Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics

Directory of Open Access Journals (Sweden)

Henrique Silva

2015-03-01

Full Text Available Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu. The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young adult subjects (21.6 ± 2.6 years old were selected after informed consent. Subjects were asked to apply a commercially available alcohol gel sanitizer to one hand for 15 days. TEWL absolute values were measured on days 1, 8 and 15 and a plastic occlusion stress test (POST applied. Evaporation half-life (t1/2 evap and dynamic water mass (DWM values increased significantly on day 15 on the treated hand compared to the control hand suggesting that, in the present experimental conditions, the regular use of an alcohol-based gel sanitizer does changes the epidermal barrier. This study also confirms the usefulness of this kinetic model to detect subtle changes on in vivo TEWL dynamics.

A homolog of Drosophila grainy head is essential for epidermal integrity in mice.

Science.gov (United States)

Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M

2005-04-15

The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.

Effects of in Utero Exposure of C57BL/6J Mice to 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Epidermal Permeability Barrier Development and Function

Science.gov (United States)

Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.

2014-01-01

Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982

Tight junction regulates epidermal calcium ion gradient and differentiation

International Nuclear Information System (INIS)

Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

2011-01-01

Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.

Science.gov (United States)

Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi

2016-04-01

Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.

Epicutaneous aeroallergen sensitization in atopic dermatitis infants - determining the role of epidermal barrier impairment.

Science.gov (United States)

Boralevi, F; Hubiche, T; Léauté-Labrèze, C; Saubusse, E; Fayon, M; Roul, S; Maurice-Tison, S; Taïeb, A

2008-02-01

Sensitization to atopens is an early phenomenon that overlaps with the onset of atopic dermatitis (AD) in infancy. Early epidermal barrier impairment may facilitate the epicutaneous penetration of atopens. To correlate transepidermal water loss (TEWL) and aeroallergen sensitization in infants with AD. In this cross-sectional study we enrolled 59 AD children and 30 controls aged 3-12 months. Transepidermal water loss in uninvolved skin, specific immunoglobulin E, atopy patch test (APT) and skin prick tests were performed with respect to seven aeroallergens, i.e., Dermatophagoides pteronyssinus, D. farinae, cat, dog, birch pollen, ambrosia, and cockroach. Environmental conditions were assessed by a questionnaire, and the house dust mite (HDM) concentration was determined in dust samples. Eighty-nine percent of AD infants had a positive APT vs one out of eleven controls. AD infants had a significantly higher mean TEWL than controls (27.4 vs 11.1 g/m(2)/h, P cats, and dogs at home. This study confirms the high prevalence of delayed sensitization to indoor and outdoor aeroallergens in AD infants, and shows that the higher the TEWL, the higher the prevalence of sensitization to aeroallergens. These data are in favor of a major role of a constitutive epidermal barrier impairment in determining early atopen sensitization in infants with AD.

Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

NARCIS (Netherlands)

Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.

2015-01-01

Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis

Barrier cell sheath formation

International Nuclear Information System (INIS)

Kesner, J.

1980-04-01

The solution for electrostatic potential within a simply modeled tandem mirror thermal barrier is seen to exhibit a sheath at each edge of the cell. The formation of the sheath requires ion collisionality and the analysis assmes that the collisional trapping rate into the barrier is considerably slower than the barrier pump rate

Compromised epidermal barrier stimulates Harderian gland activity and hypertrophy in ACBP-/- mice

DEFF Research Database (Denmark)

Sørensen, Signe Bek; Neess, Ditte; Dixen, Karen

2015-01-01

of the eye lid. We show that disruption of the Acbp gene leads to a significant enlargement of this gland with hypertrophy of the acinar cells and increased de novo synthesis of monoalkyl diacylglycerol, the main lipid species produced by the gland. Mice with conditional targeting of the Acbp gene......Acyl-CoA binding protein (ACBP) is a small, ubiquitously expressed intracellular protein that binds C14-C22 acyl-CoA esters with very high affinity and specificity. We have recently shown that targeted disruption of the Acbp gene leads to a compromised epidermal barrier and that this causes delayed...

Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

Science.gov (United States)

Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

2016-09-01

Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

Science.gov (United States)

Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

2015-03-01

The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

Science.gov (United States)

Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

2017-01-01

Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

DEFF Research Database (Denmark)

Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

Therapeutic benefits of enhancing permeability barrier for atopic eczema

Directory of Open Access Journals (Sweden)

George Man

2015-06-01

Full Text Available The regulatory role of epidermal permeability barrier function in cutaneous inflammation has been well appreciated. While barrier disruption induces cutaneous inflammation, improvement of permeability barrier function alleviates inflammation. Studies have demonstrated that improvement of epidermal permeability barrier function not only prevents the development of atopic eczema, but also delays the relapse of these diseases. Moreover, enhancing the epidermal permeability barrier also alleviates atopic eczema. Furthermore, co-applications of barrier enhancing products with glucocorticoids can increase the therapeutic efficacy and reduce the adverse effects of glucocorticoids in the treatment of atopic eczema. Therefore, utilization of permeability barrier enhancing products alone or in combination with glucocorticoids could be a valuable approach in the treatment of atopic eczema. In this review, we discuss the benefits of improving the epidermal permeability barrier in the management of atopic eczema.

[Impact of wet work on epidermal barrier (tewl and stratum corneum hydration) and skin viscoelasticity in nurses].

Science.gov (United States)

Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata

2014-01-01

Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.

Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

Directory of Open Access Journals (Sweden)

Shadmehr Demehri

2008-05-01

Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

The unique and cooperative roles of the Grainy head-like transcription factors in epidermal development reflect unexpected target gene specificity.

Science.gov (United States)

Boglev, Yeliz; Wilanowski, Tomasz; Caddy, Jacinta; Parekh, Vishwas; Auden, Alana; Darido, Charbel; Hislop, Nikki R; Cangkrama, Michael; Ting, Stephen B; Jane, Stephen M

2011-01-15

The Grainy head-like 3 (Grhl3) gene encodes a transcription factor that plays essential roles in epidermal morphogenesis during embryonic development, with deficient mice exhibiting failed skin barrier formation, defective wound repair, and loss of eyelid fusion. Despite sharing significant sequence homology, overlapping expression patterns, and an identical core consensus DNA binding site, the other members of the Grhl family (Grhl1 and -2) fail to compensate for the loss of Grhl3 in these processes. Here, we have employed diverse genetic models, coupled with biochemical studies, to define the inter-relationships of the Grhl factors in epidermal development. We show that Grhl1 and Grhl3 have evolved complete functional independence, as evidenced by a lack of genetic interactions in embryos carrying combinations of targeted alleles of these genes. In contrast, compound heterozygous Grhl2/Grhl3 embryos displayed failed wound repair, and loss of a single Grhl2 allele in Grhl3-null embryos results in fully penetrant eyes open at birth. Expression of Grhl2 from the Grhl3 locus in homozygous knock-in mice corrects the wound repair defect, but these embryos still display a complete failure of skin barrier formation. This functional dissociation is due to unexpected differences in target gene specificity, as both GRHL2 and GRHL3 bind to and regulate expression of the wound repair gene Rho GEF 19, but regulation of the barrier forming gene, Transglutaminase 1 (TGase1), is unique to GRHL3. Our findings define the mechanisms underpinning the unique and cooperative roles of the Grhl genes in epidermal development. Copyright © 2010 Elsevier Inc. All rights reserved.

Essential function of linoleic acid esterified in acylglucosylceramide and acylceramide in maintaining the epidermal water permeability barrier. Evidence from feeding studies with oleate, linoleate, arachidonate, columbinate and a-linolenate

DEFF Research Database (Denmark)

Hansen, Harald S.; Jensen, B.

1985-01-01

sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...

Biochemistry of epidermal stem cells.

Science.gov (United States)

Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

2013-02-01

The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

Biochemistry of epidermal stem cells☆

Science.gov (United States)

Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

2014-01-01

Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

Noninvasive evaluation of the barrier properties of the skin

Directory of Open Access Journals (Sweden)

Utz S.R.

2014-09-01

Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.

Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

International Nuclear Information System (INIS)

Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

1997-01-01

Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

The functions of grainy head-like proteins in animals and fungi and the evolution of apical extracellular barriers.

Directory of Open Access Journals (Sweden)

Adam Paré

Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.

Could tight junctions regulate the barrier function of the aged skin?

Science.gov (United States)

Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

2016-03-01

The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Delayed Hepatic Adaptation to Weaning in ACBP(-/-) Mice Is Caused by Disruption of the Epidermal Barrier

DEFF Research Database (Denmark)

Neess, Ditte; Bek, Signe; Bloksgaard, Maria

2013-01-01

in the skin rather than in the liver. Similarly to ACBP(-/-) mice, K14-ACBP(-/-) mice exhibit an increased transepidermal water loss, and we show that the hepatic phenotype is caused specifically by the epidermal barrier defect, which leads to increased lipolysis in white adipose tissue. Our data demonstrate......We previously reported that mice deficient in acyl-CoA-binding protein (ACBP) display a delayed metabolic adaptation to weaning. This includes a delayed activation of the hepatic lipogenic gene program, which may result from hepatic accumulation of triacylglycerol and/or cholesteryl esters...... in the late suckling period. To further investigate the basis for this phenotype, we generated mice deficient in ACBP in hepatocytes (Alb-ACBP(-/-)) and keratinocytes (K14-ACBP(-/-)). Surprisingly, the delayed adaptation to weaning, including hepatic lipid accumulation, is caused by ACBP deficiency...

A plant oil-containing pH 4 emulsion improves epidermal barrier structure and enhances ceramide levels in aged skin.

Science.gov (United States)

Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P

2017-06-01

Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Effects of epidermal growth factor on bone formation and resorption in vivo

International Nuclear Information System (INIS)

Marie, P.J.; Hott, M.; Perheentupa, J.

1990-01-01

The effects of mouse epidermal growth factor (EGF) on bone formation and resorption were examined in male mice. EGF administration (2-200 ng.g-1.day-1 ip for 7 days) induced a dose-dependent rise in plasma EGF levels that remained within physiological range. Histomorphometric analysis of caudal vertebrae showed that EGF (20 and 200 ng.g-1.day-1) reduced the endosteal matrix and mineral appositional rates after 5 days of treatment as measured by double [3H]proline labeling and double tetracycline labeling, respectively. This effect was transitory and was not observed after 7 days of EGF administration. EGF administered for 7 days induced a dose-dependent increase in the periosteal osteoblastic and tetracycline double-labeled surfaces. At high dosage (200 ng.g-1.day-1) EGF administration increased the osteoclastic surface and the number of acid phosphatase-stained osteoclasts, although plasma calcium remained normal. The results show that EGF administration at physiological doses induces distinct effects on endosteal and periosteal bone formation and that the effects are dependent on EGF dosage and duration of treatment. This study indicates that EGF at physiological dosage stimulates periosteal bone formation and increases endosteal bone resorption in the growing mouse

How to manage barriers to formation and implementation of policy packages in transport

DEFF Research Database (Denmark)

Åkerman, Jonas; Gudmundsson, Henrik; Sørensen, Claus Hedegaard

2011-01-01

The aim of this study has been to explore success factors and barriers to the formation and implementation of single policy measures and policy packages in transport, and to identify strategies to manage such barriers. As a first step, we developed a typology of barriers and success factors...... for policy formation and implementation. Secondly, we carried out an empirical analysis of barriers and success factors in four cases of policy packaging: Urban Congestion Charging; National Heavy Vehicle Fees; Aviation in the European Emissions Trading System and The EU’s First Railway Package. The third...... and final task was to identify more general strategies to manage barriers in policy formation and implementation. A main conclusion in this report is that a conscious application of these strategies may contribute significantly to successful formation and implementation of even controversial policies...

Epidermal CYP2 family cytochromes P450

International Nuclear Information System (INIS)

Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

2004-01-01

Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

Superficial Dsg2 Expression Limits Epidermal Blister Formation Mediated by Pemphigus Foliaceus Antibodies and Exfoliative Toxins

Directory of Open Access Journals (Sweden)

Donna Brennan

2010-01-01

Full Text Available Cell-cell adhesion mediated by desmosomes is crucial for maintaining proper epidermal structure and function, as evidenced by several severe and potentially fatal skin disorders involving impairment of desmosomal proteins. Pemphigus foliaceus (PF and staphylococcal scalded skin syndrome (SSSS are subcorneal blistering diseases resulting from loss of function of the desmosomal cadherin, desmoglein 1 (Dsg1. To further study the pathomechanism of these diseases and to assess the adhesive properties of Dsg2, we employed a recently established transgenic (Tg mouse model expressing Dsg2 in the superficial epidermis. Neonatal Tg and wild type (WT mice were injected with purified ETA or PF Ig. We showed that ectopic expression of Dsg2 reduced the extent of blister formation in response to both ETA and PF Ig. In response to PF Ig, we observed either a dramatic loss or a reorganization of Dsg1-α, Dsg1-β, and, to a lesser extent, Dsg1-γ, in WT mice. The Inv-Dsg2 Tg mice showed enhanced retention of Dsg1 at the cell-cell border. Collectively, our data support the role for Dsg2 in cell adhesion and suggest that ectopic superficial expression of Dsg2 can increase membrane preservation of Dsg1 and limit epidermal blister formation mediated by PF antibodies and exfoliative toxins.

Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

Science.gov (United States)

Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

2018-01-01

Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

International Nuclear Information System (INIS)

Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

2006-01-01

Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

Epidermal hydration levels in rosacea patients improve after minocycline therapy.

LENUS (Irish Health Repository)

Ní Raghallaigh, S

2013-12-06

Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.

Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

Science.gov (United States)

Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

2014-01-01

Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

Science.gov (United States)

Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

2005-01-01

The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

Enterocyte-specific epidermal growth factor prevents barrier dysfunction and improves mortality in murine peritonitis.

Science.gov (United States)

Clark, Jessica A; Gan, Heng; Samocha, Alexandr J; Fox, Amy C; Buchman, Timothy G; Coopersmith, Craig M

2009-09-01

Systemic administration of epidermal growth factor (EGF) decreases mortality in a murine model of septic peritonitis. Although EGF can have direct healing effects on the intestinal mucosa, it is unknown whether the benefits of systemic EGF in peritonitis are mediated through the intestine. Here, we demonstrate that enterocyte-specific overexpression of EGF is sufficient to prevent intestinal barrier dysfunction and improve survival in peritonitis. Transgenic FVB/N mice that overexpress EGF exclusively in enterocytes (IFABP-EGF) and wild-type (WT) mice were subjected to either sham laparotomy or cecal ligation and puncture (CLP). Intestinal permeability, expression of the tight junction proteins claudins-1, -2, -3, -4, -5, -7, and -8, occludin, and zonula occludens-1; villus length; intestinal epithelial proliferation; and epithelial apoptosis were evaluated. A separate cohort of mice was followed for survival. Peritonitis induced a threefold increase in intestinal permeability in WT mice. This was associated with increased claudin-2 expression and a change in subcellular localization. Permeability decreased to basal levels in IFABP-EGF septic mice, and claudin-2 expression and localization were similar to those of sham animals. Claudin-4 expression was decreased following CLP but was not different between WT septic mice and IFABP-EGF septic mice. Peritonitis-induced decreases in villus length and proliferation and increases in apoptosis seen in WT septic mice did not occur in IFABP-EGF septic mice. IFABP-EGF mice had improved 7-day mortality compared with WT septic mice (6% vs. 64%). Since enterocyte-specific overexpression of EGF is sufficient to prevent peritonitis-induced intestinal barrier dysfunction and confers a survival advantage, the protective effects of systemic EGF in septic peritonitis appear to be mediated in an intestine-specific fashion.

Deletion of epidermal Rac1 inhibits HPV-8 induced skin papilloma formation and facilitates HPV-8- and UV-light induced skin carcinogenesis.

Science.gov (United States)

Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo

2016-09-06

Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.

Simultaneous cell death and desquamation of the embryonic diffusion barrier during epidermal development

International Nuclear Information System (INIS)

Saathoff, Manuela; Blum, Barbara; Quast, Thomas; Kirfel, Gregor; Herzog, Volker

2004-01-01

The periderm is an epithelial layer covering the emerging epidermis in early embryogenesis of vertebrates. In the chicken embryo, an additional cellular layer, the subperiderm, occurs at later embryonic stages underneath the periderm. The questions arose what is the function of both epithelial layers and, as they are transitory structures, by which mechanism are they removed. By immunocytochemistry, the tight junction (TJ) proteins occludin and claudin-1 were localized in the periderm and in the subperiderm, and sites of close contact between adjacent cells were detected by electron microscopy. Using horseradish peroxidase (HRP) as tracer, these contacts were identified as tight junctions involved in the formation of the embryonic diffusion barrier. This barrier was lost by desquamation at the end of the embryonic period, when the cornified envelope of the emerging epidermis was formed. By TUNEL and DNA ladder assays, we detected simultaneous cell death in the periderm and the subperiderm shortly before hatching. The absence of caspases-3, -6, and -7 activity, key enzymes of apoptosis, and the lack of typical morphological criteria of apoptosis such as cell fragmentation or membrane blebbing point to a special form of programmed cell death (PCD) leading to the desquamation of the embryonic diffusion barrier

Study Tranport Barrier Formation using Bi- Stable Sandpile Model

International Nuclear Information System (INIS)

Kitpitak, B.; Kanjanaput, W.; Poolyarat, N.; Picha, R; Onjun, T.

2014-01-01

The formation of plasma transport barrier in Tokamak is an important issue for achieving high energy confinement and sufficient fusion performance. The simulation using in this experiment simulates cycles of dropping grains in a sandpile with two stable and two unstable slope regimes which share the same characteristic as the formation of pedestal and there are several parameters used, including stable boundaries, grains in a toppling, relax process iterations per cycle, grains in a drop and number of drops per cycle. By using this simulation, the effects of the relaxation times and number of trooping grain (the number of collapsing grain in the relaxation process) can be investigated. It is found in the simulations that the pedestal region can be observed only when the number of deposited grain exceeds a critical value which is related to number of relaxation times and number of allowed trooping grain. In another words, the pedestal formation occurs when the particle deposition rate is higher than the average diffusion rate. In addition, altering amount of trooping grain can lead to remarkable effects on slope and height of the profiles. In order to achieve better energy confinement, further study of formation of plasma transport barrier is needed.

Edge and internal transport barrier formations in CHS

International Nuclear Information System (INIS)

Okamura, S.; Minami, T.; Akiyama, T.; Fujisawa, A.; Ida, K.; Iguchi, H.; Isobe, M.; Nagaoka, K.; Nakamura, K.; Nishimura, S.; Matsuoka, K.; Matsushita, H.; Nakano, H.; Nishiura, M.; Ohshima, S.; Shimizu, A.; Suzuki, C.; Takahashi, C.; Toi, K.; Yoshimura, Y.; Yoshinuma, M.; Oishi, T.; Kado, S.

2005-01-01

Edge transport barrier (ETB) formation was observed in CHS. Sharp decrease of Hα emission indicates the quick transition of edge particle transport. Increase of the density gradient at the edge was measured by various profile diagnostics and the improvement of the global energy confinement was confirmed based on the stellarator confinement scaling. The heating power threshold exists. The transition and back transition is controlled by the heating power. The local density measurement by the beam emission spectroscopy shows intermittent burst of the low frequency fluctuations during the ETB formation phase. The ETB formation together with the electron temperature increase (electron ITB) in the core region were observed for the NBI discharges without ECH. (author)

Rapid formation of a sea ice barrier east of Svalbard

Science.gov (United States)

Nghiem, S. V.; van Woert, M. L.; Neumann, G.

2005-11-01

Daily SeaWinds scatterometer images acquired by the QuikSCAT satellite show an elongated sea ice feature that formed very rapidly (˜1-2 days) in November 2001 east of Svalbard over the Barents Sea. This sea ice structure, called "the Svalbard sea ice barrier," spanning approximately 10° in longitude and 2° in latitude, restricts the sea route and poses a significant navigation hazard. The secret of its formation appears to lie in the bottom of the sea: A comparison between bathymetry from the International Bathymetric Chart of the Arctic Ocean data and the pattern of sea ice formation from scatterometer data reveals that the sea ice barrier conforms well with and stretches above a deep elongated channel connecting the Franz Josef-Victoria Trough to the Hinlopen Basin between Svalbard and Franz Josef Land. Historic hydrographic data from this area indicate that this sea channel contains cold Arctic water less than 50 m below the surface. Strong and persistent cold northerly winds force strong heat loss from this shallow surface layer, leading to the rapid formation of the sea ice barrier. Heat transfer rates estimated from European Centre for Medium-Range Weather Forecasts temperature and wind data over this region suggest that the surface water along the deep channel can be rapidly cooled to the freezing point. Scatterometer results in 1999-2003 show that sea ice forms in this area between October and December. Understanding the ice formation mechanisms helps to select appropriate locations for deployment of buoys measuring wind and air-sea temperature profile and to facilitate ice monitoring, modeling, and forecasting.

Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

Directory of Open Access Journals (Sweden)

Zobiri O

2012-02-01

Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

Topical antihistamines display potent anti-inflammatory activity linked in part to enhanced permeability barrier function

DEFF Research Database (Denmark)

Lin, Tzu-Kai; Man, Mao-Qiang; Santiago, Juan-Luis

2013-01-01

antagonists likely oppose mast cell-derived histamines. In four immunologically diverse, murine disease models, characterized by either inflammation alone (acute irritant contact dermatitis, acute allergic contact dermatitis) or by prominent barrier abnormalities (subacute allergic contact dermatitis, atopic...... of epidermal differentiation, leading to thickened cornified envelopes; and (ii) enhanced epidermal lipid synthesis and secretion. As barrier homeostasis was enhanced to a comparable extent in mast cell-deficient mice, with no further improvement following application of topical H1/2r antagonists, H1/2r...... dermatitis), topical H1/2r agonists aggravated, whereas H1/2r antagonists improved, inflammation and/or barrier function. The apparent ability of topical H1r/2r antagonists to target epidermal H1/2r could translate into increased efficacy in the treatment of inflammatory dermatoses, likely due to decreased...

Formation of core transport barrier and CH-Mode by ion Bernstein wave heating in PBX-M

International Nuclear Information System (INIS)

Ono, M.; Bell, R.; Bernabei, S.; Gettelfinger, G.; Hatcher, R.; Kaita, R.; Kaye, S.; Kugel, H.; LeBlanc, B.; Manickam, J.

1995-01-01

Observation of core transport barrier formation (for particles, ion and electron energies, and toroidal momentum) by ion Bernstein wave heating (IBWH) in PBX-M plasma is reported. The formation of a transport barrier leads to a strong peaking and significant increase of the core pressure (70%) and toroidal momentum (20%), and has been termed the core-high confinement mode (CH-Mode). This formation of a transport barrier is consistent, in terms of the expected barrier location as well as the required threshold power, with a theoretical model based on the poloidal sheared flow generation by the ion Bernstein wave power. The use of ion Bernstein wave (IBW) induced sheared flow as a tool to control plasma pressure and bootstrap current profiles shows a favorable scaling for the use in future reactor grade tokamak plasmas

Perceived benefits and barriers of physical activity: A social marketing formative study.

Science.gov (United States)

Rundle-Thiele, Sharyn; Kubacki, Krzysztof; Gruneklee, Naomi

2016-01-01

The aim of this study was to gain formative research insights that can be used to design social marketing campaigns. One thousand four hundred fifty-nine people participated in an online survey. Factor analysis was undertaken to establish perceived benefits and barriers, and indexes were created for barriers, benefits, and healthy living knowledge. Four attitude groups were formed and analysis of variance was undertaken to explore group differences. Consumers with high perceived barriers report less physical activity than consumers with low perceived barriers to exercise. The current study provides evidence to suggest that exchange theory can offer important insights to inform social marketing intervention planning.

The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology

DEFF Research Database (Denmark)

Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J

2017-01-01

The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....

Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.

NARCIS (Netherlands)

Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der

2003-01-01

The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol

Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

Science.gov (United States)

Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

2016-02-01

Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

Gromwell (Lithospermum erythrorhizon) Supplementation Enhances Epidermal Levels of Ceramides, Glucosylceramides, β-Glucocerebrosidase, and Acidic Sphingomyelinase in NC/Nga Mice

OpenAIRE

Kim, Jungmin; Cho, Yunhi

2013-01-01

We have previously reported that dietary gromwell (Lithospermum erythrorhizon; LE) prevents the development of atopic dermatitis (AD) with increased epidermal levels of total ceramide (Cer), the major lipid maintaining epidermal barrier. In this study, we investigated whether the increased level of total Cer induced by dietary LE would be related to the altered metabolism of glucosylceramide (GlcCer) and sphingomyelin (SM), two major precursor lipids in Cer generation. NC/Nga mice, an animal ...

Edge transport barrier formation in compact helical system

International Nuclear Information System (INIS)

Okamura, S; Minami, T; Oishi, T; Suzuki, C; Ida, K; Isobe, M; Yoshimura, Y; Nagaoka, K; Toi, K; Fujisawa, A; Akiyama, T; Iguchi, H; Ikeda, R; Kado, S; Matsuoka, K; Matsushita, H; Nakamura, K; Nakano, H; Nishimura, S; Nishiura, M; Ohshima, S; Shimizu, A; Takagi, S; Takahashi, C; Takeuchi, M; Yoshinuma, M

2004-01-01

The edge transport barrier (ETB) for particle transport is formed in the neutral beam (NB) heated hydrogen discharges in compact helical system (CHS). The transition to the ETB formation and the back transition are controlled by the heating power. The existence of the heating power threshold is confirmed and it is roughly proportional to the density. The Hα emission signal shows a clear drop at the transition (the timescale of signal decrease is ∼1 ms for the high heating power case). The ETB formation continues for the full duration of NB injection (100 ms) with a moderate level of radiation power loss. Local density profile measurement shows increase of the edge density and the movement of the density gradient region towards the edge

The Pseudomonas aeruginosa Type III Translocon Is Required for Biofilm Formation at the Epithelial Barrier

DEFF Research Database (Denmark)

Tran, Cindy S; Rangel, Stephanie M; Almblad, Henrik

2014-01-01

Clinical infections by Pseudomonas aeruginosa, a deadly Gram-negative, opportunistic pathogen of immunocompromised hosts, often involve the formation of antibiotic-resistant biofilms. Although biofilm formation has been extensively studied in vitro on glass or plastic surfaces, much less is known...... about biofilm formation at the epithelial barrier. We have previously shown that when added to the apical surface of polarized epithelial cells, P. aeruginosa rapidly forms cell-associated aggregates within 60 minutes of infection. By confocal microscopy we now show that cell-associated aggregates...... a previously unappreciated function for the type III translocon in the formation of P. aeruginosa biofilms at the epithelial barrier and demonstrate that biofilms may form at early time points of infection....

Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis

DEFF Research Database (Denmark)

Palmer, Colin N A; Irvine, Alan D; Terron-Kwiatkowski, Ana

2006-01-01

most genetic studies have focused on immunological mechanisms, a primary epithelial barrier defect has been anticipated. Filaggrin is a key protein that facilitates terminal differentiation of the epidermis and formation of the skin barrier. Here we show that two independent loss-of-function genetic...... variants (R510X and 2282del4) in the gene encoding filaggrin (FLG) are very strong predisposing factors for atopic dermatitis. These variants are carried by approximately 9% of people of European origin. These variants also show highly significant association with asthma occurring in the context of atopic...

Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.

Science.gov (United States)

Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A

2009-08-01

The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.

TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.

Science.gov (United States)

Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina

2012-10-01

Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.

Formation and collapse of internal transport barrier

International Nuclear Information System (INIS)

Fukuyama, A.; Itoh, K.; Itoh, S.I.; Yagi, M.

1999-01-01

A theoretical model of internal transport barrier (ITB) is developed. The transport model based on the self-sustained turbulence theory of the current-diffusive ballooning mode is extended to include the effects of ExB rotation shear. Delayed formation of ITB is observed in transport simulations. The influence of finite gyroradius is also discussed. Simulation of the current ramp-up experiment successfully described the radial profile of density, temperature and safety factor. A model of ITB collapse due to magnetic braiding is proposed. Sudden enhancement of transport triggered by overlapping of magnetic islands terminates ITB. The possibility of destabilizing global low-n modes is also discussed. (author)

Formation and collapse of internal transport barrier

International Nuclear Information System (INIS)

Fukuyama, A.; Itoh, K.; Itoh, S.-I.; Yagi, M.

2001-01-01

A theoretical model of internal transport barrier (ITB) is developed. The transport model based on the self-sustained turbulence theory of the current-diffusive ballooning mode is extended to include the effects of ExB rotation shear. Delayed formation of ITB is observed in transport simulations. The influence of finite gyroradius is also discussed. Simulation of the current ramp-up experiment successfully described the radial profile of density, temperature and safety factor. A model of ITB collapse due to magnetic braiding is proposed. Sudden enhancement of transport triggered by overlaping of magnetic islands terminates ITB. The possibility of destabilizing global low-n modes is also discussed. (author)

Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

Directory of Open Access Journals (Sweden)

Sabita N. Saldanha

2015-12-01

Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

[Progress in epidermal stem cells].

Science.gov (United States)

Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

2010-03-01

Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

Science.gov (United States)

Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

2016-01-01

Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

Study of Heat Flux Threshold and Perturbation Effect on Transport Barrier Formation Based on Bifurcation Model

International Nuclear Information System (INIS)

Chatthong, B.; Onjun, T.; Imbeaux, F.; Sarazin, Y.; Strugarek, A.; Picha, R.; Poolyarat, N.

2011-06-01

Full text: Formation of transport barrier in fusion plasma is studied using a simple one-field bistable S-curve bifurcation model. This model is characterized by an S-line with two stable branches corresponding to the low (L) and high (H) confinement modes, connected by an unstable branch. Assumptions used in this model are such that the reduction in anomalous transport is caused by v E velocity shear effect and also this velocity shear is proportional to pressure gradient. In this study, analytical and numerical approaches are used to obtain necessary conditions for transport barrier formation, i.e. the ratio of anomalous over neoclassical coefficients and heat flux thresholds which must be exceeded. Several profiles of heat sources are considered in this work including constant, Gaussian, and hyperbolic tangent forms. Moreover, the effect of perturbation in heat flux is investigated with respect to transport barrier formation

Pigmented epidermal cyst with dense collection of melanin: A rare entity - Report of a case with review of the literature.

Science.gov (United States)

Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald

2012-05-01

Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.

Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

OpenAIRE

Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

2013-01-01

Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

Embryonic Blood-Cerebrospinal Fluid Barrier Formation and Function

Directory of Open Access Journals (Sweden)

David eBueno

2014-10-01

Full Text Available During embryonic development and adult life, brain cavities and ventricles are filled with cerebrospinal fluid (CSF. CSF has attracted interest as an active signaling medium that regulates brain development, homeostasis and disease. CSF is a complex protein-rich fluid containing growth factors and signaling molecules that regulate multiple cell functions in the central nervous system (CNS. The composition and substance concentrations of CSF are tightly controlled. In recent years, it has been demonstrated that embryonic CSF (eCSF has a key function as a fluid pathway for delivering diffusible signals to the developing brain, thus contributing to the proliferation, differentiation and survival of neural progenitor cells, and to the expansion and patterning of the brain. From fetal stages through to adult life, CSF is primarily produced by the choroid plexus. The development and functional activities of the choroid plexus and other blood–brain barrier (BBB systems in adults and fetuses have been extensively analyzed. However, eCSF production and control of its homeostasis in embryos, from the closure of the anterior neuropore when the brain cavities become physiologically sealed, to the formation of the functional fetal choroid plexus, has not been studied in as much depth and remains open to debate. This review brings together the existing literature, some of which is based on experiments conducted by our research group, concerning the formation and function of a temporary embryonic blood–CSF barrier in the context of the crucial roles played by the molecules in eCSF.

Homozygous ALOXE3 Nonsense Variant Identified in a Patient with Non-Bullous Congenital Ichthyosiform Erythroderma Complicated by Superimposed Bullous Majocchi’s Granuloma: The Consequences of Skin Barrier Dysfunction

Directory of Open Access Journals (Sweden)

Tao Wang

2015-09-01

Full Text Available Non-bullous congenital ichthyosiform erythroderma (NBCIE is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272* in ALOXE3 (NM_001165960.1 in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband’s skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi’s granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi’s granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.

Identification and comparative analysis of the epidermal differentiation complex in snakes

Science.gov (United States)

Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

2017-01-01

The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630

In situ formation of magnetite reactive barriers in soil for waste stabilization

Science.gov (United States)

Moore, Robert C.

2003-01-01

Reactive barriers containing magnetite and methods for making magnetite reactive barriers in situ in soil for sequestering soil contaminants including actinides and heavy metals, organic materials, iodine and technetium are disclosed. According to one embodiment, a two-step reagent introduction into soil takes place. In the first step, free oxygen is removed from the soil by separately injecting into the soil aqueous solutions of iron (II) salt, for example FeCl.sub.2, and base, for example NaOH or NH.sub.3 in about a 1:1 volume ratio. Then, in the second step, similar reagents are injected a second time (however, according to about a 1:2 volume ratio, iron to salt) to form magnetite. The magnetite formation is facilitated, in part, due to slow intrusion of oxygen into the soil from the surface. The invention techniques are suited to injection of reagents into soil in proximity to a contamination plume or source allowing in situ formation of the reactive barrier at the location of waste or hazardous material. Mixing of reagents to form. precipitate is mediated and enhanced through movement of reagents in soil as a result of phenomena including capillary action, movement of groundwater, soil washing and reagent injection pressure.

Influence of epidermal hydration on the friction of human skin against textiles

OpenAIRE

Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

2008-01-01

Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

Retinoic Acid-Induced Epidermal Transdifferentiation in Skin

Directory of Open Access Journals (Sweden)

Yoshihiro Akimoto

2014-06-01

Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.

Influence of epidermal hydration on the friction of human skin against textile

NARCIS (Netherlands)

Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

2008-01-01

Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

Collisional Fragmentation Is Not a Barrier to Close-in Planet Formation

Energy Technology Data Exchange (ETDEWEB)

Wallace, Joshua; Tremaine, Scott [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Chambers, John, E-mail: joshuajw@princeton.edu [Department of Terrestrial Magnetism, Carnegie Institution for Science, Washington, DC 20015 (United States)

2017-11-01

Collisional fragmentation is shown to not be a barrier to rocky planet formation at small distances from the host star. Simple analytic arguments demonstrate that rocky planet formation via collisions of homogeneous gravity-dominated bodies is possible down to distances of order the Roche radius ( r {sub Roche}). Extensive N -body simulations with initial bodies ≳1700 km that include plausible models for fragmentation and merging of gravity-dominated bodies confirm this conclusion and demonstrate that rocky planet formation is possible down to ∼1.1 r {sub Roche}. At smaller distances, tidal effects cause collisions to be too fragmenting to allow mass buildup to a final, dynamically stable planetary system. We argue that even differentiated bodies can accumulate to form planets at distances that are not much larger than r {sub Roche}.

Epidermal Inclusion Cysts of The Breast

Directory of Open Access Journals (Sweden)

Amir R. Motabar

2009-02-01

Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

Role of the Blood-Brain Barrier in the Formation of Brain Metastases

Directory of Open Access Journals (Sweden)

István A. Krizbai

2013-01-01

Full Text Available The majority of brain metastases originate from lung cancer, breast cancer and malignant melanoma. In order to reach the brain, parenchyma metastatic cells have to transmigrate through the endothelial cell layer of brain capillaries, which forms the morphological basis of the blood-brain barrier (BBB. The BBB has a dual role in brain metastasis formation: it forms a tight barrier protecting the central nervous system from entering cancer cells, but it is also actively involved in protecting metastatic cells during extravasation and proliferation in the brain. The mechanisms of interaction of cancer cells and cerebral endothelial cells are largely uncharacterized. Here, we provide a comprehensive review on our current knowledge about the role of junctional and adhesion molecules, soluble factors, proteolytic enzymes and signaling pathways mediating the attachment of tumor cells to brain endothelial cells and the transendothelial migration of metastatic cells. Since brain metastases represent a great therapeutic challenge, it is indispensable to understand the mechanisms of the interaction of tumor cells with the BBB in order to find targets of prevention of brain metastasis formation.

Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice

Energy Technology Data Exchange (ETDEWEB)

Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)

2011-06-15

We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.

Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

DEFF Research Database (Denmark)

Bor, M V; Sørensen, B S; Vinter-Jensen, L

2000-01-01

BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

Magnetized advective accretion flows: formation of magnetic barriers in magnetically arrested discs

Science.gov (United States)

Mondal, Tushar; Mukhopadhyay, Banibrata

2018-05-01

We discuss the importance of large-scale strong magnetic field in the removal of angular momentum outward, as well as the possible origin of different kinds of magnetic barrier in advective, geometrically thick, sub-Keplerian accretion flows around black holes. The origin of this large-scale strong magnetic field near the event horizon is due to the advection of the magnetic flux by the accreting gas from the environment, say, the interstellar medium or a companion star, because of flux freezing. In this simplest vertically averaged, 1.5-dimensional disc model, we choose the maximum upper limit of the magnetic field, which the disc around a black hole can sustain. In this so called magnetically arrested disc model, the accreting gas either decelerates or faces the magnetic barrier near the event horizon by the accumulated magnetic field depending on the geometry. The magnetic barrier may knock the matter to infinity. We suggest that these types of flow are the building block to produce jets and outflows in the accreting system. We also find that in some cases, when matter is trying to go back to infinity after knocking the barrier, matter is prevented being escaped by the cumulative action of strong gravity and the magnetic tension, hence by another barrier. In this way, magnetic field can lock the matter in between these two barriers and it might be a possible explanation for the formation of episodic jet.

