J.C.; Lamm, Alexa J.; Israel, Glenn D.; Edwards, M. Craig

    2013-01-01

    International experiences (IEs) are becoming one of the most critical elements of an undergraduate student's education to address the knowledge needed to become globally competent. However, student enrollment in IEs has been limited. Agricultural educators can more easily influence students' decisions regarding participation in IEs if they…

  14. Influence of graphene oxide on mechanical, morphological, barrier, and electrical properties of polymer membranes

    Directory of Open Access Journals (Sweden)

    Ali Ammar

    2016-03-01

    Full Text Available This paper expresses a short review of research on the effects of graphene oxide (GO as a nanocomposite element on polymer morphology and resulting property modifications including mechanical, barrier, and electrical conductivity. The effects on mechanical enhancement related to stress measurements in particular are a focus of this review. To first order, varying levels of aggregation of GO in different polymer matrices as a result of their weak inter-particle attractive interactions mainly affect the nanocomposite mechanical properties. The near surface dispersion of GO in polymer/GO nanocomposites can be investigated by studying the surface morphology of these nanocomposites using scanning probe microscopy such as atomic force microscope (AFM and scanning electron microscope (SEM. In the bulk, GO dispersion can be studied by wide-angle X-ray scattering (WAXD by analyzing the diffraction peaks corresponding to the undispersed GO fraction in the polymer matrix. In terms of an application, we review how the hydrophilicity of graphene oxide and its hydrogen bonding potential can enhance water flux of these nanocomposite materials in membrane applications. Likewise, the electrical conductivity of polymer films and bulk polymers can be advantageously enhanced via the percolative dispersion of GO nanoparticles, but this typically requires some additional chemical treatment of the GO nanoparticles to transform it to reduced GO.

  15. Boundary Effect of Planar Glow Dielectric Barrier Discharge and Its Influence on the Discharge Structure

    International Nuclear Information System (INIS)

    Xu Shaowei; Li Lulu; Ouyang Jiting

    2015-01-01

    The dielectric barrier discharge (DBD) in the glow regime in neon has been investigated by experiment and two-dimensional (2D) fluid modeling. The discharge was carried out in a planar DBD system with segmented-electrodes driven by square-wave voltage. The results show that the glow DBD originates in the center of the electrode and expands outward to the electrode edge during each half cycle of the voltage, forming a radial structure. The discharge decays firstly in the inner area but sustains longer in the edge area, showing a reversed discharge area. The discharge cannot completely cover the entire electrode surface, but remains a border of non- or weak discharge. The fluid modeling shows a similar result in agreement with the experiments. The simulations indicate that the electric field in the edge area is distorted due to the boundary effect so that the electric field and charge distribution are different from that in the inner part. The distorted field reduces the longitudinal component near the edge and causes the local field to be lower than that in the center, and hence makes the discharge behindhand. It also induces a transverse field that makes the discharge extend radially outward to the edge. The boundary effect plays an important role in the glow DBD structure. (paper)

  16. Quantum corrections to potential energy surfaces and their influence on barriers

    International Nuclear Information System (INIS)

    Reinhard, P.G.; Goeke, K.W.; Bonn Univ.

    1980-01-01

    A microscopic theory suitable for the description of fission processes and other large-amplitude collective phenomena is presented. The approach makes use of an optimal collective path, which is constructed by means of adiabatic time-dependent Hartree-Fock (TDHF) techniques as to show maximal de-coupling of collective and non-collective degrees of freedom. Although this involves a classical concept, the theory fully incorporates quantum effects associated with extracting a collective Schroedinger equation from adiabatic time-dependent Hartree-Fock theories (ATDHF). The quantum corrections are discussed extensively, and calculations in the two-centre shell model show, e.g. that they reduce the second barrier by 2 MeV and the life-time by a factor of 10 -7 . The relationships of the presented quantized ATDHF approach to the random-phase approximation (RPA) and a generalized dynamic generator co-ordinate method are investigated. For the construction of the optimal fission path, simple step-by-step methods are suggested. (author)

  17. Aging and sex influence the permeability of the blood-brain barrier in the rat

    International Nuclear Information System (INIS)

    Saija, A.; Princi, P.; D'Amico, N.; De Pasquale, R.; Costa, G.

    1990-01-01

    The aim of the present study was to investigate the existence of aging- and sex-related alterations in the permeability of the blood-brain barrier (BBB) in the rat, by calculating a unidirectional blood-to-brain transfer constant (Ki) for the circulating tracer [ 14 C]-α-aminoisobutyric acid. The authors observed that: (a) the permeability of the BBB significantly increased within the frontal and temporo-parietal cortex, hypothalamus and cerebellum in 28-30 week old rats, in comparison with younger animals; (b) in several brain areas of female intact rats higher Ki values (even though not significantly different) were calculated at oestrus than at proestrus; (c) in 1-week ovariectomized rats there was a marked increase of Ki values at the level of the frontal, temporo-parietal and occipital cortex, cerebellum and brain-stem. One can speculate that aging and sex-related alterations in thee permeability of the BBB reflect respectively changes in brain neurochemical system activity and in plasma steroid hormone levels

  18. Influence of chitosan concentration on mechanical and barrier properties of corn starch/chitosan films.

    Science.gov (United States)

    Ren, Lili; Yan, Xiaoxia; Zhou, Jiang; Tong, Jin; Su, Xingguang

    2017-12-01

    The active packaging films based on corn starch and chitosan were prepared through mixing the starch solution and the chitosan solution (1:1) by casting. The aim of this work was to characterize and analyze the effects of the chitosan concentrations (0, 21, 41, 61 and 81wt% of starch) on physicochemical, mechanical and water vapor barrier properties as well as morphological characteristics of the corn starch/chitosan (CS/CH) films. Starch molecules and chitosan could interact through hydrogen bonding as confirmed from the shift of the main peaks to higher wavenumbers in FTIR and the reduction of crystallinity in XRD. Results showed that the incorporation of chitosan resulted in an increase in film solubility, total color differences, tensile strength and elongation at break and a decrease in Young's modulus and water vapor permeability (WVP). Elongation at break of the CS/CH films increased with increasing of chitosan concentration, and reached a maximum at 41 wt%, then declined at higher chitosan concentration. The WVP of CS/CH films increased with an increase of chitosan concentration and the same tendency observed for the moisture content. The results suggest that this biodegradable CS/CH films could potentially be used as active packaging films for food and pharmaceutical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. The influence of creep properties on crack propagation in thermal barrier coatings

    International Nuclear Information System (INIS)

    Baeker, Martin

    2010-01-01

    Thermal barrier coatings are used to protect turbine blades from the high temperature of the process gas inside a turbine. They consist of a metallic bond coat and of a ceramic top coat with low thermal conductivity. During service, an additional oxide layer forms between bond coat and top coat that eventually causes failure. Finite element simulations show that the roughness of the interface between top and bond coat is crucial for determining the stress state. Lifetime models have been inferred that assume that cracks form in the peak positions at small oxide thickness and propagate when the oxide layer grows and the stress field shifts. A two-dimensional finite element model of crack propagation in the TBC layer is presented. Since the cracks propagate near a material interface and since plasticity may occur in the bond coat, standard tools of fracture mechanics for predicting the crack propagation direction are difficult to apply. This problem is circumvented in a very simple way by propagating short 'test cracks' in different directions and optimising to find the crack direction with the maximum energy release rate. It is shown that the energy release rate and the crack propagation direction are sensitive to the details of the stress state and especially to the creep properties of the materials. Implications for failure models are discussed.

  20. The influence of bed friction variability due to land cover on storm-driven barrier island morphodynamics

    Science.gov (United States)

    Passeri, Davina L.; Long, Joseph W.; Plant, Nathaniel G.; Bilskie, Matthew V.; Hagen, Scott C.

    2018-01-01

    Variations in bed friction due to land cover type have the potential to influence morphologic change during storm events; the importance of these variations can be studied through numerical simulation and experimentation at locations with sufficient observational data to initialize realistic scenarios, evaluate model accuracy and guide interpretations. Two-dimensional in the horizontal plane (2DH) morphodynamic (XBeach) simulations were conducted to assess morphodynamic sensitivity to spatially varying bed friction at Dauphin Island, AL using hurricanes Ivan (2004) and Katrina (2005) as experimental test cases. For each storm, three bed friction scenarios were simulated: (1) a constant Chezy coefficient across land and water, (2) a constant Chezy coefficient across land and depth-dependent Chezy coefficients across water, and (3) spatially varying Chezy coefficients across land based on land use/land cover (LULC) data and depth-dependent Chezy coefficients across water. Modeled post-storm bed elevations were compared qualitatively and quantitatively with post-storm lidar data. Results showed that implementing spatially varying bed friction influenced the ability of XBeach to accurately simulate morphologic change during both storms. Accounting for frictional effects due to large-scale variations in vegetation and development reduced cross-barrier sediment transport and captured overwash and breaching more accurately. Model output from the spatially varying friction scenarios was used to examine the need for an existing sediment transport limiter, the influence of pre-storm topography and the effects of water level gradients on storm-driven morphodynamics.

  1. A coupled mechanical-chemical model for reflecting the influence of stress on oxidation reactions in thermal barrier coating

    Science.gov (United States)

    Chen, Lin; Yueming, Li

    2018-06-01

    In this paper, a coupled mechanical-chemical model is established based on the thermodynamic framework, in which the contribution of chemical expansion to free energy is introduced. The stress-dependent chemical potential equilibrium at the gas-solid interface and the stress gradient-dependent diffusion equation as well as a so-called generalized force which is conjugate to the oxidation rate are derived from the proposed model, which could reflect the influence of stresses on the oxidation reaction. Based on the proposed coupled mechanical-chemical model, a user element subroutine is developed in ABAQUS. The numerical simulation of the high temperature oxidation in the thermal barrier coating is carried out to verify the accuracy of the proposed model, and then the influence of stresses on the oxidation reaction is investigated. In thermally grown oxide, the considerable stresses would be induced by permanent volumetric swelling during the oxidation. The stresses play an important role in the chemical potential equilibrium at the gas-solid interface and strongly affect the oxidation reaction. The gradient of the stresses, however, only occurs in the extremely thin oxidation front layer, which plays a very limited role in the oxidation reaction. The generalized force could be divided into the stress-dependent and the stress-independent parts. Comparing with the stress-independent part, the stress-dependent part is smaller, which has little influence on oxidation reaction.

  2. Barrier properties of PE, PP and EVA (nano)composites - The influence of filler type and concentration

    Energy Technology Data Exchange (ETDEWEB)

    Merinska, D.; Kalendova, A. [Department of Polymer Engineering, Faculty of Technology, Tomas Bata University in Zlin, Nam. T. G. Masaryka 275, 762 72 Zlin, Czech Republic and Centre of Polymer Systems, University Institute, Tomas Bata University in Zlin, Nad Ovcirnou 3685, 760 0 (Czech Republic); Tesarikova, A. [Department of Polymer Engineering, Faculty of Technology, Tomas Bata University in Zlin, Nam. T. G. Masaryka 275, 762 72 Zlin (Czech Republic)

    2014-05-15

    Nanocomposite materials with layered clay used as nanofiller and polyethylene (PE), polypropylene (PP) and copolymer ethylene and vinyl acetate matrix (EVA, the content of VA component 19 wt. %) were prepared by compounding the individual components in Brabender kneader. The MMT Na+ and four types of commercial products such as Nanofil N 5 and N3000, Cloisite 93A and 30B were used as nanofillers. Next to the clays microprecipitated CaHCO{sub 3}, nanosilica and Halloysite tubes were used. The quantity of all the above-mentioned (nano)fillers was 1, 3 and 5 wt. % in relation to the content of montmorillonite. The aim was to evaluate the influence of (nano)filler type and concentration on nanocomposite barrier properties. The morphology of nanocomposite samples was examined by means of XRD analysis illustrated by transmission electronic microscopy TEM. Furthermore, permeability for O{sub 2} and CO{sub 2} were observed.

  3. Treatment of poly(ethylene terephthalate) foils by atmospheric pressure air dielectric barrier discharge and its influence on cell growth

    Science.gov (United States)

    Kuzminova, Anna; Vandrovcová, Marta; Shelemin, Artem; Kylián, Ondřej; Choukourov, Andrei; Hanuš, Jan; Bačáková, Lucie; Slavínská, Danka; Biederman, Hynek

    2015-12-01

    In this contribution an effect of dielectric barrier discharge (DBD) sustained in air at atmospheric pressure on surface properties of poly(ethylene terephthalate) (PET) foils is studied. It is found that exposure of PET to DBD plasma leads to rapid changes of surface chemical composition, wettability, surface morphology as well as mechanical properties of PET surface. In addition, based on biological tests that were performed using two cell types (Saos-2 human osteoblast-like cells and HUVEC human umbilical vein endothelial cells), it may be concluded that DBD plasma treatment positively influences cell growth on PET. This effect was found to be connected predominantly with increased surface energy and oxygen content of the surface of treated PET foils.

  4. Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.

    NARCIS (Netherlands)

    Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der

    2003-01-01

    The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol

  5. Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

    NARCIS (Netherlands)

    Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.

    2015-01-01

    Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis

  6. Comparison of three dielectric barrier discharges regarding their physical characteristics and influence on the adhesion properties on maple, high density fiberboards and wood plastic composite

    International Nuclear Information System (INIS)

    Peters, F; Wieneke, S; Ohms, G; Viöl, W; Hünnekens, B; Militz, H

    2017-01-01

    In this study, three different dielectric barrier discharges, based on the same setup and run with the same power supply, are characterized by emission spectroscopy with regards to the reduced electrical field strength, and the rotational, vibrational and electron temperature. To compare discharges common for the treatment on wood, a coplanar surface barrier discharge, a direct dielectric barrier discharge and a jet system/remote plasma are chosen. To minimize influences due to the setups or power, the discharges are realized with the same electrodes and power supply and normalized to the same power. To evaluate the efficiency of the different discharges and the influence on treated materials, the surface free energy is determined on a maple wood, high density fiberboard and wood plastic composite. The influence is measured depending on the treatment time, with the highest impact in the time of 5 s. (paper)

  7. Comparison of three dielectric barrier discharges regarding their physical characteristics and influence on the adhesion properties on maple, high density fiberboards and wood plastic composite

    Science.gov (United States)

    Peters, F.; Hünnekens, B.; Wieneke, S.; Militz, H.; Ohms, G.; Viöl, W.

    2017-11-01

    In this study, three different dielectric barrier discharges, based on the same setup and run with the same power supply, are characterized by emission spectroscopy with regards to the reduced electrical field strength, and the rotational, vibrational and electron temperature. To compare discharges common for the treatment on wood, a coplanar surface barrier discharge, a direct dielectric barrier discharge and a jet system/remote plasma are chosen. To minimize influences due to the setups or power, the discharges are realized with the same electrodes and power supply and normalized to the same power. To evaluate the efficiency of the different discharges and the influence on treated materials, the surface free energy is determined on a maple wood, high density fiberboard and wood plastic composite. The influence is measured depending on the treatment time, with the highest impact in the time of 5 s.

  8. Influence of surface roughness and melt superheat on HDA process to form a tritium permeation barrier on RAFM steel

    Energy Technology Data Exchange (ETDEWEB)

    Purushothaman, J. [B.S. Abdur Rahman University, Chennai 600048 (India); MTD, MMG, IGCAR, Kalpakkam 603102 (India); Ramaseshan, R., E-mail: seshan@igcar.gov.in [TFCS, SND, MSG, IGCAR, Kalpakkam 603102 (India); Albert, S.K. [MTD, MMG, IGCAR, Kalpakkam 603102 (India); Rajendran, R. [B.S. Abdur Rahman University, Chennai 600048 (India); Gowrishankar, N. [IP Rings Ltd., Maraimalainagar, Chennai 603209 (India); Ramasubbu, V. [MTD, MMG, IGCAR, Kalpakkam 603102 (India); Murugesan, S.; Dasgupta, Arup [PMG, MMG, IGCAR, Kalpakkam 603102 (India); Jayakumar, T. [MTD, MMG, IGCAR, Kalpakkam 603102 (India)

    2015-12-15

    Highlights: • Surface modified RAFMS samples were subjected to HDA and thermal oxidation. • Sample modified by SB process showed better coating and interface morphology. • Aluminized samples at 740 °C for 2 min showed Fe{sub 2}Al{sub 9}Si{sub 2} intermetallic phase. • Oxidized samples showed Fe{sub 2}Al{sub 8}Si, Fe{sub 2}Al{sub 3}Si{sub 3} and Fe{sub 3}Al{sub 2}Si{sub 3} intermetallic phases. • A uniform permeation barrier Al{sub 2}O{sub 3} was formed on the coating of oxidized HDA samples. - Abstract: The most optimal candidate material for fabrication of Test Blanket Module (TBM) in the installation of ITER and future fusion reactors is Reduced Activation Ferritic Martensitic (RAFM) steel, yet one of the major challenges that need to be addressed with RAFM is minimizing the loss of tritium in a reactor environment through the formation of tritium permeation barrier. One of the most promising methods for the tritium permeation barrier is through duplex coating with Al{sub 2}O{sub 3}/Fe–Al which is well known to reduce tritium permeation rate by several orders of magnitude. The present work aims to form an alumina layer on RAFM steel by a two-step method, which consists of (i) Hot Dip Aluminizing (HDA) and (ii) conversion of Al into alumina by a subsequent oxidation process. In addition, the influence of surface roughness of the substrate, superheat condition of the Al alloy melt and its composition on microstructural properties of coating before and after oxidation were investigated using OM, SEM–EDS, XRD, indentation micro hardness and scratch test. The experimental results confirmed the formation of alumina layer on RAFM steel after the HDA and oxidation process. Moreover, the surface roughness of the substrate, melt superheat of Al alloy and its composition are found to have a significant influence on the microstructure, thickness, micro-hardness, nature of intermetallic compounds formed and adhesion strength of the coating.

  9. The influence of natural barriers in shaping the genetic structure of Maharashtra populations.

    Directory of Open Access Journals (Sweden)

    Kumarasamy Thangaraj

    Full Text Available BACKGROUND: The geographical position of Maharashtra state makes it rather essential to study the dispersal of modern humans in South Asia. Several hypotheses have been proposed to explain the cultural, linguistic and geographical affinity of the populations living in Maharashtra state with other South Asian populations. The genetic origin of populations living in this state is poorly understood and hitherto been described at low molecular resolution level. METHODOLOGY/PRINCIPAL FINDINGS: To address this issue, we have analyzed the mitochondrial DNA (mtDNA of 185 individuals and NRY (non-recombining region of Y chromosome of 98 individuals belonging to two major tribal populations of Maharashtra, and compared their molecular variations with that of 54 South Asian contemporary populations of adjacent states. Inter and intra population comparisons reveal that the maternal gene pool of Maharashtra state populations is composed of mainly South Asian haplogroups with traces of east and west Eurasian haplogroups, while the paternal haplogroups comprise the South Asian as well as signature of near eastern specific haplogroup J2a. CONCLUSIONS/SIGNIFICANCE: Our analysis suggests that Indian populations, including Maharashtra state, are largely derived from Paleolithic ancient settlers; however, a more recent (∼10 Ky older detectable paternal gene flow from west Asia is well reflected in the present study. These findings reveal movement of populations to Maharashtra through the western coast rather than mainland where Western Ghats-Vindhya Mountains and Narmada-Tapti rivers might have acted as a natural barrier. Comparing the Maharastrian populations with other South Asian populations reveals that they have a closer affinity with the South Indian than with the Central Indian populations.

  10. The influence of natural barriers in shaping the genetic structure of Maharashtra populations.

    Science.gov (United States)

    Thangaraj, Kumarasamy; Naidu, B Prathap; Crivellaro, Federica; Tamang, Rakesh; Upadhyay, Shashank; Sharma, Varun Kumar; Reddy, Alla G; Walimbe, S R; Chaubey, Gyaneshwer; Kivisild, Toomas; Singh, Lalji

    2010-12-20

    The geographical position of Maharashtra state makes it rather essential to study the dispersal of modern humans in South Asia. Several hypotheses have been proposed to explain the cultural, linguistic and geographical affinity of the populations living in Maharashtra state with other South Asian populations. The genetic origin of populations living in this state is poorly understood and hitherto been described at low molecular resolution level. To address this issue, we have analyzed the mitochondrial DNA (mtDNA) of 185 individuals and NRY (non-recombining region of Y chromosome) of 98 individuals belonging to two major tribal populations of Maharashtra, and compared their molecular variations with that of 54 South Asian contemporary populations of adjacent states. Inter and intra population comparisons reveal that the maternal gene pool of Maharashtra state populations is composed of mainly South Asian haplogroups with traces of east and west Eurasian haplogroups, while the paternal haplogroups comprise the South Asian as well as signature of near eastern specific haplogroup J2a. Our analysis suggests that Indian populations, including Maharashtra state, are largely derived from Paleolithic ancient settlers; however, a more recent (∼10 Ky older) detectable paternal gene flow from west Asia is well reflected in the present study. These findings reveal movement of populations to Maharashtra through the western coast rather than mainland where Western Ghats-Vindhya Mountains and Narmada-Tapti rivers might have acted as a natural barrier. Comparing the Maharastrian populations with other South Asian populations reveals that they have a closer affinity with the South Indian than with the Central Indian populations.

  11. Clean home-delivery in rural Southern Tanzania: barriers, influencers, and facilitators.

    Science.gov (United States)

    Shamba, Donat D; Schellenberg, Joanna; Penfold, Suzanne C; Mashasi, Irene; Mrisho, Mwifadhi; Manzi, Fatuma; Marchant, Tanya; Tanner, Marcel; Mshinda, Hassan; Schellenberg, David; Hill, Zelee

    2013-03-01

    The study explored the childbirth-related hygiene and newborn care practices in home-deliveries in Southern Tanzania and barriers to and facilitators of behaviour change. Eleven home-birth narratives and six focus group discussions were conducted with recently-delivering women; two focus group discussions were conducted with birth attendants. The use of clean cloth for delivery was reported as common in the birth narratives; however, respondents did not link its use to newborn's health. Handwashing and wearing of gloves by birth attendants varied and were not discussed in terms of being important for newborn's health, with few women giving reasons for this behaviour. The lack of handwashing and wearing of gloves was most commonly linked to the lack of water, gloves, and awareness. A common practice was the insertion of any family member's hands into the vagina of delivering woman to check labour progress before calling the birth attendant. The use of a new razor blade to cut the cord was near-universal; however, the cord was usually tied with a used thread due to the lack of knowledge and the low availability of clean thread. Applying something to the cord was near-universal and was considered essential for newborn's health. Three hygiene practices were identified as needing improvement: family members inserting a hand into the vagina of delivering woman before calling the birth attendant, the use of unclean thread, and putting substances on the cord. Little is known about families conducting internal checks of women in labour, and more research is needed before this behaviour is targeted in interventions. The use of clean thread as cord-tie appears acceptable and can be addressed, using the same channels and methods that were used for successfully encouraging the use of new razor blade.

  12. Influence of radiation on the blood-brain barrier and optimum time of chemotherapy

    International Nuclear Information System (INIS)

    Qin, D.X.; Zheng, R.; Tang, J.; Li, J.X.; Hu, Y.H.

    1990-01-01

    A pilot study of the destructive effects of radiation on the blood-brain barrier (BBB) was made on 14 patients with localized and limited brain tumors by 99MTc-GH imaging from August 1988 to November 1989. Count/pixel data were obtained from the unirradiated, irradiated, and tumor areas before and after radiotherapy of 30-40 Gy. It was observed that the BBB in the unirradiated area outside the radiation portal was not changed and the degree of destructive effect on the BBB in the irradiated normal area was directly proportional to the radiation dose. For 30-40 Gy, the count/pixel change enhances to average 24.7% [(147.6-118.4)/118.4], and (c) the BBB in the tumor area is partially destroyed on an average of 22.1% [(206.8-169.4)/169.4] by the tumor. The radiotherapy further enhances this effect to an average of 74.7% [(206.8-118.4)/118.4]. Case 3 showed that before radiation, the degree of destructive effect on the BBB in the tumor area was 22% [(167-137)/137] higher than normal brain tissue. After a dose of 30 Gy of irradiation, it increased to 76.7% [(242-137)/137]; 8 months later it decreased to 17% [(160.3-137)/137]. It has been proven that the BBB can recover at least partially. Based on these observations, the authors believe that in the combined treatment of operated brain tumors, radiotherapy should precede chemotherapy so as to enhance the destruction of the BBB, facilitating the incorporation of drugs into the tumor. The dose at which to start chemotherapy is 20-30 Gy

  13. Barriers to radiotherapy utilization: Consumer perceptions of issues influencing radiotherapy-related decisions.

    Science.gov (United States)

    Sundaresan, Puma; King, Madeleine; Stockler, Martin; Costa, Daniel; Milross, Christopher

    2017-10-01

    Radiation therapy (RT) is an essential and cost-effective cancer treatment, but it is underutilized in Australia. We aimed to quantify consumers' perceptions of factors that influence RT decisions. A cross-sectional, survey-based study was conducted in March-August 2012. Potential participants were invited to complete an electronic survey disseminated through multiple patient support and advocacy groups throughout New South Wales (NSW), Australia. Study invitations were also placed in local newspapers across NSW with hard copy surveys mailed to respondents. Current or past cancer patients (and carers) who had been offered RT were eligible to participate regardless of their RT decision. Of the 1191 participants (electronic, n = 1153; hard copy, n = 38), 91% were female, most (88%) were current or past patients, and 78% had accepted RT. Issues commonly perceived to be moderate to strong influencers of RT decisions were: concern about acute and long-term side effects; management of side effects; fear and anxiety regarding RT; lack of awareness of RT; lack of local availability of RT; and lack of RT information resources. Those who declined RT were significantly more likely to highlight practical difficulties with receiving RT. Although availability of RT is well recognized, other issues such as fear and anxiety about RT and perceived side effects appear to feature prominently in consumers' decisions. Perceived practical difficulties with receiving RT may have influenced those who declined RT. There may be a need for information resources, support services and interventions to increase awareness of RT. © 2016 John Wiley & Sons Australia, Ltd.

  14. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  15. Treatment of poly(ethylene terephthalate) foils by atmospheric pressure air dielectric barrier discharge and its influence on cell growth

    Energy Technology Data Exchange (ETDEWEB)

    Kuzminova, Anna [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Vandrovcová, Marta [Institute of Physiology, Academy of Sciences of the Czech Republic, Vídeňská 1083, 142 20 Prague 4 (Czech Republic); Shelemin, Artem [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Kylián, Ondřej, E-mail: ondrej.kylian@gmail.com [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Choukourov, Andrei; Hanuš, Jan [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Bačáková, Lucie [Institute of Physiology, Academy of Sciences of the Czech Republic, Vídeňská 1083, 142 20 Prague 4 (Czech Republic); Slavínská, Danka; Biederman, Hynek [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic)

    2015-12-01

    Highlights: • Effect of atmospheric pressure DBD plasma on PET foils was investigated. • DBD treatment causes increase in surface density of O-containing functional groups. • DBD plasma causes increase of wettability, roughness and complex modulus of PET. • DBD treatment positively influences cells growth on PET. • Enhancement of cell growth on treated PET depends on the cell type. - Abstract: In this contribution an effect of dielectric barrier discharge (DBD) sustained in air at atmospheric pressure on surface properties of poly(ethylene terephthalate) (PET) foils is studied. It is found that exposure of PET to DBD plasma leads to rapid changes of surface chemical composition, wettability, surface morphology as well as mechanical properties of PET surface. In addition, based on biological tests that were performed using two cell types (Saos-2 human osteoblast-like cells and HUVEC human umbilical vein endothelial cells), it may be concluded that DBD plasma treatment positively influences cell growth on PET. This effect was found to be connected predominantly with increased surface energy and oxygen content of the surface of treated PET foils.

  16. RESEARCH: Influence of Social, Biophysical, and Managerial Conditions on Tourism Experiences Within the Great Barrier Reef World Heritage Area.

    Science.gov (United States)

    Shafer; Inglis

    2000-07-01

    / Managing protected areas involves balancing the enjoyment of visitors with the protection of a variety of cultural and biophysical resources. Tourism pressures in the Great Barrier Reef World Heritage Area (GBRWHA) are creating concerns about how to strike this balance in a marine environment. Terrestrial-based research has led to conceptual planning and management frameworks that address issues of human use and resource protection. The limits of acceptable change (LAC) framework was used as a conceptual basis for a study of snorkeling at reef sites in the GBRWHA. The intent was to determine if different settings existed among tourism operators traveling to the reef and, if so, to identify specific conditions relating to those settings. Snorkelers (N = 1475) traveling with tourism operations of different sizes who traveled to different sites completed surveys. Results indicated that snorkelers who traveled with larger operations (more people and infrastructure) differed from those traveling with smaller operations (few people and little on-site infrastructure) on benefits received and in the way that specific conditions influenced their enjoyment. Benefits related to nature, escape, and family helped to define reef experiences. Conditions related to coral, fish, and operator staff had a positive influence on the enjoyment of most visitors but, number of people on the trip and site infrastructure may have the greatest potential as setting indicators. Data support the potential usefulness of visitor input in applying the LAC concept to a marine environment where tourism and recreational uses are rapidly changing.

  17. The Influence of Creativity Level on Overcoming the Barriers of Teachers’ Professional Development

    Directory of Open Access Journals (Sweden)

    E. F. Zeer

    2012-01-01

    Full Text Available The paper summarizes the research findings concerning the influence of creativity on overcoming the barriers of teachers’ professional development. The re- search subject includes defining the interrelations between the creativity and profes- sional burn-out. The aim of the studies is to find out the influencing factors of creativ- ity eliminating the destructive trends of professional pedagogic activity. The methodology is based on the E. E. Simanyuk’s concept describing the de- structive tendencies of teachers’ professional formation and the constructive overcom- ing strategies. The teachers’ refresher course at Sverdlovsk Regional Institute of Education De- velopment was taken as the experimental ground for the research. The diagnostics of the psychological constructs relating to the discussed phenomena was carried out by using tests of high validity and reliability. The modern methods of mathematical statis- tics were applied. The research outputs are of high practical importance both for designing the content of teachers’ professional development and upgrading their readiness for educa- tional innovations. 

  18. Influence of material properties on gloves' bacterial barrier efficacy in the presence of microperforation.

    Science.gov (United States)

    Bardorf, Michael Hermann; Jäger, Bernd; Boeckmans, Eric; Kramer, Axel; Assadian, Ojan

    2016-12-01

    Medical examination gloves and surgical gloves protect the wearer directly and the patient indirectly from the risk of contamination. Because of concerns related to latex allergy, an increasing trend toward the use of synthetic gloves made of materials other than latex is observable. However, currently it is unknown if the physical properties of different materials may influence bacterial passage in case of a glove puncture. We examined 9 different medical examination gloves from various manufacturers made of nitrile (n = 4), latex (n = 3), or neoprene (n = 2). Additionally, 1 latex surgical glove each with and without antibacterial chlorhexidine gluconate coating and 1 synthetic surgical glove made of thermoplastic elastomer were included in the experiments. The studied materials were perforated following a standardized procedure, and direct bacterial passage was measured under dynamic conditions. Glove elasticity at 1 cm up to 2.5 cm elongation was measured following EN 455-2. Nitrile gloves demonstrated higher material stiffness compared with latex gloves. Medical examination gloves made of nitrile and neoprene showed a 10-fold higher bacterial passage through a standardized puncture compared with latex gloves. All surgical gloves showed a lower bacterial passage compared with the tested examination gloves. Bacterial passage through punctures is correlated with the stiffness or elasticity of the glove material. Therefore, gloves made of latex may have an increased protective effect in case of a glove breach. Whenever gloves are purchased and selected, a risk-benefit assessment should be conducted, balancing the risk of allergy against the degree of required protection in case of a glove puncture. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  19. Influence of capillary barrier effect on biogas distribution at the base of passive methane oxidation biosystems: Parametric study.

