Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
Denda, Mitsuhiro
2011-11-01
Previous studies have suggested that hexose molecules influence the stability of phospholipid bilayers. Therefore, the effects of topical application of all 12 stereoisomers of dextro-hexose on the epidermal barrier recovery rate after barrier disruption were evaluated. Immediately after tape stripping, 0.1 m aqueous solution of each hexose was applied on hairless mouse skin. Among the eight dextro-aldohexoses, topical application of altose, idose, mannose and talose accelerated the barrier recovery, while allose, galactose, glucose and gulose had no effect. Among the four dextro-ketohexoses, psicose, fructose, sorbose and tagatose all accelerated the barrier recovery. As the effects of hexoses on the barrier recovery rate appeared within 1 h, the mechanism is unlikely to be genomic. Instead, these hexoses may influence phase transition of the lipid bilayers of lamellar bodies and cell membrane, a crucial step in epidermal permeability barrier homeostasis. © 2011 John Wiley & Sons A/S.
Epidermal Growth Factor and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Xiaopeng Tang
2016-01-01
Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.
Fatty acids are required for epidermal permeability barrier function.
Mao-Qiang, M; Elias, P M; Feingold, K R
1993-08-01
The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.
Crawford, Melissa; Dagnino, Lina
2017-10-02
The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.
TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.
Directory of Open Access Journals (Sweden)
Aurélie Hayez
Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.
Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji
2016-01-01
To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.
Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean
2012-01-01
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868
Sayedyahossein, Samar; Rudkouskaya, Alena; Leclerc, Valerie; Dagnino, Lina
2016-02-01
A functional permeability barrier is essential to prevent the passage of water and electrolytes, macromolecules, and pathogens through the epidermis. This is accomplished in terminally differentiated keratinocytes through formation of a cornified envelope and the assembly of tight intercellular junctions. Integrin-linked kinase (ILK) is a scaffold protein essential for hair follicle morphogenesis and epidermal attachment to the basement membrane. However, the biological functions of ILK in differentiated keratinocytes remain poorly understood. Furthermore, whether ILK is implicated in keratinocyte differentiation and intercellular junction formation has remained an unresolved issue. Here we describe a pivotal role for ILK in keratinocyte differentiation responses to increased extracellular Ca(2+), regulation of adherens and tight junction assembly, and the formation of an outside-in permeability barrier toward macromolecules. In the absence of ILK, the calcium sensing receptor, E-cadherin, and ZO-1 fail to translocate to the cell membrane, through mechanisms that involve abnormalities in microtubules and in RhoA activation. In situ, ILK-deficient epidermis exhibits reduced tight junction formation and increased outside-in permeability to a dextran tracer, indicating reduced barrier properties toward macromolecules. Therefore, ILK is an essential component of keratinocyte differentiation programs that contribute to epidermal integrity and the establishment of its barrier properties. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine
2018-01-01
The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics
Henrique Silva; Sara Aguiar Silva; Hugo Ferreira; L. Monteiro Rodrigues
2015-01-01
Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu). The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young ad...
Acyl-CoA binding protein and epidermal barrier function
DEFF Research Database (Denmark)
Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J
2014-01-01
The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...
Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics
Directory of Open Access Journals (Sweden)
Henrique Silva
2015-03-01
Full Text Available Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu. The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young adult subjects (21.6 ± 2.6 years old were selected after informed consent. Subjects were asked to apply a commercially available alcohol gel sanitizer to one hand for 15 days. TEWL absolute values were measured on days 1, 8 and 15 and a plastic occlusion stress test (POST applied. Evaporation half-life (t1/2 evap and dynamic water mass (DWM values increased significantly on day 15 on the treated hand compared to the control hand suggesting that, in the present experimental conditions, the regular use of an alcohol-based gel sanitizer does changes the epidermal barrier. This study also confirms the usefulness of this kinetic model to detect subtle changes on in vivo TEWL dynamics.
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
Epidermal hydration levels in rosacea patients improve after minocycline therapy.
LENUS (Irish Health Repository)
Ní Raghallaigh, S
2013-12-06
Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.
Directory of Open Access Journals (Sweden)
Susan John
Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Tight junction regulates epidermal calcium ion gradient and differentiation
International Nuclear Information System (INIS)
Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki
2011-01-01
Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.
Boralevi, F; Hubiche, T; Léauté-Labrèze, C; Saubusse, E; Fayon, M; Roul, S; Maurice-Tison, S; Taïeb, A
2008-02-01
Sensitization to atopens is an early phenomenon that overlaps with the onset of atopic dermatitis (AD) in infancy. Early epidermal barrier impairment may facilitate the epicutaneous penetration of atopens. To correlate transepidermal water loss (TEWL) and aeroallergen sensitization in infants with AD. In this cross-sectional study we enrolled 59 AD children and 30 controls aged 3-12 months. Transepidermal water loss in uninvolved skin, specific immunoglobulin E, atopy patch test (APT) and skin prick tests were performed with respect to seven aeroallergens, i.e., Dermatophagoides pteronyssinus, D. farinae, cat, dog, birch pollen, ambrosia, and cockroach. Environmental conditions were assessed by a questionnaire, and the house dust mite (HDM) concentration was determined in dust samples. Eighty-nine percent of AD infants had a positive APT vs one out of eleven controls. AD infants had a significantly higher mean TEWL than controls (27.4 vs 11.1 g/m(2)/h, P cats, and dogs at home. This study confirms the high prevalence of delayed sensitization to indoor and outdoor aeroallergens in AD infants, and shows that the higher the TEWL, the higher the prevalence of sensitization to aeroallergens. These data are in favor of a major role of a constitutive epidermal barrier impairment in determining early atopen sensitization in infants with AD.
Compromised epidermal barrier stimulates Harderian gland activity and hypertrophy in ACBP-/- mice
DEFF Research Database (Denmark)
Sørensen, Signe Bek; Neess, Ditte; Dixen, Karen
2015-01-01
of the eye lid. We show that disruption of the Acbp gene leads to a significant enlargement of this gland with hypertrophy of the acinar cells and increased de novo synthesis of monoalkyl diacylglycerol, the main lipid species produced by the gland. Mice with conditional targeting of the Acbp gene......Acyl-CoA binding protein (ACBP) is a small, ubiquitously expressed intracellular protein that binds C14-C22 acyl-CoA esters with very high affinity and specificity. We have recently shown that targeted disruption of the Acbp gene leads to a compromised epidermal barrier and that this causes delayed...
Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.
Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M
2016-09-01
Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...
Therapeutic benefits of enhancing permeability barrier for atopic eczema
Directory of Open Access Journals (Sweden)
George Man
2015-06-01
Full Text Available The regulatory role of epidermal permeability barrier function in cutaneous inflammation has been well appreciated. While barrier disruption induces cutaneous inflammation, improvement of permeability barrier function alleviates inflammation. Studies have demonstrated that improvement of epidermal permeability barrier function not only prevents the development of atopic eczema, but also delays the relapse of these diseases. Moreover, enhancing the epidermal permeability barrier also alleviates atopic eczema. Furthermore, co-applications of barrier enhancing products with glucocorticoids can increase the therapeutic efficacy and reduce the adverse effects of glucocorticoids in the treatment of atopic eczema. Therefore, utilization of permeability barrier enhancing products alone or in combination with glucocorticoids could be a valuable approach in the treatment of atopic eczema. In this review, we discuss the benefits of improving the epidermal permeability barrier in the management of atopic eczema.
Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata
2014-01-01
Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.
DEFF Research Database (Denmark)
Hansen, Harald S.; Jensen, B.
1985-01-01
sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...
Directory of Open Access Journals (Sweden)
Kyounghwan Lee
2015-04-01
Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.
Biochemistry of epidermal stem cells.
Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace
2013-02-01
The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Biochemistry of epidermal stem cells☆
Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace
2014-01-01
Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019
A homolog of Drosophila grainy head is essential for epidermal integrity in mice.
Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M
2005-04-15
The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.
Noninvasive evaluation of the barrier properties of the skin
Directory of Open Access Journals (Sweden)
Utz S.R.
2014-09-01
Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.
Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.
2014-01-01
Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982
Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats
DEFF Research Database (Denmark)
Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.
2013-01-01
The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...
Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier
Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.
2016-01-01
Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403
Could tight junctions regulate the barrier function of the aged skin?
Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš
2016-03-01
The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
DEFF Research Database (Denmark)
Neess, Ditte; Bek, Signe; Bloksgaard, Maria
2013-01-01
in the skin rather than in the liver. Similarly to ACBP(-/-) mice, K14-ACBP(-/-) mice exhibit an increased transepidermal water loss, and we show that the hepatic phenotype is caused specifically by the epidermal barrier defect, which leads to increased lipolysis in white adipose tissue. Our data demonstrate......We previously reported that mice deficient in acyl-CoA-binding protein (ACBP) display a delayed metabolic adaptation to weaning. This includes a delayed activation of the hepatic lipogenic gene program, which may result from hepatic accumulation of triacylglycerol and/or cholesteryl esters...... in the late suckling period. To further investigate the basis for this phenotype, we generated mice deficient in ACBP in hepatocytes (Alb-ACBP(-/-)) and keratinocytes (K14-ACBP(-/-)). Surprisingly, the delayed adaptation to weaning, including hepatic lipid accumulation, is caused by ACBP deficiency...
Directory of Open Access Journals (Sweden)
David Judah
Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.
Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina
2012-01-01
Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.
Epidermal CYP2 family cytochromes P450
International Nuclear Information System (INIS)
Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.
2004-01-01
Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier
Grhl3 and Lmo4 play coordinate roles in epidermal migration.
Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M
2008-09-01
In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.
Crossing safety barriers: influence of children's morphological and functional variables.
Cordovil, Rita; Vieira, Filomena; Barreiros, João
2012-05-01
Thirty-three children between 3 and 6 years of age were asked to climb four different types of safety barriers. Morphological and functional variables of the children, which were expected to influence climbing or passing through skills, were collected. The influence of those variables on children's success rate and time to cross was tested. No barrier offered a total restraining efficacy. The horizontal bars barrier was crossed by 97% of the children. In the group of children that succeeded in crossing the four barriers, mean time to cross the most difficult barrier was 15 s. Age was the best predictor for success in crossing most barriers but morphology and strength were important predictors of time to cross. The influence of anthropometric variables in time to cross was dependent upon the characteristics of the barrier. A good design of safety barriers should consider children's age, morphology and strength. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.
Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.
Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui
2018-01-01
Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.
Clark, Jessica A; Gan, Heng; Samocha, Alexandr J; Fox, Amy C; Buchman, Timothy G; Coopersmith, Craig M
2009-09-01
Systemic administration of epidermal growth factor (EGF) decreases mortality in a murine model of septic peritonitis. Although EGF can have direct healing effects on the intestinal mucosa, it is unknown whether the benefits of systemic EGF in peritonitis are mediated through the intestine. Here, we demonstrate that enterocyte-specific overexpression of EGF is sufficient to prevent intestinal barrier dysfunction and improve survival in peritonitis. Transgenic FVB/N mice that overexpress EGF exclusively in enterocytes (IFABP-EGF) and wild-type (WT) mice were subjected to either sham laparotomy or cecal ligation and puncture (CLP). Intestinal permeability, expression of the tight junction proteins claudins-1, -2, -3, -4, -5, -7, and -8, occludin, and zonula occludens-1; villus length; intestinal epithelial proliferation; and epithelial apoptosis were evaluated. A separate cohort of mice was followed for survival. Peritonitis induced a threefold increase in intestinal permeability in WT mice. This was associated with increased claudin-2 expression and a change in subcellular localization. Permeability decreased to basal levels in IFABP-EGF septic mice, and claudin-2 expression and localization were similar to those of sham animals. Claudin-4 expression was decreased following CLP but was not different between WT septic mice and IFABP-EGF septic mice. Peritonitis-induced decreases in villus length and proliferation and increases in apoptosis seen in WT septic mice did not occur in IFABP-EGF septic mice. IFABP-EGF mice had improved 7-day mortality compared with WT septic mice (6% vs. 64%). Since enterocyte-specific overexpression of EGF is sufficient to prevent peritonitis-induced intestinal barrier dysfunction and confers a survival advantage, the protective effects of systemic EGF in septic peritonitis appear to be mediated in an intestine-specific fashion.
Epidermal growth factor in alkali-burned corneal epithelial wound healing.
Singh, G; Foster, C S
1987-06-15
We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.
Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age
Directory of Open Access Journals (Sweden)
Zobiri O
2012-02-01
Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test
Using organizational influence processes to overcome IS implementation barriers
DEFF Research Database (Denmark)
Ngwenyama, Ojelanki; Nielsen, Peter Axel
2014-01-01
A fundamental tenet of the information systems (IS) discipline holds that: (a) a lack of formal power and influence over the organization targeted for change, (b) weak support from top management, and (c) organizational memories of prior failures are barriers to implementation success. Our research......, informed by organization influence, compellingly illustrates that such conditions do not necessarily doom a project to failure. In this paper, we present an analysis of how an IS implementation team designed and enacted a coordinated strategy of organizational influence to achieve implementation success...... despite these barriers. Our empirical analysis also found that technology implementation and change is largely an organizational influence process (OIP), and thus technical-rational approaches alone are inadequate for achieving success. Our findings offer managers important insights into how they can...
Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.
Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De
2016-10-01
In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.
Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.
2015-01-01
Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis
DEFF Research Database (Denmark)
Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis
2013-01-01
antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...
The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology
DEFF Research Database (Denmark)
Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J
2017-01-01
The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....
Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.
Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der
2003-01-01
The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol
Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun
2016-02-01
Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.
Kim, Jungmin; Cho, Yunhi
2013-01-01
We have previously reported that dietary gromwell (Lithospermum erythrorhizon; LE) prevents the development of atopic dermatitis (AD) with increased epidermal levels of total ceramide (Cer), the major lipid maintaining epidermal barrier. In this study, we investigated whether the increased level of total Cer induced by dietary LE would be related to the altered metabolism of glucosylceramide (GlcCer) and sphingomyelin (SM), two major precursor lipids in Cer generation. NC/Nga mice, an animal ...
Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation
M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)
1997-01-01
textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were
Directory of Open Access Journals (Sweden)
Shadmehr Demehri
2008-05-01
Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.
TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.
Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina
2012-10-01
Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.
Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter
2017-01-01
Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204
Assessment of the Developmental Toxicity of Epidermal Growth ...
African Journals Online (AJOL)
Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...
[Progress in epidermal stem cells].
Wang, Li-Juan; Wang, You-Liang; Yang, Xiao
2010-03-01
Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.
Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan
2015-03-01
The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
International Nuclear Information System (INIS)
Covens, P; Berus, D; Caveliers, V; Struelens, L; Vanhavere, F; Verellen, D
2013-01-01
Skin contamination with radiopharmaceuticals can occur during biomedical research and daily nuclear medicine practice as a result of accidental spills, after contact with bodily fluids of patients or by inattentively touching contaminated materials. Skin dose assessment should be carried out by repeated quantification to map the course of the contamination together with the use of appropriate skin dose rate conversion factors. Contamination is generally characterised by local spots on the palmar surface of the hand and complete decontamination is difficult as a result of percutaneous absorption. This specific issue requires special consideration as to the skin dose rate conversion factors as a measure for the absorbed dose rate to the basal layer of the epidermis. In this work we used Monte Carlo simulations to study the influence of the contamination area, the epidermal thickness and the percutaneous absorption on the absorbed skin dose rate conversion factors for a set of 39 medical radionuclides. The results show that the absorbed dose to the basal layer of the epidermis can differ by up to two orders of magnitude from the operational quantity H p (0.07) when using an appropriate epidermal thickness in combination with the effect of percutaneous absorption. (paper)
Identification and comparative analysis of the epidermal differentiation complex in snakes
Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2017-01-01
The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630
Influence of epidermal hydration on the friction of human skin against textiles
Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.
Directory of Open Access Journals (Sweden)
Johan Agren
2010-01-01
Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.
Influence of epidermal hydration on the friction of human skin against textile
Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between
Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing
Directory of Open Access Journals (Sweden)
Sabita N. Saldanha
2015-12-01
Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.
Epidermal Inclusion Cysts of The Breast
Directory of Open Access Journals (Sweden)
Amir R. Motabar
2009-02-01
Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Vinter-Jensen, L
2000-01-01
BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...
Influence of the geometry of protective barriers on the propagation of shock waves
Sochet, I.; Eveillard, S.; Vinçont, J. Y.; Piserchia, P. F.; Rocourt, X.
2017-03-01
The protection of industrial facilities, classified as hazardous, against accidental or intentional explosions represents a major challenge for the prevention of personal injury and property damage, which also involves social and economic issues. We consider here the use of physical barriers against the effects of these explosions, which include the pressure wave, the projection of fragments and the thermal flash. This approach can be recommended for the control of major industrial risks, but no specific instructions are available for its implementation. The influence of a protective barrier against a detonation-type explosion is studied in small-scale experiments. The effects of overpressure are examined over the entire path of the shock wave across the barrier and in the downstream zone to be protected. Two series of barrier structures are studied. The first series (A) of experiments investigates two types of barrier geometry with dimensions based on NATO recommendations. These recommendations stipulate that the barrier should be 2 m higher than the charge height, the thickness at the crest should be more than 0.5 m, while its length should be equal to twice the protected structure length and the bank slope should be equivalent to the angle of repose of the soil. The second series (B) of experiments investigates the influence of geometrical parameters of the barrier (thickness at the crest and inclination angles of the front and rear faces) on its protective effects. This project leads to an advance in our understanding of the physical phenomena involved in the propagation of blast waves resulting from an external explosion, in the area around a protective physical barrier. The study focuses on the dimensioning of protective barriers against overpressure effects arising from detonation and shows the advantage of using a barrier with a vertical front or rear face.
Directory of Open Access Journals (Sweden)
Nikolay N. Murashkin
2018-01-01
Full Text Available Atopic dermatitis is a common chronic inflammatory skin disease characterized by a recurring course and progressive decrease in the quality of life. Recent studies in this area demonstrate the multifaceted pathogenesis of atopic dermatitis. Interaction of such factors as epidermal dysfunction, immune system disorders, and the consequences of genetic mutations contributes not only to the development of the disease but also to its progression and chronic course. The article presents various components of the etiopathogenesis of atopic dermatitis, describes the role of lipids, thereby the new therapeutic targets are revealed to specialists.
Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P
2017-06-01
Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Boglev, Yeliz; Wilanowski, Tomasz; Caddy, Jacinta; Parekh, Vishwas; Auden, Alana; Darido, Charbel; Hislop, Nikki R; Cangkrama, Michael; Ting, Stephen B; Jane, Stephen M
2011-01-15
The Grainy head-like 3 (Grhl3) gene encodes a transcription factor that plays essential roles in epidermal morphogenesis during embryonic development, with deficient mice exhibiting failed skin barrier formation, defective wound repair, and loss of eyelid fusion. Despite sharing significant sequence homology, overlapping expression patterns, and an identical core consensus DNA binding site, the other members of the Grhl family (Grhl1 and -2) fail to compensate for the loss of Grhl3 in these processes. Here, we have employed diverse genetic models, coupled with biochemical studies, to define the inter-relationships of the Grhl factors in epidermal development. We show that Grhl1 and Grhl3 have evolved complete functional independence, as evidenced by a lack of genetic interactions in embryos carrying combinations of targeted alleles of these genes. In contrast, compound heterozygous Grhl2/Grhl3 embryos displayed failed wound repair, and loss of a single Grhl2 allele in Grhl3-null embryos results in fully penetrant eyes open at birth. Expression of Grhl2 from the Grhl3 locus in homozygous knock-in mice corrects the wound repair defect, but these embryos still display a complete failure of skin barrier formation. This functional dissociation is due to unexpected differences in target gene specificity, as both GRHL2 and GRHL3 bind to and regulate expression of the wound repair gene Rho GEF 19, but regulation of the barrier forming gene, Transglutaminase 1 (TGase1), is unique to GRHL3. Our findings define the mechanisms underpinning the unique and cooperative roles of the Grhl genes in epidermal development. Copyright © 2010 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Olsen, W.M.; Elgjo, K.
1990-01-01
A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system
Influence of creep and cyclic oxidation in thermal barrier coatings
Energy Technology Data Exchange (ETDEWEB)
Seiler, Philipp; Baeker, Martin; Roesler, Joachim [Technische Univ. Braunschweig (Germany). Inst. fuer Werkstoffe
2012-01-15
The lifetime of thermal barrier coating systems is limited by cracks close to the interfaces, causing delamination. To study the failure mechanisms, a simplified model system is analysed which consists of a bond-coat bulk material, a thermally grown oxide, and an yttria-stabilised zirconia topcoat. The stresses in the model system are calculated using a finite element model which covers the simulation of full thermal cycles, creep in all layers, and the anisotropic oxidation during dwelling. Creep in the oxide and the thermal barrier coating is varied with the use of different creep parameter sets. The influence of creep in the bondcoat is analysed by using two different bond-coat materials: fast creeping Fecralloy and slow creeping oxide dispersion strengthened MA956. It is shown that creep in the bondcoat influences the lifetime of the coatings. Furthermore, a fast creeping thermally grown oxide benefits the lifetime of the coating system. (orig.)
Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C
2013-06-01
In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
International Nuclear Information System (INIS)
Han, S.R.
1988-01-01
The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon
Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.
Kawano, Ken-Ichi; Umemura, Kazuo
2013-05-01
The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.
Skin barrier properties in patients with recessive X-linked ichthyosis
DEFF Research Database (Denmark)
Johansen, J D; Ramsing, D; Vejlsgaard, G
1995-01-01
Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...
Directory of Open Access Journals (Sweden)
Daniela GUZMÁN-URIBE
Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.
Standards for the Protection of Skin Barrier Function.
Giménez-Arnau, Ana
2016-01-01
The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Adam Paré
Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.
Directory of Open Access Journals (Sweden)
Akemi Ishida-Yamamoto
Full Text Available Defects in epidermal barrier function and/or vesicular transport underlie severe skin diseases including ichthyosis and atopic dermatitis. Tight junctions (TJs form a single layered network in simple epithelia. TJs are important for both barrier functions and vesicular transport. Epidermis is stratified epithelia and lamellar granules (LGs are secreted from the stratum granulosum (SG in a sequential manner. Previously, continuous TJs and paracellular permeability barriers were found in the second layer (SG2 of SG in mice, but their fate and correlation with LG secretion have been poorly understood. We studied epidermal TJ-related structures in humans and in mice and found occludin/ZO-1 immunoreactive multilayered networks spanning the first layer of SG (SG1 and SG2. Paracellular penetration tracer passed through some TJs in SG2, but not in SG1. LG secretion into the paracellular tracer positive spaces started below the level of TJs of SG1. Our study suggests that LG-secretion starts before the establishment of TJ barrier in the mammalian epidermis.
Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming
2015-09-01
Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.
Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W
2013-11-01
The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina
2005-01-01
The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.
DEFF Research Database (Denmark)
Kuntsche, Judith; Herre, Angela; Fahr, Alfred
2013-01-01
barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...
Influence of solid noise barriers on near-road and on-road air quality
Baldauf, Richard W.; Isakov, Vlad; Deshmukh, Parikshit; Venkatram, Akula; Yang, Bo; Zhang, K. Max
2016-03-01
Public health concerns regarding adverse health effects for populations spending significant amounts of time near high traffic roadways has increased substantially in recent years. Roadside features, including solid noise barriers, have been investigated as potential methods that can be implemented in a relatively short time period to reduce air pollution exposures from nearby traffic. A field study was conducted to determine the influence of noise barriers on both on-road and downwind pollutant concentrations near a large highway in Phoenix, Arizona, USA. Concentrations of nitrogen dioxide, carbon monoxide, ultrafine particles, and black carbon were measured using a mobile platform and fixed sites along two limited-access stretches of highway that contained a section of noise barrier and a section with no noise barrier at-grade with the surrounding terrain. Results of the study showed that pollutant concentrations behind the roadside barriers were significantly lower relative to those measured in the absence of barriers. The reductions ranged from 50% within 50 m from the barrier to about 30% as far as 300 m from the barrier. Reductions in pollutant concentrations generally began within the first 50 m of the barrier edge; however, concentrations were highly variable due to vehicle activity behind the barrier and along nearby urban arterial roadways. The concentrations on the highway, upwind of the barrier, varied depending on wind direction. Overall, the on-road concentrations in front of the noise barrier were similar to those measured in the absence of the barrier, contradicting previous modeling results that suggested roadside barriers increase pollutant levels on the road. Thus, this study suggests that noise barriers do reduce potential pollutant exposures for populations downwind of the road, and do not likely increase exposures to traffic-related pollutants for vehicle passengers on the highway.
An ex vivo human skin model for studying skin barrier repair.
Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A
2015-01-01
In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Epidermal stem cells: location, potential and contribution to cancer.
Ambler, C A; Määttä, A
2009-01-01
Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.
The influence of tethered epidermal growth factor on connective tissue progenitor colony formation
Marcantonio, Nicholas A.; Boehm, Cynthia A.; Rozic, Richard J.; Au, Ada; Wells, Alan; Muschler, George F.; Griffith, Linda G.
2009-01-01
Strategies to combine aspirated marrow cells with scaffolds to treat connective tissue defects are gaining increasing clinical attention and use. In situations such as large defects where initial survival and proliferation of transplanted connective tissue progenitors (CTPs) are limiting, therapeutic outcomes might be improved by using the scaffold to deliver growth factors that promote the early stages of cell function in the graft. Signaling by the epidermal growth factor receptor (EGFR) pl...
Del Rosso, James Q; Kircik, Leon H
2013-07-01
Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.
DEFF Research Database (Denmark)
Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin
2015-01-01
are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...
Renal origin of rat urinary epidermal growth factor
DEFF Research Database (Denmark)
Nexø, Ebba; Poulsen, Steen Seier
1984-01-01
The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...
DEFF Research Database (Denmark)
Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole
2009-01-01
To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...
DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B
2012-01-01
Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.
Toxic epidermal necrolysis successfully treated with etanercept.
Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio
2009-03-01
Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.
Does weight status influence perceptions of physical activity barriers among African-American women?
Genkinger, Jeanine M; Jehn, Megan L; Sapun, Marcella; Mabry, Iris; Young, Deborah Rohm
2006-01-01
Many African-American women fail to participate in regular physical activity. Weight status may influence physical activity barriers. This study examined the frequency and type of barriers. Participants in this study were enrolled in Project EXE-L (Exercising Ladies Excel), a six-month, church-based, randomized trial of moderate-intensity physical activity based in Baltimore city and county in Maryland. Participants were composed of African-American women who attended one of the participating churches, had friends who were church members, or who lived in neighborhoods surrounding one of the churches. Individuals who were between the ages of 25 and 70 years, were not regularly physically active (defined as not engaging in moderate-intensity activity more than three times per week), and were able to participate in moderate-intensity activity met eligibility criteria to participate in the trial. Barriers to physical activity were evaluated with the Steinhardt/Dishman Barriers for Habitual Physical Activity Scale at baseline. One hundred twenty women were classified as normal weight (body mass index [BMI]: or = 30 kg/m2). Obese participants were more likely to report "lack of motivation" as a barrier compared with normal-weight participants (63% vs 31%). Normal-weight and overweight participants were more likely to report no barriers compared with the obese (31%, 0%, 5%, respectively, P<.05). Barriers for African-American women may vary by BMI status. By defining these unique barriers, effective physical activity interventions can be developed.
Homogeneous dielectric barrier discharges in atmospheric air and its influencing factor
Ran, Junxia; Li, Caixia; Ma, Dong; Luo, Haiyun; Li, Xiaowei
2018-03-01
The stable homogeneous dielectric barrier discharge (DBD) is obtained in atmospheric 2-3 mm air gap. It is generated using center frequency 1 kHz high voltage power supply between two plane parallel electrodes with specific alumina ceramic plates as the dielectric barriers. The discharge characteristics are studied by a measurement of its electrical discharge parameters and observation of its light emission phenomena. The results show that a large single current pulse of about 200 μs duration appearing in each voltage pulse, and its light emission is radially homogeneous and covers the entire surface of the two electrodes. The homogeneous discharge generated is a Townsend discharge during discharge. The influences of applied barrier, its thickness, and surface roughness on the transition of discharge modes are studied. The results show that it is difficult to produce a homogeneous discharge using smooth plates or alumina plate surface roughness Ra material, dielectric thickness, and dielectric surface roughness should be used, and proper applied voltage amplitude and frequency should also be used.
Spatiotemporal Expression of p63 in Mouse Epidermal Commitment
Directory of Open Access Journals (Sweden)
Qian Zhao
2015-12-01
Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.
The influence of roadside solid and vegetation barriers on near-road air quality
Ghasemian, Masoud; Amini, Seyedmorteza; Princevac, Marko
2017-12-01
The current study evaluates the influence of roadside solid and vegetation barriers on the near-road air quality. Reynolds Averaged Navier-Stokes (RANS) technique coupled with the k - ε realizable turbulence model is utilized to investigate the flow pattern and pollutant concentration. A scalar transport equation is solved for a tracer gas to represent the roadway pollutant emissions. In addition, a broad range of turbulent Schmidt numbers are tested to calibrate the scalar transport equation. Three main scenarios including flat terrain, solid barrier, and vegetative barrier are studied. To validate numerical methodology, predicted pollutant concentration is compared with published wind tunnel data. Results show that the solid barrier induces an updraft motion and lofts the vehicle emission plume. Therefore, the ground-level pollutant concentration decreases compared to the flat terrain. For the vegetation barrier, different sub-scenarios with different vegetation densities ranging from approximately flat terrain to nearly solid barrier are examined. Dense canopies act in a similar manner as a solid barrier and mitigate the pollutant concentration through vertical mixing. On the other hand, the high porosity vegetation barriers reduce the wind speed and lead to a higher pollutant concentration. As the vegetation density increases, i.e. the barrier porosity decreases, the recirculation zone behind the canopy becomes larger and moves toward the canopy. The dense plant canopy with LAD = 3.33m-2m3 can improve the near-road air quality by 10% and high porosity canopy with LAD = 1m-2m3 deteriorates near-road air quality by 15%. The results of this study can be implemented as green infrastructure design strategies by urban planners and forestry organizations.
Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics
International Nuclear Information System (INIS)
Ayyagari, R.R.; Khan-Dawood, F.S.
1987-01-01
Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function
Barfield, J P; Cobler, D C; Lam, Eddie T C; Zhang, James; Chitiyo, George
2012-06-01
Kinesiology departments have recently started to offer allied health education programs to attract additional students to teacher education units (9). Although allied health professions offer increased work opportunities, insufficient enrollment and training of minority students in these academic fields contribute to underrepresentation in the workforce (3). To improve workforce diversity, kinesiology departments must understand how enrollment influences and barriers differ by race among prospective students. Therefore, the purpose of this study was to identify differences in allied health education enrollment influences and enrollment barriers between minority and Caucasian students. Participants (n = 601) consisted of students enrolled in kinesiology-based allied health education programs. Multivariate ANOVA was used to compare group differences in enrollment decision making. "Personal influence," "career opportunity," and "physical self-efficacy" were all significantly stronger enrollment influences among African-American students than among Caucasian students, and "social influence," "experiential opportunity," "academic preparation," and "physical self-efficacy" were all perceived as significantly greater barriers compared with Caucasian students. Findings support the need to recruit African-American students through sport and physical education settings and to market program-based experiential opportunities.
International Nuclear Information System (INIS)
Saathoff, Manuela; Blum, Barbara; Quast, Thomas; Kirfel, Gregor; Herzog, Volker
2004-01-01
The periderm is an epithelial layer covering the emerging epidermis in early embryogenesis of vertebrates. In the chicken embryo, an additional cellular layer, the subperiderm, occurs at later embryonic stages underneath the periderm. The questions arose what is the function of both epithelial layers and, as they are transitory structures, by which mechanism are they removed. By immunocytochemistry, the tight junction (TJ) proteins occludin and claudin-1 were localized in the periderm and in the subperiderm, and sites of close contact between adjacent cells were detected by electron microscopy. Using horseradish peroxidase (HRP) as tracer, these contacts were identified as tight junctions involved in the formation of the embryonic diffusion barrier. This barrier was lost by desquamation at the end of the embryonic period, when the cornified envelope of the emerging epidermis was formed. By TUNEL and DNA ladder assays, we detected simultaneous cell death in the periderm and the subperiderm shortly before hatching. The absence of caspases-3, -6, and -7 activity, key enzymes of apoptosis, and the lack of typical morphological criteria of apoptosis such as cell fragmentation or membrane blebbing point to a special form of programmed cell death (PCD) leading to the desquamation of the embryonic diffusion barrier
Bragulla, Hermann; Hirschberg, Ruth M
2003-08-15
Accessory organs of the integument are locally modified parts of the potentially feather-bearing skin in birds (e.g., the rhamphotheca, claws, or scales), and of the potentially hairy skin in mammals (e.g., the rhinarium, nails, claws, or hooves). These special parts of the integument are characterised by a modified structure of their epidermal, dermal and subcutaneous layers. The developmental processes of these various integumentary structures in birds and mammals show both similarities and differences. For example, the development of the specialised epidermal structures of both feathers and the hoof capsule is influenced by the local three-dimensional configuration of the dermis. However, in feathers, in contrast to hooves, the arrangement of the corneous cells is only partially a direct result of the particular arrangement and shape of the dermal surface of the papillary body. Whereas the diameter of the feather papilla, as well as the number, length, and width of dermal ridges on the surface of the feather papilla influence the three-dimensional architecture of the feather rami, there is no apparent direct correlation between the dermo-epidermal interface and the development of the highly ordered architecture of the radii and hamuli in the feather vane. In order to elucidate this morphogenic problem and the problem of locally different processes of keratinisation and cornification, the structure and development of feathers in birds are compared to those of the hoof capsule in horses. The equine hoof is the most complex mammalian integumentary structure, which is determined directly by the dermal surface of the papillary body. Perspectives for further research on the development of modified integumentary structures, such as the role of the dermal microangioarchitecture and the selective adhesion and various differentiation pathways of epidermal cells, are discussed. Copyright 2003 Wiley-Liss, Inc.
Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.
Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J
2014-01-01
Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.
Epidermal growth factor in the rat prostate
DEFF Research Database (Denmark)
Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier
1998-01-01
Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....
Genetic analysis of Ras genes in epidermal development and tumorigenesis
Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano
2013-01-01
Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175
Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report
International Nuclear Information System (INIS)
Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub
2006-01-01
Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess
Svaasand, Lars O; Nelson, J Stuart
2004-01-01
The physical basis for optimization of wavelength, pulse duration, and cooling for laser-induced selective photothermolysis of hair follicles in human skin is discussed. The results indicate that the most important optimization parameter is the cooling efficiency of the technique utilized for epidermal protection. The optical penetration is approximately the same for lasers at 694, 755, and 800 nm. The penetration of radiation from Nd:yttrium-aluminum-garnet lasers at 1064 nm is, however, somewhat larger. Photothermal damage to the follicle is shown to be almost independent of laser pulse duration up to 100 ms. The results reveal that epidermal cooling by a 30-80-ms-long cryogen spurt immediately before laser exposure is the only efficient technique for laser pulse durations less than 10 ms. For longer pulse durations in the 30-100 ms range, protection can be done efficiently by skin cooling during laser exposure. For laser pulses of 100 ms, an extended precooling period, e.g., by bringing a cold object into good thermal contact with the skin for about 1 s, can be of value. Thermal quenching of laser induced epidermal temperature rise after pulsed exposure can most efficiently be done with a 20 ms cryogen spurt applied immediately after irradiation. (c) 2004 Society of Photo-Optical Instrumentation Engineers.
Akdeniz, Merve; Boeing, Heiner; Müller-Werdan, Ursula; Aykac, Volkan; Steffen, Annika; Schell, Mareike; Blume-Peytavi, Ulrike; Kottner, Jan
2018-04-03
Inadequate fluid intake is assumed to be a trigger of water-loss dehydration, which is a major health risk in aged and geriatric populations. Thus, there is a need to search for easy to use diagnostic tests to identify dehydration. Our overall aim was to investigate whether skin barrier parameters could be used for predicting fluid intake and/or hydration status in geriatric patients. An explorative observational comparative study was conducted in a geriatric hospital including patients aged 65 years and older. We measured 3-day fluid intake, skin barrier parameters, Overall Dry Skin Score, serum osmolality, cognitive and functional health, and medications. Forty patients were included (mean age 78.45 years and 65% women) with a mean fluid intake of 1,747 mL/day. 20% of the patients were dehydrated and 22.5% had an impending dehydration according to serum osmolality. Multivariate analysis suggested that skin surface pH and epidermal hydration at the face were associated with fluid intake. Serum osmolality was associated with epidermal hydration at the leg and skin surface pH at the face. Fluid intake was not correlated with serum osmolality. Diuretics were associated with high serum osmolality. Approximately half of the patients were diagnosed as being dehydrated according to osmolality, which is the current reference standard. However, there was no association with fluid intake, questioning the clinical relevance of this measure. Results indicate that single skin barrier parameters are poor markers for fluid intake or osmolality. Epidermal hydration might play a role but most probably in combination with other tests. © 2018 S. Karger AG, Basel.
Immune sensitization against epidermal antigens in polymorphous light eruption
International Nuclear Information System (INIS)
Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.
1991-01-01
To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption
Post-female-circumcision clitoral epidermal inclusion cyst: a case ...
African Journals Online (AJOL)
Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.
Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei
2017-05-01
Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.
Review on technical issues influencing the performance of chemical barriers of TRU waste repository
International Nuclear Information System (INIS)
Fujita, Tomonari; Sugiyama, Daisuke; Tsukamoto, Masaki; Yokoyama, Hayaichi
1997-01-01
Studies of technical issues influencing the performance assessment of TRU waste disposal which is occurred from the nuclear fuel reprocessing were reviewed in related to the development of safety analysis method. Especially, the chemical containment was investigated as a key barrier to radionuclide migration. TRU waste including long-lived radionuclides need long-term performance assessment which could be assumed only by the chemical barrier. The description of technical issues concerned with the performance of TRU waste repository has been divided into the following categories: long-term degradation of cementitious materials as engineered barrier for radionuclide migration, effect of colloids, organic macromolecules and organic degradation products on chemical behavior of radionuclides, gas generation by corrosion of metallic wastes, and effects of microbial activity. Preliminary performance assessment indicated that important factors affecting performance of chemical barriers in near-field were the distribution coefficient and the solubility of radionuclides in near-field groundwater. Therefore, it was identified that key issues associated with performance of chemical barrier were evaluation of (a) the long-term change of distribution coefficient of cementitious material through the degradation under repository condition and (b) chemical speciation change of radionuclides such as increase of solubility by the presence of colloidal-size materials. (author)
"Cut-and-paste" manufacture of multiparametric epidermal electronic systems
Lu, Nanshu; Yang, Shixuan; Wang, Pulin
2016-05-01
Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.
Keogh, J W L; Patel, A; MacLeod, R D; Masters, J
2014-03-01
While physical activity is beneficial for men with prostate cancer, too few perform sufficient activity for such benefit. This study examined perceptions of men with prostate cancer of their barriers and facilitators to physical activity, and how androgen deprivation therapy (ADT) may influence these perceptions. Two focus groups were conducted, involving six ADT and eight non-ADT patients respectively. Data were transcribed verbatim and themes developed using a general inductive thematic approach. Facilitators to physical activity common to both groups of cancer survivors included clinician and spousal involvement, with pre-existing co-morbidities and increased age cited as barriers by both groups. The ADT subgroup cited personal involvement as a facilitator to physical activity, with fatigue, reduced motivation and a relative lack of specific advice from their clinician as additional barriers. The non-ADT subgroup had no additional facilitators to physical activity but cited time constraints as a barrier. These results highlight the important role that cancer clinicians and spouses play in promoting physical activity for men with prostate cancer and how ADT may influence their other facilitators and barriers. As physical activity is beneficial for prostate cancer survivors, especially those on ADT, cancer clinicians should regularly discuss physical activity with their patients. © 2013 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Fölster-Holst R
2015-10-01
Full Text Available Regina Fölster-Holst,1 Jagoda Galecka,1 Sigo Weißmantel,1 Ute Dickschat,2 Frank Rippke,3 Kerstin Bohnsack,3 Thomas Werfel,4 Katja Wichmann,4 Matthias Buchner,1 Thomas Schwarz,1 Annika Vogt,5 Jürgen Lademann,5 Martina C Meinke5 1Department of Dermatology, Venerology and Allergy, University of Kiel, 2Wörth, 3Beiersdorf AG, Hamburg, 4Department of Dermatology, Venerology and Allergy, Division of Immunodermatology and Allergy Research, Hannover Medical School, Hannover, 5Department of Dermatology, Venerology and Allergology, Charité – Universitätsmedizin Berlin, Berlin, Germany Abstract: There is little clinical evidence for a correlation between the severity of atopic eczema (AE and pollen exposition. To obtain more data, we performed a clinical cohort pilot study about the influence of pollen on AE between sensitized and nonsensitized subjects and an experimental study addressing the cutaneous penetration of pollen into the skin. Fifty-five patients were monitored during birch pollen season. To study the cutaneous penetration, grass pollen allergens were applied on excised skin and the uptake in CD1c-expressing dendritic cells was investigated. The correlation between environmental pollen load and severity of the Scoring Atopic Dermatitis (SCORAD score and pruritus was observed, regardless of the status of sensitization. The sensitized group recovered significantly worse after the birch pollen season. Remarkably higher amounts of pollen allergens taken up by CD1c cells were detected in epidermal cells derived from skin explants with a disturbed epidermal barrier. These findings suggest an exacerbating role of pollen in AE utilizing the epidermal route. Keywords: aeroallergens, atopic eczema, seasonality, skin antigen-presenting cells, skin barrier penetration
Foliar Epidermal Studies of Plants in Euphorbiaceae
Directory of Open Access Journals (Sweden)
H. A. Thakur
2014-03-01
Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.
Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.
Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina
2018-03-27
Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.
Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure
2013-12-01
The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
How hormones influence composition and physiological function of the brain-blood barrier.
Hampl, R; Bičíková, M; Sosvorová, L
2015-01-01
Hormones exert many actions in the brain. Their access and effects in the brain are regulated by the blood-brain barrier (BBB). Hormones as other substances may enter the brain and vice versa either by paracellular way requiring breaching tight junctions stitching the endothelial cells composing the BBB, or by passage through the cells (transcellular way). Hormones influence both ways through their receptors, both membrane and intracellular, present on/in the BBB. In the review the main examples are outlined how hormones influence the expression and function of proteins forming the tight junctions, as well as how they regulate expression and function of major protein transporters mediating transport of various substances including hormone themselves.
Barriers and facilitators influencing ethical evaluation in health technology assessment.
Assasi, Nazila; Schwartz, Lisa; Tarride, Jean-Eric; O'Reilly, Daria; Goeree, Ron
2015-01-01
The objective of this study was to explore barriers and facilitators influencing the integration of ethical considerations in health technology assessment (HTA). The study consisted of two complementary approaches: (a) a systematic review of the literature; and (b) an eighteen-item online survey that was distributed to fifty-six HTA agencies affiliated with the International Network of Agencies for Health Technology Assessment. The review identified twenty-six relevant articles. The most often cited barriers in the literature were: scarcity, heterogeneity and complexity of ethical analysis methods; challenges in translating ethical analysis results into knowledge that is useful for decision makers; and lack of organizational support in terms of required expertise, time and financial resources. The most frequently cited facilitators included: usage of value-based appraisal methods, stakeholder and public engagement, enhancement of practice guidelines, ethical expertise, and educational interventions. Representatives of twenty-six (46.5 percent) agencies from nineteen countries completed the survey. A median of 10 percent (interquartile range, 5 percent to 50 percent) of the HTA products produced by the agencies was reported to include an assessment of ethical aspects. The most commonly perceived barriers were: limited ethical knowledge and expertise, insufficient time and resources, and difficulties in finding ethical evidence or using ethical guidelines. Educational interventions, demand by policy makers, and involvement of ethicists in HTA were the most commonly perceived facilitators. Our results emphasize the importance of simplification of ethics methodology and development of good practice guidelines in HTA, as well as capacity building for engaging HTA practitioners in ethical analyses.
The organization of human epidermis: functional epidermal units and phi proportionality.
Hoath, Steven B; Leahy, D G
2003-12-01
The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...
Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal
Directory of Open Access Journals (Sweden)
Kynan T. Lawlor
2015-11-01
Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.
Taylor, Eric S; Pol-Fachin, Laercio; Lins, Roberto D; Lower, Steven K
2017-04-01
The epidermal growth factor receptor (EGFR) is an important transmembrane glycoprotein kinase involved the initiation or perpetuation of signal transduction cascades within cells. These processes occur after EGFR binds to a ligand [epidermal growth factor (EGF)], thus inducing its dimerization and tyrosine autophosphorylation. Previous publications have highlighted the importance of glycosylation and dimerization for promoting proper function of the receptor and conformation in membranes; however, the effects of these associations on the protein conformational stability have not yet been described. Molecular dynamics simulations were performed to characterize the conformational preferences of the monomeric and dimeric forms of the EGFR extracellular domain upon binding to EGF in the presence and absence of N-glycan moieties. Structural stability analyses revealed that EGF provides the most conformational stability to EGFR, followed by glycosylation and dimerization, respectively. The findings also support that EGF-EGFR binding takes place through a large-scale induced-fitting mechanism. Proteins 2017; 85:561-570. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Influence of Nitrate on the Hanford 100D Area In Situ Redox Manipulation Barrier Longevity
International Nuclear Information System (INIS)
Szecsody, Jim E.; Phillips, Jerry L.; Vermeul, Vince R.; Fruchter, Jonathan S.; Williams, Mark D.
2005-01-01
The purpose of this laboratory study is to determine the influence of nitrate on the Hanford 100D Area in situ redox manipulation (ISRM) barrier longevity. There is a wide spread groundwater plume of 60 mg/L nitrate upgradient of the ISRM barrier with lower nitrate concentrations downgradient, suggestive of nitrate reduction occurring. Batch and 1-D column experiments showed that nitrate is being slowly reduced to nitrite and ammonia. These nitrate reduction reactions are predominantly abiotic, as experiments with and without bactericides present showed no difference in nitrate degradation rates. Nitrogen species transformation rates determined in experiments covered a range of ferrous iron/nitrate ratios such that the data can be used to predict rates in field scale conditions. Field scale reaction rate estimates for 100% reduced sediment (16 C) are: (a) nitrate degradation = 202 ± 50 h (half-life), (b) nitrite production = 850 ± 300 h, and (c) ammonia production = 650 ± 300 h. Calculation of the influence of nitrate reduction on the 100D Area reductive capacity requires consideration of mass balance and reaction rate effects. While dissolved oxygen and chromate reduction rates are rapid and essentially at equilibrium in the aquifer, nitrate transformation reactions are slow (100s of hours). In the limited (20-40 day) residence time in the ISRM barrier, only a portion of the nitrate will be reduced, whereas dissolved oxygen and chromate are reduced to completion. Assuming a groundwater flow rate of 1 ft/day, it is estimated that the ISRM barrier reductive capacity is 160 pore volumes (with no nitrate), and 85 pore volumes if 60 mg/L nitrate is present (i.e., a 47% decrease in the ISRM barrier longevity). Zones with more rapid groundwater flow will be less influenced by nitrate reduction. For example, a zone with a groundwater flow rate of 3 ft/day and 60 mg/L nitrate will have a reductive capacity of 130 pore volumes. Finally, long-term column experiments
Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna
2015-08-01
The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.
Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo
2012-01-01
HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291
Roles of p63 in epidermal development and tumorigenesis
Directory of Open Access Journals (Sweden)
Jeng-Yuan Yao
2012-12-01
Full Text Available pidermis is composed mainly of keratinocytes and is the major barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcription factor p63. The p63 gene encodes proteins with structures similar to that of p53, including an N-terminal transactivation (TA domain, a DNA-binding domain and a carboxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epidermal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis remains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.
Khosravan, Shahla; Alami, Ali; Mohammadzadeh-Moghadam, Hossein; Ramezani, Vahide
Melasma disfigures the skin and thus influences people's self-image and self-concept. Therefore, melasma influences emotional and psychosocial health in addition to physical health. This clinical trial was performed to assess the effect of the topical use of Petroselinum crispum (parsley) on reduction of the severity of epidermal melasma.
Evolution of dinosaur epidermal structures.
Barrett, Paul M; Evans, David C; Campione, Nicolás E
2015-06-01
Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes
International Nuclear Information System (INIS)
Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira
1997-01-01
Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding
E. F. Zeer; L. S. Popova
2012-01-01
The paper summarizes the research findings concerning the influence of creativity on overcoming the barriers of teachers’ professional development. The re- search subject includes defining the interrelations between the creativity and profes- sional burn-out. The aim of the studies is to find out the influencing factors of creativ- ity eliminating the destructive trends of professional pedagogic activity. The methodology is based on the E. E. Simanyuk’s concept describing the de- structive te...
Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.
Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un
2008-09-01
Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.
Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis
Directory of Open Access Journals (Sweden)
Kazuhiko Arima
2015-01-01
Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.
Lee, B H; Lee, C H; Seong Baek Seok
2000-01-01
A density functional perturbative approximation, which is based on the density functional expansion of the one-particle direct correlation function of model fluids with respect to the bulk density, has been employed to investigate the influence of the potential well and the potential barrier on the density behavior of confined-model fluids. The mean spherical approximation has been used to calculate the two-particle direct correlation function of the model fluids. At lower densities, the density distributions are strongly affected by the barrier height and the well depth of the model potential, the contribution from the short-range repulsive part being especially important. However, the effects of the barrier height and the well depth of the model potential decrease with increasing bulk density. The calculated results also show that in the region where the effect of the wall-fluid interaction is relatively weak, the square-barrier part of the model potential leads to a nonuniformity in the density distributio...
Nnawulezi, Nkiru; Godsay, Surbhi; Sullivan, Cris M; Marcus, Suzanne; Hacskaylo, Margaret
2018-01-18
The purpose of community-based domestic violence crisis housing programs (e.g., shelters) is to provide a safe setting that promotes empowerment for survivors of intimate partner violence. For staff to reach this aim, the program must have formal structures and processes in place to support such efforts. This study explored how low-barrier and voluntary service policies influenced staff practices and survivor empowerment. Low-barrier policies require that programs remove barriers that prevent survivors, particularly those who have mental health concerns and/or addictions, from being able to access services. A voluntary service policy states that survivors have the right to choose which services, if any, they would like to engage in during their stay at the program. Survivors' ability to stay at the housing program is not contingent on their participation in program services. This exploratory-sequential (QUAL→ quan) mixed-method study examined how low-barrier and voluntary service policies influenced staff behavior and how these behaviors then related to survivor empowerment. Qualitative results revealed that low-barrier and voluntary service were guided by cultural values of justice and access, encouraged survivor-centered practices among staff, and were believed to promote survivor autonomy. Quantitative results suggested that when survivors perceived they had a choice to engage in program services or meet with an advocate, their empowerment increased. This study has implications for domestic violence organizational practice and provides evidence about the contextual factors that support individual empowerment. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2001-01-01
...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Optimal allocation of leaf epidermal area for gas exchange
de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.
2016-01-01
Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2003-01-01
...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
International Nuclear Information System (INIS)
Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-01-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
Energy Technology Data Exchange (ETDEWEB)
Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-07-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.
Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.
Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A
2009-08-01
The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Papiorek, Sarah; Junker, Robert R; Lunau, Klaus
2014-01-01
Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Directory of Open Access Journals (Sweden)
Sarah Papiorek
Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of
Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis
Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin
2016-01-01
Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054
Possible role of epidermal keratinocytes in the construction of acupuncture meridians.
Denda, Mitsuhiro; Tsutsumi, Moe
2014-04-01
Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.
Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells
International Nuclear Information System (INIS)
Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui
2008-01-01
Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis
DEFF Research Database (Denmark)
Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar
2014-01-01
The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...
Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M
1992-07-01
Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.
International Nuclear Information System (INIS)
Cario-Andre, M.
2000-11-01
Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)
Adrenergic effects on renal secretion of epidermal growth factor in the rat
DEFF Research Database (Denmark)
Poulsen, Steen Seier; Nexø, Ebba
1985-01-01
Urinary epidermal growth factor (EGF) has been demonstrated recently to originate from the kidneys. The present study was undertaken to investigate the adrenergic and cholinergic influence on secretion of renal EGF. beta-Adrenergic agonists increased the level of urinary EGF, while propranolol......, a beta-adrenergic blocking agent, decreased basal and beta-adrenergic stimulated total output of urinary EGF. Acetylcholine and the anticholinergic agent atropine had no effect on the output of EGF in urine. Also chemical sympathectomy induced by 6-hydroxydopamine reduced the urinary output of EGF. None...... of the experimental groups had a median serum concentration above the detection limit of the assay. The present study shows that secretion of renal EGF is under the influence of the sympathetic nervous system and release of EGF is stimulated by activation of beta-adrenergic receptors in the kidneys....
Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks
Directory of Open Access Journals (Sweden)
Sang Wha Kim
2014-03-01
Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.
Energy Technology Data Exchange (ETDEWEB)
Rempe, Ralf; Cramer, Sandra; Huewel, Sabine [Department of Biochemistry, University of Muenster, Wilhelm-Klemm-Strasse 2, D-48149 Muenster (Germany); Galla, Hans-Joachim, E-mail: gallah@uni-muenster.de [Department of Biochemistry, University of Muenster, Wilhelm-Klemm-Strasse 2, D-48149 Muenster (Germany)
2011-03-04
Research highlights: {yields} Poly(n-butylcyano-acrylate) (PBCA) nanoparticles may be promising drug carriers. {yields} Influence of PBCA nanoparticles on the integrity of the blood-brain barrier in vitro. {yields} PBCA nanoparticles lead to a reversible disruption of the BBB in vitro after 4 h. {yields} Potential application as time-dependent and specific opener of the BBB. -- Abstract: In previous studies it was shown that polysorbate 80(PS80)-coated poly(n-butylcyano-acrylate) nanoparticles (PBCA-NP) are able to cross the blood-brain barrier (BBB) in vitro and in vivo. In order to explore and extend the potential applications of PBCA-NP as drug carriers, it is important to ascertain their effect on the BBB. The objective of the present study was to determine the effect of PS80-coated PBCA-NP on the BBB integrity of a porcine in vitro model. This has been investigated by monitoring the development of the transendothelial electrical resistance (TEER) after the addition of PBCA-NP employing impedance spectroscopy. Additionally, the integrity of the BBB in vitro was verified by measuring the passage of the reference substances {sup 14}C-sucrose and FITC-BSA after addition of PBCA-NP. In this study we will show that the application of PS80-coated PBCA-NP leads to a reversible disruption of the barrier after 4 h. The observed disruption of the barrier could also be confirmed by {sup 14}C-sucrose and FITC-BSA permeability studies. Comparing the TEER and permeability studies the lowest resistances and maximal values for permeabilities were both observed after 4 h. These results indicate that PS80-coated PBCA-NP might be suitable for the use as drug carriers. The reversible disruption also offers the possibility to use these particles as specific opener of the BBB. Instead of incorporating the therapeutic agents into the NP, the drugs may cross the BBB after being applied simultaneously with the PBCA-NP.
Directory of Open Access Journals (Sweden)
Rita B. Figueira
2015-04-01
Full Text Available Previous studies have shown that the barrier effect and the performance of organic-inorganic hybrid (OIH sol-gel coatings are highly dependent on the coating deposition method as well as on the processing conditions. However, studies on how the coating deposition method influences the barrier properties in alkaline environments are scarce. The aim of this experimental research was to study the influence of experimental parameters using the dip-coating method on the barrier performance of an OIH sol-gel coating in contact with simulated concrete pore solutions (SCPS. The influence of residence time (Rt, a curing step between each dip step and the number of layers of sol-gel OIH films deposited on hot-dip galvanized steel to prevent corrosion in highly alkaline environments was studied. The barrier performance of these OIH sol-gel coatings, named U(400, was assessed in the first instants of contact with SCPS, using electrochemical impedance spectroscopy and potentiodynamic methods. The durability and stability of the OIH coatings in SCPS was monitored during eight days by macrocell current density. The morphological characterization of the surface was performed by Scanning Electronic Microscopy before and after exposure to SCPS. Glow Discharge Optical Emission Spectroscopy was used to investigate the thickness of the U(400 sol-gel coatings as a function of the number of layers deposited with and without Rt in the coatings thickness.
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.
Inhibition of epidermal cell proliferation by borderline rays
Energy Technology Data Exchange (ETDEWEB)
Born, W [Freiburg Univ.; Daikeler, G
1976-08-01
Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.
Jones, Blake L
2018-04-06
Frequent family mealtimes have been associated with numerous positive dietary, health, and behavioral outcomes for children and families. This review article summarizes some of the beneficial outcomes associated with having frequent family dinners. Current trends in family dinner frequency are discussed in the context of barriers that influence how often families eat dinner together, including time issues, work issues, and distractions in the home environment. Next, several parental influences and home environment factors that promote healthy and consistent family dinners are outlined. Finally, limitations are discussed and a few practical suggestions are mentioned to help encourage families, employers, and policy-makers to make family mealtimes a regular practice for as many families as possible. Copyright © 2018. Published by Elsevier Inc.
Factors influencing the movement biology of migrant songbirds confronted with an ecological barrier
Smolinsky, J. A.; Diehl, Robert H.; Radzio, T. A.; Delaney, D. K.; Moore, F. R
2013-01-01
Whether or not a migratory songbird embarks on a long-distance flight across an ecological barrier is likely a response to a number of endogenous and exogenous factors. During autumn 2008 and 2009, we used automated radio tracking to investigate how energetic condition, age, and weather influenced the departure timing and direction of Swainson’s thrushes (Catharus ustulatus) during migratory stopover along the northern coast of the Gulf of Mexico. Most birds left within 1 h after sunset on the evening following capture. Those birds that departed later on the first night or remained longer than 1 day were lean. Birds that carried fat loads sufficient to cross the Gulf of Mexico generally departed in a seasonally appropriate southerly direction, whereas lean birds nearly always flew inland in a northerly direction. We did not detect an effect of age or weather on departures. The decision by lean birds to reorient movement inland may reflect the suitability of the coastal stopover site for deposition of fuel stores and the motivation to seek food among more extensive forested habitat away from the barrier.
Giant epidermal inclusion cyst in the male breast: A case report
Energy Technology Data Exchange (ETDEWEB)
KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)
2017-03-15
Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.
Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E
2017-01-01
Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.
Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin
DEFF Research Database (Denmark)
Kamstrup, M.; Faurschou, A.; Gniadecki, R.
2008-01-01
In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...
International Nuclear Information System (INIS)
Peters, F; Wieneke, S; Ohms, G; Viöl, W; Hünnekens, B; Militz, H
2017-01-01
In this study, three different dielectric barrier discharges, based on the same setup and run with the same power supply, are characterized by emission spectroscopy with regards to the reduced electrical field strength, and the rotational, vibrational and electron temperature. To compare discharges common for the treatment on wood, a coplanar surface barrier discharge, a direct dielectric barrier discharge and a jet system/remote plasma are chosen. To minimize influences due to the setups or power, the discharges are realized with the same electrodes and power supply and normalized to the same power. To evaluate the efficiency of the different discharges and the influence on treated materials, the surface free energy is determined on a maple wood, high density fiberboard and wood plastic composite. The influence is measured depending on the treatment time, with the highest impact in the time of 5 s. (paper)
Peters, F.; Hünnekens, B.; Wieneke, S.; Militz, H.; Ohms, G.; Viöl, W.
2017-11-01
In this study, three different dielectric barrier discharges, based on the same setup and run with the same power supply, are characterized by emission spectroscopy with regards to the reduced electrical field strength, and the rotational, vibrational and electron temperature. To compare discharges common for the treatment on wood, a coplanar surface barrier discharge, a direct dielectric barrier discharge and a jet system/remote plasma are chosen. To minimize influences due to the setups or power, the discharges are realized with the same electrodes and power supply and normalized to the same power. To evaluate the efficiency of the different discharges and the influence on treated materials, the surface free energy is determined on a maple wood, high density fiberboard and wood plastic composite. The influence is measured depending on the treatment time, with the highest impact in the time of 5 s.
Retinoic Acid-Induced Epidermal Transdifferentiation in Skin
Directory of Open Access Journals (Sweden)
Yoshihiro Akimoto
2014-06-01
Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.
Directory of Open Access Journals (Sweden)
Cai ZX
2016-06-01
Full Text Available Zuxun Cai Department of Thoracic Surgery, Henan Provincial Chest Hospital, Zhengzhou City, People’s Republic of China Objective: To investigate the relationship between serum carcinoembryonic antigen (CEA level and epidermal growth factor receptor (EGFR gene mutations in non-small-cell lung cancer (NSCLC patients and to analyze the influence of CEA level on postoperative survival time in lung cancer patients. Methods: A total of 296 patients who were treated in Thoracic Surgery Department of Henan Provincial Chest Hospital from September 2011 to September 2013 were recruited. The level of tumor markers, such as CEA, was determined before the surgery, and EGFR gene mutations were detected after surgery. Thereby, the relationship between tumor makers, including CEA, and EGFR mutation and its influence on prognosis could be investigated. Results: Among 296 patients, the positive rate of EGFR gene mutation was 37.84% (112/296; the mutation occurred more frequently in nonsmokers, adenocarcinoma patients, women, and patients aged <60 years (P<0.05. Both tumor markers and chemosensitivity indicators were related to the profile of EGFR mutations. Elevated squamous cell carcinoma and Cyfra21-1 as well as positively expressed ERCC1 were more common in patients with wild-type EGFR (P<0.05, whereas increased CEA level was observed more frequently in patients with EGFR gene mutation (P=0.012. The positive rate of EGFR gene mutations was higher as the serum CEA level increased, that is, the positive rate in patients with serum CEA level <5, 5–20, and >20 µg/L was 39.81%, 45.32%, and 65.47%, respectively (P=0.004. Logistic regression analysis showed that CEA level was an independent factor in predicting EGFR gene mutations, and serum CEA level was also an independent factor in affecting the prognosis of NSCLC patients, as the overall 2-year survival rate was 73.86% in elevated CEA group and 86.43% in normal group (P<0.01. Conclusion: The prognosis of
EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...
African Journals Online (AJOL)
Administrator
stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...
Huber, Birgit; Czaja, Alina Maria; Kluger, Petra Juliane
2016-05-01
The composition of vascularized adipose tissue is still an ongoing challenge as no culture medium is available to supply adipocytes and endothelial cells appropriately. Endothelial cell medium is typically supplemented with epidermal growth factor (EGF) as well as hydrocortisone (HC). The effect of EGF on adipocytes is discussed controversially. Some studies say it inhibits adipocyte differentiation while others reported of improved adipocyte lipogenesis. HC is known to have lipolytic activities, which might result in mature adipocyte dedifferentiation. In this study, we evaluated the influence of EGF and HC on the co-culture of endothelial cells and mature adipocytes regarding their cell morphology and functionality. We showed in mono-culture that high levels of HC promoted dedifferentiation and proliferation of mature adipocytes, whereas EGF seemed to have no negative influence. Endothelial cells kept their typical cobblestone morphology and showed a proliferation rate comparable to the control independent of EGF and HC concentration. In co-culture, HC promoted dedifferentiation of mature adipocytes, which was shown by a higher glycerol release. EGF had no negative impact on adipocyte morphology. No negative impact on endothelial cell morphology and functionality could be seen with reduced EGF and HC supplementation in co-culture with mature adipocytes. Taken together, our results demonstrate that reduced levels of HC are needed for co-culturing mature adipocytes and endothelial cells. In co-culture, EGF had no influence on mature adipocytes. Therefore, for the composition of vascularized adipose tissue constructs, the media with low levels of HC and high or low levels of EGF can be used. © 2016 International Federation for Cell Biology.
Greguol, Márcia; Gobbi, Erica; Carraro, Attilio
2015-01-01
To analyze the practice of physical activity among children and adolescents with visual impairments (VI), regarding the possible influence of parental support and perceived barriers. Twenty-two young people with VIs (10 + 2.74 years old) and one of each of their parents were evaluated. They responded to the Physical Activity Questionnaire for Older Children (PAQ-C), Baecke Questionnaire, the Parental Support Scale and a questionnaire about perceived barriers to physical activity. The independent samples t-test, pearson correlation test and chi-square test were performed. Blind young people showed lower physical activity levels. There were significant correlations both between parents' physical activity and the support offered to children and between the PAQ-C results and the importance given by young people to physical activity, but only for those aged between 8 and 10 years old. The main perceived barriers were lack of security, motivation, professional training and information about available physical activity programs. The influence of parental support seems to be an important factor in the adoption of a physically active lifestyle for young people with VI. Parents and children should have more information about the benefits and opportunities of physical activity. Implications for Rehabilitation Young people with visual impairment should be encouraged by parents to practice physical activity. More information should be provided on the benefits of physical activity to both parents and children. Professional training should be available to help support this group become more active.
Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G
1989-10-15
The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.
Tc-99m-MDP scintigraphy in the evaluation of epidermal nevus syndrome
International Nuclear Information System (INIS)
Barbosa, M.N.S.; Cunha, M.O.; Severiche, A.F.A.; Ramos, C.D.; Etchebehere, E.C.S.C.; Belangero, W.; Camargo, E.E.
1997-01-01
Full text: Epidermal nevus syndrome has been described as a congenital neurocutaneous disorder in which epidermal nevi are associated with malformations of other organs, commonly the skeleton and central nervous system. Ocular, cardiac, and genitourinary system abnormalities, as well as other skin lesions, may also be seen. A 19 year old patient with epidermal nevus syndrome, presenting congenital facial epidermal nevi and bone deformity of the lower limbs (shortening of the left leg, left thigh varum, bilateral genu valgum, and multiple pathological fractures), as referred to the nuclear medicine laboratory to evaluate involvement of other sites of the skeleton. Whole body bone scintigraphy performed with MDP-Tc-99m showed multiple small focal areas of increased uptake in the skeleton, mainly in the upper and lower limbs, posterior ribs, right acetabulum, right sacroiliac joint, and right greater trochanter, interpreted as pathological fractures at different stages of remodeling. The range of skeletal findings in this condition is quite diverse. Many of these findings can be attributed to local tissue overgrowth with deformities and advanced bone age, associate with pathological fractures
International Nuclear Information System (INIS)
Go, K.G.; Lammertsma, A.A.; Paans, A.M.; Vaalburg, W.; Woldring, M.G.