Electron internal transport barrier formation and dynamics in the plasma core of the TJ-II stellarator

Energy Technology Data Exchange (ETDEWEB)

Estrada, T [Laboratorio Nacional de Fusion por Confinamiento Magnetico, Asociacion Euratom-CIEMAT, 28040 Madrid (Spain); Krupnik, L [Institute of Plasma Physics, NSC ' KIPT' , Kharkov (Ukraine); Dreval, N [Institute of Plasma Physics, NSC ' KIPT' , Kharkov (Ukraine); Melnikov, A [Institute of Nuclear Fusion, RRC ' Kurchatov Institute' , Moscow, Russia (Russian Federation); Khrebtov, S M [Institute of Plasma Physics, NSC ' KIPT' , Kharkov (Ukraine); Hidalgo, C [Laboratorio Nacional de Fusion por Confinamiento Magnetico, Asociacion Euratom-CIEMAT, 28040 Madrid (Spain); Milligen, B van [Laboratorio Nacional de Fusion por Confinamiento Magnetico, Asociacion Euratom-CIEMAT, 28040 Madrid (Spain); Castejon, F [Laboratorio Nacional de Fusion por Confinamiento Magnetico, Asociacion Euratom-CIEMAT, 28040 Madrid (Spain); AscasIbar, E [Laboratorio Nacional de Fusion por Confinamiento Magnetico, Asociacion Euratom-CIEMAT, 28040 Madrid (Spain); Eliseev, L [Institute of Nuclear Fusion, RRC ' Kurchatov Institute' , Moscow, Russia (Russian Federation); Chmyga, A A [Institute of Plasma Physics, NSC ' KIPT' , Kharkov (Ukraine); Komarov, A D [Institute of Plasma Physics, NSC ' KIPT' , Kharkov (Ukraine); Kozachok, A S [Institute of Plasma Physics, NSC ' KIPT' , Kharkov (Ukraine); Tereshin, V [Institute of Plasma Physics, NSC ' KIPT' , Kharkov (Ukraine)

2004-01-01

The influence of magnetic topology on the formation of electron internal transport barriers (e-ITBs) has been studied experimentally in electron cyclotron heated plasmas in the stellarator TJ-II. e-ITB formation is characterized by an increase in core electron temperature and plasma potential. The positive radial electric field increases by a factor of 3 in the central plasma region when an e-ITB forms. The experiments reported demonstrate that the formation of an e-ITB depends on the magnetic configuration. Calculations of the modification of the rotational transform due to plasma current lead to the interpretation that the formation of an e-ITB can be triggered by positioning a low order rational surface close to the plasma core region. In configurations without any central low order rational, no barrier is formed for any accessible value of heating power. Different mechanisms associated with neoclassical/turbulent bifurcations and kinetic effects are put forward to explain the impact of magnetic topology on radial electric fields and confinement.

Role of lipids in the formation and maintenance of the cutaneous permeability barrier.

Science.gov (United States)

Feingold, Kenneth R; Elias, Peter M

2014-03-01

The major function of the skin is to form a barrier between the internal milieu and the hostile external environment. A permeability barrier that prevents the loss of water and electrolytes is essential for life on land. The permeability barrier is mediated primarily by lipid enriched lamellar membranes that are localized to the extracellular spaces of the stratum corneum. These lipid enriched membranes have a unique structure and contain approximately 50% ceramides, 25% cholesterol, and 15% free fatty acids with very little phospholipid. Lamellar bodies, which are formed during the differentiation of keratinocytes, play a key role in delivering the lipids from the stratum granulosum cells into the extracellular spaces of the stratum corneum. Lamellar bodies contain predominantly glucosylceramides, phospholipids, and cholesterol and following the exocytosis of lamellar lipids into the extracellular space of the stratum corneum these precursor lipids are converted by beta glucocerebrosidase and phospholipases into the ceramides and fatty acids, which comprise the lamellar membranes. The lipids required for lamellar body formation are derived from de novo synthesis by keratinocytes and from extra-cutaneous sources. The lipid synthetic pathways and the regulation of these pathways are described in this review. In addition, the pathways for the uptake of extra-cutaneous lipids into keratinocytes are discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Published by Elsevier B.V.

Formation and evolution of the glow-like dielectric barrier discharge at atmospheric pressure

NARCIS (Netherlands)

Starostin, S.A.; ElSabbagh, M.A.M.; Premkumar, P.A.; Vries, de H.W.; Paffen, R.M.J.; Creatore, M.; Sanden, van de M.C.M.

2008-01-01

Time resolved process of formation and evolution of the atmospheric pressure glow discharge was studied in the roll-to- roll plasma- enhanced chemical vapor deposition dielectric barrier discharge reactor operating in helium-free gas mixtures by means of fast ICCD imaging. It was observed that the

Physics of turbulence control and transport barrier formation in DIII-D

International Nuclear Information System (INIS)

Doyle, E.J.; Burrell, K.H.; Carlstrom, T.N.

1996-10-01

This paper describes the physical mechanisms responsible for turbulence control and transport barrier formation on DIII-D as determined from a synthesis of results from different enhanced confinement regimes, including quantitative and qualitative comparisons to theory. A wide range of DIII-D data support the hypothesis that a single underlying physical mechanism, turbulence suppression via E x B shear flow is playing an essential, though not necessarily unique, role in reducing turbulence and transport in all of the following improved confinement regimes: H-mode, VH-mode, high-ell i modes, improved performance counter-injection L-mode discharges and high performance negative central shear (NCS) discharges. DIII-D data also indicate that synergistic effects are important in some cases, as in NCS discharges where negative magnetic shear also plays a role in transport barrier formation. This work indicates that in order to control turbulence and transport it is important to focus on understanding physical mechanisms, such as E x B shear, which can regulate and control entire classes of turbulent modes, and thus control transport. In the highest performance DIII-D discharges, NCS plasmas with a VH-mode like edge, turbulence is suppressed at all radii, resulting in neoclassical levels of ion transport over most of the plasma volume

THE ROLE OF EPIDERMAL BARRIER IMPAIRMENTS IN ATOPIC DERMATITIS: MODERN CONCEPTS OF DISEASE PATHOGENESIS

Directory of Open Access Journals (Sweden)

Nikolay N. Murashkin

2018-01-01

Full Text Available Atopic dermatitis is a common chronic inflammatory skin disease characterized by a recurring course and progressive decrease in the quality of life. Recent studies in this area demonstrate the multifaceted pathogenesis of atopic dermatitis. Interaction of such factors as epidermal dysfunction, immune system disorders, and the consequences of genetic mutations contributes not only to the development of the disease but also to its progression and chronic course. The article presents various components of the etiopathogenesis of atopic dermatitis, describes the role of lipids, thereby the new therapeutic targets are revealed to specialists.

Compartmentalized Epidermal Activation of β-Catenin Differentially Affects Lineage Reprogramming and Underlies Tumor Heterogeneity

Directory of Open Access Journals (Sweden)

Kai Kretzschmar

2016-01-01

Full Text Available Wnt/β-catenin activation in adult epidermis can induce new hair follicle formation and tumor development. We used lineage tracing to uncover the relative contribution of different stem cell populations. LGR6+ and LRIG1+ stem cells contributed to ectopic hair follicles formed in the sebaceous gland upon β-catenin activation, whereas LGR5+ cells did not. Lgr6, but not Lrig1 or Lgr5, was expressed in a subpopulation of interfollicular epidermal cells that were competent to form new hair follicles. Oncogenic β-catenin expression in LGR5+ cells led to formation of pilomatricomas, while LRIG1+ cells formed trichoadenomas and LGR6+ cells formed dermatofibromas. Tumor formation was always accompanied by a local increase in dermal fibroblast density and transient extracellular matrix remodeling. However, each tumor had a distinct stromal signature in terms of immune cell infiltrate and expression of CD26 and CD44. We conclude that compartmentalization of epidermal stem cells underlies different responses to β-catenin and skin tumor heterogeneity.

UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

International Nuclear Information System (INIS)

Olsen, W.M.; Elgjo, K.

1990-01-01

A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

The influence of tethered epidermal growth factor on connective tissue progenitor colony formation

OpenAIRE

Marcantonio, Nicholas A.; Boehm, Cynthia A.; Rozic, Richard J.; Au, Ada; Wells, Alan; Muschler, George F.; Griffith, Linda G.

2009-01-01

Strategies to combine aspirated marrow cells with scaffolds to treat connective tissue defects are gaining increasing clinical attention and use. In situations such as large defects where initial survival and proliferation of transplanted connective tissue progenitors (CTPs) are limiting, therapeutic outcomes might be improved by using the scaffold to deliver growth factors that promote the early stages of cell function in the graft. Signaling by the epidermal growth factor receptor (EGFR) pl...

Dynamical barrier for the formation of solitary waves in discrete lattices

International Nuclear Information System (INIS)

Kevrekidis, P.G.; Espinola-Rocha, J.A.; Drossinos, Y.; Stefanov, A.

2008-01-01

We consider the problem of the existence of a dynamical barrier of 'mass' that needs to be excited on a lattice site to lead to the formation and subsequent persistence of localized modes for a nonlinear Schroedinger lattice. We contrast the existence of a dynamical barrier with its absence in the static theory of localized modes in one spatial dimension. We suggest an energetic criterion that provides a sufficient, but not necessary, condition on the amplitude of a single-site initial condition required to form a solitary wave. We show that this effect is not one-dimensional by considering its two-dimensional analog. The existence of a sufficient condition for the excitation of localized modes in the non-integrable, discrete, nonlinear Schroedinger equation is compared to the dynamics of excitations in the integrable, both discrete and continuum, version of the nonlinear Schroedinger equation

The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

Science.gov (United States)

Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

2004-12-03

The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

Ring distributions leading to species formation: a global topographic analysis of geographic barriers associated with ring species.

Science.gov (United States)

Monahan, William B; Pereira, Ricardo J; Wake, David B

2012-03-12

In the mid 20th century, Ernst Mayr and Theodosius Dobzhansky championed the significance of circular overlaps or ring species as the perfect demonstration of speciation, yet in the over 50 years since, only a handful of such taxa are known. We developed a topographic model to evaluate whether the geographic barriers that favor processes leading to ring species are common or rare, and to predict where other candidate ring barriers might be found. Of the 952,147 geographic barriers identified on the planet, only about 1% are topographically similar to barriers associated with known ring taxa, with most of the likely candidates occurring in under-studied parts of the world (for example, marine environments, tropical latitudes). Predicted barriers separate into two distinct categories: (i) single cohesive barriers (barriers - formed by groups of barriers (each 184,000 to 1.7 million km2) in close geographic proximity (totaling 1.9 to 2.3 million km2) - associated with taxa that differentiate at larger spatial scales (birds: Phylloscopus trochiloides and Larus (sp. argentatus and fuscus)). When evaluated globally, we find a large number of cohesive barriers that are topographically similar to those associated with known ring taxa. Yet, compared to cohesive barriers, an order of magnitude fewer composite barriers are similar to those that favor ring divergence in species with higher dispersal. While these findings confirm that the topographic conditions that favor evolutionary processes leading to ring speciation are, in fact, rare, they also suggest that many understudied natural systems could provide valuable demonstrations of continuous divergence towards the formation of new species. Distinct advantages of the model are that it (i) requires no a priori information on the relative importance of features that define barriers, (ii) can be replicated using any kind of continuously distributed environmental variable, and (iii) generates spatially explicit hypotheses of

Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

Science.gov (United States)

Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

2013-06-01

In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

International Nuclear Information System (INIS)

Han, S.R.

1988-01-01

The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

Science.gov (United States)

Kawano, Ken-Ichi; Umemura, Kazuo

2013-05-01

The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

Shottky-barrier formation

International Nuclear Information System (INIS)

Guines, F.; Sanchez-Dehesa, J.; Flores, F.

1983-01-01

In this paper a realistic selfconsistent calculation of an abrupt metal-semiconductor junction is presented by means of a tight-binding approach. A specific Si-Ag junction has been considered, and the charge neutrality level as well as the barrier height have been determined in good agreement with experiments. For a generaljunction it is shown that the interface properties depend essentially on the characteristics of the first metal layer and its interaction with the semiconductor. (Author) [pt

Skin barrier properties in patients with recessive X-linked ichthyosis

DEFF Research Database (Denmark)

Johansen, J D; Ramsing, D; Vejlsgaard, G

1995-01-01

Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...

Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

Directory of Open Access Journals (Sweden)

Daniela GUZMÁN-URIBE

Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

Dynamical barrier for the formation of solitary waves in discrete lattices

Energy Technology Data Exchange (ETDEWEB)

Kevrekidis, P.G. [Department of Mathematics and Statistics, University of Massachusetts, Amherst, MA 01003 (United States)], E-mail: kevrekid@math.umass.edu; Espinola-Rocha, J.A. [Department of Mathematics and Statistics, University of Massachusetts, Amherst, MA 01003 (United States); Drossinos, Y. [European Commission, Joint Research Centre, I-21020 Ispra (Vatican City State, Holy See,) (Italy); School of Mechanical and Systems Engineering, University of Newcastle upon Tyne, Newcastle upon Tyne NE1 7RU (United Kingdom); Stefanov, A. [Department of Mathematics, University of Kansas, 1460 Jayhawk Blvd., Lawrence, KS 66045-7523 (United States)

2008-03-24

We consider the problem of the existence of a dynamical barrier of 'mass' that needs to be excited on a lattice site to lead to the formation and subsequent persistence of localized modes for a nonlinear Schroedinger lattice. We contrast the existence of a dynamical barrier with its absence in the static theory of localized modes in one spatial dimension. We suggest an energetic criterion that provides a sufficient, but not necessary, condition on the amplitude of a single-site initial condition required to form a solitary wave. We show that this effect is not one-dimensional by considering its two-dimensional analog. The existence of a sufficient condition for the excitation of localized modes in the non-integrable, discrete, nonlinear Schroedinger equation is compared to the dynamics of excitations in the integrable, both discrete and continuum, version of the nonlinear Schroedinger equation.

The formation of hydrogen permeation barriers on steels by aluminising

Science.gov (United States)

Forcey, K. S.; Ross, D. K.; Wu, C. H.

1991-06-01

An extensive investigation has been carried out into the effectiveness of aluminised layers as permeation barriers on AISI 316L stainless and DIN 1.4914 martensitic steels. The study involved measurement of the hydrogen permeation rate through commercially aluminised steel discs of thicknesses in the range 1-1.6 mm, at temperatures between 250 and 600 °C and for an upstream hydrogen pressure of 10 5 Pa. The composition and structure of the aluminide layers were investigated by a number of techniques such as SEM, electron beam microprobe and X-ray diffraction. Accelerator based techniques such as RBS and NRA were employed to study the top micron or so of the surfaces of the samples. By these techniques it was found that the effectiveness of the permeation barrier depended on the formation of a thin surface oxide layer consisting of Al 2O 3. It was found that the permeation rate through the aluminised steels could be reduced by 3-4 orders of magnitude by forming a surface oxide layer up to a micron or so in thickness.

Sub-barrier quasifission in heavy element formation reactions with deformed actinide target nuclei

Science.gov (United States)

Hinde, D. J.; Jeung, D. Y.; Prasad, E.; Wakhle, A.; Dasgupta, M.; Evers, M.; Luong, D. H.; du Rietz, R.; Simenel, C.; Simpson, E. C.; Williams, E.

2018-02-01

Background: The formation of superheavy elements (SHEs) by fusion of two massive nuclei is severely inhibited by the competing quasifission process. Low excitation energies favor SHE survival against fusion-fission competition. In "cold" fusion with spherical target nuclei near 208Pb, SHE yields are largest at beam energies significantly below the average capture barrier. In "hot" fusion with statically deformed actinide nuclei, this is not the case. Here the elongated deformation-aligned configurations in sub-barrier capture reactions inhibits fusion (formation of a compact compound nucleus), instead favoring rapid reseparation through quasifission. Purpose: To determine the probabilities of fast and slow quasifission in reactions with prolate statically deformed actinide nuclei, through measurement and quantitative analysis of the dependence of quasifission characteristics at beam energies spanning the average capture barrier energy. Methods: The Australian National University Heavy Ion Accelerator Facility and CUBE fission spectrometer have been used to measure fission and quasifission mass and angle distributions for reactions with projectiles from C to S, bombarding Th and U target nuclei. Results: Mass-asymmetric quasifission occurring on a fast time scale, associated with collisions with the tips of the prolate actinide nuclei, shows a rapid increase in probability with increasing projectile charge, the transition being centered around projectile atomic number ZP=14 . For mass-symmetric fission events, deviations of angular anisotropies from expectations for fusion fission, indicating a component of slower quasifission, suggest a similar transition, but centered around ZP˜8 . Conclusions: Collisions with the tips of statically deformed prolate actinide nuclei show evidence for two distinct quasifission processes of different time scales. Their probabilities both increase rapidly with the projectile charge. The probability of fusion can be severely

Standards for the Protection of Skin Barrier Function.

Science.gov (United States)

Giménez-Arnau, Ana

2016-01-01

The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.

Lamellar granule secretion starts before the establishment of tight junction barrier for paracellular tracers in mammalian epidermis.

Directory of Open Access Journals (Sweden)

Akemi Ishida-Yamamoto

Full Text Available Defects in epidermal barrier function and/or vesicular transport underlie severe skin diseases including ichthyosis and atopic dermatitis. Tight junctions (TJs form a single layered network in simple epithelia. TJs are important for both barrier functions and vesicular transport. Epidermis is stratified epithelia and lamellar granules (LGs are secreted from the stratum granulosum (SG in a sequential manner. Previously, continuous TJs and paracellular permeability barriers were found in the second layer (SG2 of SG in mice, but their fate and correlation with LG secretion have been poorly understood. We studied epidermal TJ-related structures in humans and in mice and found occludin/ZO-1 immunoreactive multilayered networks spanning the first layer of SG (SG1 and SG2. Paracellular penetration tracer passed through some TJs in SG2, but not in SG1. LG secretion into the paracellular tracer positive spaces started below the level of TJs of SG1. Our study suggests that LG-secretion starts before the establishment of TJ barrier in the mammalian epidermis.

Ring distributions leading to species formation: a global topographic analysis of geographic barriers associated with ring species

Directory of Open Access Journals (Sweden)

Monahan William B

2012-03-01

Full Text Available Abstract Background In the mid 20th century, Ernst Mayr and Theodosius Dobzhansky championed the significance of circular overlaps or ring species as the perfect demonstration of speciation, yet in the over 50 years since, only a handful of such taxa are known. We developed a topographic model to evaluate whether the geographic barriers that favor processes leading to ring species are common or rare, and to predict where other candidate ring barriers might be found. Results Of the 952,147 geographic barriers identified on the planet, only about 1% are topographically similar to barriers associated with known ring taxa, with most of the likely candidates occurring in under-studied parts of the world (for example, marine environments, tropical latitudes. Predicted barriers separate into two distinct categories: (i single cohesive barriers (2, associated with taxa that differentiate at smaller spatial scales (salamander: Ensatina eschscholtzii; tree: Acacia karroo; and (ii composite barriers - formed by groups of barriers (each 184,000 to 1.7 million km2 in close geographic proximity (totaling 1.9 to 2.3 million km2 - associated with taxa that differentiate at larger spatial scales (birds: Phylloscopus trochiloides and Larus (sp. argentatus and fuscus. When evaluated globally, we find a large number of cohesive barriers that are topographically similar to those associated with known ring taxa. Yet, compared to cohesive barriers, an order of magnitude fewer composite barriers are similar to those that favor ring divergence in species with higher dispersal. Conclusions While these findings confirm that the topographic conditions that favor evolutionary processes leading to ring speciation are, in fact, rare, they also suggest that many understudied natural systems could provide valuable demonstrations of continuous divergence towards the formation of new species. Distinct advantages of the model are that it (i requires no a priori information on the

Selective ablation of the androgen receptor in mouse sertoli cells affects sertoli cell maturation, barrier formation and cytoskeletal development.

Directory of Open Access Journals (Sweden)

Ariane Willems

2010-11-01

Full Text Available The observation that mice with a selective ablation of the androgen receptor (AR in Sertoli cells (SC (SCARKO mice display a complete block in meiosis supports the contention that SC play a pivotal role in the control of germ cell development by androgens. To delineate the physiological and molecular mechanism responsible for this control, we compared tubular development in pubertal SCARKO mice and littermate controls. Particular attention was paid to differences in SC maturation, SC barrier formation and cytoskeletal organization and to the molecular mediators potentially involved. Functional analysis of SC barrier development by hypertonic perfusion and lanthanum permeation techniques and immunohistochemical analysis of junction formation showed that SCARKO mice still attempt to produce a barrier separating basal and adluminal compartment but that barrier formation is delayed and defective. Defective barrier formation was accompanied by disturbances in SC nuclear maturation (immature shape, absence of prominent, tripartite nucleoli and SC polarization (aberrant positioning of SC nuclei and cytoskeletal elements such as vimentin. Quantitative RT-PCR was used to study the transcript levels of genes potentially related to the described phenomena between day 8 and 35. Differences in the expression of SC genes known to play a role in junction formation could be shown from day 8 for Cldn11, from day 15 for Cldn3 and Espn, from day 20 for Cdh2 and Jam3 and from day 35 for ZO-1. Marked differences were also noted in the transcript levels of several genes that are also related to cell adhesion and cytoskeletal dynamics but that have not yet been studied in SC (Actn3, Ank3, Anxa9, Scin, Emb, Mpzl2. It is concluded that absence of a functional AR in SC impedes the remodeling of testicular tubules expected at the onset of spermatogenesis and interferes with the creation of the specific environment needed for germ cell development.

The immigration delay disease: adermatoglyphia-inherited absence of epidermal ridges.

Science.gov (United States)

Burger, Bettina; Fuchs, Dana; Sprecher, Eli; Itin, Peter

2011-05-01

In the digital age, personal identification by fingerprints (epidermal ridges) has become more frequent and is often required for biometric passports. The more fingerprints are analyzed, the more variants in their formation are documented. Individuals completely missing fingerprints as an isolated finding are extremely rare. Only 4 kindreds have been described to date, with additional clinical features in most cases. We describe a female patient with missing epidermal ridges on the fingers, palms, toes, and soles as an isolated feature. Absent fingerprints, or adermatoglyphia, were inherited over 4 generations of her family in an autosomal dominant fashion. We present the clinical features of the index patient, and compare the case with previous reports in the literature. Because of problems in personal identification, this embryologic malformation caused the patient significant difficulties when traveling to other countries, which is why we name it the immigration delay disease. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

Science.gov (United States)

Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

2013-11-01

The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Comparative SAXS and DSC study on stratum corneum structural organization in an epidermal cell culture model (ROC)

DEFF Research Database (Denmark)

Kuntsche, Judith; Herre, Angela; Fahr, Alfred

2013-01-01

barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...

Simple preparation of plant epidermal tissue for laser microdissection and downstream quantitative proteome and carbohydrate analysis

Directory of Open Access Journals (Sweden)

Christian eFalter

2015-03-01

Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.

Outcome of burns treated with autologous cultured proliferating epidermal cells: a prospective randomized multicenter intrapatient comparative trial

NARCIS (Netherlands)

Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.

2016-01-01

Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,

Evidence for a role of eosinophils in blister formation in bullous pemphigoid.

Science.gov (United States)

de Graauw, E; Sitaru, C; Horn, M; Borradori, L; Yousefi, S; Simon, H-U; Simon, D

2017-07-01

Bullous pemphigoid (BP) is an autoimmune bullous disease of the skin characterized by subepidermal blister formation due to tissue-bound and circulating autoantibodies to the hemidesmosomal antigens BP180 and BP230. Although eosinophils and their toxic mediators are found abundantly in BP lesions, their role in blister formation has remained unclear. To investigate the role of eosinophils in the pathogenesis of BP with a specific focus on blister formation and to define conditions inducing dermal-epidermal separation (DES). In an ex vivo human model of BP, normal human skin cryosections were incubated with purified human peripheral blood eosinophils with or without activation in the presence or absence of BP autoantibodies, brefeldin A, diphenyleneiodonium, DNase or blocking F(ab') 2 fragments to CD16, CD18, CD32 and CD64. Dermal-epidermal separation was assessed by light microscopy studies and quantified using Fiji software. Following activation with IL-5 and in the presence of BP autoantibodies, eosinophils induced separation along the dermal-epidermal junction of ex vivo skin. Dermal-epidermal separation was significantly reduced by blocking any of the following: Fcγ receptor binding (P = 0.048), eosinophil adhesion (P = 0.046), reactive oxygen species (ROS) production (P = 0.002), degranulation (P eosinophil extracellular trap (EET) formation (P = 0.048). Our results provide evidence that IL-5-activated eosinophils directly contribute to BP blister formation in the presence of BP autoantibodies. Dermal-epidermal separation by IL-5-activated eosinophils depends on adhesion and Fcγ receptor activation, requires elevated ROS production and degranulation and involves EET formation. Thus, targeting eosinophils may be a promising therapeutic approach for BP. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

An ex vivo human skin model for studying skin barrier repair.

Science.gov (United States)

Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A

2015-01-01

In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Epidermal stem cells: location, potential and contribution to cancer.

Science.gov (United States)

Ambler, C A; Määttä, A

2009-01-01

Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.

Science.gov (United States)

Del Rosso, James Q; Kircik, Leon H

2013-07-01

Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

Distribution of epidermal growth factor receptors in rat tissues during embryonic skin development, hair formation, and the adult hair growth cycle

DEFF Research Database (Denmark)

Green, M R; Couchman, J R

1984-01-01

on the binding distribution of [125I]EGF, representing the tissue localization of available EGF receptors, during embryonic rat skin development including hair follicle formation and the adult hair growth cycle. At 16 days embryonic development a relatively low receptor density is seen over all the epidermal...... condensates marking the first stage of hair follicle development. This restricted and temporary loss of EGF receptors above these specialized mesenchymal condensates implies a role for the EGF receptor and possibly EGF or an EGF-like ligand in stimulating the epithelial downgrowth required for hair follicle...... development. In the anagen hair bulb, receptors for EGF are detected over the outer root sheath and the epithelial cell layers at the base of the follicle and show a correlation with the areas of epithelial proliferation in the hair bulb. During the catagen and telogen phases of the hair cycle, receptors...

Identification of novel immune and barrier genes in atopic dermatitis by means of laser capture microdissection

DEFF Research Database (Denmark)

Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin

2015-01-01

are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...

Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

DEFF Research Database (Denmark)

Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

2009-01-01

To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

Formation mechanism of dot-line square superlattice pattern in dielectric barrier discharge

Energy Technology Data Exchange (ETDEWEB)

Liu, Weibo; Dong, Lifang, E-mail: donglfhbu@163.com, E-mail: pyy1616@163.com; Wang, Yongjie; Zhang, Xinpu [College of Physics Science and Technology, Hebei University, Baoding 071002 (China); College of Quality and Technical Supervision, Hebei University, Baoding 071002 (China); Pan, Yuyang, E-mail: donglfhbu@163.com, E-mail: pyy1616@163.com [College of Quality and Technical Supervision, Hebei University, Baoding 071002 (China)

2014-11-15

We investigate the formation mechanism of the dot-line square superlattice pattern (DLSSP) in dielectric barrier discharge. The spatio-temporal structure studied by using the intensified-charge coupled device camera shows that the DLSSP is an interleaving of three different subpatterns in one half voltage cycle. The dot square lattice discharges first and, then, the two kinds of line square lattices, which form square grid structures discharge twice. When the gas pressure is varied, DLSSP can transform from square superlattice pattern (SSP). The spectral line profile method is used to compare the electron densities, which represent the amounts of surface charges qualitatively. It is found that the amount of surface charges accumulated by the first discharge of DLSSP is less than that of SSP, leading to a bigger discharge area of the following discharge (lines of DLSSP instead of halos of SSP). The spatial distribution of the electric field of the surface charges is simulated to explain the formation of DLSSP. This paper may provide a deeper understanding for the formation mechanism of complex superlattice patterns in DBD.

Increased skin barrier disruption by sodium lauryl sulfate in mice expressing a constitutively active STAT6 in T cells.

Science.gov (United States)

DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B

2012-01-01

Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.

Toxic epidermal necrolysis successfully treated with etanercept.

Science.gov (United States)

Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

2009-03-01

Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

Directory of Open Access Journals (Sweden)

Yung-Yi Lee

2013-06-01

Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

H-Ras activation promotes cytoplasmic accumulation and phosphoinositide 3-OH kinase association of beta-catenin in epidermal keratinocytes

DEFF Research Database (Denmark)

Espada, J; Pérez-Moreno, M; Braga, V M

1999-01-01

The mechanisms underlying downregulation of the cadherin/catenin complexes and beta-catenin signaling during tumor progression are not fully understood. We have analyzed the effect of oncogenic H-Ras on E-cadherin/catenin complex formation/stabilization and beta-catenin distribution in epidermal ...

Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

Directory of Open Access Journals (Sweden)

Qian Zhao

2015-12-01

Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

The role of zonal flows and predator-prey oscillations in triggering the formation of edge and core transport barriers

Science.gov (United States)

Schmitz, L.; Zeng, L.; Rhodes, T. L.; Hillesheim, J. C.; Peebles, W. A.; Groebner, R. J.; Burrell, K. H.; McKee, G. R.; Yan, Z.; Tynan, G. R.; Diamond, P. H.; Boedo, J. A.; Doyle, E. J.; Grierson, B. A.; Chrystal, C.; Austin, M. E.; Solomon, W. M.; Wang, G.

2014-07-01

We present direct evidence of low frequency, radially sheared, turbulence-driven flows (zonal flows (ZFs)) triggering edge transport barrier formation preceding the L- to H-mode transition via periodic turbulence suppression in limit-cycle oscillations (LCOs), consistent with predator-prey dynamics. The final transition to edge-localized mode-free H-mode occurs after the equilibrium E × B flow shear increases due to ion pressure profile evolution. ZFs are also observed to initiate formation of an electron internal transport barrier (ITB) at the q = 2 rational surface via local suppression of electron-scale turbulence. Multi-channel Doppler backscattering (DBS) has revealed the radial structure of the ZF-induced shear layer and the E × B shearing rate, ωE×B, in both barrier types. During edge barrier formation, the shearing rate lags the turbulence envelope during the LCO by 90°, transitioning to anti-correlation (180°) when the equilibrium shear dominates the turbulence-driven flow shear due to the increasing edge pressure gradient. The time-dependent flow shear and the turbulence envelope are anti-correlated (180° out of phase) in the electron ITB. LCOs with time-reversed evolution dynamics (transitioning from an equilibrium-flow dominated to a ZF-dominated state) have also been observed during the H-L back-transition and are potentially of interest for controlled ramp-down of the plasma stored energy and pressure (normalized to the poloidal magnetic field) \\beta_{\\theta} =2\\mu_{0} n{( {T_{e} +T_{i}})}/{B_{\\theta}^{2}} in ITER.

Relationship between blood-retinal barrier development and formation of selenite nuclear cataract in rat

Directory of Open Access Journals (Sweden)

Ping Lu

2017-12-01

Full Text Available AIM: To investigate the relationship between development of blood-retinal barrier and formation of selenite nuclear cataract in rat. METHODS: Activity of GPx, MDA level in lens and selenium content in the eyeballs of different ages rats were determined. Besides, lanthanum hydroxide \\〖La(OH3\\〗 tracer method was used to detect development status of blood-retina barrier at different ages. RESULTS: The result showed that the enzyme activity of GPx was highest in young rats before open eyes, but then decreased gradually with age. Distribution of La(OH3 in retinal pigment epithelial layer of 20-day-old rats was significantly less than 11-day-old rats. Injecting sodium selenite to 9-day-old rats, lanthanum hydroxide increased obviously and extended to the inner layers of the retina after 48h, and the retinal pigment epithelial layer was damaged seriously; while injecting sodium selenite to 18-day-old rats with the same dose, number of lanthanum hydroxide decreased significantly and did not extend to the inner layer after 48h.Before opening eyes, the content of MDA in the lens of rats was the highest, and decreased significantly after opening eyes. The Se group was 5 times as that of the control group. Besides, in these groups of rats, selenium content in the eyeballs and MDA level in the lens were in agreement with the change of La(OH3 distribution. CONCLUSION: These results indicated that antioxidant capacity in the eyelid unopened rats is not the main reason for selenite induced cataract formation. The real reason is that blood-retina barrier development is not mature in the eyelid unopened rats.

Internal transport barrier formation and pellet injection simulation in helical and tokamak reactors

International Nuclear Information System (INIS)

Higashiyama, You; Yamazaki, Kozo; Arimoto, Hideki; Garcia, Jeronimo

2008-01-01

In the future fusion reactor, plasma density peaking is important for increase in the fusion power gain and for achievement of confinement improvement mode. Density control and internal transport barrier (ITB) formation due to pellet injection have been simulated in tokamak and helical reactors using the toroidal transport linkage code TOTAL. First, pellet injection simulation is carried out, including the neutral gas shielding model and the mass relocation model in the TOTAL code, and the effectiveness of high-field side (HFS) pellet injection is clarified. Second, ITB simulation with pellet injection is carried out with the confinement improvement model based on the E x B shear effects, and it is found that deep pellet penetration is helpful for ITB formation as well as plasma core fuelling in the reversed-shear tokamak and helical reactors. (author)

Transport barrier in Helical system

International Nuclear Information System (INIS)

Ida, Katsumi

1998-01-01

Experiments on the transport barrier in Helical plasmas are reviewed. There are two mechanisms of transport improvement, that results in the formation of the transport barrier. One is the improvement of neoclassical transport by reducing the ripple loss with radial electric field, which exist only in helical plasma. The other is the improvement of anomalous transport due to the suppression of fluctuations associated with a radial electric field shear both in tokamak and helical plasma. The formation of the transport barrier can be triggered by the radial electric field shear associated with the transition of the radial electric field (L/H transition or ion-electron root transition) or the peaked density or the optimization of magnetic field shear. The mechanisms of transport barrier formation are also discussed. (author). 60 refs

Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

International Nuclear Information System (INIS)

Ayyagari, R.R.; Khan-Dawood, F.S.

1987-01-01

Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

Improved fueling and transport barrier formation with pellet injection from different locations on DIII-D

International Nuclear Information System (INIS)

Baylor, L.R.; Jernigan, T.C.; Gohil, P.

2001-01-01

Pellet injection has been employed on DIII-D from different injection locations to optimize the mass deposition for density profile control and internal transport barrier formation. Transport barriers have been formed deep in the plasma core with central mass deposition from high field side (HFS) injected pellets and in the edge with pellets that trigger L-mode to H-mode transitions. Pellets injected from all locations can trigger the H-mode transition, which depends on the edge density gradient created and not on the radial extent of the pellet deposition. Pellets injected from inside the magnetic axis from the inner wall or vertical port lead to stronger central mass deposition than pellets injected from the low field side (LFS) and thus yield deeper more efficient fueling. (author)

Deficiency of vasodilator-stimulated phosphoprotein (VASP increases blood-brain-barrier damage and edema formation after ischemic stroke in mice.

Directory of Open Access Journals (Sweden)

Peter Kraft

2010-12-01

Full Text Available Stroke-induced brain edema formation is a frequent cause of secondary infarct growth and deterioration of neurological function. The molecular mechanisms underlying edema formation after stroke are largely unknown. Vasodilator-stimulated phosphoprotein (VASP is an important regulator of actin dynamics and stabilizes endothelial barriers through interaction with cell-cell contacts and focal adhesion sites. Hypoxia has been shown to foster vascular leakage by downregulation of VASP in vitro but the significance of VASP for regulating vascular permeability in the hypoxic brain in vivo awaits clarification.Focal cerebral ischemia was induced in Vasp(-/- mice and wild-type (WT littermates by transient middle cerebral artery occlusion (tMCAO. Evan's Blue tracer was applied to visualize the extent of blood-brain-barrier (BBB damage. Brain edema formation and infarct volumes were calculated from 2,3,5-triphenyltetrazolium chloride (TTC-stained brain slices. Both mouse groups were carefully controlled for anatomical and physiological parameters relevant for edema formation and stroke outcome. BBB damage (p0.05 towards worse neurological outcomes.Our study identifies VASP as critical regulator of BBB maintenance during acute ischemic stroke. Therapeutic modulation of VASP or VASP-dependent signalling pathways could become a novel strategy to combat excessive edema formation in ischemic brain damage.

Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

Science.gov (United States)

Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

2016-10-01

In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

DEFF Research Database (Denmark)

Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

2013-01-01

The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

Epidermal growth factor in alkali-burned corneal epithelial wound healing.

Science.gov (United States)

Singh, G; Foster, C S

1987-06-15

We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

Role of low-order rational surfaces in transport barrier formation on the Large Helical Device

International Nuclear Information System (INIS)

Toi, K.; Tanaka, K.; Watanabe, F.

2010-11-01

In the Large Helical Device, edge transport barrier (ETB) was formed by H-mode transition near the low-order rational surfaces, that is, at the ι/2π=1 resonant layer (ι/2π: the rotational transform) in outward-shifted plasmas of R ax =3.9m (R ax : the magnetic axis position in the vacuum field), and the ι/2π=2 resonant layer in inward-shifted plasmas of R ax =3.6m. The ι/2π=1 and 2 resonant layers reside in the stochastic field region existing just outside the last closed magnetic surface (LCFS). In the outward-shifted plasmas, H-modes without edge localized modes (ELM-free H-modes) followed by giant ELMs were obtained, while H-modes with high frequency and low amplitude ELMs were obtained in the inward-shifted plasmas. A new type of barrier formation induced by TAE bursts was observed in the plasmas of R ax =3.6m, where the transport barrier is formed near the ι/2π=1 surface locates inside LCFS. (author)

Strong Schottky barrier reduction at Au-catalyst/GaAs-nanowire interfaces by electric dipole formation and Fermi-level unpinning.