    Science.gov (United States)

    Ahoughalandari, Bahar; Cabral, Alexandre R

    2017-05-01

    The efficiency of methane oxidation in passive methane oxidation biosystems (PMOBs) is influenced by, among other things, the intensity and distribution of the CH 4 loading at the base of the methane oxidation layer (MOL). Both the intensity and distribution are affected by the capillary barrier that results from the superposition of the two materials constituting the PMOB, namely the MOL and the gas distribution layer (GDL). The effect of capillary barriers on the unsaturated flow of water has been well documented in the literature. However, its effect on gas flow through PMOBs is still poorly documented. In this study, sets of numerical simulations were performed to evaluate the effect of unsaturated hydraulic characteristics of the MOL material on the value and distribution of moisture and hence, the ease and uniformity in the distribution of the upward flow of biogas along the GDL-MOL interface. The unsaturated hydraulic parameters of the materials used to construct the experimental field plot at the St-Nicephore landfill (Quebec, Canada) were adopted to build the reference simulation of the parametric study. The behavior of the upward flow of biogas for this particular material was analyzed based on its gas intrinsic permeability function, which was obtained in the laboratory. The parameters that most influenced the distribution and the ease of biogas flow at the base of the MOL were the saturated hydraulic conductivity and pore size distribution of the MOL material, whose effects were intensified as the slope of the interface increased. The effect of initial dry density was also assessed herein. Selection of the MOL material must be made bearing in mind that these three parameters are key in the effort to prevent unwanted restriction in the upward flow of biogas, which may result in the redirection of biogas towards the top of the slope, leading to high CH 4 fluxes (hotspots). In a well-designed PMOB, upward flow of biogas across the GDL-MOL interface is

  20. Barriers and facilitators influencing self-management among COPD patients: a mixed methods exploration in primary and affiliated specialist care

    Directory of Open Access Journals (Sweden)

    Hillebregt CF

    2016-12-01

    Full Text Available Chantal F Hillebregt,1 Auke J Vlonk,1 Marc A Bruijnzeels,1 Onno CP van Schayck,2 Niels H Chavannes3 1Jan van Es Institute (JVEI, Netherlands Expert Center Integrated Primary Care, Almere, 2Department of General Practice, School for Public Health and Primary Care (CAPHRI, Maastricht University Medical Center, Maastricht, 3Department of Public Health and Primary Care, Leiden University Medical Center, Leiden, the Netherlands Abstract: Self-management is becoming increasingly important in COPD health care although it remains difficult to embed self-management into routine clinical care. The implementation of self-management is understood as a complex interaction at the level of patient, health care provider (HCP, and health system. Nonetheless there is still a poor understanding of the barriers and effective facilitators. Comprehension of these determinants can have significant implications in optimizing self-management implementation and give further directions for the development of self-management interventions. Data were collected among COPD patients (N=46 and their HCPs (N=11 in three general practices and their collaborating affiliated hospitals. Mixed methods exploration of the data was conducted and collected by interviews, video-recorded consultations (N=50, and questionnaires on consultation skills. Influencing determinants were monitored by 1 interaction and communication between the patient and HCP, 2 visible and invisible competencies of both the patient and the HCP, and 3 degree of embedding self-management into the health care system. Video observations showed little emphasis on effective behavioral change and follow-up of given lifestyle advice during consultation. A strong presence of COPD assessment and monitoring negatively affects the patient-centered communication. Both patients and HCPs experience difficulties in defining personalized goals. The satisfaction of both patients and HCPs concerning patient centeredness during

  1. The influence of nurse home visits, including provision of 3 months of contraceptives and contraceptive counseling, on perceived barriers to contraceptive use and contraceptive use self-efficacy.

    Science.gov (United States)

    Melnick, Alan L; Rdesinski, Rebecca E; Creach, E Dawn; Choi, Dongseok; Harvey, S Marie

    2008-01-01

    To identify the influence of a community health nurse (CHN) home visit on perceived barriers to contraceptive access and contraceptive use self-efficacy. We enrolled 103 women into two groups in a randomized trial evaluating the influence of contraceptive dispensing and family planning counseling during home visits on perceived barriers to accessing contraceptives and contraceptive use self-efficacy. Both groups received counseling by a CHN about sexually transmitted disease and pregnancy prevention, and a resource card listing phone numbers of family planning clinics. After randomization, the CHN dispensed three months of hormonal contraception to the intensive intervention group and advised the minimal intervention group to schedule an appointment at a family planning clinic. Data collection at baseline and 12 months included demographic, reproductive and other health-related information as well as quantitative assessments of information on perceived barriers to contraceptive access and contraceptive use self-efficacy. The mean age of participants was 24.7 years. Three-fourths had household incomes under $25,000. We found significant reductions in three perceived barriers to contraceptive access for both groups, as well as significant increases in two measures of contraceptive use self-efficacy at twelve months compared to baseline. Nurse home visits involving family planning counseling might be effective in reducing perceived barriers to contraceptive access and increasing contraceptive use self-efficacy.

  2. Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

    Directory of Open Access Journals (Sweden)

    Sabita N. Saldanha

    2015-12-01

    Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

  3. Influence of Cracks in Cementitious Engineered Barriers in a Near-Surface Disposal System: Assessment Analysis of the Belgian Case

    International Nuclear Information System (INIS)

    Perko, Janez; Seetharam, Suresh C.; Jacques, Diederik; Mallants, Dirk; Cool, Wim; Vermarien, Elise

    2013-01-01

    In large cement-based structures such as a near surface disposal facility for radioactive waste voids and cracks are inevitable. However, the pattern and nature of cracks are very difficult to predict reliably. Cracks facilitate preferential water flow through the facility because their saturated hydraulic conductivity is generally higher than the conductivity of the cementitious matrix. Moreover, sorption within the crack is expected to be lower than in the matrix and hence cracks in engineered barriers can act as a bypass for radionuclides. Consequently, understanding the effects of crack characteristics on contaminant fluxes from the facility is of utmost importance in a safety assessment. In this paper we numerically studied radionuclide leaching from a crack-containing cementitious containment system. First, the effect of cracks on radionuclide fluxes is assessed for a single repository component which contains a radionuclide source (i.e. conditioned radwaste). These analyses reveal the influence of cracks on radionuclide release from the source. The second set of calculations deals with the safety assessment results for the planned near-surface disposal facility for low-level radioactive waste in Dessel (Belgium); our focus is on the analysis of total system behaviour in regards to release of radionuclide fluxes from the facility. Simulation results are interpreted through a complementary safety indicator (radiotoxicity flux). We discuss the possible consequences from different scenarios of cracks and voids. (authors)

  4. Influence of silicon on hot-dip aluminizing process and subsequent oxidation for preparing hydrogen/tritium permeation barrier

    Energy Technology Data Exchange (ETDEWEB)

    Han, Shilei; Li, Hualing; Wang, Shumao; Jiang, Lijun; Liu, Xiaopeng [Energy Materials and Technology Research Institute, General Research Institute for Nonferrous Metals, Beijing 100088 (China)

    2010-04-15

    The development of the International Thermonuclear Experimental Reactor (ITER) requires the production of a material capable of acting as a hydrogen/tritium permeation barrier on low activation steel. It is well known that thin alumina layer can reduce the hydrogen permeation rate by several orders of magnitude. A technology is introduced here to form a ductile Fe/Al intermetallic layer on the steel with an alumina over-layer. This technology, consisting of two main steps, hot-dip aluminizing (HDA) and subsequent oxidation behavior, seems to be a promising coating method to fulfill the required goals. According to the experiments that have been done in pure Al, the coatings were inhomogeneous and too thick. Additionally, a large number of cracks and porous band could be observed. In order to solve these problems, the element silicon was added to the aluminum melt with a nominal composition. The influence of silicon on the aluminizing and following oxidation process was investigated. With the addition of silicon into the aluminum melt, the coating became thinner and more homogeneous. The effort of the silicon on the oxidation behavior was observed as well concerning the suppression of porous band and cracks. (author)

  5. Influence of Experimental Parameters Using the Dip-Coating Method on the Barrier Performance of Hybrid Sol-Gel Coatings in Strong Alkaline Environments

    Directory of Open Access Journals (Sweden)

    Rita B. Figueira

    2015-04-01

    Full Text Available Previous studies have shown that the barrier effect and the performance of organic-inorganic hybrid (OIH sol-gel coatings are highly dependent on the coating deposition method as well as on the processing conditions. However, studies on how the coating deposition method influences the barrier properties in alkaline environments are scarce. The aim of this experimental research was to study the influence of experimental parameters using the dip-coating method on the barrier performance of an OIH sol-gel coating in contact with simulated concrete pore solutions (SCPS. The influence of residence time (Rt, a curing step between each dip step and the number of layers of sol-gel OIH films deposited on hot-dip galvanized steel to prevent corrosion in highly alkaline environments was studied. The barrier performance of these OIH sol-gel coatings, named U(400, was assessed in the first instants of contact with SCPS, using electrochemical impedance spectroscopy and potentiodynamic methods. The durability and stability of the OIH coatings in SCPS was monitored during eight days by macrocell current density. The morphological characterization of the surface was performed by Scanning Electronic Microscopy before and after exposure to SCPS. Glow Discharge Optical Emission Spectroscopy was used to investigate the thickness of the U(400 sol-gel coatings as a function of the number of layers deposited with and without Rt in the coatings thickness.

  6. Differences between African-American and Caucasian students on enrollment influences and barriers in kinesiology-based allied health education programs.

    Science.gov (United States)

    Barfield, J P; Cobler, D C; Lam, Eddie T C; Zhang, James; Chitiyo, George

    2012-06-01

    Kinesiology departments have recently started to offer allied health education programs to attract additional students to teacher education units (9). Although allied health professions offer increased work opportunities, insufficient enrollment and training of minority students in these academic fields contribute to underrepresentation in the workforce (3). To improve workforce diversity, kinesiology departments must understand how enrollment influences and barriers differ by race among prospective students. Therefore, the purpose of this study was to identify differences in allied health education enrollment influences and enrollment barriers between minority and Caucasian students. Participants (n = 601) consisted of students enrolled in kinesiology-based allied health education programs. Multivariate ANOVA was used to compare group differences in enrollment decision making. "Personal influence," "career opportunity," and "physical self-efficacy" were all significantly stronger enrollment influences among African-American students than among Caucasian students, and "social influence," "experiential opportunity," "academic preparation," and "physical self-efficacy" were all perceived as significantly greater barriers compared with Caucasian students. Findings support the need to recruit African-American students through sport and physical education settings and to market program-based experiential opportunities.

  7. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Directory of Open Access Journals (Sweden)

    David Judah

    Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  8. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Science.gov (United States)

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  9. Influence of gender and race/ethnicity on perceived barriers to help-seeking for alcohol or drug problems.

    Science.gov (United States)

    Verissimo, Angie Denisse Otiniano; Grella, Christine E

    2017-04-01

    This study examines reasons why people do not seek help for alcohol or drug problems by gender and race/ethnicity using data from the National Epidemiologic Survey on Alcohol and Related Conditions (NESARC), a nationally representative survey. Multivariate models were fit for 3 barriers to seeking help (structural, attitudinal, and readiness for change) for either alcohol or drug problems, controlling for socio-demographic characteristics and problem severity. Predicted probabilities were generated to evaluate gender differences by racial/ethnic subgroups. Over three quarters of the samples endorsed attitudinal barriers related to either alcohol or drug use. Generally, women were less likely to endorse attitudinal barriers for alcohol problems. African Americans and Latina/os were less likely than Whites to endorse attitudinal barriers for alcohol problems, Latina/os were less likely than Whites to endorse readiness for change barriers for alcohol and drug problems, however, African Americans were more likely to endorse structural barriers for alcohol problems. Comparisons within racial/ethnic subgroups by gender revealed more complex findings, although across all racial/ethnic groups women endorsed attitudinal barriers for alcohol problems more than men. Study findings suggest the need to tailor interventions to increase access to help for alcohol and drug problems that take into consideration both attitudinal and structural barriers and how these vary across groups. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. The influence of the AlN barrier thickness on the polarization Coulomb field scattering in AlN/GaN heterostructure field-effect transistors

    International Nuclear Information System (INIS)

    Lv, Yuanjie; Feng, Zhihong; Gu, Guodong; Han, Tingting; Yin, Jiayun; Liu, Bo; Cai, Shujun; Lin, Zhaojun; Ji, Ziwu; Zhao, Jingtao

    2014-01-01

    The electron mobility scattering mechanisms in AlN/GaN heterostuctures with 3 nm and 6 nm AlN barrier thicknesses were investigated by temperature-dependent Hall measurements. The effect of interface roughness (IFR) scattering on the electron mobility was found to be enhanced by increasing AlN barrier thickness. Moreover, using the measured capacitance-voltage and current-voltage characteristics of the fabricated heterostructure field-effect transistors (HFETs) with different Schottky areas on the two heterostuctures, the variations of electron mobility with different gate biases were investigated. Due to enhanced IFR scattering, the influence of polarization Coulomb field (PCF) scattering on electron mobility was found to decrease with increasing AlN barrier layer thickness. However, the PCF scattering remained an important scattering mechanism in the AlN/GaN HFETs.

  11. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  12. Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

    Science.gov (United States)

    Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

    2018-01-01

    Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

  13. Grhl3 and Lmo4 play coordinate roles in epidermal migration.

    Science.gov (United States)

    Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M

    2008-09-01

    In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.

  14. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  15. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  16. Extraction of water labeled with oxygen 15 during single-capillary transit. Influence of blood pressure, osmolarity, and blood-brain barrier damage

    International Nuclear Information System (INIS)

    Go, K.G.; Lammertsma, A.A.; Paans, A.M.; Vaalburg, W.; Woldring, M.G.

    1981-01-01

    By external detection, the influence of arterial blood pressure (BP), osmolarity, and cold-induced blood-brain barrier damage was assessed on the extraction of water labeled with oxygen 15 during single-capillary transit in the rat. There was an inverse relation between arterial BP and extraction that was attributable to the influence of arterial BP on cerebral blood flow (CBF) and the relation between CBF and extraction. Neither arterial BP nor osmolarity of the injected bolus had any direct effect on extraction of water 15O, signifying that the diffusional exchange component (determined by blood flow) of extraction greatly surpasses the convection flow contribution by hydrostatic or osmotic forces. Damage to the blood-brain barrier did not change its permeability to water

  17. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  18. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  19. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  20. Barriers to cancer screening in Hmong Americans: the influence of health care accessibility, culture, and cancer literacy.

    Science.gov (United States)

    Lee, Hee Yun; Vang, Suzanne

    2010-06-01

    Hmong Americans face high cancer mortality rates even in comparison to their Asian American counterparts, and report low utilization of cancer screenings. To date, no study has been conducted on the cultural barriers this population faces in undergoing cancer screenings. A systematic review of the literature was conducted to examine the existing knowledge regarding the barriers to cancer screening for Hmong Americans. Potential barriers were identified from this examination to include: health access factors (type of health insurance, ethnicity of provider, low English proficiency, and years spent in the U.S.); cultural factors (belief in the spiritual etiology of diseases, patriarchal values, modesty, and mistrust of the western medical system); and cancer literacy factors (cancer and prevention illiteracy). Based on this review, potential cultural and ethnic group-specific prevention strategies and cancer health policies are discussed to address these barriers and enhance screening behavior among the Hmong.

  1. Influence of intestinal early enteral nutrition therapy on intestinal barrier function and immune response of patients with radiation enteritis

    International Nuclear Information System (INIS)

    Liu Guohui; Kang Xin; Chen Gong; Wang Guangyi

    2012-01-01

    Objective: To investigate the influence of early enteral nutrition therapy on the intestinal barrier function and immune response of the patients with radiation enteritis (ER) so as to find a relatively simple and effective method to treat RE. Methods: Fifty-six patients with radiation enteritis (RE) diagnosed by colonoscopy, X-rays, and pathology were randomly divided into 2 equal groups: experimental group undergoing enteral nutrition therapy, and control group undergoing conventional therapy only. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Five cases from the experimental group and 5 cases from the control group underwent second-time operation because of incomplete intestinal obstruction, intestinal stenosis, or recurrent tumor respectively. The biopsy specimens of the terminal ileum or distal descending colon taken during the first and second operations underwent pathological examination. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Results: There were no significant differences in the intestinal function and blood immunological indices between these 2 groups. The levels of DAO, D-lactic acid, and endotoxin,and the L/M ratio 11 days after admission of the experiment group were all significantly lower than those of the control group (t=2.568, 2.427, 2.143, 2.443, P<0.05), and all those indices 21 days after admission of the experiment group were all much more significantly lower in comparison with the control group (t=6.019, 12.834, 7.837, 7.997, P<0.01). The levels of IgG, IgM, and IgA, and CD4/CD8 ratio 11 days after admission of the experimental group were all significantly higher than

  2. Silicon oxide barrier films deposited on PET foils in pulsed plasmas: influence of substrate bias on deposition process and film properties

    International Nuclear Information System (INIS)

    Steves, S; Bibinov, N; Awakowicz, P; Ozkaya, B; Liu, C-N; Ozcan, O; Grundmeier, G

    2013-01-01

    A widely used plastic for packaging, polyethylene terephtalate (PET) offers limited barrier properties against gas permeation. For many applications of PET (from food packaging to micro electronics) improved barrier properties are essential. A silicon oxide barrier coating of PET foils is applied by means of a pulsed microwave driven low-pressure plasma. While the adjustment of the microwave power allows for a control of the ion production during the plasma pulse, a substrate bias controls the energy of ions impinging on the substrate. Detailed analysis of deposited films applying oxygen permeation measurements, x-ray photoelectron spectroscopy and atomic force microscopy are correlated with results from plasma diagnostics describing the deposition process. The influence of a change in process parameters such as gas mixture and substrate bias on the gas temperature, electron density, mean electron energy, ion energy and the atomic oxygen density is studied. An additional substrate bias results in an increase in atomic oxygen density up to a factor of 6, although plasma parameter such as electron density of n e = 3.8 ± 0.8 × 10 17 m −3 and electron temperature of k B T e = 1.7 ± 0.1 eV are unmodified. It is shown that atomic oxygen densities measured during deposition process higher than n O = 1.8 × 10 21 m −3 yield in barrier films with a barrier improvement factor up to 150. Good barrier films are highly cross-linked and show a smooth morphology. (paper)

  3. Gromwell (Lithospermum erythrorhizon) Supplementation Enhances Epidermal Levels of Ceramides, Glucosylceramides, β-Glucocerebrosidase, and Acidic Sphingomyelinase in NC/Nga Mice

    OpenAIRE

    Kim, Jungmin; Cho, Yunhi

    2013-01-01

    We have previously reported that dietary gromwell (Lithospermum erythrorhizon; LE) prevents the development of atopic dermatitis (AD) with increased epidermal levels of total ceramide (Cer), the major lipid maintaining epidermal barrier. In this study, we investigated whether the increased level of total Cer induced by dietary LE would be related to the altered metabolism of glucosylceramide (GlcCer) and sphingomyelin (SM), two major precursor lipids in Cer generation. NC/Nga mice, an animal ...

  4. Renal origin of rat urinary epidermal growth factor

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1984-01-01

    The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...

  5. The Influence of High-Energy Electrons Irradiation on Surface of n-GaP and on Au/n-GaP/Al Schottky Barrier Diode

    Science.gov (United States)

    Demir, K. Çinar; Kurudirek, S. V.; Oz, S.; Biber, M.; Aydoğan, Ş.; Şahin, Y.; Coşkun, C.

    We fabricated 25 Au/n-GaP/Al Schottky devices and investigated the influence of high electron irradiation, which has 12MeV on the devices, at room temperature. The X-ray diffraction patterns, scanning electron microscopic images and Raman spectra of a gallium phosphide (GaP) semiconductor before and after electron irradiation have been analyzed. Furthermore, some electrical measurements of the devices were carried out through the current-voltage (I-V) and capacitance-voltage (C-V) measurements. From the I-V characteristics, experimental ideality factor n and barrier height Φ values of these Schottky diodes have been determined before and after irradiation, respectively. The results have also been analyzed statically, and a gauss distribution has been obtained. The built-in potential Vbi, barrier height Φ, Fermi level EF and donor concentration Nd values have been determined from the reverse bias C-V and C-2-V curves of Au/n-GaP/Al Schottky barrier diodes at 100kHz before and after 12MeV electron irradiation. Furthermore, we obtained the series resistance values of Au/n-GaP/Al Schottky barrier diodes with the help of different methods. Experimental results confirmed that the electrical characterization of the device changed with the electron irradiation.

  6. The influence of acculturation and breast cancer-specific distress on perceived barriers to genetic testing for breast cancer among women of African descent.

    Science.gov (United States)

    Sussner, Katarina M; Thompson, Hayley S; Jandorf, Lina; Edwards, Tiffany A; Forman, Andrea; Brown, Karen; Kapil-Pair, Nidhi; Bovbjerg, Dana H; Schwartz, Marc D; Valdimarsdottir, Heiddis B

    2009-09-01

    Rising health disparities are increasingly evident in relation to use of genetic services (including genetic counseling and testing) for breast cancer risk, with women of African descent less likely to use genetic services compared with Whites. Meanwhile, little is known regarding potential within-group acculturation and psychological differences underlying perceived barriers to genetic testing among women of African descent. Hypothesized contributions of acculturation factors and breast cancer-specific distress to perceived barriers to genetic testing were examined with a statistical analysis of baseline data from 146 women of African descent (56% US born and 44% foreign born) meeting genetic breast cancer risk criteria and participating in a larger longitudinal study that included the opportunity for free genetic counseling and testing. Perceived barriers assessed included: (1) anticipation of negative emotional reactions, (2) stigma, (3) confidentiality concerns, (4) family-related worry, and (5) family-related guilt associated with genetic testing. In multivariate analyses, being foreign born was a significant predictor of anticipated negative emotional reactions about genetic testing (beta=0.26; SE=0.11; p=0.01). Breast cancer-specific distress scores (avoidance symptoms) were positively related to anticipated negative emotional reactions (beta=0.02; SE=0.005; p=barriers to genetic testing among women of African descent. The potential utility of culturally tailored genetic counseling services taking into account such influences and addressing emotional and psychological concerns of women considering genetic testing for breast cancer should be investigated.

  7. The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology

    DEFF Research Database (Denmark)

    Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J

    2017-01-01

    The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....

  8. The influence of the structures and compounds of DLC coatings on the barrier properties of PET bottles

    International Nuclear Information System (INIS)

    Li, Yang; Zhen-Duo, Wang; Shou-Ye, Zhang; Li-Zhen, Yang; Qiang, Chen

    2009-01-01

    To reduce the oxygen transmission rate through a polyethylene terephthalate (PET) bottle (an organic plastic) diamond-like carbon (DLC) coatings on the inner surface of the PET bottle were deposited by radio frequency plasma-enhanced chemical vapour deposition (RF-PECVD) technology with C 2 H 2 as the source of carbon and Ar as the diluted gas. As the barrier layer to humidity and gas permeation, this paper analyses the DLC film structure, composition, morphology and barrier properties by Fourier transform infrared, atomic force microscopy, scanning electron microscopy and oxygen transmission rate in detail. From the spectrum, it is found that the DLC film mainly consists of sp 3 bonds. The barrier property of the films is significantly relevant to the sp 3 bond concentration in the coating, the film thickness and morphology. Additionally, it is found that DLC film deposited in an inductively coupled plasma enhanced capacitively coupled plasma source shows a compact, homogeneous and crack-free surface, which is beneficial for a good gas barrier property in PET bottles. (fluids, plasmas and electric discharges)

  9. Attitudes and perceived barriers influencing incident reporting by nurses and their correlation with reported incidents: A systematic review.

    Science.gov (United States)

    Fung, Wing Mei; Koh, Serena Siew Lin; Chow, Yeow Leng

    Clinical incident reporting is an integral feature of risk management system in the healthcare sector. By reporting clinical incidents, nurses allow for learning from errors, identification of error patterns and development of error preventive strategies. The need to understand attitudes to reporting, perceived barriers and incident reporting patterns by nurses are the core highlights of this review. INCLUSION CRITERIA: This review considered descriptive quantitative studies that examined nurses' attitudes or perceived barriers towards incident reporting.The participants in this review were nurses working in acute care settings or step-down care settings. Studies that included non-nursing healthcare personnel were excluded.This review considered studies which examined nurses' attitudes towards incident reporting, perceived barriers and incident reporting practices.The outcomes of interest were the attitudes that nurses have towards incident reporting, perceived barriers and the types of reported incidents in correlation with nurses' attitudes and barriers. A three-step search strategy was utilised in this review. An initial limited search of CINAHL and MEDLINE was undertaken. Search strategies were then developed using identified keywords and index terms. Lastly, the reference lists of all identified articles were examined. All searches were limited to studies published in English, between 1991 and 2010. The studies were independently assessed by two reviewers using the Joanna Briggs Institute Critical Appraisal Checklist for Descriptive/ Case Series studies. The reviewers extracted data independently from included studies using the Joanna Briggs Institute Data Extraction Form for Descriptive/ Case Series studies. Due to the descriptive nature of the study designs, statistical pooling was not possible. Therefore, the findings of this systematic review are presented in a narrative summary. Fifty-five papers were identified from the searches based on their titles and

  10. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  11. Transgressive Shoreface Response in the Mississippi River DeltaShoreface Sediment Budget Influence on Barrier Island Evolution, Louisiana, USA

    Science.gov (United States)

    Beasley, B.; Georgiou, I. Y.; Miner, M. D.

    2017-12-01

    In Louisiana barrier islands are undergoing rapid morphological change due to shoreface retreat and increasing bay tidal prism driven by high rates of relative sea-level rise (RSLR) (1 cm/yr) and interior wetland loss, respectively. Previous works utilized historical region-scale bathymetry change and shoreline change analyses to assess large-scale coastal evolution. However, more localized assessments considering the role of sediment transport processes in regional evolution are lacking. This is essential to predicting coastal change trajectories and allocating limited sand resources for nourishment. Using historic bathymetric and shoreline data dating to the 1890s for the Louisiana coast, 100-m spaced shore-normal transects were created to track meter-scale elevation change for 1890, 1930, 1980, 2006, and 2015. An automated framework was used to quantify and track barrier island evolution parameters such as shoreline change, area, width, bathymetric contour migration, and shoreface slope. During the 125 yr analysis period, shoreline erosion mean rates slowed from 12 to 6 m/yr while lower shoreface migration mean rates increased from 5 to 25 m/yr. Locally, retreat rates for the Caminada Headland upper shoreface slowed from 18 to 8 m/yr while lower shoreface retreat rates increased from 8 to 14m/yr. The Timbalier Islands experienced increased migration rates along the entire shoreface, while the lower shoreface of the Isles Dernieres transitioned from progradational to erosional (-5 m/yr in 1890 to 20 m/yr in 2006). Our analysis suggests that although shoreline erosion rates decreased, overall landward migration of the barrier system increased as the shoreface steepened. Our results illustrate that monitoring subaerial island erosion rates are insufficient for evaluating regional dynamics of transgressive coastal systems. The longevity of barriers appears diminished due to a reduction in the shoreface sediment available and further corroborates the role of the

  12. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  13. Influence of supplementary cementitious materials on the properties of concrete for secondary protection barrier in radioactive waste repositories

    Czech Academy of Sciences Publication Activity Database

    Koťátková, J.; Čáchová, M.; Bezdička, Petr; Vejmelková, E.; Konvalinka, P.; Zemanová, L.; Černý, R.

    2018-01-01

    Roč. 760, SI (2018), s. 96-101 ISSN 1662-9795. [Special Concrete and Composites 2017 /14./. Lísek, 10.10.2017-11.10.2017] R&D Projects: GA ČR(CZ) GA17-11635S Institutional support: RVO:61388980 Keywords : Basic physical properties * Mechanical properties * Repository * Secondary protection barrier * Supplementary cementitious materials * Thermal properties Subject RIV: CA - Inorganic Chemistry OBOR OECD: Inorganic and nuclear chemistry

  14. Alterations of the genes involved in the PI3K and estrogen-receptor pathways influence outcome in human epidermal growth factor receptor 2-positive and hormone receptor-positive breast cancer patients treated with trastuzumab-containing neoadjuvant chemotherapy

    International Nuclear Information System (INIS)

    Takada, Mamoru; Miyazaki, Masaru; Sato-Otsubo, Aiko; Ogawa, Seishi; Kaneko, Yasuhiko; Higuchi, Toru; Tozuka, Katsunori; Takei, Hiroyuki; Haruta, Masayuki; Watanabe, Junko; Kasai, Fumio; Inoue, Kenichi; Kurosumi, Masafumi

    2013-01-01

    Chemotherapy with trastuzumab is widely used for patients with human epidermal growth factor receptor 2-positive (HER2+) breast cancer, but a significant number of patients with the tumor fail to respond, or relapse. The mechanisms of recurrence and biomarkers that indicate the response to the chemotherapy and outcome are not fully investigated. Genomic alterations were analyzed using single-nucleotide polymorphism arrays in 46 HER2 immunohistochemistry (IHC) 3+ or 2+/fluorescent in situ hybridization (FISH)+ breast cancers that were treated with neoadjuvant chemotherapy with paclitaxel, cyclophosphamid, epirubicin, fluorouracil, and trastuzumab. Patients were classified into two groups based on presence or absence of alterations of 65 cancer-associated genes, and the two groups were further classified into four groups based on genomic HER2 copy numbers or hormone receptor status (HR+/−). Pathological complete response (pCR) and relapse-free survival (RFS) rates were compared between any two of the groups. The pCR rate was 54% in 37 patients, and the RFS rate at 3 years was 72% (95% CI, 0.55-0.89) in 42 patients. The analysis disclosed 8 tumors with nonamplified HER2 and 38 tumors with HER2 amplification, indicating the presence of discordance in tumors diagnosed using current HER2 testing. The 8 patients showed more difficulty in achieving pCR (P=0.019), more frequent relapse (P=0.018), and more frequent alterations of genes in the PI3K pathway (P=0.009) than the patients with HER2 amplification. The alterations of the PI3K and estrogen receptor (ER) pathway genes generally indicated worse RFS rates. The prognostic significance of the alterations was shown in patients with a HR+ tumor, but not in patients with a HR- tumor when divided. Alterations of the PI3K and ER pathway genes found in patients with a HR+ tumor with poor outcome suggested that crosstalk between the two pathways may be involved in resistance to the current chemotherapy with trastuzumab. We

  15. EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

    African Journals Online (AJOL)

    Administrator

    stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

  16. FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

    African Journals Online (AJOL)

    Administrator

    alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

  17. Stevens Johnsons syndrom og toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

    2013-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

  18. The barriers associated with emergency medical service use for acute coronary syndrome: the awareness and influence of an Australian public mass media campaign.

    Science.gov (United States)

    Cartledge, Susie; Finn, Judith; Straney, Lahn; Ngu, Phillip; Stub, Dion; Patsamanis, Harry; Shaw, James; Bray, Janet

    2017-07-01

    Emergency medical services (EMS) transport to hospital is recommended in acute coronary syndrome (ACS) guidelines, but only half of patients with ACS currently use EMS. The recent Australian Warning Signs campaign conducted by the Heart Foundation addressed some of the known barriers against using EMS. Our aim was to examine the influence of awareness of the campaign on these barriers in patients with ACS. Interviews were conducted with patients admitted to an Australian tertiary hospital between July 2013 and April 2014 with a diagnosis of ACS. Patient selection criteria included: aged 35-75 years, competent to provide consent, English speaking, not in residential care and medically stable. Multivariable logistic regression was used to examine factors associated with EMS use. Only 54% of the 199 patients with ACS interviewed used EMS for transport to hospital. Overall 64% of patients recalled seeing the campaign advertising, but this was not associated with increased EMS use (52.0%vs56.9%, p=0.49) or in the barriers against using EMS. A large proportion of patients (43%) using other transport thought it would be faster. Factors associated with EMS use for ACS were: age >65 years, ST-elevation myocardial infarction, a sudden onset of pain and experiencing vomiting. In medically stable patients with ACS, awareness of the Australian Warning Signs campaign was not associated with increased use of EMS or a change in the barriers for EMS use. Future education strategies could emphasise the clinical role that EMS provide in ACS. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  19. Reactions with Weakly Bound Nuclei, at near Barrier Energies, and the Breakup and Transfer Influences on the Fusion and Elastic Scattering

    International Nuclear Information System (INIS)

    Gomes, P. R. S.; Lubian, J.; Mendes-Junior, D. R.; Faria, P. N. de; Linares, R.; Sigaud, L.; Rangel, J.; Ferreira, J. L.; Paes, B.; Cardozo, E. N.; Cortes, M. R.; Canto, L. F.; Ermamatov, M. J.; Otomar, D. R.; Ferioli, E.; Lotti, P.; Hussein, M. S.