1981-01-01
By external detection, the influence of arterial blood pressure (BP), osmolarity, and cold-induced blood-brain barrier damage was assessed on the extraction of water labeled with oxygen 15 during single-capillary transit in the rat. There was an inverse relation between arterial BP and extraction that was attributable to the influence of arterial BP on cerebral blood flow (CBF) and the relation between CBF and extraction. Neither arterial BP nor osmolarity of the injected bolus had any direct effect on extraction of water 15O, signifying that the diffusional exchange component (determined by blood flow) of extraction greatly surpasses the convection flow contribution by hydrostatic or osmotic forces. Damage to the blood-brain barrier did not change its permeability to water
Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases
Energy Technology Data Exchange (ETDEWEB)
Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran [Uijongbu St. Mary' s Hospital, Catholic University College of Medicine, Seoul (Korea, Republic of)
2007-08-15
We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation.
Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases
International Nuclear Information System (INIS)
Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran
2007-01-01
We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation
Epidermal growth factor in mammary glands and milk from rats
DEFF Research Database (Denmark)
Thulesen, J; Raaberg, Lasse; Nexø, Ebba
1993-01-01
Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...
Toxic epidermal necrolysis and Stevens-Johnson syndrome
Directory of Open Access Journals (Sweden)
French Lars E
2010-12-01
Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis
A review of toxic epidermal necrolysis management in Japan
Directory of Open Access Journals (Sweden)
Yuri Kinoshita
2017-01-01
Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.
Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie
2017-12-01
Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.
Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...
African Journals Online (AJOL)
REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.
Epidermal cell death in frogs with chytridiomycosis
Directory of Open Access Journals (Sweden)
Laura A. Brannelly
2017-02-01
Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.
Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis
Directory of Open Access Journals (Sweden)
Hugo Nodarse-Cuní
2013-03-01
Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.
The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.
Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina
2004-12-03
The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.
FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...
African Journals Online (AJOL)
Administrator
alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...
Stevens Johnsons syndrom og toksisk epidermal nekrolyse
DEFF Research Database (Denmark)
Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis
2013-01-01
Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...
An oncological view on the blood-testis barrier
Bart, J; Groen, HJM; van der Graaf, WTA; Hollema, H; Hendrikse, NH; Vaalburg, W; Sleijfer, DT; de Vries, EGE
The function of the blood-testis barrier is to protect germ cells from harmful influences; thus, it also impedes the delivery of chemotherapeutic drugs to the testis. The barrier has three components: first, a physicochemical barrier consisting of continuous capillaries, Sertoli cells in the tubular
Barriers to Physical Activity on University Student
Jajat; Sultoni, K.; Suherman, A.
2017-03-01
The purpose of the research is to analyze the factors that become barriers to physical activity in university students based on physical activity level. An internet-based survey was conducted. The participants were 158 University students from Universitas Pendidikan Indonesia. Barriers to Physical Activity Quiz (BPAQ) were used to assessed the factors that become barriers to physical activity in university students. IPAQ (short form) were used to assessed physical activity level. The results show there was no differences BPAQ based on IPAQ level. But when analyzed further based on seven factors barriers there are differences in factors “social influence and lack of willpower” based IPAQ level. Based on this it was concluded that the “influence from other and lack of willpower” an inhibiting factor on students to perform physical activity.
Stochastic transport of particles across single barriers
International Nuclear Information System (INIS)
Kreuter, Christian; Siems, Ullrich; Henseler, Peter; Nielaba, Peter; Leiderer, Paul; Erbe, Artur
2012-01-01
Transport phenomena of interacting particles are of high interest for many applications in biology and mesoscopic systems. Here we present measurements on colloidal particles, which are confined in narrow channels on a substrate and interact with a barrier, which impedes the motion along the channel. The substrate of the particle is tilted in order for the particles to be driven towards the barrier and, if the energy gained by the tilt is large enough, surpass the barrier by thermal activation. We therefore study the influence of this barrier as well as the influence of particle interaction on the particle transport through such systems. All experiments are supported with Brownian dynamics simulations in order to complement the experiments with tests of a large range of parameter space which cannot be accessed in experiments.
Effect of contact barrier on electron transport in graphene.
Zhou, Yang-Bo; Han, Bing-Hong; Liao, Zhi-Min; Zhao, Qing; Xu, Jun; Yu, Da-Peng
2010-01-14
The influence of the barrier between metal electrodes and graphene on the electrical properties was studied on a two-electrode device. A classical barrier model was used to analyze the current-voltage characteristics. Primary parameters including barrier height and effective resistance were achieved. The electron transport properties under magnetic field were further investigated. An abnormal peak-valley-peak shape of voltage-magnetoresistance curve was observed. The underlying mechanisms were discussed under the consideration of the important influence of the contact barrier. Our results indicate electrical properties of graphene based devices are sensitive to the contact interface.
Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique
2014-10-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment
Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice
Energy Technology Data Exchange (ETDEWEB)
Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)
2011-06-15
We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.
Standardized method to obtain dermo-epidermal junction samples from bovine hoof
Directory of Open Access Journals (Sweden)
H.M.F. Mendes
2015-04-01
Full Text Available As afecções podais em bovinos causam importante impacto econômico negativo na bovinocultura. Pesquisas têm sido realizadas com o objetivo de avançar no entendimento dos processos ocorridos na junção derme-epiderme do casco de bovinos com laminite e nos demais tecidos moles durante as lesões infecciosas. Apesar disso, não foram encontrados na literatura consultada estudos que descrevessem um método padronizado para a obtenção de amostras do tecido laminar do casco. Nesse contexto, foi necessário criar e estabelecer um método viável para a colheita de amostras da junção derme-epiderme, de modo a viabilizar o estudo de pós-graduação que originou esta comunicação. O objetivo é relatar um método padronizado, testado e bem-sucedido para obtenção de amostras da junção derme-epiderme do casco de bovinos em suas regiões solear, axial e dorsal. Foram obtidos fragmentos transversais das unhas de vacas abatidas em frigorífico. A espessura desses fragmentos foi de 1,5cm, aproximadamente, e contemplava as regiões solear, axial e dorsal do casco. De forma sistematizada, amostras da junção derme-epiderme de cada uma dessas regiões foram removidas, fixadas em formol, processadas e incluídas em parafina. A análise usando microscopia de luz demonstrou cortes histológicos íntegros e sem artefatos, que permitiram ampla avaliação das estruturas tanto da derme quanto da epiderme. Concluiu-se que o método proposto viabiliza a obtenção de amostras de padrão e qualidade adequados ao estudo do tecido laminar do casco bovino.
Improvement of arbutin trans-epidermal delivery using ...
African Journals Online (AJOL)
Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...
Directory of Open Access Journals (Sweden)
Jian-Wei Zhang
2018-04-01
Full Text Available The taxonomical position of species of the genus Tamarix (Tamaricaceae has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves, and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to the studies, the leaf epidermal features, together with the character of the flower, are taxonomically clearly distinct. The establishment of Tamarix albiflonum is consolidated. Tamarix korolkowi and Tamarix ramosissima have minimal differences in epidermal characters, and the former is suggested to be a junior synonym. Tamarix ramosissima, Tamarix tarimensis, Tamarix arceuthoides and Tamarix hohenackeri are most similar with respect to their leaf epidermis; considering the common morphological features, habit, distribution and especially the hybridization, it is suggested that these four species are closely genetically related and that the variations among them are probably intraspecific. The new taxonomical evidence indicates the occurrence of 13 species and four variants in China. Presently, Tamarix is a typical plant of arid and semi-arid regions, but its Eocene ancestors lived in warm and humid climates in the coastal areas of the ancient Mediterranean Sea. Thus, the papillae or epidermal hairs, which are outgrowths of the outer epidermal cells facilitating the leaf to respond to water stress and commonly seen in the plants growing in arid or semi-arid areas rather than the plants in warm and humid climates, are of relatively recent origin in Tamarix. The primitive species lack papillae or epidermal hairs, while in evolved species these structures are abundant. Based on the ecological adaptations of the epidermal features, the palaeogeographic
Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian
2010-08-13
Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.
Hybrid Enhanced Epidermal SpaceSuit Design Approaches
Jessup, Joseph M.
A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.
International Nuclear Information System (INIS)
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-01-01
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Energy Technology Data Exchange (ETDEWEB)
Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Adrenergic effects on secretion of epidermal growth factor from Brunner's glands
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1985-01-01
The influence of the sympathetic nervous system and adrenergic agonists on flow rate and secretion of epidermal growth factor (EGF) from Brunner's glands has been investigated in the rat. Chemical sympathectomy by administration of 6-hydroxydopamine increased volume secretion and output of EGF from...... Brunner's glands but depleted the glands of EGF. Infusion of noradrenaline, an alpha-adrenergic agonist, inhibited basal and vasoactive intestinal polypeptide (VIP) stimulated flow rate and output of EGF from Brunner's glands and increased the amount of EGF in the tissue. Vasoactive intestinal polypeptide...... also increased the amount of EGF in Brunner's gland tissue and this was unchanged after simultaneous infusion of VIP and noradrenaline as well as VIP and isoproterenol, a beta-adrenergic agonist. Isoproterenol had no effect on basal and VIP stimulated secretion of EGF from Brunner's glands...
van Smeden, Jeroen; Bouwstra, Joke A
2016-01-01
Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to
Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema
DEFF Research Database (Denmark)
Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM
2010-01-01
chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...
International Nuclear Information System (INIS)
Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.
1975-01-01
Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin
Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat
Directory of Open Access Journals (Sweden)
Roberta Sartori
2016-06-01
Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.
Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan
2018-01-01
The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...
International Nuclear Information System (INIS)
Lindberg, M.; Sagstroem, S.R.; Roomans, G.M.; Forslind, B.
1989-01-01
The effect of sodium lauryl sulphate (SLS), a common ingredient of detergents, on the penetration of nickel through the stratum corneum in the guinea-pig skin model was studied with energy dispersive X-ray microanalysis (EDX) to evaluate the barrier-damaging properties of this common detergent. The EDX technique allows a simultaneous determination of physiologically important elements, e.g., Na, Mg, P, Cl, K, Ca and S in addition to Ni at each point of measurement in epidermal cell strata. Our results show that SLS reduces the barrier function to Ni-ion penetration of the stratum corneum. In addition we have shown that EDX allows analysis of the influence of different factors involved in nickel penetration through the skin by giving data on the physiological effects on the epidermal cells caused by the applied substances
International Nuclear Information System (INIS)
An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.
1996-01-01
Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas
Directory of Open Access Journals (Sweden)
Hassan Riad
2013-10-01
Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.
DEFF Research Database (Denmark)
Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana
2006-01-01
most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...
Hua, Weizhuo; Koji, Fukagata
2017-11-01
A numerical study has been conducted to understand the streamer formation and propagation of nanosecond pulsed surface dielectric barrier discharge of positive polarity. First we compared the result of different grid configuration to investigate the influence of x and y direction grid spacing on the streamer propagation. The streamer propagation is sensitive to y grid spacing especially at the dielectric surface. The streamer propagation velocity can reach 0.2 cm/ns when the voltage magnitude is 12 kV. A narrow gap was found between the streamer and dielectric barrier, where the plasma density is several orders of magnitude smaller than the streamer region. Analyses on the ion transport in the gap and streamer regions show the different ion transport mechanisms in the two different region. In the gap region, the diffusion of electron toward the dielectric layer decreases the seed electron in the beginning of voltage pulse, resulting that ionization avalanche does not occur. The streamer region is not significantly affected by the diffusion flux toward the dielectric layer, so that ionization avalanche takes place and leads to dramatic increase of plasma density.
International Nuclear Information System (INIS)
Ponce, Patricia; Parra, Duclerc F.; Carr, Laura G.; Sato, Juliana S.; Lugao, Ademar B.
2005-01-01
This work reports the influence of radiation and plasticizers on the barrier properties [water vapour permeability (WVP)] and mechanical properties (tensile strength and elongation) of edible films made of starch. These films were prepared with 4 g of starch/100 mL of water; 2-10 g polyethylene glycol (PEG)/100 g starch; and at natural pH. Tensile strength and percentage elongation were measured using a Mechanical Universal Testing Machine Instron 4400R and the water vapour permeability was determined according to ASTM E96-80 (ASTM, 1989). The mechanical properties of starch films are influenced by the plasticizer concentration. An increase in PEG content showed a considerable increase in elongation percentage and a decrease in the tensile strength of the films, also increase the permeability of the films in water. After irradiation, the barrier properties [water vapour permeability (WVP)] and mechanical properties (tensile strength and elongation) of the films were improved due to chemical reactions among polymer molecules. The films were irradiated at room temperature with gamma radiation. Irradiated starch cassava films with polyethylene glycol (PEG) as plasticizer have good flexibility and low water permeability, which indicate potential application as edible films (author)
Energy Technology Data Exchange (ETDEWEB)
Jin, Yanan; Lai, Wensheng, E-mail: wslai@tsinghua.edu.cn
2016-03-15
The effect of grain boundaries (GBs) on bulk cascades in nano-structured alpha-zirconium has been studied by molecular dynamics (MD) simulations. It turns out that the existence of GBs increases the defect productivity in grains, suggesting that the GBs may act as a thermal barrier and postpone the annihilation of defects within grains. Moreover, it is found that the thermal barrier effect of GBs facilitates the shift of symmetric tilt GBs to the grain with higher temperature, and the smaller the tilt angle is, the easier the boundary shift will be. Thus, the influence of GBs on radiation damage in the nano-structured materials comes from the competition between damage increase in grains and defect annihilation at GBs.
Culture technique of rabbit primary epidermal keratinocytes
Directory of Open Access Journals (Sweden)
Marini M
2012-10-01
Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.
Psychology of Success: Overcoming Barriers to Pursuing Further Education
Goto, Stanford T.; Martin, Connie
2009-01-01
Of the many barriers that prevent adults from continuing their education, psychological barriers are least often addressed by educators. This is an important area of concern because psychological factors influence how prospective students respond to other barriers. This qualitative study was conducted to describe how adults negotiate…
Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.
1988-01-01
In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure
Optimal allocation of leaf epidermal area for gas exchange.
de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J
2016-06-01
A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.
Miselis, Jennifer L.; Andrews, Brian D.; Nicholson, Robert S.; Defne, Zafer; Ganju, Neil K.; Navoy, Anthony S.
2016-01-01
Assessments of coupled barrier island-estuary storm response are rare. Hurricane Sandy made landfall during an investigation in Barnegat Bay-Little Egg Harbor estuary that included water quality monitoring, geomorphologic characterization, and numerical modeling; this provided an opportunity to characterize the storm response of the barrier island-estuary system. Barrier island morphologic response was characterized by significant changes in shoreline position, dune elevation, and beach volume; morphologic changes within the estuary were less dramatic with a net gain of only 200,000 m3 of sediment. When observed, estuarine deposition was adjacent to the back-barrier shoreline or collocated with maximum estuary depths. Estuarine sedimentologic changes correlated well with bed shear stresses derived from numerically simulated storm conditions, suggesting that change is linked to winnowing from elevated storm-related wave-current interactions rather than deposition. Rapid storm-related changes in estuarine water level, turbidity, and salinity were coincident with minima in island and estuarine widths, which may have influenced the location of two barrier island breaches. Barrier-estuary connectivity, or the transport of sediment from barrier island to estuary, was influenced by barrier island land use and width. Coupled assessments like this one provide critical information about storm-related coastal and estuarine sediment transport that may not be evident from investigations that consider only one component of the coastal system.
Directory of Open Access Journals (Sweden)
Yoshihiro Tokudome
2017-10-01
Full Text Available Purified glucosylceramide from beet extract (beet GlcCer and beet extract containing an equal amount of GlcCer were administered orally to ultra violet B (UVB-irradiated mice, and differences in the protective effects against skin barrier dysfunction caused by UVB irradiation were compared. In the beet GlcCer group, epidermal thickening and the decrease in stratum corneum (SC ceramide content caused by UVB irradiation were reduced. In the group that was orally administered beet extract containing glucosylceramide, effects similar to those in the beet GlcCer group were observed. Oral administration of beet GlcCer had no obvious effects against an increase in TEWL or decrease in SC water content after UVB irradiation, but there was improvement in the beet extract group. Oral administration of beet GlcCer is effective in improving skin barrier function in UVB-irradiated mice. Beet extract contains constituents other than GlcCer that are also effective in improving skin barrier function.
Inflammatory linear verrucous epidermal naevus: Report of three ...
African Journals Online (AJOL)
Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...
Etanercept therapy for toxic epidermal necrolysis.
Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio
2014-08-01
Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Steroid hormone and epidermal growth factor receptors in meningiomas.
Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R
1989-11-01
A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.
Energy Technology Data Exchange (ETDEWEB)
Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)
2016-03-15
Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.
Gruber, Robert; Sugarman, Jeffrey L.; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M.; Mauldin, Elizabeth A.; Thyssen, Jacob P.; Brandner, Johanna M.; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M.
2016-01-01
Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities. PMID:25660180
The epidermal biosynthesis of cholecalciferol (vitamin D3)
International Nuclear Information System (INIS)
Beadle, P.C.
1977-01-01
An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)
Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis
... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...
Hussain, Amara Noor; Zafar, Muhammad; Ahmad, Mushtaq; Khan, Raees; Yaseen, Ghulam; Khan, Muhammad Saleem; Nazir, Abdul; Khan, Amir Muhammad; Shaheen, Shabnum
2018-05-01
Palynological features as well as comparative foliar epidermal using light and scanning electron microscope (SEM) of 17 species (10genera) of Amaranthaceae have been studied for its taxonomic significance. Different foliar and palynological micro-morphological characters were examined to explain their value in resolving the difficulty in identification. All species were amphistomatic but stomata on abaxial surface were more abundant. Taxonomically significant epidermal character including stomata type, trichomes (unicellular, multicellular, and capitate) and epidermal cells shapes (polygonal and irregular) were also observed. Pollens of this family are Polypantoporate, pores large, spheroidal, mesoporous region is sparsely to scabrate, densely psilate, and spinulose. All these characters can be active at species level for identification purpose. This study indicates that at different taxonomic levels, LM and SEM pollen and epidermal morphology is explanatory and significant to identify species and genera. © 2018 Wiley Periodicals, Inc.
Impact of Helicobacter pylori on the healing process of the gastric barrier
Mnich, Eliza; Kowalewicz-Kulbat, Magdalena; Sicińska, Paulina; Hinc, Krzysztof; Obuchowski, Michał; Gajewski, Adrian; Moran, Anthony P; Chmiela, Magdalena
2016-01-01
AIM To determine the impact of selected well defined Helicobacter pylori (H. pylori) antigens on gastric barrier cell turnover. METHODS In this study, using two cellular models of gastric epithelial cells and fibroblasts, we have focused on exploring the effects of well defined H. pylori soluble components such as glycine acid extract antigenic complex (GE), subunit A of urease (UreA), cytotoxin associated gene A protein (CagA) and lipopolysaccharide (LPS) on cell turnover by comparing the wound healing capacity of the cells in terms of their proliferative and metabolic activity as well as cell cycle distribution. Toxic effects of H. pylori components have been assessed in an association with damage to cell nuclei and inhibition of signal transducer and activator of transcription 3 (STAT3) phosphorylation. RESULTS We showed that H. pylori GE, CagA and UreA promoted regeneration of epithelial cells and fibroblasts, which is necessary for effective tissue healing. However, in vivo increased proliferative activity of these cells may constitute an increased risk of gastric neoplasia. In contrast, H. pylori LPS showed a dose-dependent influence on the process of wound healing. At a low concentration (1 ng/mL) H. pylori LPS accelerated of healing epithelial cells, which was linked to significantly enhanced cell proliferation and MTT reduction as well as lack of alterations in cell cycle and downregulation of epidermal growth factor (EGF) production as well as cell nuclei destruction. By comparison, H. pylori LPS at a high concentration (25 ng/mL) inhibited the process of wound repair, which was related to diminished proliferative activity of the cells, cell cycle arrest, destruction of cell nuclei and downregulation of the EGF/STAT3 signalling pathway. CONCLUSION In vivo H. pylori LPS driven effects might lead to the maintenance of chronic inflammatory response and pathological disorders on the level of the gastric mucosal barrier. PMID:27672275
The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae
Directory of Open Access Journals (Sweden)
René Hans-Jürgen Heim
2015-12-01
Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.
Influences of engineered barrier systems on low-level radioactive waste disposal
International Nuclear Information System (INIS)
Buckley, L.P.
1987-09-01
There are major differences between the current practices of shallow land burial and alternative concepts for the disposal of low-level radioactive wastes. Additional protection provided with engineered barrier systems can overcome major concerns the public has with shallow land burial: subsidence; percolating ground waters; radionuclide migration; and the vulnerability of shallow trenches to intrusion. The presence of a variety of engineered barriers to restrict water movement, retain radionuclides and to prevent plant animal or human intrusion leads to significant changes to input data for performance assessment models. Several programs which are underway to more accurately predict the long-term performance of engineered barriers for low-level waste will be described
Influences of engineered barrier systems on low-level radioactive waste disposal
Energy Technology Data Exchange (ETDEWEB)
Buckley, L. P.
1987-09-15
There are major differences between the current practices of shallow land burial and alternative concepts for the disposal of low-level radioactive wastes. Additional protection provided with engineered barrier systems can overcome major concerns the public has with shallow land burial: subsidence; percolating ground waters; radionuclide migration; and the vulnerability of shallow trenches to intrusion. The presence of a variety of engineered barriers to restrict water movement, retain radionuclides and to prevent plant animal or human intrusion leads to significant changes to input data for performance assessment models. Several programs which are underway to more accurately predict the long-term performance of engineered barriers for low-level waste will be described.
HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis
2017-03-03
Stevens -Johnson Syndrome and Toxic Epidermal Necrolysis Brittany L. Lenz, MD, Andrew T. Patterson, MD, Amanda J . Laska, MD, Patrick J . Brown, MD, and...59 MDW/SGVU SUBJECT: Professional Presentation Approval 8 DEC 2016 1. Your paper, entitled HLA-B Sequencing in Patients with Stevens -Johnson...PATIENTS WITH STEVENS -JOHNSON SYNDROME AND TOXIC EPIDERMAL NECROL YSIS 2. FUNDING RECEIVED FOR THIS STUDY? DYES rgj NO FUNDING SOURCE: I I 3. IS THIS
Clinical Studies on conformal radiotherapy combined with epidermal ...
African Journals Online (AJOL)
Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...
Epidermal growth factor receptor expression in urinary bladder cancer
Directory of Open Access Journals (Sweden)
Dayalu S.L. Naik
2011-01-01
Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.
Predicting human epidermal melanin concentrations for different skin tones
CSIR Research Space (South Africa)
Smit, Jacoba E
2011-07-01
Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...
Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma
Directory of Open Access Journals (Sweden)
J Gordon Millichap
2013-01-01
Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.
Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...
African Journals Online (AJOL)
ADOWIE PERE
ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...
Directory of Open Access Journals (Sweden)
Christian eFalter
2015-03-01
Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.
Autodegradation of 125I-labeled human epidermal cell surface proteins
International Nuclear Information System (INIS)
Hashimoto, K.; Singer, K.H.; Lazarus, G.S.
1982-01-01
Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)
Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H
2014-10-01
Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure
2003-01-01
alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...
Benefits and Barriers of University Industry Collaborations from a Researcher's Perspective
DEFF Research Database (Denmark)
Kilian, Thomas; Schubert, Petra; Bjørn-Andersen, Niels
2015-01-01
parsimonious formative measures for the benefits and barriers of UIC and we found that academic and economic benefits positively influence the intention to conduct UIC in the future, while economic barriers negatively influence the intention to engage in UIC. A cluster analysis found five clusters (groups...... of researchers) that differ in their perception of benefits and barriers and the future intention to conduct UIC. However, the majority of the researchers have a very high intention to conduct UIC in the future....
Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori
2017-08-01
To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.
Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald
2012-05-01
Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.
Epidermal growth factor (EGF) inhibits stimulated thyroid hormone secretion in the mouse
International Nuclear Information System (INIS)
Ahren, B.
1987-01-01
It is known that epidermal growth factor (EGF) inhibits iodide uptake in the thyroid follicular cells and lowers plasma levels of thyroid hormones upon infusion into sheep and ewes. In this study, the effects of EGF on basal and stimulated thyroid hormone secretion were investigated in the mouse. Mice were pretreated with 125 I and thyroxine; the subsequent release of 125 I is an estimation of thyroid hormone secretion. It was found that basal radioiodine secretion was not altered by intravenous injection of EGF (5 micrograms/animal). However, the radioiodine secretion stimulated by both TSH (120 microU/animal) and vasoactive intestinal peptide (VIP; 5 micrograms/animal) were inhibited by EGF (5 micrograms/animal). At a lower dose level (0.5 microgram/animal), EGF had no influence on stimulated radioiodine secretion. In conclusion, EGF inhibits stimulated thyroid hormone secretion in the mouse
Marchesan, Melissa Andréia; Barros, Felipe; Porto, Saulo; Zaitter, Suellen; Brugnera, Aldo, Jr.; Sousa-Neto, Manoel D.
2007-02-01
This study evaluated ex vivo the influence of the number of gel/LED-laser applications/activations on cervical microleakage of two different barrier materials used for protection during whitening of endodontically treated teeth. Eighty-four canines were instrumented and obturated with epoxy resin sealer. The seal was removed 2 mm beyond the cemento-enamel junction for barrier placement and the teeth were divided into two groups of 40 teeth each: G1, zinc phosphate cement; G2, glass ionomer cement. The two groups were subdivided into 4 subgroups (n=10 each): I) no gel or LED-laser application; II) one gel application and two LED-laser activations; III) two gel applications and four LED-laser activations; IV) three gel applications and six LED-laser activations. The teeth were immersed in India ink for 7 days, decalcified and cleared. Cervical microleakage was quantified with a measurement microscope. Statistical analysis showed that zinc phosphate caused significantly lower microleakage than glass ionomer cement (presented microleakage in all subgroups). However, after two (p<0.01) and three (p<0.001) applications of gel, there was statistially significant microleakage in zinc phosphate barriers. Based on the present results, it can be concluded that cervical barriers with zinc phosphate cement show less cervical microleakage and that two or more applications/activations of gel/LED-laser significantly increase microleakage.
International Nuclear Information System (INIS)
Wakshull, E.; Kraemer, P.M.; Wharton, W.
1985-01-01
Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells
Cs-137 behaviour in landscape-geochemical structures of barrier complexes
International Nuclear Information System (INIS)
Strakh, L.I.; Ivashkevich, I.I.; Adamovich, A.A.; Zarubin, O.L.
1998-01-01
The Cs-137 distribution and cumulation accrues more actively in a marsh ecological systems of barrier complexes. The physical chemical and biogeochemical barriers influence on different way on these processes
Influence of shock wave propagation on dielectric barrier discharge plasma actuator performance
International Nuclear Information System (INIS)
Erfani, Rasool; Zare-Behtash, Hossein; Kontis, Konstantinos
2012-01-01
Interest in plasma actuators as active flow control devices is growing rapidly due to their lack of mechanical parts, light weight and high response frequency. Although the flow induced by these actuators has received much attention, the effect that the external flow has on the performance of the actuator itself must also be considered, especially the influence of unsteady high-speed flows which are fast becoming a norm in the operating flight envelopes. The primary objective of this study is to examine the characteristics of a dielectric barrier discharge (DBD) plasma actuator when exposed to an unsteady flow generated by a shock tube. This type of flow, which is often used in different studies, contains a range of flow regimes from sudden pressure and density changes to relatively uniform high-speed flow regions. A small circular shock tube is employed along with the schlieren photography technique to visualize the flow. The voltage and current traces of the plasma actuator are monitored throughout, and using the well-established shock tube theory the change in the actuator characteristics are related to the physical processes which occur inside the shock tube. The results show that not only is the shear layer outside of the shock tube affected by the plasma but the passage of the shock front and high-speed flow behind it also greatly influences the properties of the plasma. (paper)
DEFF Research Database (Denmark)
Gruber, Robert; Sugarman, Jeffrey L; Crumrine, Debra
2015-01-01
were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular...... and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial...
Directory of Open Access Journals (Sweden)
Yira Bermudez
Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.
Radiologic Findings of Epidermal Cysts in the Trunk
International Nuclear Information System (INIS)
Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi
2005-01-01
To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan
Identification of grazed grasses using epidermal characters | R ...
African Journals Online (AJOL)
The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...
Barriers and enablers that influence sustainable interprofessional education: a literature review.
Lawlis, Tanya Rechael; Anson, Judith; Greenfield, David
2014-07-01
The effective incorporation of interprofessional education (IPE) within health professional curricula requires the synchronised and systematic collaboration between and within the various stakeholders. Higher education institutions, as primary health education providers, have the capacity to advocate and facilitate this collaboration. However, due to the diversity of stakeholders, facilitating the pedagogical change can be challenging and complex, and brings a degree of uncertainty and resistance. This review, through an analysis of the barriers and enablers investigates the involvement of stakeholders in higher education IPE through three primary stakeholder levels: Government and Professional, Institutional and Individual. A review of eight primary databases using 21 search terms resulted in 40 papers for review. While the barriers to IPE are widely reported within the higher education IPE literature, little is documented about the enablers of IPE. Similarly, the specific identification and importance of enablers for IPE sustainability and the dual nature of some barriers and enablers have not been previously reported. An analysis of the barriers and enablers of IPE across the different stakeholder levels reveals five key "fundamental elements" critical to achieving sustainable IPE in higher education curricula.
Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.
Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi
2005-02-25
Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.
Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus
Directory of Open Access Journals (Sweden)
Naser Tayyebi Meibodi
2011-01-01
Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.
Growth of melanocytes in human epidermal cell cultures
International Nuclear Information System (INIS)
Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.
1990-01-01
Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient
Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism
International Nuclear Information System (INIS)
He, D.; Lim, H.W.
1991-01-01
This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes
Gabauer, Douglas J; Li, Xiaolong
2015-04-01
The purpose of this study was to investigate motorcycle-to-barrier crash frequency on horizontally curved roadway sections in Washington State using police-reported crash data linked with roadway data and augmented with barrier presence information. Data included 4915 horizontal curved roadway sections with 252 of these sections experiencing 329 motorcycle-to-barrier crashes between 2002 and 2011. Negative binomial regression was used to predict motorcycle-to-barrier crash frequency using horizontal curvature and other roadway characteristics. Based on the model results, the strongest predictor of crash frequency was found to be curve radius. This supports a motorcycle-to-barrier crash countermeasure placement criterion based, at the very least, on horizontal curve radius. With respect to the existing horizontal curve criterion of 820 feet or less, curves meeting this criterion were found to increase motorcycle-to-barrier crash frequency rate by a factor of 10 compared to curves not meeting this criterion. Other statistically significant predictors were curve length, traffic volume and the location of adjacent curves. Assuming curves of identical radius, the model results suggest that longer curves, those with higher traffic volume, and those that have no adjacent curved sections within 300 feet of either curve end would likely be better candidates for a motorcycle-to-barrier crash countermeasure. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Lv, Yuanjie; Feng, Zhihong; Gu, Guodong; Han, Tingting; Yin, Jiayun; Liu, Bo; Cai, Shujun; Lin, Zhaojun; Ji, Ziwu; Zhao, Jingtao
2014-01-01
The electron mobility scattering mechanisms in AlN/GaN heterostuctures with 3 nm and 6 nm AlN barrier thicknesses were investigated by temperature-dependent Hall measurements. The effect of interface roughness (IFR) scattering on the electron mobility was found to be enhanced by increasing AlN barrier thickness. Moreover, using the measured capacitance-voltage and current-voltage characteristics of the fabricated heterostructure field-effect transistors (HFETs) with different Schottky areas on the two heterostuctures, the variations of electron mobility with different gate biases were investigated. Due to enhanced IFR scattering, the influence of polarization Coulomb field (PCF) scattering on electron mobility was found to decrease with increasing AlN barrier layer thickness. However, the PCF scattering remained an important scattering mechanism in the AlN/GaN HFETs.