Science.gov (United States)

Suyatin, Dmitry B; Jain, Vishal; Nebol'sin, Valery A; Trägårdh, Johanna; Messing, Maria E; Wagner, Jakob B; Persson, Olof; Timm, Rainer; Mikkelsen, Anders; Maximov, Ivan; Samuelson, Lars; Pettersson, Håkan

2014-01-01

Nanoscale contacts between metals and semiconductors are critical for further downscaling of electronic and optoelectronic devices. However, realizing nanocontacts poses significant challenges since conventional approaches to achieve ohmic contacts through Schottky barrier suppression are often inadequate. Here we report the realization and characterization of low n-type Schottky barriers (~0.35 eV) formed at epitaxial contacts between Au-In alloy catalytic particles and GaAs-nanowires. In comparison to previous studies, our detailed characterization, employing selective electrical contacts defined by high-precision electron beam lithography, reveals the barrier to occur directly and solely at the abrupt interface between the catalyst and nanowire. We attribute this lowest-to-date-reported Schottky barrier to a reduced density of pinning states (~10(17) m(-2)) and the formation of an electric dipole layer at the epitaxial contacts. The insight into the physical mechanisms behind the observed low-energy Schottky barrier may guide future efforts to engineer abrupt nanoscale electrical contacts with tailored electrical properties.

Turnover of pigment granules: cyclic catabolism and anabolism of ommochromes within epidermal cells.

Science.gov (United States)

Insausti, T C; Casas, J

2009-12-01

Ommochromes are end products of the tryptophan metabolism in arthropods. While the anabolism of ommochromes has been well studied, the catabolism is totally unknown. In order to study it, we used the crab-spider Misumena vatia, which is able to change color reversibly in a few days, from yellow to white and back. Ommochromes is the only pigment class responsible for the body coloration in this animal. The aim of this study was to analyze the fine structure of the epidermal cells in bleaching spiders, in an attempt to correlate morphological changes with the fate of the pigment granules. Central to the process of bleaching is the lysis of the ommochrome granules. In the same cell, intact granules and granules in different degradation stages are found. The degradation begins with granule autolysis. Some components are extruded in the extracellular space and others are recycled via autophagy. Abundant glycogen appears associated to granulolysis. In a later stage of bleaching, ommochrome progranules, typical of white spiders, appear in the distal zone of the same epidermal cell. Catabolism and anabolism of pigment granules thus take place simultaneously in spider epidermal cells. A cyclic pathway of pigment granules formation and degradation, throughout a complete cycle of color change is proposed, together with an explanation for this turnover, involving photoprotection against UV by ommochromes metabolites. The presence of this turnover for melanins is discussed.

Epidermal growth factor in the rat prostate

DEFF Research Database (Denmark)

Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

1998-01-01

Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

Effect of SrO on the electrical barrier formation and microstructure of TiO{sub 2} varistors

Energy Technology Data Exchange (ETDEWEB)

Delbrücke, Tiago, E-mail: tiagodt@gmail.com [Laboratory of Biomaterials & Advanced Ceramics, Engineering Materials Department, Federal University of Rio Grande do Sul, 91501-970, Porto Alegre, RS (Brazil); Pianaro, Sidnei A. [Interdisciplinary Laboratory of Ceramic Materials/LIMAC, Department of Materials Engineering, State University of Ponta Grossa, 84031-510, Ponta Grossa, PR (Brazil); Schmidt, Igor [Laboratory of Biomaterials & Advanced Ceramics, Engineering Materials Department, Federal University of Rio Grande do Sul, 91501-970, Porto Alegre, RS (Brazil); Cava, Sergio [Advanced Crystal Growth and Photonics, Technology Development Center, Federal University of Pelotas, 96010-900, Pelotas, RS (Brazil); Jurado, Jose R.; Sousa, Vânia C. [Laboratory of Biomaterials & Advanced Ceramics, Engineering Materials Department, Federal University of Rio Grande do Sul, 91501-970, Porto Alegre, RS (Brazil)

2016-12-01

TiO{sub 2}-based varistor materials with SrO dopants were prepared by the mechanical mixed oxides synthesis technique using conventional sintering at 1400 °C. I−V and microstructural characterization were performed. The composition range of 0.50–2.00 mol % SrO was studied and compared to pure TiO{sub 2}. Experimental evidence shows that small amounts of SrO improve the nonlinear properties of the samples significantly. Optimal varistor characteristics α = 5.50 and E{sub b} = 345 V/cm, were obtained with 1.00 mol % SrO-doped TiO{sub 2}. SrO in larger amounts causes the formation of precipitates of the SrTiO{sub 3} layer on the microstructure, being deleterious to the electrical properties. Therefore, dopants such as SrO or TiO{sub 2} play a special role in the morphology of the grain boundary and nonlinear response of these materials. An atomic defect model based on the double barrier Schottky type can be adopted to explain the formation of electrical barriers in TiO{sub 2} grain boundaries. - Highlights: • Training an effective potential barrier in the grain boundary, measured by electrical measurements on AC and DC. • Microstructure versus electrical properties. • Good properties getting varistor using a single dopant, forming a varistor binary system based on TiO{sub 2}.

Formation of an internal transport barrier and magnetohydrodynamic activity in experiments with the controlled density of rational magnetic surfaces in the T-10 Tokamak

International Nuclear Information System (INIS)

Razumova, K. A.; Andreev, V. F.; Bel’bas, I. S.; Gorshkov, A. V.; Dnestrovskij, A. Yu.; Dyabilin, K. S.; Kislov, A. Ya.; Lysenko, S. E.; Notkin, G. E.; Timchenko, N. N.; Chudnovskiy, A. N.; Shelukhin, D. A.

2013-01-01

Results are presented from experiments on the formation of an internal electron transport barrier near the q = 1.5 rational surface in the T-10 tokamak. The experiments were carried out in the regime with off-axis electron cyclotron resonance (ECR) heating followed by a fast plasma current ramp-up. After suppressing sawtooth oscillations by off-axis ECR heating, an internal transport barrier began to form near the q = 1.5 rational surface. In the phase of the current ramp-up, the quality of the transport barrier improved; as a result, the plasma energy confinement time increased 2–2.5 times. The intentionally produced flattening of the profile of the safety factor q(r) insignificantly affected magnetohydrodynamic activity in the plasma column in spite of the theoretical possibility of formation of substantial m/n = 3/2 and 2/1 magnetic islands. Conditions are discussed under which the flattening of the profile of the safety factor q near low-order rational surfaces leads to the formation of either an internal transport barrier or the development of an island magnetic structure induced by tearing modes

Analysis and experimental study on formation conditions of large-scale barrier-free diffuse atmospheric pressure air plasmas in repetitive pulse mode

Science.gov (United States)

Li, Lee; Liu, Lun; Liu, Yun-Long; Bin, Yu; Ge, Ya-Feng; Lin, Fo-Chang

2014-01-01

Atmospheric air diffuse plasmas have enormous application potential in various fields of science and technology. Without dielectric barrier, generating large-scale air diffuse plasmas is always a challenging issue. This paper discusses and analyses the formation mechanism of cold homogenous plasma. It is proposed that generating stable diffuse atmospheric plasmas in open air should meet the three conditions: high transient power with low average power, excitation in low average E-field with locally high E-field region, and multiple overlapping electron avalanches. Accordingly, an experimental configuration of generating large-scale barrier-free diffuse air plasmas is designed. Based on runaway electron theory, a low duty-ratio, high voltage repetitive nanosecond pulse generator is chosen as a discharge excitation source. Using the wire-electrodes with small curvature radius, the gaps with highly non-uniform E-field are structured. Experimental results show that the volume-scaleable, barrier-free, homogeneous air non-thermal plasmas have been obtained between the gap spacing with the copper-wire electrodes. The area of air cold plasmas has been up to hundreds of square centimeters. The proposed formation conditions of large-scale barrier-free diffuse air plasmas are proved to be reasonable and feasible.

Myosin II activity is required for functional leading-edge cells and closure of epidermal sheets in fish skin ex vivo.

Science.gov (United States)

Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi

2011-09-01

Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.

Genetic analysis of Ras genes in epidermal development and tumorigenesis

Science.gov (United States)

Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

2013-01-01

Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

Effect of Fluid Intake on Hydration Status and Skin Barrier Characteristics in Geriatric Patients: An Explorative Study.

Science.gov (United States)

Akdeniz, Merve; Boeing, Heiner; Müller-Werdan, Ursula; Aykac, Volkan; Steffen, Annika; Schell, Mareike; Blume-Peytavi, Ulrike; Kottner, Jan

2018-04-03

Inadequate fluid intake is assumed to be a trigger of water-loss dehydration, which is a major health risk in aged and geriatric populations. Thus, there is a need to search for easy to use diagnostic tests to identify dehydration. Our overall aim was to investigate whether skin barrier parameters could be used for predicting fluid intake and/or hydration status in geriatric patients. An explorative observational comparative study was conducted in a geriatric hospital including patients aged 65 years and older. We measured 3-day fluid intake, skin barrier parameters, Overall Dry Skin Score, serum osmolality, cognitive and functional health, and medications. Forty patients were included (mean age 78.45 years and 65% women) with a mean fluid intake of 1,747 mL/day. 20% of the patients were dehydrated and 22.5% had an impending dehydration according to serum osmolality. Multivariate analysis suggested that skin surface pH and epidermal hydration at the face were associated with fluid intake. Serum osmolality was associated with epidermal hydration at the leg and skin surface pH at the face. Fluid intake was not correlated with serum osmolality. Diuretics were associated with high serum osmolality. Approximately half of the patients were diagnosed as being dehydrated according to osmolality, which is the current reference standard. However, there was no association with fluid intake, questioning the clinical relevance of this measure. Results indicate that single skin barrier parameters are poor markers for fluid intake or osmolality. Epidermal hydration might play a role but most probably in combination with other tests. © 2018 S. Karger AG, Basel.

Immune sensitization against epidermal antigens in polymorphous light eruption

International Nuclear Information System (INIS)

Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

1991-01-01

To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

Shavenbaby couples patterning to epidermal cell shape control.

Directory of Open Access Journals (Sweden)

Hélène Chanut-Delalande

2006-09-01

Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.

Lipid functions in skin: differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model

OpenAIRE

Kendall, Alexandra; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke; Harwood, John L.; Nicolaou, Anna

2017-01-01

Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, deri...

Massive star formation by accretion. II. Rotation: how to circumvent the angular momentum barrier?

Science.gov (United States)

Haemmerlé, L.; Eggenberger, P.; Meynet, G.; Maeder, A.; Charbonnel, C.; Klessen, R. S.

2017-06-01

Context. Rotation plays a key role in the star-formation process, from pre-stellar cores to pre-main-sequence (PMS) objects. Understanding the formation of massive stars requires taking into account the accretion of angular momentum during their PMS phase. Aims: We study the PMS evolution of objects destined to become massive stars by accretion, focusing on the links between the physical conditions of the environment and the rotational properties of young stars. In particular, we look at the physical conditions that allow the production of massive stars by accretion. Methods: We present PMS models computed with a new version of the Geneva Stellar Evolution code self-consistently including accretion and rotation according to various accretion scenarios for mass and angular momentum. We describe the internal distribution of angular momentum in PMS stars accreting at high rates and we show how the various physical conditions impact their internal structures, evolutionary tracks, and rotation velocities during the PMS and the early main sequence. Results: We find that the smooth angular momentum accretion considered in previous studies leads to an angular momentum barrier and does not allow the formation of massive stars by accretion. A braking mechanism is needed in order to circumvent this angular momentum barrier. This mechanism has to be efficient enough to remove more than two thirds of the angular momentum from the inner accretion disc. Due to the weak efficiency of angular momentum transport by shear instability and meridional circulation during the accretion phase, the internal rotation profiles of accreting stars reflect essentially the angular momentum accretion history. As a consequence, careful choice of the angular momentum accretion history allows circumvention of any limitation in mass and velocity, and production of stars of any mass and velocity compatible with structure equations.

Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

African Journals Online (AJOL)

Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

Analysis of Barriers against Wheat Farmers' Participation in the Formation of Water Users Association: the Case of Dez Irrigation System

Directory of Open Access Journals (Sweden)

ali pazhuhan

2016-11-01

The present study was aimed at analyzing the barriers against wheat farmers' participation in the formation of water users association within the framework of a descriptive survey. The sample of this study included 375 wheat farmers in Dez irrigation system who were selected through random cluster sampling and were studied through a questionnaire. The reliability index of this questionnaire was estimated to be 0.89. The content validity of the questionnaire was confirmed by the experts and scholars in the field. After the participants filled the questionnaires and the data were collected, the SPSS software package was used to analyze the data. In addition, the results of factor analysis related to the items of barriers led to the extraction of four barriers. These barriers, in order of importance, include the lack of proper infrastructures and economic facilities, social barriers, inadequate structural characteristics and lack of risk-taking, local organizations and lack of attention to extension activities that explain 60.78 percent of the variance of all the barriers.

Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

Science.gov (United States)

Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

2017-05-01

Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

Protoporphyrin IX formation after topical application of methyl aminolaevulinate and BF-200 aminolaevulinic acid declines with age

DEFF Research Database (Denmark)

Nissen, C V; Philipsen, P A; Wulf, H C

2015-01-01

BACKGROUND: Topical photodynamic therapy (PDT) is a popular treatment modality in dermatology. The effect of PDT in epidermal cells depends on formation of protoporphyrin IX (PpIX) from 5-aminolevulinic acid (ALA). A variety of physiological changes in epidermal function occur with increasing age...... assessed. Treatment efficacy in relation to age was evaluated in 100 basal cell carcinomas (BCCs) treated with MAL-PDT. RESULTS: Both photosensitizers induced significantly more PpIX formation in the younger group. Linear regression revealed a significant age-related decline in PpIX formation after...

"Cut-and-paste" manufacture of multiparametric epidermal electronic systems

Science.gov (United States)

Lu, Nanshu; Yang, Shixuan; Wang, Pulin

2016-05-01

Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

Epidermal growth factor induction of front–rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2

Science.gov (United States)

Ho, Ernest; Dagnino, Lina

2012-01-01

Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front–rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front–rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front–rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front–rear polarity and forward movement. PMID:22160594

Epidermal growth factor induction of front-rear polarity and migration in keratinocytes is mediated by integrin-linked kinase and ELMO2.

Science.gov (United States)

Ho, Ernest; Dagnino, Lina

2012-02-01

Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front-rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front-rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front-rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front-rear polarity and forward movement.

Dynein and EFF-1 control dendrite morphology by regulating the localization pattern of SAX-7 in epidermal cells.

Science.gov (United States)

Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang

2017-12-01

Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.

Foliar Epidermal Studies of Plants in Euphorbiaceae

Directory of Open Access Journals (Sweden)

H. A. Thakur

2014-03-01

Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

Duration for Apical Barrier Formation in Necrotic Immature Permanent Incisors Treated With Calcium Hydroxide Apexification Using Ultrasonic or Hand Filing

Directory of Open Access Journals (Sweden)

Li-Wan Lee

2010-08-01

Conclusion: Ultrasonic filing with 0.2% chlorhexidine as an irrigant is effective for disinfection of the root canal and can shorten the duration for apical barrier formation in necrotic permanent incisors treated with calcium hydroxide apexification.

Qualification of flow barriers in salt formations; SVV 2. Qualifizierung von Stroemungsbarrieren in Salzformationen

Energy Technology Data Exchange (ETDEWEB)

Herbert, Horst-Juergen; Hertes, Uwe; Meyer, Lothar; Hellwald, Karsten; Dittrich, Juergen

2011-09-15

The GRS report covers the technical concept of flow barriers in salt formations of self-healing salt backfilling (SVV) for the plugging of boreholes in underground radioactive waste repositories. Laboratory measurements in large dimensions and in-situ experiments were performed in the salt formations carnallitite (Asse mine) and tachhydrite (mine Teutschenthal) and showed the technical feasibility of the concept. The report includes the following chapters following the introduction: State-of-the-art of science and technology before the beginning of the project. Aims of the project. SVV plugging principle. Raw material and salt solutions. Laboratory measurements. Experiments concerning the efficiency assessment of SVV plugging elements. Results on SVV sealing properties - laboratory experiments. Results on SVV sealing properties - in-situ experiments. Results concerning the geomechanical properties. SVV-long-term behavior. Technical requirements to the practicability of SVV plugging elements.

Effect of density control and impurity transport on internal transport barrier formation in tokamak plasma

International Nuclear Information System (INIS)

Yamakami, Tomoyuki; Fujita, Takaaki; Arimoto, Hideki; Yamazaki, Kozo

2014-01-01

In future fusion reactors, density control, such as fueling by pellet injection, is an effective method to control the formation of the internal transport barrier (ITB) in reversed magnetic shear plasma, which can improve plasma performance. On the other hand, an operation with ITB can cause accumulation of impurities inside the core ITB region. We studied the relation between pellet injection and ITB formation and the effect of impurity transport on the core of ITB for tokamak plasmas by using the toroidal transport analysis linkage. For ITB formation, we showed that the pellet has to be injected beyond the position where the safety factor q takes the minimum value. We confirmed that the accumulation of impurities causes the attenuation of ITB owing to radiation loss inside the ITB region. Moreover, in terms of the divertor heat flux reduction by impurity gas, the line radiation loss is high for high-Z noble gas impurities, such as Kr, whereas factor Q decreases slightly. (author)

Refining the model of barrier island formation along a paraglacial coast in the Gulf of Maine

Science.gov (United States)

Hein, Christopher J.; FitzGerald, Duncan M.; Carruthers, Emily A.; Stone, Byron D.; Barnhardt, Walter A.; Gontz, Allen M.

2012-01-01

Details of the internal architecture and local geochronology of Plum Island, the longest barrier in the Gulf of Maine, have refined our understanding of barrier island formation in paraglacial settings. Ground-penetrating radar and shallow-seismic profiles coupled with sediment cores and radiocarbon dates provide an 8000-year evolutionary history of this barrier system in response to changes in sediment sources and supply rates as well as variability in the rate of sea-level change. The barrier sequence overlies tills of Wisconsinan and Illinoian glaciations as well as late Pleistocene glaciomarine clay deposited during the post-glacial sea-level highstand at approximately 17 ka. Holocene sediment began accumulating at the site of Plum Island at 7–8 ka, in the form of coarse fluvial channel-lag deposits related to the 50-m wide erosional channel of the Parker River that carved into underlying glaciomarine deposits during a lower stand of sea level. Plum Island had first developed in its modern location by ca. 3.6 ka through onshore migration and vertical accretion of reworked regressive and lowstand deposits. The prevalence of southerly, seaward-dipping layers indicates that greater than 60% of the barrier lithosome developed in its modern location through southerly spit progradation, consistent with a dominantly longshore transport system driven by northeast storms. Thinner sequences of northerly, landward-dipping clinoforms represent the northern recurve of the prograding spit. A 5–6-m-thick inlet-fill sequence was identified overlying the lower stand fluvial deposit; its stratigraphy captures events of channel migration, ebb-delta breaching, onshore bar migration, channel shoaling and inlet infilling associated with the migration and eventual closure of the inlet. This inlet had a maximum cross-sectional area of 2800 m2 and was active around 3.5–3.6 ka. Discovery of this inlet suggests that the tidal prism was once larger than at present. Bay infilling

Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

Science.gov (United States)

Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

2018-03-27

Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

[Study on formation process of honeycomb pattern in dielectric barrier discharge by optical emission spectrum].

Science.gov (United States)

Dong, Li-Fang; Zhu, Ping; Yang, Jing; Zhang, Yu

2014-04-01

The authors report on the first investigation of the variations in the plasma parameters in the formation process of the honeycomb pattern in a dielectric barrier discharge by optical emission spectrum in argon and air mixture. The discharge undergoes hexagonal lattice, concentric spot-ring pattern and honeycomb pattern with the applied voltage increasing. The molecular vibration temperature, electron excitation temperature and electronic density of the three kinds of patterns were investigated by the emission spectra of nitrogen band of second positive system (C3pi(u) --> B3 pi(g)), the relative intensity ratio method of spectral lines of Ar I 763.51 nm (2P(6) --> 1S(5)) and Ar I 772.42 nm (2P(2) -->1S(3)) and the broadening of spectral line 696.5 nm respectively. It was found that the molecular vibration temperature and electron excitation temperature of the honeycomb pattern are higher than those of the hexagonal lattice, but the electron density of the former is lower than that of the latter. The discharge powers of the patterns were also measured with the capacitance method. The discharge power of the honeycomb pattern is much higher than that of the hexagonal lattice. These results are of great importance to the formation mechanism of the patterns in dielectric barrier discharge.

Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

Science.gov (United States)

Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

2013-12-01

The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Role of external torque in the formation of ion thermal internal transport barriers

Science.gov (United States)

Jhang, Hogun; Kim, S. S.; Diamond, P. H.

2012-04-01

We present an analytic study of the impact of external torque on the formation of ion internal transport barriers (ITBs). A simple analytic relation representing the effect of low external torque on transport bifurcations is derived based on a two field transport model of pressure and toroidal momentum density. It is found that the application of an external torque can either facilitate or hamper bifurcation in heat flux driven plasmas depending on its sign relative to the direction of intrinsic torque. The ratio between radially integrated momentum (i.e., external torque) density to power input is shown to be a key macroscopic control parameter governing the characteristics of bifurcation.

The organization of human epidermis: functional epidermal units and phi proportionality.

Science.gov (United States)

Hoath, Steven B; Leahy, D G

2003-12-01

The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

DEFF Research Database (Denmark)

Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...

Formation of barrier-type anodic films on ZE41 magnesium alloy in a fluoride/glycerol electrolyte

International Nuclear Information System (INIS)

Hernández-López, J.M.; Němcová, A.; Zhong, X.L.; Liu, H.; Arenas, M.A.; Haigh, S.J.; Burke, M.G.; Skeldon, P.; Thompson, G.E.

2014-01-01

Highlights: • Barrier anodic films formed on ZE41 Mg alloy in glycerol/fluoride electrolyte. • Films contain oxygen and fluorine species; formation ratio ∼1.3 nm V −1 . • Nanocrystalline film structure, with MgO and MgF 2. • Zinc enrichment in alloy beneath anodic film. • Modified film formed above Mg-Zn-RE second phase. - Abstract: Barrier-type, nanocrystalline anodic films have been formed on a ZE41 magnesium alloy under a constant current density of 5 mA cm −2 in a glycerol/fluoride electrolyte, containing 5 vol.% of added water, at 293 K. The films contain magnesium, fluorine and oxygen as the major species, and lower amounts of alloying element species. The films grow at an efficiency of ∼0.8 to 0.9, with a formation ratio in the range of ∼1.2 to 1.4 nm V −1 at the matrix regions and with a ratio of ∼1.8 nm V −1 at Mg-Zn-RE second phase. At the former regions, rare earth species are enriched at the film surface and zinc is enriched in the alloy. A carbon- and oxygen-rich band within the film suggests that the films grow at the metal/film and film/electrolyte interfaces

Integrin-based diffusion barrier separates membrane domains enabling the formation of microbiostatic frustrated phagosomes

Science.gov (United States)

Maxson, Michelle E; Naj, Xenia; O'Meara, Teresa R; Plumb, Jonathan D; Cowen, Leah E

2018-01-01

Candida albicans hyphae can reach enormous lengths, precluding their internalization by phagocytes. Nevertheless, macrophages engulf a portion of the hypha, generating incompletely sealed tubular phagosomes. These frustrated phagosomes are stabilized by a thick cuff of F-actin that polymerizes in response to non-canonical activation of integrins by fungal glycan. Despite their continuity, the surface and invaginating phagosomal membranes retain a strikingly distinct lipid composition. PtdIns(4,5)P2 is present at the plasmalemma but is not detectable in the phagosomal membrane, while PtdIns(3)P and PtdIns(3,4,5)P3 co-exist in the phagosomes yet are absent from the surface membrane. Moreover, endo-lysosomal proteins are present only in the phagosomal membrane. Fluorescence recovery after photobleaching revealed the presence of a diffusion barrier that maintains the identity of the open tubular phagosome separate from the plasmalemma. Formation of this barrier depends on Syk, Pyk2/Fak and formin-dependent actin assembly. Antimicrobial mechanisms can thereby be deployed, limiting the growth of the hyphae. PMID:29553370

A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

Science.gov (United States)

Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

2015-08-01

The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

HaCaT Keratinocytes and Primary Epidermal Keratinocytes Have Different Transcriptional Profiles of Cornified Envelope-Associated Genes to T Helper Cell Cytokines

Science.gov (United States)

Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo

2012-01-01

HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291

OVERCOMING THE METER BARRIER AND THE FORMATION OF SYSTEMS WITH TIGHTLY PACKED INNER PLANETS (STIPs)

International Nuclear Information System (INIS)

Boley, A. C.; Morris, M. A.; Ford, E. B.

2014-01-01

We present a solution to the long outstanding meter barrier problem in planet formation theory. As solids spiral inward due to aerodynamic drag, they will enter disk regions that are characterized by high temperatures, densities, and pressures. High partial pressures of rock vapor can suppress solid evaporation, and promote collisions between partially molten solids, allowing rapid growth. This process should be ubiquitous in planet-forming disks, which may be evidenced by the abundant class of Systems with Tightly packed Inner Planets discovered by the NASA Kepler Mission

Roles of p63 in epidermal development and tumorigenesis

Directory of Open Access Journals (Sweden)

Jeng-Yuan Yao

2012-12-01

Full Text Available pidermis is composed mainly of keratinocytes and is the ma­jor barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcrip­tion factor p63. The p63 gene encodes proteins with structures simi­lar to that of p53, including an N-terminal transacti­vation (TA domain, a DNA-binding domain and a car­boxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epider­mal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis re­mains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.

Evolution of dinosaur epidermal structures.

Science.gov (United States)

Barrett, Paul M; Evans, David C; Campione, Nicolás E

2015-06-01

Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

International Nuclear Information System (INIS)

Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

2008-01-01

The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

International Nuclear Information System (INIS)

Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

1997-01-01

Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

Science.gov (United States)

Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

2008-12-01

Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.

Science.gov (United States)

Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un

2008-09-01

Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.

Stability of Microturbulent Drift Modes during Internal Transport Barrier Formation in the Alcator C-Mod Radio Frequency Heated H-mode

International Nuclear Information System (INIS)

Redi, M.H.; Fiore, C.L.; Dorland, W.; Mikkelsen, D.R.; Rewoldt, G.; Bonoli, P.T.; Ernst, D.R.; Rice, J.E.; Wukitch, S.J.

2003-01-01

Recent H-mode experiments on Alcator C-Mod [I.H. Hutchinson, et al., Phys. Plasmas 1 (1994) 1511] which exhibit an internal transport barrier (ITB), have been examined with flux tube geometry gyrokinetic simulations, using the massively parallel code GS2 [M. Kotschenreuther, G. Rewoldt, and W.M. Tang, Comput. Phys. Commun. 88 (1995) 128]. The simulations support the picture of ion/electron temperature gradient (ITG/ETG) microturbulence driving high xi/ xe and that suppressed ITG causes reduced particle transport and improved ci on C-Mod. Nonlinear calculations for C-Mod confirm initial linear simulations, which predicted ITG stability in the barrier region just before ITB formation, without invoking E x B shear suppression of turbulence. Nonlinear fluxes are compared to experiment, which both show low heat transport in the ITB and higher transport within and outside of the barrier region

Effect of toroidal field ripple on the formation of internal transport barriers

Energy Technology Data Exchange (ETDEWEB)

Vries, P C de; Hawkes, N C; Challis, C D; Andrew, Y; Beurskens, M; Brix, M; Giroud, C; Zastrow, K-D [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, OX14 3DB (United Kingdom); Joffrin, E [EFDA-JET CSU, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Litaudon, X [Association EURATOM-CEA, DSM/DFRC, CEA Cadarache, 13108, St Paul lez Durance (France); Brzozowski, J; Johnson, T [Association EURATOM-VR, Fusion Plasma Physics, EES, KTH, Stockholm (Sweden); Crombe, K [Department of Applied Physics, Ghent University, Ghent (Belgium); Hobirk, J [Max-Planck-Institut fuer Plasmaphysik, Euratom Association, 85748 Garching (Germany); Loennroth, J; Salmi, A [Association Euratom-Tekes, Helsinki University of Technology, PO Box 4100, 02015 TKK (Finland); Tala, T [Association Euratom-Tekes, VTT, PO Box 1000, 02044 VTT (Finland); Yavorskij, V [Institute for Theoretical Physics, Association EURATOM-OEAW, University of Innsbruck (Austria)], E-mail: Peter.de.Vries@jet.uk

2008-06-15

The effect of a toroidal field (TF) ripple on the formation and performance of internal transport barriers (ITBs) has been studied in JET. It was found that the TF ripple had a profound effect on the toroidal plasma rotation. An increased TF ripple up to {delta} = 1% led to a lower rotation and reduced the rotational shear in the region where the ITBs were formed. ITB triggering events were observed in all cases and it is thought that the rotational shear may be less important for this process than, for example, the q-profile. However, the increase in the pressure gradient following the ITB trigger was reduced in discharges with a larger TF ripple and consequently a lower rotational shear. This suggests that toroidal rotation and its shear play a role in the growth of the ITB once it has been triggered.

Formation conditions for electron internal transport barriers in JT-60U plasmas

Energy Technology Data Exchange (ETDEWEB)

Fujita, T [Japan Atomic Energy Research Institute, Naka Fusion Research Establishment, Naka-machi, Naka-gun, Ibaraki 311-0193 (Japan); Fukuda, T [Osaka University, Suita, Osaka 565-0871 (Japan); Sakamoto, Y [Japan Atomic Energy Research Institute, Naka Fusion Research Establishment, Naka-machi, Naka-gun, Ibaraki 311-0193 (Japan); Ide, S [Japan Atomic Energy Research Institute, Naka Fusion Research Establishment, Naka-machi, Naka-gun, Ibaraki 311-0193 (Japan); Suzuki, T [Japan Atomic Energy Research Institute, Naka Fusion Research Establishment, Naka-machi, Naka-gun, Ibaraki 311-0193 (Japan); Takenaga, H [Japan Atomic Energy Research Institute, Naka Fusion Research Establishment, Naka-machi, Naka-gun, Ibaraki 311-0193 (Japan); Ida, K [National Institute for Fusion Science, Toki, Gifu 509-5292 (Japan); Idei, H [Kyushu University, Kasuga, Fukuoka 816-8580 (Japan); Shimozuma, T [National Institute for Fusion Science, Toki, Gifu 509-5292 (Japan); Fujisawa, A [National Institute for Fusion Science, Toki, Gifu 509-5292 (Japan); Ohdachi, S [National Institute for Fusion Science, Toki, Gifu 509-5292 (Japan); Toi, K [National Institute for Fusion Science, Toki, Gifu 509-5292 (Japan)

2004-05-01

The formation of electron internal transport barriers (ITBs) was studied using electron cyclotron (EC) heating in JT-60U positive shear (PS) and reversed shear (RS) plasmas with scan of neutral beam (NB) power. With no or low values of NB power and with a small radial electric field (E{sub r}) gradient, a strong, box-type electron ITB was formed in RS plasmas while a peaked profile with no strong electron ITBs was observed in PS plasmas within the available EC power. When the NB power and the E{sub r} gradient were increased, the electron transport in strong electron ITBs with EC heating in RS plasmas was not affected, while electron thermal diffusivity was reduced in conjunction with the reduction of ion thermal diffusivity, and strong electron and ion ITBs were formed in PS plasmas.

Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

Directory of Open Access Journals (Sweden)

Kazuhiko Arima

2015-01-01

Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

Tritium permeation barriers for fusion technology

International Nuclear Information System (INIS)

Perujo, A.; Forcey, K.

1994-01-01

An important issue concerning the safety, feasibility and fueling (i.e., tritium breeding ratio and recovery from the breeding blanket) of a fusion reactor is the possible tritium leakages through the structural materials and in particular through those operating at high temperatures. The control of tritium permeation could be a critical factor in determining the viability of a future fusion power reactor. The formation of tritium permeation barriers to prevent the loss of tritium to the coolant by diffusion though the structural material seems to be the most practical method to minimize such losses. Many authors have discussed the formation of permeation barriers to reduce the leakage of hydrogen isotopes through proposed first wall and structural materials. In general, there are two routes for the formation of such a barrier, namely: the growth of oxide layers (e.g., Cr 2 O 3 , Al 2 O 3 , etc.) or the application of surface coatings. Non-metals are the most promising materials from the point of view of the formation of permeation barriers. Oxides such as Al 2 O 3 or Cr 2 O 3 or carbides such as SiC or TiC have been proposed. Amongst the metals only tungsten or gold are sufficiently less permeable than steel to warrant investigation as candidate materials for permeation barriers. It is of course possible to grow oxide layers on steel directly by heating in the atmosphere or under a variety of conditions (first route above). The direct oxidizing is normally done in an environment of open-quotes wet hydrogenclose quotes to promote the growth of chromia on, for example, nickel steels or ternary oxides on 316L to prevent corrosion. The application of surface layers (second route above), offers a greater range of materials for the formation of permeation barriers. In addition to reducing permeation, such layers should be adhesive, resistant to attack by corrosive breeder materials and should not crack during thermal cycling

Radiation defect formation in two-barrier structures based on silicon

International Nuclear Information System (INIS)

Madatov, R.S.; Abbasov, F.P.; Mustafayev, Yu.M.

2013-01-01

It was developed a silicon-based photodetector with high integral sensitivity in low-wave spectrum. It was investigated the effect of gamma radiation on the mechanism of current transport in the structure of Schottky barrier type and in transitions. It is shown that the double-barrier structures can improve the photovoltaic parameters of conventional detectors. For the first time it was obtained and studied the characteristics of two-barrier structures created on the same plane. The advantages over conventional structures are shown. The annealing point is changing the structure of radiation defects and leads to their disappearance

Creation and dynamical co-evolution of electron and ion channel transport barriers

International Nuclear Information System (INIS)

Newman, D.E.

2002-01-01

A wide variety of magnetic confinement devices have found transitions to an enhanced confinement regime. Simple dynamical models have been able to capture much of the dynamics of these barriers however an open question has been the disconnected nature of the electron thermal transport channel sometimes observed in the presence of a standard ('ion channel' barrier. By adding to simple barrier model an evolution equation for electron fluctuations we can investigate the interaction between the formation of the standard ion channel barrier and the somewhat less common electron channel barrier. Barrier formation in the electron channel is even more sensitive to the alignment of the various gradients making up the sheared radial electric field than the ion barrier is. Electron channel heat transport is found to significantly increase after the formation of the ion channel barrier but before the electron channel barrier is formed. This increased transport is important in the barrier evolution. (author)

An Epidermal Biosensor for Carcinoembryonic Antigen

National Research Council Canada - National Science Library

Schwartz, Pauline

2001-01-01

...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

Scattering of an attractive Bose-Einstein condensate from a barrier: Formation of quantum superposition states

International Nuclear Information System (INIS)

Streltsov, Alexej I.; Alon, Ofir E.; Cederbaum, Lorenz S.

2009-01-01

Scattering in one dimension of an attractive ultracold bosonic cloud from a barrier can lead to the formation of two nonoverlapping clouds. Once formed, the clouds travel with constant velocity, in general different in magnitude from that of the incoming cloud, and do not disperse. The phenomenon and its mechanism - transformation of kinetic energy to internal energy of the scattered cloud - are obtained by solving the time-dependent many-boson Schroedinger equation. The analysis of the wave function shows that the object formed corresponds to a quantum superposition state of two distinct wave packets traveling through real space.

Barriers to Medication Decision Making in Women with Lupus Nephritis: A Formative Study using Nominal Group Technique.

Science.gov (United States)

Singh, Jasvinder A; Qu, Haiyan; Yazdany, Jinoos; Chatham, Winn; Dall'era, Maria; Shewchuk, Richard M

2015-09-01

To assess the perspectives of women with lupus nephritis on barriers to medication decision making. We used the nominal group technique (NGT), a structured process to elicit ideas from participants, for a formative assessment. Eight NGT meetings were conducted in English and moderated by an expert NGT researcher at 2 medical centers. Participants responded to the question: "What sorts of things make it hard for people to decide to take the medicines that doctors prescribe for treating their lupus kidney disease?" Patients nominated, discussed, and prioritized barriers to decisional processes involving medications for treating lupus nephritis. Fifty-one women with lupus nephritis with a mean age of 40.6 ± 13.3 years and disease duration of 11.8 ± 8.3 years participated in 8 NGT meetings: 26 African Americans (4 panels), 13 Hispanics (2 panels), and 12 whites (2 panels). Of the participants, 36.5% had obtained at least a college degree and 55.8% needed some help in reading health materials. Of the 248 responses generated (range 19-37 responses/panel), 100 responses (40%) were perceived by patients as having relatively greater importance than other barriers in their own decision-making processes. The most salient perceived barriers, as indicated by percent-weighted votes assigned, were known/anticipated side effects (15.6%), medication expense/ability to afford medications (8.2%), and the fear that the medication could cause other diseases (7.8%). Women with lupus nephritis identified specific barriers to decisions related to medications. Information relevant to known/anticipated medication side effects and medication cost will form the basis of a patient guide for women with systemic lupus erythematosus, currently under development.