    2016-01-01

    We present a brief review of the reaction mechanisms involved in collisions of weakly bound projectiles with tightly bound targets, at near-barrier energies. We discuss systematic behaviors of the data, with emphasis in fusion, breakup, nucleon transfer and elastic scattering. The dependence of the breakup cross section on the charge and mass of the target is discussed, and the influence of the breakup channel on complete fusion is investigated. For this purpose, we compare reduced fusion cross sections with a benchmark universal curve. The behaviors observed in the comparisons are explained in terms of polarization potentials and of nucleon transfer followed by breakup. The influence of the breakup process on elastic scattering is also discussed. Some apparent contradictions between results of different authors are explained and some perspectives of the field are presented. (author)

  20. The Influence of Gas Composition in Dielectric Barrier Discharges on the Broadening of the Hydrogen Hα Transition

    International Nuclear Information System (INIS)

    Janus, H. W.

    2006-01-01

    The distribution of hydrogen atoms responsible for emission of the Balmer Hα line in the region of the dielectric barrier discharges in the helium and hydrogen as well as in the argon and hydrogen mixtures, in the direction perpendicular to the electrode surfaces, has bee determined by the optical emission spectroscopy accounting for the polarization of the emitted light. The procedure of fitting the measured line profiles accounting for the Stark effect has been used for determination of the distribution of the electric field in the discharge region

  1. Improving Behavioral Support for Smoking Cessation in Pregnancy: What Are the Barriers to Stopping and Which Behavior Change Techniques Can Influence These? Application of Theoretical Domains Framework.

    Science.gov (United States)

    Campbell, Katarzyna A; Fergie, Libby; Coleman-Haynes, Tom; Cooper, Sue; Lorencatto, Fabiana; Ussher, Michael; Dyas, Jane; Coleman, Tim

    2018-02-17

    Behavioral support interventions are used to help pregnant smokers stop; however, of those tested, few are proven effective. Systematic research developing effective pregnancy-specific behavior change techniques (BCTs) is ongoing. This paper reports contributory work identifying potentially-effective BCTs relative to known important barriers and facilitators (B&Fs) to smoking cessation in pregnancy; to detect priority areas for BCTs development. A Nominal Group Technique with cessation experts ( n = 12) elicited an expert consensus on B&Fs most influencing women's smoking cessation and those most modifiable through behavioral support. Effective cessation interventions in randomized trials from a recent Cochrane review were coded into component BCTs using existing taxonomies. B&Fs were categorized using Theoretical Domains Framework (TDF) domains. Matrices, mapping BCT taxonomies against TDF domains, were consulted to investigate the extent to which BCTs in existing interventions target key B&Fs. Experts ranked "smoking a social norm" and "quitting not a priority" as most important barriers and "desire to protect baby" an important facilitator to quitting. From 14 trials, 23 potentially-effective BCTs were identified (e.g., information about consequences). Most B&Fs fell into "Social Influences", "Knowledge", "Emotions" and "Intentions" TDF domains; few potentially-effective BCTs mapped onto every TDF domain. B&Fs identified by experts as important to cessation, are not sufficiently targeted by BCT's currently within interventions for smoking cessation in pregnancy.

  2. Calculation of the Electronic Parameters of an Al/DNA/p-Si Schottky Barrier Diode Influenced by Alpha Radiation

    Directory of Open Access Journals (Sweden)

    Hassan Maktuff Jaber Al-Ta'ii

    2015-02-01

    Full Text Available Many types of materials such as inorganic semiconductors have been employed as detectors for nuclear radiation, the importance of which has increased significantly due to recent nuclear catastrophes. Despite the many advantages of this type of materials, the ability to measure direct cellular or biological responses to radiation might improve detector sensitivity. In this context, semiconducting organic materials such as deoxyribonucleic acid or DNA have been studied in recent years. This was established by studying the varying electronic properties of DNA-metal or semiconductor junctions when exposed to radiation. In this work, we investigated the electronics of aluminium (Al/DNA/silicon (Si rectifying junctions using their current-voltage (I-V characteristics when exposed to alpha radiation. Diode parameters such as ideality factor, barrier height and series resistance were determined for different irradiation times. The observed results show significant changes with exposure time or total dosage received. An increased deviation from ideal diode conditions (7.2 to 18.0 was observed when they were bombarded with alpha particles for up to 40 min. Using the conventional technique, barrier height values were observed to generally increase after 2, 6, 10, 20 and 30 min of radiation. The same trend was seen in the values of the series resistance (0.5889–1.423 Ω for 2–8 min. These changes in the electronic properties of the DNA/Si junctions could therefore be utilized in the construction of sensitive alpha particle detectors.

  3. Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

    Science.gov (United States)

    Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

    2013-06-01

    In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  4. Thermal cycling damage evolution of a thermal barrier coating and the influence of substrate creep, interface roughness and pre-oxidation

    Energy Technology Data Exchange (ETDEWEB)

    Schweda, Mario; Beck, Tilmann; Singheiser, Lorenz [Forschungszentrum Juelich GmbH (DE). Inst. fuer Energie- und Klimaforschung (IEK), Werkstoffstruktur und Eigenschaften (IEK-2)

    2012-01-15

    The influence of roughness profile shape, roughness depth, bond coat creep strength and pre-oxidation on the thermal cycling damage evolution and lifetime of a plasma-sprayed ZrO{sub 2} thermal barrier coating system was investigated. A simplified model system was used where FeCrAlY substrates simulated the bond coat. Substrate creep was varied by using the oxide dispersoid strengthened alloy MA956 and the conventional material Fecralloy. Stochastic 3- and periodic 2-dimensional roughness profiles were produced by sand blasting and high speed turning. Damage evolution is significantly influenced by substrate creep with a trend to higher lifetimes for the fast creeping substrate. Pre-oxidation has no influence. Lifetimes of the periodically profiled samples are up to 100 times lower than these of stochastically profiled samples. In the case of periodically profiled samples, the highest lifetime was reached for the highest roughness depth combined with local undercuttings in the roughness profile. For stochastically profiled samples the influence of roughness depth could not be determined due to the wide lifetime scatter. (orig.)

  5. Influence of the oxygen electrode and inter-diffusion barrier on the degradation of solid oxide electrolysis cells

    DEFF Research Database (Denmark)

    Hjalmarsson, Per; Sun, Xiufu; Liu, Yi-Lin

    2013-01-01

    -diffusion barrier sandwiched between the YSZ electrolyte and an LSCF:CGO oxygen electrode. Impedance Spectroscopy was used during the tests to diagnose the change in electrochemical response of the different components of the SOECs. The results showed a significantly lower degradation rate for the cell with an LSCF......Two Solid Oxide Electrolysis Cells (SOECs) with different oxygen electrodes have been tested in galvanostatic tests carried out at −1.5 Acm−2 and 800 °C converting 60% of a 50:50% mixture of H2O and CO2 (co-electrolysis). One of the cells had an LSM:YSZ oxygen electrode. The other had an CGO inter...

  6. Influence of semiconductor barrier tunneling on the current-voltage characteristics of tunnel metal-oxide-semiconductor diodes

    DEFF Research Database (Denmark)

    Nielsen, Otto M.

    1983-01-01

    of multistep tunneling recombination current and injected minority carrier diffusion current. This can explain the observed values of the diode quality factor n. The results also show that the voltage drop across the oxide Vox is increased with increased NA, with the result that the lowering of the minority...... carrier diode current Jmin is greater than in the usual theory. The conclusion drawn is that the increase in Vox and lowering of Jmin is due to multistep tunneling of majority carriers through the semiconductor barrier. Journal of Applied Physics is copyrighted by The American Institute of Physics.......Current–voltage characteristics have been examined for Al–SiO2–pSi diodes with an interfacial oxide thickness of delta[approximately-equal-to]20 Å. The diodes were fabricated on and oriented substrates with an impurity concentration in the range of NA=1014–1016 cm−3. The results show that for low...

  7. Trypanosome infection establishment in the tsetse fly gut is influenced by microbiome-regulated host immune barriers.

    Directory of Open Access Journals (Sweden)

    Brian L Weiss

    Full Text Available Tsetse flies (Glossina spp. vector pathogenic African trypanosomes, which cause sleeping sickness in humans and nagana in domesticated animals. Additionally, tsetse harbors 3 maternally transmitted endosymbiotic bacteria that modulate their host's physiology. Tsetse is highly resistant to infection with trypanosomes, and this phenotype depends on multiple physiological factors at the time of challenge. These factors include host age, density of maternally-derived trypanolytic effector molecules present in the gut, and symbiont status during development. In this study, we investigated the molecular mechanisms that result in tsetse's resistance to trypanosomes. We found that following parasite challenge, young susceptible tsetse present a highly attenuated immune response. In contrast, mature refractory flies express higher levels of genes associated with humoral (attacin and pgrp-lb and epithelial (inducible nitric oxide synthase and dual oxidase immunity. Additionally, we discovered that tsetse must harbor its endogenous microbiome during intrauterine larval development in order to present a parasite refractory phenotype during adulthood. Interestingly, mature aposymbiotic flies (Gmm(Apo present a strong immune response earlier in the infection process than do WT flies that harbor symbiotic bacteria throughout their entire lifecycle. However, this early response fails to confer significant resistance to trypanosomes. Gmm(Apo adults present a structurally compromised peritrophic matrix (PM, which lines the fly midgut and serves as a physical barrier that separates luminal contents from immune responsive epithelial cells. We propose that the early immune response we observe in Gmm(Apo flies following parasite challenge results from the premature exposure of gut epithelia to parasite-derived immunogens in the absence of a robust PM. Thus, tsetse's PM appears to regulate the timing of host immune induction following parasite challenge. Our results

  8. Noninvasive evaluation of the barrier properties of the skin

    Directory of Open Access Journals (Sweden)

    Utz S.R.

    2014-09-01

    Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.

  9. Influence of deposition conditions on the microstructure of Al-based coatings for applications as corrosion and anti-permeation barrier

    Energy Technology Data Exchange (ETDEWEB)

    Wulf, Sven-Erik, E-mail: sven-erik.wulf@kit.edu; Holstein, Nils; Krauss, Wolfgang; Konys, Jürgen

    2013-10-15

    Highlights: • Electrochemical Al deposition is industrially relevant for barrier formation. • Al coatings have to be converted into protective layers by heat treatments. • Morphology of Al coatings made by ECX process depends on deposition parameters. • Heat treatment behavior depends on the morphology of the coating produced by ECX. • ECX is proven to produce layer sequences on Eurofer similar to HDA and ECA process. -- Abstract: Previous research revealed that the application of aluminum-based barriers is suitable to minimize corrosion rates of Eurofer steel in Pb–15.7Li and tritium-permeation from the liquid breeder into the cooling system (HCLL) in an envisaged future fusion reactor. Besides the former developed hot-dip-aluminization process (HDA), electrodeposition techniques based on water-free electrolytes, such as toluene-based electrolytes (ECA) and ionic liquids (ECX), showed promising results for the production of suitable aluminum layers. These processes allow electrodeposition of Al-layers on Eurofer steel with adjustable layer thicknesses, but a heat treatment procedure is needed afterwards to form the desired Fe–Al/Alumina scale. To investigate the deposition and treatment process in more detail, a new series of aluminum electroplating was performed by using the ECX process. The variation of deposition parameters (direct and pulsed current) showed clear impact on the morphology of deposited Al-layers. Heat treatments revealed that the formation of Fe–Al barriers is significantly influenced by the morphology of deposits, beyond other parameters like layer thickness. Presented metallographic and SEM/EDX analyses underline the occurred dependencies between deposition conditions and morphology and on the other hand Al-layer morphology and heat treatment behavior.

  10. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  11. A qualitative study of enablers and barriers influencing the incorporation of social accountability values into organisational culture: a perspective from two medical schools.

    Science.gov (United States)

    Leigh-Hunt, Nicholas; Stroud, Laura; Murdoch Eaton, Deborah; Rudolf, Mary

    2015-01-01

    Definitions of social accountability describe the obligation of medical schools to direct education, research and service activities towards addressing the priority health concerns of the population they serve. While such statements give some direction as to how the goal might be reached, it does not identify what factors might facilitate or hinder its achievement. This study set out to identify and explore enablers and barriers influencing the incorporation of social accountability values into medical schools. Semi structured interviews of fourteen senior staff in Bar Ilan and Leeds medical schools were undertaken following a literature review. Participants were recruited by purposive sampling in order to identify factors perceived to play a part in the workings of each institution. Academic prestige was seen as a key barrier that was dependent on research priorities and student selection. The role of champions was considered to be vital to tackle staff perceptions and facilitate progress. Including practical community experience for students was felt to be a relevant way in which the curriculum could be designed through engagement with local partners. Successful adoption of social accountability values requires addressing concerns around potential negative impacts on academic prestige and standards. Identifying and supporting credible social accountability champions to disseminate the values throughout research and education departments in medical and other faculties is also necessary, including mapping onto existing work streams and research agendas. Demonstrating the contribution the institution can make to local health improvement and regional development by a consideration of its economic footprint may also be valuable.

  12. Speech pathologists' experiences with stroke clinical practice guidelines and the barriers and facilitators influencing their use: a national descriptive study.

    Science.gov (United States)

    Hadely, Kathleen A; Power, Emma; O'Halloran, Robyn

    2014-03-06

    Communication and swallowing disorders are a common consequence of stroke. Clinical practice guidelines (CPGs) have been created to assist health professionals to put research evidence into clinical practice and can improve stroke care outcomes. However, CPGs are often not successfully implemented in clinical practice and research is needed to explore the factors that influence speech pathologists' implementation of stroke CPGs. This study aimed to describe speech pathologists' experiences and current use of guidelines, and to identify what factors influence speech pathologists' implementation of stroke CPGs. Speech pathologists working in stroke rehabilitation who had used a stroke CPG were invited to complete a 39-item online survey. Content analysis and descriptive and inferential statistics were used to analyse the data. 320 participants from all states and territories of Australia were surveyed. Almost all speech pathologists had used a stroke CPG and had found the guideline "somewhat useful" or "very useful". Factors that speech pathologists perceived influenced CPG implementation included the: (a) guideline itself, (b) work environment, (c) aspects related to the speech pathologist themselves, (d) patient characteristics, and (e) types of implementation strategies provided. There are many different factors that can influence speech pathologists' implementation of CPGs. The factors that influenced the implementation of CPGs can be understood in terms of knowledge creation and implementation frameworks. Speech pathologists should continue to adapt the stroke CPG to their local work environment and evaluate their use. To enhance guideline implementation, they may benefit from a combination of educational meetings and resources, outreach visits, support from senior colleagues, and audit and feedback strategies.

  13. Prey Density Threshold and Tidal Influence on Reef Manta Ray Foraging at an Aggregation Site on the Great Barrier Reef.

    Directory of Open Access Journals (Sweden)

    Asia O Armstrong

    Full Text Available Large tropical and sub-tropical marine animals must meet their energetic requirements in a largely oligotrophic environment. Many planktivorous elasmobranchs, whose thermal ecologies prevent foraging in nutrient-rich polar waters, aggregate seasonally at predictable locations throughout tropical oceans where they are observed feeding. Here we investigate the foraging and oceanographic environment around Lady Elliot Island, a known aggregation site for reef manta rays Manta alfredi in the southern Great Barrier Reef. The foraging behaviour of reef manta rays was analysed in relation to zooplankton populations and local oceanography, and compared to long-term sighting records of reef manta rays from the dive operator on the island. Reef manta rays fed at Lady Elliot Island when zooplankton biomass and abundance were significantly higher than other times. The critical prey density threshold that triggered feeding was 11.2 mg m-3 while zooplankton size had no significant effect on feeding. The community composition and size structure of the zooplankton was similar when reef manta rays were feeding or not, with only the density of zooplankton changing. Higher zooplankton biomass was observed prior to low tide, and long-term (~5 years sighting data confirmed that more reef manta rays are also observed feeding during this tidal phase than other times. This is the first study to examine prey availability at an aggregation site for reef manta rays and it indicates that they feed in locations and at times of higher zooplankton biomass.

  14. Influence of duration and rate of pulse rise of the applied voltage on ozone concentration in the barrier glow discharge

    International Nuclear Information System (INIS)

    Krasnyj, V.V.; Klosovski, A.V.; Knysh, A.S.; Shvets, O.M.; Taran, V.S.; Tereshin, V.I.

    2005-01-01

    The barrier glow discharge between two planar electrodes, covered with dielectric, is studied under high-voltage pulsed power supply. Wide applications of such type of discharges, in particular, for ozone production, stimulated a number of investigations in this direction. In this work we investigated the dependence of ozone concentration on the duration and the rate of pulse rise of the applied voltage. The thyristor converter circuit with the shortening of input pulses on the base of the saturable throttle was used for the realization of this task. The output pulses with amplitude up to 15 kV, repetition frequency of 1 kHz, pulse duration of 0.3 μs (or 7 μs) and the rate of pulse rise of 0.1 μs were generated with this scheme. Measurements of the ozone concentration produced in the air mixture have shown that its value increased by factor two with variation of the rate of pulse rise from 0.5 μs to 0.1 μs (for pulse duration of 7 μs). The dependence of the ozone concentration on the variation of air mixture pressure in the discharge gap of reactor was investigated also. It was shown proportional increase of the output concentration of ozone with increasing the pressure value. Spectroscopic measurements carried out in the ultraviolet spectrum made it possible to analyze changing the concentration of ozone and nitric components. (author)

  15. Numerical study of the influence of dielectric tube on propagation of atmospheric pressure plasma jet based on coplanar dielectric barrier discharge

    Science.gov (United States)

    Haixin, HU; Feng, HE; Ping, ZHU; Jiting, OUYANG

    2018-05-01

    A 2D fluid model was employed to simulate the influence of dielectric on the propagation of atmospheric pressure helium plasma jet based on coplanar dielectric barrier discharge (DBD). The spatio-temporal distributions of electron density, ionization rate, electrical field, spatial charge and the spatial structure were obtained for different dielectric tubes that limit the helium flow. The results show that the change of the relative permittivity of the dielectric tube where the plasma jet travels inside has no influence on the formation of DBD itself, but has great impact on the jet propagation. The velocity of the plasma jet changes drastically when the jet passes from a tube of higher permittivity to one of lower permittivity, resulting in an increase in jet length, ionization rate and electric field, as well as a change in the distribution of space charges and discharge states. The radius of the dielectric tube has a great influence on the ring-shaped or solid bullet structure. These results can well explain the behavior of the plasma jet from the dielectric tube into the ambient air and the hollow bullet in experiments.

  16. [11C]befloxatone brain kinetics is not influenced by Bcrp function at the blood-brain barrier: A PET study using Bcrp TGEM knockout rats

    International Nuclear Information System (INIS)

    Hosten, Benoit; Jacob, Aude; Saubamea, Bruno; Scherrmann, Jean-Michel; Boisgard, Raphael; Goutal, Sebastien; Dolle, Frederic; Tournier, Nicolas; Cisternino, Salvatore

    2013-01-01

    Knockout (KO) animals are useful tools with which to assess the interplay between P-glycoprotein (P-gp; Abcb1) and the breast cancer resistance protein (Bcrp, Abcg2), two major ABC-transporters expressed at the blood-brain barrier (BBB). However, one major drawback of such deficient models is the possible involvement of compensation between transporters. In the present study, P-gp and Bcrp distribution in the brain as well as P-gp expression levels at the BBB were compared between the Bcrp TGEM KO rat model and the wild-type (WT) strain. Therefore, we used confocal microscopy of brain slices and western blot analysis of the isolated brain microvessels forming the BBB. This deficient rat model was used to assess the influence of Bcrp on the brain and peripheral kinetics of its substrate [ 11 C]befloxatone using positron emission tomography (PET). The influence of additional P-gp inhibition was tested using elacridar (GF120918) 2 mg/kg in Bcrp KO rats. The distribution pattern of P-gp in the brain as well as P-gp expression levels at the BBB was similar in Bcrp-deficient and WT rats. Brain and peripheral kinetics of [ 11 C]befloxatone were not influenced by the lack of Bcrp. Neither was the brain uptake of [ 11 C]befloxatone in Bcrp-deficient rats influenced by the inhibition of P-gp. In conclusion, the Bcrp-deficient rat strain, in which we detected no compensatory mechanism or modification of P-gp expression as compared to WT rats, is a suitable model to study Bcrp function separately from that of P-gp at the BBB. However, although selectively transported by BCRP in vitro, our results suggest that [ 11 C]befloxatone PET imaging might not be biased by impaired function of this transporter in vivo. (authors)

  17. Identification and comparative analysis of the epidermal differentiation complex in snakes

    Science.gov (United States)

    Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

    2017-01-01

    The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630

  18. TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.

    Science.gov (United States)

    Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina

    2012-10-01

    Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.

  19. Roles of p63 in epidermal development and tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeng-Yuan Yao

    2012-12-01

    Full Text Available pidermis is composed mainly of keratinocytes and is the ma­jor barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcrip­tion factor p63. The p63 gene encodes proteins with structures simi­lar to that of p53, including an N-terminal transacti­vation (TA domain, a DNA-binding domain and a car­boxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epider­mal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis re­mains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.

  20. Retinoic Acid-Induced Epidermal Transdifferentiation in Skin

    Directory of Open Access Journals (Sweden)

    Yoshihiro Akimoto

    2014-06-01

    Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.

  1. Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

    International Nuclear Information System (INIS)

    Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

    2006-01-01

    Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

  2. Antenatal Corticosteroids and Postnatal Fluid Restriction Produce Differential Effects on AQP3 Expression, Water Handling, and Barrier Function in Perinatal Rat Epidermis

    Directory of Open Access Journals (Sweden)

    Johan Agren

    2010-01-01

    Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.

  3. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  4. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

  5. Improving Behavioral Support for Smoking Cessation in Pregnancy: What Are the Barriers to Stopping and Which Behavior Change Techniques Can Influence Them? Application of Theoretical Domains Framework

    Science.gov (United States)

    Coleman-Haynes, Tom; Lorencatto, Fabiana; Ussher, Michael; Dyas, Jane; Coleman, Tim

    2018-01-01

    Behavioral support interventions are used to help pregnant smokers stop; however, of those tested, few are proven effective. Systematic research developing effective pregnancy-specific behavior change techniques (BCTs) is ongoing. This paper reports contributory work identifying potentially-effective BCTs relative to known important barriers and facilitators (B&Fs) to smoking cessation in pregnancy; to detect priority areas for BCTs development. A Nominal Group Technique with cessation experts (n = 12) elicited an expert consensus on B&Fs most influencing women’s smoking cessation and those most modifiable through behavioral support. Effective cessation interventions in randomized trials from a recent Cochrane review were coded into component BCTs using existing taxonomies. B&Fs were categorized using Theoretical Domains Framework (TDF) domains. Matrices, mapping BCT taxonomies against TDF domains, were consulted to investigate the extent to which BCTs in existing interventions target key B&Fs. Experts ranked ‘smoking a social norm’ and ‘quitting not a priority’ as most important barriers and ‘desire to protect baby’ an important facilitator to quitting. From 14 trials, 23 potentially-effective BCTs were identified (e.g., ‘information about consequences). Most B&Fs fell into ‘Social Influences’, ‘Knowledge’, ‘Emotions’ and ‘Intentions’ TDF domains; few potentially-effective BCTs mapped onto every TDF domain. B&Fs identified by experts as important to cessation, are not sufficiently targeted by BCT’s currently within interventions for smoking cessation in pregnancy. PMID:29462994

  6. Study of the influence of the citric and oxalic acid in the uranyl sorption in ZrP2O7 for their use in contention barriers

    International Nuclear Information System (INIS)

    Garcia G, N.

    2009-01-01

    Countries which produce electricity by nuclear means, such as Mexico, need to develop a technology for that at long term safe containment of nuclear waste that are produced in nuclear power plants, for now, the arrangement of these is made by international companies, as which is extremely expensive. The most accepted proposal for the containment of radioactive waste is the Deep Geological Repository (DGR), which consists of a number of natural barriers and of engineering barriers. Currently, barriers to engineering and materials that the make up are still under study, because must meet a series of structural criteria and chemical such as high insolubility, thermal and chemical stability with ionizing radiation. The surface must have adsorbed features of ions and organic compounds dissolved in infiltration water that could penetrate for a crack in the DGR. This study focuses, as first stage, is the uranyl sorption on zirconium diphosphate in various conditions of time, concentration and ph, then evaluates the influence of citric acid and oxalic acid on the sorption of uranyl on ZrP 2 O 7 , in order to model the behaviour of alpha emitters that are dissolved by percolating water laden with salts and organic matter, that infiltrates might during catastrophic events in the DGR. It was confirmed the purity of the zirconium diphosphate because it was synthesized from sea sand with the physicochemical characterization and superficial. The proposed methodology included elemental analysis by neutron activation and X-ray emission induced by charged particles, functional group analysis with infrared spectroscopy, morphology with scanning electron microscopy, crystallinity with transmission electron microscopy and X-ray diffraction. For properties surface was determined, the specific area using Bet multipoint technique, acidity constants in the FITEQL 4.0 program, the hydration time was obtained from literature, the point of zero charge was identified with a mass titration and

  7. Beliefs, barriers, social support, and environmental influences related to diabetes risk behaviours among women with a history of gestational diabetes.

    Science.gov (United States)

    Razee, Husna; van der Ploeg, Hidde P; Blignault, Ilse; Smith, Ben J; Bauman, Adrian E; McLean, Mark; Wah Cheung, N

    2010-08-01

    Women with previous gestational diabetes mellitus (GDM) are at increased risk of developing type 2 diabetes; this risk is higher in non-Caucasian women. This study explored the beliefs, attitudes, social support, environmental influences and other factors related to diabetes risk behaviours among Arabic, Cantonese/Mandarin, and English speaking women with recent GDM. Women living in the Sydney metropolitan area (Australia) who had GDM 6-36 months previously were included. In-depth semi-structured telephone interviews on women's experiences and perceptions of GDM and the lifestyle risk factors for developing type 2 diabetes were conducted in the language participants spoke at home (n=20 Arabic, 20 Cantonese/Mandarin, 17 English). Data were analysed for underlying themes using NVivo software. Mental distress, role perceptions, social support and cultural expectations were major issues related to women's struggles to find the right balance between the large proportion of household and child care responsibilities and leading a healthy lifestyle. Women's ability to follow a healthy lifestyle is embedded in their psychological wellbeing and the social and cultural context of their lives. The study highlights the need for a holistic approach that ensures personal support and access to services as well as lifestyle specific programs.

  8. Etanercept therapy for toxic epidermal necrolysis.

    Science.gov (United States)

    Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio

    2014-08-01

    Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  9. Beliefs and barriers for organ donation and influence of educational intervention on dental students: A questionnaire study

    Directory of Open Access Journals (Sweden)

    Basavaraj Patthi

    2015-01-01

    Full Text Available Introduction: Many developmental disorders or accidents leave the victims crippled resulting in vision loss and fatal damages to the vital organs. At such point of time, organ donation remains the only ray of hope. However, there exists very little awareness among the masses regarding the same. Aim: To assess the knowledge, attitude and, belief on/toward organ donation and the impact of an educational intervention among the Dental undergraduate students of a Dental College of Modinagar, India. Materials and Methods: A questionnaire and intervention based survey was carried out. All the students from B.D.S 1 st year to internship and patients who attended screening/treatment camps organized by the Department of Public Health Dentistry were included for the study. A 11-item structured questionnaire to assess the knowledge, attitude, and beliefs regarding organ donation was used. This was followed by an educational intervention for the college students. Immediately after this session, the same questionnaire was again distributed and collected. Chi-square test was used to analyze the statistical difference. Results: The overall level of knowledge and beliefs about the concept of organ donation in the two groups was similar before the intervention was provided. After the intervention for B.D.S students, a significant improvement in the level of knowledge and attitude was observed. About 74.6% of students in contrast to 42.3% of the patients realized the significance of organ (P < 0.0001 and 72.4% of the patients and 63.4% of students considered organ donation against their religious beliefs. About 65.6% of the students post interventions were willing to educate the masses about significance of organ donation. Conclusion: A significant knowledge gap exists amongst the dental undergraduates and the general population for organ donation. The positive influence of educational intervention emphasizes the need of an intervention to bring positive changes

  10. Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

    African Journals Online (AJOL)

    Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

  11. Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

    International Nuclear Information System (INIS)

    Han, S.R.

    1988-01-01

    The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

  12. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  13. Influence of Surface Passivation on AlN Barrier Stress and Scattering Mechanism in Ultra-thin AlN/GaN Heterostructure Field-Effect Transistors.

    Science.gov (United States)

    Lv, Y J; Song, X B; Wang, Y G; Fang, Y L; Feng, Z H

    2016-12-01

    Ultra-thin AlN/GaN heterostructure field-effect transistors (HFETs) with, and without, SiN passivation were fabricated by the same growth and device processes. Based on the measured DC characteristics, including the capacitance-voltage (C-V) and output current-voltage (I-V) curves, the variation of electron mobility with gate bias was found to be quite different for devices with, and without, SiN passivation. Although the AlN barrier layer is ultra thin (c. 3 nm), it was proved that SiN passivation induces no additional tensile stress and has no significant influence on the piezoelectric polarization of the AlN layer using Hall and Raman measurements. The SiN passivation was found to affect the surface properties, thereby increasing the electron density of the two-dimensional electron gas (2DEG) under the access region. The higher electron density in the access region after SiN passivation enhanced the electrostatic screening for the non-uniform distributed polarization charges, meaning that the polarization Coulomb field scattering has a weaker effect on the electron drift mobility in AlN/GaN-based devices.

  14. Influence of two barrier membranes on staged guided bone regeneration and osseointegration of titanium implants in dogs. Part 2: augmentation using bone graft substitutes.

    Science.gov (United States)

    Mihatovic, Ilja; Becker, Jürgen; Golubovic, Vladimir; Hegewald, Andrea; Schwarz, Frank

    2012-03-01

    To assess the influence of two barrier membranes and two bone graft substitutes on staged guided bone regeneration and osseointegration of titanium implants in dogs. Saddle-type defects were prepared in the lower jaws of 6 fox hounds and randomly filled with a natural bone mineral (NBM) and a biphasic calcium phosphate (SBC) and allocated to either an in situ gelling polyethylene glycol (PEG) or a collagen membrane (CM). At 8 weeks, modSLA titanium implants were inserted and left to heal in a submerged position. At 8+2 weeks, respectively, dissected blocks were processed for histomorphometrical analysis (e.g., mineralized tissue [MT], bone-to-implant contact [BIC]). The mean MT values (mm2) and BIC values (%) tended to be higher in the PEG groups (MT: NBM [3.4±1.7]; SBC [4.2±2]/BIC: NBM [67.7±16.9]; SBC [66.9±17.8]) when compared with the corresponding CM groups (MT: NBM [2.5±0.8]; SBC [2.3±1.6]/BIC: NBM [54.1±22.6]; SBC [61±8.7]). These differences, however, did not reach statistical significance. It was concluded that all augmentation procedures investigated supported bone regeneration and staged osseointegration of modSLA titanium implants. © 2011 John Wiley & Sons A/S.

  15. Influence of O-methylated metabolite penetrating the blood-brain barrier to estimation of dopamine synthesis capacity in human L-[β-(11)C]DOPA PET.