Melnick, Alan L; Rdesinski, Rebecca E; Creach, E Dawn; Choi, Dongseok; Harvey, S Marie
2008-01-01
To identify the influence of a community health nurse (CHN) home visit on perceived barriers to contraceptive access and contraceptive use self-efficacy. We enrolled 103 women into two groups in a randomized trial evaluating the influence of contraceptive dispensing and family planning counseling during home visits on perceived barriers to accessing contraceptives and contraceptive use self-efficacy. Both groups received counseling by a CHN about sexually transmitted disease and pregnancy prevention, and a resource card listing phone numbers of family planning clinics. After randomization, the CHN dispensed three months of hormonal contraception to the intensive intervention group and advised the minimal intervention group to schedule an appointment at a family planning clinic. Data collection at baseline and 12 months included demographic, reproductive and other health-related information as well as quantitative assessments of information on perceived barriers to contraceptive access and contraceptive use self-efficacy. The mean age of participants was 24.7 years. Three-fourths had household incomes under $25,000. We found significant reductions in three perceived barriers to contraceptive access for both groups, as well as significant increases in two measures of contraceptive use self-efficacy at twelve months compared to baseline. Nurse home visits involving family planning counseling might be effective in reducing perceived barriers to contraceptive access and increasing contraceptive use self-efficacy.
International Nuclear Information System (INIS)
Steves, S; Bibinov, N; Awakowicz, P; Ozkaya, B; Liu, C-N; Ozcan, O; Grundmeier, G
2013-01-01
A widely used plastic for packaging, polyethylene terephtalate (PET) offers limited barrier properties against gas permeation. For many applications of PET (from food packaging to micro electronics) improved barrier properties are essential. A silicon oxide barrier coating of PET foils is applied by means of a pulsed microwave driven low-pressure plasma. While the adjustment of the microwave power allows for a control of the ion production during the plasma pulse, a substrate bias controls the energy of ions impinging on the substrate. Detailed analysis of deposited films applying oxygen permeation measurements, x-ray photoelectron spectroscopy and atomic force microscopy are correlated with results from plasma diagnostics describing the deposition process. The influence of a change in process parameters such as gas mixture and substrate bias on the gas temperature, electron density, mean electron energy, ion energy and the atomic oxygen density is studied. An additional substrate bias results in an increase in atomic oxygen density up to a factor of 6, although plasma parameter such as electron density of n e = 3.8 ± 0.8 × 10 17 m −3 and electron temperature of k B T e = 1.7 ± 0.1 eV are unmodified. It is shown that atomic oxygen densities measured during deposition process higher than n O = 1.8 × 10 21 m −3 yield in barrier films with a barrier improvement factor up to 150. Good barrier films are highly cross-linked and show a smooth morphology. (paper)
Pérez-Gutiérrez, J F; Argüelles, J C; Iglesias-Núñez, M; Oliveira, K S; De La Muela, M Sánchez
2011-07-01
To perform a histological and immunohistochemical study of epidermal growth factor, transforming growth factor-alpha and their receptor, as well as the apoptotic signal active caspase-3 in the levator ani muscle of dogs with and without perineal hernia. Biopsy specimens of the levator ani muscle were obtained from 25 dogs with perineal hernia and 4 non-affected dogs and were processed for Masson and immunohistochemical staining. The affected dogs exhibited myopathological features, internalised nuclei, destruction and abnormal size of muscle fibres, which were replaced by collagen. The immunohistochemical study revealed active caspase-3, epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor in the levator ani. Compared to the healthy muscle, transforming growth factor-alpha staining intensity was lower in the affected muscle, whereas epidermal growth factor receptor and active caspase-3 staining were higher. Pelvic diaphragm muscle weakening is the leading cause of perineal hernia in the dog. Survival and death signals expressed in these muscles may contribute to the pathogenesis of this disease. This study reports epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor immunohistochemical expression in the skeletal muscle and suggests that perineal hernia in the dog is accompanied by levator ani muscle atrophy, increased expression of epidermal growth factor receptor, caspase-3 activation, and decreased expression of transforming growth factor-alpha. © 2011 British Small Animal Veterinary Association.
Skin barrier properties in patients with recessive X-linked ichthyosis
DEFF Research Database (Denmark)
Johansen, J D; Ramsing, D; Vejlsgaard, G
1995-01-01
increased in controls compared to ichthyosis patients, when evaluated by TEWL. When evaluated by erythema index a statistically significant increase in redness was found in controls, but not in ichthyosis patients. Electrical capacitance, reflecting skin hydration, was significantly reduced in RXLI patients......Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...... properties and skin response to SLS were studied by measurement of transepidermal water loss (TEWL), electrical capacitance and erythema index. No statistically significant difference in basal TEWL was found between the two groups. The skin response to SLS was found to be statistically significantly...
Morphometric analysis of epidermal differentiation in primary roots of Zea mays
Moore, R.; Smith, H. S.
1990-01-01
Epidermal differentiation in primary roots of Zea mays was divided into six cell types based on cellular shape and cytoplasmic appearance. These six cell types are: 1) apical protoderm, located at the tip of the root pole and characterized by periclinally flattened cells; 2) cuboidal protoderm, located approximately 230 microns from the root pole and characterized by cuboidal cells; 3) tabular epidermis, located approximately 450 microns from the root pole and characterized by anticlinally flattened cells; 4) cuboidal epidermis, located approximately 900 microns from the root pole and characterized by cuboidal cells having numerous small vacuoles; 5) vacuolate cuboidal epidermis, located approximately 1,500 microns from the root pole and characterized by cuboidal cells containing several large vacuoles; and 6) columnar epidermis, located approximately 2,200 microns from the root pole (i.e., at the beginning of the zone of elongation) and characterized by elongated cells. We also used stereology to quantify the cellular changes associated with epidermal differentiation. The quiescent center and the apical protoderm have significantly different ultrastructures. The relative volume of dictyosomes increases dramatically during the early stages of epidermal differentiation. This increase correlates inversely with the amount of coverage provided by the root cap and mucilage.
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst
2013-02-01
Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.
Pattern of hormone receptors and human epidermal growth factor ...
African Journals Online (AJOL)
Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen
2017-06-16
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen
2017-01-01
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
International Nuclear Information System (INIS)
Nudnova, M. M.; Aleksandrov, N. L.; Starikovskii, A. Yu.
2010-01-01
The properties of a surface barrier discharge in atmospheric-pressure air at different polarities of applied voltage were studied experimentally. The influence of the voltage polarity on the spatial structure of the discharge and the electric field in the discharge plasma was determined by means of spectroscopic measurements. It is found that the energy deposited in the discharge does not depend on the voltage polarity and that discharges of positive polarity are more homogenous and the electric fields in them are higher.
The protective influence of the locus ceruleus on the blood-brain barrier
International Nuclear Information System (INIS)
Harik, S.I.; McGunigal, T. Jr.
1984-01-01
The functions of the putative noradrenergic innervation of cerebral microvessels from the nucleus locus ceruleus remain ambiguous. Although most evidence indicates that such innervation does not have a major role in the control of cerebral blood flow, there are increasing indications that it modulates transport and permeability functions of the blood-brain barrier. In this study we investigated the effect of unilateral chemical lesioning of the locus ceruleus on the leakage of radioiodinated human serum albumin across the blood-brain barrier. Experiments were performed in awake and restrained rats under steady-state conditions and during drug-induced systemic arterial hypertension, and in anesthetized and paralyzed rats during bicuculline-induced seizures. Both hypertension and seizures are known to be associated with increased leakage of macromolecules across the blood-brain barrier. Albumin leakage into norepinephrine-depleted forebrain structures ipsilateral to the locus ceruleus lesion was compared with that of the contralateral side. There were no side-to-side differences in blood-brain barrier permeability to albumin under steady-state conditions, the stress of restraint, or angiotensin-induced hypertension, or after isoproterenol administration. Norepinephrine-induced hypertension and seizures, however, caused significant increases in albumin leakage into forebrain structures ipsilateral to the lesion. These results suggest that noradrenergic innervation of cerebral microvessels from the locus ceruleus helps preserve the integrity of the blood-brain barrier during pathophysiological states associated with hypertension and increased circulating catecholamines
Directory of Open Access Journals (Sweden)
E. F. Zeer
2012-01-01
Full Text Available The paper summarizes the research findings concerning the influence of creativity on overcoming the barriers of teachers’ professional development. The re- search subject includes defining the interrelations between the creativity and profes- sional burn-out. The aim of the studies is to find out the influencing factors of creativ- ity eliminating the destructive trends of professional pedagogic activity. The methodology is based on the E. E. Simanyuk’s concept describing the de- structive tendencies of teachers’ professional formation and the constructive overcom- ing strategies. The teachers’ refresher course at Sverdlovsk Regional Institute of Education De- velopment was taken as the experimental ground for the research. The diagnostics of the psychological constructs relating to the discussed phenomena was carried out by using tests of high validity and reliability. The modern methods of mathematical statis- tics were applied. The research outputs are of high practical importance both for designing the content of teachers’ professional development and upgrading their readiness for educa- tional innovations.
Shavenbaby couples patterning to epidermal cell shape control.
Directory of Open Access Journals (Sweden)
Hélène Chanut-Delalande
2006-09-01
Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.
Phonic Attenuation due to Screen-Barriers
Directory of Open Access Journals (Sweden)
Vasile Bacria
2011-10-01
Full Text Available The technique of noise decreasing admits two basic approaches: an active approach and a passive one. In the frame of passive method one can count the employment of screen-barriers. In this paper we present some considerations on sound attenuation due to screen-barriers emphasizing the elements which influence it. The elucidation of these elements is made by measurements. The obtained results can be applied in every other practical situation concerning the protection against noise.
Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung
2013-01-01
Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...
Directory of Open Access Journals (Sweden)
Tao Wang
2015-09-01
Full Text Available Non-bullous congenital ichthyosiform erythroderma (NBCIE is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272* in ALOXE3 (NM_001165960.1 in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband’s skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi’s granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi’s granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.
Epidermal response of rainbow trout to Ichthyobodo necator
DEFF Research Database (Denmark)
Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar
2014-01-01
Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion
DEFF Research Database (Denmark)
Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore
2009-01-01
BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...
Directory of Open Access Journals (Sweden)
Serge C Thal
Full Text Available Disruption of the blood-brain barrier (BBB results in cerebral edema formation, which is a major cause for high mortality after traumatic brain injury (TBI. As anesthetic care is mandatory in patients suffering from severe TBI it may be important to elucidate the effect of different anesthetics on cerebral edema formation. Tight junction proteins (TJ such as zonula occludens-1 (ZO-1 and claudin-5 (cl5 play a central role for BBB stability. First, the influence of the volatile anesthetics sevoflurane and isoflurane on in-vitro BBB integrity was investigated by quantification of the electrical resistance (TEER in murine brain endothelial monolayers and neurovascular co-cultures of the BBB. Secondly brain edema and TJ expression of ZO-1 and cl5 were measured in-vivo after exposure towards volatile anesthetics in native mice and after controlled cortical impact (CCI. In in-vitro endothelial monocultures, both anesthetics significantly reduced TEER within 24 hours after exposure. In BBB co-cultures mimicking the neurovascular unit (NVU volatile anesthetics had no impact on TEER. In healthy mice, anesthesia did not influence brain water content and TJ expression, while 24 hours after CCI brain water content increased significantly stronger with isoflurane compared to sevoflurane. In line with the brain edema data, ZO-1 expression was significantly higher in sevoflurane compared to isoflurane exposed CCI animals. Immunohistochemical analyses revealed disruption of ZO-1 at the cerebrovascular level, while cl5 was less affected in the pericontusional area. The study demonstrates that anesthetics influence brain edema formation after experimental TBI. This effect may be attributed to modulation of BBB permeability by differential TJ protein expression. Therefore, selection of anesthetics may influence the barrier function and introduce a strong bias in experimental research on pathophysiology of BBB dysfunction. Future research is required to investigate
Composite of microgels and lipids as biofilm to restore skin barrier function
Oudshoorn, M.H.M.
2008-01-01
The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential
Fundamentals of the double-humped fission barrier
International Nuclear Information System (INIS)
Brack, M.
1980-01-01
We review the development of the theory of the fission barrier over the past forty years. Special emphasis is put on the shell-correction method of Strutinsky and its foundation and numerical verification from microscopical Hartree-Fock calculations. The different practical realisations of the method and its applications to the calculation of deformation energy surfaces are reviewed. The influence of the different shape degrees of freedom of the nucleus on the form of the fission barrier is discussed. Finally, we summarize some more recent developments concerning both experimental and theoretical aspects of the double-humped fission barrier. (author)
Directory of Open Access Journals (Sweden)
Yen-Hsi Liu
2010-09-01
Conclusions: Both aerobic and anaerobic microorganisms were present in the inflamed epidermal cysts, although the anaerobic bacteria, specifically, Propionibacterium spp and Peptostreptococcus spp, were isolated slightly more frequently. Antibiotics directed against anaerobes may be considered in the treatment regimen for inflamed epidermal cysts.
Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel
2006-08-01
Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
Directory of Open Access Journals (Sweden)
Raj Victor
2011-08-01
Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
2011-01-01
Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061
Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.
Bolívar-Flores, Y J; Kuri-Harcuch, W
1999-08-01
Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.
Chuukese migrant women in Guam: Perceptions of barriers to health care
Directory of Open Access Journals (Sweden)
Margaret Hattori-Uchima
2017-04-01
Full Text Available This descriptive qualitative study examined perceived barriers to health care among Chuukese migrant women in Guam and explored which factors influenced health-seeking behaviors. Study participants recommended interventions which may reduce those perceived barriers. Since the Compact of Free Association with the United States was enacted in 1985, there has been a dramatic rise in the numbers of Chuukese migrating to Guam. This migration is anticipated to continue with more migrants needing health care, education, and social services. Little is known about their perceptions of barriers to health care services or the cultural, social, economic, and other factors that influence their health-seeking behaviors. Focus group interviews provided rich data, which were analyzed using content analysis. Themes included barriers to seeking and maintaining health and social and cultural factors influencing health-seeking behaviors. Major barriers identified were financial issues, difficulty in obtaining care due to long wait times, transportation problems, and struggles with both language and cultural nuances of communication. It was found that the women identified a mistrust of health and social services resulting from communication barriers. Social and cultural factors included the use of traditional Chuukese medicines, lack of preventive care services, confidentiality concerns, and feelings of mistreatment. Participants made recommendations for improved care and expressed a strong desire to achieve the mutual goal of better health care for Chuukese migrants in Guam.
Kiwifruit, mucins, and the gut barrier.
Moughan, Paul J; Rutherfurd, Shane M; Balan, Prabhu
2013-01-01
Kiwifruit has long been regarded in China, where it originated from, for its health properties and particularly in relation to digestion and general gut health. There are a number of physical and chemical properties of the fruit, including its dietary fiber content, the presence of raphides, its high water holding capacity and actinidin content, that suggest that kiwifruit may be effective in influencing gut mucin production and thus enhancing the integrity of the gut barrier. The mucous layer, which comprises mucins and other materials, overlying the mucosal epithelium, is an important component of the gut barrier. The gut barrier plays a crucial role in separating the host from the often noxious external environment. The mucous layer, which covers the entire gastrointestinal tract (GIT), is the front line of innate host defense. There have been few direct studies of the effect of kiwifruit ingestion on mucin production in the GIT, and findings that are available using animal models are somewhat inconsistent. Taking results for digesta mucin content, number of goblet cells, and mucin gene expression, together, it would seem that green kiwifruit and possibly gold kiwifruit do influence gut mucin production, and the kiwifruit as part of a balanced diet may help to maintain the mucous layer and gut barrier. More corroborative experimental evidence is needed, and studies need to be undertaken in humans. Copyright © 2013 Elsevier Inc. All rights reserved.
Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity
International Nuclear Information System (INIS)
Lowe, N.J.; Breeding, J.
1982-01-01
Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study
Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques
2015-06-01
Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.
Grafting of human epidermal cells, presence and perspectives
Czech Academy of Sciences Publication Activity Database
Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.
2001-01-01
Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry
Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice
Directory of Open Access Journals (Sweden)
Azahara Rodríguez-Luna
2017-12-01
Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.
Barriers and facilitators of mental health screening in pregnancy.
Kingston, Dawn; Austin, Marie-Paule; Heaman, Maureen; McDonald, Sheila; Lasiuk, Gerri; Sword, Wendy; Giallo, Rebecca; Hegadoren, Kathy; Vermeyden, Lydia; van Zanten, Sander Veldhuyzen; Kingston, Joshua; Jarema, Karly; Biringer, Anne
2015-11-01
Access to mental health services during pregnancy is most commonly mobilized through formal mental health screening. However, few studies to date have identified barriers and facilitators that affect pregnant women's responses to mental health screening. The objective was to identify barriers and facilitators that influence pregnant women's responses to the screening process and factors associated with their identification. This multi-site, cross-sectional survey recruited pregnant women >16 years of age who spoke/read English in Alberta, Canada. Main outcomes were barriers and facilitators of mental health screening. Descriptive statistics were generated to identify the most common barriers and facilitators and multivariable logistic regression models were conducted to determine factors associated with barriers and facilitators. Study participation rate was 92% (460/500). Women's most common barriers were: significant others normalizing their emotional difficulties; desiring to handle mental health problems on their own; preferring to discuss feelings with significant others; and not knowing what emotions were 'normal'. Women who identified these barriers were more likely not to have been treated previously for mental illness, were primiparous, and could not be completely honest with their provider. Main facilitators were provider characteristics (sensitive, interested), reassurance that mental healthcare is a part of routine prenatal care, hearing that other women have emotional problems during pregnancy and knowing that help was available. The sample comprised largely Caucasian, well-educated, and partnered women, which limits generalizability of the findings. Personal and stigma-related barriers influence pregnant women's responses to mental health screening. Efforts to minimize barriers and enhance facilitators should be explored as potential strategies for optimizing prenatal mental health screening. Copyright © 2015 Elsevier B.V. All rights reserved.
Tumores dermóides e epidermóides intra-espinhas
Directory of Open Access Journals (Sweden)
Oscar Fontenelle Filho
1971-03-01
Full Text Available São relatados dois casos de tumores epidermóides e um de tumor dermóide, todos intrarraquianos. Este último era de localização epidural ao nível da coluna torácica (caso 3; os dois tumores epidermóides situavam-se na coluna tóraco-lombar (caso 1 e lombar (caso 2, respectivamente, sendo o primeiro intramedular e o segundo intradural. Em dois casos (casos 2 e 3 os tumores associavam-se a fístula dérmica congênita. Um paciente (caso 3 foi operado aos dois meses de idade; a descoberta do tumor deveu-se à realização da raquimanometria que revelou bloqueio, apesar do paciente não apresentar qualquer sinal neurológico de compressão medular. Os autores são de opinião que, em presença de fístula dérmica congênita ao nível da coluna vertebral, principalmente quando localizada acima do segmento lombosacro, deve-se sempre suspeitar da possibilidade do tumor epidermóide ou dermóide intrarraquiano, mesmo na ausência de sinais neurológicos. A combinação de sintomas neurológicos de longa duração, a evidência radiológica de erosão e alargamento do canal raquiano e a história de fístula dérmica congênita proporcionaram o diagnóstico pré-operatório correto no caso 2.
Role of submandibular saliva and epidermal growth factor in gastric cytoprotection
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1984-01-01
without submandibular glands. Exogenous EGF and saliva with a high but still physiological concentration of EGF significantly reduced the median area in the stomach displaying ulcers and ulcerations, whereas saliva without EGF had no effect. Although EGF is a known inhibitor of gastric acid secretion......The role of submandibular epidermal growth factor in protection of the gastric mucosa was investigated in rats. Removal of the submandibular glands and thereby submandibular epidermal growth factor (EGF) caused rats to develop gastric lesions (ulcerations and ulcers) after administration......, the dose used in the present study had no effect on gastric acid secretion in chronic gastric fistula rats; removal of the submandibular glands also did not have any such effect. We conclude that exocrine secretion of submandibular EGF has a cytoprotective function in the stomach, an effect that may...
Functional barriers: Properties and evaluation
Feigenbaum, A.; Dole, P.; Aucejo, S.; Dainelli, D.; Cruz Garcia, C. de la; Hankemeier, T.; N'Gono, Y.; Papaspyrides, C.D.; Paseiro, P.; Pastorelli, S.; Pavlidou, S.; Pennarun, P.Y.; Saillard, P.; Vidal, L.; Vitrac, O.; Voulzatis, Y.
2005-01-01
Functional barriers are multilayer structures deemed to prevent migration of some chemicals released by food-contact materials into food. In the area of plastics packaging, different migration behaviours of mono- and multilayer structures are assessed in terms of lag time and of their influence of
Lakshmanan, J; Landel, C P
1986-07-01
We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.
Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour
International Nuclear Information System (INIS)
Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.
1996-01-01
Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)
Influence of dielectric barrier discharge treatment on mechanical and dyeing properties of wool
Rahul, NAVIK; Sameera, SHAFI; Md Miskatul, ALAM; Md Amjad, FAROOQ; Lina, LIN; Yingjie, CAI
2018-06-01
Physical and chemical properties of wool surface significantly affect the absorbency, rate of dye bath exhaustion and fixation of the industrial dyes. Hence, surface modification is a necessary operation prior to coloration process in wool wet processing industries. Plasma treatment is an effective alternative for physiochemical modification of wool surface. However, optimum processing parameters to get the expected modification are still under investigation, hence this technology is still under development in the wool wet processing industries. Therefore, in this paper, treatment parameters with the help of simple dielectric barrier discharge plasma reactor and air as a plasma gas, which could be a promising combination for treatment of wool substrate at industrial scale were schematically studied, and their influence on the water absorbency, mechanical, and dyeing properties of twill woven wool fabric samples are reported. It is expected that the results will assist to the wool coloration industries to improve the dyeing processes.
Communication barriers in the family
Directory of Open Access Journals (Sweden)
BARBARA KOC-KOZŁOWIEC
2017-10-01
Full Text Available The art of communication – listening and speaking – is a major life skill, with a thorough influence on every human life. Remaining silent while the interlocutor speaks is not all that there is to the act of listening to messages. True listening is based on an intention to get involved in understanding of the other person, enjoying his or her presence, learning something from the conversation, giving assistance, or comforting the interlocutor. In the article the author describes obstacles (barriers, which render true listening impossible. These barriers have been identified by a group of young adults.
Daniels, R
2017-11-01
It is international consensus that the daily use of properly selected products for the maintenance therapy is a must in the adjuvant treatment of most chronic skin diseases. In a first step, the selection of an adequate product can be guided by the classical triangle of the dermal vehicles. However, modern skin care products use diverse excipients, e. g. emulsifiers and viscosity enhancers, to improve the galenical and haptic properties of the formulations. It is thus no longer sufficient to simply have knowledge about the oil and water content of a cream in order to make a proper selection. A very positive effect on the skin barrier can be achieved using biomimetic lipids which can be incorporated into the epidermal lipid barrier. The application of such products as a foam cream is the most convenient way especially favorable when inflamed or hardly accessible skin areas have to be treated.
Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants
International Nuclear Information System (INIS)
Nishida, K.; Roksandic, Z.; Osmond, B.
1981-01-01
The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon
Wicks, M.; Thomas, F. O.; Corke, T. C.; Patel, M.
2012-11-01
Dielectric barrier discharge (DBD) plasma actuators possess numerous advantages for flow control applications and have been the focus of several previous studies. Most work has been performed in relatively pristine laboratory settings. In actual flow control applications, however, it is essential to assess the impact of various environmental influences on actuator performance. As a first effort toward assessing a broad range of environmental effects on DBD actuator performance, the influence of relative humidity (RH) is considered. Actuator performance is quantified by force balance measurements of reactive thrust while RH is systematically varied via an ultrasonic humidifier. The DBD plasma actuator assembly, force balance, and ultrasonic humidifier are all contained inside a large, closed test chamber instrumented with RH and temperature sensors in order to accurately estimate the average RH at the actuator. Measurements of DBD actuator thrust as a function of RH for several different applied voltage regimes and dielectric materials and thicknesses are presented. Based on these results, several important design recommendations are made. This work was supported by Innovative Technology Applications Company (ITAC), LLC under a Small Business Innovation Research (SBIR) Phase II Contract No. N00014-11-C-0267 issued by the U.S. Department of the Navy.
Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B
2000-01-01
Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.
Metabolic epidermal necrosis in two dogs with different underlying diseases.
Bond, R; McNeil, P E; Evans, H; Srebernik, N
1995-05-06
Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.
The immigration delay disease: adermatoglyphia-inherited absence of epidermal ridges.
Burger, Bettina; Fuchs, Dana; Sprecher, Eli; Itin, Peter
2011-05-01
In the digital age, personal identification by fingerprints (epidermal ridges) has become more frequent and is often required for biometric passports. The more fingerprints are analyzed, the more variants in their formation are documented. Individuals completely missing fingerprints as an isolated finding are extremely rare. Only 4 kindreds have been described to date, with additional clinical features in most cases. We describe a female patient with missing epidermal ridges on the fingers, palms, toes, and soles as an isolated feature. Absent fingerprints, or adermatoglyphia, were inherited over 4 generations of her family in an autosomal dominant fashion. We present the clinical features of the index patient, and compare the case with previous reports in the literature. Because of problems in personal identification, this embryologic malformation caused the patient significant difficulties when traveling to other countries, which is why we name it the immigration delay disease. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Immunohistochemical localization of epidermal growth factor in rat and man
DEFF Research Database (Denmark)
Poulsen, Steen Seier; Nexø, Ebba
1986-01-01
Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...
Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing
2018-03-01
Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.
Epidermal growth factor and lung development in the offspring of the diabetic rat
DEFF Research Database (Denmark)
Thulesen, J; Poulsen, Steen Seier; Nexø, Ebba
2000-01-01
Fetuses of diabetic mothers who were exposed to excessive glucose show delayed maturation. Under these conditions, altered growth factor expression or signaling may have important regulatory influences. We examined the role of epidermal growth factor (EGF) in lung development and maternal diabetes...... in the rat. In order to evaluate the possible role of glucose for the expression of EGF and the growth of lung tissue, we performed in vitro studies with organotypic cultures of fetal alveolar cells obtained from control rats. Compared to pups of normal rats, the newborn rats of untreated diabetic rats had...... and was associated with a reduced intensity of surfactant protein A-IR. The only difference observed between pups of treated diabetic rats and controls was a decrease in the lung weight:body weight ratio. In organotypic cultures, the presence of 13 mmol/L glucose in the cell media increased immunoreactive staining...
Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)
International Nuclear Information System (INIS)
Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.
1997-01-01
This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist
Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes
Laporta, Robert F.; Taichman, Lorne B.
1982-06-01
Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.
DEFF Research Database (Denmark)
Mellergaard, Stig; Nielsen, Else
1997-01-01
and the disease prevalence in the present case, the disease pattern showed evident similarities with formerly described oxygen deficiency-induced outbreaks of lymphocystis and epidermal papilloma in dab in the Kattegat. In 1988, the prevalence of lymphocystis and epidermal papilloma increased significantly...
Epidermal nevus syndrome associated with unusual neurological, ocular, and skeletal features
Directory of Open Access Journals (Sweden)
Reena Sharma
2012-01-01
Full Text Available Epidermal nevus syndrome (ENS is a rare disease, the pathogenesis of which is largely elusive. We, hereby, report an exclusive case of a 20-year-old man with verrucous ENS presented with dark colored papules and plaques along the Blaschko′s lines present over the head and neck area along with fleshy growth in both eyes since birth. Limb length discrepancy and kyphoscoliosis were remarkable. Skin biopsy was compatible with verrucous epidermal nevus while the biopsy of the ocular lesion confirmed complex choristoma. MRI brain revealed calcification in the right temporal lobe. Bilateral arachnoid cyst in the middle cranial fossa, scleral osteoma in the posterior part of the right eyeball, and deformed calvarium were evident on CECT skull and orbit. The present illustration emphasizes the importance of a punctilious work up of the case.
Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.
Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna
2018-01-21
Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.
Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad
2017-04-01
Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.
The under-appreciated promiscuity of the epidermal growth factor receptor family.
Directory of Open Access Journals (Sweden)
Sean P Kennedy
2016-08-01
Full Text Available Each member of the epidermal growth factor receptor (EGFR family plays a key role in normal development, homeostasis and a variety of pathophysiological conditions, most notably in cancer. According to the prevailing dogma, these four receptor tyrosine kinases (RTKs; EGFR, ERBB2, ERBB3 and ERBB4 function exclusively through the formation of homodimers and heterodimers within the EGFR family. These combinatorial receptor interactions are known to generate increased interactome diversity and therefore influence signalling output, subcellular localization and function of the heterodimer. This molecular plasticity is also thought to play a role in the development of resistance towards targeted cancer therapies aimed at these known oncogenes. Interestingly, many studies now challenge this dogma and suggest that the potential for EGFR family receptors to interact with more distantly related RTKs is much greater than currently appreciated. Here we discuss how the promiscuity of these oncogenic receptors may lead to the formation of many unexpected receptor pairings and the significant implications for the efficiency of many targeted cancer therapies.
An immunologic approach to induction of epidermal growth factor deficiency
DEFF Research Database (Denmark)
Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier
1995-01-01
Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....
International Nuclear Information System (INIS)
Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos
2010-01-01
Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.
Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase
Spaargaren, M.; Defize, L. H.; Boonstra, J.; de Laat, S. W.
1991-01-01
The relationship between epidermal growth factor receptor (EGF-R) protein tyrosine kinase activation and ligand-induced receptor dimerization was investigated using several bivalent anti-EGF-R antibodies directed against various receptor epitopes. In A431 membrane preparations and permeabilized
DEFF Research Database (Denmark)
Boone, Marc; Draye, Jean Pierre; Verween, Gunther
2014-01-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...
Mitigation of Traffic-Induced Ground Vibration by Inclined Wave Barriers
DEFF Research Database (Denmark)
Andersen, Lars; Augustesen, Anders Hust
2009-01-01
Double sheet pile walls can be used as wave barriers in order to mitigate ground vibrations from railways. The present analysis concerns the efficiency of such barriers, especially with regard to the influence of the barrier inclination and the backfill between the walls. Thus, the screening capa...... of reference following the load. This allows a computation of the steady state response to a harmonically varying point source moving at different speeds typical for a train....
In Vivo Cosmetic Product Efficacy Testing by Analyzing Epidermal Proteins Extracted from Tape Strips
Directory of Open Access Journals (Sweden)
Marie Westman
2014-02-01
Full Text Available The objective of this in vivo pilot study was to investigate whether differential biomarker analysis from skin tape strips could be used, not only to evaluate the difference between treated and untreated skin, but also to evaluate the effect of different product treatments. Ten volunteers were included in the study, applying two different basic formulations on their forearms. After four weeks of product application, and also after one week of treatment remission, tape strips were collected from the different treatment sites, as well as from untreated skin. The biomarkers investigated were selected to cover different aspects of epidermal differentiation and in connection with moisturization and barrier function. Levels of Involucrin were increased in both treatments, compared to untreated skin, whereas the levels of Keratin-6 were decreased for both treatments. In addition, a pattern for increased levels of Hornerin and Claudin-1 was also detected. There were no significant differences between the two treatments, only for treatment compared to untreated, but there were tendencies for different effect on some of the biomarkers investigated, differences that may reach significance with increased sample size. The major differences between the two treatments in this study were seen after one week of product remission, although due to too small sample size these differences were not significant.
Surface pre-treatment for barrier coatings on polyethylene terephthalate
Bahre, H.; Bahroun, K.; Behm, H.; Steves, S.; Awakowicz, P.; Böke, M.; Hopmann, Ch; Winter, J.
2013-02-01
Polymers have favourable properties such as light weight, flexibility and transparency. Consequently, this makes them suitable for food packaging, organic light-emitting diodes and flexible solar cells. Nonetheless, raw plastics do not possess sufficient barrier functionality against oxygen and water vapour, which is of paramount importance for most applications. A widespread solution is to deposit thin silicon oxide layers using plasma processes. However, silicon oxide layers do not always fulfil the requirements concerning adhesion and barrier performance when deposited on films. Thus, plasma pre-treatment is often necessary. To analyse the influence of a plasma-based pre-treatment on barrier performance, different plasma pre-treatments on three reactor setups were applied to a very smooth polyethylene terephthalate film before depositing a silicon oxide barrier layer. In this paper, the influence of oxygen and argon plasma pre-treatments towards the barrier performance is discussed examining the chemical and topological change of the film. It was observed that a short one-to-ten-second plasma treatment can reduce the oxygen transmission rate by a factor of five. The surface chemistry and the surface topography change significantly for these short treatment times, leading to an increased surface energy. The surface roughness rises slowly due to the development of small spots in the nanometre range. For very long treatment times, surface roughness of the order of the barrier layer's thickness results in a complete loss of barrier properties. During plasma pre-treatment, the trade-off between surface activation and roughening of the surface has to be carefully considered.