Optimal allocation of leaf epidermal area for gas exchange

OpenAIRE

de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.

2016-01-01

Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...

An Epidermal Biosensor for Carcinoembryonic Antigen

National Research Council Canada - National Science Library

Schwartz, Pauline

2003-01-01

...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

Directory of Open Access Journals (Sweden)

Jinyang Wang

2018-05-01

Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

Formation of neoclassical internal transport barriers under various operational regimes on compact helical system

Energy Technology Data Exchange (ETDEWEB)

Minami, T [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Fujisawa, A [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Iguchi, H [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Nishimura, S [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Ida, K [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Yokoyama, M [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Murakami, S [Department of Nuclear Engineering, Kyoto University, Kyoto (Japan); Yoshimura, Y [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Isobe, M [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Suzuki, C [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Nagaoka, K [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Akiyama, T [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Yoshinuma, M [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Shimizu, A [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Takahashi, C [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Matsuoka, K [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan); Okamura, S [National Institute for Fusion Science, 322-6 Oroshi, Toki, Gifu 509-5292 (Japan)

2004-05-01

Optimization has been carried out on the operational regime where neoclassical internal transport barriers (N-ITBs) are formed. The condition of the forming N-ITB is sensitive to the location of the electron cyclotron heating resonance zone. A high electron temperature is obtained for the central heating (-2 cm < R{sub resonance} < 2 cm). The variation of the magnetic axis location affects the formation of the N-ITB. The electron and ion temperatures at the magnetic axis location (R{sub ax}) of 94.9 cm are higher than those at 92.1 and 97.4 cm. This result indicates that the neoclassical flux and the created radial electric field are influenced by the magnetic field structure.

Antenatal Corticosteroids and Postnatal Fluid Restriction Produce Differential Effects on AQP3 Expression, Water Handling, and Barrier Function in Perinatal Rat Epidermis

Directory of Open Access Journals (Sweden)

Johan Agren

2010-01-01

Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.

Epidermal growth in the bottlenose dolphin, Tursiops truncatus

International Nuclear Information System (INIS)

Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

1985-01-01

Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

Epidermal growth in the bottlenose dolphin, Tursiops truncatus

Energy Technology Data Exchange (ETDEWEB)

Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

1985-07-01

Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

Science.gov (United States)

Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

2014-01-01

Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

Directory of Open Access Journals (Sweden)

Sarah Papiorek

Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

The formation of tritium permeation barriers by CVD

International Nuclear Information System (INIS)

Forcey, K.S.; Perujo, A.; Reiter, F.; Lolli-Ceroni, P.L.

1993-01-01

The effectiveness as permeation barriers of the following CVD coatings have been investigated: TiC (1 to 2 μm in thickness); a bi-layer of TiN on TiC (3 μm total thickness) and CVD Al 2 O 3 on a TiN/TiC bi-layer. The substrate materials were TZM (a Mo alloy) and 316L stainless steel in the form of discs of diameter 48 mm and thickness 0.1 or 1 mm. Permeation measurements were performed in the temperature range 515-742 K using deuterium at pressures in the range 1-50 kPa. CVD layers were shown to form reasonably effective permeation barriers. At a temperature of 673 K TiC is around 6000 times less permeable to deuterium than 316L stainless steel. (orig.)

Regulation of the ligand-dependent activation of the epidermal growth factor receptor by calmodulin

DEFF Research Database (Denmark)

Li, Hongbing; Panina, Svetlana; Kaur, Amandeep

2012-01-01

Calmodulin (CaM) is the major component of calcium signaling pathways mediating the action of various effectors. Transient increases in the intracellular calcium level triggered by a variety of stimuli lead to the formation of Ca2+/CaM complexes, which interact with and activate target proteins....... In the present study the role of Ca2+/CaM in the regulation of the ligand-dependent activation of the epidermal growth factor receptor (EGFR) has been examined in living cells. We show that addition of different cell permeable CaM antagonists to cultured cells or loading cells with a Ca2+ chelator inhibited...

Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

Science.gov (United States)

Denda, Mitsuhiro; Tsutsumi, Moe

2014-04-01

Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

International Nuclear Information System (INIS)

Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

2008-01-01

Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

The under-appreciated promiscuity of the epidermal growth factor receptor family.

Directory of Open Access Journals (Sweden)

Sean P Kennedy

2016-08-01

Full Text Available Each member of the epidermal growth factor receptor (EGFR family plays a key role in normal development, homeostasis and a variety of pathophysiological conditions, most notably in cancer. According to the prevailing dogma, these four receptor tyrosine kinases (RTKs; EGFR, ERBB2, ERBB3 and ERBB4 function exclusively through the formation of homodimers and heterodimers within the EGFR family. These combinatorial receptor interactions are known to generate increased interactome diversity and therefore influence signalling output, subcellular localization and function of the heterodimer. This molecular plasticity is also thought to play a role in the development of resistance towards targeted cancer therapies aimed at these known oncogenes. Interestingly, many studies now challenge this dogma and suggest that the potential for EGFR family receptors to interact with more distantly related RTKs is much greater than currently appreciated. Here we discuss how the promiscuity of these oncogenic receptors may lead to the formation of many unexpected receptor pairings and the significant implications for the efficiency of many targeted cancer therapies.

Fractional sunburn threshold UVR doses generate equivalent vitamin D and DNA damage in skin types I-VI, but with epidermal DNA damage gradient correlated to skin darkness.

Science.gov (United States)

Shih, Barbara B; Farrar, Mark D; Cooke, Marcus S; Osman, Joanne; Langton, Abigail K; Kift, Richard; Webb, Ann R; Berry, Jacqueline L; Watson, Rachel E B; Vail, Andy; de Gruijl, Frank R; Rhodes, Lesley E

2018-05-03

Public health guidance recommends limiting sun-exposure to sub-sunburn levels, but it's unknown whether these can gain vitamin D (for musculoskeletal health) whilst avoiding epidermal DNA damage (initiates skin cancer). Well-characterised healthy humans of all skin types (I-VI; lightest to darkest skin) were exposed to a low dose-series of solar simulated UVR of 20-80% their individual sunburn threshold dose (minimal erythemal dose, MED). Significant UVR dose-responses were seen for serum 25(OH)D and whole epidermal CPD, with as little as 0.2 MED concurrently producing 25(OH)D and CPD. Notably, fractional MEDs generated equivalent levels of whole epidermal CPD and 25(OH)D across all skin types. Crucially, we demonstrated an epidermal gradient of CPD formation strongly correlated with skin darkness (r=0.74; Pskin types, ranging from darkest skin, where high CPD levels occurred superficially with none in the germinative basal layer, through to lightest skin where CPD were induced evenly across the epidermal depth. Darker skin people can be encouraged to utilise sub-sunburn UVR-exposure to enhance their vitamin D. In lighter skin people, basal cell damage occurs concurrent with vitamin D synthesis at exquisitely low UVR levels, providing an explanation for their high skin cancer incidence; greater caution is required. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

DEFF Research Database (Denmark)

Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

2014-01-01

The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

[Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

Science.gov (United States)

Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

1992-07-01

Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

Chronic activation of wild-type epidermal growth factor receptor and loss of Cdkn2a cause mouse glioblastoma formation.

Science.gov (United States)

Acquaviva, Jaime; Jun, Hyun Jung; Lessard, Julie; Ruiz, Rolando; Zhu, Haihao; Donovan, Melissa; Woolfenden, Steve; Boskovitz, Abraham; Raval, Ami; Bronson, Roderick T; Pfannl, Rolf; Whittaker, Charles A; Housman, David E; Charest, Al

2011-12-01

Glioblastoma multiforme (GBM) is characterized by overexpression of epidermal growth factor receptor (EGFR) and loss of the tumor suppressors Ink4a/Arf. Efforts at modeling GBM using wild-type EGFR in mice have proven unsuccessful. Here, we present a unique mouse model of wild-type EGFR-driven gliomagenesis. We used a combination of somatic conditional overexpression and ligand-mediated chronic activation of EGFR in cooperation with Ink4a/Arf loss in the central nervous system of adult mice to generate tumors with the histopathologic and molecular characteristics of human GBMs. Sustained, ligand-mediated activation of EGFR was necessary for gliomagenesis, functionally substantiating the clinical observation that EGFR-positive GBMs from patients express EGFR ligands. To gain a better understanding of the clinically disappointing EGFR-targeted therapies for GBM, we investigated the molecular responses to EGFR tyrosine kinase inhibitor (TKI) treatment in this model. Gefitinib treatment of primary GBM cells resulted in a robust apoptotic response, partially conveyed by mitogen-activated protein kinase (MAPK) signaling attenuation and accompanied by BIM(EL) expression. In human GBMs, loss-of-function mutations in the tumor suppressor PTEN are a common occurrence. Elimination of PTEN expression in GBM cells posttumor formation did not confer resistance to TKI treatment, showing that PTEN status in our model is not predictive. Together, these findings offer important mechanistic insights into the genetic determinants of EGFR gliomagenesis and sensitivity to TKIs and provide a robust discovery platform to better understand the molecular events that are associated with predictive markers of TKI therapy.

Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks

Directory of Open Access Journals (Sweden)

Sang Wha Kim

2014-03-01

Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.

Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors.

Science.gov (United States)

Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

2014-10-15

Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.

Inhibition of epidermal cell proliferation by borderline rays

Energy Technology Data Exchange (ETDEWEB)

Born, W [Freiburg Univ.; Daikeler, G

1976-08-01

Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

Formation of transport barriers in the MAST spherical tokamak

International Nuclear Information System (INIS)

Meyer, H; Field, A R; Akers, R J; Brickley, C; Conway, N J; Patel, A; Carolan, P G; Challis, C; Counsell, G F; Cunningham, G; Helander, P; Kirk, A; Lloyd, B; Maingi, R; Tournianski, M R; Walsh, M J

2004-01-01

In the Mega Ampere Spherical Tokamak (MAST) plasmas have been generated with internal (ITB) or edge (ETB) transport barriers. ITBs were achieved in both the electron and the ion energy channel. In the presence of an ITB in the ion energy channel, transport analysis shows that the ion thermal diffusivity, χ i , is reduced to almost neoclassical values while the ITB persists. The widely tested criteria for ITB formation ρ t * =ρ s αlnT/αR>ρ ITB * ∼0.014 (ρ s : Larmor radius at sound speed) obtained from dimensional analysis of JET discharges is easily exceeded on MAST. Even without the evidence of an ρ T * >0.014 often applies, showing that this criterion in its current form is not generally applicable. ETBs are most easily formed in MAST if in a double null divertor configuration the discharge is vertically balanced, so that both X-points are almost on the same flux surface (CDND), and if the plasma is refuelled from the high field side mid-plane. The H-mode threshold power, P thr = 0.5 MW, in connected double null diverted (CDND) is only about half of that in a similar disconnected discharge with the ion ∇ B drift towards the X-point on the last closed flux surface (LDND). P thr scales between lower double null diverted (LDND) and the single null diverted configuration with the plasma surface area on MAST

Structural details of Al/Al 2O3 junctions and their role in the formation of electron tunnel barriers

Science.gov (United States)

Koberidze, M.; Puska, M. J.; Nieminen, R. M.

2018-05-01

We present a computational study of the adhesive and structural properties of the Al/Al 2O3 interfaces as building blocks of the metal-insulator-metal (MIM) tunnel devices, where electron transport is accomplished via tunneling mechanism through the sandwiched insulating barrier. The main goal of this paper is to understand, on the atomic scale, the role of the geometrical details in the formation of the tunnel barrier profiles. Initially, we concentrate on the adhesive properties of the interfaces. To provide reliable results, we carefully assess the accuracy of the traditional methods used to examine Al/Al 2O3 systems. These are the most widely employed exchange-correlation functionals—local-density approximation and two different generalized gradient approximations; the universal binding-energy relation for predicting equilibrium interfacial distances and adhesion energies; and the ideal work of separation as a measure of junction stability. In addition, we show that the established interpretation of the computed ideal work of separation might be misleading in predicting the optimal interface structures. Finally, we perform a detailed analysis of the atomic and interplanar relaxations in each junction, and identify their contributions to the tunnel barrier parameters. Our results imply that the structural irregularities on the surface of the Al film have a significant contribution to lowering the tunnel barrier height, while atomic relaxations at the interface and interplanar relaxations in Al2O3 may considerably change the width of the barrier and, thus, distort its uniformity. Both the effects may critically influence the performance of the MIM tunnel devices.

Role of ADAMs in cancer formation and progression.

LENUS (Irish Health Repository)

Duffy, Michael J

2012-02-01

The ADAMs (a disintegrin and metalloproteinase) comprise a family of multidomain transmembrane and secreted proteins. One of their best-established roles is the release of biologically important ligands, such as tumor necrosis factor-alpha, epidermal growth factor, transforming growth factor-alpha, and amphiregulin. Because these ligands have been implicated in the formation and progression of tumors, it might be expected that the specific ADAMs involved in their release would also be involved in malignancy. Consistent with this hypothesis, emerging data from model systems suggest that ADAMs, such as ADAM-9, ADAM-12, ADAM-15, and ADAM-17, are causally involved in tumor formation\\/progression. In human cancer, specific ADAMs are up-regulated, with levels generally correlating with parameters of tumor progression and poor outcome. In preclinical models, selective ADAM inhibitors against ADAM-10 and ADAM-17 have been shown to synergize with existing therapies in decreasing tumor growth. The ADAMs are thus a new family of potential targets for the treatment of cancer, especially malignancies that are dependent on human epidermal growth factor receptor ligands or tumor necrosis factor-alpha.

JET internal transport barriers: experiment vs theory

Energy Technology Data Exchange (ETDEWEB)

Esposito, B [Associazione Euratom - ENEA sulla Fusione, C.R. Frascati, CP 65, I-00040, Frascati, Rome (Italy); Crisanti, F [Associazione Euratom - ENEA sulla Fusione, C.R. Frascati, CP 65, I-00040, Frascati, Rome (Italy); Parail, V [Euratom/UKAEA Fusion Association, Cuhlam Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Maget, P [Association Euratom - CEA pour la Fusion, CEA Cadarache, F-13108 Saint Paul-lez-Durance Cedex (France); Baranov, Y [Euratom/UKAEA Fusion Association, Cuhlam Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Becoulet, A [Association Euratom - CEA pour la Fusion, CEA Cadarache, F-13108 Saint Paul-lez-Durance Cedex (France); Castaldo, C [Associazione Euratom - ENEA sulla Fusione, C.R. Frascati, CP 65, I-00040, Frascati, Rome (Italy); Challis, C D [Euratom/UKAEA Fusion Association, Cuhlam Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Angelis, R De [Associazione Euratom - ENEA sulla Fusione, C.R. Frascati, CP 65, I-00040, Frascati, Rome (Italy); Garbet, X [Association Euratom - CEA pour la Fusion, CEA Cadarache, F-13108 Saint Paul-lez-Durance Cedex (France); Giroud, C [Association Euratom - CEA pour la Fusion, CEA Cadarache, F-13108 Saint Paul-lez-Durance Cedex (France); Hawkes, N [Euratom/UKAEA Fusion Association, Cuhlam Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom); Joffrin, E [Association Euratom - CEA pour la Fusion, CEA Cadarache, F-13108 Saint Paul-lez-Durance Cedex (France); Litaudon, X [Association Euratom - CEA pour la Fusion, CEA Cadarache, F-13108 Saint Paul-lez-Durance Cedex (France); Mazon, D [Association Euratom - CEA pour la Fusion, CEA Cadarache, F-13108 Saint Paul-lez-Durance Cedex (France); Riva, M [Associazione Euratom - ENEA sulla Fusione, C.R. Frascati, CP 65, I-00040, Frascati, Rome (Italy); Zastrow, K D [Euratom/UKAEA Fusion Association, Cuhlam Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom)

2003-06-01

A large variety of JET discharges with internal transport barriers (ITBs) has been analysed in order to determine the main features which characterize turbulence stabilization at the barrier. It is found that the location of barriers is well correlated with regions where the ExB flow shearing rate exceeds the linear growth rate of the ion temperature gradient mode instability ({gamma}{sub {eta}{sub i}}). A key point is the dependence of {gamma}{sub {eta}{sub i}} on the magnetic shear: in the discharges of this database the reduction of {gamma}{sub {eta}{sub i}} associated to very low or null magnetic shear favours the formation of an ITB. After the ITB formation a positive feedback occurs in which the ExB flow shear mechanism has the leading role and the position of the barrier may be no longer linked to the low shear region.

Giant epidermal inclusion cyst in the male breast: A case report

Energy Technology Data Exchange (ETDEWEB)

KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)

2017-03-15

Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.

Recent experimental studies of edge and internal transport barriers in the DIII-D tokamak

International Nuclear Information System (INIS)

Gohil, P; Baylor, L R; Burrell, K H; Casper, T A; Doyle, E J; Greenfield, C M; Jernigan, T C; Kinsey, J E; Lasnier, C J; Moyer, R A; Murakami, M; Rhodes, T L; Rudakov, D L; Staebler, G M; Wang, G; Watkins, J G; West, W P; Zeng, L

2003-01-01

Results from recent experiments on the DIII-D tokamak have revealed many important details on transport barriers at the plasma edge and in the plasma core. These experiments include: (a) the formation of the H-mode edge barrier directly by pellet injection; (b) the formation of a quiescent H-mode edge barrier (QH-mode) which is free from edge localized modes, but which still exhibits good density and radiative power control; (c) the formation of multiple transport barriers, such as the quiescent double barrier (QDB) which combines an internal transport barrier with the quiescent H-mode edge barrier. Results from the pellet-induced H-mode experiments indicate that: (a) the edge temperature (electron or ion) does not need to attain a critical value for the formation of the H-mode barrier, (b) pellet injection leads to an increased gradient in the radial electric field, E r , at the plasma edge; (c) the experimentally determined edge parameters at barrier transition are well below the predictions of several theories on the formation of the H-mode barrier, (d) pellet injection can lower the threshold power required to form the H-mode barrier. The quiescent H-mode barrier exhibits good density control as the result of continuous magnetohydrodynamic activity at the plasma edge called the edge harmonic oscillation (EHO). The EHO enhances the edge particle transport whilst maintaining a good energy transport barrier. The ability to produce multiple barriers in the QDB regime has led to long duration, high-performance plasmas with β N H 89 values of 7 for up to 10 times the confinement time. Density profile control in the plasma core of QDB plasmas has been demonstrated using on-axis electron cyclotron heating

Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

DEFF Research Database (Denmark)

Kamstrup, M.; Faurschou, A.; Gniadecki, R.

2008-01-01

In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

Transport barriers in bootstrap-driven tokamaks

Science.gov (United States)

Staebler, G. M.; Garofalo, A. M.; Pan, C.; McClenaghan, J.; Van Zeeland, M. A.; Lao, L. L.

2018-05-01

Experiments have demonstrated improved energy confinement due to the spontaneous formation of an internal transport barrier in high bootstrap fraction discharges. Gyrokinetic analysis, and quasilinear predictive modeling, demonstrates that the observed transport barrier is caused by the suppression of turbulence primarily from the large Shafranov shift. It is shown that the Shafranov shift can produce a bifurcation to improved confinement in regions of positive magnetic shear or a continuous reduction in transport for weak or negative magnetic shear. Operation at high safety factor lowers the pressure gradient threshold for the Shafranov shift-driven barrier formation. Two self-organized states of the internal and edge transport barrier are observed. It is shown that these two states are controlled by the interaction of the bootstrap current with magnetic shear, and the kinetic ballooning mode instability boundary. Election scale energy transport is predicted to be dominant in the inner 60% of the profile. Evidence is presented that energetic particle-driven instabilities could be playing a role in the thermal energy transport in this region.

EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

African Journals Online (AJOL)

Administrator

stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

Science.gov (United States)

Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

1989-10-15

The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

Role of E x B Shear and Magnetic Shear in the Formation of Transport Barriers in DIII-D

International Nuclear Information System (INIS)

Burrell, K.H.

2005-01-01

Development of the E x B shear stabilization model to explain the formation of transport barriers in magnetic confinement devices is a major achievement of fusion research. This concept has the universality needed to explain the H-mode edge transport barriers seen in limiter and divertor tokamaks, stellarators, and mirror machines; the broader edge transport barrier seen in VH-mode plasmas; and the core transport barriers formed in tokamaks with low or negative magnetic shear. These examples of confinement improvement are of considerable physical interest; it is not often that a system self-organizes to reduce transport when an additional source of free energy is applied to it. The transport decrease associated with E x B velocity shear is also of great practical benefit to fusion research. The fundamental physics involved in transport reduction is the effect of E x B shear on the growth, radial extent, and phase correlation of turbulent eddies in the plasma. The same basic transport reduction process can be operational in various portions of the plasma because there are a number of ways to change the radial electric field E r . An important theme in this area is the synergistic effect of E x B velocity shear and magnetic shear. Although the E x B velocity shear appears to have an effect on broader classes of microturbulence, magnetic shear can mitigate some potentially harmful effects of E x B velocity shear and facilitate turbulence stabilization. The experimental results on DIII-D and other devices are generally consistent with the basic theoretical models

Tc-99m-MDP scintigraphy in the evaluation of epidermal nevus syndrome

International Nuclear Information System (INIS)

Barbosa, M.N.S.; Cunha, M.O.; Severiche, A.F.A.; Ramos, C.D.; Etchebehere, E.C.S.C.; Belangero, W.; Camargo, E.E.

1997-01-01

Full text: Epidermal nevus syndrome has been described as a congenital neurocutaneous disorder in which epidermal nevi are associated with malformations of other organs, commonly the skeleton and central nervous system. Ocular, cardiac, and genitourinary system abnormalities, as well as other skin lesions, may also be seen. A 19 year old patient with epidermal nevus syndrome, presenting congenital facial epidermal nevi and bone deformity of the lower limbs (shortening of the left leg, left thigh varum, bilateral genu valgum, and multiple pathological fractures), as referred to the nuclear medicine laboratory to evaluate involvement of other sites of the skeleton. Whole body bone scintigraphy performed with MDP-Tc-99m showed multiple small focal areas of increased uptake in the skeleton, mainly in the upper and lower limbs, posterior ribs, right acetabulum, right sacroiliac joint, and right greater trochanter, interpreted as pathological fractures at different stages of remodeling. The range of skeletal findings in this condition is quite diverse. Many of these findings can be attributed to local tissue overgrowth with deformities and advanced bone age, associate with pathological fractures

Formation of transport barriers in the MAST spherical tokamak

Energy Technology Data Exchange (ETDEWEB)

Meyer, H [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Field, A R [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Akers, R J [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Brickley, C [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Conway, N J [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Patel, A [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Carolan, P G [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Challis, C [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Counsell, G F [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Cunningham, G [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Helander, P [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Kirk, A [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Lloyd, B [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Maingi, R [Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States); Tournianski, M R [EURATOM/UKAEA Fusion Association, Culham Science Centre, Abingdon, Oxfordshire, OX14 3DB (United Kingdom); Walsh, M J [Walsh Scientific Ltd, Culham Science Centre, Abingdon, Oxfordshire, OX14 3EB (United Kingdom)

2004-05-01

In the Mega Ampere Spherical Tokamak (MAST) plasmas have been generated with internal (ITB) or edge (ETB) transport barriers. ITBs were achieved in both the electron and the ion energy channel. In the presence of an ITB in the ion energy channel, transport analysis shows that the ion thermal diffusivity, {chi}{sub i}, is reduced to almost neoclassical values while the ITB persists. The widely tested criteria for ITB formation {rho}{sub t}{sup *}={rho}{sub s}{alpha}lnT/{alpha}R>{rho}{sub ITB}{sup *}{approx}0.014 ({rho}{sub s}: Larmor radius at sound speed) obtained from dimensional analysis of JET discharges is easily exceeded on MAST. Even without the evidence of an {rho}{sub T}{sup *}>0.014 often applies, showing that this criterion in its current form is not generally applicable. ETBs are most easily formed in MAST if in a double null divertor configuration the discharge is vertically balanced, so that both X-points are almost on the same flux surface (CDND), and if the plasma is refuelled from the high field side mid-plane. The H-mode threshold power, P{sub thr} = 0.5 MW, in connected double null diverted (CDND) is only about half of that in a similar disconnected discharge with the ion {nabla} B drift towards the X-point on the last closed flux surface (LDND). P{sub thr} scales between lower double null diverted (LDND) and the single null diverted configuration with the plasma surface area on MAST.

Stepwise expansion of a surface dielectric barrier discharge as a result of alternation in formation of streamers and leaders

International Nuclear Information System (INIS)

Akishev, Yu; Aponin, G; Balakirev, A; Grushin, M; Petryakov, A; Karal'nik, V; Trushkin, N

2013-01-01

Spatial–temporal development of the plasma sheet structure in a surface dielectric barrier discharge (SDBD) powered with a single long pulse of negative polarity is traced. Ambient air and Ar at atmospheric pressure are used as plasma-forming gases. It is found that current regimes and spatial structures occurring at the development of a long-pulsed discharge differ cardinally as compared with those of a short-pulsed SDBD. In the case of long-pulsed SDBDs, the expansion of the barrier area covered by the plasma sheet and seeded with a surface negative charge occurs in a stepwise manner due to cyclic alternation (one after another) in generation of surface streamers and formation of hot surface leaders from the streamers due to streamer–leader transitions. Leaders, in their turn, initiate new streamers, which serve again as precursors for next-step leader formation, and so on. However, the crucial role in surface charge deposition is played not by streamers and leaders but by a diffusive plasma sheet (DPS), which slowly extends from the sides of streamers and leaders. The expansion of the DPS occurs due to the ionization wave propagating from the sides of the streamers and leaders. The difference in spatial structures of a single long-pulsed and a steady-state sin SDBD is studied. In high-frequency sin SDBDs at negative half-cycle there are only leaders and DPS, but there are no streamers. The reason is that there is no necessity for the formation of leaders due to streamer–leader transitions—leaders are formed at the previous cycle and do not decay strongly till the beginning of the next cycle, and they recover themselves without streamers. (paper)

Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

Energy Technology Data Exchange (ETDEWEB)

Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran [Uijongbu St. Mary' s Hospital, Catholic University College of Medicine, Seoul (Korea, Republic of)

2007-08-15

We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation.

Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

International Nuclear Information System (INIS)

Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran

2007-01-01

We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation

Barriers in the energy of deformed nuclei

Directory of Open Access Journals (Sweden)

V. Yu. Denisov

2014-06-01

Full Text Available Interaction energy between two nuclei considering to their deformations is studied. Coulomb and nuclear in-teraction energies, as well as the deformation energies of both nuclei, are taken into account at evaluation of the interaction energy. It is shown that the barrier related to the interaction energy of two nuclei depends on the de-formations and the height of the minimal barrier is evaluated. It is obtained that the heavier nucleus-nucleus sys-tems have large deformation values at the lowest barrier. The difference between the barrier between spherical nuclei and the lowest barrier between deformed nuclei increases with the mass and the charge of the interacting nuclei.

Epidermal growth factor in mammary glands and milk from rats

DEFF Research Database (Denmark)

Thulesen, J; Raaberg, Lasse; Nexø, Ebba

1993-01-01

Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

Toxic epidermal necrolysis and Stevens-Johnson syndrome

Directory of Open Access Journals (Sweden)

French Lars E

2010-12-01

Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

A review of toxic epidermal necrolysis management in Japan

Directory of Open Access Journals (Sweden)

Yuri Kinoshita

2017-01-01

Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

African Journals Online (AJOL)

REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.

Epidermal cell death in frogs with chytridiomycosis

Directory of Open Access Journals (Sweden)

Laura A. Brannelly

2017-02-01

Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis

Directory of Open Access Journals (Sweden)

Hugo Nodarse-Cuní

2013-03-01

Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.

Comparison of Edge and Internal Transport Barriers in Drift Wave Predictive Simulations

DEFF Research Database (Denmark)

Weiland, J.; Crombe, K.; Mantica, P.

2011-01-01

We have simulated the formation of an internal transport barrier on JET including a self-consistent treatment of ion and electron temperatures and poloidal and toroidal momentum. Similar simulations of edge transport barriers, including the L-H transition have also been made. However, here only p...... for the internal barrier. For the edge barrier the edge density was varied and it turned out that a lower edge density gave a stronger barrier. Electromagnetic and nonlocal effects were important for both types of barriers. [ABSTRACT FROM AUTHOR]......We have simulated the formation of an internal transport barrier on JET including a self-consistent treatment of ion and electron temperatures and poloidal and toroidal momentum. Similar simulations of edge transport barriers, including the L-H transition have also been made. However, here only...... polodal momentum and the temperatures were simulated. The internal barrier included an anomalous spinup of poloidal momentum similar to that in the experiment. Also the edge barrier was accompanied by a spinup of poloidal momentum. The experimental density (with no barrier) was used and kept fixed...

FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

African Journals Online (AJOL)

Administrator

alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

Stevens Johnsons syndrom og toksisk epidermal nekrolyse

DEFF Research Database (Denmark)

Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

2013-01-01

Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography.

Science.gov (United States)

Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique

2014-10-01

While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment

Standardized method to obtain dermo-epidermal junction samples from bovine hoof

Directory of Open Access Journals (Sweden)

H.M.F. Mendes

2015-04-01

Full Text Available As afecções podais em bovinos causam importante impacto econômico negativo na bovinocultura. Pesquisas têm sido realizadas com o objetivo de avançar no entendimento dos processos ocorridos na junção derme-epiderme do casco de bovinos com laminite e nos demais tecidos moles durante as lesões infecciosas. Apesar disso, não foram encontrados na literatura consultada estudos que descrevessem um método padronizado para a obtenção de amostras do tecido laminar do casco. Nesse contexto, foi necessário criar e estabelecer um método viável para a colheita de amostras da junção derme-epiderme, de modo a viabilizar o estudo de pós-graduação que originou esta comunicação. O objetivo é relatar um método padronizado, testado e bem-sucedido para obtenção de amostras da junção derme-epiderme do casco de bovinos em suas regiões solear, axial e dorsal. Foram obtidos fragmentos transversais das unhas de vacas abatidas em frigorífico. A espessura desses fragmentos foi de 1,5cm, aproximadamente, e contemplava as regiões solear, axial e dorsal do casco. De forma sistematizada, amostras da junção derme-epiderme de cada uma dessas regiões foram removidas, fixadas em formol, processadas e incluídas em parafina. A análise usando microscopia de luz demonstrou cortes histológicos íntegros e sem artefatos, que permitiram ampla avaliação das estruturas tanto da derme quanto da epiderme. Concluiu-se que o método proposto viabiliza a obtenção de amostras de padrão e qualidade adequados ao estudo do tecido laminar do casco bovino.

Improvement of arbutin trans-epidermal delivery using ...

African Journals Online (AJOL)

Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...

Lipid functions in skin: Differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model.

Science.gov (United States)

Kendall, Alexandra C; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke C; Harwood, John L; Nicolaou, Anna

2017-09-01

Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, derivatives of the same sphingoid bases and various fatty acids, are produced by dermal and epidermal cells and perform signalling roles in cell functions ranging from differentiation to apoptosis. Supplementation with the n-3 polyunsaturated fatty acids (PUFA) eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have shown promise as therapeutic agents in a number of inflammatory skin conditions, altering the lipid profile of the skin and production of bioactive lipids such as the eicosanoids, docosanoids and endocannabinoids. In this study we wished to investigate whether EPA and DHA could also affect the ceramide profile in epidermis and dermis, and, in this way, contribute to formation of a robust lipid barrier and ceramide-mediated regulation of skin functions. Ex vivo skin explants were cultured for 6days, and supplemented with EPA or DHA (50μM). Liquid chromatography coupled to tandem mass spectrometry with electrospray ionisation was used to assess the prevalence of 321 individual ceramide species, and a number of sphingoid bases, phosphorylated sphingoid bases, and phosphorylated ceramides, within the dermis and epidermis. EPA augmented dermal production of members of the ceramide families containing Non-hydroxy fatty acids and Sphingosine or Dihydrosphingosine bases (CER[NS] and CER[NDS], respectively), while epidermal CER[EOH], CER[EOS] and CER[EOP] ceramides were not affected. DHA did not significantly affect ceramide production. Ceramide-1-phosphate levels in

Epidermal characters of Tamarix L. (Tamaricaceae from Northwest China and their taxonomic and palaeogeographic implications

Directory of Open Access Journals (Sweden)

Jian-Wei Zhang

2018-04-01

Full Text Available The taxonomical position of species of the genus Tamarix (Tamaricaceae has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves, and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to the studies, the leaf epidermal features, together with the character of the flower, are taxonomically clearly distinct. The establishment of Tamarix albiflonum is consolidated. Tamarix korolkowi and Tamarix ramosissima have minimal differences in epidermal characters, and the former is suggested to be a junior synonym. Tamarix ramosissima, Tamarix tarimensis, Tamarix arceuthoides and Tamarix hohenackeri are most similar with respect to their leaf epidermis; considering the common morphological features, habit, distribution and especially the hybridization, it is suggested that these four species are closely genetically related and that the variations among them are probably intraspecific. The new taxonomical evidence indicates the occurrence of 13 species and four variants in China. Presently, Tamarix is a typical plant of arid and semi-arid regions, but its Eocene ancestors lived in warm and humid climates in the coastal areas of the ancient Mediterranean Sea. Thus, the papillae or epidermal hairs, which are outgrowths of the outer epidermal cells facilitating the leaf to respond to water stress and commonly seen in the plants growing in arid or semi-arid areas rather than the plants in warm and humid climates, are of relatively recent origin in Tamarix. The primitive species lack papillae or epidermal hairs, while in evolved species these structures are abundant. Based on the ecological adaptations of the epidermal features, the palaeogeographic

Barrier Methods of Birth Control: Spermicide, Condom, Sponge, Diaphragm, and Cervical Cap

Science.gov (United States)

... ACOG Barrier Methods of Birth Control: Spermicide, Condom, Sponge, Diaphragm, and Cervical Cap Home For Patients Search ... Format Barrier Methods of Birth Control: Spermicide, Condom, Sponge, Diaphragm, and Cervical Cap Contraception What are barrier ...

Loss of corneodesmosin leads to severe skin barrier defect, pruritus, and atopy: unraveling the peeling skin disease.

Science.gov (United States)

Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

2010-08-13

Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.

Hybrid Enhanced Epidermal SpaceSuit Design Approaches

Science.gov (United States)

Jessup, Joseph M.

A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

Self-stabilized discharge filament in plane-parallel barrier discharge configuration: formation, breakdown mechanism, and memory effects

Science.gov (United States)

Tschiersch, R.; Nemschokmichal, S.; Bogaczyk, M.; Meichsner, J.

2017-10-01

Single self-stabilized discharge filaments were investigated in the plane-parallel electrode configuration. The barrier discharge was operated inside a gap of 3 mm shielded by glass plates to both electrodes, using helium-nitrogen mixtures and a square-wave feeding voltage at a frequency of 2 kHz. The combined application of electrical measurements, ICCD camera imaging, optical emission spectroscopy and surface charge diagnostics via the electro-optic Pockels effect allowed the correlation of the discharge development in the volume and on the dielectric surfaces. The formation criteria and existence regimes were found by systematic variation of the nitrogen admixture to helium, the total pressure and the feeding voltage amplitude. Single self-stabilized discharge filaments can be operated over a wide parameter range, foremost, by significant reduction of the voltage amplitude after the operation in the microdischarge regime. Here, the outstanding importance of the surface charge memory effect on the long-term stability was pointed out by the recalculated spatio-temporally resolved gap voltage. The optical emission revealed discharge characteristics that are partially reminiscent of both the glow-like barrier discharge and the microdischarge regime, such as a Townsend pre-phase, a fast cathode-directed ionization front during the breakdown and radially propagating surface discharges during the afterglow.

BAG-1 enhances cell-cell adhesion, reduces proliferation and induces chaperone-independent suppression of hepatocyte growth factor-induced epidermal keratinocyte migration

International Nuclear Information System (INIS)

Hinitt, C.A.M.; Wood, J.; Lee, S.S.; Williams, A.C.; Howarth, J.L.; Glover, C.P.; Uney, J.B.; Hague, A.

2010-01-01

Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF) in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.

Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

International Nuclear Information System (INIS)

Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

2014-01-01

Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

Energy Technology Data Exchange (ETDEWEB)

Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

2014-10-15

Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

Combination effects of epidermal growth factor and glial cell line-derived neurotrophic factor on the in vitro developmental potential of porcine oocytes

DEFF Research Database (Denmark)

Valleh, Mehdi Vafaye; Rasmussen, Mikkel Aabech; Hyttel, Poul

2016-01-01

of improving this issue, the single and combined effects of epidermal growth factor (EGF) and glial cell line-derived neurotrophic factor (GDNF) on oocyte developmental competence were investigated. Porcine cumulus–oocyte cell complexes (COCs) were matured in serum-free medium supplemented with EGF (0, 10...... with the combination of EGF and GDNF was shown to significantly improve oocyte competence in terms of blastocyst formation, blastocyst cell number and blastocyst hatching rate (P

On barrier performance of high compaction bentonite in facilities of disposing high level radioactive wastes in formation

International Nuclear Information System (INIS)

Ikeda, Hidefumi; Komada, Hiroya

1989-01-01

As for the method of disposing high level radioactive wastes generated in the reprocessing of spent fuel, at present formation disposal is regarded as most promising. The most important point in this formation disposal is to prevent the leak of radioactive nuclides within the disposal facilities into bedrocks and their move to the zone of human life. As the method of formation disposal, the canisters containing high level radioactive wastes are placed in the horizontal or vertical holes for disposal dug from horizontal tunnels which are several hundreds m underground, and the tunnels and disposal holes are filled again. For this filling material, the barrier performance to prevent and retard the leak of radioactive nuclides out of the disposal facilities is expected, and the characteristics of low water permeability, the adsorption of nuclides and long term stability are required. However, due to the decay heat of wastes just after the disposal, high temperature and drying condition arises, and this must be taken in consideration. The characteristics required for filling materials and the selection of the materials, the features and classification of bentonite, the properties of high compaction bentonite, and the move of water, heat and nuclides in high compaction bentonite are reported.(Kako, I.)

Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

Science.gov (United States)

van Smeden, Jeroen; Bouwstra, Joke A

2016-01-01

Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

Cardiotonic steroid ouabain stimulates expression of blood-testis barrier proteins claudin-1 and -11 and formation of tight junctions in Sertoli cells.

Science.gov (United States)

Dietze, Raimund; Shihan, Mazen; Stammler, Angelika; Konrad, Lutz; Scheiner-Bobis, Georgios

2015-04-15

The interaction of ouabain with the sodium pump induces signalling cascades resembling those triggered by hormone/receptor interactions. In the rat Sertoli cell line 93RS2, ouabain at low concentrations stimulates the c-Src/c-Raf/Erk1/2 signalling cascade via its interaction with the α4 isoform of the sodium pump expressed in these cells, leading to the activation of the transcription factor CREB. As a result of this signalling sequence, ouabain stimulates expression of claudin-1 and claudin-11, which are also controlled by a CRE promoter. Both of these proteins are known to be essential constituents of tight junctions (TJ) between Sertoli cells, and as a result of the ouabain-induced signalling TJ formation between neighbouring Sertoli cells is significantly enhanced by the steroid. Thus, ouabain-treated cell monolayers display higher transepithelial resistance and reduced free diffusion of FITC-coupled dextran in tracer diffusion assays. Taking into consideration that the formation of TJ is indispensable for the maintenance of the blood-testis barrier (BTB) and therefore for male fertility, the actions of ouabain described here and the fact that this and other related cardiotonic steroids (CTS) are produced endogenously suggest a direct influence of ouabain/sodium pump interactions on the maintenance of the BTB and thereby an effect on male fertility. Since claudin-1 and claudin-11 are also present in other blood-tissue barriers, one can speculate that ouabain and perhaps other CTS influence the dynamics of these barriers as well. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Permeability Barrier Generation in the Martian Lithosphere

Science.gov (United States)

Schools, Joe; Montési, Laurent

2015-11-01

Permeability barriers develop when a magma produced in the interior of a planet rises into the cooler lithosphere and crystallizes more rapidly than the lithosphere can deform (Sparks and Parmentier, 1991). Crystallization products may then clog the porous network in which melt is propagating, reducing the permeability to almost zero, i.e., forming a permeability barrier. Subsequent melts cannot cross the barrier. Permeability barriers have been useful to explain variations in crustal thickness at mid-ocean ridges on Earth (Magde et al., 1997; Hebert and Montési, 2011; Montési et al., 2011). We explore here under what conditions permeability barriers may form on Mars.We use the MELTS thermodynamic calculator (Ghiorso and Sack, 1995; Ghiorso et al., 2002; Asimow et al., 2004) in conjunction with estimated Martian mantle compositions (Morgan and Anders, 1979; Wänke and Dreibus, 1994; Lodders and Fegley, 1997; Sanloup et al., 1999; Taylor 2013) to model the formation of permeability barriers in the lithosphere of Mars. In order to represent potential past and present conditions of Mars, we vary the lithospheric thickness, mantle potential temperature (heat flux), oxygen fugacity, and water content.Our results show that permeability layers can develop in the thermal boundary layer of the simulated Martian lithosphere if the mantle potential temperature is higher than ~1500°C. The various Martian mantle compositions yield barriers in the same locations, under matching variable conditions. There is no significant difference in barrier location over the range of accepted Martian oxygen fugacity values. Water content is the most significant influence on barrier development as it reduces the temperature of crystallization, allowing melt to rise further into the lithosphere. Our lower temperature and thicker lithosphere model runs, which are likely the most similar to modern Mars, show no permeability barrier generation. Losing the possibility of having a permeability

Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

DEFF Research Database (Denmark)

Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

2010-01-01

chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

International Nuclear Information System (INIS)

Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

1975-01-01

Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat

Directory of Open Access Journals (Sweden)

Roberta Sartori

2016-06-01

Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.

Epidermal characters of Tamarix L. (Tamaricaceae) from Northwest China and their taxonomic and palaeogeographic implications

OpenAIRE

Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan

2018-01-01

The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...

Immobilization of epidermal growth factor on titanium and stainless steel surfaces via dopamine treatment

Energy Technology Data Exchange (ETDEWEB)

Kang, Jeonghwa [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Department of Biological Sciences, Tokyo Metropolitan University, 1-1 Minami-Osawa, Tokyo, 192-0397 Japan (Japan); Sakuragi, Makoto; Shibata, Aya; Abe, Hiroshi; Kitajima, Takashi; Tada, Seiichi [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Mizutani, Masayoshi; Ohmori, Hitoshi [Material Fabrication Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Ayame, Hirohito [Diagnostic Biochip Laboratory, RIKEN Center for Intellectual Property Strategies, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Son, Tae Il [Bioscience and Biotechnology, Chung-Ang University, 40-1 San, Nae-Ri, Daeduck-myun, Ansung-si, Kyungki-do, 456-756 (Korea, Republic of); Aigaki, Toshiro [Department of Biological Sciences, Tokyo Metropolitan University, 1-1 Minami-Osawa, Tokyo, 192-0397 Japan (Japan); Ito, Yoshihiro, E-mail: y-ito@riken.jp [Nano Medical Engineering Laboratory, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Department of Biological Sciences, Tokyo Metropolitan University, 1-1 Minami-Osawa, Tokyo, 192-0397 Japan (Japan); Diagnostic Biochip Laboratory, RIKEN Center for Intellectual Property Strategies, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan)

2012-12-01

Titanium and stainless steel were modified with dopamine for the immobilization of biomolecules, epidermal growth factor (EGF). First, the treatment of metal surfaces with a dopamine solution under different pH conditions was investigated. At higher pH, the dopamine solution turned brown and formed precipitates. Treatment of the metals with dopamine at pH 8.5 also resulted in the development of brown color at the surface of the metals. The hydrophobicity of the surfaces increased after treatment with dopamine, independently of pH. X-ray photoelectron spectroscopy revealed the formation of a significant amount of an organic layer on both surfaces at pH 8.5. According to ellipsometry measurements, the organic layer formed at pH 8.5 was about 1000 times as thick as that formed at pH 4.5. The amount of amino groups in the layer formed at pH 8.5 was also higher than that observed in the layer formed at pH 4.5. EGF molecules were immobilized onto the dopamine-treated surfaces via a coupling reaction using carbodiimide. A greater amount of EGF was immobilized on surfaces treated at pH 8.5 compared with pH 4.5. Significantly higher growth of rat fibroblast cells was observed on the two EGF-immobilized surfaces compared with non-immobilized surfaces in the presence of EGF. The present study demonstrated that metals can become bioactive via the surface immobilization of a growth factor and that the effect of the immobilized growth factor on metals was greater than that of soluble growth factor. - Highlights: Black-Right-Pointing-Pointer Epidermal growth factor was covalently immobilized on titan or stainless steel surfaces. Black-Right-Pointing-Pointer Amino groups were formed on the surfaces by the treatment and the growth factor was immobilized through amide bonds. Black-Right-Pointing-Pointer The immobilized epidermal growth factor accelerated cell proliferation more than soluble ones on the surfaces.

Safety factor profile dependence of turbulent structure formation in relevant to internal transport barrier relaxation

International Nuclear Information System (INIS)

Tokunaga, S.; Yagi, M.; Itoh, S.-I.; Itoh, K.

2009-01-01

Full text: It is widely understood that the improved confinement mode with transport barrier is necessary to achieve the self-ignition condition in ITER. The negative magnetic shear, mean ExB flow shear, and zonal flow are considered to play important roles for ITB formation. In our previous study, it is found that the non-linear interaction between the meso-scale modes produces non-local energy transfer to the off-resonant mode in the vicinity of q min surface and brings global relaxation of the temperature profile involving ITB collapse. Experimental studies indicate that a relationship exists between the ITB formation and safety factor q-profile, with a reversed magnetic shear (RS) configuration. Transitional ITB events occur on the low-order rational resonant surface. The ITB shape and location depend on the q-profile and q min position. These observations indicate that the q-profile might play an essential role in determining the turbulent structure. In this study, the effect of safety factor profile on the ion temperature gradient driven drift wave (ITG) turbulence is investigated using a global non-linear simulation code based on the gyro-fluid model. A heat source and toroidal momentum source are introduced. Dependence of safety factor profiles on ITB formation and its stability is examined to clarify the influence of the radial distribution of the rational surfaces and the q min value. It is found that the nonlinearly excited meso-scale mode in the vicinity of q min depends on the value of q min . A detailed analysis of the structure selection rule is in progress. (author)

Epidermal growth factor receptor: an independent predictor of survival in astrocytic tumors given definitive irradiation

International Nuclear Information System (INIS)

An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.

1996-01-01

Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas

Advanced transport modeling of toroidal plasmas with transport barriers

International Nuclear Information System (INIS)

Fukuyama, A.; Murakami, S.; Honda, M.; Izumi, Y.; Yagi, M.; Nakajima, N.; Nakamura, Y.; Ozeki, T.

2005-01-01

Transport modeling of toroidal plasmas is one of the most important issue to predict time evolution of burning plasmas and to develop control schemes in reactor plasmas. In order to describe the plasma rotation and rapid transition self-consistently, we have developed an advanced scheme of transport modeling based on dynamical transport equation and applied it to the analysis of transport barrier formation. First we propose a new transport model and examine its behavior by the use of conventional diffusive transport equation. This model includes the electrostatic toroidal ITG mode and the electromagnetic ballooning mode and successfully describes the formation of internal transport barriers. Then the dynamical transport equation is introduced to describe the plasma rotation and the radial electric field self-consistently. The formation of edge transport barriers is systematically studied and compared with experimental observations. The possibility of kinetic transport modeling in velocity space is also examined. Finally the modular structure of integrated modeling code for tokamaks and helical systems is discussed. (author)

Fatal Metastatic Cutaneous Squamous Cell Carcinoma Evolving from a Localized Verrucous Epidermal Nevus

Directory of Open Access Journals (Sweden)

Hassan Riad

2013-10-01

Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.

Plasma Turbulence Suppression and Transport Barrier Formation by Externally Driven RF Waves in Spherical Tokamaks

International Nuclear Information System (INIS)

Bruma, C.; Cuperman, S.C.; Komoshvili, K.

2002-01-01

Turbulent transport of heat and particles is the principle obstacle confronting controlled fusion today. Thus, we investigate quantitatively the suppression of turbulence and formation of transport barriers in spherical tokamaks by sheared electric fields generated by externally driven radio-frequency (RF) waves, in the frequency range o)A n o] < o)ci (e)A and o)ci are the Alfven and ion cyclotron frequencies). This investigation consists of the solution of the full-wave equation for a spherical tokamak in the presence of externally driven fast waves and the evaluation of the power dissipation by the mode-converted Alfven waves. This in turn, provides a radial flow shear responsible for the suppression of plasma turbulence. Thus, a strongly non-linear equation for the radial sheared electric field is solved, the turbulent transport suppression rate is evaluated and compared with the ion temperature gradient (ITG) instability increment. For illustration, the case of START-like device (Sykes 2000) is treated. Thus, (i) the exact D-shape cross-section is considered; (ii) additional kinetic (including Landau damping) and particle trapping effects are added to the resistive two-fluid dielectric tensor operator; (iii) a finite extension antenna located on the low-field-side of the plasma is considered; (iv) a rigorous 2.5 finite elements numerical code (Sewell 1993) is used; and (v) the turbulence and transport barrier generated as a result of wave-plasma interaction is evaluated

Compact toroid formation using barrier fields and controlled reconnection in the TRX-1 field reversed theta pinch

International Nuclear Information System (INIS)

Hoffman, A.L.; Armstrong, W.T.

1982-01-01

TRX-1 is a new 20 cm diameter, 1-m long field reversed theta pinch with a magnetic field swing of 10 kG in 3 μsec. It employs z discharge preionization and octopole barrier fields to maximize flux trapping on first half cycle operation. Cusp coils are used at the theta pinch ends to delay reconnection and fast mirror coils are used to trigger reconnection at a time designed to maximize axial heating efficiency and toroid lifetime. These controls are designed to study toroid formation methods which are claimed to be especially efficient by Russian experimenters. Studies have been conducted on flux trapping efficiency, triggered reconnection, and equilibrium and lifetime

Rapid and dynamic subcellular reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics responses to fungal and oomycete attack

Directory of Open Access Journals (Sweden)

Takemoto Daigo

2008-06-01

Full Text Available Abstract Background Plant cells respond to the presence of potential fungal or oomycete pathogens by mounting a basal defence response that involves aggregation of cytoplasm, reorganization of cytoskeletal, endomembrane and other cell components and development of cell wall appositions beneath the infection site. This response is induced by non-adapted, avirulent and virulent pathogens alike, and in the majority of cases achieves penetration resistance against the microorganism on the plant surface. To explore the nature of signals that trigger this subcellular response and to determine the timing of its induction, we have monitored the reorganization of GFP-tagged actin, microtubules, endoplasmic reticulum (ER and peroxisomes in Arabidopsis plants – after touching the epidermal surface with a microneedle. Results Within 3 to 5 minutes of touching the surface of Arabidopsis cotyledon epidermal cells with fine glass or tungsten needles, actin microfilaments, ER and peroxisomes began to accumulate beneath the point of contact with the needle. Formation of a dense patch of actin was followed by focusing of actin cables on the site of contact. Touching the cell surface induced localized depolymerization of microtubules to form a microtubule-depleted zone surrounding a dense patch of GFP-tubulin beneath the needle tip. The concentration of actin, GFP-tubulin, ER and peroxisomes remained focused on the contact site as the needle moved across the cell surface and quickly dispersed when the needle was removed. Conclusion Our results show that plant cells can detect the gentle pressure of a microneedle on the epidermal cell surface and respond by reorganizing subcellular components in a manner similar to that induced during attack by potential fungal or oomycete pathogens. The results of our study indicate that during plant-pathogen interactions, the basal defence response may be induced by the plant's perception of the physical force exerted by the

High-resolution reconstruction of a coastal barrier system

DEFF Research Database (Denmark)

Fruergaard, Mikkel; Andersen, Thorbjørn Joest; Nielsen, Lars Henrik

2015-01-01

This study presents a detailed reconstruction of the sedimentary effects of Holocene sea-level rise on a modern coastal barrier system (CBS). Increasing concern over the evolution of CBSs due to future accelerated rates of sea-level rise calls for a better understanding of coastal barriers response...... from retreat of the barrier island and probably also due to formation of a tidal inlet close to the study area. Continued transgression and shoreface retreat created a distinct hiatus and wave ravinement surface in the seaward part of the CBS before the barrier shoreline stabilised between 5.0 and 4...

Culture technique of rabbit primary epidermal keratinocytes

Directory of Open Access Journals (Sweden)

Marini M

2012-10-01

Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

NARCIS (Netherlands)

Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

1988-01-01

In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

Optimal allocation of leaf epidermal area for gas exchange.

Science.gov (United States)

de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J

2016-06-01

A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.

Structural Stability of Tokamak Equilibrium: Transport Barriers

Energy Technology Data Exchange (ETDEWEB)

Solano, E. R.

2001-07-01

A generalised theory of structural stability of differential equations is introduced and applied to the Grad-Shafranov equation. It is discussed how the formation and loss of transport barrier could be associated with the appearance/disappearance of equilibria. The equilibrium conjecture is presented: transport barriers are associated with locally diamagnetic regions in the plasma, and affected by the paramagnetism of the bootstrap current. (Author) 18 refs.

Formation of a barrier to groundwater contaminants by the injection of zero-valent iron colloids: Suspension properties

International Nuclear Information System (INIS)

Kaplan, D.I.; Cantrell, K.J.; Wietsma, T.W.

1994-01-01

Zero-valent iron (Fe 0 ) (metallic iron) is a strong chemical reductant that is capable of degrading several halogenated-hydrocarbon compounds (e.g., trichloroethene and tetrachloroethene) and chemically reducing several highly mobile oxidized oxyanions and oxycations to their immobile forms. A series of studies was undertaken to develop methods of injecting micrometer-sized Fe 0 colloids into the subsurface environment to form a chemical barrier to these highly mobile contaminants. Forming a barrier by means of this technique may have the distinct advantage over traditional trench-and-fill technologies: it may be safer, more cost-effective, and may be used at greater depths. Several commercially available Fe 0 colloids were evaluated. One type was selected for further study based on its small size (1 to 2 microm) and the presence of an organic coating. This organic coating was weathered away within 7 days by Hanford ground water (CaCO 3 system, pH 8.1) and exposed the chemically active Fe 0 -colloid surface. Through the use of surfactants in a low ionic strength solution, the length of time that these extremely dense (7.8 g cm -3 ) colloids remained in suspension increased as much as 250%. The efficiency of quartz-sand columns to remove surfactant-coated Fe 0 colloids appeared to be at least partially controlled by injection rate; the filter coefficient values at injection rates of 6, 124, and 248 ml min -1 were 0.30, 0.05, and 0.02 cm -1 , respectively. Studies are underway to develop further understanding of this relationship and to determine the interactive effect of influent colloid concentration and injection flow rate on colloid placement in aquifer sediments for barrier formation

Recovery Effects of Oral Administration of Glucosylceramide and Beet Extract on Skin Barrier Destruction by UVB in Hairless Mice

Directory of Open Access Journals (Sweden)

Yoshihiro Tokudome

2017-10-01

Full Text Available Purified glucosylceramide from beet extract (beet GlcCer and beet extract containing an equal amount of GlcCer were administered orally to ultra violet B (UVB-irradiated mice, and differences in the protective effects against skin barrier dysfunction caused by UVB irradiation were compared. In the beet GlcCer group, epidermal thickening and the decrease in stratum corneum (SC ceramide content caused by UVB irradiation were reduced. In the group that was orally administered beet extract containing glucosylceramide, effects similar to those in the beet GlcCer group were observed. Oral administration of beet GlcCer had no obvious effects against an increase in TEWL or decrease in SC water content after UVB irradiation, but there was improvement in the beet extract group. Oral administration of beet GlcCer is effective in improving skin barrier function in UVB-irradiated mice. Beet extract contains constituents other than GlcCer that are also effective in improving skin barrier function.

Inflammatory linear verrucous epidermal naevus: Report of three ...

African Journals Online (AJOL)

Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

Formation and sustainment of internal transport barriers in the International Thermonuclear Experimental Reactor with the baseline heating mix

Energy Technology Data Exchange (ETDEWEB)

Poli, Francesca M.; Kessel, Charles E. [Princeton Plasma Physics laboratory, Princeton, New Jersey 08543 (United States)

2013-05-15

Plasmas with internal transport barriers (ITBs) are a potential and attractive route to steady-state operation in ITER. These plasmas exhibit radially localized regions of improved confinement with steep pressure gradients in the plasma core, which drive large bootstrap current and generate hollow current profiles and negative magnetic shear. This work examines the formation and sustainment of ITBs in ITER with electron cyclotron heating and current drive. The time-dependent transport simulations indicate that, with a trade-off of the power delivered to the equatorial and to the upper launcher, the sustainment of steady-state ITBs can be demonstrated in ITER with the baseline heating configuration.

Formation and sustainment of internal transport barriers in the International Thermonuclear Experimental Reactor with the baseline heating mixa)

Science.gov (United States)

Poli, Francesca M.; Kessel, Charles E.

2013-05-01

Plasmas with internal transport barriers (ITBs) are a potential and attractive route to steady-state operation in ITER. These plasmas exhibit radially localized regions of improved confinement with steep pressure gradients in the plasma core, which drive large bootstrap current and generate hollow current profiles and negative magnetic shear. This work examines the formation and sustainment of ITBs in ITER with electron cyclotron heating and current drive. The time-dependent transport simulations indicate that, with a trade-off of the power delivered to the equatorial and to the upper launcher, the sustainment of steady-state ITBs can be demonstrated in ITER with the baseline heating configuration.

Etanercept therapy for toxic epidermal necrolysis.

Science.gov (United States)

Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio

2014-08-01

Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

Steroid hormone and epidermal growth factor receptors in meningiomas.

Science.gov (United States)

Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R

1989-11-01

A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.

Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

Energy Technology Data Exchange (ETDEWEB)

Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

2016-03-15

Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

Sebaceous Gland, Hair Shaft, and Epidermal Barrier Abnormalities in Keratosis Pilaris with and without Filaggrin Deficiency

Science.gov (United States)

Gruber, Robert; Sugarman, Jeffrey L.; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M.; Mauldin, Elizabeth A.; Thyssen, Jacob P.; Brandner, Johanna M.; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M.

2016-01-01

Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities. PMID:25660180

Trafficking through COPII stabilises cell polarity and drives secretion during Drosophila epidermal differentiation.

Directory of Open Access Journals (Sweden)

Michaela Norum

2010-05-01

Full Text Available The differentiation of an extracellular matrix (ECM at the apical side of epithelial cells implies massive polarised secretion and membrane trafficking. An epithelial cell is hence engaged in coordinating secretion and cell polarity for a correct and efficient ECM formation.We are studying the molecular mechanisms that Drosophila tracheal and epidermal cells deploy to form their specific apical ECM during differentiation. In this work we demonstrate that the two genetically identified factors haunted and ghost are essential for polarity maintenance, membrane topology as well as for secretion of the tracheal luminal matrix and the cuticle. We show that they code for the Drosophila COPII vesicle-coating components Sec23 and Sec24, respectively, that organise vesicle transport from the ER to the Golgi apparatus.Taken together, epithelial differentiation during Drosophila embryogenesis is a concerted action of ECM formation, plasma membrane remodelling and maintenance of cell polarity that all three rely mainly, if not absolutely, on the canonical secretory pathway from the ER over the Golgi apparatus to the plasma membrane. Our results indicate that COPII vesicles constitute a central hub for these processes.

Financial Inclusion, Entry Barriers, and Entrepreneurship: Evidence from China

Directory of Open Access Journals (Sweden)

Zhaobin Fan

2017-02-01

Full Text Available This paper aims at investigating the relationship between financial inclusion and the formation of entrepreneurs, both theoretically and empirically. We first construct a theoretical model to examine how the development of financial inclusion affects the formation of entrepreneurs. The model suggests that the development of financial inclusion can mitigate credit constraints on entrepreneurial activities by reducing information asymmetry in financial transactions, and in addition this effect is greater in industries with lower barriers to entry. Then, using data from 31 provinces and 19 industries in China during the period 2005–2014, we test the impact of financial inclusion on the formation of entrepreneurs. The estimation results confirm the positive effect of financial inclusion development on the formation of entrepreneurs, and indicate that this effect is heterogeneous across industries. Moreover, the development of financial inclusion is often beneficial to the formations of entrepreneurs in sectors with lower entry barriers.

Assessment of the Developmental Toxicity of Epidermal Growth ...

African Journals Online (AJOL)

Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

Calcium-dependent depletion zones in the cortical microtubule array coincide with sites of, but do not regulate, wall ingrowth papillae deposition in epidermal transfer cells

Science.gov (United States)

Zhang, Hui-ming; Talbot, Mark J.; McCurdy, David W.; Patrick, John W.; Offler, Christina E.

2015-01-01

Trans-differentiation to a transfer-cell morphology is characterized by the localized deposition of wall ingrowth papillae that protrude into the cytosol. Whether the cortical microtubule array directs wall ingrowth papillae formation was investigated using a Vicia faba cotyledon culture system in which their adaxial epidermal cells were spontaneously induced to trans-differentiate to transfer cells. During deposition of wall ingrowth papillae, the aligned cortical microtubule arrays in precursor epidermal cells were reorganized into a randomized array characterized by circular depletion zones. Concurrence of the temporal appearance, spatial pattern, and size of depletion zones and wall ingrowth papillae was consistent with each papilla occupying a depletion zone. Surprisingly, microtubules appeared not to regulate construction of wall ingrowth papillae, as neither depolymerization nor stabilization of cortical microtubules changed their deposition pattern or morphology. Moreover, the size and spatial pattern of depletion zones was unaltered when the formation of wall ingrowth papillae was blocked by inhibiting cellulose biosynthesis. In contrast, the depletion zones were absent when the cytosolic calcium plumes, responsible for directing wall ingrowth papillae formation, were blocked or dissipated. Thus, we conclude that the depletion zones within the cortical microtubule array result from localized depolymerization of microtubules initiated by elevated cytosolic Ca2+ levels at loci where wall ingrowth papillae are deposited. The physiological significance of the depletion zones as a mechanism to accommodate the construction of wall ingrowth papillae without compromising maintenance of the plasma membrane–microtubule inter-relationship is discussed. PMID:26136268

Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

Science.gov (United States)

Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

2015-09-01

Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

The epidermal biosynthesis of cholecalciferol (vitamin D3)

International Nuclear Information System (INIS)

Beadle, P.C.

1977-01-01

An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis

Science.gov (United States)

... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...

Comparative SEM and LM foliar epidermal and palyno-morphological studies of Amaranthaceae and its taxonomic implications.

Science.gov (United States)

Hussain, Amara Noor; Zafar, Muhammad; Ahmad, Mushtaq; Khan, Raees; Yaseen, Ghulam; Khan, Muhammad Saleem; Nazir, Abdul; Khan, Amir Muhammad; Shaheen, Shabnum

2018-05-01

Palynological features as well as comparative foliar epidermal using light and scanning electron microscope (SEM) of 17 species (10genera) of Amaranthaceae have been studied for its taxonomic significance. Different foliar and palynological micro-morphological characters were examined to explain their value in resolving the difficulty in identification. All species were amphistomatic but stomata on abaxial surface were more abundant. Taxonomically significant epidermal character including stomata type, trichomes (unicellular, multicellular, and capitate) and epidermal cells shapes (polygonal and irregular) were also observed. Pollens of this family are Polypantoporate, pores large, spheroidal, mesoporous region is sparsely to scabrate, densely psilate, and spinulose. All these characters can be active at species level for identification purpose. This study indicates that at different taxonomic levels, LM and SEM pollen and epidermal morphology is explanatory and significant to identify species and genera. © 2018 Wiley Periodicals, Inc.

Fisetin Regulates Nrf2 Expression and the Inflammation-Related Signaling Pathway to Prevent UVB-Induced Skin Damage in Hairless Mice

Directory of Open Access Journals (Sweden)

Po-Yuan Wu

2017-10-01

Full Text Available Chronic ultraviolet (UV exposure may cause skin damage, disrupt skin barrier function, and promote wrinkle formation. UV induces oxidative stress and inflammation, which results in extracellular matrix degradation in the dermis and epidermal hyperplasia. Our previous study demonstrated that fisetin exerts photoprotective activity by inhibiting mitogen-activated protein kinase/activator protein-1/matrix metalloproteinases (MMPs activation. In this study, fisetin was applied topically to investigate its antiphotodamage effects in hairless mice. The erythema index (a* values and transepidermal water loss were evaluated to assess skin damage, and immunohistochemical staining was conducted to elucidate the photoprotective mechanism of fisetin. The results revealed that the topical application of fisetin reduced UVB-induced increase in the a* value and wrinkle formation. In addition, fisetin inhibited epidermal hyperplasia and increased the collagen content in the dermis. Fisetin exerted photoprotective activity by inhibiting the expression of MMP-1, MMP-2, and cyclooxygenase-2 and increasing the expression of nuclear factor erythroid 2-related factor. Furthermore, fisetin increased the expression of filaggrin to prevent UVB-induced barrier function disruption. Altogether, the present results provide evidence of the effects and mechanisms of fisetin’s antiphotodamage and antiphotoinflammation activities.

Fisetin Regulates Nrf2 Expression and the Inflammation-Related Signaling Pathway to Prevent UVB-Induced Skin Damage in Hairless Mice.

Science.gov (United States)

Wu, Po-Yuan; Lyu, Jia-Ling; Liu, Yi-Jung; Chien, Ting-Yi; Hsu, Hao-Cheng; Wen, Kuo-Ching; Chiang, Hsiu-Mei

2017-10-10

Chronic ultraviolet (UV) exposure may cause skin damage, disrupt skin barrier function, and promote wrinkle formation. UV induces oxidative stress and inflammation, which results in extracellular matrix degradation in the dermis and epidermal hyperplasia. Our previous study demonstrated that fisetin exerts photoprotective activity by inhibiting mitogen-activated protein kinase/activator protein-1/matrix metalloproteinases (MMPs) activation. In this study, fisetin was applied topically to investigate its antiphotodamage effects in hairless mice. The erythema index (a* values) and transepidermal water loss were evaluated to assess skin damage, and immunohistochemical staining was conducted to elucidate the photoprotective mechanism of fisetin. The results revealed that the topical application of fisetin reduced UVB-induced increase in the a* value and wrinkle formation. In addition, fisetin inhibited epidermal hyperplasia and increased the collagen content in the dermis. Fisetin exerted photoprotective activity by inhibiting the expression of MMP-1, MMP-2, and cyclooxygenase-2 and increasing the expression of nuclear factor erythroid 2-related factor. Furthermore, fisetin increased the expression of filaggrin to prevent UVB-induced barrier function disruption. Altogether, the present results provide evidence of the effects and mechanisms of fisetin's antiphotodamage and antiphotoinflammation activities.

The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae

Directory of Open Access Journals (Sweden)

René Hans-Jürgen Heim

2015-12-01

Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.

The Skallingen spit, Denmark: birth of a back-barrier saltmarsh

Science.gov (United States)

Bartholdy, Jesper; Brivio, Lara; Bartholdy, Anders; Kim, Daehyun; Fruergaard, Mikkel

2018-04-01

The formation and evolution of a modern saltmarsh platform on the barrier spit Skallingen in the northernmost part of the Wadden Sea was investigated through historical map records, 12 orthophotos covering the period from 1945 to 2012, sediment cores and cross-sectional creek profiles. The barrier spit, which constitutes the foundation of the saltmarsh platform, formed in about 50 years in the seventeenth century. After its formation the spit was left as a bare sandflat for about 200 years. Along with the development of foredunes, an increased availability of fine-grained sediment and establishment of vegetation in the beginning of the 1890s, the saltmarsh area formed in about 100 years, while the development of a large system of saltmarsh creeks took place in just ca. 50 years. The development of the drainage network, saltmarsh creek morphology and sedimentology during the saltmarsh formation are described in detail and analysed with special attention to the transformation rate from bare sandflat to a genuine vegetation-covered back-barrier saltmarsh.

HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

Science.gov (United States)

2017-03-03

Stevens -Johnson Syndrome and Toxic Epidermal Necrolysis Brittany L. Lenz, MD, Andrew T. Patterson, MD, Amanda J . Laska, MD, Patrick J . Brown, MD, and...59 MDW/SGVU SUBJECT: Professional Presentation Approval 8 DEC 2016 1. Your paper, entitled HLA-B Sequencing in Patients with Stevens -Johnson...PATIENTS WITH STEVENS -JOHNSON SYNDROME AND TOXIC EPIDERMAL NECROL YSIS 2. FUNDING RECEIVED FOR THIS STUDY? DYES rgj NO FUNDING SOURCE: I I 3. IS THIS

Clinical Studies on conformal radiotherapy combined with epidermal ...

African Journals Online (AJOL)

Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

Epidermal growth factor receptor expression in urinary bladder cancer

Directory of Open Access Journals (Sweden)

Dayalu S.L. Naik

2011-01-01

Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

Predicting human epidermal melanin concentrations for different skin tones

CSIR Research Space (South Africa)

Smit, Jacoba E

2011-07-01

Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma

Directory of Open Access Journals (Sweden)

J Gordon Millichap

2013-01-01

Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.

Surface stability test plan for protective barriers

International Nuclear Information System (INIS)

Ligotke, M.W.

1989-01-01

Natural-material protective barriers for long-term isolation of buried waste have been identified as integral components of a plan to isolate a number of Hanford defense waste sites. Standards currently being developed for internal and external barrier performance will mandate a barrier surface layer that is resistant to the eolian erosion processes of wind erosion (deflation) and windborne particle deposition (formation of sand dunes). Thus, experiments are needed to measure rates of eolian erosion processes impacting those surfaces under different surface and climatological conditions. Data from these studies will provide information for use in the evaluation of selected surface layers as a means of providing stable cover over waste sites throughout the design life span of protective barriers. The multi-year test plan described in this plan is directed at understanding processes of wind erosion and windborne particle deposition, providing measurements of erosion rates for models, and suggesting construction materials and methods for reducing the effect of long-term eolian erosion on the barrier. Specifically, this plan describes possible methods to measure rates of eolian erosion, including field and laboratory procedure. Advantages and disadvantages of laboratory (wind tunnel) tests are discussed, and continued wind tunnel tests are recommended for wind erosion studies. A comparison between field and wind tunnel erosive forces is discussed. Plans for testing surfaces are described. Guidance is also presented for studying the processes controlling sand dune and blowout formation. 24 refs., 7 figs., 3 tabs

Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...

African Journals Online (AJOL)

ADOWIE PERE

ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...

Autodegradation of 125I-labeled human epidermal cell surface proteins

International Nuclear Information System (INIS)

Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

1982-01-01

Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

DEFF Research Database (Denmark)

Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

2003-01-01

alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

On the regime transitions during the formation of an atmospheric pressure dielectric barrier glow discharge

International Nuclear Information System (INIS)

Martens, T; Bogaerts, A; Brok, W J M; Van Dijk, J

2009-01-01

The atmospheric pressure dielectric barrier discharge in helium is a pulsed discharge in nature. If during the electrical current pulse a glow discharge is reached, then this pulse will last only a few microseconds in operating periods of sinusoidal voltage with lengths of about 10 to 100 μs. In this paper we demonstrate that right before a glow discharge is reached, the discharge very closely resembles the commonly assumed Townsend discharge structure, but actually contains some significant differing features and hence should not be considered as a Townsend discharge. In order to clarify this, we present calculation results of high time and space resolution of the pulse formation. The results indicate that indeed a maximum of ionization is formed at the anode, but that the level of ionization remains high and that the electric field at that time is significantly disturbed. Our results also show where this intermediate structure comes from. (fast track communication)

Ultrathin epidermal strain sensor based on an elastomer nanosheet with an inkjet-printed conductive polymer

Science.gov (United States)

Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori

2017-08-01

To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.

Development of tensiometric barriers for containment and remediation at waste sites

International Nuclear Information System (INIS)

Thomson, B.M.; Stormont, J.C.; Morris, C.E.

1996-01-01

This report describes a concept in which dry air is injected into an unsaturated formation to reduce the soil moisture content, referred to here as a tensiometric (or sometimes dry) barrier. The objective is to reduce the hydraulic conductivity of the unsaturated media to the point where liquid phase transport becomes negligible, thereby achieving containment. The concept could be applied in subsurface formations to provide containment from a leaking facility, or it could be incorporated into a cover design to provide redundancy for a capillary barrier. The air injection process could in principle be coupled with a vacuum extraction system to recover soil vapors, which would then provide a remediation process that would be appropriate if volatile organic compounds were present. Work to date has consisted of a combined theoretical, laboratory, and field research investigation. The objective of this research was to demonstrate the technical feasibility of the tensiometric barrier concept by identifying the parameters which determine its effectiveness. Based on the results obtained for the experimental and theoretical studies, feasibility analyses were prepared as a modification for a landfill cover design to prevent infiltration from atmospheric precipitation and for potential application of tensiometric barriers to achieve subsurface containment of mobile pollutants and removal of volatile constituents. These analyses considered the technical as well as the economic aspects of the tensiometric barrier concept, and found that a properly designed and operated tensiometric barrier is competitive with conventional containment methods. In addition, they benefit from being able to recover from failure by circulating additional dry air through the formation to re-establish the barrier phenomena. (author) 10 figs., 4 tabs., 17 refs

Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

International Nuclear Information System (INIS)

Wakshull, E.; Kraemer, P.M.; Wharton, W.

1985-01-01

Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

Learning from eponyms: George F. Odland and Odland bodies

Directory of Open Access Journals (Sweden)

Rajiv Joshi

2014-01-01

Full Text Available Odland bodies (lamellar bodies are small sub-cellular structures of size 200-300 nm that are present in the upper spinous and granular cell layers of the epidermis. These act as processing and repository areas for lipids that contribute to the epidermal permeability barrier. They also contain proteases, cathepsin D, kallikrein and other proteins including corneo-desmosins. Recent information also credits them with a role in the local innate immune response as they contain beta 2 defensins, which are anti-microbial peptides with potent activity against Gram-negative bacteria and candida. Odland bodies are important for maintaining homeostasis of the epidermis and are involved in epidermal permeability barrier function, desquamation of keratinocytes, formation of the cornified envelope and in local anti-microbial immunity. This article reviews the structure and functions of these bodies with a brief biography of George F. Odland who first described these bodies in 1960 and whose name is eponymically associated with them.