    Science.gov (United States)

    Matsubara, Keisuke; Ikoma, Yoko; Okada, Maki; Ibaraki, Masanobu; Suhara, Tetsuya; Kinoshita, Toshibumi; Ito, Hiroshi

    2014-02-01

    O-methyl metabolite (L-[β-(11)C]OMD) of (11)C-labeled L-3,4-dihydroxyphenylalanine (L-[β-(11)C]DOPA) can penetrate into brain tissue through the blood-brain barrier, and can complicate the estimation of dopamine synthesis capacity by positron emission tomography (PET) study with L-[β-(11)C]DOPA. We evaluated the impact of L-[β-(11)C]OMD on the estimation of the dopamine synthesis capacity in a human L-[β-(11)C]DOPA PET study. The metabolite correction with mathematical modeling of L-[β-(11)C]OMD kinetics in a reference region without decarboxylation and further metabolism, proposed by a previous [(18)F]FDOPA PET study, were implemented to estimate radioactivity of tissue L-[β-(11)C]OMD in 10 normal volunteers. The component of L-[β-(11)C]OMD in tissue time-activity curves (TACs) in 10 regions were subtracted by the estimated radioactivity of L-[β-(11)C]OMD. To evaluate the influence of omitting blood sampling and metabolite correction, relative dopamine synthesis rate (kref) was estimated by Gjedde-Patlak analysis with reference tissue input function, as well as the net dopamine synthesis rate (Ki) by Gjedde-Patlak analysis with the arterial input function and TAC without and with metabolite correction. Overestimation of Ki was observed without metabolite correction. However, the kref and Ki with metabolite correction were significantly correlated. These data suggest that the influence of L-[β-(11)C]OMD is minimal for the estimation of kref as dopamine synthesis capacity.

  16. Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

    DEFF Research Database (Denmark)

    Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

    2013-01-01

    antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

  17. Melanoma cells influence the differentiation pattern of human epidermal keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Kodet, O.; Lacina, L.; Krejčí, E.; Dvořáková, B.; Grim, M.; Štork, J.; Kodetová, D.; Vlček, Čestmír; Šáchová, Jana; Kolář, Michal; Strnad, Hynek; Smetana, K.

    2015-01-01

    Roč. 14, č. 1 (2015), s. 1-1 ISSN 1476-4598 R&D Projects: GA ČR GAP304/12/1333; GA MZd(CZ) NT13488; GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:Charles University in Prague(CZ) PRVOUK 27 – 1; Charles University in Prague(CZ) UNCE 204013 Institutional support: RVO:68378050 Keywords : Melanoma * Cancer microenvironment * Melanocyte Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.888, year: 2015

  18. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  19. Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

    Directory of Open Access Journals (Sweden)

    Shadmehr Demehri

    2008-05-01

    Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

  20. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

    Directory of Open Access Journals (Sweden)

    Qian Zhao

    2015-12-01

    Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

  2. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  3. Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

    DEFF Research Database (Denmark)

    Kuntsche, Judith; Herre, Angela; Fahr, Alfred

    2013-01-01

    barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

  4. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  5. UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

    International Nuclear Information System (INIS)

    Olsen, W.M.; Elgjo, K.

    1990-01-01

    A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

  6. Influence of two barrier membranes on staged guided bone regeneration and osseointegration of titanium implants in dogs: part 1. Augmentation using bone graft substitutes and autogenous bone.

    Science.gov (United States)

    Schwarz, Frank; Mihatovic, Ilja; Golubovic, Vladimir; Hegewald, Andrea; Becker, Jürgen

    2012-01-01

    To assess the influence of two barrier membranes and two bone graft substitutes mixed with autogenous bone (AB) on staged guided bone regeneration and osseointegration of titanium implants in dogs. Four saddle-type defects each were prepared in the upper jaw of six fox hounds and randomly filled with a natural bone mineral (NBM)+AB and a biphasic calcium phosphate (SBC)+AB and allocated to either an in situ gelling polyethylene glycol (PEG) or a collagen membrane (CM). At 8 weeks, modSLA titanium implants were inserted and left to heal in a submerged position. At 8+2 weeks, dissected blocks were processed for histomorphometrical analysis (e.g., treated area [TA], bone-to-implant contact [BIC]). The mean TA values (mm(2) ) and BIC values (%) tended to be higher in the PEG groups(TA: NBM+AB [10.4 ± 2.5]; SBC+AB [10.4 ± 5.8]/BIC: NBM+AB [86.4 ± 20.1]; SBC+AB [80.1 ± 21.5]) when compared with the corresponding CM groups (TA: NBM+AB [9.7 ± 4.8]; SBC+AB [7.8 ± 4.3]/BIC: NBM+AB [71.3 ± 20.8]; SBC+AB [72.4 ± 20.3]). A significant difference was observed for the mean TA values in the SBC+AB groups. It was concluded that all augmentation procedures investigated supported bone regeneration and staged osseointegration of modSLA titanium implants. However, the application of PEG may be associated with increased TA values. © 2011 John Wiley & Sons A/S.

  7. Facilitators and barriers influencing the readiness to receive dental implants in a geriatric institutionalised population-A randomized non-invasive interventional study.

    Science.gov (United States)

    Merz, Miriam A; Terheyden, Hendrik; Huber, Christian G; Seixas, Azizi A; Schoetzau, Andreas; Schneeberger, Andres R

    2017-09-01

    Although elderly people have many serious dental issues and are in need of prosthesis, few opt for dental implants. The aim of this study was to investigate barriers that prevent elderly people from receiving dental implants. Specifically, we examined (i) whether the message was delivered before or after the interview had an impact, and (ii) whether it did matter who delivered the message. Sixty-six residents from seven residential homes in the Canton of Grisons, Switzerland were included. The sample was randomized to a treatment group that received comprehensive education about dental implants before the interview and a control group that received education after completing the questionnaire. The sample consisted of 54 women (81.8%) and 12 males (18.2%) with an average age of 86.2 years. Education before the interview did not show any impact on the attitude towards dental implants. Main reasons for a negative attitude towards implants were old age and high costs. Participants who received information about implants from their relatives and their own dentist and not from the study dentist were significantly more willing to receive implants. Providing an adequate education about benefits and risks of receiving dental implants does not change the attitude towards dental implants. The source of information/messenger does influence attitudes towards implants. If the person delivering the education and information is a relative or a known medical person, the person's attitude is more likely to change as compared to people receiving the information from an unrelated person. © 2017 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  8. The influence of transfer reactions on the sub-barrier fusion enhancement in the systems {sup 58.64}Ni +, {sup 92,100}Mo

    Energy Technology Data Exchange (ETDEWEB)

    Rehm, K.E.; Jiang, C.L.; Esbensen, H. [and others

    1995-08-01

    High resolution experiments performed during the past few years demonstrated that the various reaction modes occurring in heavy ion collisions can strongly influence each other. This interrelation of the different reaction modes brings a nuclear structure dependence to the fusion and deep-inelastic channels that were previously described in the framework of pure statistical models. In order to fully understand the interrelation between these reaction channels, a complete set of measurements including elastic and inelastic scattering, few-nucleon transfer and fusion is required. In continuation of our earlier measurements of the fusion cross sections in the system {sup 58,64}Ni + {sup 92,100}Mo we finished the studies of the quasielastic process in these systems. The experiments were done in inverse reaction kinematics using the split-pole spectrograph with its hybrid focal-plane detector for particle identification. The experiments with {sup 100}Mo beams were performed previously. First test runs with {sup 92}Mo showed the possible interference with {sup 98}Mo ions which could be eliminated by using the 13{sup +} charge state from the ECR source. The data from these experiments were completely analyzed. The smallest transfer cross sections are observed for the systems {sup 64}Ni + {sup 100}Mo and {sup 58}Ni + {sup 92}Mo, i.e., the most neutron-rich and neutron-deficient systems, respectively. For the other systems, {sup 64}Ni + {sup 92}Mo and {sup 58}Ni + {sup 100}Mo, the transfer cross sections at energies close to the barrier are about of equal magnitude. This observation does not correlate with the deviation of the experimental fusion cross sections from the coupled-channels predictions. While for {sup 58}Ni + {sup 100}Mo discrepancies between the experimental and theoretical fusion cross sections are observed, the system {sup 64}Ni + {sup 92}Mo which shows about the same transfer yields, is quite well described by the coupled-channels calculations.

  9. The Effect of Topical Use of Petroselinum Crispum (Parsley) Versus That of Hydroquinone Cream on Reduction of Epidermal Melasma: A Randomized Clinical Trial.

    Science.gov (United States)

    Khosravan, Shahla; Alami, Ali; Mohammadzadeh-Moghadam, Hossein; Ramezani, Vahide

    Melasma disfigures the skin and thus influences people's self-image and self-concept. Therefore, melasma influences emotional and psychosocial health in addition to physical health. This clinical trial was performed to assess the effect of the topical use of Petroselinum crispum (parsley) on reduction of the severity of epidermal melasma.

  10. Influence of a BGaN back-barrier on DC and dynamic performances of an AlGaN/GaN HEMT: simulation study

    Science.gov (United States)

    Guenineche, Lotfi; Hamdoune, Abdelkader

    2016-05-01

    In this paper, we study the effect of a BGaN back-barrier on the DC and RF performances of an AlGaN/GaN high electron mobility transistor. Using TCAD Silvaco, we examine some variations of thickness and boron concentration in the BGaN back-barrier layer. First, we fix the thickness of the back-barrier layer at 5 nm and we vary the concentration of the boron in BGaN from 1% to 4%. Second, we fix the concentration of the boron in BGaN to only 2% and we vary the thickness of the back-barrier layer from 20 nm to 110 nm. The BGaN back-barrier layer creates an electrostatic barrier under the channel layer and improves the performances of the device by improving the electron confinement in the two-dimensional electron gas. The DC and AC characteristics are improved, respectively, by a greater concentration of boron and by a thicker BGaN layer. For 4% boron concentration and 5 nm thick back-barrier layer, we obtain a maximum drain current of 1.1 A, a maximum transconductance of 480 mS mm-1, a cut-off frequency of 119 GHz, and a maximum oscillation frequency of 311 GHz.

  11. Barriers to diabetes awareness and self-help are influenced by people's demographics: perspectives of South Asians with type 2 diabetes.

    Science.gov (United States)

    Pardhan, Shahina; Nakafero, Georgina; Raman, Rajiv; Sapkota, Raju

    2018-03-26

    To determine whether barriers to diabetes awareness and self-help differ in South Asian participants of different demographic characteristics (age, gender, and literacy) with type 2 diabetes living in the United Kingdom. Six focus group discussions (FGDs) were carried out in patients who were categorized according to age (30-60 years, ≥60 years), gender (male, female) and literacy status (literate, illiterate). Data were analysed following the iterative process of thematic analysis techniques. Barriers were demographic-specific. The illiterate groups reported language as the major barrier to improved diabetes awareness and self-help. The literate groups reported that information provided by healthcare providers was general, and not specific to their diet/culture. Major barriers to adherence to the recommended diet for diabetes included: insufficient knowledge/awareness about nutritional content of food (all groups); lack of self-will to resist eating sweets, especially during weddings/festivals (literate older groups/literate younger females/illiterate older males); difficulty cooking separate meals for diabetic and non-diabetic family members (illiterate/literate older females). Other barriers to seeking advice/help ranged from not wanting to disclose their diabetes as it may affect employment/work (literate groups) to fear of being singled out at social gatherings (illiterate groups). General lack of motivation to exercise was reported by all groups. Time constraints and not knowing what/how to exercise was reported by literate younger groups whilst the illiterate older groups reported to not having suitable exercising facilities at local communities. Different barriers were also reported when accessing healthcare; language barriers (illiterate groups), restricted access to doctors' appointments/difficulty attending specific appointment slots offered by General Practitioners (literate females). Different barriers exist to improved awareness about diabetes and

  12. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  13. Shavenbaby couples patterning to epidermal cell shape control.

    Directory of Open Access Journals (Sweden)

    Hélène Chanut-Delalande

    2006-09-01

    Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.

  14. Fatal toxic epidermal necrolysis associated with minoxidil.

    Science.gov (United States)

    Karaoui, Lamis R; Chahine-Chakhtoura, Corinne

    2009-04-01

    Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this

  15. Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

    African Journals Online (AJOL)

    REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.

  16. Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

    Science.gov (United States)

    Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

    2014-01-01

    Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

  17. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  18. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  19. Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2013-01-01

    Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.

  20. Barrier Systems

    NARCIS (Netherlands)

    Heteren, S. van

    2015-01-01

    Barrier-system dynamics are a function of antecedent topography and substrate lithology, Relative sea-level (RSL) changes, sediment availability and type, climate, vegetation type and cover, and various aero- and hydrodynamic processes during fair-weather conditions and extreme events. Global change

  1. Optimal allocation of leaf epidermal area for gas exchange

    OpenAIRE

    de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.

    2016-01-01

    Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...

  2. On the influence of the European trade barrier on the chinese pv industry: Is the solution to the solar-dispute “successful”?

    International Nuclear Information System (INIS)

    McCarthy, Killian J.

    2016-01-01

    In July 2013 the European Union (EU) imposed restrictions on Chinese solar photovoltaic (PV) manufacturers, looking to exporting to the EU. In this paper, we consider the impact of this trade barrier, using a sample of 454 stock-listed PV producing firms. We find that the trade barrier erased US$ 8,19 million off the value of the average European PV manufacturers and US$ 247.03 million off the value of the average Chinese PV manufacturers. We also find that while the trade barrier reduced the willingness of the industry to reorganise, it stimulates Chinese manufacturers to reorganise both their domestic and their international operations. The latter, we warn, is likely an attempt by Chinese manufacturers to ‘tariff jump’. We conclude, therefore, that the trade barrier was both inefficient, in that it both hurt the companies it aimed to protect, and ineffective, as those it sought to punish may have circumvented it. - Highlights: • Consider the impact of EU trade restrictions on 454 PV producing firms. • Show that the regulation wiped $8 m off the average European PV manufacturer. • Show that the regulation wiped US$247 m off the value of the average Chinese PV manufacturers. • Show that the regulation stimulated Chinese firms to circumvent the barrier. • Conclude that the trade barrier was inefficient and ineffective.

  3. Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

    Science.gov (United States)

    Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

    2013-12-01

    The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  5. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  6. Standards for the Protection of Skin Barrier Function.

    Science.gov (United States)

    Giménez-Arnau, Ana

    2016-01-01

    The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.

  7. Information barriers

    International Nuclear Information System (INIS)

    Fuller, J.L.; Wolford, J.

    2001-01-01

    Full text: An information barrier (IB) consists of procedures and technology that prevent the release of sensitive information during a joint inspection of a sensitive nuclear item, and provides confidence that the measurement system into which it has been integrated functions exactly as designed and constructed. Work in the U.S. on radiation detection system information barriers dates back at least to 1990, even though the terminology is more recent. In January 1999 the Joint DoD-DOE Information Barrier Working Group was formed in the United States to help coordinate technical efforts related to information barrier R and D. This paper presents an overview of the efforts of this group, by its Chairs, as well as recommendations for further information barrier R and D. Progress on the demonstration of monitoring systems containing IBs is also provided. From the U.S. perspective, the basic, top-level functional requirements for the information barrier portion of an integrated radiation signature-information barrier inspection system are twofold: The host must be assured that his classified information is protected from disclosure to the inspecting party; and The inspecting party must be confident that the integrated inspection system measures, processes, and presents the radiation-signature-based measurement conclusion in an accurate and reproducible manner. It is the position of the United States that in the absence of any agreement to share classified nuclear weapons design information in the conduct of an inspection regime, the requirement to protect host country classified warhead design information is paramount and admits no tradeoff versus the confidence provided to the inspecting party in the accuracy and reproducibility of the measurements. The U.S. has reached an internal consensus on several critical design elements that define a general standard for radiation signature information barrier design. These criteria have stood the test of time under intense

  8. Influence of blood-brain barrier permeability on O-(2-{sup 18}F-fluoroethyl)-L-tyrosine uptake in rat gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Stegmayr, Carina; Bandelow, Ulrike; Oliveira, Dennis; Lohmann, Philipp; Willuweit, Antje; Galldiks, Norbert; Luebke, Joachim H.R. [Institute of Neuroscience and Medicine, Forschungszentrum Juelich, Juelich (Germany); Filss, Christian; Ermert, Johannes; Langen, Karl-Josef [Institute of Neuroscience and Medicine, Forschungszentrum Juelich, Juelich (Germany); RWTH/University Hospital Aachen, Department of Nuclear Medicine and Neurology, Aachen (Germany); Shah, N. Jon [Institute of Neuroscience and Medicine, Forschungszentrum Juelich, Juelich (Germany); RWTH/University Hospital Aachen, Department of Nuclear Medicine and Neurology, Aachen (Germany); Juelich-Aachen Research Alliance (JARA) - Section JARA-Brain, Aachen (Germany)

    2017-03-15

    O-(2-{sup 18}F-fluoroethyl)-L-tyrosine ({sup 18}F-FET) is an established tracer for the diagnosis of brain tumors with PET. This study investigates the influence of blood-brain barrier (BBB) permeability on {sup 18}F-FET uptake in two rat glioma models and one human xenograft model. F98 glioma, 9L gliosarcoma or human U87 glioblastoma cells were implanted into the striatum of 56 Fischer or RNU rats. Thereafter, animals were divided into a control group and a group receiving injections of the glucocorticoid dexamethasone (Dex). After 12-13 days of tumor growth animals received injection of Evans blue dye (EBD) to visualize BBB disturbance and underwent {sup 18}F-FET PET followed by autoradiography. Time activity curves, standardized uptake values (SUV) and Tumor-to-brain ratios (TBR) of {sup 18}F-FET uptake [18-61 min post injection (p.i.)] were evaluated using a volume-of-Interest (VOI) analysis. BBB disturbance was quantitatively evaluated by EBD fluorescence. The membrane gaps of blood vessel endothelial tight junctions were measured using electron microscopy to visualize ultrastructural BBB alterations in one untreated and one Dex treated F98 glioma. Data were analyzed by two-way ANOVAs. In Dex treated animals EBD extravasation was significantly reduced in 9L (P < 0.001) and U87 (P = 0.008) models and showed a trend in F98 models (P = 0.053). In contrast, no significant differences of {sup 18}F-FET uptake were observed between Dex treated animals and control group except a decrease of the TBR in the 9L tumor model in PET (P < 0.01). Ultrastructural evaluation of tumor blood vessel endothelia revealed significant reduction of the cleft diameter between endothelial cells after Dex treatment in F98 model (P = 0.010). Despite a considerable reduction of BBB permeability in rat gliomas after Dex treatment, no relevant changes of {sup 18}F-FET uptake were noted in this experimental study. Thus, {sup 18}F-FET uptake in gliomas appears to be widely independent of the

  9. Floating barrier

    Energy Technology Data Exchange (ETDEWEB)

    1968-05-06

    This floating barrier consists of relatively long elements which can be connected to form a practically continuous assembly. Each element consists of an inflatable tube with an apron of certain height, made of impregnated fabric which is resistant to ocean water and also to hydrocarbons. Means for connecting one element to the following one, and means for attaching ballast to the apron are also provided.

  10. Epidermal growth factor and growth in vivo

    International Nuclear Information System (INIS)

    Rhodes, J.A.

    1986-01-01

    Epidermal growth factor (EGF) causes a dose-dependent thickening of the epidermis in suckling mice. The cellular mechanisms underlying this thickening were analyzed by measuring the effect of EGF on the cell-cycle. Neonatal mice were given daily injections of either 2ug EGF/g body weight/day or an equivalent volume of saline, and on the seventh day received a single injection of 3 H-thymidine. At various times the mice were perfused with fixative; 1um sections of skin were stained with a modification of Harris' hematoxylin and were autoradiographed. The sections were analyzed using three methods based on the dependence on time after injection of 3 H-thymidine of: frequency of labelled mitoses, labelling index, and reciprocal grains/nucleus. It was found that EGF caused a two-fold increase in the cell production rate. The effect of exogenous EGF on the morphology of gastric mucosa and incisors of suckling mice was also studied. The gastric mucosa appeared thicker in EGF-treated animals, but the effect was not statistically significant. In contrast to its effect on epidermis and gastric mucosa, EGF caused a significant, dose-dependent decrease in the size of the incisors. Because the mouse submandibular salivary gland is the major source of EGF the effect of sialoadenectomy on female reproductive functions was examined. Ablation of the submandibular gland had no effect on: length of estrus cycle, ability of the female to produce litters, length of the gestation period, litter size, and weight of the litter at birth. There was also no effect on survival of the offspring or on age at which the eyelids separated

  11. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  12. How does a lifestyle intervention during pregnancy influence perceived barriers to leisure-time physical activity? The Norwegian fit for delivery study, a randomized controlled trial.

    Science.gov (United States)

    Haakstad, Lene A H; Vistad, Ingvild; Sagedal, Linda Reme; Lohne-Seiler, Hilde; Torstveit, Monica K

    2018-05-03

    To develop effective health promotional and preventive prenatal programs, it is important to understand perceived barriers to leisure-time physical activity during pregnancy, including exercise and sport participation. The aims of the present study was 1) to assess the effect of prenatal lifestyle intervention on the perceived barrier to leisure-time physical activity during pregnancy and the first year after delivery and 2) identify the most important perceived barriers to leisure-time physical activity at multiple time points during and after pregnancy. This secondary analysis was part of the Norwegian Fit for Delivery study, a combined lifestyle intervention evaluated in a blinded, randomized controlled trial. Healthy, nulliparous women with singleton pregnancy of ≤20 gestational weeks, age ≥ 18 years and body mass index ≥19 kg/m 2 were recruited via healthcare clinics in southern Norway, including urban and rural settings. Participants were randomized to either twice-weekly supervised exercise sessions and nutritional counselling (n = 303) or standard prenatal care (n = 303). The principal analysis was based on the participants who completed the standardized questionnaire assessing their perceived barriers to leisure-time physical activity at inclusion (gestational week 16, n = 589) and following intervention (gestational week 36, n = 509), as well as six months (n = 470) and 12 months (n = 424) postpartum. Following intervention (gestation week 35.4 ± 1.0), a significant between-group difference in perceived barriers to leisure-time physical activity was found with respect to time constraints: "... I do not have the time" (intervention: 22 vs. control: 38, p = 0.030), mother-child safety concerns: "... afraid to harm the baby" (intervention: 8 vs. control: 25, p = 0.002) and self-efficacy: "... I do not believe/think that I can do it" (intervention: 3 vs. control: 10, p = 0.050). No positive effect was seen

  13. Smart parking barrier

    KAUST Repository

    Alharbi, Abdulrazaq M.

    2016-01-01

    positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking

  14. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  15. Immune sensitization against epidermal antigens in polymorphous light eruption

    International Nuclear Information System (INIS)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

  16. INFLUENCE OF GROUNDWATER GEOCHEMISTRY ON THE LONG-TERM PERFORMANCE OF IN-SITU PERMEABLE REACTIVE BARRIERS CONTAINING ZERO-VALENT IRON

    Science.gov (United States)

    Reactive barriers that couple subsurface fluid flow with a passive chemical treatment zone are emerging, cost effective approaches for in-situ remediation of contaminated groundwater. Factors such as the build-up of surface precipitates, bio-fouling, and changes in subsurface tr...

  17. Influence of Food with High Moisture Content on Oxygen Barrier Property of Polyvinyl Alcohol (PVA)/Vermiculite Nanocomposite Coated Multilayer Packaging Film.

    Science.gov (United States)

    Kim, Jung Min; Lee, Min Hyeock; Ko, Jung A; Kang, Dong Ho; Bae, Hojae; Park, Hyun Jin

    2018-02-01

    This study investigates the potential complications in applying nanoclay-based waterborne coating to packaging films for food with high moisture content. Multilayer packaging films were prepared by dry laminating commercially available polyvinyl alcohol (PVA)/vermiculite nanocomposite coating films and linear low-density polyethylene film, and the changes in oxygen barrier properties were investigated according to different relative humidity using 3 types of food simulants. When the relative humidity was above 60%, the oxygen permeability increased sharply, but this was reversible. Deionized water and 3% acetic acid did not cause any large structural change in the PVA/vermiculite nanocomposite but caused a reversible deterioration of the oxygen barrier properties. In contrast, 50% ethanol, a simulant for the semifatty food, induced irreversible structural changes with deterioration of the oxygen barrier property. These changes are due to the characteristics of PVA rather than vermiculite. We believe this manuscript would be of interest to the wide group of researchers, organizations, and companies in the field of developing nanoclay-based gas barrier packaging for foods with high moisture content. Hence, we wish to diffuse our knowledge to the scientific community. © 2018 Institute of Food Technologists®.

  18. Influence of average ion energy and atomic oxygen flux per Si atom on the formation of silicon oxide permeation barrier coatings on PET

    Science.gov (United States)

    Mitschker, F.; Wißing, J.; Hoppe, Ch; de los Arcos, T.; Grundmeier, G.; Awakowicz, P.

    2018-04-01

    The respective effect of average incorporated ion energy and impinging atomic oxygen flux on the deposition of silicon oxide (SiO x ) barrier coatings for polymers is studied in a microwave driven low pressure discharge with additional variable RF bias. Under consideration of plasma parameters, bias voltage, film density, chemical composition and particle fluxes, both are determined relative to the effective flux of Si atoms contributing to film growth. Subsequently, a correlation with barrier performance and chemical structure is achieved by measuring the oxygen transmission rate (OTR) and by performing x-ray photoelectron spectroscopy. It is observed that an increase in incorporated energy to 160 eV per deposited Si atom result in an enhanced cross-linking of the SiO x network and, therefore, an improved barrier performance by almost two orders of magnitude. Furthermore, independently increasing the number of oxygen atoms to 10 500 per deposited Si atom also lead to a comparable barrier improvement by an enhanced cross-linking.

  19. Skin barrier properties in patients with recessive X-linked ichthyosis

    DEFF Research Database (Denmark)

    Johansen, J D; Ramsing, D; Vejlsgaard, G

    1995-01-01

    Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...

  20. Influence of thermal stress on the relative permittivity of the AlGaN barrier layer in an AlGaN/GaN heterostructure Schottky contacts

    International Nuclear Information System (INIS)

    Lü Yuan-Jie; Lin Zhao-Jun; Zhang Yu; Meng Ling-Guo; Cao Zhi-Fang; Luan Chong-Biao; Chen Hong; Wang Zhan-Guo

    2011-01-01

    Ni Schottky contacts on AlGaN/GaN heterostructures were fabricated. Some samples were thermally treated in a furnace with N 2 ambience at 600 °C for different times (0.5 h, 4.5 h, 10.5 h, 18 h, 33 h, 48 h, and 72 h), the others were thermally treated for 0.5 h at different temperatures (500 °C, 600 °C, 700 °C, and 800 °C). With the measured current—voltage (I—V) and capacitance—voltage (C—V) curves and by self-consistently solving Schrodinger's and Poisson's equations, we found that the relative permittivity of the AlGaN barrier layer was related to the piezoelectric and the spontaneous polarization of the AlGaN barrier layer. The relative permittivity was in proportion to the strain of the AlGaN barrier layer. The relative permittivity and the strain reduced with the increased thermal stress time until the AlGaN barrier totally relaxed (after 18 h at 600 °C in the current study), and then the relative permittivity was almost a constant with the increased thermal stress time. When the sample was treated at 800 °C for 0.5 h, the relative permittivity was less than the constant due to the huge diffusion of the contact metal atoms. Considering the relation between the relative permittivity of the AlGaN barrier layer and the converse piezoelectric effect, the conclusion can be made that a moderate thermal stress can restrain the converse piezoelectric effect and can improve the stability of AlGaN/GaN heterostructure devices. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  1. Radiotherapy and receptor of epidermal growth factor

    International Nuclear Information System (INIS)

    Deberne, M.

    2009-01-01

    The expression level of the receptor of the epidermal growth factor is in correlation with the tumor cells radiosensitivity. An overexpression of the E.G.F.R. is often present in the bronchi cancer, epidermoid carcinomas of the O.R.L. sphere, esophagus, uterine cervix, and anal duct but also in the rectum cancers and glioblastomas. At the clinical level, the E.G.F.R. expression is in correlation with an unfavourable prognosis after radiotherapy in numerous tumoral localizations. In the rectum cancers it is an independent prognosis factor found in multifactorial analysis: increase of the rate of nodes and local recurrence when the E.G.F.R. is over expressed. In the uterine cervix cancers, the survival is is negatively affected in multifactorial analysis by the E.G.F.R. membranes expression level. At the therapy level, the development of anti E.G.F.R. targeted therapies (tyrosine kinase inhibitors and monoclonal antibodies) opens a new therapy field at radio-sensitivity potentiality. The irradiation makes an activation of the E.G.F.R. way that would be partially responsible of the post irradiation tumoral repopulation. This activation leads the phosphorylation of the PI3 kinase ways and M.A.P. kinase ones, then the Akt protein one that acts an apoptotic modulator part. It has been shown that blocking the E.G.F.R. way acts on three levels: accumulation of ells in phase G1, reduction of the cell repair and increasing of apoptosis. he inhibition of post irradiation action of the E.G.F.R. signal way is a factor explaining the ionizing radiation - anti E.G.F.R. synergy. The preclinical data suggest that the E.G.F.R. blocking by the monoclonal antibodies is more important than the use of tyrosine kinase inhibitors. A first positive randomized study with the cetuximab, published in 2006 in the epidermoid carcinomas of the O.R.L. sphere lead to its authorization on the market with the radiotherapy for this localization. The use of cetuximab in other indication with or in

  2. Inhibition of epidermal cell proliferation by borderline rays

    Energy Technology Data Exchange (ETDEWEB)

    Born, W [Freiburg Univ.; Daikeler, G

    1976-08-01

    Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

  3. Epidermal growth factor in mammary glands and milk from rats

    DEFF Research Database (Denmark)

    Thulesen, J; Raaberg, Lasse; Nexø, Ebba

    1993-01-01

    Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

  4. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  5. Influence of age on the passage of paraquat through the blood-brain barrier in rats: a distribution and pathological examination

    International Nuclear Information System (INIS)

    Widdowson, P.S.; Farnworth, M.J.; Simpson, M.G.; Lock, E.A.

    1996-01-01

    Experiments were performed to determine the extent of paraquat entry into the brain of neonatal and elderly rats, as compared with adult rats, which may be dependent on the efficacy of the blood-brain barrier. A single, median lethal dose (20 mg/kg s.c.) of paraquat containing [14C]paraquat was administered to neonatal (10 day old), adult (3 month old) and elderly (18 month old) rats. In contrast to the adult and elderly rats where paraquat levels fell over the 24 h post-dosing period to negligible levels, paraquat concentrations in neonatal brains did not decrease with time between 0.5 and 24 h following dosing. The distribution of [14C]paraquat was measured in selective brain regions using quantitative autoradiography in all three age groups of rats, 30 min and 24 h following dosing. Autoradiography demonstrated that brain paraquat distributions were similar in the rat age groups. Most of the paraquat was confined to regions outside the blood-brain barrier and to brain regions that lack a complete blood-brain barrier e.g. dorsal hypothalamus, area postrema and the anterior olfactory bulb. Between 0.5 h and 24 h following dosing, paraquat concentrations in deeper brain structures, some distance away from the sites of entry, began to slowly increase in all the rat age groups. By 24 h following dosing, a majority of brain regions examined using quantitative autoradiography revealed significantly higher paraquat concentrations in neonatal brains as compared to brain regions of adult and elderly rats. Despite increased paraquat entry into neonatal brain, we could find no evidence for paraquat-induced neuronal cell damage following a detailed histopathological examination of perfused-fixed brains. In conclusion, impaired blood-brain barrier integrity in neonatal brain thus permitting more paraquat to enter than in adult brain, did not result in neuronal damage

  6. Nationally Certified School Psychologists' use and reported barriers to using evidence-based interventions in schools: the influence of graduate program training and education.