Surface pre-treatment for barrier coatings on polyethylene terephthalate
International Nuclear Information System (INIS)
Bahre, H; Böke, M; Winter, J; Bahroun, K; Behm, H; Hopmann, Ch; Steves, S; Awakowicz, P
2013-01-01
Polymers have favourable properties such as light weight, flexibility and transparency. Consequently, this makes them suitable for food packaging, organic light-emitting diodes and flexible solar cells. Nonetheless, raw plastics do not possess sufficient barrier functionality against oxygen and water vapour, which is of paramount importance for most applications. A widespread solution is to deposit thin silicon oxide layers using plasma processes. However, silicon oxide layers do not always fulfil the requirements concerning adhesion and barrier performance when deposited on films. Thus, plasma pre-treatment is often necessary. To analyse the influence of a plasma-based pre-treatment on barrier performance, different plasma pre-treatments on three reactor setups were applied to a very smooth polyethylene terephthalate film before depositing a silicon oxide barrier layer. In this paper, the influence of oxygen and argon plasma pre-treatments towards the barrier performance is discussed examining the chemical and topological change of the film. It was observed that a short one-to-ten-second plasma treatment can reduce the oxygen transmission rate by a factor of five. The surface chemistry and the surface topography change significantly for these short treatment times, leading to an increased surface energy. The surface roughness rises slowly due to the development of small spots in the nanometre range. For very long treatment times, surface roughness of the order of the barrier layer's thickness results in a complete loss of barrier properties. During plasma pre-treatment, the trade-off between surface activation and roughening of the surface has to be carefully considered. (paper)
IPR Barriers in Collaboration between University and Engineering Industry in Sweden
Huang, Wenting
2011-01-01
This thesis examines the barriers, especially intellectual property rights concerned that inhibit industry academia collaboration. By analyzing Swedish firms in the engineering industry, I explore the influence of IPR barrier on firms’ benefits, short- and long-term respectively from university-industry interaction. Three hypotheses are suggested to investigate the relationship between IPR barriers, firm categories, short-term benefits and long-term benefits. The results illustrate different ...
Overcoming Barriers: Women in Superintendency
Miller, Claire M.
2009-01-01
Women currently represent the largest number of teachers in the United States but remain underrepresented in the superintendent position. This suggests that the superintendency has been influenced by patriarchy. If women are to break through the barriers that prevent them from attaining a superintendency, we will need to understand the social…
Energy Technology Data Exchange (ETDEWEB)
Purushothaman, J. [B.S. Abdur Rahman University, Chennai 600048 (India); MTD, MMG, IGCAR, Kalpakkam 603102 (India); Ramaseshan, R., E-mail: seshan@igcar.gov.in [TFCS, SND, MSG, IGCAR, Kalpakkam 603102 (India); Albert, S.K. [MTD, MMG, IGCAR, Kalpakkam 603102 (India); Rajendran, R. [B.S. Abdur Rahman University, Chennai 600048 (India); Gowrishankar, N. [IP Rings Ltd., Maraimalainagar, Chennai 603209 (India); Ramasubbu, V. [MTD, MMG, IGCAR, Kalpakkam 603102 (India); Murugesan, S.; Dasgupta, Arup [PMG, MMG, IGCAR, Kalpakkam 603102 (India); Jayakumar, T. [MTD, MMG, IGCAR, Kalpakkam 603102 (India)
2015-12-15
Highlights: • Surface modified RAFMS samples were subjected to HDA and thermal oxidation. • Sample modified by SB process showed better coating and interface morphology. • Aluminized samples at 740 °C for 2 min showed Fe{sub 2}Al{sub 9}Si{sub 2} intermetallic phase. • Oxidized samples showed Fe{sub 2}Al{sub 8}Si, Fe{sub 2}Al{sub 3}Si{sub 3} and Fe{sub 3}Al{sub 2}Si{sub 3} intermetallic phases. • A uniform permeation barrier Al{sub 2}O{sub 3} was formed on the coating of oxidized HDA samples. - Abstract: The most optimal candidate material for fabrication of Test Blanket Module (TBM) in the installation of ITER and future fusion reactors is Reduced Activation Ferritic Martensitic (RAFM) steel, yet one of the major challenges that need to be addressed with RAFM is minimizing the loss of tritium in a reactor environment through the formation of tritium permeation barrier. One of the most promising methods for the tritium permeation barrier is through duplex coating with Al{sub 2}O{sub 3}/Fe–Al which is well known to reduce tritium permeation rate by several orders of magnitude. The present work aims to form an alumina layer on RAFM steel by a two-step method, which consists of (i) Hot Dip Aluminizing (HDA) and (ii) conversion of Al into alumina by a subsequent oxidation process. In addition, the influence of surface roughness of the substrate, superheat condition of the Al alloy melt and its composition on microstructural properties of coating before and after oxidation were investigated using OM, SEM–EDS, XRD, indentation micro hardness and scratch test. The experimental results confirmed the formation of alumina layer on RAFM steel after the HDA and oxidation process. Moreover, the surface roughness of the substrate, melt superheat of Al alloy and its composition are found to have a significant influence on the microstructure, thickness, micro-hardness, nature of intermetallic compounds formed and adhesion strength of the coating.
Steven johnsons syndrome and toxic epidermal necrolysis: A review
Directory of Open Access Journals (Sweden)
Sri ram Anne
2014-12-01
Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.
Energy Technology Data Exchange (ETDEWEB)
Schweda, Mario; Beck, Tilmann; Singheiser, Lorenz [Forschungszentrum Juelich GmbH (DE). Inst. fuer Energie- und Klimaforschung (IEK), Werkstoffstruktur und Eigenschaften (IEK-2)
2012-01-15
The influence of roughness profile shape, roughness depth, bond coat creep strength and pre-oxidation on the thermal cycling damage evolution and lifetime of a plasma-sprayed ZrO{sub 2} thermal barrier coating system was investigated. A simplified model system was used where FeCrAlY substrates simulated the bond coat. Substrate creep was varied by using the oxide dispersoid strengthened alloy MA956 and the conventional material Fecralloy. Stochastic 3- and periodic 2-dimensional roughness profiles were produced by sand blasting and high speed turning. Damage evolution is significantly influenced by substrate creep with a trend to higher lifetimes for the fast creeping substrate. Pre-oxidation has no influence. Lifetimes of the periodically profiled samples are up to 100 times lower than these of stochastically profiled samples. In the case of periodically profiled samples, the highest lifetime was reached for the highest roughness depth combined with local undercuttings in the roughness profile. For stochastically profiled samples the influence of roughness depth could not be determined due to the wide lifetime scatter. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)
2017-02-01
Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.
Kappus, H; Reinhold, C
1994-04-01
Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.
Gastric luminal epidermal growth factor is affected by diet | Iputo ...
African Journals Online (AJOL)
Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...
Investigating the barriers on media privatization
Directory of Open Access Journals (Sweden)
Roghiyeh Jame
2013-01-01
Full Text Available During the past few years, there has been growing interests in reducing cost of products and services among developing countries. Privatization is believed to be one of the most important techniques to increase relative efficiencies of publically held organizations. In this paper, we study important barriers on privatization of television (TV media industry in Iran. The proposed study of this paper designs and distributes a questionnaire using a sample of 234 out of 600 graduate students who were enrolled in media communication studies and examined six hypotheses based on one-side t-student. The survey considers different factors influencing privatization of TV media industry. The results of the investigation indicate that the cost of TV production, short and long-term investment security, people's interest on investing on TV media industry, building appropriate culture, cultural obstacles and economic barriers influence media privatization, significantly.
Differential Rollover Risk in Vehicle-to-Traffic Barrier Collisions
Gabauer, Douglas J.; Gabler, Hampton C.
2009-01-01
In the roadside safety community, there has been debate over the influence of vehicle and barrier type on rollover rates in traffic barrier crashes. This study investigated rollover rates between sport utility vehicles (SUVs), pickup trucks, and cars in vehicle-traffic barrier crashes and has examined the effect of barrier type on rollover risk for concrete barrier and metal barrier impacts. The analysis included 955 barrier impact cases that were selected from 11-years of in-depth crash data available through the National Automotive Sampling System (NASS) / Crashworthiness Data System (CDS). In real world tow-away level longitudinal barrier collisions, the most important predictors of vehicle rollover were found to be vehicle type and whether the vehicle was tracking prior to barrier impact. Based on binary logistic regression, SUVs were found to have 8 times the risk of rollover as cars in barrier impacts. Although pickups were found to have an increased risk of rollover compared to cars, the risk was not as pronounced as that found for SUVs. This finding has direct implications for the full scale crash testing of longitudinal barriers as the testing procedures have been predicated on the assumption that the pickup truck provides a critical or worst case impact scenario. In towaway crashes, our study does not support the notion that concrete barriers have a higher risk of vehicle rollover than metal beam barriers. PMID:20184839
Morphological response of a barrier island system on a catastrophic event
DEFF Research Database (Denmark)
Fruergaard, Mikkel; Kroon, Aart
2016-01-01
storms are capable of moving large amounts of sediments over relatively short time-periods and can create barrier shoals, whereas moderate storms mostly rework the shoal or barrier and create more local erosion and/or landward migration. Catastrophic storms substantially influence long-term and large...
Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.
Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira
2012-03-01
As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.
Demir, K. Çinar; Kurudirek, S. V.; Oz, S.; Biber, M.; Aydoğan, Ş.; Şahin, Y.; Coşkun, C.
We fabricated 25 Au/n-GaP/Al Schottky devices and investigated the influence of high electron irradiation, which has 12MeV on the devices, at room temperature. The X-ray diffraction patterns, scanning electron microscopic images and Raman spectra of a gallium phosphide (GaP) semiconductor before and after electron irradiation have been analyzed. Furthermore, some electrical measurements of the devices were carried out through the current-voltage (I-V) and capacitance-voltage (C-V) measurements. From the I-V characteristics, experimental ideality factor n and barrier height Φ values of these Schottky diodes have been determined before and after irradiation, respectively. The results have also been analyzed statically, and a gauss distribution has been obtained. The built-in potential Vbi, barrier height Φ, Fermi level EF and donor concentration Nd values have been determined from the reverse bias C-V and C-2-V curves of Au/n-GaP/Al Schottky barrier diodes at 100kHz before and after 12MeV electron irradiation. Furthermore, we obtained the series resistance values of Au/n-GaP/Al Schottky barrier diodes with the help of different methods. Experimental results confirmed that the electrical characterization of the device changed with the electron irradiation.
Expression and analysis of exogenous proteins in epidermal cells.
Dagnino, Lina; Ho, Ernest; Chang, Wing Y
2010-01-01
In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.
"Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.
Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu
2015-11-04
Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Zhou, F.S.; Andersen, C.H.; Burhenne, K.
2000-01-01
We propose a model for activation of the epidermal cell hypersensitive response (HR) in the barley/powdery mildew interaction. The model suggests that the plasma membrane proton pump (H+-ATPase) of epidermal cells is activated following penetration by an avirulent powdery mildew fungus...... in the incompatible interaction; (4) race-specific proton extrusion is observed underneath epidermal tissue detached from leaves inoculated 15 h earlier; and (5) treatment of leaves with fusicoccin, an activator of the plasma membrane H+-ATPase, increases the number of HR-cells in the compatible interaction........ This will cause an acidification of the apoplast towards the mesophyll cells, thereby activating generation of H2O2 from the mesophyll, which subsequently triggers the epidermal cell to undergo HR. The model is supported by the following data: (1) the earliest HR-related H2O2 is found in the attachment zones...
The time of simultaneous tunneling of identical particles through the rectangular quantum barrier
International Nuclear Information System (INIS)
Martsenyuk, L.S.; Omelchenko, S.A.
2010-01-01
Work is devoted to studying the influence of exchange processes on a time of simultaneous crossing by identical particles of a rectangular quantum barrier. It is shown, that such processes essentially influence on the parameters of tunneling. The size of addition to time of identical particles tunneling, arising up because of their exchange interaction in a field of a rectangular quantum barrier is first counted.
Vissers, W.H.P.M.; Muys, L.; Erp, P.E.J. van; Jong, E.M.G.J. de; Kerkhof, P.C.M. van de
2004-01-01
Inflammatory linear verrucous epidermal nevus (ILVEN) is a rare skin disorder with a clinical and histological resemblance to psoriasis. In the past clinical and histological criteria have been defined. However, there remains a discussion as to whether ILVEN is a disease entity distinct from linear
Amplification of epidermal growth factor receptor gene in renal cell carcinoma
DEFF Research Database (Denmark)
El-Hariry, Iman; Powles, Thomas; Lau, Mike R
2010-01-01
Expression of epidermal growth factor receptor (EGFR) may be of prognostic value in renal cell cancer (RCC). Gene amplification of EGFR was investigated in a cohort of 315 patients with advanced RCC from a previously reported randomised study. Using fluorescent in situ hybridisation, only 2...
Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi
2011-09-01
Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.
Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.
Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F
2005-09-15
Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.
International Nuclear Information System (INIS)
Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.
1996-01-01
UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1984-01-01
The effect of VIP and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands was investigated in the rat. Vasoactive intestinal polypeptide infused in doses of 10 and 100 ng/kg/h significantly increased epidermal growth factor and bicarbonate output......, but the concentrations did not change. Somatostatin infused at doses of 1, 10, 100 and 1000 ng/kg/h against a background of VIP 100 ng/kg/h inhibited in dose-dependent fashion the stimulated epidermal growth factor and bicarbonate outputs from rat Brunner's gland pouches. Also basal secretion was inhibited...... growth factor and bicarbonate from Brunner's glands, an effect which is inhibited by somatostatin. A possible role for somatostatin in the control of Brunner's gland secretion is suggested....
Motivators and barriers for paediatricians discharging patients.
Turbitt, Erin; Kunin, Marina; Gafforini, Sarah; Freed, Gary L
2017-07-01
The aim of this study was to identify motivators and barriers that paediatricians face when discharging patients from outpatient specialty care. A questionnaire was administered to outpatient care paediatricians in Victoria working in one of five speciality public hospital clinics. Questions focused on how important various motivators and barriers were in respondents' decision to discharge a patient from their clinic. Nearly all (91%, n=74) paediatricians invited to participate provided responses. The factor influencing the greatest proportion of paediatricians in their decision to discharge patients back to primary care was the potential that patients may not receive the required care from a GP. The next most highly rated barrier was that it is too complicated to arrange discharge; rated as a very important influence by one-third of paediatricians (33%, n=24). Improvements to the discharge process may encourage more paediatricians to discharge patients back to their GP, therefore freeing up appointment slots. This in turn could reduce waiting times for paediatric outpatient clinics in Victoria. The concern from paediatricians that patients may not receive the required care from a GP warrants attention and should be further investigated.
Renal content and output of epidermal growth factor in long-term adrenergic agonist-treated rats
DEFF Research Database (Denmark)
Thulesen, J; Nexø, Ebba; Poulsen, Steen Seier
2000-01-01
This study investigates the renal and urinary levels of epidermal growth factor (EGF) in rats under long-term treatment with alpha- or beta-adrenergic agonists. Urine samples were obtained on days 7, 14 and 21, and renal tissue samples on day 21. EGF was quantified by ELISA and tissue sections were...... material in the distal tubules. Concomitantly, reduced levels of EGF and EGF mRNA were observed, and also the urinary levels of EGF were reduced. Together, these observations indicate alpha-adrenergic treatment to affect the distal tubules. Treatment with the beta-adrenergic agonist did not change...... fractional kidney weight, but initially the urinary excretion of EGF was reduced. The data add further evidence to the suggestion that activity of the sympathetic nervous system influences renal homeostasis of EGF, either directly or indirectly through renal histopathological changes....
γδ T cells in homeostasis and host defence of epithelial barrier tissues.
Nielsen, Morten M; Witherden, Deborah A; Havran, Wendy L
2017-12-01
Epithelial surfaces line the body and provide a crucial interface between the body and the external environment. Tissue-resident epithelial γδ T cells represent a major T cell population in the epithelial tissues and are ideally positioned to carry out barrier surveillance and aid in tissue homeostasis and repair. In this Review, we focus on the intraepithelial γδ T cell compartment of the two largest epithelial tissues in the body - namely, the epidermis and the intestine - and provide a comprehensive overview of the crucial contributions of intraepithelial γδ T cells to tissue integrity and repair, host homeostasis and protection in the context of the symbiotic relationship with the microbiome and during pathogen clearance. Finally, we describe epithelium-specific butyrophilin-like molecules and briefly review their emerging role in selectively shaping and regulating epidermal and intestinal γδ T cell repertoires.
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...
Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.
von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J
2017-11-06
The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Osamu Natsume
2018-01-01
Full Text Available Therapeutic strategy in late 20th century to prevent allergic diseases was derived from a conceptual framework of allergens elimination which was as same as that of coping with them after their onset. Manifold trials were implemented; however, most of them failed to verify the effectiveness of their preventive measures. Recent advancement of epidemiological studies and cutaneous biology revealed epidermal barrier dysfunction plays a major role of allergen sensitization and development of atopic dermatitis which ignites the inception of allergy march. For this decade, therapeutic strategy to prevent the development of food allergy has been confronted with a paradigm shift from avoidance and delayed introduction of allergenic foods based on the theoretical concept to early introduction of them based on the clinical and epidemiological evidences. Especially, prevention of peanut allergy and egg allergy has been established with the highest evidence verified by randomized controlled trials, although application in clinical practice should be done with attention. This paradigm shift concerning food allergy was also due to the discovery of cutaneous sensitization risk of food allergens for an infant with eczema revealed by prospective studies. Here we have recognized the increased importance of prevention of eczema/atopic dermatitis in infancy. Two randomized controlled trials using emollients showed successful results in prevention of atopic dermatitis in infancy; however, longer term safety and prognosis including allergy march should be pursued. To establish more fundamental strategy for prevention of the development of allergy, further studies clarifying the mechanisms of interaction between barrier dysfunction and microbial milieu are needed with macroscope to understand the relationship between allergic diseases and a diversity of environmental influences.
Fusion and particle transfer around the Coulomb-Barrier in intermediate systems
International Nuclear Information System (INIS)
Pascholati, P.R.
1989-01-01
The most important characteristics of fusion reactions below and around the Coulomb-barrier are summarized. Experimental fusion cross sections for typical systems are discussed and compared with current formulae obtained from semi-classical and quantum tunneling approaches. The influence of nucleons transfer in the enhancement of the fusion cross section below the Coulomb-barrier is also shown. Sub-barrier fusion cross sections for the systems 35,37 Cl + 58,64 Ni and 33 S + 90,91,92 Zr, and near-barrier cross sections of all important transfer channels have been measured using the XTU-TANDEM at Legnaro, Italy. In 35,37 Cl + 58,64 Ni systems, the motivation further investigated was the influence of the valence proton in the enhancement of the sub-barrier fusion cross section. The data are discussed in comparison with the similar data of 34,36 S + 58,64 Ni with the aim of revealing the influence of coupled proton transfer channels. Calculations were performed using the simplified coupled channel code CCFUS including ''pick-up'' of one and two neutrons and ''stripping'' of two neutrons channels. Signatures of positive Q-values transfer channels coupled to fusion were clearly identified. For the 33 S + 90,91,92 Zr systems taking into account the coupling effects between transfer and fusion and using the semi-classical approach, transfer form-factors were extracted and succesfully employed to described the isotopic effects in fusion enhancement. (Author) [es
Directory of Open Access Journals (Sweden)
Kai Kretzschmar
2014-10-01
Full Text Available B-lymphocyte-induced nuclear maturation protein 1 (BLIMP1 was previously reported to define a sebaceous gland (SG progenitor population in the epidermis. However, the recent identification of multiple stem cell populations in the hair follicle junctional zone has led us to re-evaluate its function. We show, in agreement with previous studies, that BLIMP1 is expressed by postmitotic, terminally differentiated epidermal cells within the SG, interfollicular epidermis, and hair follicle. Epidermal overexpression of c-Myc results in loss of BLIMP1+ cells, an effect modulated by androgen signaling. Epidermal-specific deletion of Blimp1 causes multiple differentiation defects in the epidermis in addition to SG enlargement. In culture, BLIMP1+ sebocytes have no greater clonogenic potential than BLIMP1− sebocytes. Finally, lineage-tracing experiments reveal that, under steady-state conditions, BLIMP1-expressing cells do not divide. Thus, rather than defining a sebocyte progenitor population, BLIMP1 functions in terminally differentiated cells to maintain homeostasis in multiple epidermal compartments.
Directory of Open Access Journals (Sweden)
Simon Krabbe
2016-01-01
Full Text Available This case report describes a patient with arthritis of the large joints, bilateral sacroiliitis, and positive anti-SSA and anti-dsDNA antibody, who received sulfasalazine and shortly thereafter became critically ill. He developed toxic epidermal necrolysis, hemolytic anemia, lymphopenia, markedly elevated ferritin, and muscle wasting. A diagnosis of systemic lupus erythematosus was made, and mycophenolate mofetil and systemic glucocorticoids brought this severe disease under control. Toxic epidermal necrolysis-like lesions and hemophagocytic syndrome have been reported as manifestations of systemic lupus erythematosus. This patient possibly had spondyloarthritis or an undifferentiated connective tissue disease at presentation, and we suggest, based on the timing of events, that sulfasalazine may have acted as a trigger of the severe disease manifestations.
Epidermal electronics with advanced capabilities in near-field communication.
Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A
2015-02-25
Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Toxic epidermal necrolysis due to concomitant use of lamotrigine and valproic acid
Directory of Open Access Journals (Sweden)
Sukhjot Kaur
2013-01-01
Full Text Available Anti-epileptic drugs can be associated with a wide spectrum of cutaneous adverse reactions ranging from simple maculopapular rashes to more severe and life threatening reactions like Stevens-Johnson syndrome and toxic epidermal necrolysis. These rashes are well documented with older antiepileptic drugs like phenytoin, phenobarbitone and carbamazapine. Lamotrigine is a newer, unrelated antiepileptic drug that causes skin rashes in 3-10% of new users. Higher starting dose or rapid escalation, concurrent treatment with valproic acid, and a previous history of a rash with other antiepileptic drugs are well recognized risk factors for lamotrigine related serious rashes. We report two patients with toxic epidermal necrolysis, resulting from concomitant use of lamotrigine and valproic acid. It is emphasized that clinicians adhere to the recommended dosage guidelines and adopt a slow dose titration when initiating treatment with lamotrigine.
Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells
International Nuclear Information System (INIS)
Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook
2011-01-01
Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.
Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors
International Nuclear Information System (INIS)
Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili
2013-01-01
High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors
Visual selective attention with virtual barriers.
Schneider, Darryl W
2017-07-01
Previous studies have shown that interference effects in the flanker task are reduced when physical barriers (e.g., hands) are placed around rather than below a target flanked by distractors. One explanation of this finding is the referential coding hypothesis, whereby the barriers serve as reference objects for allocating attention. In five experiments, the generality of the referential coding hypothesis was tested by investigating whether interference effects are modulated by the placement of virtual barriers (e.g., parentheses). Modulation of flanker interference was found only when target and distractors differed in size and the virtual barriers were beveled wood-grain objects. Under these conditions and those of previous studies, the author conjectures that an impression of depth was produced when the barriers were around the target, such that the target was perceived to be on a different depth plane than the distractors. Perception of depth in the stimulus display might have led to referential coding of the stimuli in three-dimensional (3-D) space, influencing the allocation of attention beyond the horizontal and vertical dimensions. This 3-D referential coding hypothesis is consistent with research on selective attention in 3-D space that shows flanker interference is reduced when target and distractors are separated in depth.
Strong association of epidermal growth factor receptor status with breast cancer FDG uptake
Energy Technology Data Exchange (ETDEWEB)
Lee, Joohee; Moon, Seung Hwan; Hyun, Seung Hyup; Cho, Young Seok; Choi, Joon Young; Kim, Byung-Tae; Lee, Kyung-Han [Sungkyunkwan University School of Medicine, Department of Nuclear Medicine, Samsung Medical Center, Seoul (Korea, Republic of); Lee, Eun Jeong [Seoul Medical Center, Department of Nuclear Medicine, Seoul (Korea, Republic of); Kim, Seokhwi [Sungkyunkwan University School of Medicine, Department of Pathology, Samsung Medical Center, Seoul (Korea, Republic of)
2017-08-15
Imaging tumor FDG uptake could complement breast cancer biomarkers of risk and treatment response. Although breast cancer FDG uptake is reputedly influenced by major biomarker states, the role of epidermal growth factor receptor (EGFR) expression remains largely unexplored. This is a retrospective study that included 499 patients with primary breast cancer at initial presentation. Tumor FDG uptake was measured on pretreatment PET/CT as maximum standardized uptake value (SUVmax), and biomarkers were assessed by immunohistochemistry of tumor tissue. Regression analysis was performed for predictors of high tumor FDG uptake (SUVmax ≥ 8.6). SUVmax was higher in ER- (36.5%; 11.2 ± 6.0 vs. 8.3 ± 5.3), PR- (42.3%; 10.9 ± 6.0 vs. 8.2 ± 5.2), and triple-negative tumors (19.8%; 12.0 ± 6.9 vs. 8.7 ± 5.2; all p < 0.0001). EGFR expression (28.5%) was more frequent in ER-, PR-, triple-negative, cytokeratin 5/6 (CK5/6) + and mutant P53 (mP53) + tumors (all p < 0.0001). EGFR+ was associated with higher SUVmax among all tumors (11.9 ± 6.0 vs. 8.3 ± 5.3), ER- tumors (p < 0.0001), PR- and + tumors (p < 0.0001 and 0.027), hormone receptor- and + tumors (p < 0.0001 and 0.004), human epidermal growth factor receptor 2 (HER2)- and + tumors (p < 0.0001 and 0.006), non-triple negative tumors (p < 0.0001), CK5/6- and + tumors (p = 0.021 and <0.0001), and mP53- and + tumors (p < 0.0001 and 0.008). Tumors had high FDG uptake in 73.2% of EGFR+ and 40.6% of EGFR- tumors. On regression analysis, significant multivariate predictors of high tumor FDG uptake were large size, EGFR+ and CK5/6+ for the entire subjects, and EGFR+ and CK5/6+ for ER- and hormone receptor negative subgroups. High FDG uptake was able to sub-stratify EGFR+ tumors that were more likely to be ER- and CK5/6+, and EGFR- tumors more likely to be mP53 +. Primary breast tumor FDG uptake is strongly influenced by EGFR status beyond that by other major biomarkers including hormone receptor and HER2 status, and EGFR
McInnes, Susan; Peters, Kath; Bonney, Andrew; Halcomb, Elizabeth
2015-09-01
To identify facilitators and barriers influencing collaboration and teamwork between general practitioners and nurses working in general (family) practice. Internationally, a shortage of doctors entering and remaining in general practice and an increasing burden of chronic disease has diversified the nurse's role in this setting. Despite a well-established general practice nursing workforce, little attention has been paid to the ways doctors and nurses collaborate in this setting. Integrative literature review. CINAHL, Scopus, Web of Life, Cochrane Library, Joanna Briggs Institute Library of Systematic Reviews and Trove (dissertation and theses) were searched for papers published between 2000 and May 2014. This review was informed by the approach of Whittemore and Knafl (2005). All included papers were assessed for methodological quality. Findings were extracted, critically examined and grouped into themes. Eleven papers met the inclusion criteria. Thematic analysis revealed three themes common to the facilitators of and barriers to collaboration and teamwork between GPs in general practice: (1) roles and responsibilities; (2) respect, trust and communication; and (3) hierarchy, education and liability. This integrative review has provided insight into issues around role definition, communication and organizational constraints which influence the way nurses and general practitioners collaborate in a team environment. Future research should investigate in more detail the ways doctors and nurses work together in general practice and the impact of collaboration on nursing leadership and staff retention. © 2015 John Wiley & Sons Ltd.
Turnover of pigment granules: cyclic catabolism and anabolism of ommochromes within epidermal cells.
Insausti, T C; Casas, J
2009-12-01
Ommochromes are end products of the tryptophan metabolism in arthropods. While the anabolism of ommochromes has been well studied, the catabolism is totally unknown. In order to study it, we used the crab-spider Misumena vatia, which is able to change color reversibly in a few days, from yellow to white and back. Ommochromes is the only pigment class responsible for the body coloration in this animal. The aim of this study was to analyze the fine structure of the epidermal cells in bleaching spiders, in an attempt to correlate morphological changes with the fate of the pigment granules. Central to the process of bleaching is the lysis of the ommochrome granules. In the same cell, intact granules and granules in different degradation stages are found. The degradation begins with granule autolysis. Some components are extruded in the extracellular space and others are recycled via autophagy. Abundant glycogen appears associated to granulolysis. In a later stage of bleaching, ommochrome progranules, typical of white spiders, appear in the distal zone of the same epidermal cell. Catabolism and anabolism of pigment granules thus take place simultaneously in spider epidermal cells. A cyclic pathway of pigment granules formation and degradation, throughout a complete cycle of color change is proposed, together with an explanation for this turnover, involving photoprotection against UV by ommochromes metabolites. The presence of this turnover for melanins is discussed.
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.
Directory of Open Access Journals (Sweden)
Aleksandra Piwko-Czuchra
Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.
The role of deep level traps in barrier height of 4H-SiC Schottky diode
Energy Technology Data Exchange (ETDEWEB)
Zaremba, G., E-mail: gzaremba@ite.waw.pl [Institute of Electron Technology, Al. Lotnikow 32/46, 02-668 Warsaw (Poland); Adamus, Z. [Institute of Physics, Polish Academy of Sciences, Al. Lotnikow 32/46, 02-668 Warsaw (Poland); Jung, W.; Kaminska, E.; Borysiewicz, M.A.; Korwin-Mikke, K. [Institute of Electron Technology, Al. Lotnikow 32/46, 02-668 Warsaw (Poland)
2012-09-01
This paper presents a discussion about the influence of deep level defects on the height of Ni-Si based Schottky barriers to 4H-SiC. The defects were characterized by deep level transient spectroscopy (DLTS) in a wide range of temperatures (78-750 K). The numerical simulation of barrier height value as a function of dominant defect concentration was carried out to estimate concentration, necessary to 'pin' Fermi level and thus significantly influence the barrier height. From comparison of the results of simulation with barrier height values obtained by capacitance-voltage (C-V) measurements it seems that dominant defect in measured concentration has a very small impact on the barrier height and on the increase of reverse current.
Wu, Jia; Zhang, Wei; Xu, Aiqiang; Zhang, Li; Yan, Tao; Li, Zhuo; Wu, Xiaopan; Zhu, Xilin; Ma, Juan; Li, Ke; Li, Hui; Liu, Ying
2013-08-01
Hepatocellular carcinoma (HCC) is a common solid malignant tumor occurring worldwide that leads to the third largest cause of death compared to other cancers. Genetic and environmental factors are involved in the pathogenesis of HCC. Epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) can stimulate the proliferation of epidermal and epithelial cells. The EGF signal pathway has a relationship with the growth of the embryo, tissue repairing, and tumorigenesis. In this study, 416 patients with hepatitis B virus infection (HBV)-related HCC and 645 individuals who had never been infected with HBV of the Chinese Han population were enrolled. Eight single-nucleotide polymorphisms (SNPs), whose minor allele frequency >20% in the EGF and EGFR genes, were genotyped to examine their associations with hepatocarcinogenesis. Genotyping experiments were carried out using TaqMan. There were significant differences in genotype distributions (p=0.005) and allele frequencies (p=0.001, odds ratio [OR]=1.43, 95% confidence interval [CI]=1.15-1.79) of rs11569017 in the EGF gene between the HCC and control groups. After binary logistic regression to determine independent factors for susceptibility to HCC under an additive model, rs11569017 was still independently associated with the susceptibility to HCC (p=0.021, OR=1.48, 95% CI=1.06-2.07), but no significant differences in other SNPs were found. Additionally, the haplotype T-G constructed by rs11569017 and rs4444903 of the EGF gene might increase the risk of HBV-related HCC (p=0.002, OR=1.44, 95% CI=1.15-1.82). The rs11569017 T allele was associated with susceptibility to HBV-related HCC.
Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M
2007-02-01
Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.
STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT
Directory of Open Access Journals (Sweden)
V.F. Zhernosek
2011-01-01
Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.
Directory of Open Access Journals (Sweden)
V. D. El'kin
2017-01-01
Full Text Available We present a clinical case of ichthyosis hystrix, a rare genetic ichthyosiform dermatosis. Specifics of the disease are related to the complexity of differential diagnosis and verification of the diagnosis, because clinical manifestation of ichthyosis hystrix is similar with that of verrucous epidermal nevus. Clinical particulars of both nosologies are characterized by bizarre and widespread skin lesions of spicular hyperkeratotic growth, located along Blaschko lines. The exclusive feature of the clinical case described is a long-term (20 years clinical and laboratory monitoring of the patient. The literature review provides brief information on etiology, pathogenesis, clinical features, differential diagnosis, and pathomorphology of ichthyosis hystrix and verrucous epidermal nevus.
Barriers to colorectal cancer screening in community health centers: A qualitative study
Directory of Open Access Journals (Sweden)
Fletcher Robert H
2008-02-01
Full Text Available Abstract Background Colorectal cancer screening rates are low among disadvantaged patients; few studies have explored barriers to screening in community health centers. The purpose of this study was to describe barriers to/facilitators of colorectal cancer screening among diverse patients served by community health centers. Methods We identified twenty-three outpatients who were eligible for colorectal cancer screening and their 10 primary care physicians. Using in-depth semi-structured interviews, we asked patients to describe factors influencing their screening decisions. For each unscreened patient, we asked his or her physician to describe barriers to screening. We conducted patient interviews in English (n = 8, Spanish (n = 2, Portuguese (n = 5, Portuguese Creole (n = 1, and Haitian Creole (n = 7. We audiotaped and transcribed the interviews, and then identified major themes in the interviews. Results Four themes emerged: 1 Unscreened patients cited lack of trust in doctors as a barrier to screening whereas few physicians identified this barrier; 2 Unscreened patients identified lack of symptoms as the reason they had not been screened; 3 A doctor's recommendation, or lack thereof, significantly influenced patients' decisions to be screened; 4 Patients, but not their physicians, cited fatalistic views about cancer as a barrier. Conversely, physicians identified competing priorities, such as psychosocial stressors or comorbid medical illness, as barriers to screening. In this culturally diverse group of patients seen at community health centers, similar barriers to screening were reported by patients of different backgrounds, but physicians perceived other factors as more important. Conclusion Further study of these barriers is warranted.