A sphingolipid-dependent diffusion barrier confines ER stress to the yeast mother cell

Science.gov (United States)

Clay, Lori; Caudron, Fabrice; Denoth-Lippuner, Annina; Boettcher, Barbara; Buvelot Frei, Stéphanie; Snapp, Erik Lee; Barral, Yves

2014-01-01

In many cell types, lateral diffusion barriers compartmentalize the plasma membrane and, at least in budding yeast, the endoplasmic reticulum (ER). However, the molecular nature of these barriers, their mode of action and their cellular functions are unclear. Here, we show that misfolded proteins of the ER remain confined into the mother compartment of budding yeast cells. Confinement required the formation of a lateral diffusion barrier in the form of a distinct domain of the ER-membrane at the bud neck, in a septin-, Bud1 GTPase- and sphingolipid-dependent manner. The sphingolipids, but not Bud1, also contributed to barrier formation in the outer membrane of the dividing nucleus. Barrier-dependent confinement of ER stress into the mother cell promoted aging. Together, our data clarify the physical nature of lateral diffusion barriers in the ER and establish the role of such barriers in the asymmetric segregation of proteotoxic misfolded proteins during cell division and aging. DOI: http://dx.doi.org/10.7554/eLife.01883.001 PMID:24843009

Sebaceous gland, hair shaft, and epidermal barrier abnormalities in keratosis pilaris with and without filaggrin deficiency

DEFF Research Database (Denmark)

Gruber, Robert; Sugarman, Jeffrey L; Crumrine, Debra

2015-01-01

were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular...... and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial...

Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

Directory of Open Access Journals (Sweden)

Yira Bermudez

Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

Barrier island facies models and recognition criteria

Science.gov (United States)

Mulhern, J.; Johnson, C. L.

2017-12-01

Barrier island outcrops record transgressive shoreline motion at geologic timescales, providing integral clues to understanding how coastlines respond to rising sea levels. However, barrier island deposits are difficult to recognize. While significant progress has been made in understanding the modern coastal morphodynamics, this insight is not fully leveraged in existing barrier island facies models. Excellent outcrop exposures of the paralic Upper Cretaceous Straight Cliffs Formation of southern Utah provide an opportunity to revise facies models and recognition criteria for barrier island deposits. Preserved barrier islands are composed of three main architectural elements (shorefaces, tidal inlets, and tidal channels) which occur independently or in combination to create larger-scale barrier island deposits. Barrier island shorefaces record progradation, while barrier island tidal inlets record lateral migration, and barrier island tidal channels record aggradation within the tidal inlet. Four facies associations are used to describe and characterize these barrier island architectural elements. Barrier islands occur in association with backarrier fill and internally contain lower and upper shoreface, high-energy upper shoreface, and tidal channel facies. Barrier islands bound lagoons or estuaries, and are distinguished from other shoreface deposits by their internal facies and geometry, association with backbarrier facies, and position within transgressive successions. Tidal processes, in particular tidal inlet migration and reworking of the upper shoreface, also distinguish barrier island deposits. Existing barrier island models highlight the short term heterogeneous and dynamic nature of barrier island systems, yet overlook processes tied to geologic time scales, such as multi-directional motion, erosion, and reworking, and their expressions in preserved barrier island strata. This study uses characteristic outcrop expressions of barrier island successions to

Radiologic Findings of Epidermal Cysts in the Trunk

International Nuclear Information System (INIS)

Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi

2005-01-01

To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan

Identification of grazed grasses using epidermal characters | R ...

African Journals Online (AJOL)

The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...

Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.

Science.gov (United States)

Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi

2005-02-25

Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.

Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

Directory of Open Access Journals (Sweden)

Naser Tayyebi Meibodi

2011-01-01

Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

Growth of melanocytes in human epidermal cell cultures

International Nuclear Information System (INIS)

Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

1990-01-01

Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism

International Nuclear Information System (INIS)

He, D.; Lim, H.W.

1991-01-01

This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes

Calcium-dependent depletion zones in the cortical microtubule array coincide with sites of, but do not regulate, wall ingrowth papillae deposition in epidermal transfer cells.

Science.gov (United States)

Zhang, Hui-ming; Talbot, Mark J; McCurdy, David W; Patrick, John W; Offler, Christina E

2015-09-01

Trans-differentiation to a transfer-cell morphology is characterized by the localized deposition of wall ingrowth papillae that protrude into the cytosol. Whether the cortical microtubule array directs wall ingrowth papillae formation was investigated using a Vicia faba cotyledon culture system in which their adaxial epidermal cells were spontaneously induced to trans-differentiate to transfer cells. During deposition of wall ingrowth papillae, the aligned cortical microtubule arrays in precursor epidermal cells were reorganized into a randomized array characterized by circular depletion zones. Concurrence of the temporal appearance, spatial pattern, and size of depletion zones and wall ingrowth papillae was consistent with each papilla occupying a depletion zone. Surprisingly, microtubules appeared not to regulate construction of wall ingrowth papillae, as neither depolymerization nor stabilization of cortical microtubules changed their deposition pattern or morphology. Moreover, the size and spatial pattern of depletion zones was unaltered when the formation of wall ingrowth papillae was blocked by inhibiting cellulose biosynthesis. In contrast, the depletion zones were absent when the cytosolic calcium plumes, responsible for directing wall ingrowth papillae formation, were blocked or dissipated. Thus, we conclude that the depletion zones within the cortical microtubule array result from localized depolymerization of microtubules initiated by elevated cytosolic Ca(2+) levels at loci where wall ingrowth papillae are deposited. The physiological significance of the depletion zones as a mechanism to accommodate the construction of wall ingrowth papillae without compromising maintenance of the plasma membrane-microtubule inter-relationship is discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Arbuscular Mycorrhizal Fungi Elicit a Novel Intracellular Apparatus in Medicago truncatula Root Epidermal Cells before InfectionW⃞

Science.gov (United States)

Genre, Andrea; Chabaud, Mireille; Timmers, Ton; Bonfante, Paola; Barker, David G.

2005-01-01

The penetration of arbuscular mycorrhizal (AM) fungi through the outermost root tissues of the host plant is a critical step in root colonization, ultimately leading to the establishment of this ecologically important endosymbiotic association. To evaluate the role played by the host plant during AM infection, we have studied in vivo cellular dynamics within Medicago truncatula root epidermal cells using green fluorescent protein labeling of both the plant cytoskeleton and the endoplasmic reticulum. Targeting roots with Gigaspora hyphae has revealed that, before infection, the epidermal cell assembles a transient intracellular structure with a novel cytoskeletal organization. Real-time monitoring suggests that this structure, designated the prepenetration apparatus (PPA), plays a central role in the elaboration of the apoplastic interface compartment through which the fungus grows when it penetrates the cell lumen. The importance of the PPA is underlined by the fact that M. truncatula dmi (for doesn't make infections) mutants fail to assemble this structure. Furthermore, PPA formation in the epidermis can be correlated with DMI-dependent transcriptional activation of the Medicago early nodulin gene ENOD11. These findings demonstrate how the host plant prepares and organizes AM infection of the root, and both the plant–fungal signaling mechanisms involved and the mechanistic parallels with Rhizobium infection in legume root hairs are discussed. PMID:16284314

Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation

DEFF Research Database (Denmark)

Chidgey, M; Brakebusch, C; Gustafsson, E

2001-01-01

epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human...

Epidermal growth factor and active caspase-3 expression in the levator ani muscle of dogs with and without perineal hernia.

Science.gov (United States)

Pérez-Gutiérrez, J F; Argüelles, J C; Iglesias-Núñez, M; Oliveira, K S; De La Muela, M Sánchez

2011-07-01

To perform a histological and immunohistochemical study of epidermal growth factor, transforming growth factor-alpha and their receptor, as well as the apoptotic signal active caspase-3 in the levator ani muscle of dogs with and without perineal hernia. Biopsy specimens of the levator ani muscle were obtained from 25 dogs with perineal hernia and 4 non-affected dogs and were processed for Masson and immunohistochemical staining. The affected dogs exhibited myopathological features, internalised nuclei, destruction and abnormal size of muscle fibres, which were replaced by collagen. The immunohistochemical study revealed active caspase-3, epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor in the levator ani. Compared to the healthy muscle, transforming growth factor-alpha staining intensity was lower in the affected muscle, whereas epidermal growth factor receptor and active caspase-3 staining were higher. Pelvic diaphragm muscle weakening is the leading cause of perineal hernia in the dog. Survival and death signals expressed in these muscles may contribute to the pathogenesis of this disease. This study reports epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor immunohistochemical expression in the skeletal muscle and suggests that perineal hernia in the dog is accompanied by levator ani muscle atrophy, increased expression of epidermal growth factor receptor, caspase-3 activation, and decreased expression of transforming growth factor-alpha. © 2011 British Small Animal Veterinary Association.

Skin barrier properties in patients with recessive X-linked ichthyosis

DEFF Research Database (Denmark)

Johansen, J D; Ramsing, D; Vejlsgaard, G

1995-01-01

increased in controls compared to ichthyosis patients, when evaluated by TEWL. When evaluated by erythema index a statistically significant increase in redness was found in controls, but not in ichthyosis patients. Electrical capacitance, reflecting skin hydration, was significantly reduced in RXLI patients......Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...... properties and skin response to SLS were studied by measurement of transepidermal water loss (TEWL), electrical capacitance and erythema index. No statistically significant difference in basal TEWL was found between the two groups. The skin response to SLS was found to be statistically significantly...

Morphometric analysis of epidermal differentiation in primary roots of Zea mays

Science.gov (United States)

Moore, R.; Smith, H. S.

1990-01-01

Epidermal differentiation in primary roots of Zea mays was divided into six cell types based on cellular shape and cytoplasmic appearance. These six cell types are: 1) apical protoderm, located at the tip of the root pole and characterized by periclinally flattened cells; 2) cuboidal protoderm, located approximately 230 microns from the root pole and characterized by cuboidal cells; 3) tabular epidermis, located approximately 450 microns from the root pole and characterized by anticlinally flattened cells; 4) cuboidal epidermis, located approximately 900 microns from the root pole and characterized by cuboidal cells having numerous small vacuoles; 5) vacuolate cuboidal epidermis, located approximately 1,500 microns from the root pole and characterized by cuboidal cells containing several large vacuoles; and 6) columnar epidermis, located approximately 2,200 microns from the root pole (i.e., at the beginning of the zone of elongation) and characterized by elongated cells. We also used stereology to quantify the cellular changes associated with epidermal differentiation. The quiescent center and the apical protoderm have significantly different ultrastructures. The relative volume of dictyosomes increases dramatically during the early stages of epidermal differentiation. This increase correlates inversely with the amount of coverage provided by the root cap and mucilage.

Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

Science.gov (United States)

Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

2017-05-01

High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

Science.gov (United States)

Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

2013-02-01

Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

Pattern of hormone receptors and human epidermal growth factor ...

African Journals Online (AJOL)

Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

Core barrier formation near integer q surfaces in DIII-D

International Nuclear Information System (INIS)

Austin, M. E.; Gentle, K. W.; Burrell, K. H.; Waltz, R. E.; Gohil, P.; Greenfield, C. M.; Groebner, R. J.; Petty, C. C.; Prater, R.; Heidbrink, W. W.; Luo, Y.; Kinsey, J. E.; Makowski, M. A.; McKee, G. R.; Shafer, M. W.; Nazikian, R.; Rhodes, T. L.; Van Zeeland, M. A.

2006-01-01

Recent DIII-D experiments have significantly improved the understanding of internal transport barriers (ITBs) that are triggered close to the time when an integer value of the minimum in q is crossed. While this phenomenon has been observed on many tokamaks, the extensive transport and fluctuation diagnostics on DIII-D have permitted a detailed study of the generation mechanisms of q-triggered ITBs as pertaining to turbulence suppression dynamics, shear flows, and energetic particle modes. In these discharges, the evolution of the q profile is measured using motional Stark effect polarimetry and the integer q min crossings are further pinpointed in time by the observation of Alfven cascades. High time resolution measurements of the ion and electron temperatures and the toroidal rotation show that the start of improved confinement is simultaneous in all three channels, and that this event precedes the traversal of integer q min by 5-20 ms. There is no significant low-frequency magnetohydrodynamic activity prior to or just after the crossing of the integer q min and hence magnetic reconnection is determined not to be the precipitant of the confinement change. Instead, results from the GYRO code point to the effects of zonal flows near low order rational q values as playing a role in ITB triggering. A reduction in local turbulent fluctuations is observed at the start of the temperature rise and, concurrently, an increase in turbulence poloidal flow velocity and flow shear is measured with the beam emission spectroscopy diagnostic. For the case of a transition to an enduring internal barrier the fluctuation level remains at a reduced amplitude. The timing and nature of the temperature, rotation, and fluctuation changes leading to internal barriers suggests transport improvement due to increased shear flow arising from the zonal flow structures

Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

KAUST Repository

Cai, Yichen

2017-06-16

Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

KAUST Repository

Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

2017-01-01

Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

Formation of edge transport barrier in the ergodic field layer of helical divertor configuration on the Large Helical Device

International Nuclear Information System (INIS)

Toi, K; Ohdachi, S; Watanabe, F; Narihara, K; Morisaki, T; Sakakibara, S; Morita, S; Goto, M; Ida, K; Masuzaki, S; Miyazawa, K; Tanaka, K; Tokuzawa, T; Watanabe, K W; Yoshinuma, M

2006-01-01

On the Large Helical Device (LHD), low to high confinement (L-H) transition and edge transport barrier (ETB) formation were observed in the low beta regime ((β dia ) dia ): volume-averaged beta derived from diamagnetic measurement) as well as in relatively high beta regime (>1.5%). In most of ETB plasmas electron density preferentially increases in the edge region without a substantial rise of the edge electron temperature. The ETB zone develops inside the ergodic field layer calculated in the vacuum field. The ETB formation strongly destabilizes edge coherent modes such as m/n = 2/3 or 1/2 (m, n: poloidal and toroidal mode numbers), because the plasma edge region is in the magnetic hill. The ETB is partially destroyed by the combination of these edge MHD modes and ELM-like activities. For a particular experimental condition, the forced generation of a sizable m/n = 1/1 magnetic island near the edge by application of external field perturbations facilitates the L-H transition at a lower electron density and suppresses edge MHD modes and ELM-like activities to lower levels

Electron internal transport barrier in the core of TJ-II ECH plasmas

Energy Technology Data Exchange (ETDEWEB)

Estrada, T.; Hidalgo, C. [Laboratorio Nacional de Fusion por Confinamiento Magnetico. Asociacion EURATOM CIEMAT, Madrid (Spain); Dreval, N. [and others

2003-07-01

The influence of the magnetic topology on the formation of electron internal transport barriers (e-ITB) has been experimentally studied in the stellarator TJ-II. The formation of e-ITBs in electron cyclotron heated plasmas can be triggered by positioning a low order rational surface close to the plasma core region, while in configurations without any low order rational there are no indications of barrier formation within the available heating power. The e-ITB formation is characterized by an increase in the core electron temperature and plasma potential. Positive radial electric field increases in a factor of three in the plasma central region when the e-ITB forms. The results demonstrate that low order rational surfaces modify radial electric fields and electron heat transport. (orig.)

Crack formation in cementitious materials used for an engineering barrier system and their impact on hydraulic conductivity from the viewpoint of performance assessment of a TRU waste disposal system

International Nuclear Information System (INIS)

Hirano, Fumio; Mihara, Morihiro; Honda, Akira; Otani, Yoshiteru; Kyokawa, Hiroyuki; Shimizu, Hiroyuki

2016-01-01

The mechanical analysis code MACBECE2014 has been developed at the Japan Atomic Energy Agency (JAEA) to make realistic simulations of the physical integrity of the near field for performance assessment of the geological disposal of TRU waste in Japan. The MACBECE2014 code can be used to evaluate long-term changes in the mechanical behavior of the near field and any subsequent changes in the permeability of engineering barrier components, including crack formation in cementitious materials caused by expansion due to metal corrosion. Cracks in cementitious materials are likely to channel the flow of groundwater and so the represent preferred flow paths of any released radionuclides. Mechanical analysis was conducted using the MACBECE2014 code to investigate the concept of the TRU waste disposal system described in JAEA's Second Progress TRU Report. Simulated results of a disposal system with a bentonite buffer demonstrated that the low permeability of the engineering barrier system could be maintained for long time periods because the physical integrity of the bentonite buffer remained intact even if cracks in the cementitious components had formed locally. Simulated results of the disposal system with a concrete backfill instead of a bentonite buffer showed that crack formation leads to a significant increase in the permeability of the engineering barrier system. (author)

Adhesion barriers at cesarean delivery: advertising compared with the evidence.

Science.gov (United States)

Albright, Catherine M; Rouse, Dwight J

2011-07-01

Cesarean delivery, the most common surgery performed in the United States, is complicated by adhesion formation in 24-73% of cases. Because adhesions have potential sequelae, different synthetic adhesion barriers are currently heavily marketed as a means of reducing adhesion formation resultant from cesarean delivery. However, their use for this purpose has been studied in only two small, nonblinded and nonrandomized trials, both of which were underpowered and subject to bias. Neither demonstrated improvement in meaningful clinical outcomes. In the only cost-effectiveness analysis of adhesion barriers to date, the use of synthetic adhesion barriers was cost-effective only when the subsequent rate of small bowel obstruction was at least 2.4%, a rate far higher than that associated with cesarean delivery. In fact, intra-abdominal adhesions from prior cesarean delivery rarely cause maternal harm and have not been demonstrated to adversely affect perinatal outcome. Based on our review of the available literature, we think the use of adhesion barriers at the time of cesarean delivery would be ill-advised at the present time.

Topical grape seed proanthocyandin extract reduces sunburn cells and mutant p53 positive epidermal cell formation, and prevents depletion of Langerhans cells in an acute sunburn model.

Science.gov (United States)

Yuan, Xiao-Ying; Liu, Wei; Hao, Jian-Chun; Gu, Wei-Jie; Zhao, Yan-Shuang

2012-01-01

The purpose of this study was to investigate whether grape seed proanthocyanidin extract (GSPE) can provide photoprotection against ultraviolet (UV) irradiation. Study has shown that GSPE is a natural oxidant, and is used in many fields such as ischemia-reperfusion injury, chronic pancreatitis, and even cancer. However, the effect of GSPE on UV irradiation is as yet unknown. Cutaneous areas on the backs of normal volunteers were untreated or treated with GSPE solutions or vehicles 30 min before exposure to two minimal erythema doses (MED) of solar simulated radiation. Cutaneous areas at different sites were examined histologically for the number of sunburn cells, or immunohistochemically for Langerhans cells and mutant p53 epidermal cells. On histological and immunohistochemical examination, skin treated with GSPE before UV radiation showed fewer sunburn cells and mutant p53-positive epidermal cells and more Langerhans cells compared with skin treated with 2-MED UV radiation only (p<0.001, p<0.001, and p<0.01, respectively). GSPE may be a possible preventive agent for photoprotection.

Double internal transport barrier triggering mechanism in tokamak plasmas

International Nuclear Information System (INIS)

Dong, Jiaqi; Mou, Zongze; Long, Yongxing; Mahajan, Swadesh M.

2004-01-01

Sheared flow layers created by energy released in magnetic reconnection processes are studied with the magneto hydrodynamics (MHD), aimed at internal transport barrier (ITB) dynamics. The double tearing mode induced by electron viscosity is investigated and proposed as a triggering mechanism for double internal transport barrier (DITB) observed in tokamak plasmas with non-monotonic safety factor profiles. The quasi-linear development of the mode is simulated and the emphasis is placed on the structure of sheared poloidal flow layers formed in the vicinity of the magnetic islands. For viscosity double tearing modes, it is shown that the sheared flows induced by the mode may reach the level required by the condition for ITB formation. Especially, the flow layers are found to form just outside the magnetic islands. The scaling of the generated velocity with plasma parameters is given. Possible explanation for the experimental observations that the preferential formation of transport barriers in the proximity of low order rational surface is discussed. (author)

The important role of stratum corneum lipids for the cutaneous barrier function.

Science.gov (United States)

van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

2014-03-01

The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

Formation of permeation barriers on ceramic SiC/SiC composites

International Nuclear Information System (INIS)

Racault, C.; Fenici, P.

1996-01-01

The effectiveness as permeation barriers of the following CVD and PVD (sputtering) coatings has been investigated: TiC+Al 2 O 3 (CVD), SiC(CVD), SiO 2 (CVD), TiN(CVD), TiN(CVD)+TiN(PVD) and SiC(CVD)+Al 2 O 3 (PVD). The substrate material was a SiC/SiC composite, proposed as low activation structural material for fusion applications. Permeation measurements were performed in the temperature range 300-750 K using deuterium at pressures in the range 0.5-150 kPa. A linear dependence of permeation rate on pressure was measured. The efficiency of the coatings as deuterium permeation barriers is discussed in terms of coating microstructure. The best result was obtained with a bilayer of TiN(CVD) (15 μm) +TiN(PVD) (8 μm). (orig.)

Epidermal response of rainbow trout to Ichthyobodo necator

DEFF Research Database (Denmark)

Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar

2014-01-01

Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...

Dynamic model based on voltage transfer curve for pattern formation in dielectric barrier glow discharge

Energy Technology Data Exchange (ETDEWEB)

Li, Ben; He, Feng; Ouyang, Jiting, E-mail: jtouyang@bit.edu.cn [School of Physics, Beijing Institute of Technology, Beijing 100081 (China); Duan, Xiaoxi [Research Center of Laser Fusion, CAEP, Mianyang 621900 (China)

2015-12-15

Simulation work is very important for understanding the formation of self-organized discharge patterns. Previous works have witnessed different models derived from other systems for simulation of discharge pattern, but most of these models are complicated and time-consuming. In this paper, we introduce a convenient phenomenological dynamic model based on the basic dynamic process of glow discharge and the voltage transfer curve (VTC) to study the dielectric barrier glow discharge (DBGD) pattern. VTC is an important characteristic of DBGD, which plots the change of wall voltage after a discharge as a function of the initial total gap voltage. In the modeling, the combined effect of the discharge conditions is included in VTC, and the activation-inhibition effect is expressed by a spatial interaction term. Besides, the model reduces the dimensionality of the system by just considering the integration effect of current flow. All these greatly facilitate the construction of this model. Numerical simulations turn out to be in good accordance with our previous fluid modeling and experimental result.

Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

DEFF Research Database (Denmark)

Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

2009-01-01

BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

Time evolution of the Clay Barrier Chemistry in a HLW deep geological disposal in granite

International Nuclear Information System (INIS)

Font, I.; Miguel, M. J.; Juncosa, R.

2000-01-01

The main goal of a high level waste geological disposal is to guarantee the waste isolation from the biosphere, locking them away into very deep geological formations. The best way to assure the isolation is by means of a multiple barrier system. These barriers, in a serial disposition, should assure the confinement function of the disposal system. Two kinds of barriers are considered: natural barriers (geological formations) and engineered barriers (waste form, container and backfilling and sealing materials). Bentonite is selected as backfilling and sealing materials for HLW disposal into granite formations, due to its very low permeability and its ability to fill the remaining spaces. bentonite has also other interesting properties, such as, the radionuclide retention capacity by sorption processes. Once the clay barrier has been placed, the saturation process starts. The granite groundwater fills up the voids of the bentonite and because of the chemical interactions, the groundwater chemical composition varies. Near field processes, such as canister corrosion, waste leaching and radionuclide release, strongly depends on the water chemical composition. Bentonite pore water composition is such a very important feature of the disposal system and its determination and its evolution have great relevance in the HLW deep geological disposal performance assessment. The process used for the determination of the clay barrier pore water chemistry temporal evolution, and its influence on the performance assessment, are presented in this paper. (Author)

Bacteriological examination of inflamed epidermal cysts: a survey between 2008 and 2009 at a hospital in southern Taiwan

Directory of Open Access Journals (Sweden)

Yen-Hsi Liu

2010-09-01

Conclusions: Both aerobic and anaerobic microorganisms were present in the inflamed epidermal cysts, although the anaerobic bacteria, specifically, Propionibacterium spp and Peptostreptococcus spp, were isolated slightly more frequently. Antibiotics directed against anaerobes may be considered in the treatment regimen for inflamed epidermal cysts.

Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

Science.gov (United States)

Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

2006-08-01

Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

Directory of Open Access Journals (Sweden)

Raj Victor

2011-08-01

Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.

Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

Science.gov (United States)

2011-01-01

Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061

Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

Science.gov (United States)

Bolívar-Flores, Y J; Kuri-Harcuch, W

1999-08-01

Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity

International Nuclear Information System (INIS)

Lowe, N.J.; Breeding, J.

1982-01-01

Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study

Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

Science.gov (United States)

Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

2015-06-01

Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

Investigation of the development of dielectric-barrier discharge instabilities in excimer lamp

Science.gov (United States)

Bouchachia, A.; Belasri, A.; Harrache, Z.; Amir Aid, D.

2017-11-01

This work represents a study of the formation and propagation of the streamer during a pulse in a plasma cell with dielectric barriers containing a Ne/Xe gas mixture. It is based on a longitudinal mono-dimensional model of the dielectric barrier discharge. In this model, we show the possibility of streamers development in the cathode sheath and its propagation during the plasma formation stage. The model gives the spatiotemporal variations of the propagation speed, the electric field, and the charged particle density of the streamer's head.

Collective phenomena in volume and surface barrier discharges

Science.gov (United States)

Kogelschatz, U.

2010-11-01

Barrier discharges are increasingly used as a cost-effective configuration to produce non-equilibrium plasmas at atmospheric pressure. This way, copious amounts of electrons, ions, free radicals and excited species can be generated without significant heating of the background gas. In most applications the barrier is made of dielectric material. Major applications utilizing mainly dielectric barriers include ozone generation, surface cleaning and modification, polymer and textile treatment, sterilization, pollution control, CO2 lasers, excimer lamps, plasma display panels (flat TV screens). More recent research efforts are devoted to biomedical applications and to plasma actuators for flow control. Sinusoidal feeding voltages at various frequencies as well as pulsed excitation schemes are used. Volume as well as surface barrier discharges can exist in the form of filamentary, regularly patterned or diffuse, laterally homogeneous discharges. The physical effects leading to collective phenomena in volume and surface barrier discharges are discussed in detail. Special attention is paid to self-organization of current filaments and pattern formation. Major similarities of the two types of barrier discharges are elaborated.

Grafting of human epidermal cells, presence and perspectives

Czech Academy of Sciences Publication Activity Database

Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

2001-01-01

Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice

Directory of Open Access Journals (Sweden)

Azahara Rodríguez-Luna

2017-12-01

Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.

Dielectric barrier discharge image processing by Photoshop

Science.gov (United States)

Dong, Lifang; Li, Xuechen; Yin, Zengqian; Zhang, Qingli

2001-09-01

In this paper, the filamentary pattern of dielectric barrier discharge has been processed by using Photoshop, the coordinates of each filament can also be obtained. By using Photoshop two different ways have been used to analyze the spatial order of the pattern formation in dielectric barrier discharge. The results show that the distance of the neighbor filaments at U equals 14 kV and d equals 0.9 mm is about 1.8 mm. In the scope of the experimental error, the results from the two different methods are similar.

Polarized and persistent Ca²⁺ plumes define loci for formation of wall ingrowth papillae in transfer cells.

Science.gov (United States)

Zhang, Hui-Ming; Imtiaz, Mohammad S; Laver, Derek R; McCurdy, David W; Offler, Christina E; van Helden, Dirk F; Patrick, John W

2015-03-01

Transfer cell morphology is characterized by a polarized ingrowth wall comprising a uniform wall upon which wall ingrowth papillae develop at right angles into the cytoplasm. The hypothesis that positional information directing construction of wall ingrowth papillae is mediated by Ca(2+) signals generated by spatiotemporal alterations in cytosolic Ca(2+) ([Ca(2+)]cyt) of cells trans-differentiating to a transfer cell morphology was tested. This hypothesis was examined using Vicia faba cotyledons. On transferring cotyledons to culture, their adaxial epidermal cells synchronously trans-differentiate to epidermal transfer cells. A polarized and persistent Ca(2+) signal, generated during epidermal cell trans-differentiation, was found to co-localize with the site of ingrowth wall formation. Dampening Ca(2+) signal intensity, by withdrawing extracellular Ca(2+) or blocking Ca(2+) channel activity, inhibited formation of wall ingrowth papillae. Maintenance of Ca(2+) signal polarity and persistence depended upon a rapid turnover (minutes) of cytosolic Ca(2+) by co-operative functioning of plasma membrane Ca(2+)-permeable channels and Ca(2+)-ATPases. Viewed paradermally, and proximal to the cytosol-plasma membrane interface, the Ca(2+) signal was organized into discrete patches that aligned spatially with clusters of Ca(2+)-permeable channels. Mathematical modelling demonstrated that these patches of cytosolic Ca(2+) were consistent with inward-directed plumes of elevated [Ca(2+)]cyt. Plume formation depended upon an alternating distribution of Ca(2+)-permeable channels and Ca(2+)-ATPase clusters. On further inward diffusion, the Ca(2+) plumes coalesced into a uniform Ca(2+) signal. Blocking or dispersing the Ca(2+) plumes inhibited deposition of wall ingrowth papillae, while uniform wall formation remained unaltered. A working model envisages that cytosolic Ca(2+) plumes define the loci at which wall ingrowth papillae are deposited. © The Author 2014. Published by Oxford

Tumores dermóides e epidermóides intra-espinhas

Directory of Open Access Journals (Sweden)

Oscar Fontenelle Filho

1971-03-01

Full Text Available São relatados dois casos de tumores epidermóides e um de tumor dermóide, todos intrarraquianos. Este último era de localização epidural ao nível da coluna torácica (caso 3; os dois tumores epidermóides situavam-se na coluna tóraco-lombar (caso 1 e lombar (caso 2, respectivamente, sendo o primeiro intramedular e o segundo intradural. Em dois casos (casos 2 e 3 os tumores associavam-se a fístula dérmica congênita. Um paciente (caso 3 foi operado aos dois meses de idade; a descoberta do tumor deveu-se à realização da raquimanometria que revelou bloqueio, apesar do paciente não apresentar qualquer sinal neurológico de compressão medular. Os autores são de opinião que, em presença de fístula dérmica congênita ao nível da coluna vertebral, principalmente quando localizada acima do segmento lombosacro, deve-se sempre suspeitar da possibilidade do tumor epidermóide ou dermóide intrarraquiano, mesmo na ausência de sinais neurológicos. A combinação de sintomas neurológicos de longa duração, a evidência radiológica de erosão e alargamento do canal raquiano e a história de fístula dérmica congênita proporcionaram o diagnóstico pré-operatório correto no caso 2.

Role of submandibular saliva and epidermal growth factor in gastric cytoprotection

DEFF Research Database (Denmark)

Poulsen, Steen Seier

1984-01-01

without submandibular glands. Exogenous EGF and saliva with a high but still physiological concentration of EGF significantly reduced the median area in the stomach displaying ulcers and ulcerations, whereas saliva without EGF had no effect. Although EGF is a known inhibitor of gastric acid secretion......The role of submandibular epidermal growth factor in protection of the gastric mucosa was investigated in rats. Removal of the submandibular glands and thereby submandibular epidermal growth factor (EGF) caused rats to develop gastric lesions (ulcerations and ulcers) after administration......, the dose used in the present study had no effect on gastric acid secretion in chronic gastric fistula rats; removal of the submandibular glands also did not have any such effect. We conclude that exocrine secretion of submandibular EGF has a cytoprotective function in the stomach, an effect that may...

Neonatal hyperthyroidism impairs epinephrine-provoked secretion of nerve growth factor and epidermal growth factor in mouse saliva.

Science.gov (United States)

Lakshmanan, J; Landel, C P

1986-07-01

We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.

The effect of different aluminum alloy surface compositions on barrier anodic film formation

International Nuclear Information System (INIS)

Panitz, J.K.G.; Sharp, D.J.

1984-01-01

The authors have grown barrier anodic coatings on samples of aluminum alloy with different elemental surface compositions. In one series of experiments, they characterized the surface composition present on 6061 aluminum alloy samples after different chemical treatments including a detergent-water and methyl-ethyl ketone solvent clean, a 50% nitric acid-water etch, and a concentrated nitric acid-ammonium bifluoride etch. They anodized samples which were prepared similarly to those analyzed to evaluate the practical effects of the three different surface compositions. The anodization voltage rise time to 950V at constant current was used as a figure of merit. The solvent cleaned and the 50% nitric acid etched samples required, respectively, 113% and 41% more time to reach 950V than the concentrated nitric acidammonium bifloride etched samples. In a second series of experiments, they alternately anodized groups of either 6061 or 1100 (commercially pure) aluminum alloy, observed rise times to 950V, and measured chloride ion concentrations in the electrolyte. Longer rise times and higher chloride ion concentrations were observed for the 1100 samples. It was observed that the chloride ion concentration fell from initially high levels when 6061 samples were anodized. The results of both series of experiments augment the results of other investigators, who report that the surface species initially present on aluminum have a significant effect on anodic film formation

Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour

International Nuclear Information System (INIS)

Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.

1996-01-01

Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)

[Basic therapeutics : What are the features of modern personal care products to protect and regenerate the skin barrier?

Science.gov (United States)

Daniels, R

2017-11-01

It is international consensus that the daily use of properly selected products for the maintenance therapy is a must in the adjuvant treatment of most chronic skin diseases. In a first step, the selection of an adequate product can be guided by the classical triangle of the dermal vehicles. However, modern skin care products use diverse excipients, e. g. emulsifiers and viscosity enhancers, to improve the galenical and haptic properties of the formulations. It is thus no longer sufficient to simply have knowledge about the oil and water content of a cream in order to make a proper selection. A very positive effect on the skin barrier can be achieved using biomimetic lipids which can be incorporated into the epidermal lipid barrier. The application of such products as a foam cream is the most convenient way especially favorable when inflamed or hardly accessible skin areas have to be treated.

Investigation of anodizing parameter effect on barrier layer of anodic zirconium oxide

International Nuclear Information System (INIS)

Kharchenko, Eh.P.

1979-01-01

Effect of fluoride concentration and forming direction upon kinetics of barrier layer transformations in the process of preparation of phase anodic zirconium oxide in acid fluorine-containing solutions is considered. Suppositions are made on the mechanism of barrier layer transformation under the effect of the parameters mentioned. The thickness of the barrier layer is determined by two methods and it is shown that coefficient of the layer thickess growth at the voltage increase by 1 V is much lower than during formation of the barrier films in non-agressive electrolytes

Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants

International Nuclear Information System (INIS)

Nishida, K.; Roksandic, Z.; Osmond, B.

1981-01-01

The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon

Benefits and Barriers of University Industry Collaborations from a Researcher's Perspective

DEFF Research Database (Denmark)

Kilian, Thomas; Schubert, Petra; Bjørn-Andersen, Niels

2015-01-01

parsimonious formative measures for the benefits and barriers of UIC and we found that academic and economic benefits positively influence the intention to conduct UIC in the future, while economic barriers negatively influence the intention to engage in UIC. A cluster analysis found five clusters (groups...... of researchers) that differ in their perception of benefits and barriers and the future intention to conduct UIC. However, the majority of the researchers have a very high intention to conduct UIC in the future....

Barrier for cold-fusion production of superheavy elements

International Nuclear Information System (INIS)

Ichikawa, Takatoshi; Iwamoto, Akira; Moeller, Peter; Sierk, Arnold J.

2005-01-01

We estimate the fusion-barrier height B fu (two-body) for approaching ions in cold-fusion reactions in a model where the projectile deformation and quadrupole zero-point vibrational energy are taken into account. This barrier height is defined as the barrier energy at the target and projectile separation distance where an original oblate deformation of projectile and/or target caused by a repulsive Coulomb force turns into a large prolate deformation caused by the attractive nuclear force as the target and projectile come closer. The instability develops before touching because the attractive short-range nuclear force overcomes the repulsive Coulomb force and the shape-stabilizing effect of shell structure. The shell structure of the doubly magic 208 Pb target is sufficiently strong that its shape remains very close to spherical in all cases studied here. The fusion potential for approaching ions in the two-body channel is calculated in the macroscopic-microscopic model with the quadrupole vibrational zero-point energy obtained in the WKB approximation. We compare our results with data from 10 experimental cold-fusion reactions and with the Bass barriers. Differences and similarities between the Yukawa-plus-exponential model and the Bass model are discussed. We also calculate five-dimensional potential-energy surfaces for the single compound system and show that well-established fission and fusion valleys are both present. For heavy systems, B fu (two-body) becomes lower than the fission barrier just beyond the ground state of the compound system. In the vicinity of this transition, the optimum collision energy for formation of evaporation residues can be expected to depend in a delicate fashion on the interplay among B fu (two-body) , the fusion valley, the fission barrier of the compound system, and the one- and two-neutron separation energies S 1n and S 2n . We discuss these issues in detail and calculate fission-barrier heights. Except for reactions in which

Bridging the Barriers: Knowledge Connections, Productivity, and Capital Accumulation

OpenAIRE

R. Quentin Grafton; Tom Kompas; P. Dorian Owen

2004-01-01

The paper explains the large differences in cross-country productivity performance by modeling and testing the effects of social barriers to communication on productivity and capital accumulation. In an optimal growth model, social barriers to communication that impede the formation of knowledge connections are shown to reduce both transitory and steady-state levels of total factor productivity (TFP), per capita consumption, and reproducible capital. A ‘bridging’ parameter in the growth model...

Epidermal protection with cryogen spray cooling during high fluence pulsed dye laser irradiation: an ex vivo study.