    Science.gov (United States)

    Hicks, Taylor B; Shahidullah, Jeffrey D; Carlson, John S; Palejwala, Mohammed H

    2014-12-01

    The purpose of this study was to empirically investigate Nationally Certified School Psychologists' (NCSP) training in and use of evidence-based interventions (EBIs) for child behavior concerns as well as their reported implementation barriers. A modified Tailored Design Method (TDM; Dillman, Smyth, & Christian, 2009) using up to four mail-based participant contacts was used to obtain survey data (72% usable response rate; n = 392) from a randomly selected national sample of 548 currently practicing NCSPs. Lack of time was rated as the most serious barrier to behavioral EBI implementation, followed by a lack of necessary resources, and financial constraints. Nearly three-quarters (71%) of respondents reported a perceived inadequacy of graduate program training in behavioral EBIs, with a statistically significant difference found between respondents who attended American Psychological Association (APA)-accredited/National Association of School Psychologists (NASP)-approved programs and those who did not. These findings highlight the significant barriers school psychologists encounter when attempting to implement behavioral EBIs within applied practice, as well as the importance of graduate program training in implementation science. Implications for training, practice, and research are discussed. PsycINFO Database Record (c) 2014 APA, all rights reserved.

  7. Sphingosine 1 Phosphate at the Blood Brain Barrier: Can the Modulation of S1P Receptor 1 Influence the Response of Endothelial Cells and Astrocytes to Inflammatory Stimuli?

    Directory of Open Access Journals (Sweden)

    Simona F Spampinato

    Full Text Available The ability of the Blood Brain Barrier (BBB to maintain proper barrier functions, keeping an optimal environment for central nervous system (CNS activity and regulating leukocytes' access, can be affected in CNS diseases. Endothelial cells and astrocytes are the principal BBB cellular constituents and their interaction is essential to maintain its function. Both endothelial cells and astrocytes express the receptors for the bioactive sphingolipid S1P. Fingolimod, an immune modulatory drug whose structure is similar to S1P, has been approved for treatment in multiple sclerosis (MS: fingolimod reduces the rate of MS relapses by preventing leukocyte egress from the lymph nodes. Here, we examined the ability of S1P and fingolimod to act on the BBB, using an in vitro co-culture model that allowed us to investigate the effects of S1P on endothelial cells, astrocytes, and interactions between the two. Acting selectively on endothelial cells, S1P receptor signaling reduced cell death induced by inflammatory cytokines. When acting on astrocytes, fingolimod treatment induced the release of a factor, granulocyte macrophage colony-stimulating factor (GM-CSF that reduced the effects of cytokines on endothelium. In an in vitro BBB model incorporating shear stress, S1P receptor modulation reduced leukocyte migration across the endothelial barrier, indicating a novel mechanism that might contribute to fingolimod efficacy in MS treatment.

  8. The acyl-CoA binding protein is required for normal epidermal barrier function in mice

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Bek, Signe; Marcher, Ann-Britt

    2012-01-01

    (+/+) and ACBP(-/-) mice showed very similar composition, except for a significant and specific decrease in the very long chain free fatty acids (VLC-FFA) in stratum corneum of ACBP(-/-) mice. This finding indicates that ACBP is critically involved in the processes that lead to production of stratum corneum VLC......The acyl-CoA binding protein (ACBP) is a 10 kDa intracellular protein expressed in all eukaryotic species. Mice with targeted disruption of Acbp (ACBP(-/-) mice) are viable and fertile but present a visible skin and fur phenotype characterized by greasy fur and development of alopecia and scaling...... with age. Morphology and development of skin and appendages are normal in ACBP(-/-) mice; however, the stratum corneum display altered biophysical properties with reduced proton activity and decreased water content. Mass spectrometry analyses of lipids from epidermis and stratum corneum of ACBP...

  9. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation

    DEFF Research Database (Denmark)

    Chidgey, M; Brakebusch, C; Gustafsson, E

    2001-01-01

    epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human...

  10. Support or Barrier?

    DEFF Research Database (Denmark)

    Sanden, Guro Refsum; Lønsmann, Dorte

    This study offers a critical look at how corporate-level language management influences front-line language practices among employees in three multinational corporations (MNCs) headquartered in Scandinavia. Based on interview and document data, we examine, firstly, what front-line practices...... employees use to cross language boundaries in their everyday work, and, secondly, how these practices relate to top-down language management in the case companies. Our findings show that employees are often dependent on ad hoc and informal solutions in cross- language situations, which leads us...... to a discussion of how a company’s language policy may be seen as both support and a barrier....

  11. Horse hooves and bird feathers: Two model systems for studying the structure and development of highly adapted integumentary accessory organs--the role of the dermo-epidermal interface for the micro-architecture of complex epidermal structures.

    Science.gov (United States)

    Bragulla, Hermann; Hirschberg, Ruth M

    2003-08-15

    Accessory organs of the integument are locally modified parts of the potentially feather-bearing skin in birds (e.g., the rhamphotheca, claws, or scales), and of the potentially hairy skin in mammals (e.g., the rhinarium, nails, claws, or hooves). These special parts of the integument are characterised by a modified structure of their epidermal, dermal and subcutaneous layers. The developmental processes of these various integumentary structures in birds and mammals show both similarities and differences. For example, the development of the specialised epidermal structures of both feathers and the hoof capsule is influenced by the local three-dimensional configuration of the dermis. However, in feathers, in contrast to hooves, the arrangement of the corneous cells is only partially a direct result of the particular arrangement and shape of the dermal surface of the papillary body. Whereas the diameter of the feather papilla, as well as the number, length, and width of dermal ridges on the surface of the feather papilla influence the three-dimensional architecture of the feather rami, there is no apparent direct correlation between the dermo-epidermal interface and the development of the highly ordered architecture of the radii and hamuli in the feather vane. In order to elucidate this morphogenic problem and the problem of locally different processes of keratinisation and cornification, the structure and development of feathers in birds are compared to those of the hoof capsule in horses. The equine hoof is the most complex mammalian integumentary structure, which is determined directly by the dermal surface of the papillary body. Perspectives for further research on the development of modified integumentary structures, such as the role of the dermal microangioarchitecture and the selective adhesion and various differentiation pathways of epidermal cells, are discussed. Copyright 2003 Wiley-Liss, Inc.

  12. Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...

    African Journals Online (AJOL)

    ADOWIE PERE

    ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...

  13. An immunologic approach to induction of epidermal growth factor deficiency

    DEFF Research Database (Denmark)

    Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....

  14. Clinical Studies on conformal radiotherapy combined with epidermal ...

    African Journals Online (AJOL)

    Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

  15. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  16. Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

    Science.gov (United States)

    von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

    2017-11-06

    The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Gastric luminal epidermal growth factor is affected by diet | Iputo ...

    African Journals Online (AJOL)

    Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...

  18. Inflammatory linear verrucous epidermal naevus: Report of three ...

    African Journals Online (AJOL)

    Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

  19. Identification of grazed grasses using epidermal characters | R ...

    African Journals Online (AJOL)

    The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...

  20. Improvement of arbutin trans-epidermal delivery using ...

    African Journals Online (AJOL)

    Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...

  1. Influence of pairing correlations on the probability and dynamics of tunneling through the barrier in fission and fusion of complex nuclei

    International Nuclear Information System (INIS)

    Lazarev, Yu.A.

    1986-01-01

    An analytically solvable model is used to study the potential barrier penetrability in the case when the gap parameter Δ is treated as a dynamical variable governed by the least action principle. It is found that, as compared to the standard (BCS) approach, the dynamical treatment of pairing results in a considerably weakened dependence of the fission barrier penetrability on the intensity of pairing correlations in the initial state (Δ 0 ), on the barrier height, and on the energy of the initial state. On this basis, a more adequate explanation is proposed for typical order-of-magnitude values of the empirical hidrance factors for groun-state spontaneous fission of odd nuclei. It is also shown that a large enhancement of superfluidity in tunneling - the inherent effect of the dynamical treatment of pairing - strongly facilitates deeply subbarier fusion of complex nuclei. Finally, an analysis is given for the probability of spontaneous fission from K-isomeric quasiparticle (q-p) states in even-even heavy nuclei. The relative change of the partial spontaneous fission half-life in going from the ground-state to a high-spin q-p isomeric state, T* sf /T sf , is found to be strongly dependent on whether or not there takes place the dynamically induced enhancement of superfluidity in tunneling. Measurements of T* sf /T sf provide thus a unique possibility of verifying theoretical predictions about the strong, inverse-square Δ dependence of the effective inertia associated with large-scale subbarrier rearrangements of nuclei

  2. Influence of the gas mixture radio on the correlations between the excimer XeCl emission and the sealed gas temperature in dielectric barrier discharge lamps

    CERN Document Server

    Xu Jin Zhou; Ren Zhao Xing

    2002-01-01

    For dielectric barrier discharge lamps filled with various gas mixture ratios, the correlations between the excimer XeCl emission and the sealed gas temperature have been founded, and a qualitative explication is presented. For gas mixture with chlorine larger than 3%, the emission intensity increases with the sealed gas temperature, while with chlorine about 2%, the emission intensity decreases with the increasing in the gas temperature, and could be improved by cooling water. However, if chlorine is less than 1.5%, the discharge appears to be a mixture mode with filaments distributed in a diffused glow-like discharge, and the UV emission is independent on the gas temperature

  3. The Influence of Drainage Wells Barrier on Reducing the Amount of Major Contaminants Migrating from a Very Large Mine Tailings Disposal Site

    Directory of Open Access Journals (Sweden)

    Duda Robert

    2014-12-01

    its foreground. The efficiency of groundwater protection was determined on the basis of a new approach. In applied method the loads of characteristic and commonly recognizable compounds, i.e. salt (NaCl and gypsum (CaSO4 were calculated, instead their chemical components. The temporal and spatial variability of captured main contaminants loads as well as its causes are discussed. The paper ends with the results of efficiency analyses of the barrier and with respect to the predicted increase in contaminant concentrations in the pulp poured out to the tailings site.

  4. Adrenergic effects on renal secretion of epidermal growth factor in the rat

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1985-01-01

    Urinary epidermal growth factor (EGF) has been demonstrated recently to originate from the kidneys. The present study was undertaken to investigate the adrenergic and cholinergic influence on secretion of renal EGF. beta-Adrenergic agonists increased the level of urinary EGF, while propranolol......, a beta-adrenergic blocking agent, decreased basal and beta-adrenergic stimulated total output of urinary EGF. Acetylcholine and the anticholinergic agent atropine had no effect on the output of EGF in urine. Also chemical sympathectomy induced by 6-hydroxydopamine reduced the urinary output of EGF. None...... of the experimental groups had a median serum concentration above the detection limit of the assay. The present study shows that secretion of renal EGF is under the influence of the sympathetic nervous system and release of EGF is stimulated by activation of beta-adrenergic receptors in the kidneys....

  5. Identification of novel immune and barrier genes in atopic dermatitis by means of laser capture microdissection

    DEFF Research Database (Denmark)

    Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin

    2015-01-01

    are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...

  6. Influence of geochemical processes on transport in porous medium; application to the clogging of confinement barriers in a geological waste disposal

    International Nuclear Information System (INIS)

    Lagneau, V.

    2002-01-01

    Three research orientations are currently followed for the future of radioactive wastes. Disposal in deep geological formations is one of these options. The package and the successive barriers are attacked by the in-situ water and start interacting. These reactions lead to modifications of the mineralogical composition of the materials and of their macroscopic properties. While the coupling between transport and geochemistry is widely studied, the feedback of porosity changes is usually neglected. Yet, studying different possible interfaces of a repository reveals that large modifications of porosity are likely to occur. This work, performed at the Ecole des Mines de Paris and Commissariat a l'Energie Atomique, aimed at investigating the effective consequences of taking porosity changes into account in coupled geochemistry-transport models. A simplified theoretic problem was addressed. It highlighted the difficulties of introducing porosity changes. In particular, it pointed out the effect of the several macroscopic relations binding porosity to transport and chemistry. Separately, two series of experiments, on very simple geochemical systems, gave concrete information on clogging systems. Following these results, porosity changes and their feedback on chemistry and transport were inserted in the coupled code HYTEC at the Ecole des Mines de Paris. Complex issues, related to the engineered barrier, were then addressed (concrete-clay interaction). New effects were found, including a decrease in the flux of dissolved species, due to the partial clogging at the interface, a slow down of reacting fronts; some reactions were even found to change directions. (author)

  7. Influence of the simultaneous addition of bentonite and cellulose fibers on the mechanical and barrier properties of starch composite-films.

    Science.gov (United States)

    de Moraes, J Oliveira; Müller, C M O; Laurindo, J B

    2012-02-01

    The addition of nanoclay or cellulose fibers has been presented in the literature as a suitable alternative for reinforcing starch films. The aim of the present work was to evaluate the effect of the simultaneous incorporation of nanoclay (bentonite) and cellulose fibers on the mechanical and water barrier properties of the resultant composite-films. Films were prepared by casting with 3% in weight of cassava starch, using glycerol as plasticizer (0.30 g per g of starch), cellulose fibers at a concentration of 0.30 g of fibers per g of starch and nanoclay (0.05 g clay per g starch and 0.10 g clay per g starch). The addition of cellulose fibers and nanoclay increased the tensile strength of the films 8.5 times and the Young modulus 24 times but reduced the elongation capacity 14 times. The water barrier properties of the composite-films to which bentonite and cellulose fibers were added were approximately 60% inferior to those of starch films. Diffractograms showed that the nanoclay was intercalated in the polymeric matrix. These results indicate that the simultaneous addition of bentonite and cellulose fibers is a suitable alternative to increase the tensile strength of the films and decrease their water vapor permeabilities.

  8. Functional barriers: Properties and evaluation

    NARCIS (Netherlands)

    Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.

    2005-01-01

    Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of

  9. Overcoming Barriers: Women in Superintendency

    Science.gov (United States)

    Miller, Claire M.

    2009-01-01

    Women currently represent the largest number of teachers in the United States but remain underrepresented in the superintendent position. This suggests that the superintendency has been influenced by patriarchy. If women are to break through the barriers that prevent them from attaining a superintendency, we will need to understand the social…

  10. Linguistic Barriers and Bridges

    DEFF Research Database (Denmark)

    Thuesen, Frederik

    2016-01-01

    The influence of language on social capital in low-skill and ethnically diverse workplaces has thus far received very limited attention within the sociology of work. As the ethnically diverse workplace is an important social space for the construction of social relations bridging different social...... groups, the sociology of work needs to develop a better understanding of the way in which linguistic diversity influences the formation of social capital, i.e. resources such as the trust and reciprocity inherent in social relations in such workplaces. Drawing on theories about intergroup contact...... and intercultural communication, this article analyses interviews with 31 employees from two highly ethnically diverse Danish workplaces. The article shows how linguistic barriers such as different levels of majority language competence and their consequent misunderstandings breed mistrust and hostility, whilst...

  11. Sprache als Barriere (Language as a Barrier)

    Science.gov (United States)

    Mattheier, Klaus

    1974-01-01

    The concept of language barrier has its derivations in the fields of dialectology, sociology and psychology. In contemporary usage however, the concept has two meanings i.e. regional-cultural barrier and socio-cultural barrier. (Text is in German.) (DS)

  12. Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis

    Science.gov (United States)

    Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin

    2016-01-01

    Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054

  13. In vitro dermal and epidermal cellular response to titanium alloy implants fabricated with electron beam melting.

    Science.gov (United States)

    Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H

    2014-10-01

    Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  14. Step edge influence on barrier height and contact area in vertical heterojunctions between epitaxial graphene and n-type 4H-SiC

    International Nuclear Information System (INIS)

    Tadjer, M. J.; Nyakiti, L. O.; Robinson, Z.; Anderson, T. J.; Myers-Ward, R. L.; Wheeler, V. D.; Eddy, C. R.; Gaskill, D. K.; Koehler, A. D.; Hobart, K. D.; Kub, F. J.

    2014-01-01

    Vertical rectifying contacts of epitaxial graphene grown by Si sublimation on the Si-face of 4H-SiC epilayers were investigated. Forward bias preferential conduction through the step edges was correlated by linear current density normalization. This phenomenon was observed on samples with 2.7–5.8 monolayers of epitaxial graphene as determined by X-ray photoelectron spectroscopy. A modified Richardson plot was implemented to extract the barrier height (0.81 eV at 290 K, 0.99 eV at 30 K) and the electrically dominant SiC step length of a Ti/Al contact overlapping a known region of approximately 0.52 μm wide SiC terraces

  15. Influence of argon/oxygen atmospheric dielectric barrier discharge treatment on desizing and scouring of poly (vinyl alcohol) on cotton fabrics

    International Nuclear Information System (INIS)

    Peng Shujing; Gao Zhiqiang; Sun Jie; Yao Lan; Qiu Yiping

    2009-01-01

    The effect of argon/oxygen atmospheric dielectric barrier discharge (DBD) treatment on desizing and scouring of polyvinyl alcohol (PVA) on cotton fabric was studied with respect to the treatment duration of 1, 2, 4 and 6 min. X-ray photoelectron spectroscopy (XPS) analysis indicated that oxygen concentration increased for the plasma treated PVA film. Solubility measurement revealed that plasma treatment increased PVA solubility in hot washing but less effective in cold washing. Scanning electron microscopy (SEM) showed that the fiber surfaces were as clean as unsized fibers after 6 min treatment followed by hot washing. Wickability analysis indicated that the capillary heights of plasma treated fabrics increased significantly as the plasma treatment duration increased. The results of the yarn tensile strength test showed that the plasma treatment did not have a negative effect on fabric tensile strength.

  16. Appearance of a conductive carbonaceous coating in a CO2 dielectric barrier discharge and its influence on the electrical properties and the conversion efficiency

    International Nuclear Information System (INIS)

    Belov, Igor; Paulussen, Sabine; Bogaerts, Annemie

    2016-01-01

    This work examines the properties of a dielectric barrier discharge (DBD) reactor, built for CO 2 decomposition, by means of electrical characterization, optical emission spectroscopy and gas chromatography. The discharge, formed in an electronegative gas (such as CO 2 , but also O 2 ), exhibits clearly different electrical characteristics, depending on the surface conductivity of the reactor walls. An asymmetric current waveform is observed in the metal-dielectric (MD) configuration, with sparse high-current pulses in the positive half-cycle (HC) and a more uniform regime in the negative HC. This indicates that the discharge is operating in two alternating regimes with rather different properties. At high CO 2 conversion regimes, a conductive coating is deposited on the dielectric. This so-called coated MD configuration yields a symmetric current waveform, with current peaks in both the positive and negative HCs. In a double-dielectric (DD) configuration, the current waveform is also symmetric, but without current peaks in both the positive and negative HC. Finally, the DD configuration with conductive coating on the inner surface of the outer dielectric, i.e. so-called coated DD, yields again an asymmetric current waveform, with current peaks in the negative HC. These different electrical characteristics are related to the presence of the conductive coating on the dielectric wall of the reactor and can be explained by an increase of the local barrier capacitance available for charge transfer. The different discharge regimes affect the CO 2 conversion, more specifically, the CO 2 conversion is lowest in the clean DD configuration. It is somewhat higher in the coated DD configuration, and still higher in the MD configuration. The clean and coated MD configuration, however, gave similar CO 2 conversion. These results indicate that the conductivity of the dielectric reactor walls can highly promote the development of the high-amplitude discharge current pulses and

  17. Investigation on the influence of electrode geometry on characteristics of coaxial dielectric barrier discharge reactor driven by an oscillating microsecond pulsed power supply

    Science.gov (United States)

    Miao, Chuanrun; Liu, Feng; Wang, Qian; Cai, Meiling; Fang, Zhi

    2018-03-01

    In this paper, an oscillating microsecond pulsed power supply with rise time of several tens of nanosecond (ns) is used to excite a coaxial DBD with double layer dielectric barriers. The effects of various electrode geometries by changing the size of inner quartz tube (different electrode gaps) on the discharge uniformity, power deposition, energy efficiency, and operation temperature are investigated by electrical, optical, and temperature diagnostics. The electrical parameters of the coaxial DBD are obtained from the measured applied voltage and current using an equivalent electrical model. The energy efficiency and the power deposition in air gap of coaxial DBD with various electrode geometries are also obtained with the obtained electrical parameters, and the heat loss and operation temperature are analyzed by a heat conduction model. It is found that at the same applied voltage, with the increasing of the air gap, the discharge uniformity becomes worse and the discharge power deposition and the energy efficiency decrease. At 2.5 mm air gap and 24 kV applied voltage, the energy efficiency of the coaxial DBD reaches the maximum value of 68.4%, and the power deposition in air gap is 23.6 W and the discharge uniformity is the best at this case. The corresponding operation temperature of the coaxial DBD reaches 64.3 °C after 900 s operation and the temperature of the inner dielectric barrier is 114.4 °C under thermal balance. The experimental results provide important experimental references and are important to optimize the design and the performance of coaxial DBD reactor.

  18. The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

    Science.gov (United States)

    Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

    2017-01-01

    Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

  19. Psychological barriers

    DEFF Research Database (Denmark)

    Skinner, T. C.

    2004-01-01

    Type 2 diabetes treatment outcomes ultimately depend on patients and their ability to make long-term behavioural changes that support good self-care and metabolic control. Patients' perceptions about diabetes and diabetes-related complications can have a strong influence on their emotional well...... of lifestyle changes and pharmacological therapy in preventing future complications. Negative emotions and preconceptions about treatment can also discourage adherence to treatment plans. 'Psychological Insulin resistance' caused by fear and concerns about insulin and daily insulin injections can discourage...... many patients from starting insulin therapy, even if oral agents have failed. Depression, stress and anxiety represent further obstacles to optimum self-care and the attainment of glucose goals. Healthcare professionals should endeavour to understand and accommodate these issues when setting personal...

  20. Heterogeneity and plasticity of epidermal stem cells

    DEFF Research Database (Denmark)

    Schepeler, Troels; Page, Mahalia E; Jensen, Kim Bak

    2014-01-01

    The epidermis is an integral part of our largest organ, the skin, and protects us against the hostile environment. It is a highly dynamic tissue that, during normal steady-state conditions, undergoes constant turnover. Multiple stem cell populations residing in autonomously maintained compartments...... facilitate this task. In this Review, we discuss stem cell behaviour during normal tissue homeostasis, regeneration and disease within the pilosebaceous unit, an integral structure of the epidermis that is responsible for hair growth and lubrication of the epithelium. We provide an up-to-date view...... of the pilosebaceous unit, encompassing the heterogeneity and plasticity of multiple discrete stem cell populations that are strongly influenced by external cues to maintain their identity and function....

  1. Communication barriers in the family

    Directory of Open Access Journals (Sweden)

    BARBARA KOC-KOZŁOWIEC

    2017-10-01

    Full Text Available The art of communication – listening and speaking – is a major life skill, with a thorough influence on every human life. Remaining silent while the interlocutor speaks is not all that there is to the act of listening to messages. True listening is based on an intention to get involved in understanding of the other person, enjoying his or her presence, learning something from the conversation, giving assistance, or comforting the interlocutor. In the article the author describes obstacles (barriers, which render true listening impossible. These barriers have been identified by a group of young adults.

  2. The epidermal biosynthesis of cholecalciferol (vitamin D3)

    International Nuclear Information System (INIS)

    Beadle, P.C.

    1977-01-01

    An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

  3. Metabolic epidermal necrosis in two dogs with different underlying diseases.

    Science.gov (United States)

    Bond, R; McNeil, P E; Evans, H; Srebernik, N

    1995-05-06

    Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.

  4. Steroid hormone and epidermal growth factor receptors in meningiomas.

    Science.gov (United States)

    Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R

    1989-11-01

    A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.

  5. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  6. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  7. Epidermal electronics with advanced capabilities in near-field communication.

    Science.gov (United States)

    Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A

    2015-02-25

    Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  9. A review of toxic epidermal necrolysis management in Japan

    Directory of Open Access Journals (Sweden)

    Yuri Kinoshita

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

  10. "Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.

    Science.gov (United States)

    Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu

    2015-11-04

    Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  12. Epidermal growth factor receptor expression in urinary bladder cancer

    Directory of Open Access Journals (Sweden)

    Dayalu S.L. Naik

    2011-01-01

    Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

  13. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-07-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

  14. Optimal allocation of leaf epidermal area for gas exchange.

    Science.gov (United States)

    de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J

    2016-06-01

    A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.

  15. Birch pollen influence the severity of atopic eczema – prospective clinical cohort pilot study and ex vivo penetration study

    Directory of Open Access Journals (Sweden)

    Fölster-Holst R

    2015-10-01

    Full Text Available Regina Fölster-Holst,1 Jagoda Galecka,1 Sigo Weißmantel,1 Ute Dickschat,2 Frank Rippke,3 Kerstin Bohnsack,3 Thomas Werfel,4 Katja Wichmann,4 Matthias Buchner,1 Thomas Schwarz,1 Annika Vogt,5 Jürgen Lademann,5 Martina C Meinke5 1Department of Dermatology, Venerology and Allergy, University of Kiel, 2Wörth, 3Beiersdorf AG, Hamburg, 4Department of Dermatology, Venerology and Allergy, Division of Immunodermatology and Allergy Research, Hannover Medical School, Hannover, 5Department of Dermatology, Venerology and Allergology, Charité – Universitätsmedizin Berlin, Berlin, Germany Abstract: There is little clinical evidence for a correlation between the severity of atopic eczema (AE and pollen exposition. To obtain more data, we performed a clinical cohort pilot study about the influence of pollen on AE between sensitized and nonsensitized subjects and an experimental study addressing the cutaneous penetration of pollen into the skin. Fifty-five patients were monitored during birch pollen season. To study the cutaneous penetration, grass pollen allergens were applied on excised skin and the uptake in CD1c-expressing dendritic cells was investigated. The correlation between environmental pollen load and severity of the Scoring Atopic Dermatitis (SCORAD score and pruritus was observed, regardless of the status of sensitization. The sensitized group recovered significantly worse after the birch pollen season. Remarkably higher amounts of pollen allergens taken up by CD1c cells were detected in epidermal cells derived from skin explants with a disturbed epidermal barrier. These findings suggest an exacerbating role of pollen in AE utilizing the epidermal route. Keywords: aeroallergens, atopic eczema, seasonality, skin antigen-presenting cells, skin barrier penetration

  16. Adrenergic effects on secretion of epidermal growth factor from Brunner's glands

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier

    1985-01-01

    The influence of the sympathetic nervous system and adrenergic agonists on flow rate and secretion of epidermal growth factor (EGF) from Brunner's glands has been investigated in the rat. Chemical sympathectomy by administration of 6-hydroxydopamine increased volume secretion and output of EGF from...... Brunner's glands but depleted the glands of EGF. Infusion of noradrenaline, an alpha-adrenergic agonist, inhibited basal and vasoactive intestinal polypeptide (VIP) stimulated flow rate and output of EGF from Brunner's glands and increased the amount of EGF in the tissue. Vasoactive intestinal polypeptide...... also increased the amount of EGF in Brunner's gland tissue and this was unchanged after simultaneous infusion of VIP and noradrenaline as well as VIP and isoproterenol, a beta-adrenergic agonist. Isoproterenol had no effect on basal and VIP stimulated secretion of EGF from Brunner's glands...

  17. Epidermal growth factor (EGF) inhibits stimulated thyroid hormone secretion in the mouse

    International Nuclear Information System (INIS)

    Ahren, B.

    1987-01-01

    It is known that epidermal growth factor (EGF) inhibits iodide uptake in the thyroid follicular cells and lowers plasma levels of thyroid hormones upon infusion into sheep and ewes. In this study, the effects of EGF on basal and stimulated thyroid hormone secretion were investigated in the mouse. Mice were pretreated with 125 I and thyroxine; the subsequent release of 125 I is an estimation of thyroid hormone secretion. It was found that basal radioiodine secretion was not altered by intravenous injection of EGF (5 micrograms/animal). However, the radioiodine secretion stimulated by both TSH (120 microU/animal) and vasoactive intestinal peptide (VIP; 5 micrograms/animal) were inhibited by EGF (5 micrograms/animal). At a lower dose level (0.5 microgram/animal), EGF had no influence on stimulated radioiodine secretion. In conclusion, EGF inhibits stimulated thyroid hormone secretion in the mouse

  18. Epidermal growth factor and lung development in the offspring of the diabetic rat

    DEFF Research Database (Denmark)

    Thulesen, J; Poulsen, Steen Seier; Nexø, Ebba

    2000-01-01

    Fetuses of diabetic mothers who were exposed to excessive glucose show delayed maturation. Under these conditions, altered growth factor expression or signaling may have important regulatory influences. We examined the role of epidermal growth factor (EGF) in lung development and maternal diabetes...... in the rat. In order to evaluate the possible role of glucose for the expression of EGF and the growth of lung tissue, we performed in vitro studies with organotypic cultures of fetal alveolar cells obtained from control rats. Compared to pups of normal rats, the newborn rats of untreated diabetic rats had...... and was associated with a reduced intensity of surfactant protein A-IR. The only difference observed between pups of treated diabetic rats and controls was a decrease in the lung weight:body weight ratio. In organotypic cultures, the presence of 13 mmol/L glucose in the cell media increased immunoreactive staining...

  19. Influence of dietary inclusion of Bacillus licheniformis on laying performance, egg quality, antioxidant enzyme activities, and intestinal barrier function of laying hens.

    Science.gov (United States)

    Lei, K; Li, Y L; Yu, D Y; Rajput, I R; Li, W F

    2013-09-01

    This experiment was conducted to evaluate the effects of dietary inclusion of Bacillus licheniformis on laying performance, egg quality, antioxidant enzyme activities, and intestinal barrier function of laying hens. Hy-Line Variety W-36 hens (n = 540; 28 wk of age) were randomized into 6 groups, each group with 6 replications (n = 15). The control group received the basal diet formulated with maize and soybean meal. The treatment groups received the same basal diets supplemented with 0.01, 0.02, 0.03, 0.06, and 0.09% Bacillus licheniformis powder (2 × 10(10) cfu/g) for an 8-wk trial. The results showed that dietary supplementation with 0.01 and 0.03% B. licheniformis significantly increased egg production and egg mass. However, no significant differences were observed in egg weight, feed consumption, and feed conversion efficiency among the 6 groups. Supplementation with different levels of B. licheniformis was found to be effective in improvement of egg quality by increasing egg shell thickness and strength. Compared with control, d-lactate content, diamine oxidase activity, and adrenocorticotropic hormone level in serum decreased significantly, and the level of estradiol and follicle-stimulating hormone increased significantly in plasma of all the experimental groups. Dietary supplementation with B. licheniformis increased the intestinal villus height and reduced the crypt depth. In conclusion, dietary inclusion of B. licheniformis could improve laying performance and egg quality significantly in a dose-dependent manner by decreasing the stress response, upregulating the growth hormone, and improving intestinal health.

  20. Influence of source and drain contacts on the properties of indium-gallium-zinc-oxide thin-film transistors based on amorphous carbon nanofilm as barrier layer.

    Science.gov (United States)

    Luo, Dongxiang; Xu, Hua; Zhao, Mingjie; Li, Min; Xu, Miao; Zou, Jianhua; Tao, Hong; Wang, Lei; Peng, Junbiao

    2015-02-18

    Amorphous indium-gallium-zinc-oxide thin film transistors (α-IGZO TFTs) with damage-free back channel wet-etch (BCE) process were achieved by introducing a carbon nanofilm as a barrier layer. We investigate the effects of different source-and-drain (S/D) materials on TFT performance. We find the TFT with Ti/C S/D electrodes exhibits a superior performance with higher output current, lower threshold voltage, and higher effective electron mobility compared to that of Mo/C S/D electrodes. Transmittance electron microscopy (TEM) and X-ray photoelectron spectroscopy (XPS) are employed to analysis the interfacial interaction between S/D metal/C/α-IGZO layers. The results indicate that the better performance of TFTs with Ti/C electrodes should be attributed to the formations of Ti-C and Ti-O at the Ti/C-contact regions, which lead to a lower contact resistance, whereas Mo film is relatively stable and does not react easily with C nanofilm, resulting in a nonohmic contact behavior between Mo/C and α-IGZO layer. However, both kinds of α-IGZO TFTs show good stability under thermal bias stress, indicating that the inserted C nanofilms could avoid the impact on the α-IGZO channel regions during S/D electrodes formation. Finally, we successfully fabricated a high-definition active-matrix organic lighting emitting diode prototype driven by α-IGZO TFTs with Ti/C electrodes in a pilot line.