Passeri, Davina L.; Long, Joseph W.; Plant, Nathaniel G.; Bilskie, Matthew V.; Hagen, Scott C.
2018-01-01
Variations in bed friction due to land cover type have the potential to influence morphologic change during storm events; the importance of these variations can be studied through numerical simulation and experimentation at locations with sufficient observational data to initialize realistic scenarios, evaluate model accuracy and guide interpretations. Two-dimensional in the horizontal plane (2DH) morphodynamic (XBeach) simulations were conducted to assess morphodynamic sensitivity to spatially varying bed friction at Dauphin Island, AL using hurricanes Ivan (2004) and Katrina (2005) as experimental test cases. For each storm, three bed friction scenarios were simulated: (1) a constant Chezy coefficient across land and water, (2) a constant Chezy coefficient across land and depth-dependent Chezy coefficients across water, and (3) spatially varying Chezy coefficients across land based on land use/land cover (LULC) data and depth-dependent Chezy coefficients across water. Modeled post-storm bed elevations were compared qualitatively and quantitatively with post-storm lidar data. Results showed that implementing spatially varying bed friction influenced the ability of XBeach to accurately simulate morphologic change during both storms. Accounting for frictional effects due to large-scale variations in vegetation and development reduced cross-barrier sediment transport and captured overwash and breaching more accurately. Model output from the spatially varying friction scenarios was used to examine the need for an existing sediment transport limiter, the influence of pre-storm topography and the effects of water level gradients on storm-driven morphodynamics.
Local Variability of the Peierls Barrier of Screw Dislocations in Ta-10W.
Energy Technology Data Exchange (ETDEWEB)
Foiles, Stephen M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2017-10-01
It is well know that the addition of substitutional elements changes the mechanical behavior of metals, a effect referred to solid solution hardening. For body-centered-cubic (BCC) metals, screw dislocation play a key role in the mechanical properties. Here the detailed modification of the Peierls barrier for screw dislocation motion in Ta with W substitutional atoms is computing using density functional theory (DFT). A reduced order model (ROM) of the influence of W substitution on the Peierls barrier is developed. The mean field change in the Peierls barrier for a Ta10W alloy is determined and shown to be larger than anticipated based on simple elasticity considerations. The ROM could be used in future calculations to determine the local variability of the Peierls barrier and the resultant influence on the motion of screw dislocation in this alloy.
Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas
2013-01-01
Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.
Rostad, Whitney L; Moreland, Angela D; Valle, Linda Anne; Chaffin, Mark J
2018-04-01
Families experiencing child maltreatment or risk factors for child maltreatment often receive referrals to interventions focused on changing parenting practices. Compliance with specific parenting programs can be challenging as many of the stressors that place families at-risk may also interfere with program participation. Because families may receive limited benefit from programs they do not fully receive, it is critical to understand the relationship between parenting stress and barriers to program completion. We used structural equation modeling to examine the relationship among parenting stress, perceived barriers to program participation, and program completion in two datasets involving low-income parents. Data were collected at two time points from a sample of parents involved with child welfare services and a sample of parents considered at-risk of future involvement (total study n = 803). Direct paths from parenting stress at time 1 to barriers to participation and parenting stress at time 2, and from parenting stress at time 2 to program completion were significant. Interestingly, increased barriers to participation were related to increased parenting stress at time 2, and greater parenting stress was related to increased program completion. Results suggest that with increasing levels of parenting stress, parents have an increased likelihood of completing the program. Assessing and addressing the influence of perceived barriers and parenting stress on program participation may decrease the likelihood of treatment attrition.
Directory of Open Access Journals (Sweden)
Victor Paromov
2011-01-01
Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.
Perceived Barriers in Accessing the Reproductive Health Care Services in Odisha
Directory of Open Access Journals (Sweden)
Madhulika Sahoo
2017-09-01
Full Text Available Background: The utilization of Reproductive, Maternal, and Newborn and Child health (RMNCH services is often influenced by the socio-cultural, financial, access, political barriers acting at the community, family and individual level. Yet, very little attention has been given, either by policy makers or researchers for minimizing their effect. Aim and objective: To examine the demand and supply side barriers in accessing the maternity services and to understand the perception on maternal healthcare services. Material & Methods: The study was carried out in four districts of Odisha state, with a well representative sample of 1194 women, who delivered a child in last 2 years. Quantitative and qualitative study design was followed to collect the data. Results: The supply side barriers such as physical access and facilities were faced by the service providers. The demand side barriers such as socio-cultural, financial and access barriers were faced by the service receivers in order to avail the services. Conclusions: In order to overcome the barriers faced by the women of Odisha it is important to improve the access to services so that they get them easily. Some of the imperative actions such as strengthening community mobilization through inter-personal communication, dialogue with the key influencers in the community as well as continuous engagement with and sensitization of the service providers
Perceived Barriers in Accessing the Reproductive Health Care Services in Odisha
Directory of Open Access Journals (Sweden)
Madhulika Sahoo
2017-09-01
Full Text Available Background: The utilization of Reproductive, Maternal, and Newborn and Child health (RMNCH services is often influenced by the socio-cultural, financial, access, political barriers acting at the community, family and individual level. Yet, very little attention has been given, either by policy makers or researchers for minimizing their effect. Aim and objective: To examine the demand and supply side barriers in accessing the maternity services and to understand the perception on maternal healthcare services. Material & Methods: The study was carried out in four districts of Odisha state, with a well representative sample of 1194 women, who delivered a child in last 2 years. Quantitative and qualitative study design was followed to collect the data. Results: The supply side barriers such as physical access and facilities were faced by the service providers. The demand side barriers such as socio-cultural, financial and access barriers were faced by the service receivers in order to avail the services. Conclusions: In order to overcome the barriers faced by the women of Odisha it is important to improve the access to services so that they get them easily. Some of the imperative actions such as strengthening community mobilization through inter-personal communication, dialogue with the key influencers in the community as well as continuous engagement with and sensitization of the service providers
Epidermal stem cells response to radiative genotoxic stress
International Nuclear Information System (INIS)
Marie, Melanie
2013-01-01
Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global
Directory of Open Access Journals (Sweden)
Michelle T Juarez
2011-12-01
Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating
Fission barriers within the liquid drop model with the surface-curvature term
International Nuclear Information System (INIS)
Pomorski, K.; Dudek, J.
2004-01-01
The recently revised liquid drop model (PRC 67(2003) 044316) containing the curvature term reproduces the masses of 2766 experimentally known isotopes having Z≥8 and N≥8 with the r.m.s. deviation equal to 0.698 MeV when the microscopic corrections of Moeller et al. is used. The influence of the congruence energy as well as the compression term on the barrier heights is discussed within this new macroscopic model. The r.m.s. deviation of the fission barrier heights of 40 isotopes with Z≥34 is 1.73 MeV only when deformation-dependent congruence energy is included. The effect of the compression term in the liquid drop energy has rather weak influence on the barrier heights. (author)
Performance of intact and partially degraded concrete barriers in limiting fluid flow
International Nuclear Information System (INIS)
Walton, J.C.; Seitz, R.R.
1991-07-01
Concrete barriers will play a critical role in the long-term isolation of low-level radioactive wastes. Over time the barriers will degrade, and in many cases, the fundamental processes controlling performance of the barriers will be different for intact and degraded conditions. This document examines factors controlling fluid flow through intact and degraded concrete disposal facilities. Simplified models are presented fro predicting build up of fluid above a vault; fluid flow through and around intact vaults, through flaws in coatings/liners applied to a vault, and through cracks in a concrete vault; and the influence of different backfill materials around the outside of the vault. Example calculations are presented to illustrate the parameters and processes that influence fluid flow. 46 refs., 49 figs., 2 tabs
Epidermal inclusion cyst in male breast: mammographic and ultrasonographic findings in three cases
International Nuclear Information System (INIS)
Cubells, M.; Gil de Ramales, V.; Bulto, J. A.; Morcillo, E.; Celma, J.
2000-01-01
Three cases of histologically diagnosed epidermal inclusion cysts in male breast are presented. This is a very uncommon condition that results from the inclusion of epidermal remnants beneath the skin, which form a keratin-filled cystic cavity. The clinical presentation is that of palpable breast masses showing medium-to-high density in mammography. They are well defined and do not present calcifications. Ultrasound discloses their cystic form, with moderate posterior reinforcement, although they do not appear as anechoic cysts. Characteristically, echoes are detected in the interior that correspond to the degeneration keratin. The differential diagnosis should include cysts complicated by infection or hemorrhage, fibroadenomas with low echogenicity and even tumors of neoplastic origin. Color Doppler ultrasound disclosed the absence of internal vascularisation, a circumstance that indicated the benignity of the lesion. (Author) 9 refs
Ocean barrier layers' effect on tropical cyclone intensification.
Balaguru, Karthik; Chang, Ping; Saravanan, R; Leung, L Ruby; Xu, Zhao; Li, Mingkui; Hsieh, Jen-Shan
2012-09-04
Improving a tropical cyclone's forecast and mitigating its destructive potential requires knowledge of various environmental factors that influence the cyclone's path and intensity. Herein, using a combination of observations and model simulations, we systematically demonstrate that tropical cyclone intensification is significantly affected by salinity-induced barrier layers, which are "quasi-permanent" features in the upper tropical oceans. When tropical cyclones pass over regions with barrier layers, the increased stratification and stability within the layer reduce storm-induced vertical mixing and sea surface temperature cooling. This causes an increase in enthalpy flux from the ocean to the atmosphere and, consequently, an intensification of tropical cyclones. On average, the tropical cyclone intensification rate is nearly 50% higher over regions with barrier layers, compared to regions without. Our finding, which underscores the importance of observing not only the upper-ocean thermal structure but also the salinity structure in deep tropical barrier layer regions, may be a key to more skillful predictions of tropical cyclone intensities through improved ocean state estimates and simulations of barrier layer processes. As the hydrological cycle responds to global warming, any associated changes in the barrier layer distribution must be considered in projecting future tropical cyclone activity.
Guided bone regeneration : the influence of barrier membranes on bone grafts and bone defects
Gielkens, Pepijn Frans Marie
2008-01-01
Guided bone regeneration (GBR) can be described as the use of a barrier membrane to provide a space available for new bone formation in a bony defect. The barrier membrane protects the defect from in-growth of soft tissue cells and allows bone progenitor cells to develop bone within a blood clot
Antimicrobial susceptibility of Staphylococcus hyicus Isolated from exudative epidermitis in pigs
DEFF Research Database (Denmark)
Wegener, Henrik Caspar; Watts, J.L.; Salmon, S.A.
1994-01-01
for their activities against 100 S. hyicus strains isolated from pigs with exudative epidermitis. Novobiocin was the most active compound tested, with an MIC for 90% of the strains tested (MIC(90)) of less than or equal to 0.06 mu g/ml. Enrofloxacin, ampicillin, and ceftiofur were the next most active compounds...
International Nuclear Information System (INIS)
Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.
1991-01-01
Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent
Gu, Yang; Zhang, Gang; Lin, Mei
2008-02-01
To examine the change of epidermal growth factor (EGF) concentration in saliva of recurrent aphthous ulcer (RAU) patients during the ulcerous and interval period and epidermal growth factor receptor (EGFR) in ulcer biopsy samples. ECF data of the samples, which were 27 saliva samples from RAU gained not only in the ulcerous period but also in interval period and 33 ones from normal persons, were acquired through enzyme linked immunosorhent assay (ELISA) and EGF standard curve. ECFR-RNA date of RAU biopsies, which were 31 biopsy samples from RAU got during the ulcerous period and 35 ones from normal persons, were surveyed by QF-RT-PCR. All RAU samples were obtained under the same level, which were the whole patients were minor aphthous ulcers and their ulcers occurred not over the first four days. All patients and normal persons were selected seriously under the rule of physical situations without any other diseases and histories of using medicines. The EGF concentration of saliva in RAU group at ulcer occurrence was higher than that in the interval period and the normal control with a significant test (F = 3.24, P ulcer occurrence was higher than the normal control with a significant test (t = 3.15, P ulcer occasion of RAU patients could be related with the decreasing of EGF in saliva during interval period, and that the ulcer sell-cure of RAU patients would be contributed to
Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H
2017-11-01
Gene co-expression network analysis has been a research method widely used in systematically exploring gene function and interaction. Using the Weighted Gene Co-expression Network Analysis (WGCNA) approach to construct a gene co-expression network using data from a customized 44K microarray transcriptome of chicken epidermal embryogenesis, we have identified two distinct modules that are highly correlated with scale or feather development traits. Signaling pathways related to feather development were enriched in the traditional KEGG pathway analysis and functional terms relating specifically to embryonic epidermal development were also enriched in the Gene Ontology analysis. Significant enrichment annotations were discovered from customized enrichment tools such as Modular Single-Set Enrichment Test (MSET) and Medical Subject Headings (MeSH). Hub genes in both trait-correlated modules showed strong specific functional enrichment toward epidermal development. Also, regulatory elements, such as transcription factors and miRNAs, were targeted in the significant enrichment result. This work highlights the advantage of this methodology for functional prediction of genes not previously associated with scale- and feather trait-related modules.
Directory of Open Access Journals (Sweden)
Eriko Kage-Nakadai
Full Text Available In multicellular organisms, the surface barrier is essential for maintaining the internal environment. In mammals, the barrier is the stratum corneum. Fatty acid transport protein 4 (FATP4 is a key factor involved in forming the stratum corneum barrier. Mice lacking Fatp4 display early neonatal lethality with features such as tight, thick, and shiny skin, and a defective skin barrier. These symptoms are strikingly similar to those of a human skin disease called restrictive dermopathy. FATP4 is a member of the FATP family that possesses acyl-CoA synthetase activity for very long chain fatty acids. How Fatp4 contributes to skin barrier function, however, remains to be elucidated. In the present study, we characterized two Caenorhabditis elegans genes, acs-20 and acs-22, that are homologous to mammalian FATPs. Animals with mutant acs-20 exhibited defects in the cuticle barrier, which normally prevents the penetration of small molecules. acs-20 mutant animals also exhibited abnormalities in the cuticle structure, but not in epidermal cell fate or cell integrity. The acs-22 mutants rarely showed a barrier defect, whereas acs-20;acs-22 double mutants had severely disrupted barrier function. Moreover, the barrier defects of acs-20 and acs-20;acs-22 mutants were rescued by acs-20, acs-22, or human Fatp4 transgenes. We further demonstrated that the incorporation of exogenous very long chain fatty acids into sphingomyelin was reduced in acs-20 and acs-22 mutants. These findings indicate that C. elegans Fatp4 homologue(s have a crucial role in the surface barrier function and this model might be useful for studying the fundamental molecular mechanisms underlying human skin barrier and relevant diseases.
Suppression of surface barriers in superconductors by columnar defects
International Nuclear Information System (INIS)
Koshelev, A. E.; Vinokur, V. M.
2001-01-01
We investigate the influence of columnar defects in layered superconductors on the thermally activated penetration of pancake vortices through the surface barrier. Columnar defects, located near the surface, facilitate penetration of vortices through the surface barrier, by creating ''weak spots,'' through which pancakes can penetrate into the superconductor. Penetration of a pancake mediated by an isolated column, located near the surface, is a two-stage process involving hopping from the surface to the column and the detachment from the column into the bulk; each stage is controlled by its own activation barrier. The resulting effective energy is equal to the maximum of those two barriers. For a given external field there exists an optimum location of the column for which the barriers for the both processes are equal and the reduction of the effective penetration barrier is maximal. At high fields the effective penetration field is approximately 2 times smaller than in unirradiated samples. We also estimate the suppression of the effective penetration field by column clusters. This mechanism provides further reduction of the penetration field at low temperatures
Nicholson, S L; Greig, C A; Sniehotta, F; Johnston, M; Lewis, S J; McMurdo, M E; Johnston, D; Scopes, J; Mead, G E
2017-09-01
Levels of physical activity after stroke are low, despite multiple health benefits. We explored stroke survivors' perceived barriers, motivators, self-efficacy and intention to physical activity. Fifty independently mobile stroke survivors were recruited prior to hospital discharge. Participants rated nine possible motivators and four possible barriers based on the Mutrie Scale, as having 'no influence', 'some influence' or 'a major influence' on physical activity. Participants also rated their self-efficacy and intention to increasing walking. The most common motivator was 'physical activity is good for health' [34 (68%)]. The most common barrier was 'feeling too tired' [24 (48%)]. Intention and self-efficacy were high. Self-efficacy was graded as either 4 or 5 (highly confident) on a five-point scale by [34 (68%)] participants, while 42 (84%) 'strongly agreed' or 'agreed' that they intended to increase their walking. Participants felt capable of increasing physical activity but fatigue was often perceived as a barrier to physical activity. This needs to be considered when encouraging stroke survivors to be more active.
Pediatric Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Halted by Etanercept.
Gavigan, Geneviève M; Kanigsberg, Nordau D; Ramien, Michele L
2018-02-01
We report a case of an 11-year-old female with Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) overlap, most likely triggered by sulfamethoxazole-trimethoprim, who was treated with the combination of methylprednisolone, cyclosporine, and etanercept. Her condition stabilized and her skin involvement did not progress after the addition of etanercept. To our knowledge, this is the first report of etanercept for pediatric SJS/TEN.
Barriers to oral health care amongst different social classes in India.
Garcha, V; Shetiya, S H; Kakodkar, P
2010-09-01
To investigate and compare the influence of social and cultural factors as access barriers to oral health care amongst people from various social classes. A cross sectional survey in Pimpri, was conducted using a pilot tested 15 item-structured, close-ended and self-administered questionnaire. Two hundred and fifty people aged 35-45 years (50 participants each in five social classes as per British Registrar's General classification of occupation) were selected. The chi-square test was applied to check statistical differences between social classes at 5% level of significance. Overall, it was observed that irrespective of the social class difference 88% participants wished to seek only expert/professional advice for the dental treatment. Unavailability of services on Sunday (63%), going to dentist only when in pain (57%), trying self care or home remedy (54%), inadequate government policies (50%), budgetary constraints (40%) were among the major access barriers. Statistically significant difference in the access barriers among the social classes were found related to: Inadequate government policies, budgetary constraints, appointment schedules, far-off located clinics, myths and fear about dental treatment. Social and cultural factors act as access barriers to oral health care and social class differences have a significant influence on the access barriers.
Barriers for the introduction of bioenergy in the Netherlands
International Nuclear Information System (INIS)
Gerlagh, T.; Groenendaal, B.; Van Ree, R.; Dinkelbach, L.; Van Doorn, J.; Hemmes, K.
2000-01-01
The use of biomass for energy in the Netherlands is still limited despite the political incentives to make bio-energy a major source of renewable energy. The hesitation of many stake-holders is due to the limited insight into the potential of biomass in the Netherlands and the presence of numerous other barriers. Availability of biomass, emission regulation and waste treatment regulations are considered important barriers. Analyses of their current state show that these barriers are broadly recognised and possibilities to decrease their impact are present. Some barriers with a minor influence so far will be of increasing importance and could be a threat to the development of bio-energy in future. These are the fast liberalising of the energy market and sustainable energy market, the competition with other renewables and the unclear status of the current technology available. Future research should focus on the possibilities to overcome these new barriers. 5 refs
International Nuclear Information System (INIS)
Gomes, P. R. S.; Lubian, J.; Mendes-Junior, D. R.; Faria, P. N. de; Linares, R.; Sigaud, L.; Rangel, J.; Ferreira, J. L.; Paes, B.; Cardozo, E. N.; Cortes, M. R.; Canto, L. F.; Ermamatov, M. J.; Otomar, D. R.; Ferioli, E.; Lotti, P.; Hussein, M. S.
2016-01-01
We present a brief review of the reaction mechanisms involved in collisions of weakly bound projectiles with tightly bound targets, at near-barrier energies. We discuss systematic behaviors of the data, with emphasis in fusion, breakup, nucleon transfer and elastic scattering. The dependence of the breakup cross section on the charge and mass of the target is discussed, and the influence of the breakup channel on complete fusion is investigated. For this purpose, we compare reduced fusion cross sections with a benchmark universal curve. The behaviors observed in the comparisons are explained in terms of polarization potentials and of nucleon transfer followed by breakup. The influence of the breakup process on elastic scattering is also discussed. Some apparent contradictions between results of different authors are explained and some perspectives of the field are presented. (author)
Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.
Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar
2012-09-01
Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Buch Salomonsen, K.
2000-06-01
The Ph.D. thesis describes the influence from continued expansion of organic farming systems to the potential for energy production from biogas in Denmark. The project analyses the consequence from three categories of barriers: 1) Practical barriers, 2) The attitude of organic farmers, and 3) Agricultural biological problems. Economic and political barriers are not examined. When the barriers can be quantified, they are included in the calculation of the maximum biogas potential. When not, the implications of barriers are expressed qualitatively. It has been a particular goal to provide new information on whether agricultural biological problems are a barrier to biogas production in organic farming systems. One important question in this connection is whether biogas production has a negative influence on the soil carbon content compared to composting. This question is investigated by an experiment. The project is based on technical and natural science disciplines, with an interdisciplinary basis ranging over energy planning, agricultural science, microbiology, and crop, and animal operation. (au)
[The blood-brain barrier in ageing persons].
Haaning, Nina; Damsgaard, Else Marie; Moos, Torben
2018-03-26
Brain capillary endothelial cells (BECs) form the ultra-tight blood-brain barrier (BBB). The permeability of the BBB increases with increasing age and neurovascular and neurodegenerative diseases. Major defects of the BBB can be initiated by increased permeability to plasma proteins in small arteriosclerotic arteries and release of proteins from degenerating neurons into the brain extracellular space. These proteins deposit in perivascular spaces, and subsequently negatively influence the BECs leading to decreased expression of barrier proteins. Detection of BBB defects by the use of non-invasive techniques is relevant for clinical use in settings with advanced age and severe brain disorders.
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
Gibbs, S.; Corsini, E.; Spiekstra, S.W.; Galbiati, V.; Fuchs, H.W.; Degeorge, G.; Troese, M.; Hayden, P.; Deng, W.; Roggen, E.
2013-01-01
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low
Immunohistochemical localisation and developmental aspects of epidermal growth factor in the rat
DEFF Research Database (Denmark)
Raaberg, L; Nexø, E; Damsgaard Mikkelsen, J
1988-01-01
The tissue localisation and time of first appearance of Epidermal Growth Factor (EGF) in the developing rat were investigated by means of immunohistochemistry, radioimmunoassay and radioreceptor assay. In this study we were able to show, that EGF appears prenatally in the lung and the kidney from...
Does epidermal growth factor play a role in the action of sucralfate?
DEFF Research Database (Denmark)
Nexø, Ebba; Poulsen, Steen Seier
1987-01-01
Epidermal growth factor (EGF) is a mitogenic peptide synthesized in the submandibular glands and released in saliva. EGF is able to prevent the development of gastrointestinal ulcers in the rat and to accelerate their healing. The present work was undertaken to examine whether Sucralfate acts via...
Epidermal wound repair is regulated by the planar cell polarity signaling pathway.
Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M
2010-07-20
The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.
Anti-epidermal growth factor receptor skin toxicity: a matter of topical hydration.
Ferrari, Daris; Codecà, Carla; Bocci, Barbara; Crepaldi, Francesca; Violati, Martina; Viale, Giulia; Careri, Carmela; Caldiera, Sarah; Bordin, Veronica; Luciani, Andrea; Zonato, Sabrina; Cassinelli, Gabriela; Foa, Paolo
2016-02-01
Skin toxicity is a frequent complication of anti-epidermal growth factor receptor therapy, which can be an obstacle in maintaining the dose intensity and may negatively impact on the clinical outcome of cancer patients. Skin lesions depend on the disruption of the keratinocyte development pathways and no treatment is clearly effective in resolving the cutaneous alterations frequently found during anti-epidermal growth factor receptor therapy. Among systemic treatments, oral tetracycline proved to be useful in preventing skin manifestations. We describe the case of a patient affected by metastatic colorectal cancer, for whom a combination of chemotherapy and cetuximab was used as second-line treatment. The patient developed a symptomatic papulopustular skin rash that disappeared completely after a twice-daily application of a hydrating and moisturizing cream, mainly consisting of a mixture of paraffin, silicone compounds, and macrogol. The marked cutaneous amelioration allowed the patient to continue cetuximab without any further symptoms and was associated with a partial radiological response.
A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.
Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi
2016-04-01
Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.
Permeability Barrier Generation in the Martian Lithosphere
Schools, Joe; Montési, Laurent
2015-11-01
Permeability barriers develop when a magma produced in the interior of a planet rises into the cooler lithosphere and crystallizes more rapidly than the lithosphere can deform (Sparks and Parmentier, 1991). Crystallization products may then clog the porous network in which melt is propagating, reducing the permeability to almost zero, i.e., forming a permeability barrier. Subsequent melts cannot cross the barrier. Permeability barriers have been useful to explain variations in crustal thickness at mid-ocean ridges on Earth (Magde et al., 1997; Hebert and Montési, 2011; Montési et al., 2011). We explore here under what conditions permeability barriers may form on Mars.We use the MELTS thermodynamic calculator (Ghiorso and Sack, 1995; Ghiorso et al., 2002; Asimow et al., 2004) in conjunction with estimated Martian mantle compositions (Morgan and Anders, 1979; Wänke and Dreibus, 1994; Lodders and Fegley, 1997; Sanloup et al., 1999; Taylor 2013) to model the formation of permeability barriers in the lithosphere of Mars. In order to represent potential past and present conditions of Mars, we vary the lithospheric thickness, mantle potential temperature (heat flux), oxygen fugacity, and water content.Our results show that permeability layers can develop in the thermal boundary layer of the simulated Martian lithosphere if the mantle potential temperature is higher than ~1500°C. The various Martian mantle compositions yield barriers in the same locations, under matching variable conditions. There is no significant difference in barrier location over the range of accepted Martian oxygen fugacity values. Water content is the most significant influence on barrier development as it reduces the temperature of crystallization, allowing melt to rise further into the lithosphere. Our lower temperature and thicker lithosphere model runs, which are likely the most similar to modern Mars, show no permeability barrier generation. Losing the possibility of having a permeability
PRIORITISING LEAN CONSTRUCTION BARRIERS IN UGANDA'S CONSTRUCTION INDUSTRY
Directory of Open Access Journals (Sweden)
Henry Mwanaki Alinaitwe
2009-06-01
Full Text Available Engaging in lean construction efforts could prove to be highly rewarding for building firms in Uganda. However, lean construction is risky and can be disastrous if not properly managed. Lean production efforts in some other countries have not been successful due to the many barriers to its successful implementation. To enable sound lean construction efforts and to increase the chances of success in eliminating waste, a thorough investigation of the barriers is essential. This study presents 31 barriers and investigates their influence (strength on the success of lean construction initiatives. Structured interviews were carried out with technical managers of building firms to assess their perception of the barriers to lean production based on their experience at their firms. The strongest barrier is the provision of inputs exactly when required. Additionally, the barriers were ranked according to the ease of overcoming each. The easiest barrier to overcome is keeping the required items in the right place. Finally, a graphical aid is provided to enable decision makers to concentrate their efforts on the influential (strong, yet easy to overcome barriers. A lack of buildable designs and a participative management style for the workforce are the most important barriers to successful waste reduction in terms of strength and ease of overcoming. On the other hand, a lack of an organisational culture that supports teamwork, a lack of prefabrication and a lack of knowledgeable and skilled workers are regarded as low in strength, and at the same time difficult to overcome.
Sussner, Katarina M; Thompson, Hayley S; Jandorf, Lina; Edwards, Tiffany A; Forman, Andrea; Brown, Karen; Kapil-Pair, Nidhi; Bovbjerg, Dana H; Schwartz, Marc D; Valdimarsdottir, Heiddis B
2009-09-01
Rising health disparities are increasingly evident in relation to use of genetic services (including genetic counseling and testing) for breast cancer risk, with women of African descent less likely to use genetic services compared with Whites. Meanwhile, little is known regarding potential within-group acculturation and psychological differences underlying perceived barriers to genetic testing among women of African descent. Hypothesized contributions of acculturation factors and breast cancer-specific distress to perceived barriers to genetic testing were examined with a statistical analysis of baseline data from 146 women of African descent (56% US born and 44% foreign born) meeting genetic breast cancer risk criteria and participating in a larger longitudinal study that included the opportunity for free genetic counseling and testing. Perceived barriers assessed included: (1) anticipation of negative emotional reactions, (2) stigma, (3) confidentiality concerns, (4) family-related worry, and (5) family-related guilt associated with genetic testing. In multivariate analyses, being foreign born was a significant predictor of anticipated negative emotional reactions about genetic testing (beta=0.26; SE=0.11; p=0.01). Breast cancer-specific distress scores (avoidance symptoms) were positively related to anticipated negative emotional reactions (beta=0.02; SE=0.005; p=barriers to genetic testing among women of African descent. The potential utility of culturally tailored genetic counseling services taking into account such influences and addressing emotional and psychological concerns of women considering genetic testing for breast cancer should be investigated.
Understanding Motivators and Barriers to Physical Activity
Patay, Mary E.; Patton, Kevin; Parker, Melissa; Fahey, Kathleen; Sinclair, Christina
2015-01-01
The purpose of this study was to understand the factors that influence physical activity among year-round residents in an isolated summer resort community. Specifically, we explored the personal, environmental, social, and culture-specific perceived motivators and barriers to physical activity. Participants were formally interviewed about their…
Barriers to care for women with breast cancer symptoms in rural Bangladesh.
Steiness, Heather Story; Villegas-Gold, Michelle; Parveen, Homaira; Ferdousy, Tahmina; Ginsburg, Ophira
2018-05-01
Breast cancer survival rates in lower-income countries like Bangladesh are approximately 50%, versus over 80% in high income countries. Anecdotal reports suggest that, beyond economic and health system barriers, sociocultural factors may influence a woman's care-seeking behavior and resultant early stage diagnoses. To understand these barriers, we conducted 63 interviews (43 women with breast cancer symptoms and 20 men) in Khulna, Bangladesh. We identified socio-cultural barriers like neglect and indifference toward women, women's lack of power to use resources, and reduced support from family due to stigma. Interventions must address these barriers and improve the status of women in Bangladesh.
Influence of Trash-Barriering on Operation of Pumping Station with Wet-Pits
Directory of Open Access Journals (Sweden)
Baoyun Qiu
2014-04-01
Full Text Available Trash racks are set before inlet sumps of a pumping station with wet-pits in order to block trash. The flow fields before and behind the trash rack were numerically simulated and flow fields in the inlet sump were calculated using the simulated velocity distribution of the section behind the trash rack as the inlet boundary condition. Local head loss of trash-barriering increases with the increase of blockage ratio of the trash rack. When waterweeds block upper part of the trash rack, flow pattern behind the trash rack will be extremely turbulent, flow velocity of lower part of inlet section of inlet sump will increase, flow velocity of the upper part will decrease, and even backflow appears, which will deteriorate the flow pattern and increase head loss in the inlet sump. Trash-barriering has little effect on velocity distribution of impeller inlet section. Trash-barriering will not only increase head and power of the pump but also decrease the flow. For the example of the pumping station: when blockage ratios of the trash racks are 0.3, 0.5, and 0.7, operating cost will increase by 13%~43% than that of without trash racks. Therefore, the trash rack should be cleaned up timely.
Injectable barriers for waste isolation
International Nuclear Information System (INIS)
Persoff, P.; Finsterle, S.; Moridis, G.J.; Apps, J.; Pruess, K.; Muller, S.J.