Science.gov (United States)

Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B

2000-01-01

Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.

Study on invadopodia formation for lung carcinoma invasion with a microfluidic 3D culture device.

Science.gov (United States)

Wang, Shanshan; Li, Encheng; Gao, Yanghui; Wang, Yan; Guo, Zhe; He, Jiarui; Zhang, Jianing; Gao, Zhancheng; Wang, Qi

2013-01-01

Invadopodia or invasive feet, which are actin-rich membrane protrusions with matrix degradation activity formed by invasive cancer cells, are a key determinant in the malignant invasive progression of tumors and represent an important target for cancer therapies. In this work, we presented a microfluidic 3D culture device with continuous supplement of fresh media via a syringe pump. The device mimicked tumor microenvironment in vivo and could be used to assay invadopodia formation and to study the mechanism of human lung cancer invasion. With this device, we investigated the effects of epidermal growth factor (EGF) and matrix metalloproteinase (MMP) inhibitor, GM6001 on invadopodia formation by human non-small cell lung cancer cell line A549 in 3D matrix model. This device was composed of three units that were capable of achieving the assays on one control group and two experimental groups' cells, which were simultaneously pretreated with EGF or GM6001 in parallel. Immunofluorescence analysis of invadopodia formation and extracellular matrix degradation was conducted using confocal imaging system. We observed that EGF promoted invadopodia formation by A549 cells in 3D matrix and that GM6001 inhibited the process. These results demonstrated that epidermal growth factor receptor (EGFR) signaling played a significant role in invadopodia formation and related ECM degradation activity. Meanwhile, it was suggested that MMP inhibitor (GM6001) might be a powerful therapeutic agent targeting invadopodia formation in tumor invasion. This work clearly demonstrated that the microfluidic-based 3D culture device provided an applicable platform for elucidating the mechanism of cancer invasion and could be used in testing other anti-invasion agents.

Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

NARCIS (Netherlands)

M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

1997-01-01

textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

Magnetic barriers and their q95 dependence at DIII-D

Science.gov (United States)

Volpe, F. A.; Kessler, J.; Ali, H.; Evans, T. E.; Punjabi, A.

2012-05-01

It is well known that externally generated resonant magnetic perturbations (RMPs) can form islands in the plasma edge. In turn, large overlapping islands generate stochastic fields, which are believed to play a role in the avoidance and suppression of edge localized modes (ELMs) at DIII-D. However, large coalescing islands can also generate, in the middle of these stochastic regions, KAM surfaces effectively acting as ‘barriers’ against field-line dispersion and, indirectly, particle diffusion. It was predicted in Ali and Punjabi (2007 Plasma Phys. Control. Fusion 49 1565-82) that such magnetic barriers can form in piecewise analytic DIII-D plasma equilibria. In this work, the formation of magnetic barriers at DIII-D is corroborated by field-line tracing calculations using experimentally constrained EFIT (Lao et al 1985 Nucl. Fusion 25 1611) DIII-D equilibria perturbed to include the vacuum field from the internal coils utilized in the experiments. According to these calculations, the occurrence and location of magnetic barriers depend on the edge safety factor q95. It was thus suggested that magnetic barriers might contribute to narrowing the edge stochastic layer and play an indirect role in the RMPs failing to control ELMs for certain values of q95. The analysis of DIII-D discharges where q95 was varied, however, does not show anti-correlation between barrier formation and ELM suppression.

Magnetic barriers and their q95 dependence at DIII-D

International Nuclear Information System (INIS)

Volpe, F.A.; Kessler, J.; Ali, H.; Punjabi, A.; Evans, T.E.

2012-01-01

It is well known that externally generated resonant magnetic perturbations (RMPs) can form islands in the plasma edge. In turn, large overlapping islands generate stochastic fields, which are believed to play a role in the avoidance and suppression of edge localized modes (ELMs) at DIII-D. However, large coalescing islands can also generate, in the middle of these stochastic regions, KAM surfaces effectively acting as ‘barriers’ against field-line dispersion and, indirectly, particle diffusion. It was predicted in Ali and Punjabi (2007 Plasma Phys. Control. Fusion 49 1565–82) that such magnetic barriers can form in piecewise analytic DIII-D plasma equilibria. In this work, the formation of magnetic barriers at DIII-D is corroborated by field-line tracing calculations using experimentally constrained EFIT (Lao et al 1985 Nucl. Fusion 25 1611) DIII-D equilibria perturbed to include the vacuum field from the internal coils utilized in the experiments. According to these calculations, the occurrence and location of magnetic barriers depend on the edge safety factor q 95 . It was thus suggested that magnetic barriers might contribute to narrowing the edge stochastic layer and play an indirect role in the RMPs failing to control ELMs for certain values of q 95 . The analysis of DIII-D discharges where q 95 was varied, however, does not show anti-correlation between barrier formation and ELM suppression. (paper)

Metabolic epidermal necrosis in two dogs with different underlying diseases.

Science.gov (United States)

Bond, R; McNeil, P E; Evans, H; Srebernik, N

1995-05-06

Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.

Immunohistochemical localization of epidermal growth factor in rat and man

DEFF Research Database (Denmark)

Poulsen, Steen Seier; Nexø, Ebba

1986-01-01

Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

Conformable liquid metal printed epidermal electronics for smart physiological monitoring and simulation treatment

Science.gov (United States)

Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing

2018-03-01

Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.

Transport Barriers in Bootstrap Driven Tokamaks

Science.gov (United States)

Staebler, Gary

2017-10-01

Maximizing the bootstrap current in a tokamak, so that it drives a high fraction of the total current, reduces the external power required to drive current by other means. Improved energy confinement, relative to empirical scaling laws, enables a reactor to more fully take advantage of the bootstrap driven tokamak. Experiments have demonstrated improved energy confinement due to the spontaneous formation of an internal transport barrier in high bootstrap fraction discharges. Gyrokinetic analysis, and quasilinear predictive modeling, demonstrates that the observed transport barrier is due to the suppression of turbulence primarily due to the large Shafranov shift. ExB velocity shear does not play a significant role in the transport barrier due to the high safety factor. It will be shown, that the Shafranov shift can produce a bifurcation to improved confinement in regions of positive magnetic shear or a continuous reduction in transport for weak or negative magnetic shear. Operation at high safety factor lowers the pressure gradient threshold for the Shafranov shift driven barrier formation. The ion energy transport is reduced to neoclassical and electron energy and particle transport is reduced, but still turbulent, within the barrier. Deeper into the plasma, very large levels of electron transport are observed. The observed electron temperature profile is shown to be close to the threshold for the electron temperature gradient (ETG) mode. A large ETG driven energy transport is qualitatively consistent with recent multi-scale gyrokinetic simulations showing that reducing the ion scale turbulence can lead to large increase in the electron scale transport. A new saturation model for the quasilinear TGLF transport code, that fits these multi-scale gyrokinetic simulations, can match the data if the impact of zonal flow mixing on the ETG modes is reduced at high safety factor. This work was supported by the U.S. Department of Energy under DE-FG02-95ER54309 and DE-FC02

Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

International Nuclear Information System (INIS)

Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

1997-01-01

This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

Science.gov (United States)

Laporta, Robert F.; Taichman, Lorne B.

1982-06-01

Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

Epidemiology of lymphocystis, epidermal papilloma and skin ulcers in common dab Limanda limanda along the west coast of Denmark

DEFF Research Database (Denmark)

Mellergaard, Stig; Nielsen, Else

1997-01-01

and the disease prevalence in the present case, the disease pattern showed evident similarities with formerly described oxygen deficiency-induced outbreaks of lymphocystis and epidermal papilloma in dab in the Kattegat. In 1988, the prevalence of lymphocystis and epidermal papilloma increased significantly...

Epidermal nevus syndrome associated with unusual neurological, ocular, and skeletal features

Directory of Open Access Journals (Sweden)

Reena Sharma

2012-01-01

Full Text Available Epidermal nevus syndrome (ENS is a rare disease, the pathogenesis of which is largely elusive. We, hereby, report an exclusive case of a 20-year-old man with verrucous ENS presented with dark colored papules and plaques along the Blaschko′s lines present over the head and neck area along with fleshy growth in both eyes since birth. Limb length discrepancy and kyphoscoliosis were remarkable. Skin biopsy was compatible with verrucous epidermal nevus while the biopsy of the ocular lesion confirmed complex choristoma. MRI brain revealed calcification in the right temporal lobe. Bilateral arachnoid cyst in the middle cranial fossa, scleral osteoma in the posterior part of the right eyeball, and deformed calvarium were evident on CECT skull and orbit. The present illustration emphasizes the importance of a punctilious work up of the case.

Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.

Science.gov (United States)

Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna

2018-01-21

Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.

Science.gov (United States)

Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad

2017-04-01

Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.

An immunologic approach to induction of epidermal growth factor deficiency

DEFF Research Database (Denmark)

Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier

1995-01-01

Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....

Preparation of epidermal growth factor (EGF) conjugated iron oxide nanoparticles and their internalization into colon cancer cells

International Nuclear Information System (INIS)

Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos

2010-01-01

Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.

Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase

NARCIS (Netherlands)

Spaargaren, M.; Defize, L. H.; Boonstra, J.; de Laat, S. W.

1991-01-01

The relationship between epidermal growth factor receptor (EGF-R) protein tyrosine kinase activation and ligand-induced receptor dimerization was investigated using several bivalent anti-EGF-R antibodies directed against various receptor epitopes. In A431 membrane preparations and permeabilized

Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

DEFF Research Database (Denmark)

Boone, Marc; Draye, Jean Pierre; Verween, Gunther

2014-01-01

While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...

In Vivo Cosmetic Product Efficacy Testing by Analyzing Epidermal Proteins Extracted from Tape Strips

Directory of Open Access Journals (Sweden)

Marie Westman

2014-02-01

Full Text Available The objective of this in vivo pilot study was to investigate whether differential biomarker analysis from skin tape strips could be used, not only to evaluate the difference between treated and untreated skin, but also to evaluate the effect of different product treatments. Ten volunteers were included in the study, applying two different basic formulations on their forearms. After four weeks of product application, and also after one week of treatment remission, tape strips were collected from the different treatment sites, as well as from untreated skin. The biomarkers investigated were selected to cover different aspects of epidermal differentiation and in connection with moisturization and barrier function. Levels of Involucrin were increased in both treatments, compared to untreated skin, whereas the levels of Keratin-6 were decreased for both treatments. In addition, a pattern for increased levels of Hornerin and Claudin-1 was also detected. There were no significant differences between the two treatments, only for treatment compared to untreated, but there were tendencies for different effect on some of the biomarkers investigated, differences that may reach significance with increased sample size. The major differences between the two treatments in this study were seen after one week of product remission, although due to too small sample size these differences were not significant.

Project Guarantee 1985. Final repository for high-level radioactive wastes: The system of safety barriers

International Nuclear Information System (INIS)

Anon.

1985-01-01

Final disposal of radioactive waste involves preventing the waste from returning from the repository location into the biosphere by means of successively arranged containment measures known as safety barriers. In the present volume NGB 85-04 of the series of reports for Project 'Guarantee' 1985, the safety barrier system for the type C repository for high-level waste is described. The barrier parameters which are relevant for safety analysis are quantified and associated error limits and data scatter are given. The aim of the report is to give a summary documentation of the safety analysis input data and their scientific background. For secure containment of radioactive waste safety barriers are used which effectively limit the release of radioactive material from the repository (release barriers) and effectively retard the entry of the original radioactive material into the biosphere (time barriers). Safety barriers take the form of both technically constructed containment measures and the siting of the repository in suitable geological formations. The technical safety barrier system in the case of high-level waste comprises: the waste solidification matrix (borosilicate glass), massive steel canisters, encasement of the waste canisters, encasement of the waste canisters in highly compacted bentonite, sealing of vacant storage space and access routes on repository closure. The natural geological safety barriers - the host rock and overlying formations provide sufficiently long deep groundwater flow times from the repository location to the earth's surface and for additional lengthening of radionuclide migration times by means of various chemical and physical retardation mechanisms. The stability of the geological formations is so great that hydrogeological system is protected for a sufficient length of time from deterioration caused, in particular, by erosion. Observations in the final section of the report indicate that input data for the type C repository safety

Smoldering and Flame Resistant Textiles via Conformal Barrier Formation.

Science.gov (United States)

Zammarano, Mauro; Cazzetta, Valeria; Nazaré, Shonali; Shields, J Randy; Kim, Yeon Seok; Hoffman, Kathleen M; Maffezzoli, Alfonso; Davis, Rick

2016-12-07

A durable and flexible silicone-based backcoating (halogen free) is applied to the backside of an otherwise smoldering-prone and flammable fabric. When exposed to fire, cyclic siloxanes (produced by thermal decomposition of the backcoating) diffuse through the fabric in the gas phase. The following oxidation of the cyclic siloxanes forms a highly conformal and thermally stable coating that fully embeds all individual fibers and shields them from heat and oxidation. As a result, the combustion of the fabric is prevented. This is a novel fire retardant mechanism that discloses a powerful approach towards textiles and multifunctional flexible materials with combined smoldering/flaming ignition resistance and fire-barrier properties.

Reconsolidated Salt as a Geotechnical Barrier

International Nuclear Information System (INIS)

Hansen, Francis D.; Gadbury, Casey

2015-01-01

Salt as a geologic medium has several attributes favorable to long-term isolation of waste placed in mined openings. Salt formations are largely impermeable and induced fractures heal as stress returns to equilibrium. Permanent isolation also depends upon the ability to construct geotechnical barriers that achieve nearly the same high-performance characteristics attributed to the native salt formation. Salt repository seal concepts often include elements of reconstituted granular salt. As a specific case in point, the Waste Isolation Pilot Plant recently received regulatory approval to change the disposal panel closure design from an engineered barrier constructed of a salt-based concrete to one that employs simple run-of-mine salt and temporary bulkheads for isolation from ventilation. The Waste Isolation Pilot Plant is a radioactive waste disposal repository for defense-related transuranic elements mined from the Permian evaporite salt beds in southeast New Mexico. Its approved shaft seal design incorporates barrier components comprising salt-based concrete, bentonite, and substantial depths of crushed salt compacted to enhance reconsolidation. This paper will focus on crushed salt behavior when applied as drift closures to isolate disposal rooms during operations. Scientific aspects of salt reconsolidation have been studied extensively. The technical basis for geotechnical barrier performance has been strengthened by recent experimental findings and analogue comparisons. The panel closure change was accompanied by recognition that granular salt will return to a physical state similar to the halite surrounding it. Use of run-of-mine salt ensures physical and chemical compatibility with the repository environment and simplifies ongoing disposal operations. Our current knowledge and expected outcome of research can be assimilated with lessons learned to put forward designs and operational concepts for the next generation of salt repositories. Mined salt

Reconsolidated Salt as a Geotechnical Barrier

Energy Technology Data Exchange (ETDEWEB)

Hansen, Francis D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Gadbury, Casey [USDOE Carlsbad Field Office, NM (United States)

2015-11-01

Salt as a geologic medium has several attributes favorable to long-term isolation of waste placed in mined openings. Salt formations are largely impermeable and induced fractures heal as stress returns to equilibrium. Permanent isolation also depends upon the ability to construct geotechnical barriers that achieve nearly the same high-performance characteristics attributed to the native salt formation. Salt repository seal concepts often include elements of reconstituted granular salt. As a specific case in point, the Waste Isolation Pilot Plant recently received regulatory approval to change the disposal panel closure design from an engineered barrier constructed of a salt-based concrete to one that employs simple run-of-mine salt and temporary bulkheads for isolation from ventilation. The Waste Isolation Pilot Plant is a radioactive waste disposal repository for defense-related transuranic elements mined from the Permian evaporite salt beds in southeast New Mexico. Its approved shaft seal design incorporates barrier components comprising salt-based concrete, bentonite, and substantial depths of crushed salt compacted to enhance reconsolidation. This paper will focus on crushed salt behavior when applied as drift closures to isolate disposal rooms during operations. Scientific aspects of salt reconsolidation have been studied extensively. The technical basis for geotechnical barrier performance has been strengthened by recent experimental findings and analogue comparisons. The panel closure change was accompanied by recognition that granular salt will return to a physical state similar to the halite surrounding it. Use of run-of-mine salt ensures physical and chemical compatibility with the repository environment and simplifies ongoing disposal operations. Our current knowledge and expected outcome of research can be assimilated with lessons learned to put forward designs and operational concepts for the next generation of salt repositories. Mined salt

High-Performance Ink-Synthesized Cu-Gate Thin-Film Transistor with Diffusion Barrier Formation

Science.gov (United States)

Woo, Whang Je; Nam, Taewook; Oh, Il-Kwon; Maeng, Wanjoo; Kim, Hyungjun

2018-05-01

The improved electrical properties of Cu-gate thin-film transistors (TFTs) using an ink-synthesizing process were studied; this technology enables a low-cost and large area process for the display industry. We investigated the film properties and the effects of the ink-synthesized Cu layer in detail with respect to device characteristics. The mobility and reliability of the devices were significantly improved by applying a diffusion barrier at the interface between the Cu gate and the gate insulator. By using a TaN diffusion barrier layer, considerably improved and stabilized ink-Cu gated TFTs could be realized, comparable to sputtered-Cu gated TFTs under positive bias temperature stress measurements.

Possibility of internal transport barrier formation and electric field bifurcation in LHD plasma

International Nuclear Information System (INIS)

Sanuki, H.; Itoh, K.; Yokoyama, M.; Fujisawa, A.; Ida, K.; Toda, S.; Itoh, S.-I.; Yagi, M.; Fukuyama, A.

1999-05-01

Theoretical analysis of the electric field bifurcation is made for the LHD plasma. For given shapes of plasma profiles, a region of bifurcation is obtained in a space of the plasma parameters. In this region of plasma parameters, the electric field domain interface is predicted to appear in the plasma column. The reduction of turbulent transport is expected to occur in the vicinity of the interface, inducing a internal transport barrier. Within this simple model, the plasma with internal barriers is predicted to be realized for the parameters of T e (0) ∼ 2 keV and n(0) ≅ 10 18 m -3 . (author)

High-Performance Ink-Synthesized Cu-Gate Thin-Film Transistor with Diffusion Barrier Formation

Science.gov (United States)

Woo, Whang Je; Nam, Taewook; Oh, Il-Kwon; Maeng, Wanjoo; Kim, Hyungjun

2018-02-01

The improved electrical properties of Cu-gate thin-film transistors (TFTs) using an ink-synthesizing process were studied; this technology enables a low-cost and large area process for the display industry. We investigated the film properties and the effects of the ink-synthesized Cu layer in detail with respect to device characteristics. The mobility and reliability of the devices were significantly improved by applying a diffusion barrier at the interface between the Cu gate and the gate insulator. By using a TaN diffusion barrier layer, considerably improved and stabilized ink-Cu gated TFTs could be realized, comparable to sputtered-Cu gated TFTs under positive bias temperature stress measurements.

Steven johnsons syndrome and toxic epidermal necrolysis: A review

Directory of Open Access Journals (Sweden)

Sri ram Anne

2014-12-01

Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.

Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

Energy Technology Data Exchange (ETDEWEB)

Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

2017-02-01

Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

Science.gov (United States)

Kappus, H; Reinhold, C

1994-04-01

Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

Gastric luminal epidermal growth factor is affected by diet | Iputo ...

African Journals Online (AJOL)

Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...

Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.

Science.gov (United States)

Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira

2012-03-01

As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.

Expression and analysis of exogenous proteins in epidermal cells.

Science.gov (United States)

Dagnino, Lina; Ho, Ernest; Chang, Wing Y

2010-01-01

In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

"Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.

Science.gov (United States)

Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu

2015-11-04

Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ab initio transport across bismuth selenide surface barriers

KAUST Repository

Narayan, Awadhesh

2014-11-24

© 2014 American Physical Society. We investigate the effect of potential barriers in the form of step edges on the scattering properties of Bi2Se3(111) topological surface states by means of large-scale ab initio transport simulations. Our results demonstrate the suppression of perfect backscattering, while all other scattering processes, which do not entail a complete spin and momentum reversal, are allowed. Furthermore, we find that the spin of the surface state develops an out-of-plane component as it traverses the barrier. Our calculations reveal the existence of quasibound states in the vicinity of the surface barriers, which appear in the form of an enhanced density of states in the energy window corresponding to the topological state. For double barriers we demonstrate the formation of quantum well states. To complement our first-principles results we construct a two-dimensional low-energy effective model and illustrate its shortcomings. Our findings are discussed in the context of a number of recent experimental works.

Proton extrusion is an essential signalling component in the HR of epidermal single cells in the barley-powdery mildew interaction

DEFF Research Database (Denmark)

Zhou, F.S.; Andersen, C.H.; Burhenne, K.

2000-01-01

We propose a model for activation of the epidermal cell hypersensitive response (HR) in the barley/powdery mildew interaction. The model suggests that the plasma membrane proton pump (H+-ATPase) of epidermal cells is activated following penetration by an avirulent powdery mildew fungus...... in the incompatible interaction; (4) race-specific proton extrusion is observed underneath epidermal tissue detached from leaves inoculated 15 h earlier; and (5) treatment of leaves with fusicoccin, an activator of the plasma membrane H+-ATPase, increases the number of HR-cells in the compatible interaction........ This will cause an acidification of the apoplast towards the mesophyll cells, thereby activating generation of H2O2 from the mesophyll, which subsequently triggers the epidermal cell to undergo HR. The model is supported by the following data: (1) the earliest HR-related H2O2 is found in the attachment zones...

Alteration of non-metallic barriers and evolution of solution chemistry in salt formations in Germany

International Nuclear Information System (INIS)

Herbert, H.J.; Becker, D.; Hagemann, S.; Meyer, Th.; Noseck, U.; Rubel, A.; Mauke, R.; Wollrath, J.

2005-01-01

Different Engineered Barrier Systems (EBS) materials considered in Germany for the sealing of repositories in salt formations are presented. Their long term behaviour in terms of interactions with salt solutions is discussed and evaluated. The discussed EBS materials are crushed salt, self sealing salt backfill, bentonite and salt concrete. Whereas the knowledge concerning the geochemical, geomechanical, hydrological and thermal behavior of crushed salt and salt concrete is well advanced further research is needed for other EBS materials. The self healing salt backfill has also been investigated in depth recently. In order to fully qualify this material large scale in situ experiments are still needed. The present knowledge on compacted bentonites in a salt environment is not yet sufficient for reliable predictions of the long-term performance in salt formations. The sealing concept of the low- and intermediate-level Radioactive Waste Repository Morsleben (ERAM) in a former rock salt and potash mine is presented. This concept is based on cementitious materials, i.e. salt concrete. The geochemical stability of different salt concretes in contact with brines expected in ERAM is addressed. It is shown how the results from leaching experiments and geochemical modelling are used in the safety analyses and how the chemical boundary conditions prevailing in the EBS influence the development of the permeability of the sealing system and thus control the radionuclide release. As a result of modelling the behaviour of the seals in the safety assessment it is shown, that the seals are corroded within a time span of about 20 000 years. The influence of the uncertainty in the model parameters on the safety of the repository was assessed by a variation of the initial permeability of the seal. The maximum dose rate resulting from the radionuclide release from ERAM is nearly independent of the variation of the initial permeability within four orders of magnitude. (authors)

Chalk Formations as Natural Barriers towards Radionuclide Migration

DEFF Research Database (Denmark)

Pedersen, Walther Batsberg; Carlsen, Lars; Jensen, Bror Skytte

1985-01-01

A series of chalk samples from the cretaceous formation overlying the Erslev salt dome have been studied in order to establish permeabilities, porosities, dispersion-, diffusion-, and sorption characteristics of the chalk. The chalk was found to be porous (∊≈0.4), however, of rather low...

Development of dry barriers for containment and remediation at waste sites

International Nuclear Information System (INIS)

Thomson, B.M.; Morris, C.E.; Ankeny, M.D.

1994-01-01

This paper describes a concept in which dry air is injected into an unsaturated formation to reduce the soil moisture content, referred to here as a dry (or sometimes tensiometric) barrier. The objective is to reduce the hydraulic conductivity of the unsaturated media to the point where liquid phase transport becomes negligible, thereby achieving containment. The concept could be applied in subsurface formations to provide containment from a leaking facility, or it could be incorporated into a cover design to provide redundancy for a capillary barrier. The air injection process could in principle be coupled with a vacuum extraction system to recover soil vapors, which would then provide a remediation process that would be appropriate if volatile organic compounds were present. Work to date has consisted of a combined theoretical, laboratory, and field research investigation. The objective of this research was to demonstrate the technical feasibility of the dry barrier concept by identifying the parameters which determine its effectiveness. Based on the results obtained for the experimental and theoretical studies, feasibility analyses were prepared for as a modification for a landfill cover design to prevent infiltration from atmospheric precipitation and for potential application of dry barriers to achieve subsurface containment and removal of volatile constituents. These analyses considered the technical as well as the economic aspects of the dry barrier concept

Immunohistochemical differentiation between inflammatory linear verrucous epidermal nevus (ILVEN) and psoriasis.

NARCIS (Netherlands)

Vissers, W.H.P.M.; Muys, L.; Erp, P.E.J. van; Jong, E.M.G.J. de; Kerkhof, P.C.M. van de

2004-01-01

Inflammatory linear verrucous epidermal nevus (ILVEN) is a rare skin disorder with a clinical and histological resemblance to psoriasis. In the past clinical and histological criteria have been defined. However, there remains a discussion as to whether ILVEN is a disease entity distinct from linear

Amplification of epidermal growth factor receptor gene in renal cell carcinoma

DEFF Research Database (Denmark)

El-Hariry, Iman; Powles, Thomas; Lau, Mike R

2010-01-01

Expression of epidermal growth factor receptor (EGFR) may be of prognostic value in renal cell cancer (RCC). Gene amplification of EGFR was investigated in a cohort of 315 patients with advanced RCC from a previously reported randomised study. Using fluorescent in situ hybridisation, only 2...

Design of dry barriers for containment of contaminants in unsaturated soils

International Nuclear Information System (INIS)

Morris, C.E.; Thomson, B.M.; Stormont, J.C.

1997-01-01

A dry barrier is a region of very dry conditions in unsaturated soil that prevents vertical migration of water created by circulating dry air through the formation. Dry soil creates a barrier to vertical water movement by decreasing the soil's hydraulic conductivity, a concept also used in capillary barriers. A dry barrier may be a viable method for providing containment of a contaminant plume in a setting with a thick unsaturated zone and dry climate. The principal factors which determine the feasibility of a dry barrier include: (1) an and environment, (2) thick vadose zone, and (3) the ability to circulate air through the vadose zone. This study investigated the technical and economic considerations associated with creating a dry barrier to provide containment of a hypothetical 1 ha aqueous contaminant plume. The concept appears to be competitive with other interim containment methods such as ground freezing

Discontinuity model for internal transport barrier formation in reversed magnetic shear plasmas

International Nuclear Information System (INIS)

Kishimoto, Y.; Kim, J-Y.; Horton, W.; Tajima, T.; LeBrun, M.J.

2001-01-01

To aid in understanding the internal transport barrier (ITB) being formed in reversed magnetic shear experiments, in addition to the well known shear flow effect, we point out an important nonlocal effect and/or finite size effect which comes from the complex behavior of the nonlocal mode over a finite radial region around the minimum q(safety factor)-surface. The nonlocal mode changes its structure depending on the sign of the magnetic shear and due to this fact, the nonlocal modes are weakly excited across the q min -surface. This leads to a discontinuity or gap which disconnects the phase relation in the global wave structure across the q min -surface. Once such a discontinuity (or gap) is formed, transport suppression occurs and therefore a transport barrier can be expected near the q min -surface. We confirm the existence of this discontinuity using a toroidal particle simulation. (author)

Defective channels lead to an impaired skin barrier.

Science.gov (United States)

Blaydon, Diana C; Kelsell, David P

2014-10-15

Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.

Science.gov (United States)

Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F

2005-09-15

Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.

UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

International Nuclear Information System (INIS)

Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

1996-01-01

UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

Effect of vasoactive intestinal polypeptide and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands

DEFF Research Database (Denmark)

Poulsen, Steen Seier

1984-01-01

The effect of VIP and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands was investigated in the rat. Vasoactive intestinal polypeptide infused in doses of 10 and 100 ng/kg/h significantly increased epidermal growth factor and bicarbonate output......, but the concentrations did not change. Somatostatin infused at doses of 1, 10, 100 and 1000 ng/kg/h against a background of VIP 100 ng/kg/h inhibited in dose-dependent fashion the stimulated epidermal growth factor and bicarbonate outputs from rat Brunner's gland pouches. Also basal secretion was inhibited...... growth factor and bicarbonate from Brunner's glands, an effect which is inhibited by somatostatin. A possible role for somatostatin in the control of Brunner's gland secretion is suggested....

Injectable barriers for waste isolation

International Nuclear Information System (INIS)

Persoff, P.; Finsterle, S.; Moridis, G.J.; Apps, J.; Pruess, K.; Muller, S.J.

1995-03-01

In this paper the authors report laboratory work and numerical simulation done in support of development and demonstration of injectable barriers formed from either of two fluids: colloidal silica or polysiloxane. Two principal problems addressed here are control of gel time and control of plume emplacement in the vadose zone. Gel time must be controlled so that the viscosity of the barrier fluid remains low long enough to inject the barrier, but increases soon enough to gel the barrier in place. During injection, the viscosity must be low enough to avoid high injection pressures which could uplift or fracture the formation. To test the grout gel time in the soil, the injection pressure was monitored as grouts were injected into sandpacks. When grout is injected into the vadose zone, it slumps under the influence of gravity, and redistributes due to capillary forces as it gels. The authors have developed a new module for the reservoir simulator TOUGH2 to model grout injection into the vadose zone, taking into account the increase of liquid viscosity as a function of gel concentration and time. They have also developed a model to calculate soil properties after complete solidification of the grout. The numerical model has been used to design and analyze laboratory experiments and field pilot tests. The authors present the results of computer simulations of grout injection, redistribution, and solidification

Drug Delivery Through the Skin: Molecular Simulations of Barrier Lipids to Design more Effective Noninvasive Dermal and Transdermal Delivery Systems for Small Molecules Biologics and Cosmetics

Energy Technology Data Exchange (ETDEWEB)

J Torin Huzil; S Sivaloganathan; M Kohandel; M Foldvari

2011-12-31

The delivery of drugs through the skin provides a convenient route of administration that is often preferable to injection because it is noninvasive and can typically be self-administered. These two factors alone result in a significant reduction of medical complications and improvement in patient compliance. Unfortunately, a significant obstacle to dermal and transdermal drug delivery alike is the resilient barrier that the epidermal layers of the skin, primarily the stratum corneum, presents for the diffusion of exogenous chemical agents. Further advancement of transdermal drug delivery requires the development of novel delivery systems that are suitable for modern, macromolecular protein and nucleotide therapeutic agents. Significant effort has already been devoted to obtain a functional understanding of the physical barrier properties imparted by the epidermis, specifically the membrane structures of the stratum corneum. However, structural observations of membrane systems are often hindered by low resolutions, making it difficult to resolve the molecular mechanisms related to interactions between lipids found within the stratum corneum. Several models describing the molecular diffusion of drug molecules through the stratum corneum have now been postulated, where chemical permeation enhancers are thought to disrupt the underlying lipid structure, resulting in enhanced permeability. Recent investigations using biphasic vesicles also suggested a possibility for novel mechanisms involving the formation of complex polymorphic lipid phases. In this review, we discuss the advantages and limitations of permeation-enhancing strategies and how computational simulations, at the atomic scale, coupled with physical observations can provide insight into the mechanisms of diffusion through the stratum corneum.

Potential involvement of oxygen intermediates and glutathione depletion in UV-induced epidermal cell injury in vitro

International Nuclear Information System (INIS)

Hsieh, G.C.; Acosta, D.

1991-01-01

Generation of reactive oxygen species (ROS) and depletion of glutathione (GSH) are suggested as the cytotoxic mechanisms for UVB-induced cellular damage. Primary monolayer cultures of epidermal keratinocytes (KCs) prepared from the skin of neonatal rats were irradiated with UVB at levels of 0.25-3.0 J/cm 2 . Cytotoxicity was measured at 3, 6, and 12 hr after UVB radiation. Exposure of KCs to UVB resulted in time- and dose-related toxic responses as determined by plasma membrane integrity, lysosomal function and mitochondrial metabolic activity. Irradiated KCs generated superoxide in a dose-dependent manner when compared to sham-irradiated cells. Superoxide formation, which occurred before and concomitant with cell injury, was decreased by superoxide dismutase (SOD). Cell injury was also significantly prevented by ROS scavengers, SOD and catalase. Pretreatment of cells with endocytosis inhibitors, cytochalasin B and methylamine, suppressed the ability of SOD and catalase to protect keratinocytes from UVB-induced toxicity. Irradiation of cells with UVB caused rapid depletion of GSH to about 30% of unirradiated levels within 15 min. UVB-irradiation led to a rapid transient increase in GSH peroxidase activity, concomitant with a marked decrease in the GSH/GSSG ratio. After 1 hr., while the GSH/GSSG ratio remained low, the GSH peroxidase activity declined below the control levels in UVB-treated epidermal cells. Following extensive GSH depletion in cells preincubated with 0.1 mM buthiomine sulfoximine, KCs became strongly sensitized to the cytotoxic action of UVB. These results indicate that UVB-induced cell injury in cultured KCs may be mediated by ROs and that endogenous GSH may play an important protective role against the cytotoxic action of UVB

γδ T cells in homeostasis and host defence of epithelial barrier tissues.

Science.gov (United States)

Nielsen, Morten M; Witherden, Deborah A; Havran, Wendy L

2017-12-01

Epithelial surfaces line the body and provide a crucial interface between the body and the external environment. Tissue-resident epithelial γδ T cells represent a major T cell population in the epithelial tissues and are ideally positioned to carry out barrier surveillance and aid in tissue homeostasis and repair. In this Review, we focus on the intraepithelial γδ T cell compartment of the two largest epithelial tissues in the body - namely, the epidermis and the intestine - and provide a comprehensive overview of the crucial contributions of intraepithelial γδ T cells to tissue integrity and repair, host homeostasis and protection in the context of the symbiotic relationship with the microbiome and during pathogen clearance. Finally, we describe epithelium-specific butyrophilin-like molecules and briefly review their emerging role in selectively shaping and regulating epidermal and intestinal γδ T cell repertoires.

Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

Science.gov (United States)

Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

Science.gov (United States)

von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

2017-11-06

The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

Two Ancient Gene Families Are Critical for Maintenance of the Mammalian Skin Barrier in Postnatal Life.

Science.gov (United States)

Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M

2016-07-01

The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

BLIMP1 Is Required for Postnatal Epidermal Homeostasis but Does Not Define a Sebaceous Gland Progenitor under Steady-State Conditions

Directory of Open Access Journals (Sweden)

Kai Kretzschmar

2014-10-01

Full Text Available B-lymphocyte-induced nuclear maturation protein 1 (BLIMP1 was previously reported to define a sebaceous gland (SG progenitor population in the epidermis. However, the recent identification of multiple stem cell populations in the hair follicle junctional zone has led us to re-evaluate its function. We show, in agreement with previous studies, that BLIMP1 is expressed by postmitotic, terminally differentiated epidermal cells within the SG, interfollicular epidermis, and hair follicle. Epidermal overexpression of c-Myc results in loss of BLIMP1+ cells, an effect modulated by androgen signaling. Epidermal-specific deletion of Blimp1 causes multiple differentiation defects in the epidermis in addition to SG enlargement. In culture, BLIMP1+ sebocytes have no greater clonogenic potential than BLIMP1− sebocytes. Finally, lineage-tracing experiments reveal that, under steady-state conditions, BLIMP1-expressing cells do not divide. Thus, rather than defining a sebocyte progenitor population, BLIMP1 functions in terminally differentiated cells to maintain homeostasis in multiple epidermal compartments.

Toxic Epidermal Necrolysis-Like Lesions and Systemic Lupus Erythematosus Possibly Triggered by Sulfasalazine

Directory of Open Access Journals (Sweden)

Simon Krabbe

2016-01-01

Full Text Available This case report describes a patient with arthritis of the large joints, bilateral sacroiliitis, and positive anti-SSA and anti-dsDNA antibody, who received sulfasalazine and shortly thereafter became critically ill. He developed toxic epidermal necrolysis, hemolytic anemia, lymphopenia, markedly elevated ferritin, and muscle wasting. A diagnosis of systemic lupus erythematosus was made, and mycophenolate mofetil and systemic glucocorticoids brought this severe disease under control. Toxic epidermal necrolysis-like lesions and hemophagocytic syndrome have been reported as manifestations of systemic lupus erythematosus. This patient possibly had spondyloarthritis or an undifferentiated connective tissue disease at presentation, and we suggest, based on the timing of events, that sulfasalazine may have acted as a trigger of the severe disease manifestations.

Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

Science.gov (United States)

Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

2018-01-01

Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

Epidermal electronics with advanced capabilities in near-field communication.