  1. An oncological view on the blood-testis barrier

    NARCIS (Netherlands)

    Bart, J; Groen, HJM; van der Graaf, WTA; Hollema, H; Hendrikse, NH; Vaalburg, W; Sleijfer, DT; de Vries, EGE

    The function of the blood-testis barrier is to protect germ cells from harmful influences; thus, it also impedes the delivery of chemotherapeutic drugs to the testis. The barrier has three components: first, a physicochemical barrier consisting of continuous capillaries, Sertoli cells in the tubular

  2. Psychology of Success: Overcoming Barriers to Pursuing Further Education

    Science.gov (United States)

    Goto, Stanford T.; Martin, Connie

    2009-01-01

    Of the many barriers that prevent adults from continuing their education, psychological barriers are least often addressed by educators. This is an important area of concern because psychological factors influence how prospective students respond to other barriers. This qualitative study was conducted to describe how adults negotiate…

  3. Countermeasures and barriers

    Energy Technology Data Exchange (ETDEWEB)

    Petersen, Johannes [Oersted - DTU, Automation, Kgs. Lyngby (Denmark)

    2005-10-01

    In 1973 Haddon proposed ten strategies for reducing and avoiding damages based on a model of potential harmful energy transfer (Haddon, 1973). The strategies apply to a large variety of unwanted phenomena. Haddon's pioneering work on countermeasures has had a major influence on later thinking about safety. Considering its impact it is remarkable that the literature offers almost no discussions related to the theoretical foundations of Haddon's countermeasure strategies. The present report addresses a number of theoretical issues related to Haddon's countermeasure strategies, which are: 1) A reformulation and formalization of Haddon's countermeasure strategies. 2) An identification and description of some of the problems associated with the term 'barrier'. 3) Suggestions for a more precise terminology based on the causal structure of countermeasures. 4) Extending the scope of countermeasures to include sign-based countermeasures. (au)

  4. Countermeasures and barriers

    International Nuclear Information System (INIS)

    Petersen, Johannes

    2005-10-01

    In 1973 Haddon proposed ten strategies for reducing and avoiding damages based on a model of potential harmful energy transfer (Haddon, 1973). The strategies apply to a large variety of unwanted phenomena. Haddon's pioneering work on countermeasures has had a major influence on later thinking about safety. Considering its impact it is remarkable that the literature offers almost no discussions related to the theoretical foundations of Haddon's countermeasure strategies. The present report addresses a number of theoretical issues related to Haddon's countermeasure strategies, which are: 1) A reformulation and formalization of Haddon's countermeasure strategies. 2) An identification and description of some of the problems associated with the term 'barrier'. 3) Suggestions for a more precise terminology based on the causal structure of countermeasures. 4) Extending the scope of countermeasures to include sign-based countermeasures. (au)

  5. The unique and cooperative roles of the Grainy head-like transcription factors in epidermal development reflect unexpected target gene specificity.

    Science.gov (United States)

    Boglev, Yeliz; Wilanowski, Tomasz; Caddy, Jacinta; Parekh, Vishwas; Auden, Alana; Darido, Charbel; Hislop, Nikki R; Cangkrama, Michael; Ting, Stephen B; Jane, Stephen M

    2011-01-15

    The Grainy head-like 3 (Grhl3) gene encodes a transcription factor that plays essential roles in epidermal morphogenesis during embryonic development, with deficient mice exhibiting failed skin barrier formation, defective wound repair, and loss of eyelid fusion. Despite sharing significant sequence homology, overlapping expression patterns, and an identical core consensus DNA binding site, the other members of the Grhl family (Grhl1 and -2) fail to compensate for the loss of Grhl3 in these processes. Here, we have employed diverse genetic models, coupled with biochemical studies, to define the inter-relationships of the Grhl factors in epidermal development. We show that Grhl1 and Grhl3 have evolved complete functional independence, as evidenced by a lack of genetic interactions in embryos carrying combinations of targeted alleles of these genes. In contrast, compound heterozygous Grhl2/Grhl3 embryos displayed failed wound repair, and loss of a single Grhl2 allele in Grhl3-null embryos results in fully penetrant eyes open at birth. Expression of Grhl2 from the Grhl3 locus in homozygous knock-in mice corrects the wound repair defect, but these embryos still display a complete failure of skin barrier formation. This functional dissociation is due to unexpected differences in target gene specificity, as both GRHL2 and GRHL3 bind to and regulate expression of the wound repair gene Rho GEF 19, but regulation of the barrier forming gene, Transglutaminase 1 (TGase1), is unique to GRHL3. Our findings define the mechanisms underpinning the unique and cooperative roles of the Grhl genes in epidermal development. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. Smart parking barrier

    KAUST Repository

    Alharbi, Abdulrazaq M.

    2016-05-06

    Various methods and systems are provided for smart parking barriers. In one example, among others, a smart parking barrier system includes a movable parking barrier located at one end of a parking space, a barrier drive configured to control positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking space and a second position that allows access to the parking space. The parking controller can initiate movement of the movable parking barrier in response to a positive identification of an individual allowed to use the parking space. The parking controller can identify the individual through, e.g., a RFID tag, a mobile device (e.g., a remote control, smartphone, tablet, etc.), an access card, biometric information, or other appropriate identifier.

  7. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  8. In Vivo Cosmetic Product Efficacy Testing by Analyzing Epidermal Proteins Extracted from Tape Strips

    Directory of Open Access Journals (Sweden)

    Marie Westman

    2014-02-01

    Full Text Available The objective of this in vivo pilot study was to investigate whether differential biomarker analysis from skin tape strips could be used, not only to evaluate the difference between treated and untreated skin, but also to evaluate the effect of different product treatments. Ten volunteers were included in the study, applying two different basic formulations on their forearms. After four weeks of product application, and also after one week of treatment remission, tape strips were collected from the different treatment sites, as well as from untreated skin. The biomarkers investigated were selected to cover different aspects of epidermal differentiation and in connection with moisturization and barrier function. Levels of Involucrin were increased in both treatments, compared to untreated skin, whereas the levels of Keratin-6 were decreased for both treatments. In addition, a pattern for increased levels of Hornerin and Claudin-1 was also detected. There were no significant differences between the two treatments, only for treatment compared to untreated, but there were tendencies for different effect on some of the biomarkers investigated, differences that may reach significance with increased sample size. The major differences between the two treatments in this study were seen after one week of product remission, although due to too small sample size these differences were not significant.

  9. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2016-03-15

    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  10. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  11. The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.

    Science.gov (United States)

    Del Rosso, James Q; Kircik, Leon H

    2013-07-01

    Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

  12. Radiologic Findings of Epidermal Cysts in the Trunk

    International Nuclear Information System (INIS)

    Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi

    2005-01-01

    To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan

  13. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.

    Science.gov (United States)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi

    2005-02-25

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.

  14. Geologic framework influences on the geomorphology of an anthropogenically modified barrier island: Assessment of dune/beach changes at Fire Island, New York

    Science.gov (United States)

    Lentz, E.E.; Hapke, C.J.

    2011-01-01

    Antecedent geology plays a crucial role in determining the inner-shelf, nearshore, and onshore geomorphology observed in coastal systems. However, the influence of the geologic framework on a system is difficult to extract when evaluating responses to changes due to storms and anthropogenic modifications, and few studies have quantified the potential for these influences in dune/beach environments. This study evaluates topographic change to the dune/beach system at Fire Island, New York over a ten year period (1998-2008) at two sites representing eastern and western reaches of the island where morphology has been shown to vary. The sites are situated along swaths of coast eroding differentially and where the inner shelf geologic framework differs substantially. Fewer large storms occurred in the first half of the study period, compared with the later part of the study period which includes several severe and prolonged extratropical storms. Additionally, a major beach replenishment project was conducted at one of the study sites. Topographic data from LiDAR and RTK GPS surveys are used to construct high-resolution 3D surfaces, which are used to determine volumetric change and to extract 2D alongshore features and profiles for analysis. The study sites help to further characterize morphologic differences between eastern and western reaches of the island. The western site displays higher sand volumes, lower dunes, and a lower gradient profile slope when compared with the eastern site. In addition to these fundamental morphologic differences, the two sites also differ significantly in their response to coastal storms and in the fact that their replenishment histories are different. The replenished areas show reduced vulnerability to storms through minimal volume loss and shoreline accretion that should be considered when evaluating the response of replenished areas to episodic events. We propose that site-specific differences evident throughout the study period can be

  15. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  16. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

  17. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  18. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  19. Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

    Science.gov (United States)

    Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

    2013-11-01

    The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Corrosion behaviour of reinforcements in a carbonaceous concrete: influence of the chemistry of the interstitial solution and of a transport barrier

    International Nuclear Information System (INIS)

    Huet, B.

    2005-10-01

    The phenomenon of steel reinforcements corrosion in a carbonaceous concrete is a many-sided process, little understood and of a great economical importance. The aim of this work is to identify, in condition of concrete carbonation, the corrosion mechanisms of reinforcements in order to anticipate the long term damage of the buildings. An analytical and experimental study has been carried out and has revealed two hypotheses. These ones consist to characterize the control of the corrosion velocity, either by the anodic reaction or by addition of an oxidant. The corrosion experiments in solution which represents the interstitial solution of a carbonaceous cement paste show that the evolution of the metal/medium interface is very sensitive to the species introduced in the medium during the carbonation process. The change of the ionic strength and of the sulfate and alkali metals concentrations are the main factors influencing the localization of the reactional areas, the nature of the phases formed at the interface as well as the corrosion velocities and their change with time. The evolution of the water saturation degree of the coating is the preponderant factor on the corrosion velocity. The analytical calculations and the experimental results show that for fixed hydrous conditions, the corrosion velocity in stationary conditions is negligible. The taking into account of transient conditions of transport as well as humidification and drying cycles is required for the long term anticipation of the damage of reinforced concrete buildings. (O.M.)

  1. Barrier cell sheath formation

    International Nuclear Information System (INIS)

    Kesner, J.

    1980-04-01

    The solution for electrostatic potential within a simply modeled tandem mirror thermal barrier is seen to exhibit a sheath at each edge of the cell. The formation of the sheath requires ion collisionality and the analysis assmes that the collisional trapping rate into the barrier is considerably slower than the barrier pump rate

  2. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

    Science.gov (United States)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Factors Influencing the Use of Biomedical Health Care by Rural Bolivian Anemic Women: Structural Barriers, Reproductive Status, Gender Roles, and Concepts of Anemia.

    Directory of Open Access Journals (Sweden)

    Rebecca M Bedwell

    Full Text Available Non-pregnant women from a rural town and its surrounding region were tested for anemia. During phase 1 (n = 181, anemic women received a written recommendation for low-cost purchase of iron pills at the nearest health center. They were subsequently interviewed on their actions and experiences.Estimated anemia prevalence among these non-pregnant women was 50% higher than the national average. Despite holding conceptualizations of anemia generally aligned with biomedical concepts, only 40% of anemic women attempted to obtain iron supplements from the health center. Town residents were about twice as likely to attempt to purchase pills as outside-town residents. Town women who were concurrently breastfeeding and menstruating, considered anemia most serious for women, and considered family health the shared responsibility of spouses were most likely to decide to purchase iron pills. Age, education, or native language did not negatively influence this health care behavior.Securing iron supplements involves individual trade-offs in the allocation of time, cost and effort. Nonetheless, suitably tailored programs can potentially harness local perceptions in the service of reducing anemia. Because of their comparatively high motivation to obtain iron supplements, targeting concurrently breastfeeding and menstruating women could have a positive cascade effect such that these women continue attending to their iron needs once they stop breastfeeding and if they become pregnant again. Because a sense of shared responsibility for family health appears to encourage women to attend to their own health, programs for women could involve their spouses. Complementing centralized availability, biomedical and traditional healers could distribute iron supplements on rotating visits to outlying areas and/or at highly attended weekly markets.

  4. Factors Influencing the Use of Biomedical Health Care by Rural Bolivian Anemic Women: Structural Barriers, Reproductive Status, Gender Roles, and Concepts of Anemia.

    Science.gov (United States)

    Bedwell, Rebecca M; Spielvogel, Hilde; Bellido, Diva; Vitzthum, Virginia J

    2017-01-01

    Non-pregnant women from a rural town and its surrounding region were tested for anemia. During phase 1 (n = 181), anemic women received a written recommendation for low-cost purchase of iron pills at the nearest health center. They were subsequently interviewed on their actions and experiences. Estimated anemia prevalence among these non-pregnant women was 50% higher than the national average. Despite holding conceptualizations of anemia generally aligned with biomedical concepts, only 40% of anemic women attempted to obtain iron supplements from the health center. Town residents were about twice as likely to attempt to purchase pills as outside-town residents. Town women who were concurrently breastfeeding and menstruating, considered anemia most serious for women, and considered family health the shared responsibility of spouses were most likely to decide to purchase iron pills. Age, education, or native language did not negatively influence this health care behavior. Securing iron supplements involves individual trade-offs in the allocation of time, cost and effort. Nonetheless, suitably tailored programs can potentially harness local perceptions in the service of reducing anemia. Because of their comparatively high motivation to obtain iron supplements, targeting concurrently breastfeeding and menstruating women could have a positive cascade effect such that these women continue attending to their iron needs once they stop breastfeeding and if they become pregnant again. Because a sense of shared responsibility for family health appears to encourage women to attend to their own health, programs for women could involve their spouses. Complementing centralized availability, biomedical and traditional healers could distribute iron supplements on rotating visits to outlying areas and/or at highly attended weekly markets.

  5. Influence of geochemical processes on transport in porous medium; application to the clogging of confinement barriers in a geological waste disposal; Influence des processus geochimiques sur le transport en milieu poreux; application au colmatage en barrieres de confinement potentielles dans un stockage en formation geologique

    Energy Technology Data Exchange (ETDEWEB)

    Lagneau, V

    2002-07-01

    Three research orientations are currently followed for the future of radioactive wastes. Disposal in deep geological formations is one of these options. The package and the successive barriers are attacked by the in-situ water and start interacting. These reactions lead to modifications of the mineralogical composition of the materials and of their macroscopic properties. While the coupling between transport and geochemistry is widely studied, the feedback of porosity changes is usually neglected. Yet, studying different possible interfaces of a repository reveals that large modifications of porosity are likely to occur. This work, performed at the Ecole des Mines de Paris and Commissariat a l'Energie Atomique, aimed at investigating the effective consequences of taking porosity changes into account in coupled geochemistry-transport models. A simplified theoretic problem was addressed. It highlighted the difficulties of introducing porosity changes. In particular, it pointed out the effect of the several macroscopic relations binding porosity to transport and chemistry. Separately, two series of experiments, on very simple geochemical systems, gave concrete information on clogging systems. Following these results, porosity changes and their feedback on chemistry and transport were inserted in the coupled code HYTEC at the Ecole des Mines de Paris. Complex issues, related to the engineered barrier, were then addressed (concrete-clay interaction). New effects were found, including a decrease in the flux of dissolved species, due to the partial clogging at the interface, a slow down of reacting fronts; some reactions were even found to change directions. (author)

  6. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  7. Barriers to Physical Activity on University Student

    Science.gov (United States)

    Jajat; Sultoni, K.; Suherman, A.

    2017-03-01

    The purpose of the research is to analyze the factors that become barriers to physical activity in university students based on physical activity level. An internet-based survey was conducted. The participants were 158 University students from Universitas Pendidikan Indonesia. Barriers to Physical Activity Quiz (BPAQ) were used to assessed the factors that become barriers to physical activity in university students. IPAQ (short form) were used to assessed physical activity level. The results show there was no differences BPAQ based on IPAQ level. But when analyzed further based on seven factors barriers there are differences in factors “social influence and lack of willpower” based IPAQ level. Based on this it was concluded that the “influence from other and lack of willpower” an inhibiting factor on students to perform physical activity.

  8. Stochastic transport of particles across single barriers

    International Nuclear Information System (INIS)

    Kreuter, Christian; Siems, Ullrich; Henseler, Peter; Nielaba, Peter; Leiderer, Paul; Erbe, Artur

    2012-01-01

    Transport phenomena of interacting particles are of high interest for many applications in biology and mesoscopic systems. Here we present measurements on colloidal particles, which are confined in narrow channels on a substrate and interact with a barrier, which impedes the motion along the channel. The substrate of the particle is tilted in order for the particles to be driven towards the barrier and, if the energy gained by the tilt is large enough, surpass the barrier by thermal activation. We therefore study the influence of this barrier as well as the influence of particle interaction on the particle transport through such systems. All experiments are supported with Brownian dynamics simulations in order to complement the experiments with tests of a large range of parameter space which cannot be accessed in experiments.

  9. Barriers to fusion

    International Nuclear Information System (INIS)

    Berriman, A.C.; Butt, R.D.; Dasgupta, M.; Hinde, D.J.; Morton, C.R.; Newton, J.O.

    1999-01-01

    The fusion barrier is formed by the combination of the repulsive Coulomb and attractive nuclear forces. Recent research at the Australian National University has shown that when heavy nuclei collide, instead of a single fusion barrier, there is a set of fusion barriers. These arise due to intrinsic properties of the interacting nuclei such deformation, rotations and vibrations. Thus the range of barrier energies depends on the properties of both nuclei. The transfer of matter between nuclei, forming a neck, can also affect the fusion process. High precision data have been used to determine fusion barrier distributions for many nuclear reactions, leading to new insights into the fusion process

  10. Extremal surface barriers

    International Nuclear Information System (INIS)

    Engelhardt, Netta; Wall, Aron C.

    2014-01-01

    We present a generic condition for Lorentzian manifolds to have a barrier that limits the reach of boundary-anchored extremal surfaces of arbitrary dimension. We show that any surface with nonpositive extrinsic curvature is a barrier, in the sense that extremal surfaces cannot be continuously deformed past it. Furthermore, the outermost barrier surface has nonnegative extrinsic curvature. Under certain conditions, we show that the existence of trapped surfaces implies a barrier, and conversely. In the context of AdS/CFT, these barriers imply that it is impossible to reconstruct the entire bulk using extremal surfaces. We comment on the implications for the firewall controversy

  11. Safety- barrier diagrams

    DEFF Research Database (Denmark)

    Duijm, Nijs Jan

    2008-01-01

    Safety-barrier diagrams and the related so-called 'bow-tie' diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation of safety-barrier diagrams to other methods such as fault...... trees and Bayesian networks is discussed. A simple method for quantification of safety-barrier diagrams is proposed. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk analysis with operational safety management....

  12. Safety-barrier diagrams

    DEFF Research Database (Denmark)

    Duijm, Nijs Jan

    2007-01-01

    Safety-barrier diagrams and the related so-called "bow-tie" diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation with other methods such as fault trees and Bayesian networks...... are discussed. A simple method for quantification of safety-barrier diagrams is proposed, including situations where safety barriers depend on shared common elements. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk...... analysis with operational safety management....

  13. Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

    Directory of Open Access Journals (Sweden)

    Naser Tayyebi Meibodi

    2011-01-01

    Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

  14. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  15. Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.

    Science.gov (United States)

    Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali

    2016-03-01

    Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen

    2017-06-16

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  17. Steven johnsons syndrome and toxic epidermal necrolysis: A review

    Directory of Open Access Journals (Sweden)

    Sri ram Anne

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.

  18. Hybrid Enhanced Epidermal SpaceSuit Design Approaches

    Science.gov (United States)

    Jessup, Joseph M.

    A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

  19. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

    2017-01-01

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  20. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  1. Impact of Helicobacter pylori on the healing process of the gastric barrier

    Science.gov (United States)

    Mnich, Eliza; Kowalewicz-Kulbat, Magdalena; Sicińska, Paulina; Hinc, Krzysztof; Obuchowski, Michał; Gajewski, Adrian; Moran, Anthony P; Chmiela, Magdalena

    2016-01-01

    AIM To determine the impact of selected well defined Helicobacter pylori (H. pylori) antigens on gastric barrier cell turnover. METHODS In this study, using two cellular models of gastric epithelial cells and fibroblasts, we have focused on exploring the effects of well defined H. pylori soluble components such as glycine acid extract antigenic complex (GE), subunit A of urease (UreA), cytotoxin associated gene A protein (CagA) and lipopolysaccharide (LPS) on cell turnover by comparing the wound healing capacity of the cells in terms of their proliferative and metabolic activity as well as cell cycle distribution. Toxic effects of H. pylori components have been assessed in an association with damage to cell nuclei and inhibition of signal transducer and activator of transcription 3 (STAT3) phosphorylation. RESULTS We showed that H. pylori GE, CagA and UreA promoted regeneration of epithelial cells and fibroblasts, which is necessary for effective tissue healing. However, in vivo increased proliferative activity of these cells may constitute an increased risk of gastric neoplasia. In contrast, H. pylori LPS showed a dose-dependent influence on the process of wound healing. At a low concentration (1 ng/mL) H. pylori LPS accelerated of healing epithelial cells, which was linked to significantly enhanced cell proliferation and MTT reduction as well as lack of alterations in cell cycle and downregulation of epidermal growth factor (EGF) production as well as cell nuclei destruction. By comparison, H. pylori LPS at a high concentration (25 ng/mL) inhibited the process of wound repair, which was related to diminished proliferative activity of the cells, cell cycle arrest, destruction of cell nuclei and downregulation of the EGF/STAT3 signalling pathway. CONCLUSION In vivo H. pylori LPS driven effects might lead to the maintenance of chronic inflammatory response and pathological disorders on the level of the gastric mucosal barrier. PMID:27672275

  2. Injectable barriers for waste isolation

    International Nuclear Information System (INIS)

    Persoff, P.; Finsterle, S.; Moridis, G.J.; Apps, J.; Pruess, K.; Muller, S.J.

    1995-03-01

    In this paper the authors report laboratory work and numerical simulation done in support of development and demonstration of injectable barriers formed from either of two fluids: colloidal silica or polysiloxane. Two principal problems addressed here are control of gel time and control of plume emplacement in the vadose zone. Gel time must be controlled so that the viscosity of the barrier fluid remains low long enough to inject the barrier, but increases soon enough to gel the barrier in place. During injection, the viscosity must be low enough to avoid high injection pressures which could uplift or fracture the formation. To test the grout gel time in the soil, the injection pressure was monitored as grouts were injected into sandpacks. When grout is injected into the vadose zone, it slumps under the influence of gravity, and redistributes due to capillary forces as it gels. The authors have developed a new module for the reservoir simulator TOUGH2 to model grout injection into the vadose zone, taking into account the increase of liquid viscosity as a function of gel concentration and time. They have also developed a model to calculate soil properties after complete solidification of the grout. The numerical model has been used to design and analyze laboratory experiments and field pilot tests. The authors present the results of computer simulations of grout injection, redistribution, and solidification

  3. Phonic Attenuation due to Screen-Barriers

    Directory of Open Access Journals (Sweden)

    Vasile Bacria

    2011-10-01

    Full Text Available The technique of noise decreasing admits two basic approaches: an active approach and a passive one. In the frame of passive method one can count the employment of screen-barriers. In this paper we present some considerations on sound attenuation due to screen-barriers emphasizing the elements which influence it. The elucidation of these elements is made by measurements. The obtained results can be applied in every other practical situation concerning the protection against noise.

  4. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  5. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  6. Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Kazuhiko Arima

    2015-01-01

    Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

  7. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  8. Permeability Barrier Generation in the Martian Lithosphere

    Science.gov (United States)

    Schools, Joe; Montési, Laurent

    2015-11-01

    Permeability barriers develop when a magma produced in the interior of a planet rises into the cooler lithosphere and crystallizes more rapidly than the lithosphere can deform (Sparks and Parmentier, 1991). Crystallization products may then clog the porous network in which melt is propagating, reducing the permeability to almost zero, i.e., forming a permeability barrier. Subsequent melts cannot cross the barrier. Permeability barriers have been useful to explain variations in crustal thickness at mid-ocean ridges on Earth (Magde et al., 1997; Hebert and Montési, 2011; Montési et al., 2011). We explore here under what conditions permeability barriers may form on Mars.We use the MELTS thermodynamic calculator (Ghiorso and Sack, 1995; Ghiorso et al., 2002; Asimow et al., 2004) in conjunction with estimated Martian mantle compositions (Morgan and Anders, 1979; Wänke and Dreibus, 1994; Lodders and Fegley, 1997; Sanloup et al., 1999; Taylor 2013) to model the formation of permeability barriers in the lithosphere of Mars. In order to represent potential past and present conditions of Mars, we vary the lithospheric thickness, mantle potential temperature (heat flux), oxygen fugacity, and water content.Our results show that permeability layers can develop in the thermal boundary layer of the simulated Martian lithosphere if the mantle potential temperature is higher than ~1500°C. The various Martian mantle compositions yield barriers in the same locations, under matching variable conditions. There is no significant difference in barrier location over the range of accepted Martian oxygen fugacity values. Water content is the most significant influence on barrier development as it reduces the temperature of crystallization, allowing melt to rise further into the lithosphere. Our lower temperature and thicker lithosphere model runs, which are likely the most similar to modern Mars, show no permeability barrier generation. Losing the possibility of having a permeability

  9. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    International Nuclear Information System (INIS)

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

    1975-01-01

    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

  10. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  11. Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.

    Science.gov (United States)

    Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un

    2008-09-01

    Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.

  12. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  13. Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

    Science.gov (United States)

    Kawano, Ken-Ichi; Umemura, Kazuo

    2013-05-01

    The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

  14. Multilayer moisture barrier

    Science.gov (United States)

    Pankow, Joel W; Jorgensen, Gary J; Terwilliger, Kent M; Glick, Stephen H; Isomaki, Nora; Harkonen, Kari; Turkulainen, Tommy

    2015-04-21

    A moisture barrier, device or product having a moisture barrier or a method of fabricating a moisture barrier having at least a polymer layer, and interfacial layer, and a barrier layer. The polymer layer may be fabricated from any suitable polymer including, but not limited to, fluoropolymers such as polyethylene terephthalate (PET) or polyethylene naphthalate (PEN), or ethylene-tetrafluoroethylene (ETFE). The interfacial layer may be formed by atomic layer deposition (ALD). In embodiments featuring an ALD interfacial layer, the deposited interfacial substance may be, but is not limited to, Al.sub.2O.sub.3, AlSiO.sub.x, TiO.sub.2, and an Al.sub.2O.sub.3/TiO.sub.2 laminate. The barrier layer associated with the interfacial layer may be deposited by plasma enhanced chemical vapor deposition (PECVD). The barrier layer may be a SiO.sub.xN.sub.y film.

  15. Influence of bondcoat composition and manufacturing parameters on the lifetime of thermal barrier coatings under cyclic temperature loading; Einfluss der Bondcoatzusammensetzung und Herstellungsparameter auf die Lebensdauer von Waermedaemmschichten bei zyklischer Temperaturbelastung

    Energy Technology Data Exchange (ETDEWEB)

    Subanovic, Marko

    2008-08-21

    In the present study the influence of the bond coat composition on the lifetime of thermal barrier coatings during thermal cycling was investigated. The knowledge, that the reactive elements (RE), which are essential for the improvement of the oxide scale adhesion, are ''lost'', during the bond coat processing, made it necessary to investigate systematically the influence of the different manufacturing stages on the RE distribution. After VPS (vacuum plasma spraying) with a high oxygen partial pressure in the spraying chamber, the reactive elements in the NiCoCrAl-coating were tied up in oxide precipitates, and thus their beneficial effect on the scale adhesion was inhibited. Another important observation is that the RE's are depleted during the bondcoat vacuum heat-treatment. The degree of Y-depletion depends not only on the Y-reservoir in the coating (Y-content and thickness) but also on the heat-treatment parameters, such as vacuum quality and temperature. A thin, dense alumina oxide scale with a smooth interface between bond coat and TGO doesn't necessary lead to a lifetime extension of the EB-PVD TBC's. TBC's with such oxide morphology typically failed due to crack formation and propagation along the interface between the TGO and the bondcoat. By addition of zirconium it was possible to shift the failure initiation from the interface TGO/bondcoat to the interface TBC/TGO, which can apparently accommodate more thermal strain energy before failure. The shift of the failure location was achieved by a change of the oxide morphology, which mainly relies on adjusting a non-even wavy interface between the TGO and the bond coat and formation of defected oxide layers. In contrast, a defected oxide scale with a high growth rate shortened the life time of APSTBC's. Porosity and spinel formation weakened the mechanical integrity of the oxide scale, and facilitated the crack formation and propagation of the already existing

  16. Differential Rollover Risk in Vehicle-to-Traffic Barrier Collisions

    Science.gov (United States)

    Gabauer, Douglas J.; Gabler, Hampton C.

    2009-01-01

    In the roadside safety community, there has been debate over the influence of vehicle and barrier type on rollover rates in traffic barrier crashes. This study investigated rollover rates between sport utility vehicles (SUVs), pickup trucks, and cars in vehicle-traffic barrier crashes and has examined the effect of barrier type on rollover risk for concrete barrier and metal barrier impacts. The analysis included 955 barrier impact cases that were selected from 11-years of in-depth crash data available through the National Automotive Sampling System (NASS) / Crashworthiness Data System (CDS). In real world tow-away level longitudinal barrier collisions, the most important predictors of vehicle rollover were found to be vehicle type and whether the vehicle was tracking prior to barrier impact. Based on binary logistic regression, SUVs were found to have 8 times the risk of rollover as cars in barrier impacts. Although pickups were found to have an increased risk of rollover compared to cars, the risk was not as pronounced as that found for SUVs. This finding has direct implications for the full scale crash testing of longitudinal barriers as the testing procedures have been predicated on the assumption that the pickup truck provides a critical or worst case impact scenario. In towaway crashes, our study does not support the notion that concrete barriers have a higher risk of vehicle rollover than metal beam barriers. PMID:20184839

  17. Barrier penetration database

    International Nuclear Information System (INIS)

    Fainberg, A.; Bieber, A.M. Jr.

    1978-11-01

    This document is intended to supply the NRC and nuclear power plant licensees with basic data on the times required to penetrate forcibly the types of barriers commonly found in nuclear plants. These times are necessary for design and evaluation of the physical protection system required under 10CFR73.55. Each barrier listed is described in detail. Minor variations in basic barrier construction that result in the same penetration time, are also described

  18. Perforated Sigmoid Diverticulitis in the Presence of Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    P. Heye

    2014-02-01

    Full Text Available Even though the incidence of toxic epidermal necrolysis (TEN is low, it is also associated with a high mortality rate. The condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. We present a case of perforated sigmoid diverticulitis in the presence of TEN. The patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of TEN. Characteristic abdominal symptoms, however, were missing. Gastrointestinal involvement in TEN appears to be a poor prognostic factor; medical staff must therefore be alert to patients with TEN who complain of abdominal discomfort. The exact pathogenesis, however, remains unclear.

  19. Epidermal Growth Factor Receptor (EGFR) Crosstalks in Liver Cancer

    International Nuclear Information System (INIS)

    Berasain, Carmen; Latasa, María Ujue; Urtasun, Raquel; Goñi, Saioa; Elizalde, María; Garcia-Irigoyen, Oihane; Azcona, María; Prieto, Jesús; Ávila, Matías A.

    2011-01-01

    Hepatocarcinogenesis is a complex multistep process in which many different molecular pathways have been implicated. Hepatocellular carcinoma (HCC) is refractory to conventional chemotherapeutic agents, and the new targeted therapies are meeting with limited success. Interreceptor crosstalk and the positive feedback between different signaling systems are emerging as mechanisms of targeted therapy resistance. The identification of such interactions is therefore of particular relevance to improve therapeutic efficacy. Among the different signaling pathways activated in hepatocarcinogenesis the epidermal growth factor receptor (EGFR) system plays a prominent role, being recognized as a “signaling hub” where different extracellular growth and survival signals converge. EGFR can be transactivated in response to multiple heterologous ligands through the physical interaction with multiple receptors, the activity of intracellular kinases or the shedding of EGFR-ligands. In this article we review the crosstalk between the EGFR and other signaling pathways that could be relevant to liver cancer development and treatment

  20. Epidermal segmentation in high-definition optical coherence tomography.

    Science.gov (United States)

    Li, Annan; Cheng, Jun; Yow, Ai Ping; Wall, Carolin; Wong, Damon Wing Kee; Tey, Hong Liang; Liu, Jiang

    2015-01-01

    Epidermis segmentation is a crucial step in many dermatological applications. Recently, high-definition optical coherence tomography (HD-OCT) has been developed and applied to imaging subsurface skin tissues. In this paper, a novel epidermis segmentation method using HD-OCT is proposed in which the epidermis is segmented by 3 steps: the weighted least square-based pre-processing, the graph-based skin surface detection and the local integral projection-based dermal-epidermal junction detection respectively. Using a dataset of five 3D volumes, we found that this method correlates well with the conventional method of manually marking out the epidermis. This method can therefore serve to effectively and rapidly delineate the epidermis for study and clinical management of skin diseases.