1995-03-01
In this paper the authors report laboratory work and numerical simulation done in support of development and demonstration of injectable barriers formed from either of two fluids: colloidal silica or polysiloxane. Two principal problems addressed here are control of gel time and control of plume emplacement in the vadose zone. Gel time must be controlled so that the viscosity of the barrier fluid remains low long enough to inject the barrier, but increases soon enough to gel the barrier in place. During injection, the viscosity must be low enough to avoid high injection pressures which could uplift or fracture the formation. To test the grout gel time in the soil, the injection pressure was monitored as grouts were injected into sandpacks. When grout is injected into the vadose zone, it slumps under the influence of gravity, and redistributes due to capillary forces as it gels. The authors have developed a new module for the reservoir simulator TOUGH2 to model grout injection into the vadose zone, taking into account the increase of liquid viscosity as a function of gel concentration and time. They have also developed a model to calculate soil properties after complete solidification of the grout. The numerical model has been used to design and analyze laboratory experiments and field pilot tests. The authors present the results of computer simulations of grout injection, redistribution, and solidification
Verissimo, Angie Denisse Otiniano; Grella, Christine E
2017-04-01
This study examines reasons why people do not seek help for alcohol or drug problems by gender and race/ethnicity using data from the National Epidemiologic Survey on Alcohol and Related Conditions (NESARC), a nationally representative survey. Multivariate models were fit for 3 barriers to seeking help (structural, attitudinal, and readiness for change) for either alcohol or drug problems, controlling for socio-demographic characteristics and problem severity. Predicted probabilities were generated to evaluate gender differences by racial/ethnic subgroups. Over three quarters of the samples endorsed attitudinal barriers related to either alcohol or drug use. Generally, women were less likely to endorse attitudinal barriers for alcohol problems. African Americans and Latina/os were less likely than Whites to endorse attitudinal barriers for alcohol problems, Latina/os were less likely than Whites to endorse readiness for change barriers for alcohol and drug problems, however, African Americans were more likely to endorse structural barriers for alcohol problems. Comparisons within racial/ethnic subgroups by gender revealed more complex findings, although across all racial/ethnic groups women endorsed attitudinal barriers for alcohol problems more than men. Study findings suggest the need to tailor interventions to increase access to help for alcohol and drug problems that take into consideration both attitudinal and structural barriers and how these vary across groups. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang
2017-12-01
Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.
L. Cao (Lu); M. Graauw (Marjo de); K. Yan (Kuan); L.C.J. Winkel (Leah C.J.); F.J. Verbeek (Fons)
2016-01-01
textabstractBackground: Endocytosis is regarded as a mechanism of attenuating the epidermal growth factor receptor (EGFR) signaling and of receptor degradation. There is increasing evidence becoming available showing that breast cancer progression is associated with a defect in EGFR endocytosis. In
Tseng, Jeng-Sen; Wang, Chih-Liang; Yang, Tsung-Ying; Chen, Chih-Yi; Yang, Cheng-Ta; Chen, Kun-Chieh; Hsu, Kuo-Hsuan; Tsai, Chi-Ren; Chang, Gee-Chen
2015-12-01
Smoking status is an important determinant of the prevalence of epidermal growth factor receptor (EGFR) mutations in lung cancer patients. However, it is unclear whether smoking status could also influence the spectrum of EGFR mutations. We enrolled patients with lung adenocarcinoma from three medical centers in Taiwan. EGFR mutations were assessed by Sanger direct sequencing. The objective of this study was to evaluate the influence of smoking status on both the frequency and patterns of EGFR mutations. From 2001 to 2013, a total of 1175 patients with lung adenocarcinoma were enrolled for EGFR mutation analysis. The overall EGFR mutation rate was 59.6%, which was significantly higher in females than males (69.1% vs. 49.8%) and in non-smokers than current/former smokers (73.8% vs. 29.8%) (both Psmokers expressed L858R mutation less frequently (35.2% vs. 50.2%, P=0.005) and exon 19 deletions more frequently (52.8% vs 38.8%, P=0.008) than non-smokers. Smokers and non-smokers also had divergent exon 19 deletions subtypes (Del E746-A750 82.5% vs. 57.6%, respectively, Psmokers were associated with a higher rate of complex mutations than non-smokers (34.2% vs. 8.4%, P<0.001). Our results suggested that smoking status could influence not only the frequency but also the spectrum of EGFR mutations. These findings provide a clue for further investigation of EGFR mutagenesis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Lori, Jody R; Rominski, Sarah D; Gyakobo, Mawuli; Muriu, Eunice W; Kweku, Nakua E; Agyei-Baffour, Peter
2012-07-24
Research on the mal-distribution of health care workers has focused mainly on physicians and nurses. To meet the Millennium Development Goal Five and the reproductive needs of all women, it is predicted that an additional 334,000 midwives are needed. Despite the on-going efforts to increase this cadre of health workers there are still glaring gaps and inequities in distribution. The objectives of this study are to determine the perceived barriers and motivators influencing final year midwifery students' acceptance of rural postings in Ghana, West Africa. An exploratory qualitative study using focus group interviews as the data collection strategy was conducted in two of the largest midwifery training schools in Ghana. All final year midwifery students from the two training schools were invited to participate in the focus groups. A purposive sample of 49 final year midwifery students participated in 6 focus groups. All students were women. Average age was 23.2 years. Glaser's constant comparative method of analysis was used to identify patterns or themes from the data. Three themes were identified through a broad inductive process: 1) social amenities; 2) professional life; and 3) further education/career advancement. Together they create the overarching theme, quality of life, we use to describe the influences on midwifery students' decision to accept a rural posting following graduation. In countries where there are too few health workers, deployment of midwives to rural postings is a continuing challenge. Until more midwives are attracted to work in rural, remote areas health inequities will exist and the targeted reduction for maternal mortality will remain elusive.
Sprache als Barriere (Language as a Barrier)
Mattheier, Klaus
1974-01-01
The concept of language barrier has its derivations in the fields of dialectology, sociology and psychology. In contemporary usage however, the concept has two meanings i.e. regional-cultural barrier and socio-cultural barrier. (Text is in German.) (DS)
Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells
International Nuclear Information System (INIS)
Ronald Sluyter; Kylie S Yuen; Gary M Halliday
2001-01-01
There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc
Radiosensitivity of normal human epidermal cells in culture
International Nuclear Information System (INIS)
Dover, R.; Potten, C.S.
1983-01-01
Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)
Milne, Catherine T; Saucier, Darlene; Trevellini, Chenel; Smith, Juliet
2011-01-01
Peristomal skin alterations under ostomy barrier wafers are a commonly reported problem. While a number of interventions to manage this issue have been reported, the use of a topically applied cyanoacrylate has received little attention. This case series describes the use of a topical cyanoacrylate for the management of peristomal skin alterations in persons living with an ostomy. Using a convenience sample, the topical cyanoacrylate dressing was applied to 11 patients with peristomal skin disruption under ostomy wafers in acute care and outpatient settings. The causes of barrier function interruption were also addressed to enhance outcomes. Patients were assessed for wound discomfort using a Likert Scale, time to healing, and number of appliance changes. Patient satisfaction was also examined. Average reported discomfort levels were 9.5 out of 10 at the initial peristomal irritation assessment visit decreased to 3.5 at the first wafer change and were absent by the second wafer change. Wafers had increasing wear time between changes in both settings with acute care patients responding faster. Epidermal resurfacing occurred within 10.2 days in outpatients and within 7 days in acute care patients. Because of the skin sealant action of this dressing, immediate adherence of the wafer was reported at all pouch changes.
DEFF Research Database (Denmark)
Christensen, M E; Therkildsen, M H; Poulsen, Steen Seier
1993-01-01
the basal cell layer. The present investigation and our previous results confirm the existence of EGF receptors, TGF-alpha and EGF in laryngeal carcinomas. In addition, we conclude that the conditions do exist for growth factors to act through an autocrine system in poorly differentiated tumours and through......Fifteen laryngeal squamous cell carcinomas were investigated for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF) using immunohistochemical methods. In a recent study the same material was characterized for epidermal growth factor receptors (EGF...... receptors) which were confined predominantly to the undifferentiated cells. The expression of this growth factor system in malignant cells may play a role in carcinogenesis and/or tumour growth. All carcinomas were positive for TGF-alpha and 12 were positive for EGF. In moderately-to-well differentiated...
Energy Technology Data Exchange (ETDEWEB)
Merinska, D.; Kalendova, A. [Department of Polymer Engineering, Faculty of Technology, Tomas Bata University in Zlin, Nam. T. G. Masaryka 275, 762 72 Zlin, Czech Republic and Centre of Polymer Systems, University Institute, Tomas Bata University in Zlin, Nad Ovcirnou 3685, 760 0 (Czech Republic); Tesarikova, A. [Department of Polymer Engineering, Faculty of Technology, Tomas Bata University in Zlin, Nam. T. G. Masaryka 275, 762 72 Zlin (Czech Republic)
2014-05-15
Nanocomposite materials with layered clay used as nanofiller and polyethylene (PE), polypropylene (PP) and copolymer ethylene and vinyl acetate matrix (EVA, the content of VA component 19 wt. %) were prepared by compounding the individual components in Brabender kneader. The MMT Na+ and four types of commercial products such as Nanofil N 5 and N3000, Cloisite 93A and 30B were used as nanofillers. Next to the clays microprecipitated CaHCO{sub 3}, nanosilica and Halloysite tubes were used. The quantity of all the above-mentioned (nano)fillers was 1, 3 and 5 wt. % in relation to the content of montmorillonite. The aim was to evaluate the influence of (nano)filler type and concentration on nanocomposite barrier properties. The morphology of nanocomposite samples was examined by means of XRD analysis illustrated by transmission electronic microscopy TEM. Furthermore, permeability for O{sub 2} and CO{sub 2} were observed.
A novel role of RASSF9 in maintaining epidermal homeostasis.
Directory of Open Access Journals (Sweden)
Chiou-Mei Lee
Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.
Energy Technology Data Exchange (ETDEWEB)
Wulf, Sven-Erik, E-mail: sven-erik.wulf@kit.edu; Holstein, Nils; Krauss, Wolfgang; Konys, Jürgen
2013-10-15
Highlights: • Electrochemical Al deposition is industrially relevant for barrier formation. • Al coatings have to be converted into protective layers by heat treatments. • Morphology of Al coatings made by ECX process depends on deposition parameters. • Heat treatment behavior depends on the morphology of the coating produced by ECX. • ECX is proven to produce layer sequences on Eurofer similar to HDA and ECA process. -- Abstract: Previous research revealed that the application of aluminum-based barriers is suitable to minimize corrosion rates of Eurofer steel in Pb–15.7Li and tritium-permeation from the liquid breeder into the cooling system (HCLL) in an envisaged future fusion reactor. Besides the former developed hot-dip-aluminization process (HDA), electrodeposition techniques based on water-free electrolytes, such as toluene-based electrolytes (ECA) and ionic liquids (ECX), showed promising results for the production of suitable aluminum layers. These processes allow electrodeposition of Al-layers on Eurofer steel with adjustable layer thicknesses, but a heat treatment procedure is needed afterwards to form the desired Fe–Al/Alumina scale. To investigate the deposition and treatment process in more detail, a new series of aluminum electroplating was performed by using the ECX process. The variation of deposition parameters (direct and pulsed current) showed clear impact on the morphology of deposited Al-layers. Heat treatments revealed that the formation of Fe–Al barriers is significantly influenced by the morphology of deposits, beyond other parameters like layer thickness. Presented metallographic and SEM/EDX analyses underline the occurred dependencies between deposition conditions and morphology and on the other hand Al-layer morphology and heat treatment behavior.
International Nuclear Information System (INIS)
Hirata, Y.; Orth, D.N.
1981-01-01
Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)
Directory of Open Access Journals (Sweden)
Lakshmana K Yerneni
2007-01-01
Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed
ANALYSIS OF FLEXIBLE BARRIERS USED AS SAFETY PROTECTION IN WOODWORKING
Directory of Open Access Journals (Sweden)
Ana Pavlovic
2016-03-01
Full Text Available Machine tools use physical barriers, made by flexible thermoplastic materials, to protect the environment and the operators against the projections of wood chips and parts of cutting tools. These barriers constitute a partial closure and allow the passage of the workpiece, being simultaneously able to contain sharp fragments projected at high speed. The present research was conducted with the aim to evaluate the real effectiveness of these barriers, to investigate their dynamic behaviour by numerical simulations. Results showed that these barriers, if properly considered, could retain heavier masses and higher speeds. The research also allowed, in fact, to investigate the influence of several factors in design, selection and use, as material, shape, position, assemblages and many others, highlighting weaknesses and identifying possible measures to increase its effectiveness.
Isolation and In Vitro Characterization of Epidermal Stem Cells
DEFF Research Database (Denmark)
Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak
2017-01-01
flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...
Vaccine-induced toxic epidermal necrolysis: A case and systematic review
Chahal, Dev; Aleshin, Maria; Turegano, Mamina; Chiu, Melvin; Worswick, Scott
2018-01-01
Background: Erythema multiforme (EM), Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are cutaneous hypersensitivityreactions that develop in response to specific triggers such as medications and certain infections. Vaccines, which undergo rigorous safety testing prior to use in humans, are a rare cause of SJS/TEN and little is known about the frequency of such events and corresponding pathogenesis. Objective: Herein, we discuss a case of suspected TEN in a 19-yea...
Chen, Lin; Yueming, Li
2018-06-01
In this paper, a coupled mechanical-chemical model is established based on the thermodynamic framework, in which the contribution of chemical expansion to free energy is introduced. The stress-dependent chemical potential equilibrium at the gas-solid interface and the stress gradient-dependent diffusion equation as well as a so-called generalized force which is conjugate to the oxidation rate are derived from the proposed model, which could reflect the influence of stresses on the oxidation reaction. Based on the proposed coupled mechanical-chemical model, a user element subroutine is developed in ABAQUS. The numerical simulation of the high temperature oxidation in the thermal barrier coating is carried out to verify the accuracy of the proposed model, and then the influence of stresses on the oxidation reaction is investigated. In thermally grown oxide, the considerable stresses would be induced by permanent volumetric swelling during the oxidation. The stresses play an important role in the chemical potential equilibrium at the gas-solid interface and strongly affect the oxidation reaction. The gradient of the stresses, however, only occurs in the extremely thin oxidation front layer, which plays a very limited role in the oxidation reaction. The generalized force could be divided into the stress-dependent and the stress-independent parts. Comparing with the stress-independent part, the stress-dependent part is smaller, which has little influence on oxidation reaction.
Barrier mechanisms in the Drosophila blood-brain barrier
Directory of Open Access Journals (Sweden)
Samantha Jane Hindle
2014-12-01
Full Text Available The invertebrate blood-brain barrier field is growing at a rapid pace and, in recent years, studies have shown a physiologic and molecular complexity that has begun to rival its vertebrate counterpart. Novel mechanisms of paracellular barrier maintenance through GPCR signaling were the first demonstrations of the complex adaptive mechanisms of barrier physiology. Building upon this work, the integrity of the invertebrate blood-brain barrier has recently been shown to require coordinated function of all layers of the compound barrier structure, analogous to signaling between the layers of the vertebrate neurovascular unit. These findings strengthen the notion that many blood-brain barrier mechanisms are conserved between vertebrates and invertebrates, and suggest that novel findings in invertebrate model organisms will have a significant impact on the understanding of vertebrate BBB functions. In this vein, important roles in coordinating localized and systemic signaling to dictate organism development and growth are beginning to show how the blood-brain barrier can govern whole animal physiologies. This includes novel functions of blood-brain barrier gap junctions in orchestrating synchronized neuroblast proliferation, and of blood-brain barrier secreted antagonists of insulin receptor signaling. These advancements and others are pushing the field forward in exciting new directions. In this review, we provide a synopsis of invertebrate blood-brain barrier anatomy and physiology, with a focus on insights from the past 5 years, and highlight important areas for future study.
Directory of Open Access Journals (Sweden)
Fernanda Bastos Segatto
2004-10-01
Full Text Available Embora a batata (Solanum tuberosum seja uma espécie de grande valor econômico, são poucas as informações disponíveis sobre a anatomia foliar, principalmente de características estruturais da epiderme. O estudo da anatomia foliar assume grande importância básica, para a ecologia e fisiologia, e aplicada para a fitopatologia e o melhoramento genético. Este trabalho teve por objetivo identificar uma técnica histológica que permite a confecção de lâminas semipermanentes para avaliar a epiderme foliar, em vista frontal, de um grande número de plantas de batata em um curto período de tempo. O corte paradérmico a mão livre, o método de Jeffrey e as técnicas de hidróxido de potássio e de impressão da epiderme foram avaliados. Lâminas semipermanentes foram confeccionadas da secção frontal da epiderme de folíolos principais do terço médio de plantas de batata. A impressão da epiderme em lâmina foi a única técnica que possibilitou a avaliação adequada de todos os clones de batata utilizados. A impressão da epiderme é uma técnica muito rápida, de baixo custo e de fácil execução, que atende os requisitos necessários para a identificação e seleção de características anatômicas de um grande número de plantas em um programa de melhoramento genético de batata.Even though potato (Solanum tuberosum is an economically important crop, information about leaf characteristics of anatomical structure has not been well studied. Studies of leaf epidermis have significance for basic fields as ecology and physiology and for applied fields as plant pathology and breeding. The objective of this research was to identify a fast and easy technique to prepare semi-permanent slides for studying the anatomy of potato leaf epidermis. Para dermal free hand cut, Jeffrey method, potassium hydroxide and epidermal fingerprint on glass slide techniques were evaluated. Semi-permanent slides were prepared from the longitudinal section of
Electric-field effects on electronic tunneling transport in magnetic barrier structures
International Nuclear Information System (INIS)
Guo Yong; Wang Hao; Gu Binglin; Kawazoe, Yoshiyuki
2000-01-01
Electronic transport properties in magnetic barrier structures under the influence of an electric field have been investigated. The results indicate that the characteristics of transmission resonance are determined not only by the structure and the incident wave vector but also strongly by the electric field. It is shown that the transmission coefficient at resonance in the low-energy range is suppressed by applying the electric field for electron tunneling through the magnetic barrier structure, arranged with identical magnetic barriers and wells. It is also shown that the transmission resonance is first enhanced up to optimal resonance, and then suppressed with further increased electric field for electron tunneling through the magnetic barrier structure, arranged with unidentical building blocks. Strong suppression of the current density is also found in the magnetic barrier structure, arranged with two different building blocks
Development of epidermal growth factor receptor targeted therapy in pancreatic cancer.
Qing, Liu; Qing, Wang
2018-02-01
The epidermal growth factor receptor (EGFR) family are a series of important cancer therapeutic targets involved in cancer biology. These genes play an important role in tumor biological characteristics including angiogenesis, cell survival, invasion and glucose metabolism. In recent years, progresses have been achieved upon the cellular and molecular biological characteristics of EGFR and its role in cancer development based on the study of tumor specimens and experimental animal model. EGFR(HER1/ErbB) is overexpressed in over sixty percent of triple-negative breast cancers and occurs in pancreatic, bladder, lung and head-and-neck cancers. Up to now, EGFR inhibitors have been applied in various of cancer, such as lung, breast, bladder and head and neck cancers etc., in which the combination of EGFR inhibitors plus chemotherapeutic agents is now seen as the standard of care for advanced/metastatic pancreatic cancer. For these reasons, EGFR inhibitors and their therapeutic effect for pancreatic cancer is becoming the focus in Laboratory and clinical research. In this paper, research progress of the development of epidermal growth factor receptor targeted therapy in pancreatic cancer is introduced.
International Nuclear Information System (INIS)
Popov, D.V.; Kalistratova, E.N.; Kaluzhina, A.V.
1982-01-01
Dynamics of physiological reactions of epidermal melanophors of larvae Rana temporaria L.. adapted to white and black backgrounds and irradiated with a dose of 700 R has been investigated. Ouring the first day after irradiation no day changes of melanophor index characteristic of intact tadpoles were discovered in whitebackground animals; melanophors preserve the aggregation state. Comparison of black background irradiated and control larvae didn't show confident differences in changes of their melanophor indices. Irradiation affects differently epidermal melanophors in the state of pigment dispersion and aggregation. It is suggested that pigment dispersion and aggregation in melanophor is realized at the expense of different cellular structures. It is shown that by the end of the experiment (21-st day) the amount of epidermal melanophor per surface unit is two times larger in black-ground larvae. General biological signaficance of revealed facts from the point of view of ontogenesis evolution is discussed
Kuzminova, Anna; Vandrovcová, Marta; Shelemin, Artem; Kylián, Ondřej; Choukourov, Andrei; Hanuš, Jan; Bačáková, Lucie; Slavínská, Danka; Biederman, Hynek
2015-12-01
In this contribution an effect of dielectric barrier discharge (DBD) sustained in air at atmospheric pressure on surface properties of poly(ethylene terephthalate) (PET) foils is studied. It is found that exposure of PET to DBD plasma leads to rapid changes of surface chemical composition, wettability, surface morphology as well as mechanical properties of PET surface. In addition, based on biological tests that were performed using two cell types (Saos-2 human osteoblast-like cells and HUVEC human umbilical vein endothelial cells), it may be concluded that DBD plasma treatment positively influences cell growth on PET. This effect was found to be connected predominantly with increased surface energy and oxygen content of the surface of treated PET foils.
Energy Technology Data Exchange (ETDEWEB)
Gillett, N A; Haley, P J; Hahn, F F
1988-12-01
Increased levels of epidermal growth factor receptor have been reported in a variety of tumors, including pulmonary squamous cell carcinomas in man. The purpose of this study was to determine if increased levels of epidermal growth factor (EGFR) were present in lung tumors from Beagle dogs that had been exposed to {sup 239}PuO{sub 2}- Using immunohistochemical techniques, sections from 17 lung tumors were examined for the presence of EGFR. Seven of the tumors were strongly positive for EGFR; the remainder of the tumors and the normal lung sections were negative. The positive immunostaining could not be correlated with the histologic phenotype of the tumors. Work is in progress to determine the level of EGFR in preneoplastic, proliferative epithelial foci in the Iung. (author)
Directory of Open Access Journals (Sweden)
Yung-Yi Lee
2013-06-01
Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.
International Nuclear Information System (INIS)
Kobayashi, Koshi
1977-01-01
Epidermal mitotic activity during wound healing was estimated both in the adrenalectomized, head-irradiated mice and in the adrenalectomized, non-irradiated mice, and was compared with those obtained previously from the unoperated, head-irradiated mice. It was found that head-irradiation caused a mitotic depression to a much smaller extent in the adrenalectomized mice than it did in the unoperated mice, though adrenalectomy itself had exerted a great inhibitory effect upon the mitosis induced by an injury. Whether this abscopal effect of head-irradiation upon the mitotic activity was mediated via the adrenals, and whether in the adrenalectomized mice the head-irradiation acted to increase epidermal response to injury, making the mitotic pattern of adrenalectomized mice to come near that of control mice were discussed. (auth.)
Nicholson, Sarah L; Donaghy, Marie; Johnston, Marie; Sniehotta, Falko F; van Wijck, Frederike; Johnston, Derek; Greig, Carolyn; McMurdo, Marion E T; Mead, Gillian
2014-01-01
After stroke, physical activity and physical fitness levels are low, impacting on health, activity and participation. It is unclear how best to support stroke survivors to increase physical activity. Little is known about the barriers and facilitators to physical activity after stroke. Thus, our aim was to explore stroke survivors' perceived barriers and facilitators to physical activity. Semi-structured interviews with 13 ambulatory stroke survivors exploring perceived barriers and facilitators to physical activity post stroke were conducted in participants' homes, audio-recorded and transcribed verbatim. The Theoretical Domains Framework (TDF) informed content analysis of the interview transcripts. Data saturation was reached after interviews with 13 participants (median age of 76 years (inter-quartile range (IQR) = 69-83 years). The median time since stroke was 345 d (IQR = 316-366 d). The most commonly reported TDF domains were "beliefs about capabilities", "environmental context and resources" and "social influence". The most commonly reported perceived motivators were: social interaction, beliefs of benefits of exercise, high self-efficacy and the necessity of routine behaviours. The most commonly reported perceived barriers were: lack of professional support on discharge from hospital and follow-up, transport issues to structured classes/interventions, lack of control and negative affect. Stroke survivors perceive several different barriers and facilitators to physical activity. Stroke services need to address barriers to physical activity and to build on facilitators to promote physical activity after stroke. Physical activity post stroke can improve physical fitness and function, yet physical activity remains low among stroke survivors. Understanding stroke survivors' perceived barriers and facilitators to physical activity is essential to develop targeted interventions to increase physical activity. Beliefs about capabilities, environmental
Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.
Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali
2016-03-01
Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Jiang Zhao-Tan; Yu Cheng-Long; Dong Quan-Li
2012-01-01
We study the quasibound states in a graphene quantum-dot structure generated by the single-, double-, and triple-barrier electrostatic potentials. It is shown that the strongest quasibound states are mainly determined by the innermost barrier. Specifically, the positions of the quasibound states are determined by the barrier height, the number of the quasibound states is determined by the quantum-dot radius and the angular momentum, and the localization degree of the quasibound states is influenced by the width of the innermost barrier, as well as the outside barriers. Furthermore, according to the study on the double- and triple-barrier quantum dots, we find that an effective way to generate more quasibound states with even larger energy level spacings is to design a quantum dot defined by many concentric barriers with larger barrier-height differences. Last, we extend our results into the quantum dot of many barriers, which gives a complete picture about the formation of the quasibound states in the kind of graphene quantum dot created by many concentric potential barrier rings. (rapid communication)
Ho, Ernest; Dagnino, Lina
2012-01-01
Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front–rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front–rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front–rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front–rear polarity and forward movement. PMID:22160594
Ho, Ernest; Dagnino, Lina
2012-02-01
Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front-rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front-rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front-rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front-rear polarity and forward movement.
Energy Technology Data Exchange (ETDEWEB)
Kuzminova, Anna [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Vandrovcová, Marta [Institute of Physiology, Academy of Sciences of the Czech Republic, Vídeňská 1083, 142 20 Prague 4 (Czech Republic); Shelemin, Artem [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Kylián, Ondřej, E-mail: ondrej.kylian@gmail.com [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Choukourov, Andrei; Hanuš, Jan [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic); Bačáková, Lucie [Institute of Physiology, Academy of Sciences of the Czech Republic, Vídeňská 1083, 142 20 Prague 4 (Czech Republic); Slavínská, Danka; Biederman, Hynek [Department of Macromolecular Physics, Faculty of Mathematics and Physics, Charles University, V Holešovickách 2, 180 00 Praha 8 (Czech Republic)
2015-12-01
Highlights: • Effect of atmospheric pressure DBD plasma on PET foils was investigated. • DBD treatment causes increase in surface density of O-containing functional groups. • DBD plasma causes increase of wettability, roughness and complex modulus of PET. • DBD treatment positively influences cells growth on PET. • Enhancement of cell growth on treated PET depends on the cell type. - Abstract: In this contribution an effect of dielectric barrier discharge (DBD) sustained in air at atmospheric pressure on surface properties of poly(ethylene terephthalate) (PET) foils is studied. It is found that exposure of PET to DBD plasma leads to rapid changes of surface chemical composition, wettability, surface morphology as well as mechanical properties of PET surface. In addition, based on biological tests that were performed using two cell types (Saos-2 human osteoblast-like cells and HUVEC human umbilical vein endothelial cells), it may be concluded that DBD plasma treatment positively influences cell growth on PET. This effect was found to be connected predominantly with increased surface energy and oxygen content of the surface of treated PET foils.
Linguistic Barriers and Bridges
DEFF Research Database (Denmark)
Thuesen, Frederik
2016-01-01
The influence of language on social capital in low-skill and ethnically diverse workplaces has thus far received very limited attention within the sociology of work. As the ethnically diverse workplace is an important social space for the construction of social relations bridging different social...... groups, the sociology of work needs to develop a better understanding of the way in which linguistic diversity influences the formation of social capital, i.e. resources such as the trust and reciprocity inherent in social relations in such workplaces. Drawing on theories about intergroup contact...... and intercultural communication, this article analyses interviews with 31 employees from two highly ethnically diverse Danish workplaces. The article shows how linguistic barriers such as different levels of majority language competence and their consequent misunderstandings breed mistrust and hostility, whilst...
Directory of Open Access Journals (Sweden)
Lori Jody R
2012-07-01
Full Text Available Abstract Background Research on the mal-distribution of health care workers has focused mainly on physicians and nurses. To meet the Millennium Development Goal Five and the reproductive needs of all women, it is predicted that an additional 334,000 midwives are needed. Despite the on-going efforts to increase this cadre of health workers there are still glaring gaps and inequities in distribution. The objectives of this study are to determine the perceived barriers and motivators influencing final year midwifery students’ acceptance of rural postings in Ghana, West Africa. Methods An exploratory qualitative study using focus group interviews as the data collection strategy was conducted in two of the largest midwifery training schools in Ghana. All final year midwifery students from the two training schools were invited to participate in the focus groups. A purposive sample of 49 final year midwifery students participated in 6 focus groups. All students were women. Average age was 23.2 years. Glaser’s constant comparative method of analysis was used to identify patterns or themes from the data. Results Three themes were identified through a broad inductive process: 1 social amenities; 2 professional life; and 3 further education/career advancement. Together they create the overarching theme, quality of life, we use to describe the influences on midwifery students’ decision to accept a rural posting following graduation. Conclusions In countries where there are too few health workers, deployment of midwives to rural postings is a continuing challenge. Until more midwives are attracted to work in rural, remote areas health inequities will exist and the targeted reduction for maternal mortality will remain elusive.
Directory of Open Access Journals (Sweden)
D. Maneze
2015-01-01
Full Text Available Understanding factors that influence health-seeking behaviour of migrants is necessary to intervene for behaviour change. This paper explores Filipino migrants’ perceptions of facilitators and barriers to maintaining health in Australia. Open-ended survey item responses reflecting factors that assisted and hindered health following migration to Australia were inductively analysed. Three hundred and thirty-seven of the 552 survey respondents (61% provided open-ended responses. Responses were grouped into two major categories: individual factors, including personal resources and cultural influences, and environmental factors encompassing both the physical conditions in the host country and health service access. Awareness of practices that enhance health was a major personal facilitator of health-seeking behaviour; however, competing priorities of daily living were perceived as barriers. Cultural beliefs and practices influenced health-seeking behaviour. Despite high self-rated English language skills in this population, new migrants and the elderly cited communication difficulties as barriers to accessing health services. Insight into facilitators and barriers to health-seeking behaviour in this less researched migrant population revealed tools for enhancing engagement in health promotion programs addressing healthy lifestyle.
Maneze, D; DiGiacomo, M; Salamonson, Y; Descallar, J; Davidson, P M
2015-01-01
Understanding factors that influence health-seeking behaviour of migrants is necessary to intervene for behaviour change. This paper explores Filipino migrants' perceptions of facilitators and barriers to maintaining health in Australia. Open-ended survey item responses reflecting factors that assisted and hindered health following migration to Australia were inductively analysed. Three hundred and thirty-seven of the 552 survey respondents (61%) provided open-ended responses. Responses were grouped into two major categories: individual factors, including personal resources and cultural influences, and environmental factors encompassing both the physical conditions in the host country and health service access. Awareness of practices that enhance health was a major personal facilitator of health-seeking behaviour; however, competing priorities of daily living were perceived as barriers. Cultural beliefs and practices influenced health-seeking behaviour. Despite high self-rated English language skills in this population, new migrants and the elderly cited communication difficulties as barriers to accessing health services. Insight into facilitators and barriers to health-seeking behaviour in this less researched migrant population revealed tools for enhancing engagement in health promotion programs addressing healthy lifestyle.
Salamonson, Y.; Descallar, J.; Davidson, P. M.
2015-01-01
Understanding factors that influence health-seeking behaviour of migrants is necessary to intervene for behaviour change. This paper explores Filipino migrants' perceptions of facilitators and barriers to maintaining health in Australia. Open-ended survey item responses reflecting factors that assisted and hindered health following migration to Australia were inductively analysed. Three hundred and thirty-seven of the 552 survey respondents (61%) provided open-ended responses. Responses were grouped into two major categories: individual factors, including personal resources and cultural influences, and environmental factors encompassing both the physical conditions in the host country and health service access. Awareness of practices that enhance health was a major personal facilitator of health-seeking behaviour; however, competing priorities of daily living were perceived as barriers. Cultural beliefs and practices influenced health-seeking behaviour. Despite high self-rated English language skills in this population, new migrants and the elderly cited communication difficulties as barriers to accessing health services. Insight into facilitators and barriers to health-seeking behaviour in this less researched migrant population revealed tools for enhancing engagement in health promotion programs addressing healthy lifestyle. PMID:26380277
Barriers to occupational health and safety management in small Brazilian enterprises
Garnica, Guilherme Besse; Barriga, Gladys Dorotea Cacsire
2018-01-01
Abstract Paper aims To determine main barriers to the implementation of occupational health and safety management systems OHSMS in the context of small Brazilian enterprises from the perspectives of owners/managers, labor auditors, and OHS consultants. Originality: Survey with three different perspectives on small Brazilian enterprises. Research method: Survey conducted with stakeholders who influence the safety culture in small enterprises to identify the main barriers to the implementati...
Barriers to Medicaid Participation among Florida Dentists
Logan, Henrietta L.; Catalanotto, Frank; Guo, Yi; Marks, John; Dharamsi, Shafik
2015-01-01
Background Finding dentists who treat Medicaid-enrolled children is a struggle for many parents. The purpose of this study was to identify non-reimbursement factors that influence the decision by dentists about whether or not to participate in the Medicaid program in Florida. Methods Data from a mailed survey was analyzed using a logistic regression model to test the association of Medicaid participation with the Perceived Barriers and Social Responsibility variables. Results General and pediatric dentists (n=882) who identified themselves as either Medicaid (14%) or Non-Medicaid (86%) participants responded. Five items emerged as significant predictors of Medicaid participation, with a final concordance index of 0.905. Two previously unreported barriers to participation in Medicaid emerged: 1) dentists’ perception of social stigma from other dentists for participating in Medicaid, and 2) the lack of specialists to whom Medicaid patients can be referred. Conclusions This study provides new information about non-reimbursement barriers to Medicaid participation. PMID:25702734
Matsumoto, Reiko; Sugimoto, Masazumi
2007-02-01
We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.
