Jacobs, J. J. L.; Lehé, C.; Cammans, K. D. A.; Das, P. K.; Elliott, G. R.
2002-01-01
We evaluated the potential of human organotypic skin explant cultures (hOSECs) for screening skin irritants. Test chemicals were applied to the epidermis of the skin explants which were incubated for 4, 24 or 48 h in tissue culture medium. A decrease in epidermal RNA staining, visualised in frozen
Macfarlane, Martin; Jones, Penny; Goebel, Carsten; Dufour, Eric; Rowland, Joanna; Araki, Daisuke; Costabel-Farkas, Margit; Hewitt, Nicola J; Hibatallah, Jalila; Kirst, Annette; McNamee, Pauline; Schellauf, Florian; Scheel, Julia
2009-07-01
Evaluation of the skin irritancy and corrosivity potential of an ingredient is a necessity in the safety assessment of cosmetic ingredients. To date, there are two formally validated alternatives to the rabbit Draize test for skin corrosivity in place, namely the rat skin transcutaneous electrical resistance (TER) assay and the Human Skin Model Test using EpiSkin, EpiDerm and SkinEthic reconstructed human epidermal equivalents. For skin irritation, EpiSkin, EpiDerm and SkinEthic are validated as stand-alone test replacements for the rabbit Draize test. Data from these tests are rarely considered in isolation and are evaluated in combination with other factors to establish the overall irritating or corrosive potential of an ingredient. In light of the deadlines established in the Cosmetics Directive for cessation of animal testing for cosmetic ingredients, a COLIPA scientific meeting was held in Brussels on 30th January, 2008 to review the use of alternative approaches and to set up a decision tree approach for their integration into tiered testing strategies for hazard and safety assessment of cosmetic ingredients and their use in products. In conclusion, the safety assessments for skin irritation/corrosion of new chemicals for use in cosmetics can be confidently accomplished using exclusively alternative methods.
The use of nanoencapsulation to decrease human skin irritation caused by capsaicinoids
Directory of Open Access Journals (Sweden)
Contri RV
2014-02-01
Full Text Available Renata V Contri,1 Luiza A Frank,2 Moacir Kaiser,1 Adriana R Pohlmann,1,3 Silvia S Guterres1,2 1Programa de Pós-Graduação em Ciências Farmacêuticas, 2Faculdade de Farmácia, 3Instituto de Química, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil Abstract: Capsaicin, a topical analgesic used in the treatment of chronic pain, has irritant properties that frequently interrupt its use. In this work, the effect of nanoencapsulation of the main capsaicinoids (capsaicin and dihydrocapsaicin on skin irritation was tested in humans. Skin tolerance of a novel vehicle composed of chitosan hydrogel containing nonloaded nanocapsules (CH-NC was also evaluated. The chitosan hydrogel containing nanoencapsulated capsaicinoids (CH-NC-CP did not cause skin irritation, as measured by an erythema probe and on a visual scale, while a formulation containing free capsaicinoids (chitosan gel with hydroalcoholic solution [CH-ET-CP] and a commercially available capsaicinoids formulation caused skin irritation. Thirty-one percent of volunteers reported slight irritation one hour after application of CH-NC-CP, while moderate (46% [CH-ET-CP] and 23% [commercial product] and severe (8% [CH-ET-CP] and 69% [commercial product] irritation were described for the formulations containing free capsaicinoids. When CH-NC was applied to the skin, erythema was not observed and only 8% of volunteers felt slight irritation, which demonstrates the utility of the novel vehicle. A complementary in vitro skin permeation study showed that permeation of capsaicinoids through an epidermal human membrane was reduced but not prevented by nanoencapsulation. Keywords: chitosan, nanocapsules, capsaicinoids, skin irritation, skin permeation
International Nuclear Information System (INIS)
Han, S.R.
1988-01-01
The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....
Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W
2013-11-01
The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
AbstractDermal exposure to metals may res·ult in irritant contact dermatitis. This study examined the potential of metal nanoparticles to elicit irritant contact dermatitis in a human skin equivalent model (HSEM) derived from epidermal keratinocytes. These cultured cells form a m...