  1. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  2. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise

    2005-01-01

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S....... chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had...... an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654...

  3. EPIDERMAL CHARACTERS OF BACCHARIS (ASTERACEAE SPECIES USED IN TRADITIONAL MEDICINE

    Directory of Open Access Journals (Sweden)

    FREIRE SUSANA E.

    2007-06-01

    Full Text Available A morphological study of 38 species of Baccharis used in traditional medicinewas carried out to provide some epidermal characters that will contribute to theknowledge of the genus. The present study revealed: 1 seven different types oftrichomes: conical, aseptate fl agellate, fi liform fl agellate, 1-armed, 2-4-armed,bulbiferous fl agellate, and glandular biseriate; 2 that 28 of the total of 38 specieshave trichomes in tufts; 3 six different types of stomata: anomocytic, anisocytic,cyclocytic, actinocytic, tetracytic, and staurocytic; 4 that some trichome types,such as 2-4-armed (B. dracunculifolia and aseptate fl agellate branched (B. trinervis,show a high diagnostic value; 5 that the stomata types can be used to differentiatespecies with similar trichomes type (e.g. B. trimera and B. articulata.Illustrations of the studied characters are provided.

  4. Epidermal growth factor pathway substrate 15, Eps15

    DEFF Research Database (Denmark)

    Salcini, A E; Chen, H; Iannolo, G

    1999-01-01

    Eps15 was originally identified as a substrate for the kinase activity of the epidermal growth factor receptor (EGFR). Eps15 has a tripartite structure comprising a NH2-terminal portion, which contains three EH domains, a central putative coiled-coil region, and a COOH-terminal domain containing...... multiple copies of the amino acid triplet Aspartate-Proline-Phenylalanine. A pool of Eps15 is localized at clathrin coated pits where it interacts with the clathrin assembly complex AP-2 and a novel AP-2 binding protein, Epsin. Perturbation of Eps15 and Epsin function inhibits receptor-mediated endocytosis...... of EGF and transferrin, demonstrating that both proteins are components of the endocytic machinery. Since the family of EH-containing proteins is implicated in various aspects of intracellular sorting, biomolecular strategies aimed at interfering with these processes can now be envisioned...

  5. Effect of glucocorticoids and gamma radiation on epidermal Langerhans cells

    International Nuclear Information System (INIS)

    Belsito, D.V.; Baer, R.L.; Thorbecke, G.J.; Gigli, I.

    1984-01-01

    The effect of 750 rads of gamma radiation on the rate of return of epidermal Langerhans cells (LC) following suppressive doses of topical glucorticoids was studied in guinea pigs. Gamma radiation alone had no effect on the LC as assessed by staining for cell membrane ATPase activity and Ia antigen. It did, however, delay the expected return of Ia but not ATPase surface markers on the LC after perturbation with glucocorticoids. The delayed return of surface Ia antigen is possibly related to a radiation-induced defect in the production of a required lymphokine and/or in intracellular Ia transport. Although our data do not rule out a cytolytic effect of steroids on the LC, they do strongly suggest that, at least in part, glucocorticoids act on the LC by altering cell surface characteristics

  6. Analysis of E2F factors during epidermal differentiation.

    Science.gov (United States)

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  7. Collagen sheet dressings for cutaneous lesions of toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    S Bhattacharya

    2011-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is associated with a significant mortality of 30-50% and long-term sequelae. Treatment includes early admission to a burn unit, where management with precise fluid, electrolyte, protein, and energy supplementation, moderate mechanical ventilation, and expert wound care can be provided. Specific treatment with immunosuppressive drugs or immunoglobulins did not show an improved outcome in most studies and remains controversial. We have treated the cutaneous lesions of seven patients of TEN with collagen sheet dressings and have found a significant reduction in morbidity. The sheets are a one-time dressing, easy to apply and they reduce fluid loss, prevent infection, reduce pain, avoid repeated dressings and gradually peal off as the underlying lesions heal.

  8. Epidermal differential impedance sensor for conformal skin hydration monitoring.

    Science.gov (United States)

    Huang, Xian; Yeo, Woon-Hong; Liu, Yuhao; Rogers, John A

    2012-12-01

    We present the design and use of an ultrathin, stretchable sensor system capable of conformal lamination onto the skin, for precision measurement and spatial mapping of levels of hydration. This device, which we refer to as a class of 'epidermal electronics' due to its 'skin-like' construction and mode of intimate integration with the body, contains miniaturized arrays of impedance-measurement electrodes arranged in a differential configuration to compensate for common-mode disturbances. Experimental results obtained with different frequencies and sensor geometries demonstrate excellent precision and accuracy, as benchmarked against conventional, commercial devices. The reversible, non-invasive soft contact of this device with the skin makes its operation appealing for applications ranging from skin care, to athletic monitoring to health/wellness assessment.

  9. Toxic epidermal necrolysis associated with deflazacort therapy with nephrotic syndrome

    Directory of Open Access Journals (Sweden)

    Eun Chae Lee

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN is a drug-related fatal disease. Extensive necrosis of the epidermis can lead to serious complications. This report describes two cases of TEN, associated with deflazacort (DFZ, in two boys, aged 4 years and 14 years, with nephrotic syndrome (NS. The 14-year-old male teenager received DFZ following NS relapse. After 17 days, pruritic papules appeared on the lower extremities. Another case involved a 4-year-old boy receiving DFZ and enalapril. After a 41-day DFZ treatment period, erythematous papules appeared on the palms and soles. Within 3 days, both boys developed widespread skin lesions (>50% and were admitted to the intensive care unit for resuscitative and supportive treatment. The patients showed improvement after intravenous immunoglobulin-G therapy. Owing to the rapid, fatal course of TEN, clinicians need to be aware of the adverse effects of this drug when treating cases of NS.

  10. The functions of grainy head-like proteins in animals and fungi and the evolution of apical extracellular barriers.

    Directory of Open Access Journals (Sweden)

    Adam Paré

    Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.

  11. Influence of P-Glycoprotein Inhibition or Deficiency at the Blood-Brain Barrier on (18)F-2-Fluoro-2-Deoxy-D-glucose ( (18)F-FDG) Brain Kinetics.

    Science.gov (United States)

    Tournier, Nicolas; Saba, Wadad; Goutal, Sébastien; Gervais, Philippe; Valette, Héric; Scherrmann, Jean-Michel; Bottlaender, Michel; Cisternino, Salvatore

    2015-05-01

    The fluorinated D-glucose analog (18)F-2-fluoro-2-deoxy-D-glucose ((18)F-FDG) is the most prevalent radiopharmaceutical for positron emission tomography (PET) imaging. P-Glycoprotein's (P-gp, MDR1, and ABCB1) function in various cancer cell lines and tumors was shown to impact (18)F-FDG incorporation, suggesting that P-gp function at the blood-brain barrier may also modulate (18)F-FDG brain kinetics. We tested the influence of P-gp inhibition using the cyclosporine analog valspodar (PSC833; 5 μM) on the uptake of (18)F-FDG in standardized human P-gp-overexpressing cells (MDCKII-MDR1). Consequences for (18)F-FDG brain kinetics were then assessed using (i) (18)F-FDG PET imaging and suitable kinetic modelling in baboons without or with P-gp inhibition by intravenous cyclosporine infusion (15 mg kg(-1) h(-1)) and (ii) in situ brain perfusion in wild-type and P-gp/Bcrp (breast cancer resistance protein) knockout mice and controlled D-glucose exposure to the brain. In vitro, the time course of (18)F-FDG uptake in MDR1 cells was influenced by the presence of valspodar in the absence of D-glucose but not in the presence of high D-glucose concentration. PET analysis revealed that P-gp inhibition had no significant impact on estimated brain kinetics parameters K 1, k 2, k 3, V T , and CMRGlc. The lack of P-gp effect on in vivo (18)F-FDG brain distribution was confirmed in P-gp/Bcrp-deficient mice. P-gp inhibition indirectly modulates (18)F-FDG uptake into P-gp-overexpressing cells, possibly through differences in the energetic cell level state. (18)F-FDG is not a P-gp substrate at the BBB and (18)F-FDG brain kinetics as well as estimated brain glucose metabolism are influenced by neither P-gp inhibition nor P-gp/Bcrp deficiencies in baboon and mice, respectively.

  12. Effect of contact barrier on electron transport in graphene.

    Science.gov (United States)

    Zhou, Yang-Bo; Han, Bing-Hong; Liao, Zhi-Min; Zhao, Qing; Xu, Jun; Yu, Da-Peng

    2010-01-14

    The influence of the barrier between metal electrodes and graphene on the electrical properties was studied on a two-electrode device. A classical barrier model was used to analyze the current-voltage characteristics. Primary parameters including barrier height and effective resistance were achieved. The electron transport properties under magnetic field were further investigated. An abnormal peak-valley-peak shape of voltage-magnetoresistance curve was observed. The underlying mechanisms were discussed under the consideration of the important influence of the contact barrier. Our results indicate electrical properties of graphene based devices are sensitive to the contact interface.

  13. Transport barriers in plasmas

    International Nuclear Information System (INIS)

    Caldas, I L; Szezech, J D Jr; Kroetz, T; Marcus, F A; Roberto, M; Viana, R L; Lopes, S R

    2012-01-01

    We discuss the creation of transport barriers in magnetically confined plasmas with non monotonic equilibrium radial profiles. These barriers reduce the transport in the shearless region (i.e., where the twist condition does not hold). For the chaotic motion of particles in an equilibrium electric field with a nonmonotonic radial profile, perturbed by electrostatic waves, we show that a nontwist transport barrier can be created in the plasma by modifying the electric field radial profile. We also show non twist barriers in chaotic magnetic field line transport in the plasma near to the tokamak wall with resonant modes due to electric currents in external coils.

  14. Strong association of epidermal growth factor receptor status with breast cancer FDG uptake

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Joohee; Moon, Seung Hwan; Hyun, Seung Hyup; Cho, Young Seok; Choi, Joon Young; Kim, Byung-Tae; Lee, Kyung-Han [Sungkyunkwan University School of Medicine, Department of Nuclear Medicine, Samsung Medical Center, Seoul (Korea, Republic of); Lee, Eun Jeong [Seoul Medical Center, Department of Nuclear Medicine, Seoul (Korea, Republic of); Kim, Seokhwi [Sungkyunkwan University School of Medicine, Department of Pathology, Samsung Medical Center, Seoul (Korea, Republic of)

    2017-08-15

    Imaging tumor FDG uptake could complement breast cancer biomarkers of risk and treatment response. Although breast cancer FDG uptake is reputedly influenced by major biomarker states, the role of epidermal growth factor receptor (EGFR) expression remains largely unexplored. This is a retrospective study that included 499 patients with primary breast cancer at initial presentation. Tumor FDG uptake was measured on pretreatment PET/CT as maximum standardized uptake value (SUVmax), and biomarkers were assessed by immunohistochemistry of tumor tissue. Regression analysis was performed for predictors of high tumor FDG uptake (SUVmax ≥ 8.6). SUVmax was higher in ER- (36.5%; 11.2 ± 6.0 vs. 8.3 ± 5.3), PR- (42.3%; 10.9 ± 6.0 vs. 8.2 ± 5.2), and triple-negative tumors (19.8%; 12.0 ± 6.9 vs. 8.7 ± 5.2; all p < 0.0001). EGFR expression (28.5%) was more frequent in ER-, PR-, triple-negative, cytokeratin 5/6 (CK5/6) + and mutant P53 (mP53) + tumors (all p < 0.0001). EGFR+ was associated with higher SUVmax among all tumors (11.9 ± 6.0 vs. 8.3 ± 5.3), ER- tumors (p < 0.0001), PR- and + tumors (p < 0.0001 and 0.027), hormone receptor- and + tumors (p < 0.0001 and 0.004), human epidermal growth factor receptor 2 (HER2)- and + tumors (p < 0.0001 and 0.006), non-triple negative tumors (p < 0.0001), CK5/6- and + tumors (p = 0.021 and <0.0001), and mP53- and + tumors (p < 0.0001 and 0.008). Tumors had high FDG uptake in 73.2% of EGFR+ and 40.6% of EGFR- tumors. On regression analysis, significant multivariate predictors of high tumor FDG uptake were large size, EGFR+ and CK5/6+ for the entire subjects, and EGFR+ and CK5/6+ for ER- and hormone receptor negative subgroups. High FDG uptake was able to sub-stratify EGFR+ tumors that were more likely to be ER- and CK5/6+, and EGFR- tumors more likely to be mP53 +. Primary breast tumor FDG uptake is strongly influenced by EGFR status beyond that by other major biomarkers including hormone receptor and HER2 status, and EGFR

  15. Increased skin barrier disruption by sodium lauryl sulfate in mice expressing a constitutively active STAT6 in T cells.

    Science.gov (United States)

    DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B

    2012-01-01

    Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.

  16. Epidermal growth factor regulates apoptosis and oxidative stress in a rat model of spinal cord injury.

    Science.gov (United States)

    Ozturk, Anil Murat; Sozbilen, Murat Celal; Sevgili, Elvin; Dagci, Taner; Özyalcin, Halit; Armagan, Guliz

    2018-03-22

    Spinal cord injury (SCI) leads to vascular damage and disruption of blood-spinal cord barrier which participates in secondary nerve injury. Epidermal growth factor (EGF) is an endogenous protein which regulates cell proliferation, growth and differention. Previous studies reported that EGF exerts neuroprotective effect in spinal cord after SCI. However, the molecular mechanisms underlying EGF-mediated protection in different regions of nervous system have not shown yet. In this study, we aimed to examine possible anti-apoptotic and protective roles of EGF not only in spinal cord but also in brain following SCI. Twenty-eight adult rats were divided into four groups of seven animals each as follows: sham, trauma (SCI), SCI + EGF and SCI + methylprednisolone (MP) groups. The functional neurological deficits due to the SCI were assessed by behavioral analysis using the Basso, Beattie and Bresnahan (BBB) open-field locomotor test. The alterations in pro-/anti-apoptotic protein levels and antioxidant enzyme activities were measured in spinal cord and frontal cortex. In our study, EGF promoted locomotor recovery and motor neuron survival of SCI rats. EGF treatment significantly decreased Bax and increased Bcl-2 protein expressions both in spinal cord and brain when compared to SCI group. Moreover, antioxidant enzyme activities including catalase, superoxide dismutase (SOD) and glutathione peroxidase (GPx) were increased following EGF treatment similar to MP treatment. Our experiment also suggests that alteration of the ratio of Bcl-2 to Bax may result from decreased apoptosis following EGF treatment. As a conclusion, these results show, for the first time, that administration of EGF exerts its protection via regulating apoptotic and oxidative pathways in response to spinal cord injury in different regions of central nervous system. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Science.gov (United States)

    Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

    2014-01-01

    Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

  18. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Directory of Open Access Journals (Sweden)

    Sarah Papiorek

    Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

  19. Converse Barrier Certificate Theorems

    DEFF Research Database (Denmark)

    Wisniewski, Rafael; Sloth, Christoffer

    2016-01-01

    This paper shows that a barrier certificate exists for any safe dynamical system. Specifically, we prove converse barrier certificate theorems for a class of structurally stable dynamical systems. Other authors have developed a related result by assuming that the dynamical system has neither...

  20. Influence of barrier layer indium on efficiency and wavelength of InGaN multiple quantum well (MQW) with and without semi-bulk InGaN buffer for blue to green regime emission

    Energy Technology Data Exchange (ETDEWEB)

    Alam, Saiful [School of Electrical and Computer Engineering, Georgia Institute of Technology, Atlanta, GA (United States); Georgia Tech-CNRS, UMI 2958, Metz (France); CEA-LETI, Minatec Campus, Grenoble (France); Sundaram, Suresh; Li, Xin; El Gmili, Youssef [Georgia Tech-CNRS, UMI 2958, Metz (France); Jamroz, Miryam E.; Robin, Ivan C. [CEA-LETI, Minatec Campus, Grenoble (France); Voss, Paul L.; Ougazzaden, Abdallah [School of Electrical and Computer Engineering, Georgia Institute of Technology, Atlanta, GA (United States); Georgia Tech-CNRS, UMI 2958, Metz (France); Salvestrini, Jean-Paul [Georgia Tech-CNRS, UMI 2958, Metz (France); LMOPS, University of Lorraine, EA4423, Metz (France)

    2017-08-15

    The effect of indium (In) in the barrier of InGaN/GaN multiple quantum well (MQW) has been studied for MQWs with and without semi-bulk InGaN buffer. From simulation, the optimum In content in the barrier with 3-5 nm width is 5-7% to get the optimal material quality and internal quantum efficiency (IQE) of ∝65% for 450-480 nm emission range. Simulation shows a reduction of the potential barrier due to band flattening, a more homogeneous distribution of electrons and holes in the active region and subsequently, a more radiative recombination rate with InGaN as barrier layer. Both cathodoluminescence (CL) and photoluminescence (PL) experimental results show a blue-shift of emission wavelength along with an enhancement in the emission intensity when GaN barrier is replaced with InGaN barrier, for a MQW structure both with and without the semi-bulk InGaN buffer. We attribute this blue shift to the reduced polarization mismatch and increased effective bandgap. This InGaN barrier-related improvement in IQE and efficiency droop could be useful for the realization of longer wavelength ''green-gap'' range LEDs where poor IQE and efficiency droop are more prominent due to high indium (In) in the active region. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  1. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  2. Barriers to the future

    Energy Technology Data Exchange (ETDEWEB)

    Massey, C T

    1986-09-01

    Opportunities for the British coal industry seem vast yet there are still barriers to progress. Seven areas are identified and discussed: mining mobility (for example, longwall mining systems are rigid and inflexible compared with American stall and pillar working); mine structure (many mines are more suitable to pit ponies than to large pieces of equipment); financial barriers (Government requires the industry to break even in 1987/88); personnel barriers (less specialization, better use of skills); safety barriers (increased use of remote control, ergonomics and robotics to protect workers); microelectronic management (nationalization has cushioned management from the market place; there is a need for a more multidisciplinary approach to the industry); and legal barriers (most legislation in the past has been in response to accidents; legislation external to the industry but affecting it is more fundamental).

  3. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  4. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  5. Cs-137 behaviour in landscape-geochemical structures of barrier complexes

    International Nuclear Information System (INIS)

    Strakh, L.I.; Ivashkevich, I.I.; Adamovich, A.A.; Zarubin, O.L.

    1998-01-01

    The Cs-137 distribution and cumulation accrues more actively in a marsh ecological systems of barrier complexes. The physical chemical and biogeochemical barriers influence on different way on these processes

  6. Divergent epidermal growth factor receptor mutation patterns between smokers and non-smokers with lung adenocarcinoma.

    Science.gov (United States)

    Tseng, Jeng-Sen; Wang, Chih-Liang; Yang, Tsung-Ying; Chen, Chih-Yi; Yang, Cheng-Ta; Chen, Kun-Chieh; Hsu, Kuo-Hsuan; Tsai, Chi-Ren; Chang, Gee-Chen

    2015-12-01

    Smoking status is an important determinant of the prevalence of epidermal growth factor receptor (EGFR) mutations in lung cancer patients. However, it is unclear whether smoking status could also influence the spectrum of EGFR mutations. We enrolled patients with lung adenocarcinoma from three medical centers in Taiwan. EGFR mutations were assessed by Sanger direct sequencing. The objective of this study was to evaluate the influence of smoking status on both the frequency and patterns of EGFR mutations. From 2001 to 2013, a total of 1175 patients with lung adenocarcinoma were enrolled for EGFR mutation analysis. The overall EGFR mutation rate was 59.6%, which was significantly higher in females than males (69.1% vs. 49.8%) and in non-smokers than current/former smokers (73.8% vs. 29.8%) (both Psmokers expressed L858R mutation less frequently (35.2% vs. 50.2%, P=0.005) and exon 19 deletions more frequently (52.8% vs 38.8%, P=0.008) than non-smokers. Smokers and non-smokers also had divergent exon 19 deletions subtypes (Del E746-A750 82.5% vs. 57.6%, respectively, Psmokers were associated with a higher rate of complex mutations than non-smokers (34.2% vs. 8.4%, P<0.001). Our results suggested that smoking status could influence not only the frequency but also the spectrum of EGFR mutations. These findings provide a clue for further investigation of EGFR mutagenesis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

    Science.gov (United States)

    Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

    2012-01-01

    HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

  8. Epidermal Growth Factor Enhances Cellular Uptake of Polystyrene Nanoparticles by Clathrin-Mediated Endocytosis.

    Science.gov (United States)

    Phuc, Le Thi Minh; Taniguchi, Akiyoshi

    2017-06-19

    The interaction between nanoparticles and cells has been studied extensively, but most research has focused on the effect of various nanoparticle characteristics, such as size, morphology, and surface charge, on the cellular uptake of nanoparticles. In contrast, there have been very few studies to assess the influence of cellular factors, such as growth factor responses, on the cellular uptake efficiency of nanoparticles. The aim of this study was to clarify the effects of epidermal growth factor (EGF) on the uptake efficiency of polystyrene nanoparticles (PS NPs) by A431 cells, a human carcinoma epithelial cell line. The results showed that EGF enhanced the uptake efficiency of A431 cells for PS NPs. In addition, inhibition and localization studies of PS NPs and EGF receptors (EGFRs) indicated that cellular uptake of PS NPs is related to the binding of EGF-EGFR complex and PS NPs. Different pathways are used to enter the cells depending on the presence or absence of EGF. In the presence of EGF, cellular uptake of PS NPs is via clathrin-mediated endocytosis, whereas, in the absence of EGF, uptake of PS NPs does not involve clathrin-mediated endocytosis. Our findings indicate that EGF enhances cellular uptake of PS NPs by clathrin-mediated endocytosis. This result could be important for developing safe nanoparticles and their safe use in medical applications.

  9. Epidermal Growth Factor Enhances Cellular Uptake of Polystyrene Nanoparticles by Clathrin-Mediated Endocytosis

    Directory of Open Access Journals (Sweden)

    Le Thi Minh Phuc

    2017-06-01

    Full Text Available The interaction between nanoparticles and cells has been studied extensively, but most research has focused on the effect of various nanoparticle characteristics, such as size, morphology, and surface charge, on the cellular uptake of nanoparticles. In contrast, there have been very few studies to assess the influence of cellular factors, such as growth factor responses, on the cellular uptake efficiency of nanoparticles. The aim of this study was to clarify the effects of epidermal growth factor (EGF on the uptake efficiency of polystyrene nanoparticles (PS NPs by A431 cells, a human carcinoma epithelial cell line. The results showed that EGF enhanced the uptake efficiency of A431 cells for PS NPs. In addition, inhibition and localization studies of PS NPs and EGF receptors (EGFRs indicated that cellular uptake of PS NPs is related to the binding of EGF–EGFR complex and PS NPs. Different pathways are used to enter the cells depending on the presence or absence of EGF. In the presence of EGF, cellular uptake of PS NPs is via clathrin-mediated endocytosis, whereas, in the absence of EGF, uptake of PS NPs does not involve clathrin-mediated endocytosis. Our findings indicate that EGF enhances cellular uptake of PS NPs by clathrin-mediated endocytosis. This result could be important for developing safe nanoparticles and their safe use in medical applications.

  10. Epidermal Growth Factor Receptor Is Related to Poor Survival in Glioblastomas: Single-Institution Experience

    Science.gov (United States)

    Choi, Youngmin; Lee, Hyung-Sik; Hur, Won-Joo; Sung, Ki-Han; Kim, Ki-Uk; Choi, Sun-Seob; Kim, Su-Jin; Kim, Dae-Cheol

    2013-01-01

    Purpose There are conflicting results surrounding the prognostic significance of epidermal growth factor receptor (EGFR) status in glioblastoma (GBM) patients. Accordingly, we attempted to assess the influence of EGFR expression on the survival of GBM patients receiving postoperative radiotherapy. Materials and Methods Thirty three GBM patients who had received surgery and postoperative radiotherapy at our institute, between March 1997 and February 2006, were included. The evaluation of EGFR expression with immunohistochemistry was available for 30 patients. Kaplan-Meier survival analysis and Cox regression were used for statistical analysis. Results EGFR was expressed in 23 patients (76.7%), and not expressed in seven (23.3%). Survival in EGFR expressing GBM patients was significantly less than that in non-expressing patients (median survival: 12.5 versus 17.5 months, p=0.013). Patients who received more than 60 Gy showed improved survival over those who received up to 60 Gy (median survival: 17.0 versus 9.0 months, p=0.000). Negative EGFR expression and a higher radiation dose were significantly correlated with improved survival on multivariate analysis. Survival rates showed no differences according to age, sex, and surgical extent. Conclusion The expression of EGFR demonstrated a significantly deleterious effect on the survival of GBM patients. Therefore, approaches targeting EGFR should be considered in potential treatment methods for GBM patients, in addition to current management strategies. PMID:23225805

  11. The under-appreciated promiscuity of the epidermal growth factor receptor family.

    Directory of Open Access Journals (Sweden)

    Sean P Kennedy

    2016-08-01

    Full Text Available Each member of the epidermal growth factor receptor (EGFR family plays a key role in normal development, homeostasis and a variety of pathophysiological conditions, most notably in cancer. According to the prevailing dogma, these four receptor tyrosine kinases (RTKs; EGFR, ERBB2, ERBB3 and ERBB4 function exclusively through the formation of homodimers and heterodimers within the EGFR family. These combinatorial receptor interactions are known to generate increased interactome diversity and therefore influence signalling output, subcellular localization and function of the heterodimer. This molecular plasticity is also thought to play a role in the development of resistance towards targeted cancer therapies aimed at these known oncogenes. Interestingly, many studies now challenge this dogma and suggest that the potential for EGFR family receptors to interact with more distantly related RTKs is much greater than currently appreciated. Here we discuss how the promiscuity of these oncogenic receptors may lead to the formation of many unexpected receptor pairings and the significant implications for the efficiency of many targeted cancer therapies.

  12. The influence of interfacial barrier engineering on the resistance switching of In2O3:SnO2/TiO2/In2O3:SnO2 device

    International Nuclear Information System (INIS)

    Liu Zi-Yu; Zhang Pei-Jian; Meng Yang; Li Dong; Meng Qing-Yu; Li Jian-Qi; Zhao Hong-Wu

    2012-01-01

    The I—V characteristics of In 2 O 3 :SnO 2 /TiO 2 /In 2 O 3 :SnO 2 junctions with different interfacial barriers are investigated by comparing experiments. A two-step resistance switching process is found for samples with two interfacial barriers produced by specific thermal treatment on the interfaces. The nonsynchronous occurrence of conducting filament formation through the oxide bulk and the reduction in the interfacial barrier due to the migration of oxygen vacancies under the electric field is supposed to explain the two-step resistive switching process. The unique switching properties of the device, based on interfacial barrier engineering, could be exploited for novel applications in nonvolatile memory devices. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  13. Vehicle barrier systems

    International Nuclear Information System (INIS)

    Sena, P.A.

    1986-01-01

    The ground vehicle is one of the most effective tools available to an adversary force. Vehicles can be used to penetrate many types of perimeter barriers, transport equipment and personnel rapidly over long distances, and deliver large amounts of explosives directly to facilities in suicide missions. The function of a vehicle barrier system is to detain or disable a defined threat vehicle at a selected distance from a protected facility. Numerous facilities are installing, or planning to install, vehicle barrier systems and many of these facilities are requesting guidance to do so adequately. Therefore, vehicle barriers are being evaluated to determine their stopping capabilities so that systems can be designed that are both balanced and capable of providing a desired degree of protection. Equally important, many of the considerations that should be taken into account when establishing a vehicle barrier system have been identified. These considerations which pertain to site preparation, barrier selection, system integration and operation, and vehicle/barrier interaction, are discussed in this paper

  14. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  15. Understanding Motivators and Barriers to Physical Activity

    Science.gov (United States)

    Patay, Mary E.; Patton, Kevin; Parker, Melissa; Fahey, Kathleen; Sinclair, Christina

    2015-01-01

    The purpose of this study was to understand the factors that influence physical activity among year-round residents in an isolated summer resort community. Specifically, we explored the personal, environmental, social, and culture-specific perceived motivators and barriers to physical activity. Participants were formally interviewed about their…

  16. Converse Barrier Certificate Theorem

    DEFF Research Database (Denmark)

    Wisniewski, Rafael; Sloth, Christoffer

    2013-01-01

    This paper presents a converse barrier certificate theorem for a generic dynamical system.We show that a barrier certificate exists for any safe dynamical system defined on a compact manifold. Other authors have developed a related result, by assuming that the dynamical system has no singular...... points in the considered subset of the state space. In this paper, we redefine the standard notion of safety to comply with generic dynamical systems with multiple singularities. Afterwards, we prove the converse barrier certificate theorem and illustrate the differences between ours and previous work...

  17. Epidermal response of rainbow trout to Ichthyobodo necator

    DEFF Research Database (Denmark)

    Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar

    2014-01-01

    Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...

  18. Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis

    Science.gov (United States)

    ... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...

  19. Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

    International Nuclear Information System (INIS)

    Wakshull, E.; Kraemer, P.M.; Wharton, W.

    1985-01-01

    Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

  20. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  1. HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Science.gov (United States)

    2017-03-03

    Stevens -Johnson Syndrome and Toxic Epidermal Necrolysis Brittany L. Lenz, MD, Andrew T. Patterson, MD, Amanda J . Laska, MD, Patrick J . Brown, MD, and...59 MDW/SGVU SUBJECT: Professional Presentation Approval 8 DEC 2016 1. Your paper, entitled HLA-B Sequencing in Patients with Stevens -Johnson...PATIENTS WITH STEVENS -JOHNSON SYNDROME AND TOXIC EPIDERMAL NECROL YSIS 2. FUNDING RECEIVED FOR THIS STUDY? DYES rgj NO FUNDING SOURCE: I I 3. IS THIS

  2. Epidermal growth factor receptor mutation in gastric cancer.

    Science.gov (United States)

    Liu, Zhimin; Liu, Lina; Li, Mei; Wang, Zhaohui; Feng, Lu; Zhang, Qiuping; Cheng, Shihua; Lu, Shen

    2011-04-01

    Epidermal growth factor receptor (EGFR) and Kirsten-RAS (KRAS) mutations have been identified as predictors of response to EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer. We aimed to screen the mutations of both genes in gastric carcinoma to detect the suitability of EGFR TKIs for patients with gastric carcinoma. We screened EGFR mutation in exons 19-21 and KRAS mutation in exon 2 in 58 gastric adenocarcinomas from China using high resolution melting analysis (HRMA). Positive samples were confirmed by DNA sequencing. Three EGFR missense mutations (5.2%) and 22 single nucleotide polymorphisms (SNP, Q787Q, 37.9%) were identified. To our knowledge, we report for the first time three mutation patterns of EGFR, Y801C, L858R and G863D, in gastric carcinoma. Two samples with EGFR mutation were mucinous adenocarcinoma. These three samples were collected from male patients aged over 75 years old. The frequency of KRAS mutation was 10.3% (6/58). The exclusiveness of EGFR and KRAS mutations was proven for the first time in gastric cancer. Gastric carcinoma of the mucinous adenocarcinoma type collected from older male patients may harbour EGFR mutations. The small subset of gastric adenocarcinoma patients may respond to EGFR TKIs.