International Nuclear Information System (INIS)
Ejaz, A.; Raza, N.; Iftikhar, N.; Muzzafar, F.
2008-01-01
To compare the efficacy and safety of Jessner's solution with 30% salicylic acid as superficial chemical peeling agents in treating epidermal melasma in Asian skin. Sixty consenting patients with epidermal melasma were randomly divided into two groups. Group A was treated with Jessner's solution and Group B with 30% salicylic acid. Baseline Melasma Area Severity Index (MASI) score was noted and peeling started at 2-weekly intervals. Sunscreen in morning and moisturizer at night were prescribed in all patients. MASI score and adverse effects were recorded biweekly. Treatment was stopped at 12 weeks and patients were followed-up at 4 weekly intervals for further 12 weeks. Final MASI score and adverse effects were noted at the end of follow-up period. Mean MASI scores were compared using paired sample t-test and one-way ANOVA. Difference in baseline, treatment end and follow-up end MASI scores was not statistically significant between the two groups (p=0.54, 0.26, and 0.55 respectively). On the other hand, within group analysis of difference between pre and posttreatment MASI score was highly significant in both groups (p < 0.0001). Adverse effects were mild and comparable in both groups. Jessner's solution and 30% salicylic acid are equally effective and safe peeling agents for use in epidermal melasma in Asian skin. (author)
Barriers to green supply chain management in the automotive industry
Directory of Open Access Journals (Sweden)
Flávia Cristina da Silva
2018-04-01
Full Text Available This study identified the barriers to and analyzed their degree of influence on Green Supply Chain Management (GSCM from the perspective of a first tier supplier in the Brazilian automotive industry. There are 43 barriers in the literature of which 13 were validated: support and involvement (five, operational performance (three, economic performance (two, environmental performance (two, and knowledge and information (one. The validation occurred through the perception of technical and academic specialists familiar with environmental management and supply chains in several sectors. The hierarchy of barriers priorities was obtained through the application of the Analytic Hierarchy Process (AHP, with decision makers representing an industry in the automotive sector. The research showed that the cost implications represent the most influential barrier to GCSV, from the perspective of a first tier supplier in the sector.
Hato, Naohito; Tsujimura, Mika; Takagi, Taro; Okada, Masahiro; Gyo, Kiyofumi; Tohyama, Mikiko; Tauchi, Hisamichi
2013-12-01
The first reported case of facial paralysis due to an inflammatory pseudotumor (IPT) of the facial nerve as a complication of epidermal nevus syndrome (ENS) is herein presented. A 10-month-old female patient was diagnosed with ENS at 3 months of age. She was referred to us because of moderate left facial paralysis. Epidermal nevi of her left auricle extended deep into the external ear canal. Otoscopy revealed polypous nevi and cholesteatoma debris filling the left ear. Computed tomography showed a soft mass filling the ear canal, including the middle ear, and an enormously enlarged facial nerve. Surgical exploration revealed numerous polypous nevi, external ear cholesteatoma, and tumorous swelling of the facial nerve. The middle ear ossicles were completely lost. The facial paralysis was improved after decompression surgery, but recurred 5 months later. A second operation was conducted 10 months after the first. During this operation, facial nerve decompression was completed from the geniculate ganglion to near the stylomastoid foramen. Histological diagnosis of the facial nerve tumor was IPT probably caused by chronic external ear inflammation induced by epidermal nevi. The facial paralysis gradually improved to House-Blackmann grade III 5 years after the second operation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Abdullahi Alanamu ABDULRAHAMAN
2016-06-01
Full Text Available Herbal medicine is the oldest and still the most widely used system of medicine in the world today and they are made exclusively from plants. However, most of these medicines or drugs are adulterated due to lack of proper identification of the plant samples. Method of checking adulteration of drug plants is the main focus of this study. The identification and authentication of dry samples of some medicinal plants were carried out using anatomical features. Twenty-five (25 plants materials were collected in Ibadan and Ilorin, Nigeria. The plants studied include Azardiracta indica, Newboudia leavis, Polyalthia longifolia, Cymbopogon citratus, Anarcardium occidentalis, Nicotiana tobbaccum, Jatropha curcas, Chromoleana odorata, Mangifera indica, Terminalia catappa, Ocimum gratisimum, Morus messosygia, Morinda lucida, Psidium guajava, Vitellaria paradoxa, Annona senegalensis, Vernonia amygdalina, Gliricidium sepium, Ravoulvia vomitora, Telferia occindentalis Citrus aurantifolia, C. limon, C. paradisi and C. sinensis. Leaf epidermal anatomy of these selected plants showed no major variations in stomatal complex types, frequency, size and shape of stomatal cells, epidermal cell wall and trichomes between fresh and dry samples. The variations that occur were between different species but not within species. Leaf epidermal anatomy, therefore, proved to be a significant tool for resolution of taxonomic confusion of dried samples of these plants.
Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2016-03-01
The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
International Nuclear Information System (INIS)
Ananthaswamy, H.N.; Kripke, M.L.
1981-01-01
Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients
Hubbard, Gill; Macmillan, Iona; Canny, Anne; Forbat, Liz; Neal, Richard D; O’Carroll, Ronan E; Haw, Sally; Kyle, Richard G
2014-01-01
Background Initiatives to promote early diagnosis include raising public awareness of signs and symptoms of cancer and addressing barriers to seeking medical help about cancer. Awareness of signs and symptoms of cancer and emotional barriers, such as, fear, worry, and embarrassment strongly influence help seeking behaviour. Whether anxiety influences seeking medical help about cancer is not known. The purpose of this study about adolescents was to examine: 1) the relationship between contextu...
Gupta, Lalit Kumar; Martin, Abhay Mani; Agarwal, Nidheesh; D'Souza, Paschal; Das, Sudip; Kumar, Rajesh; Pande, Sushil; Das, Nilay Kanti; Kumaresan, Muthuvel; Kumar, Piyush; Garg, Anubhav; Singh, Saurabh
2016-01-01
Stevens-Johnson syndrome and toxic epidermal necrolysis are severe, life-threatening mucocutaneous adverse drug reactions with a high morbidity and mortality that require immediate medical care. The various immunomodulatory treatments include systemic corticosteroids, cyclosporine, intravenous immunoglobulin, cyclophosphamide, plasmapheresis and tumor necrosis factor-α inhibitors. The ideal therapy of Stevens-Johnson syndrome/toxic epidermal necrolysis still remains a matter of debate as there are only a limited number of studies of good quality comparing the usefulness of different specific treatments. The aim of this article is to comprehensively review the published medical literature and frame management guidelines suitable in the Indian perspective. The Indian Association of Dermatologists, Venereologists and Leprologists (IADVL) assigned the task of preparing these guidelines to its special interest group on cutaneous adverse drug reactions. The group performed a comprehensive English language literature search for management options in Stevens-Johnson syndrome/toxic epidermal necrolysis across multiple databases (PubMed, EMBASE, MEDLINE and Cochrane) for keywords (alone and in combination) and MeSH items such as "guidelines," "Stevens-Johnson syndrome," "toxic epidermal necrolysis," "corticosteroids," "intravenous immunoglobulin," "cyclosporine" and "management." The available evidence was evaluated using the strength of recommendation taxonomy and graded using a three-point scale. A draft of clinical recommendations was developed on the best available evidence which was also scrutinized and critically evaluated by the IADVL Academy of Dermatology. Based on the inputs received, this final consensus statement was prepared. A total of 104 articles (meta-analyses, prospective and retrospective studies, reviews [including chapters in books], previous guidelines [including Indian guidelines of 2006] and case series) were critically evaluated and the evidence
Velocity barrier-controlled of spin-valley polarized transport in monolayer WSe2 junction
Qiu, Xuejun; Lv, Qiang; Cao, Zhenzhou
2018-05-01
In this work, we have theoretically investigated the influence of velocity barrier on the spin-valley polarized transport in monolayer (ML) WSe2 junction with a large spin-orbit coupling (SOC). Both the spin-valley resolved transmission probabilities and conductance are strong dependent on the velocity barrier, as the velocity barrier decreases to 0.06, a spin-valley polarization of exceeding 90% is observed, which is distinct from the ML MoS2 owing to incommensurable SOC. In addition, the spin-valley polarization is further increased above 95% in a ML WSe2 superlattice, in particular, it's found many extraordinary velocity barrier-dependent transport gaps for multiple barrier due to evanescent tunneling. Our results may open an avenue for the velocity barrier-controlled high-efficiency spin and valley polarizations in ML WSe2-based electronic devices.
DEFF Research Database (Denmark)
Juhl, C O; Vinter-Jensen, Lars; Poulsen, Steen Seier
1995-01-01
Epidermal growth factor (EGF) is an important factor for maintaining the esophageal functional integrity. Goettingen minipigs were treated with either placebo or subcutaneous EGF (30 micrograms/kg/day) for four weeks. Wistar rats were treated with either placebo or subcutaneous EGF (150 microgram...
van Belzen, N.; Spaargaren, M.; Verkleij, A. J.; Boonstra, J.
1990-01-01
Recently it has been established that cytoskeleton-associated epidermal growth factor (EGF) receptors are predominantly of the high-affinity class and that EGF induces a recruitment of low-affinity receptors to the cytoskeleton. The nature of this EGF-induced receptor-cytoskeleton interaction,
Transient expression of P-type ATPases in tobacco epidermal cells
DEFF Research Database (Denmark)
Pedas, Lisbeth Rosager; Palmgren, Michael Broberg; Lopez Marques, Rosa Laura
2016-01-01
Transient expression in tobacco cells is a convenient method for several purposes such as analysis of protein-protein interactions and the subcellular localization of plant proteins. A suspension of Agrobacterium tumefaciens cells carrying the plasmid of interest is injected into the intracellula...... for example protein-protein interaction studies. In this chapter, we describe the procedure to transiently express P-type ATPases in tobacco epidermal cells, with focus on subcellular localization of the protein complexes formed by P4-ATPases and their β-subunits....
Cartledge, Susie; Finn, Judith; Straney, Lahn; Ngu, Phillip; Stub, Dion; Patsamanis, Harry; Shaw, James; Bray, Janet
2017-07-01
Emergency medical services (EMS) transport to hospital is recommended in acute coronary syndrome (ACS) guidelines, but only half of patients with ACS currently use EMS. The recent Australian Warning Signs campaign conducted by the Heart Foundation addressed some of the known barriers against using EMS. Our aim was to examine the influence of awareness of the campaign on these barriers in patients with ACS. Interviews were conducted with patients admitted to an Australian tertiary hospital between July 2013 and April 2014 with a diagnosis of ACS. Patient selection criteria included: aged 35-75 years, competent to provide consent, English speaking, not in residential care and medically stable. Multivariable logistic regression was used to examine factors associated with EMS use. Only 54% of the 199 patients with ACS interviewed used EMS for transport to hospital. Overall 64% of patients recalled seeing the campaign advertising, but this was not associated with increased EMS use (52.0%vs56.9%, p=0.49) or in the barriers against using EMS. A large proportion of patients (43%) using other transport thought it would be faster. Factors associated with EMS use for ACS were: age >65 years, ST-elevation myocardial infarction, a sudden onset of pain and experiencing vomiting. In medically stable patients with ACS, awareness of the Australian Warning Signs campaign was not associated with increased use of EMS or a change in the barriers for EMS use. Future education strategies could emphasise the clinical role that EMS provide in ACS. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei
2016-02-01
Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor
Fatal toxic epidermal necrolysis associated with minoxidil.
Karaoui, Lamis R; Chahine-Chakhtoura, Corinne
2009-04-01
Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this
DEFF Research Database (Denmark)
Sanden, Guro Refsum; Lønsmann, Dorte
This study offers a critical look at how corporate-level language management influences front-line language practices among employees in three multinational corporations (MNCs) headquartered in Scandinavia. Based on interview and document data, we examine, firstly, what front-line practices...... employees use to cross language boundaries in their everyday work, and, secondly, how these practices relate to top-down language management in the case companies. Our findings show that employees are often dependent on ad hoc and informal solutions in cross- language situations, which leads us...... to a discussion of how a company’s language policy may be seen as both support and a barrier....
Permeation barrier properties of thin oxide films on flexible polymer substrates
International Nuclear Information System (INIS)
Fahlteich, John; Fahland, Matthias; Schoenberger, Waldemar; Schiller, Nicolas
2009-01-01
Solar cells and organic electronic devices require an encapsulation to ensure sufficient lifetime. Key parameters of the encapsulation are permeation barrier, UV stability, temperature stability, optical transmission spectra and mechanical stability. The requirements depend very much on the specific application. Many work groups suggest multilayer stacks to meet the permeation requirements. In this paper the permeation barrier properties of the different constituents of such a multilayer stack are characterized. Different layer materials are compared regarding their water vapour and oxygen permeability as well as the influence of process parameters is examined. Finally temperature dependent permeation measurements are used to characterize the permeation mechanisms in the different constituents of the multilayer barrier
Haixin, HU; Feng, HE; Ping, ZHU; Jiting, OUYANG
2018-05-01
A 2D fluid model was employed to simulate the influence of dielectric on the propagation of atmospheric pressure helium plasma jet based on coplanar dielectric barrier discharge (DBD). The spatio-temporal distributions of electron density, ionization rate, electrical field, spatial charge and the spatial structure were obtained for different dielectric tubes that limit the helium flow. The results show that the change of the relative permittivity of the dielectric tube where the plasma jet travels inside has no influence on the formation of DBD itself, but has great impact on the jet propagation. The velocity of the plasma jet changes drastically when the jet passes from a tube of higher permittivity to one of lower permittivity, resulting in an increase in jet length, ionization rate and electric field, as well as a change in the distribution of space charges and discharge states. The radius of the dielectric tube has a great influence on the ring-shaped or solid bullet structure. These results can well explain the behavior of the plasma jet from the dielectric tube into the ambient air and the hollow bullet in experiments.
Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk
2010-02-01
Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.
Barriers to antenatal psychosocial assessment and depression screening in private hospital settings.
Connell, Tanya; Barnett, Bryanne; Waters, Donna
2017-10-11
The evidence of benefit for antenatal psychosocial assessment and depression screening has been sufficient to lead the implementation of screening in public hospitals in all states of Australia. Details of the implementation of perinatal screening in private obstetric settings is less well known. As any successful implementation relies on the identification of local barriers, we aimed to determine what perceived or actual barriers may exist for the implementation of evidence-based perinatal screening interventions in private obstetric care, and specifically within small private hospitals. The integrative literature review method offers a structured systematic approach to organise, synthesize and critique research from a range of sources. This method was used to determine what barriers have been identified in implementing psychosocial assessment and depression screening with women receiving obstetric care in private hospital settings. The integrative review findings suggest that barriers to implementing psychosocial screening in the private sector are similar to those experienced in the public sector but may also be influenced by the corporate focus of private services. Barriers were identified among health professionals, within the personal and psychosocial context of women and their families, and at provider or system level. Once identified, barriers can be systematically addressed to enhance the success of implementing psychosocial and depression screening in the private sector. Screening is likely to be influenced by the business models and operating systems of private service providers. Health professionals working within this environment need more support to conduct perinatal assessment within this context. Copyright © 2017 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.
An investigation on the noise reduction performance of profiled rigid median barriers at highways
Directory of Open Access Journals (Sweden)
Mohammad Reza Monazzam
2012-01-01
Full Text Available Median barriers as a portion of a divided highway are provided to minimize the cross-median crashes. Moreover, median barriers similar to roadside noise barriers could protect people from transportation noise. Thus, there is a need to investigate various median barrier models to identify changes of insertion loss over a simple rigid barrier. In order to estimate the acoustical influence of median barrier′s profile in the shadow zone, different median barrier models are presented and their insertion losses are calculated over a frequency range from 50 to 4000 Hz using a two-dimensional boundary element method. The present investigation has clearly revealed that among the profiled median barriers, T-shape, Y-shape, and L-shape provide better performance than that of the other shapes. It is also found that among inclined barriers, V-shape barrier significantly presents higher values of attenuation. Based on the calculation of different geometrics, it has been shown that a further 2 dB (A in efficiency could be obtained by a better design of the median barrier which is labeled model "L."
Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation
DEFF Research Database (Denmark)
Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina
2007-01-01
12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...
Wave attenuation over the Great Barrier Reef matrix
Gallop, S.; Young, I.; Ranasinghe, Ranasinghe W M R J B; Durrant, T.; Haigh, I.; Mynett, Arthur
2015-01-01
This is the first large-scale study of the influence of an offshore reef matrix on wave transmission. The focus was on the Great Barrier Reef (GBR), Australia, utilizing a 16 yr-record of wave height, from seven satellite altimeters. Within the GBR matrix, wave height is not strongly dependent on
Magnetization reversal processes of single nanomagnets and their energy barrier
International Nuclear Information System (INIS)
Krone, P.; Makarov, D.; Albrecht, M.; Schrefl, T.; Suess, D.
2010-01-01
Micromagnetic simulations were performed to investigate the influence of geometry and magnetic anisotropy constant on energy barrier and magnetization reversal mechanism of individual bits important for the bit patterned media concept in magnetic data storage. It is shown that dependency of the energy barrier on magnetic and geometric properties of bits can be described by an analytical approach in the case of quasi-coherent magnetization rotation process. However, when the bit size exceeds a critical size, for which an incoherent magnetization reversal is preferred, the analytical approach becomes invalid and no self-consistent theory is available. By systematically investigating the influence of bit size on the magnetization reversal mode, it was found that the transition from quasi-coherent to incoherent magnetization reversal mode can still be described analytically if an activation volume is considered instead of the bit volume. In this case, the nucleation volume is an important parameter determining thermal stability of the bit. If the volume of the bit is larger than twice the activation volume, the energy barrier stays nearly constant; with further increase in bit size, no gain in thermal stability can be achieved.
Influence of ultrasonic irradiation on ozone generation in a dielectric barrier discharge
DEFF Research Database (Denmark)
Kusano, Yukihiro; Drews, J.; Leipold, Frank
2012-01-01
An atmospheric pressure dielectric barrier discharge (DBD) was generated in an N2/O2 gas mixture at room temperature with and without ultrasonic irradiation to investigate ozone production. Powerful ultrasonic irradiation with the sound pressure level of approximately 150 dB into the DBD can...
Epidermal segmentation in high-definition optical coherence tomography.
Li, Annan; Cheng, Jun; Yow, Ai Ping; Wall, Carolin; Wong, Damon Wing Kee; Tey, Hong Liang; Liu, Jiang
2015-01-01
Epidermis segmentation is a crucial step in many dermatological applications. Recently, high-definition optical coherence tomography (HD-OCT) has been developed and applied to imaging subsurface skin tissues. In this paper, a novel epidermis segmentation method using HD-OCT is proposed in which the epidermis is segmented by 3 steps: the weighted least square-based pre-processing, the graph-based skin surface detection and the local integral projection-based dermal-epidermal junction detection respectively. Using a dataset of five 3D volumes, we found that this method correlates well with the conventional method of manually marking out the epidermis. This method can therefore serve to effectively and rapidly delineate the epidermis for study and clinical management of skin diseases.
Sex steroids and epidermal glands in two species of gekkonine lizards.
Chiu, K W; Maderson, P F; Alexander, S A; Wong, K L
1975-09-01
In vivo and in vitro experiments on the endocrine relationships of epidermal glands in the tokay Gekko gecko, and the common house gecko Hemidactylus bowringii are reported. The results show that certain aspects of beta-gland differentiation involve a synergistic action between androgens and those hormones responsible for controlling the normal shedding cycle, while other aspects are solely under androgenic control. Pre-anal organ activity appears to be solely under androgenic control.
Directory of Open Access Journals (Sweden)
Erol Koç
2014-03-01
Full Text Available Background: Er: YAG lasers are precise ablation systems used in the treatment epidermal and dermal benign skin lesions. In this study, we restrospectively analysed efficiency of Er: YAG laser therapy in the treatment of epidermal and dermal benign skin lesions. Materials and Methods: We retrospectively investigated our clinical records of 116 patients treated with Er: YAG laser between April 2011 and April 2013. The clinical records of 103 patients (47 men, 56 women were included in our study. Of these 103 patients included in the study were xanthelasma, solar lentigo, epidermal nevus, seborrheic keratosis, nevus of ota, syringoma, cafe au lait macules (CALM and other than these. Treatment parameters, demographic features and before and after photographs of the lesions were investigated from patients’ records in order to evaluate efficiency of Er: YAG laser therapy. Results: Of these 103 patients included in the study were evaluated in 8 groups, described as xanthelasma (n=21, syringoma (n=17, solar lentigo (n=16, epidermal nevus (n=11, seborrheic keratosis (n=9, nevus of ota (n=5, CALM (n=3 and other than these (n=21. In the Er: YAG laser treatment, the average energy flow was 3-7 J/cm2, the average pulse duration was 300 ms, the average number of passes was 3-5 repeat, and the average pulse frequency was 3-7 Hz. While 4.9% of the patients showed no improvement, 59.2% showed marked improvement, 26.2% showed moderate improvement and 9.7% showed mild improvement. Treatment responses in xanthelasma, syringoma, epidermal nevus, solar lentigo and CALM lesions were statistically significant. Observed side effects were hyperpigmentation in 4 patients, hypopigmentation in 3 patients, hypertrophic scar in 2 patients and persistent erythema in one patient and the treatment was well tolerated by all the patients. Conclusion: Er: YAG laser is an effective and safe treatment option in the treatment of benign skin lesions especially in epidermal lesions.
Mawson, Anthony R; Eriator, Ike; Karre, Sridhar
2015-01-12
Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.
Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong
2016-12-01
: Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.
International Nuclear Information System (INIS)
Myers, D.R.; Wing, N.R.
1994-01-01
The development of the Protective Isolation Surface Barrier has been an ongoing program since 1985. This development effort has focused on several technical areas. These technical areas include water infiltration, biointrusion, human intrusion, erosion/deposition, physical stability, barrier materials, computer modeling, long-term climate effects, natural analogs, and barrier design. This paper briefly reviews the results of the research and development in the technical areas and then explains how the results of this work have influenced the design features of the prototype barrier. A good example of this is to explain how the type and depth of the soil layer used in the barrier is related to water infiltration, biointrusion, modeling, climate, analogs, and barrier materials. Another good example is to explain the relationship of the barrier sideslopes (basalt riprap and native soil) with human intrusion, biointrusion, barrier materials, and barrier design. In general, the design features of the prototype barrier will be explained in terms of the results of the testing and development program. After the basis for prototype barrier design has been established, the paper will close by reviewing the construction of the prototype barrier, sharing the lessons learned during construction, and explaining the ongoing testing and monitoring program which will determine the success or failure of this barrier concept and the need for additional design modifications
Directory of Open Access Journals (Sweden)
Barańska Sylwia
2009-03-01
Full Text Available Abstract Background Mucopolysaccharidoses (MPS are inherited metabolic disorders caused by mutations leading to dysfunction of one of enzymes involved in degradation of glycosaminoglycans (GAGs. Due to their impaired degradation, GAGs accumulate in cells of patients, which results in dysfunction of tissues and organs. Substrate reduction therapy is one of potential treatment of these diseases. It was demonstrated previously that genistein (4', 5, 7-trihydroxyisoflavone inhibits synthesis and reduces levels of GAGs in cultures of fibroblasts of MPS patients. Recent pilot clinical study indicated that such a therapy may be effective in MPS III (Sanfilippo syndrome. Methods To learn on details of the molecular mechanism of genistein-mediated inhibition of GAG synthesis, efficiency of this process was studied by measuring of incorporation of labeled sulfate, storage of GAGs in lysosomes was estimated by using electron microscopic techniques, and efficiency of phosphorylation of epidermal growth factor (EGF receptor was determined by using an ELISA-based assay with fluorogenic substrates. Results Effects of genistein on inhibition of GAG synthesis and accumulation in fibroblasts from patients suffering from various MPS types were abolished in the presence of an excess of EGF, and were partially reversed by an increased concentration of genistein. No such effects were observed when an excess of 17β-estradiol was used instead of EGF. Moreover, EGF-mediated stimulation of phsophorylation of the EGF receptor was impaired in the presence of genistein in both wild-type and MPS fibroblasts. Conclusion The results presented in this report indicate that the mechanism of genistein-mediated inhibition of GAG synthesis operates through epidermal growth factor (EGF-dependent pathway.
Expression of epidermal growth factor receptors in human endometrial carcinoma
DEFF Research Database (Denmark)
Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B
1993-01-01
Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...
Investigation of the geometrical barrier in Bi-2212 using the magneto-optical technique
International Nuclear Information System (INIS)
Lin, Z.W.
2000-01-01
It has been found that the penetration of vortices into a weak pinning crystal is governed by a geometrical barrier and they form a dome-shaped flux profile across the crystal. Using the powerful magneto-optical technique, we investigated this geometrical barrier in a high-purity Bi 2 Sr 2 CaCu 2 O 8+x single-crystal platelet. Our results show that over the temperature range 20-70 K the dome-shaped profile is observed. Also, the influences of the edge shape and the roughness on the geometrical barrier are discussed. (author)
Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D
2005-08-01
The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.
Ferrer, C; Solano, F; Zuasti, A
1999-04-01
We have studied the pigmentary system of the teleost Sparus aurata skin by electron microscopy and chromatographic analysis. Under electron microscopy, we found the dermis to contain the three major types of recognized chromatophores: melanophores, xanthophores and iridophores. Melanophores were more abundant in the dorsal region, whereas the iridophores were more abundant in the ventral region. The most important discovery was that of epidermal xanthophores. Epidermal xanthophores were the only chromatophores in the epidermis, something only found in S aurata and in a teleost species living in the Antartic sea. In contrast, the biochemical analysis did not establish any special characteristics: we found pteridine and flavin pigments located mostly in the pigmented dorsal region. Riboflavin and pterin were two of the most abundant coloured pigment types, but other colourless pigments such as xanthopterin and isoxanthopterin were also detected.
International Nuclear Information System (INIS)
Ross, J.A.; Howie, S.E.; Norval, M.; Maingay, J.P.
1987-01-01
Urocanic acid (UCA), the putative photoreceptor for ultraviolet radiation (UV)-induced suppression, undergoes a UV-dependent trans to cis isomerisation. Epidermal cells from mice painted with UCA, containing a known proportion of the cis-isomer, generate suppression of the delayed type hypersensitivity response to herpes simplex virus type 1 (HSV-1) when transferred to naive syngeneic recipients at the same time and site as infection with HSV-1. One T suppressor cell subset, of phenotype (Thy1+, L3T4+, Ly2-), is induced by the cis-UCA modified epidermal cell transfer. Flow cytometric analysis of the epidermal cells from skin treated with UV or cis-UCA indicates an overall reduction from normal in the number of cells expressing MHC Class II antigens, but no alteration in the number expressing I-J antigens
Alharbi, Abdulrazaq M.
2016-05-06
Various methods and systems are provided for smart parking barriers. In one example, among others, a smart parking barrier system includes a movable parking barrier located at one end of a parking space, a barrier drive configured to control positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking space and a second position that allows access to the parking space. The parking controller can initiate movement of the movable parking barrier in response to a positive identification of an individual allowed to use the parking space. The parking controller can identify the individual through, e.g., a RFID tag, a mobile device (e.g., a remote control, smartphone, tablet, etc.), an access card, biometric information, or other appropriate identifier.
In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells
DEFF Research Database (Denmark)
Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K
2003-01-01
a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...
Cavazos, J M; Naik, A D; Woofter, A; Abraham, N S
2008-09-15
Despite wide availability of physician guidelines for safer use of nonsteroidal anti-inflammatory drugs (NSAIDs) and widespread use of these drugs in the US, NSAID prescribing guidelines have been only modestly effective. To identify and describe comprehensively barriers to provider adherence to NSAID prescribing guidelines. We conducted interviews with 25 physicians, seeking to identify the major influences explaining physician non-adherence to guidelines. Interviews were standardized and structured probes were used for clarification and detail. All interviews were audio-taped and transcribed. Three independent investigators analysed the transcripts, using the constant-comparative method of qualitative analysis. Our analysis identified six dominant physician barriers explaining non-adherence to established NSAID prescribing guidelines. These included (i) lack of familiarity with guidelines, (ii) perceived limited validity of guidelines, (iii) limited applicability of guidelines among specific patients, (iv) clinical inertia, (v) influences of prior anecdotal experiences and (vi) medical heuristics. A heterogeneous set of influences are barriers to physician adherence to NSAID prescribing guidelines. Suggested measures for improving guideline-concordant prescribing should focus on measures to improve physician education and confidence in guidelines, implementation of physician/pharmacist co-management strategies and expansion of guideline scope.
Gupta, M.; Markocsan, N.; Li, X.-H.; Östergren, L.
2018-01-01
Development of thermal barrier coatings (TBCs) manufactured by suspension plasma spraying (SPS) is of high commercial interest as SPS has been shown capable of producing highly porous columnar microstructures similar to the conventionally used electron beam-physical vapor deposition. However, lifetime of SPS coatings needs to be improved further to be used in commercial applications. The bondcoat microstructure as well as topcoat-bondcoat interface topography affects the TBC lifetime significantly. The objective of this work was to investigate the influence of different bondcoat deposition processes for SPS topcoats. In this work, a NiCoCrAlY bondcoat deposited by high velocity air fuel (HVAF) was compared to commercial vacuum plasma-sprayed NiCoCrAlY and PtAl diffusion bondcoats. All bondcoat variations were prepared with and without grit blasting the bondcoat surface. SPS was used to deposit the topcoats on all samples using the same spray parameters. Lifetime of these samples was examined by thermal cyclic fatigue testing. Isothermal heat treatment was performed to study bondcoat oxidation over time. The effect of bondcoat deposition process and interface topography on lifetime in each case has been discussed. The results show that HVAF could be a suitable process for bondcoat deposition in SPS TBCs.
Directory of Open Access Journals (Sweden)
Ethan Frank
2018-03-01
Full Text Available Epidermal inclusion cysts are common lesions that rarely develop into squamous cell carcinoma (SCC. Neoplastic change in these cysts can be associated with prominent symptoms such as pain, rapid growth, or ulceration. This study describes the case of a 64-year-old woman with a 4-year history of a largely asymptomatic neck mass, which after routine excision was found to be an epidermal inclusion cyst harboring well-differentiated SCC. The diagnosis was made incidentally after routine cyst bisection and hematoxylin and eosin staining. Given the potential for variable presentation and low cost of hematoxylin and eosin analysis, we recommend a low threshold for a comprehensive pathological search for malignancy in excised cysts when appropriate.
State of offsite construction in India-Drivers and barriers
Arif, M.; Bendi, D.; Sawhney, A.; Iyer, K. C.
2012-05-01
The rapid growth of the construction industry in India has influenced key players in the industry to adopt alternative technologies addressing time, cost and quality. The rising demand in housing, infrastructure and other facilities have further highlighted the need for the construction industry to look at adopting alternate building technologies. Offsite construction has evolved as a panacea to dealing with the under-supply and poor quality in the current age construction industry. Several offsite techniques have been adopted by the construction sector. Although, different forms of offsite techniques have been around for a while but their uptake has been low in the Indian context. This paper presents the perceptions about offsite construction in India and highlights some of the barriers and drivers facing the Indian construction industry. The data was gathered through a survey of 17 high level managers from some of the largest stakeholder organizations of the construction sector in India. The influence of time and cost has been highlighted as a major factor fuelling the adoption of offsite construction. However, the influence of current planning systems and the need for a paradigm shift are some of the prominent barriers towards the adoption of offsite techniques.
Chaotic correlations in barrier billiards with arbitrary barriers
International Nuclear Information System (INIS)
Osbaldestin, A H; Adamson, L N C
2013-01-01
We study autocorrelation functions in symmetric barrier billiards for golden mean trajectories with arbitrary barriers. Renormalization analysis reveals the presence of a chaotic invariant set and thus that, for a typical barrier, there are chaotic correlations. The chaotic renormalization set is the analogue of the so-called orchid that arises in a generalized Harper equation. (paper)
Influence of fluorine on vegetation. [Sinapsis
Energy Technology Data Exchange (ETDEWEB)
Gautier, A.
1915-01-01
Fluorine occurs in living organisms in 2 forms, always associated with P. In epidermal tissues, nails, hair, and other tissues by which it is finally eliminated, the proportion of F to P is about the same as in apatite. In cells of glands, muscles, and nerves the proportion of F to P sinks 1 to 400. In artificial media of known F content, F in most cases favored the growth, flowering and seed production of plants, especially of Sinapsis. In exceptional cases such as corn, rye and oats, its influence remains doubtful. In rare cases it was found harmful.