Science.gov (United States)

Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A

2015-02-25

Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Toxic epidermal necrolysis due to concomitant use of lamotrigine and valproic acid

Directory of Open Access Journals (Sweden)

Sukhjot Kaur

2013-01-01

Full Text Available Anti-epileptic drugs can be associated with a wide spectrum of cutaneous adverse reactions ranging from simple maculopapular rashes to more severe and life threatening reactions like Stevens-Johnson syndrome and toxic epidermal necrolysis. These rashes are well documented with older antiepileptic drugs like phenytoin, phenobarbitone and carbamazapine. Lamotrigine is a newer, unrelated antiepileptic drug that causes skin rashes in 3-10% of new users. Higher starting dose or rapid escalation, concurrent treatment with valproic acid, and a previous history of a rash with other antiepileptic drugs are well recognized risk factors for lamotrigine related serious rashes. We report two patients with toxic epidermal necrolysis, resulting from concomitant use of lamotrigine and valproic acid. It is emphasized that clinicians adhere to the recommended dosage guidelines and adopt a slow dose titration when initiating treatment with lamotrigine.

Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells

International Nuclear Information System (INIS)

Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook

2011-01-01

Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.

Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

International Nuclear Information System (INIS)

Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

2013-01-01

High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.

Directory of Open Access Journals (Sweden)

Aleksandra Piwko-Czuchra

Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.

Association of epidermal growth factor and epidermal growth factor receptor polymorphisms with the risk of hepatitis B virus-related hepatocellular carcinoma in the population of North China.

Science.gov (United States)

Wu, Jia; Zhang, Wei; Xu, Aiqiang; Zhang, Li; Yan, Tao; Li, Zhuo; Wu, Xiaopan; Zhu, Xilin; Ma, Juan; Li, Ke; Li, Hui; Liu, Ying

2013-08-01

Hepatocellular carcinoma (HCC) is a common solid malignant tumor occurring worldwide that leads to the third largest cause of death compared to other cancers. Genetic and environmental factors are involved in the pathogenesis of HCC. Epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) can stimulate the proliferation of epidermal and epithelial cells. The EGF signal pathway has a relationship with the growth of the embryo, tissue repairing, and tumorigenesis. In this study, 416 patients with hepatitis B virus infection (HBV)-related HCC and 645 individuals who had never been infected with HBV of the Chinese Han population were enrolled. Eight single-nucleotide polymorphisms (SNPs), whose minor allele frequency >20% in the EGF and EGFR genes, were genotyped to examine their associations with hepatocarcinogenesis. Genotyping experiments were carried out using TaqMan. There were significant differences in genotype distributions (p=0.005) and allele frequencies (p=0.001, odds ratio [OR]=1.43, 95% confidence interval [CI]=1.15-1.79) of rs11569017 in the EGF gene between the HCC and control groups. After binary logistic regression to determine independent factors for susceptibility to HCC under an additive model, rs11569017 was still independently associated with the susceptibility to HCC (p=0.021, OR=1.48, 95% CI=1.06-2.07), but no significant differences in other SNPs were found. Additionally, the haplotype T-G constructed by rs11569017 and rs4444903 of the EGF gene might increase the risk of HBV-related HCC (p=0.002, OR=1.44, 95% CI=1.15-1.82). The rs11569017 T allele was associated with susceptibility to HBV-related HCC.

Quasibound states in graphene quantum-dot nanostructures generated by concentric potential barrier rings

International Nuclear Information System (INIS)

Jiang Zhao-Tan; Yu Cheng-Long; Dong Quan-Li

2012-01-01

We study the quasibound states in a graphene quantum-dot structure generated by the single-, double-, and triple-barrier electrostatic potentials. It is shown that the strongest quasibound states are mainly determined by the innermost barrier. Specifically, the positions of the quasibound states are determined by the barrier height, the number of the quasibound states is determined by the quantum-dot radius and the angular momentum, and the localization degree of the quasibound states is influenced by the width of the innermost barrier, as well as the outside barriers. Furthermore, according to the study on the double- and triple-barrier quantum dots, we find that an effective way to generate more quasibound states with even larger energy level spacings is to design a quantum dot defined by many concentric barriers with larger barrier-height differences. Last, we extend our results into the quantum dot of many barriers, which gives a complete picture about the formation of the quasibound states in the kind of graphene quantum dot created by many concentric potential barrier rings. (rapid communication)

Toxic epidermal necrolysis.

Science.gov (United States)

Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

2007-02-01

Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT

Directory of Open Access Journals (Sweden)

V.F. Zhernosek

2011-01-01

Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.

Ichthyosis hystrix disease or verrucous epidermal nevus (a retrospective analysis of 20-year observation

Directory of Open Access Journals (Sweden)

V. D. El'kin

2017-01-01

Full Text Available We present a  clinical case of ichthyosis hystrix, a rare genetic ichthyosiform dermatosis. Specifics of the disease are related to the complexity of differential diagnosis and verification of the diagnosis, because clinical manifestation of ichthyosis hystrix is similar with that of verrucous epidermal nevus. Clinical particulars of both nosologies are characterized by bizarre and widespread skin lesions of spicular hyperkeratotic growth, located along Blaschko lines. The exclusive feature of the clinical case described is a  long-term (20 years clinical and laboratory monitoring of the patient. The literature review provides brief information on etiology, pathogenesis, clinical features, differential diagnosis, and pathomorphology of ichthyosis hystrix and verrucous epidermal nevus.

Spatial fluctuations in barrier height at the graphene-silicon carbide Schottky junction.

Science.gov (United States)

Rajput, S; Chen, M X; Liu, Y; Li, Y Y; Weinert, M; Li, L

2013-01-01

When graphene is interfaced with a semiconductor, a Schottky contact forms with rectifying properties. Graphene, however, is also susceptible to the formation of ripples upon making contact with another material. Here we report intrinsic ripple- and electric field-induced effects at the graphene semiconductor Schottky junction, by comparing chemical vapour-deposited graphene transferred on semiconductor surfaces of opposite polarization-the hydrogen-terminated silicon and carbon faces of hexagonal silicon carbide. Using scanning tunnelling microscopy/spectroscopy and first-principles calculations, we show the formation of a narrow Schottky dipole barrier approximately 10 Å wide, which facilitates the observed effective electric field control of the Schottky barrier height. We further find atomic-scale spatial fluctuations in the Schottky barrier that directly follow the undulation of ripples on both graphene-silicon carbide junctions. These findings reveal fundamental properties of the graphene/semiconductor Schottky junction-a key component of vertical graphene devices that offer functionalities unattainable in planar device architecture.

Geology, petrology, and petrogenesis of Little Barrier Island, Hauraki Gulf, New Zealand

International Nuclear Information System (INIS)

Lindsay, J.M.; Worthington, T.J.; Smith, I.E.M.; Black, P.M.

1999-01-01

Little Barrier Island is the emergent part of a large, isolated, dacite-rhyodacite volcano in the active Hauraki Rift, 80 km northeast of Auckland. Two volcanic episodes are recognised: Waimaomao Formation was emplaced as a rhyodacite dome at 3 Ma, whereas the more extensive dacitic lavas of Haowhenua Formation were erupted between 1.2 and 1.6 Ma. All Little Barrier lavas are strongly porphyritic and contain phenocrysts of plagioclase, orthopyroxene, and hornblende. Geochemically, they are subduction related and distinct from the older lavas of the Coromandel Volcanic Group, being Zr rich but Rb and Ba poor. Their Sr and Nd isotope ratios are similar to those of the Tonga-Kermadec arc volcanoes. Modelling of the dacite supports petrographic evidence that recharge and mixing were important in the magmatic system. Little Barrier and two dacite domes of similar age and composition near Whangarei form a northwest-trending lineament subparallel to the Alexandra Volcanics and the Vening Meinesz Fracture Zone. (author). 49 refs., 13 figs., 5 tabs

X-ray photoelectron spectroscopy study of Schottky barrier formation and thermal stability of the LaB6/GaAs(001) c (4 x 4) interface

International Nuclear Information System (INIS)

Yokotsuka, T.; Narusawa, T.; Uchida, Y.; Nakashima, H.

1987-01-01

Schottky barrier formation and thermal stability of the LaB 6 /GaAs(001) c (4 x 4) interface were investigated by x-ray photoelectron spectroscopy. Results show an excellent thermal stability without any appreciable interface reactions such as interdiffusion. Band bending induced by LaB 6 deposition is found to depend on the evaporation condition. However, the Fermi level pinning position does not change due to heat treatments between 300 and 700 0 C. This indicates that LaB 6 is a promising gate material for GaAs integrated circuits

Transport barrier formation by LHCD on TRIAM-1M

International Nuclear Information System (INIS)

Hanada, K.; Iyomasa, A.; Zushi, H.; Hasegawa, M.; Nakamura, K.; Sakamoto, M.; Sato, K.N.; Idei, H.; Kawasaki, S.; Nakashima, H.; Higashijima, A.; Sasaki, K.; Hoshika, H.

2004-01-01

Internal transport barrier (ITB) has been obtained in full lower hybrid current driven (LHCD) plasmas on a superconducting tokamak, TRIMA-1M (R 0.84 m, a x b = 0.12 m x 0.18 m, B T L/R . ITB is terminated by the reduction of current drive efficiency caused by metal impurities accumulation. In some condition, self organized slow sawtooth oscillations (SSSO) of plasma current, density, temperature, and so on with the period comparable to the current diffusion time have been also observed during ITB discharge. The oscillation has the capability of particle exhaust, as the result, it may play an role in the avoidance of the impurity accumulation and the dilution in the future steady state fusion plasma with ITB, as the edge-localized mode in H-mode. (authors)

Effect of seasonal and geographical differences on skin and effect of treatment with an osmoprotectant: Sorbitol.

Science.gov (United States)

Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas

2013-01-01

Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.

Formation condition of internal transport barrier in JT-60U plasmas

International Nuclear Information System (INIS)

Koide, Y.; Fujita, T.; Takizuka, T.; Shirai, H.; Hatae, T.; Isayama, A.; Isei, N.; Sakamoto, Y.; Kamada, Y.; Kikuchi, M.

2001-01-01

Onset condition of Internal Transport Barrier (ITB) in reversed shear discharges was investigated. Local values of electron density, electron temperature, and ion temperature seem not to be essential for the ITB onset. Remarkable correlation between electron temperature gradient and magnetic shear was observed at the onset. In addition, ITB well outside the q-minimum position was found. Its onset condition seems to be continuous with that observed in negative shear region. (author)

CAPILLARY BARRIERS IN UNSATURATED FRACTURED ROCKS OF YUCCA MOUNTAIN, NEVADA

International Nuclear Information System (INIS)

Wu, Y.S.; Zhang, W.; Pan, L.; Hinds, J.; Bodvarsson, G.

2000-01-01

This work presents modeling studies investigating the effects of capillary barriers on fluid-flow and tracer-transport processes in the unsaturated zone of Yucca Mountain, Nevada, a potential site for storing high-level radioactive waste. These studies are designed to identify factors controlling the formation of capillary barriers and to estimate their effects on the extent of possible large-scale lateral flow in unsaturated fracture rocks. The modeling approach is based on a continuum formulation of coupled multiphase fluid and tracer transport through fractured porous rock. Flow processes in fractured porous rock are described using a dual-continuum concept. In addition, approximate analytical solutions are developed and used for assessing capillary-barrier effects in fractured rocks. This study indicates that under the current hydrogeologic conceptualization of Yucca Mountain, strong capillary-barrier effects exist for significantly diverting moisture flow

Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

Directory of Open Access Journals (Sweden)

Victor Paromov

2011-01-01

Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

Epidermal stem cells response to radiative genotoxic stress

International Nuclear Information System (INIS)

Marie, Melanie

2013-01-01

Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

Directory of Open Access Journals (Sweden)

Michelle T Juarez

2011-12-01

Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

Epidermal inclusion cyst in male breast: mammographic and ultrasonographic findings in three cases

International Nuclear Information System (INIS)

Cubells, M.; Gil de Ramales, V.; Bulto, J. A.; Morcillo, E.; Celma, J.

2000-01-01

Three cases of histologically diagnosed epidermal inclusion cysts in male breast are presented. This is a very uncommon condition that results from the inclusion of epidermal remnants beneath the skin, which form a keratin-filled cystic cavity. The clinical presentation is that of palpable breast masses showing medium-to-high density in mammography. They are well defined and do not present calcifications. Ultrasound discloses their cystic form, with moderate posterior reinforcement, although they do not appear as anechoic cysts. Characteristically, echoes are detected in the interior that correspond to the degeneration keratin. The differential diagnosis should include cysts complicated by infection or hemorrhage, fibroadenomas with low echogenicity and even tumors of neoplastic origin. Color Doppler ultrasound disclosed the absence of internal vascularisation, a circumstance that indicated the benignity of the lesion. (Author) 9 refs

Guided bone regeneration : the influence of barrier membranes on bone grafts and bone defects

NARCIS (Netherlands)

Gielkens, Pepijn Frans Marie

2008-01-01

Guided bone regeneration (GBR) can be described as the use of a barrier membrane to provide a space available for new bone formation in a bony defect. The barrier membrane protects the defect from in-growth of soft tissue cells and allows bone progenitor cells to develop bone within a blood clot

Nuclear dynamics around the barrier: from fusion to evaporation

International Nuclear Information System (INIS)

Simenel, Cedric

2003-01-01

This work is devoted to aspects of nuclear dynamics around the barrier. It is shown that for fusion reactions, the Coulomb field couples relative motion of nuclei to rotation of a deformed projectile independently of the energy and the charge of the nuclei. An experimental study of the reaction 6 He + 190 Os via gamma spectroscopy of product nuclei has shown that the break up of the 6 He is coupled to the relative motion too, a strong hindrance resulting in the fusion around and above the fusion barrier. The path to fusion after overcoming the barrier, especially the charge equilibration, have been studied in the framework of the TDHF theory via the preequilibrium GDR excited in N/Z asymmetric reactions. An application to formation of the super-heavy elements has been proposed. Finally, couplings between protons and neutrons have been shown up in mean field calculations. Their main expected effect is an emission of protons under the Coulomb barrier. (author)

Antimicrobial susceptibility of Staphylococcus hyicus Isolated from exudative epidermitis in pigs

DEFF Research Database (Denmark)

Wegener, Henrik Caspar; Watts, J.L.; Salmon, S.A.

1994-01-01

for their activities against 100 S. hyicus strains isolated from pigs with exudative epidermitis. Novobiocin was the most active compound tested, with an MIC for 90% of the strains tested (MIC(90)) of less than or equal to 0.06 mu g/ml. Enrofloxacin, ampicillin, and ceftiofur were the next most active compounds...

Examination of tetrachlorosalicylanilide (TCSA) photoallergy using in vitro photohapten-modified Langerhans cell-enriched epidermal cells

International Nuclear Information System (INIS)

Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.

1991-01-01

Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent

Progress Towards Increased Understanding and Control of Internal Transport Barriers on DIII-D

Energy Technology Data Exchange (ETDEWEB)

Doyle, E. J. [University of California, Los Angeles; Greenfield, C. M. [General Atomics; Austin, M. E. [University of Texas, Austin; Baylor, Larry R [ORNL; Burrell, K. H. [General Atomics; Casper, T. A. [Lawrence Livermore National Laboratory (LLNL); DeBoo, J. C. [General Atomics; Ernst, D. R. [Princeton Plasma Physics Laboratory (PPPL); Fenzi, C. [University of Wisconsin, Madison; Gohil, P. [General Atomics; Groebner, R. J. [General Atomics; Heidbrink, W. W. [University of California, Irvine; Jackson, G. L. [General Atomics; Jernigan, Thomas C [ORNL; Kinsey, J. E. [Lehigh University, Bethlehem, PA; Lao, L. L. [General Atomics; Makowski, M. A. [Lawrence Livermore National Laboratory (LLNL); Mckee, G. R. [University of Wisconsin, Madison; Murakami, Masanori [ORNL; Peebles, W. A. [University of California, Los Angeles; Prater, R. [General Atomics; Rettig, C. L. [University of California, Los Angeles; Rhodes, T. L. [University of California, Los Angeles; Rost, J. C. [Massachusetts Institute of Technology (MIT); Staebler, G. M. [General Atomics; Stallard, B. W. [Lawrence Livermore National Laboratory (LLNL); Strait, E. J. [General Atomics; Synakowski, E. J. [Princeton Plasma Physics Laboratory (PPPL); Thomas, D. M. [General Atomics; Wade, Mickey R [ORNL; Waltz, R. E. [General Atomics; Zeng, L. [University of California, Los Angeles

2001-01-01

Substantial progress has been made towards both understanding and control of internal transport barriers (ITBs) on DIII-D, resulting in the discovery of a new sustained high performance operating mode termed the Quiescent Double-Barrier (QDB) regime. The QDB regime combines core transport barriers with a quiescent, ELM-free H-mode edge (termed QH-mode), giving rise to separate (double) core and edge transport barriers. The core and edge barriers are mutually compatible and do not merge, resulting in broad core profiles with an edge pedestal. The QH-mode edge is characterized by ELM-free behavior with continuous multiharmonic MHD activity in the pedestal region, and has provided density and impurity control for 3.5 s (>20 τE) with divertor pumping. QDB plasmas are long-pulse high-performance candidates, having maintained a βNH89 product of 7 for 5 energy confinement times (Ti ≤ 16 keV, βN ≤ 2.9, H89 ≤ 2.4, τE ≤ 150 ms, DD neutron rate Sn ≤ 4x1015 s-1). The QDB regime has only been obtained in counter-NBI discharges (injection anti-parallel to plasma current) with divertor pumping. Other results include successful expansion of the ITB radius using (separately) both impurity injection and counter-NBI, and the formation of ITBs in the electron thermal channel using both ECH and strong negative central shear (NCS) at high power. These results are interpreted within a theoretical framework in which turbulence suppression is the key to ITB formation and control, and a decrease in core turbulence is observed in all cases of ITB formation.

Hot electron formation in thermal barrier region of tandem mirror GAMMA 10

International Nuclear Information System (INIS)

Katanuma, I.; Kiwamoto, Y.; Sawada, K.; Miyoshi, S.

1987-01-01

We have studied the hot electron build-up by the second harmonic electron cyclotron resonance heating in the thermal barrier region of tandem mirror GAMMA 10 by using a Fokker-Planck code with self-consistent potential profile taken into account. We have found two phases in the evolution of hot electron population and the potential profile. In the first phase where the RF diffusion is dominant quick increase of the hot electron density and that of the mean energy are observed. No further increase in the mean energy is observed thereafter. The potential is the deepest during the first phase. The second phase starts in the mean-free-time of the pitch angle scattering of hot electrons on cold electrons and ions. In this phase the hot electron population increases in the rate of the pitch angle scattering. The potential dip shallows due to the accumulation of pitch angle scattered passing ions. This observation indicates the necessity of the ion pumping for maintaining the negative potential at the thermal barrier. (author)

Novel mechanisms for the vitamin D receptor (VDR) in the skin and in skin cancer.

Science.gov (United States)

Bikle, Daniel D; Oda, Yuko; Tu, Chia-Ling; Jiang, Yan

2015-04-01

The VDR acting with or without its principal ligand 1,25(OH)2D regulates two central processes in the skin, interfollicular epidermal (IFE) differentiation and hair follicle cycling (HFC). Calcium is an important co-regulator with 1,25(OH)2D at least of epidermal differentiation. Knockout of the calcium sensing receptor (CaSR) in addition to VDR accelerates the development of skin cancer in mice on a low calcium diet. Coactivators such as mediator 1 (aka DRIP205) and steroid receptor coactivator 3 (SRC3) regulate VDR function at different stages of the differentiation process, with Med 1 essential for hair follicle differentiation and early stages of epidermal differentiation and proliferation and SRC3 essential for the latter stages of differentiation including formation of the permeability barrier and innate immunity. The corepressor of VDR, hairless (HR), is essential for hair follicle cycling, although its effect on epidermal differentiation in vivo is minimal. In its regulation of HFC and IFE VDR controls two pathways-wnt/β-catenin and sonic hedgehog (SHH). In the absence of VDR these pathways are overexpressed leading to tumor formation. Whereas, VDR binding to β-catenin may block its activation of TCF/LEF1 sites, β-catenin binding to VDR may enhance its activation of VDREs. 1,25(OH)2D promotes but may not be required for these interactions. Suppression of SHH expression by VDR, on the other hand, requires 1,25(OH)2D. The major point of emphasis is that the role of VDR in the skin involves a number of novel mechanisms, both 1,25(OH)2D dependent and independent, that when disrupted interfere with IFE differentiation and HFC, predisposing to cancer formation. This article is part of a Special Issue entitled '17th Vitamin D Workshop'. Copyright © 2014 Elsevier Ltd. All rights reserved.

Evidence for sites of methylmercury formation in a flowing water system: Impact of anthropogenic barriers and water management

Energy Technology Data Exchange (ETDEWEB)

Pizarro-Barraza, Claudia [Department of Natural Resources and Environmental Sciences, University of Nevada-Reno, Reno, NV 89557 (United States); Gustin, Mae Sexauer, E-mail: mgustin@cabnr.unr.edu [Department of Natural Resources and Environmental Sciences, University of Nevada-Reno, Reno, NV 89557 (United States); Peacock, Mary [Department of Biology, University of Nevada-Reno, Reno, NV 89557 (United States); Miller, Matthieu [Department of Natural Resources and Environmental Sciences, University of Nevada-Reno, Reno, NV 89557 (United States)

2014-04-01

The Truckee River, California-Nevada, USA is impacted by mercury (Hg) contamination associated with legacy gold mining. In this work, we investigated the potential for hot-spots of methylmercury (MeHg) formation in the river. Mercury concentrations in multiple media were also used to assess the impacts of anthropogenic barriers, restoration, and water management in this flowing water ecosystem. Water samples were collected on a seasonal time step over 3 years, and analyzed for total Hg (THg) and MeHg concentrations, along with a variety of other water quality parameters. In addition, we measured THg and MeHg in sediments, THg in macroinvertebrates, and THg and δ{sup 15}N and δ{sup 13}C concentrations in fish. Differences in stable isotopes and Hg concentrations in fish were applied to understand the mobility of fish in the river. Mercury concentrations of specific macroinvertebrate species were used to identify sites of MeHg production. In general, loads of Hg and nutrients in the river reach above the Reno–Sparks metropolitan area were similar to that reported for pristine systems, while within and below the city, water quality impacts were observed. Fish isotope data showed that in the city reach food resources were different than those upriver and downriver. Based on Hg and isotope data, mobility of the fish in the river is impacted by anthropogenic obstructions and water manipulation. Below the city, particle bound Hg, derived from the legacy mining, continues to be input to the Truckee River. This Hg is deposited in riparian habitats and areas of river restoration, where it is methylated and becomes available to biota. During spring, when flows were highest, MeHg produced and stored in the sediments is mobilized and transported downriver. Fish and macroinvertebrate concentrations increased downriver indicating passive uptake from water. The information presented here could be useful for those doing river restoration and water manipulation in mercury

Evidence for sites of methylmercury formation in a flowing water system: Impact of anthropogenic barriers and water management

International Nuclear Information System (INIS)

Pizarro-Barraza, Claudia; Gustin, Mae Sexauer; Peacock, Mary; Miller, Matthieu

2014-01-01

The Truckee River, California-Nevada, USA is impacted by mercury (Hg) contamination associated with legacy gold mining. In this work, we investigated the potential for hot-spots of methylmercury (MeHg) formation in the river. Mercury concentrations in multiple media were also used to assess the impacts of anthropogenic barriers, restoration, and water management in this flowing water ecosystem. Water samples were collected on a seasonal time step over 3 years, and analyzed for total Hg (THg) and MeHg concentrations, along with a variety of other water quality parameters. In addition, we measured THg and MeHg in sediments, THg in macroinvertebrates, and THg and δ 15 N and δ 13 C concentrations in fish. Differences in stable isotopes and Hg concentrations in fish were applied to understand the mobility of fish in the river. Mercury concentrations of specific macroinvertebrate species were used to identify sites of MeHg production. In general, loads of Hg and nutrients in the river reach above the Reno–Sparks metropolitan area were similar to that reported for pristine systems, while within and below the city, water quality impacts were observed. Fish isotope data showed that in the city reach food resources were different than those upriver and downriver. Based on Hg and isotope data, mobility of the fish in the river is impacted by anthropogenic obstructions and water manipulation. Below the city, particle bound Hg, derived from the legacy mining, continues to be input to the Truckee River. This Hg is deposited in riparian habitats and areas of river restoration, where it is methylated and becomes available to biota. During spring, when flows were highest, MeHg produced and stored in the sediments is mobilized and transported downriver. Fish and macroinvertebrate concentrations increased downriver indicating passive uptake from water. The information presented here could be useful for those doing river restoration and water manipulation in mercury contaminated

Renal origin of rat urinary epidermal growth factor

DEFF Research Database (Denmark)

Nexø, Ebba; Poulsen, Steen Seier

1984-01-01

The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...

Free energy barriers to evaporation of water in hydrophobic confinement.

Science.gov (United States)

Sharma, Sumit; Debenedetti, Pablo G

2012-11-08

We use umbrella sampling Monte Carlo and forward and reverse forward flux sampling (FFS) simulation techniques to compute the free energy barriers to evaporation of water confined between two hydrophobic surfaces separated by nanoscopic gaps, as a function of the gap width, at 1 bar and 298 K. The evaporation mechanism for small (1 × 1 nm(2)) surfaces is found to be fundamentally different from that for large (3 × 3 nm(2)) surfaces. In the latter case, the evaporation proceeds via the formation of a gap-spanning tubular cavity. The 1 × 1 nm(2) surfaces, in contrast, are too small to accommodate a stable vapor cavity. Accordingly, the associated free energy barriers correspond to the formation of a critical-sized cavity for sufficiently large confining surfaces, and to complete emptying of the gap region for small confining surfaces. The free energy barriers to evaporation were found to be of O(20kT) for 14 Å gaps, and to increase by approximately ~5kT with every 1 Å increase in the gap width. The entropy contribution to the free energy of evaporation was found to be independent of the gap width.

[Quantity research on epidermal growth factor in saliva and epidermal growth factor receptor in biopsy samples of recurrent aphthous ulcer patients].

Science.gov (United States)

Gu, Yang; Zhang, Gang; Lin, Mei

2008-02-01

To examine the change of epidermal growth factor (EGF) concentration in saliva of recurrent aphthous ulcer (RAU) patients during the ulcerous and interval period and epidermal growth factor receptor (EGFR) in ulcer biopsy samples. ECF data of the samples, which were 27 saliva samples from RAU gained not only in the ulcerous period but also in interval period and 33 ones from normal persons, were acquired through enzyme linked immunosorhent assay (ELISA) and EGF standard curve. ECFR-RNA date of RAU biopsies, which were 31 biopsy samples from RAU got during the ulcerous period and 35 ones from normal persons, were surveyed by QF-RT-PCR. All RAU samples were obtained under the same level, which were the whole patients were minor aphthous ulcers and their ulcers occurred not over the first four days. All patients and normal persons were selected seriously under the rule of physical situations without any other diseases and histories of using medicines. The EGF concentration of saliva in RAU group at ulcer occurrence was higher than that in the interval period and the normal control with a significant test (F = 3.24, P ulcer occurrence was higher than the normal control with a significant test (t = 3.15, P ulcer occasion of RAU patients could be related with the decreasing of EGF in saliva during interval period, and that the ulcer sell-cure of RAU patients would be contributed to

Using scale and feather traits for module construction provides a functional approach to chicken epidermal development.

Science.gov (United States)

Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H

2017-11-01

Gene co-expression network analysis has been a research method widely used in systematically exploring gene function and interaction. Using the Weighted Gene Co-expression Network Analysis (WGCNA) approach to construct a gene co-expression network using data from a customized 44K microarray transcriptome of chicken epidermal embryogenesis, we have identified two distinct modules that are highly correlated with scale or feather development traits. Signaling pathways related to feather development were enriched in the traditional KEGG pathway analysis and functional terms relating specifically to embryonic epidermal development were also enriched in the Gene Ontology analysis. Significant enrichment annotations were discovered from customized enrichment tools such as Modular Single-Set Enrichment Test (MSET) and Medical Subject Headings (MeSH). Hub genes in both trait-correlated modules showed strong specific functional enrichment toward epidermal development. Also, regulatory elements, such as transcription factors and miRNAs, were targeted in the significant enrichment result. This work highlights the advantage of this methodology for functional prediction of genes not previously associated with scale- and feather trait-related modules.

Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Eriko Kage-Nakadai

Full Text Available In multicellular organisms, the surface barrier is essential for maintaining the internal environment. In mammals, the barrier is the stratum corneum. Fatty acid transport protein 4 (FATP4 is a key factor involved in forming the stratum corneum barrier. Mice lacking Fatp4 display early neonatal lethality with features such as tight, thick, and shiny skin, and a defective skin barrier. These symptoms are strikingly similar to those of a human skin disease called restrictive dermopathy. FATP4 is a member of the FATP family that possesses acyl-CoA synthetase activity for very long chain fatty acids. How Fatp4 contributes to skin barrier function, however, remains to be elucidated. In the present study, we characterized two Caenorhabditis elegans genes, acs-20 and acs-22, that are homologous to mammalian FATPs. Animals with mutant acs-20 exhibited defects in the cuticle barrier, which normally prevents the penetration of small molecules. acs-20 mutant animals also exhibited abnormalities in the cuticle structure, but not in epidermal cell fate or cell integrity. The acs-22 mutants rarely showed a barrier defect, whereas acs-20;acs-22 double mutants had severely disrupted barrier function. Moreover, the barrier defects of acs-20 and acs-20;acs-22 mutants were rescued by acs-20, acs-22, or human Fatp4 transgenes. We further demonstrated that the incorporation of exogenous very long chain fatty acids into sphingomyelin was reduced in acs-20 and acs-22 mutants. These findings indicate that C. elegans Fatp4 homologue(s have a crucial role in the surface barrier function and this model might be useful for studying the fundamental molecular mechanisms underlying human skin barrier and relevant diseases.

Atomistic simulation of dislocation nucleation barriers from cracktips in α-Fe

International Nuclear Information System (INIS)

Gordon, Peter A; Neeraj, T; Luton, Michael J

2008-01-01

In this work, we demonstrate that activation pathways for dislocation loop nucleation from cracktips can be explored with full atomistic detail using an efficient form of the nudged elastic band method. The approach is demonstrated in detail with an example of edge emission from an Fe crack under mode II loading, wherein activation energy barriers are obtained as a function of sub-critical stress intensity and the energy barriers for loop formation are compared with 2D calculations. Activation energy barriers are also computed for an intrinsically ductile cracktip orientation under mode I loading, from which we can infer the frequency of nucleation from the cracktip

Self-Formed Barrier with Cu-Mn alloy Metallization and its Effects on Reliability

International Nuclear Information System (INIS)

Koike, J.; Wada, M.; Usui, T.; Nasu, H.; Takahashi, S.; Shimizu, N.; Yoshimaru, M.; Shibata, H.

2006-01-01

Advancement of semiconductor devices requires the realization of an ultra-thin (less than 5 nm thick) diffusion barrier layer between Cu interconnect and insulating layers. Self-forming barrier layers have been considered as an alternative barrier structure to the conventional Ta/TaN barrier layers. The present work investigated the possibility of the self-forming barrier layer using Cu-Mn alloy thin films deposited directly on SiO2. After annealing at 450 deg. C for 30 min, an amorphous oxide layer of 3-4 nm in thickness was formed uniformly at the interface. The oxide formation was accompanied by complete expulsion of Mn atoms from the Cu-Mn alloy, leading to a drastic decrease in resistivity of the film. No interdiffusion was observed between Cu and SiO2, indicating an excellent diffusion-barrier property of the interface oxide

Pediatric Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Halted by Etanercept.

Science.gov (United States)

Gavigan, Geneviève M; Kanigsberg, Nordau D; Ramien, Michele L

2018-02-01

We report a case of an 11-year-old female with Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) overlap, most likely triggered by sulfamethoxazole-trimethoprim, who was treated with the combination of methylprednisolone, cyclosporine, and etanercept. Her condition stabilized and her skin involvement did not progress after the addition of etanercept. To our knowledge, this is the first report of etanercept for pediatric SJS/TEN.

Theoretical modeling of transport barriers in helical plasmas

International Nuclear Information System (INIS)

Toda, S.; Itoh, K.; Ohyabu, N.

2008-10-01

A unified transport modelling to explain electron Internal Transport Barriers (e-ITB) in helical plasmas and Internal Diffusion Barriers (IDB) observed in Large Helical Device (LHD) is proposed. The e-ITB can be predicted with the effect of zonal flows to obtain the e-ITB in the low collisional regime when the radial variation of the particle anomalous diffusivity is included. Transport analysis in this article can newly show that the particle fuelling induces the IDB formation when this unified transport modelling is used in the high collisional regime. The density limit for the IDB in helical plasmas is also examined including the effect of the radiation loss. (author)

Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

Science.gov (United States)

Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar

2012-09-01

Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An epidermal equivalent assay for identification and ranking potency of contact sensitizers

NARCIS (Netherlands)

Gibbs, S.; Corsini, E.; Spiekstra, S.W.; Galbiati, V.; Fuchs, H.W.; Degeorge, G.; Troese, M.; Hayden, P.; Deng, W.; Roggen, E.

2013-01-01

The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low

Immunohistochemical localisation and developmental aspects of epidermal growth factor in the rat

DEFF Research Database (Denmark)

Raaberg, L; Nexø, E; Damsgaard Mikkelsen, J

1988-01-01

The tissue localisation and time of first appearance of Epidermal Growth Factor (EGF) in the developing rat were investigated by means of immunohistochemistry, radioimmunoassay and radioreceptor assay. In this study we were able to show, that EGF appears prenatally in the lung and the kidney from...

Does epidermal growth factor play a role in the action of sucralfate?

DEFF Research Database (Denmark)

Nexø, Ebba; Poulsen, Steen Seier

1987-01-01

Epidermal growth factor (EGF) is a mitogenic peptide synthesized in the submandibular glands and released in saliva. EGF is able to prevent the development of gastrointestinal ulcers in the rat and to accelerate their healing. The present work was undertaken to examine whether Sucralfate acts via...

Fibronectin changes in eosinophilic meningitis with blood-CSF barrier disruption.

Science.gov (United States)

Shyu, Ling-Yuh; Hu, Ming-E; Chou, Chun-Hui; Chen, Ke-Min; Chiu, Ping-Sung; Lai, Shih-Chan

2015-01-01

Fibronectin, which is present at relatively low levels in healthy central nervous systems (CNS), shows increased levels in meningitis. In this study, fibronectin processing was correlated with the increased permeability of the blood-cerebrospinal fluid (CSF) barrier as well as with the formation of eosinophil infiltrates in angiostrongyliasis meningitis. The immunohistochemistry results show matrix metalloproteinase-9 (MMP-9) is localized in the choroid plexus epithelium. Coimmunoprecipitation demonstrated fibronectin strongly binds MMP-9. Furthermore, treatment with the MMP-9 inhibitor GM6001 significantly inhibited fibronectin processing, reduced the blood-CSF barrier permeability, and decreased the eosinophil counts. The decreased fibronectin processing in CSF implies decreased cellular invasion of the subarachnoid space across the blood-CSF barrier. Therefore, increased fibronectin processing may be associated with barrier disruption and participate in the extravasation and migration of eosinophils into the CNS during experimental parasitic infection. Copyright © 2015 Elsevier Inc. All rights reserved.

Barriers to cross--institutional health information exchange: a literature review.

Science.gov (United States)

Edwards, Ashley; Hollin, Ilene; Barry, Jeffrey; Kachnowski, Stan

2010-01-01

While the development of health information technology, particularly electronic health records (EHR), is a triumph for the advancement of healthcare, non-interoperable clinical data systems lead to fragmented communication and incomplete records. If interoperable HIT systems could be achieved integrated HIT could be leveraged to lessen medical errors, improve patient care and optimize epidemiological research. To understand the barriers to interoperability or health information exchange (HIE), we reviewed the literature on HIT and barriers to HIE. Our search yielded 492 articles, 25 meeting our inclusion criteria. In general, we found that the predominant barriers to HIE are need for standards, security concerns, economic loss to competitors, and federated systems. Research on interoperability is limited because most HIE programs are still in formative stages. More research is needed to fully understand interoperability of HIT, how to overcome the barriers to interoperability, and how to design HIT to better facilitate HIE.

Composition, structure and electrical properties of alumina barrier layers grown in fluoride-containing oxalic acid solutions

Energy Technology Data Exchange (ETDEWEB)

Jagminas, A. [Institute of Chemistry, A. Gostauto 9, LT-01108 Vilnius (Lithuania)], E-mail: jagmin@ktl.mii.lt; Vrublevsky, I. [Department of Microelectricals, Belarusian State University of Informatics and Radioelectricals, 6 Brovka Street, Minsk 220013 (Belarus); Kuzmarskyte, J.; Jasulaitiene, V. [Institute of Chemistry, A. Gostauto 9, LT-01108 Vilnius (Lithuania)

2008-04-15

The composition, structure and electrical properties of alumina barrier layers grown by anodic oxidation in F{sup -}-containing (FC) and F{sup -}-free (FF) oxalic acid solutions were studied using the re-anodizing/dissolution technique, Fourier-transformed infrared and X-ray photoelectron spectroscopy. These results confirmed formation in FC anodizing solutions of films structurally different from ones grown in FF oxalic acid baths. It was found that the barrier layer of FC alumina films is composed of two layers differing in the dissolution rate. These differences are related to the formation in the FC electrolyte of a barrier layer composed of a more microporous outer part and a thin, non-porous and non-scalloped inner part consisting of aluminum oxide and aluminum fluoride.

Epidermal wound repair is regulated by the planar cell polarity signaling pathway.

Science.gov (United States)

Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M

2010-07-20

The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.