  3. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  4. Intensive Care in a Patient with Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    J. Wallenborn

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a serious adverse drug reaction with high lethality, which usually requires intensive-medical care. A 44-year-old man developed generalized exanthema with increasing exfoliation and mucosal involvement after taking allopurinol, ibuprofen, and etoricoxib. The clinical diagnosis of TEN was histologically confirmed. Prednisolone therapy with 3 mg/kg body weight (BW was not able to prevent further progress to finally 80% of the body surface, and infliximab 5 mg/kg BW was given as a single dose. This prevented further progression of the TEN. Despite marked improvement in skin findings, the ICU stay was prolonged by a complex analgosedation, transient kidney failure, volume management, positioning therapy, and vegetatively impeded weaning. Moreover, there was colonization with multiresistant bacteria (MRSA and VRE. Nonetheless, the patient could be restored to health and was released after four weeks. Infliximab seems to be effective in the treatment of TEN, especially in cases of rapid progression. Moreover, patients with TEN are difficult to handle in intensive-medical care, whereby attention should especially be paid to sufficient pain therapy, and the positioning of the patient is a particular challenge.

  5. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  6. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  7. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  8. Intranasal epidermal growth factor treatment rescues neonatal brain injury

    Science.gov (United States)

    Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio

    2014-02-01

    There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.

  9. Information barriers and authentication

    International Nuclear Information System (INIS)

    MacArthur, D.W.; Wolford, J.K.

    2001-01-01

    Acceptance of nuclear materials into a monitoring regime is complicated if the materials are in classified shapes or have classified composition. An attribute measurement system with an information barrier can be emplo,yed to generate an unclassified display from classified measurements. This information barrier must meet two criteria: (1) classified information cannot be released to the monitoring party, and (2) the monitoring party must be convinced that the unclassified output accurately represents the classified input. Criterion 1 is critical to the host country to protect the classified information. Criterion 2 is critical to the monitoring party and is often termed the 'authentication problem.' Thus, the necessity for authentication of a measurement system with an information barrier stems directly from the description of a useful information barrier. Authentication issues must be continually addressed during the entire development lifecycle of the measurement system as opposed to being applied only after the system is built.

  10. Barrier Infrared Detector (BIRD)

    Data.gov (United States)

    National Aeronautics and Space Administration — A recent breakthrough in MWIR detector design, has resulted in a high operating temperature (HOT) barrier infrared detector (BIRD) that is capable of spectral...

  11. Protective barrier development: Overview

    International Nuclear Information System (INIS)

    Wing, N.R.; Gee, G.W.

    1990-01-01

    Protective barrier and warning marker systems are being developed to isolate wastes disposed of near the earth's surface at the Hanford Site. The barrier is designed to function in an arid to semiarid climate, to limit infiltration and percolation of water through the waste zone to near-zero, to be maintenance free, and to last up to 10,000 yr. Natural materials (e.g., fine soil, sand, gravel, riprap, clay, asphalt) have been selected to optimize barrier performance and longevity and to create an integrated structure with redundant features. These materials isolate wastes by limiting water drainage; reducing the likelihood of plant, animal, and human intrusion; controlling emission of noxious gases; and minimizing erosion. Westinghouse Hanford Company and Pacific Northwest Laboratory efforts to assess the performance of various barrier and marker designs will be discussed

  12. Engineered barriers: current status

    International Nuclear Information System (INIS)

    Atkinson, A.; Marsh, G.P.

    1988-01-01

    This report summarises the current state of research relevant to assessing the performance of engineered barriers made of steel and concrete in radioactive waste repositories. The objective of these barriers is to contain the radionuclides within them by providing both physical and chemical impediment to their release. The physical barriers are of most value for highly soluble isotopes with relatively short half-lives (eg 137 Cs), since they can provide containment until a large fraction of the activity has decayed. In addition they can facilitate retrievability for some period after disposal. The chemical barriers operate by beneficial conditioning of the near field groundwater and providing sites for sorption of radionuclides. Both of these reduce the aqueous concentration of radionuclides in the near field. (author)

  13. Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

    International Nuclear Information System (INIS)

    Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

    2008-01-01

    The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

  14. [Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

    Science.gov (United States)

    Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

    1992-07-01

    Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

  15. Skin barrier composition

    International Nuclear Information System (INIS)

    Osburn, F.G.

    1985-01-01

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices. (author)

  16. Skin barrier composition

    Energy Technology Data Exchange (ETDEWEB)

    Osburn, F G

    1985-06-12

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices.

  17. Renal content and output of epidermal growth factor in long-term adrenergic agonist-treated rats

    DEFF Research Database (Denmark)

    Thulesen, J; Nexø, Ebba; Poulsen, Steen Seier

    2000-01-01

    This study investigates the renal and urinary levels of epidermal growth factor (EGF) in rats under long-term treatment with alpha- or beta-adrenergic agonists. Urine samples were obtained on days 7, 14 and 21, and renal tissue samples on day 21. EGF was quantified by ELISA and tissue sections were...... material in the distal tubules. Concomitantly, reduced levels of EGF and EGF mRNA were observed, and also the urinary levels of EGF were reduced. Together, these observations indicate alpha-adrenergic treatment to affect the distal tubules. Treatment with the beta-adrenergic agonist did not change...... fractional kidney weight, but initially the urinary excretion of EGF was reduced. The data add further evidence to the suggestion that activity of the sympathetic nervous system influences renal homeostasis of EGF, either directly or indirectly through renal histopathological changes....

  18. Recent advancement to prevent the development of allergy and allergic diseases and therapeutic strategy in the perspective of barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Osamu Natsume

    2018-01-01

    Full Text Available Therapeutic strategy in late 20th century to prevent allergic diseases was derived from a conceptual framework of allergens elimination which was as same as that of coping with them after their onset. Manifold trials were implemented; however, most of them failed to verify the effectiveness of their preventive measures. Recent advancement of epidemiological studies and cutaneous biology revealed epidermal barrier dysfunction plays a major role of allergen sensitization and development of atopic dermatitis which ignites the inception of allergy march. For this decade, therapeutic strategy to prevent the development of food allergy has been confronted with a paradigm shift from avoidance and delayed introduction of allergenic foods based on the theoretical concept to early introduction of them based on the clinical and epidemiological evidences. Especially, prevention of peanut allergy and egg allergy has been established with the highest evidence verified by randomized controlled trials, although application in clinical practice should be done with attention. This paradigm shift concerning food allergy was also due to the discovery of cutaneous sensitization risk of food allergens for an infant with eczema revealed by prospective studies. Here we have recognized the increased importance of prevention of eczema/atopic dermatitis in infancy. Two randomized controlled trials using emollients showed successful results in prevention of atopic dermatitis in infancy; however, longer term safety and prognosis including allergy march should be pursued. To establish more fundamental strategy for prevention of the development of allergy, further studies clarifying the mechanisms of interaction between barrier dysfunction and microbial milieu are needed with macroscope to understand the relationship between allergic diseases and a diversity of environmental influences.

  19. Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    ) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...

  20. Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis

    DEFF Research Database (Denmark)

    List, Karin; Haudenschild, Christian C; Szabo, Roman

    2002-01-01

    of Matriptase/MT-SP1 also seriously affected hair follicle development resulting in generalized follicular hypoplasia, absence of erupted vibrissae, lack of vibrissal hair canal formation, ingrown vibrissae, and wholesale abortion of vibrissal follicles. Furthermore, Matriptase/MT-SP1-deficiency resulted...... in dramatically increased thymocyte apoptosis, and depletion of thymocytes. This study demonstrates that Matriptase/MT-SP1 has pleiotropic functions in the development of the epidermis, hair follicles, and cellular immune system....

  1. Increased epidermal laser fluence through simultaneous ultrasonic microporation

    Science.gov (United States)

    Whiteside, Paul J. D.; Chininis, Jeff A.; Schellenberg, Mason W.; Qian, Chenxi; Hunt, Heather K.

    2016-03-01

    Lasers have demonstrated widespread applicability in clinical dermatology as minimally invasive instruments that achieve photogenerated responses within tissue. However, before reaching its target, the incident light must first transmit through the surface layer of tissue, which is interspersed with chromophores (e.g. melanin) that preferentially absorb the light and may also generate negative tissue responses. These optical absorbers decrease the efficacy of the procedures. In order to ensure that the target receives a clinically relevant dose, most procedures simply increase the incident energy; however, this tends to exacerbate the negative complications of melanin absorption. Here, we present an alternative solution aimed at increasing epidermal energy uence while mitigating excess absorption by unintended targets. Our technique involves the combination of a waveguide-based contact transmission modality with simultaneous high-frequency ultrasonic pulsation, which alters the optical properties of the tissue through the agglomeration of dissolved gasses into micro-bubbles within the tissue. Doing so effectively creates optically transparent pathways for the light to transmit unobstructed through the tissue, resulting in an increase in forward scattering and a decrease in absorption. To demonstrate this, Q-switched nanosecond-pulsed laser light at 532nm was delivered into pig skin samples using custom glass waveguides clad in titanium and silver. Light transmission through the tissue was measured with a photodiode and integrating sphere for tissue with and without continuous ultrasonic pulsation at 510 kHz. The combination of these techniques has the potential to improve the efficiency of laser procedures while mitigating negative tissue effects caused by undesirable absorption.

  2. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  3. Epidermal characters of Tamarix L. (Tamaricaceae) from Northwest China and their taxonomic and palaeogeographic implications

    OpenAIRE

    Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan

    2018-01-01

    The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...

  4. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  5. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  6. Fuzzy barrier distributions

    International Nuclear Information System (INIS)

    Piasecki, E.

    2009-01-01

    Heavy-ion collisions often produce a fusion barrier distribution with structures displaying a fingerprint of couplings to highly collective excitations [1]. Basically the same distribution can be obtained from large-angle quasi-elastic scattering, though here the role of the many weak direct-reaction channels is unclear. For 2 0N e + 9 0Z r we have observed the barrier structures expected for the highly deformed neon projectile, but for 2 0N e + 9 2Z r we find completely smooth distribution (see Fig.1). We find that transfer channels in these systems are of similar strength but single particle excitations are significantly stronger in the latter case. They apparently reduce the 'resolving power' of the quasi-elastic channel, what leads to smeared out, or 'fuzzy' barrier distribution. This is the first case when such a phenomenon has been observed.(author)

  7. Health Barriers to Learning

    Directory of Open Access Journals (Sweden)

    Delaney Gracy

    2014-01-01

    Full Text Available This article summarizes the results from a 2013 online survey with 408 principals and assistant principals in New York City public elementary and middle schools. The survey assessed three primary areas: health issues in the school, health issues perceived as barriers to learning for affected students, and resources needed to address these barriers. Eighteen of the 22 health conditions listed in the survey were considered a moderate or serious issue within their schools by at least 10% of respondents. All 22 of the health issues were perceived as a barrier to learning by between 12% and 87% of the respondents. Representatives from schools that serve a higher percentage of low-income students reported significantly higher levels of concern about the extent of health issues and their impact on learning. Respondents most often said they need linkages with organizations that can provide additional services and resources at the school, especially for mental health.

  8. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars.

    Science.gov (United States)

    Jackisch, Christian; Lammers, Philip; Jacobs, Ira

    2017-04-01

    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer. Copyright © 2017 Authors, Pfizer Inc. Published by Elsevier Ltd.. All rights reserved.

  9. Barriers to Medicaid Participation among Florida Dentists

    Science.gov (United States)

    Logan, Henrietta L.; Catalanotto, Frank; Guo, Yi; Marks, John; Dharamsi, Shafik

    2015-01-01

    Background Finding dentists who treat Medicaid-enrolled children is a struggle for many parents. The purpose of this study was to identify non-reimbursement factors that influence the decision by dentists about whether or not to participate in the Medicaid program in Florida. Methods Data from a mailed survey was analyzed using a logistic regression model to test the association of Medicaid participation with the Perceived Barriers and Social Responsibility variables. Results General and pediatric dentists (n=882) who identified themselves as either Medicaid (14%) or Non-Medicaid (86%) participants responded. Five items emerged as significant predictors of Medicaid participation, with a final concordance index of 0.905. Two previously unreported barriers to participation in Medicaid emerged: 1) dentists’ perception of social stigma from other dentists for participating in Medicaid, and 2) the lack of specialists to whom Medicaid patients can be referred. Conclusions This study provides new information about non-reimbursement barriers to Medicaid participation. PMID:25702734

  10. Pigmented epidermal cyst with dense collection of melanin: A rare entity - Report of a case with review of the literature.

    Science.gov (United States)

    Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald

    2012-05-01

    Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.

  11. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  12. Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

    Energy Technology Data Exchange (ETDEWEB)

    Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran [Uijongbu St. Mary' s Hospital, Catholic University College of Medicine, Seoul (Korea, Republic of)

    2007-08-15

    We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation.

  13. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  14. Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

    International Nuclear Information System (INIS)

    Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran

    2007-01-01

    We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation

  15. Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)

    2011-06-15

    We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.

  16. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  17. Epidermal growth factor receptor: an independent predictor of survival in astrocytic tumors given definitive irradiation

    International Nuclear Information System (INIS)

    An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.

    1996-01-01

    Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas

  18. Composite of microgels and lipids as biofilm to restore skin barrier function

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

  19. Visual selective attention with virtual barriers.

    Science.gov (United States)

    Schneider, Darryl W

    2017-07-01

    Previous studies have shown that interference effects in the flanker task are reduced when physical barriers (e.g., hands) are placed around rather than below a target flanked by distractors. One explanation of this finding is the referential coding hypothesis, whereby the barriers serve as reference objects for allocating attention. In five experiments, the generality of the referential coding hypothesis was tested by investigating whether interference effects are modulated by the placement of virtual barriers (e.g., parentheses). Modulation of flanker interference was found only when target and distractors differed in size and the virtual barriers were beveled wood-grain objects. Under these conditions and those of previous studies, the author conjectures that an impression of depth was produced when the barriers were around the target, such that the target was perceived to be on a different depth plane than the distractors. Perception of depth in the stimulus display might have led to referential coding of the stimuli in three-dimensional (3-D) space, influencing the allocation of attention beyond the horizontal and vertical dimensions. This 3-D referential coding hypothesis is consistent with research on selective attention in 3-D space that shows flanker interference is reduced when target and distractors are separated in depth.

  20. Induction of proliferation of basal epidermal keratinocytes by cold atmospheric-pressure plasma.

    Science.gov (United States)

    Hasse, S; Duong Tran, T; Hahn, O; Kindler, S; Metelmann, H-R; von Woedtke, T; Masur, K

    2016-03-01

    Over the past few decades, new cold plasma sources have been developed that have the great advantage of operating at atmospheric pressure and at temperatures tolerable by biological material. New applications for these have emerged, especially in the field of dermatology. Recently it was demonstrated that cold atmospheric-pressure plasma positively influences healing of chronic wounds. The potential of cold plasma lies in its capacity to reduce bacterial load in the wound while at the same time stimulating skin cells and therefore promoting wound closure. In recent years, there have been great advances in the understanding of the molecular mechanisms triggered by cold plasma involving signalling pathways and gene regulation in cell culture. To investigate cold plasma-induced effects in ex vivo treated human skin biopsies. Human skin tissue was exposed to cold plasma for different lengths of time, and analysed by immunofluorescence with respect to DNA damage, apoptosis, proliferation and differentiation markers. After cold plasma treatment, the epidermal integrity and keratin expression pattern remained unchanged. As expected, the results revealed an increase in apoptotic cells after 3 and 5 min of treatment. Strikingly, an induction of proliferating basal keratinocytes was detected after cold plasma exposure for 1 and 3 min. As these are the cells that regenerate the epidermis, this could indeed be beneficial for wound closure. We investigated the effect of cold plasma on human skin by detecting molecules for growth and apoptosis, and found that both processes are dependent on treatment time. Therefore, this approach offers promising results for further applications of cold plasma in clinical dermatology. © 2015 British Association of Dermatologists.

  1. Modulation of Regorafenib effects on HCC cell lines by epidermal growth factor.

    Science.gov (United States)

    D'Alessandro, Rosalba; Refolo, Maria Grazia; Lippolis, Catia; Carella, Nicola; Messa, Caterina; Cavallini, Aldo; Carr, Brian Irving

    2015-06-01

    Blood platelet numbers are correlated to growth and aggressiveness of several tumor types, including hepatocellular carcinoma (HCC). We previously found that platelet lysates (hPLs) also stimulated growth and migration, and antagonized the growth-inhibitory and apoptotic effects of both Sorafenib and Regorafenib, two multikinase inhibitors, on three HCC cell lines. In this study, in vitro function of human epidermal growth factor (EGF) with and without Sorafenib or Regorafenib was investigated. An ELISA kit was used to evaluate the EGF concentrations in hPLs. In vitro function of EGF was assessed with proliferation MTT test. Apoptosis assay, scratch assays, and Transwell assays were performed for apoptosis, invasion, and migration, respectively. MAPK Activation Kit was used to explore MAPK phosphorylation. EGF antagonized the growth inhibition of Regorafenib on three HCC cell lines. Regorafenib-mediated growth inhibition was blocked by 70 % when the cells were pre-treated with EGF. EGF also blocked Regorafenib-induced apoptosis, as well as Regorafenib-induced decreases in cell migration and invasion. The EGF effects were in turn antagonized by concomitant addition to the cultures of EGF receptor antagonist Erlotinib, showing that the EGF receptor was involved in the mechanisms of EGF-mediated blocking of Regorafenib effects. Erlotinib also partially blocked the effects of hPLs in antagonizing Regorafenib-mediated growth inhibition, showing that EGF was an important component of hPL actions. All these results show that EGF antagonized Regorafenib-mediated growth and migration inhibition and apoptosis induction in HCC cells and reinforce the idea that microenvironment can influence cancer drug actions.

  2. Morphology and dynamics of tumor cell colonies propagating in epidermal growth factor supplemented media

    Science.gov (United States)

    Muzzio, N. E.; Carballido, M.; Pasquale, M. A.; González, P. H.; Azzaroni, O.; Arvia, A. J.

    2018-07-01

    The epidermal growth factor (EGF) plays a key role in physiological and pathological processes. This work reports on the influence of EGF concentration (c EGF) on the modulation of individual cell phenotype and cell colony kinetics with the aim of perturbing the colony front roughness fluctuations. For this purpose, HeLa cell colonies that remain confluent along the whole expansion process with initial quasi-radial geometry and different initial cell populations, as well as colonies with initial quasi-linear geometry and large cell population, are employed. Cell size and morphology as well as its adhesive characteristics depend on c EGF. Quasi-radial colonies (QRC) expansion kinetics in EGF-containing medium exhibits a complex behavior. Namely, at the first stages of growth, the average QRC radius evolution can be described by a t 1/2 diffusion term coupled with exponential growth kinetics up to a critical time, and afterwards a growth regime approaching constant velocity. The extension of each regime depends on c EGF and colony history. In the presence of EGF, the initial expansion of quasi-linear colonies (QLCs) also exhibits morphological changes at both the cell and the colony levels. In these cases, the cell density at the colony border region becomes smaller than in the absence of EGF and consequently, the extension of the effective rim where cell duplication and motility contribute to the colony expansion increases. QLC front displacement velocity increases with c EGF up to a maximum value in the 2–10 ng ml‑1 range. Individual cell velocity is increased by EGF, and an enhancement in both the persistence and the ballistic characteristics of cell trajectories can be distinguished. For an intermediate c EGF, collective cell displacements contribute to the roughening of the colony contours. This global dynamics becomes compatible with the standard Kardar–Parisi–Zhang growth model, although a faster colony roughness saturation in EGF-containing medium

  3. Normal epidermal growth factor receptor signaling is dispensable for bone anabolic effects of parathyroid hormone.

    Science.gov (United States)

    Schneider, Marlon R; Dahlhoff, Maik; Andrukhova, Olena; Grill, Jessica; Glösmann, Martin; Schüler, Christiane; Weber, Karin; Wolf, Eckhard; Erben, Reinhold G

    2012-01-01

    Although the bone anabolic properties of intermittent parathyroid hormone (PTH) have long been employed in the treatment of osteoporosis, the molecular mechanisms behind this action remain largely unknown. Previous studies showed that PTH increases the expression and the activity of epidermal growth factor receptor (EGFR) in osteoblasts, and activation of ERK1/2 by PTH in osteoblasts was demonstrated to induce the proteolytical release of EGFR ligands and EGFR transactivation. However, conclusive evidence for an important role of the EGFR system in mediating the anabolic actions of intermittent PTH on bone in vivo is lacking. Here, we evaluated the effects of intermittent PTH on bone in Waved-5 (Wa5) mice which carry an antimorphic Egfr allele whose product acts as a dominant negative receptor. Heterozygous Wa5 females and control littermates received a subcutaneous injection of PTH (80 μg/kg) or buffer on 5 days per week for 4 weeks. Wa5 mice had slightly lower total bone mineral density (BMD), but normal cancellous bone volume and turnover in the distal femoral metaphysis. The presence of the antimorphic Egfr allele neither influenced the PTH-induced increase in serum osteocalcin nor the increases in distal femoral BMD, cortical thickness, cancellous bone volume, and cancellous bone formation rate. Similarly, the PTH-induced rise in lumbar vertebral BMD was unchanged in Wa5 relative to wild-type mice. Wa5-derived osteoblasts showed considerably lower basal extracellular signal-regulated kinase 1/2 (ERK1/2) activation as compared to control osteoblasts. Whereas activation of ERK1/2 by the EGFR ligand amphiregulin was largely blocked in Wa5 osteoblasts, treatment with PTH induced ERK1/2 activation comparable to that observed in control osteoblasts, relative to baseline levels. Our data indicate that impairment of EGFR signaling does not affect the anabolic action of intermittent PTH on cancellous and cortical bone. Copyright © 2011. Published by Elsevier Inc.

  4. Sulindac metabolites inhibit epidermal growth factor receptor activation and expression

    Directory of Open Access Journals (Sweden)

    Ahnen Dennis

    2005-01-01

    Full Text Available Abstract Background Regular use of nonsteroidal anti-inflammatory drugs (NSAIDs is associated with a decreased mortality from colorectal cancer (CRC. NSAIDs induce apoptotic cell death in colon cancer cells in vitro and inhibit growth of neoplastic colonic mucosa in vivo however, the biochemical mechanisms required for these growth inhibitory effects are not well defined. We previously reported that metabolites of the NSAID sulindac downregulate extracellular-signal regulated kinase 1/2 (ERK1/2 signaling and that this effect is both necessary and sufficient for the apoptotic effects of these drugs. The goal of this project was to specifically test the hypothesis that sulindac metabolites block activation and/or expression of the epidermal growth factor (EGF receptor (EGFR. Methods HT29 human colon cancer cells were treated with EGF, alone, or in the presence of sulindac sulfide or sulindac sulfone. Cells lysates were assayed by immunoblotting for phosphorylated EGFR (pEGFR, pY1068, total EGFR, phosphorylated ERK1/2 (pERK1/2, total ERK1/2, activated caspase-3, and α-tubulin. Results EGF treatment rapidly induced phosphorylation of both EGFR and ERK1/2 in HT29 colon cancer cells. Pretreatment with sulindac metabolites for 24 h blocked EGF-induced phosphorylation of both EGFR and ERK1/2 and decreased total EGFR protein expression. Under basal conditions, downregulation of pEGFR and total EGFR was detected as early as 12 h following sulindac sulfide treatment and persisted through at least 48 h. Sulindac sulfone induced downregulation of pEGFR and total EGFR was detected as early as 1 h and 24 h, respectively, following drug treatment, and persisted through at least 72 h. EGFR downregulation by sulindac metabolites was observed in three different CRC cell lines, occurred prior to the observed downregulation of pERK1/2 and induction of apoptosis by these drugs, and was not dependent of caspase activation. Conclusion These results suggest that

  5. Kiwifruit, mucins, and the gut barrier.

    Science.gov (United States)

    Moughan, Paul J; Rutherfurd, Shane M; Balan, Prabhu

    2013-01-01

    Kiwifruit has long been regarded in China, where it originated from, for its health properties and particularly in relation to digestion and general gut health. There are a number of physical and chemical properties of the fruit, including its dietary fiber content, the presence of raphides, its high water holding capacity and actinidin content, that suggest that kiwifruit may be effective in influencing gut mucin production and thus enhancing the integrity of the gut barrier. The mucous layer, which comprises mucins and other materials, overlying the mucosal epithelium, is an important component of the gut barrier. The gut barrier plays a crucial role in separating the host from the often noxious external environment. The mucous layer, which covers the entire gastrointestinal tract (GIT), is the front line of innate host defense. There have been few direct studies of the effect of kiwifruit ingestion on mucin production in the GIT, and findings that are available using animal models are somewhat inconsistent. Taking results for digesta mucin content, number of goblet cells, and mucin gene expression, together, it would seem that green kiwifruit and possibly gold kiwifruit do influence gut mucin production, and the kiwifruit as part of a balanced diet may help to maintain the mucous layer and gut barrier. More corroborative experimental evidence is needed, and studies need to be undertaken in humans. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Quantifying the influence of the epidermal optical properties on laser treatment parameters

    CSIR Research Space (South Africa)

    Karsten, AE

    2013-05-01

    Full Text Available . The formation of highly reactive singlet oxygen in the cells leads to cell death through apoptosis or necrosis9,11,12. Due to the short lifetime of the singlet oxygen in biological systems only molecules close to the PS are affected. The half...-lifetime of singlet oxygen is less than 40 ns, and the radius of the action of singlet oxygen is in the order of 20 nm13. PDT is a localised treatment, having less of an adverse effect on the healthy cells not irradiated by the light source. PDT has been approved...

  7. Barrier Data Base user's guide

    International Nuclear Information System (INIS)

    Worrell, R.B.; Gould, D.J.; Wall, D.W.

    1977-06-01

    A special purpose data base for physical security barriers has been developed. In addition to barriers, the entities accommodated by the Barrier Data Base (BDB) include threats and references. A threat is established as a configuration of people and equipment which has been employed to penetrate (or attempt to penetrate) a barrier. References are used to cite publications pertinent to the barriers and threats in the data base. Utilization and maintenance of the Barrier Data Base is achieved with LIST, QUERY, ENTER, DELETE, and CHANGE commands which are used to manipulate the data base entities

  8. Fatal Metastatic Cutaneous Squamous Cell Carcinoma Evolving from a Localized Verrucous Epidermal Nevus

    Directory of Open Access Journals (Sweden)

    Hassan Riad

    2013-10-01

    Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.

  9. Ultrathin epidermal strain sensor based on an elastomer nanosheet with an inkjet-printed conductive polymer

    Science.gov (United States)

    Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori

    2017-08-01

    To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.

  10. Giant epidermal inclusion cyst in the male breast: A case report

    Energy Technology Data Exchange (ETDEWEB)

    KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)

    2017-03-15

    Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.

  11. Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants

    International Nuclear Information System (INIS)

    Nishida, K.; Roksandic, Z.; Osmond, B.

    1981-01-01

    The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon

  12. Rotational spectrum of 1,1-difluoroethane-argon: influence of the interaction with the Ar atom on the V 3 barrier to internal rotation of the methyl group

    Science.gov (United States)

    Velino, Biagio; Melandri, Sonia; Favero, Paolo G.; Dell'Erba, Adele; Caminati, Walther

    2000-01-01

    The free-jet millimeter-wave absorption spectrum of 1,1-difluoroethane-Ar is reported. Most of the measured lines are split due to internal rotation of the methyl group and the tunnelling motion of Ar connecting two equivalent potential energy minima. The Ar atom, close to the CHF 2 group, eclipses one of the methylic hydrogens in the symmetryless geometry of the complex, reducing in this way the barrier to the internal rotation of the methyl group with respect to isolated 1,1-difluoroethane. For high J levels the distance of Ar from the molecule increases, however, due to the centrifugal distortion, and the barrier increases towards the value for 1,1-difluoroethane.

  13. Investigating the barriers on media privatization

    Directory of Open Access Journals (Sweden)

    Roghiyeh Jame

    2013-01-01

    Full Text Available During the past few years, there has been growing interests in reducing cost of products and services among developing countries. Privatization is believed to be one of the most important techniques to increase relative efficiencies of publically held organizations. In this paper, we study important barriers on privatization of television (TV media industry in Iran. The proposed study of this paper designs and distributes a questionnaire using a sample of 234 out of 600 graduate students who were enrolled in media communication studies and examined six hypotheses based on one-side t-student. The survey considers different factors influencing privatization of TV media industry. The results of the investigation indicate that the cost of TV production, short and long-term investment security, people's interest on investing on TV media industry, building appropriate culture, cultural obstacles and economic barriers influence media privatization, significantly.

  14. Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Hugo Nodarse-Cuní

    2013-03-01

    Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.

  15. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  16. Simple preparation of plant epidermal tissue for laser microdissection and downstream quantitative proteome and carbohydrate analysis

    Directory of Open Access Journals (Sweden)

    Christian eFalter

    2015-03-01

    Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.

  17. Radiotherapy and receptor of epidermal growth factor; Radiotherapie et recepteur de l'Epidermal Growth Factor

    Energy Technology Data Exchange (ETDEWEB)

    Deberne, M. [Institut Gustave-Roussy, 94 - Villejuif (France)

    2009-10-15

    The expression level of the receptor of the epidermal growth factor is in correlation with the tumor cells radiosensitivity. An overexpression of the E.G.F.R. is often present in the bronchi cancer, epidermoid carcinomas of the O.R.L. sphere, esophagus, uterine cervix, and anal duct but also in the rectum cancers and glioblastomas. At the clinical level, the E.G.F.R. expression is in correlation with an unfavourable prognosis after radiotherapy in numerous tumoral localizations. In the rectum cancers it is an independent prognosis factor found in multifactorial analysis: increase of the rate of nodes and local recurrence when the E.G.F.R. is over expressed. In the uterine cervix cancers, the survival is is negatively affected in multifactorial analysis by the E.G.F.R. membranes expression level. At the therapy level, the development of anti E.G.F.R. targeted therapies (tyrosine kinase inhibitors and monoclonal antibodies) opens a new therapy field at radio-sensitivity potentiality. The irradiation makes an activation of the E.G.F.R. way that would be partially responsible of the post irradiation tumoral repopulation. This activation leads the phosphorylation of the PI3 kinase ways and M.A.P. kinase ones, then the Akt protein one that acts an apoptotic modulator part. It has been shown that blocking the E.G.F.R. way acts on three levels: accumulation of ells in phase G1, reduction of the cell repair and increasing of apoptosis. he inhibition of post irradiation action of the E.G.F.R. signal way is a factor explaining the ionizing radiation - anti E.G.F.R. synergy. The preclinical data suggest that the E.G.F.R. blocking by the monoclonal antibodies is more important than the use of tyrosine kinase inhibitors. A first positive randomized study with the cetuximab, published in 2006 in the epidermoid carcinomas of the O.R.L. sphere lead to its authorization on the market with the radiotherapy for this localization. The use of cetuximab in other indication with or in

  18. Geophysical characterization of subsurface barriers

    International Nuclear Information System (INIS)

    Borns, D.J.

    1995-08-01

    An option for controlling contaminant migration from plumes and buried waste sites is to construct a subsurface barrier of a low-permeability material. The successful application of subsurface barriers requires processes to verify the emplacement and effectiveness of barrier and to monitor the performance of a barrier after emplacement. Non destructive and remote sensing techniques, such as geophysical methods, are possible technologies to address these needs. The changes in mechanical, hydrologic and chemical properties associated with the emplacement of an engineered barrier will affect geophysical properties such a seismic velocity, electrical conductivity, and dielectric constant. Also, the barrier, once emplaced and interacting with the in situ geologic system, may affect the paths along which electrical current flows in the subsurface. These changes in properties and processes facilitate the detection and monitoring of the barrier. The approaches to characterizing and monitoring engineered barriers can be divided between (1) methods that directly image the barrier using the contrasts in physical properties between the barrier and the host soil or rock and (2) methods that reflect flow processes around or through the barrier. For example, seismic methods that delineate the changes in density and stiffness associated with the barrier represents a direct imaging method. Electrical self potential methods and flow probes based on heat flow methods represent techniques that can delineate the flow path or flow processes around and through a barrier

  19. An ex vivo human skin model for studying skin barrier repair.

    Science.gov (United States)

    Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A

    2015-01-01

    In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Chaotic correlations in barrier billiards with arbitrary barriers

    International Nuclear Information System (INIS)

    Osbaldestin, A H; Adamson, L N C

    2013-01-01

    We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)