Wilhelm, K P; Freitag, G; Wolff, H H
1994-12-01
Although surfactant-induced acute irritant dermatitis has been extensively studied, our understanding about the induction and repair of the clinically more relevant chronic form is limited. Our purpose was to investigate qualitative and quantitative differences in surfactant-induced irritant skin reactions from cumulative exposure to structurally unrelated surfactants and to compare the maximal irritant responses from this model with corresponding reactions noted in a previously reported acute irritation model. Sodium lauryl sulfate (SLS), dodecyl trimethyl ammonium bromide (DTAB), and potassium soap were the model irritants. Surfactant solutions (7.5%) were applied for 20 minutes daily (for 8 consecutive days excluding the weekend) to the volar aspect of the forearm of 11 volunteers. Irritant reactions were repeatedly assessed until complete healing was indicated by visual assessment and by measurements of transepidermal water loss (TEWL), erythema (skin color reflectance), and stratum corneum hydration (electrical capacitance). Maximum irritant responses were compared with corresponding reactions from an acute irritation model. TEWL was increased by SLS and DTAB to the same extent, but erythema was significantly higher in DTAB-treated skin. Skin dryness, as demonstrated by decreased capacitance values and increased scores for scaling and fissuring, was significantly more pronounced than in an acute irritation model for SLS and DTAB, although no difference was detected between the two surfactants. Potassium soap led to a slight increase in TEWL, whereas the remaining features were not significantly changed. This chronic irritation model appears to represent the clinical situation of irritant contact dermatitis with pronounced skin dryness more closely than the acute irritation model. The present study confirms that an extended time is needed for complete healing of irritant skin reactions. We also demonstrated that the evaluation of the irritation potential of
Wilhelm, K P; Freitag, G; Wolff, H H
1994-06-01
Although the induction of irritant dermatitis by surfactants has been extensively studied in recent years, our understanding of the repair phase of irritant dermatitis is limited. We investigated qualitative and quantitative differences in surfactant-induced irritant skin reactions from short-term exposure to three structurally different surfactants. Sodium lauryl sulfate (SLS), dodecyl trimethyl ammonium bromide (DTAB), and potassium soap were the model irritants. Surfactant solutions (0.5%) were applied for 24 hours to the volar aspect of the forearm of 11 volunteers. Irritant reactions were assessed until complete healing was indicated by visual assessment and by various aspects of skin function, that is, transepidermal water loss (TEWL), erythema (skin color reflectance), and stratum that is, transepidermal water loss (TEWL), erythema (skin color reflectance), and stratum corneum hydration (electrical capacitance). SLS and DTAB induced similar degrees of erythema, whereas SLS induced significantly higher TEWL increase. Although both erythema and TEWL were highest 1 hour after exposure to surfactants, skin dryness was a symptom with delayed onset, justifying the long observation period in this study. Minimum hydration values were measured as late as 7 days after surfactant exposure. Dryness was significantly more pronounced in areas exposed to SLS than in areas exposed to DTAB. Complete repair of the irritant reaction induced by either SLS or DTAB was achieved 17 days after surfactant exposure. Stratum corneum hydration was the last feature to return to baseline values. Potassium soap did not significantly influence any skin function. We emphasize the importance of extended periods needed before a patient with irritant contact dermatitis can be reexposed to irritant substances. The evaluation of the irritation potential of diverse surfactants depended significantly on the feature (erythema vs hydration and TEWL) measured.
Botham, P.A.; Earl, L.K.; Fentem, J.H.; Roguet, R.; Sandt, J.J.M.
1998-01-01
The ECVAM Skin Irritation Task Force was established in November 1996, primarily to prepare a report on the current status of the development and validation of alternative tests for skin irritation and corrosion and, in particular, to identify any appropriate non-animal tests for predicting human
Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata
2014-01-01
Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...
The role of dermal irritation in the skin tumor promoting activity of petroleum middle distillates.
Nessel, C S; Freeman, J J; Forgash, R C; McKee, R H
1999-05-01
Petroleum middle distillates (PMDs), a class of hydrocarbons which boil between 350-700 degrees F, are tumor promoters in mouse skin. The promotional activity is produced under conditions that also result in local changes, including chronic irritation and epidermal hyperplasia. The present study was conducted by comparing equal weekly doses of irritating and minimally or nonirritating test materials, to assess whether tumor promotion was a secondary response to these effects. Four PMDs, C10-C14 normal paraffins (NP), lightly refined paraffinic oil (LRPO), Jet Fuel A (JF), and steam-cracked gas oil (SCGO), were evaluated. Test materials were applied undiluted (2x/week) or as 28.6% (7x/week) or 50% (4x/week) concentrations in mineral oil for 52 weeks following initiation with dimethylbenzanthracene (DMBA). When applied undiluted, all materials produced moderate irritation and significant increase in tumor incidence. When NP, LRPO, or JF were applied in mineral oil diluent, skin irritation was generally ameliorated and few, if any, tumors were produced. SCGO was irritating and produced a significant increase in tumor frequency when administered in mineral-oil diluent. These data indicate that the promotional activity of straight-run PMDs is likely related to chronic irritation at the application site and not to dose. Thus, when used appropriately in the absence of prolonged irritation, these materials should not present a tumorigenic hazard to humans.
Cumulative irritancy in the guinea pig from low grade irritant vehicles and the angry skin syndrome
DEFF Research Database (Denmark)
Andersen, Klaus Ejner; Maibach, H I
1980-01-01
A 4-week open cumulative irritancy test in guinea pigs discriminated between two low grade irritant vehicles, nonionic base (anhydrous) and hydrophilic ointment. The procedure might be useful as a predictive test for low grade irritants. The angry skin syndrome was established in the guinea pigs...
Van Rompay, A R; Alépée, N; Nardelli, L; Hollanders, K; Leblanc, V; Drzewiecka, A; Gruszka, K; Guest, R; Kandarova, H; Willoughby, J A; Verstraelen, S; Adriaens, E
2018-06-01
Assessment of ocular irritancy is an international regulatory requirement and a necessary step in the safety evaluation of industrial and consumer products. Although a number of in vitro ocular irritation assays exist, none are capable of fully categorizing chemicals as a stand-alone assay. Therefore, the CEFIC-LRI-AIMT6-VITO CON4EI (CONsortium for in vitro Eye Irritation testing strategy) project was developed with the goal of assessing the reliability of eight in vitro/alternative test methods as well as establishing an optimal tiered-testing strategy. One of the in vitro assays selected was the validated SkinEthic™ Human Corneal Epithelium Eye Irritation Test method (SkinEthic™ HCE EIT). The SkinEthic™ HCE EIT has already demonstrated its capacity to correctly identify chemicals (both substances and mixtures) not requiring classification and labelling for eye irritation or serious eye damage (No Category). The goal of this study was to evaluate the performance of the SkinEthic™ HCE EIT test method in terms of the important in vivo drivers of classification. For the performance with respect to the drivers all in vivo Cat 1 and No Cat chemicals were 100% correctly identified. For Cat 2 chemicals the liquids and the solids had a sensitivity of 100% and 85.7%, respectively. For the SkinEthic™ HCE EIT test method, 100% concordance in predictions (No Cat versus No prediction can be made) between the two participating laboratories was obtained. The accuracy of the SkinEthic™ HCE EIT was 97.5% with 100% sensitivity and 96.9% specificity. The SkinEthic™ HCE EIT confirms its excellent results of the validation studies. Copyright © 2017. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Brodsky, Berta; Erlanger-Rosengarten, Avigail; Proscura, Elena; Shapira, Elena; Wormser, Uri
2008-01-01
The primary purpose of the present study was to investigate the mechanism of the counter-irritating activity of topical iodine against skin lesions induced by chemical and thermal stimuli. The hypothesis that iodine exerts its activity by inducing an endogenous anti-inflammatory factor was confirmed by exposing guinea pig skin to heat stimulus followed by topical iodine treatment and skin extraction. Injection of the extract into naive guinea pigs reduced heat-induced irritation by 69%. The protective factor, identified as a new nonapeptide (histone H2A 36-44, H-Lys-Gly-Asn-Tyr-Ala-Glu-Arg-Ileu-Ala-OH), caused reduction of 40% in irritation score in heat-exposed guinea pigs. The murine analog (H-Lys-Gly-His-Tyr-Ala-Glu-Arg-Val-Gly-OH, termed IIIM1) reduced sulfur mustard (SM)-induced ear swelling at a dose-dependent bell-shape manner reaching peak activity of 1 mg/kg. Cultured keratinocytes transfected with the peptide were more resistant towards SM than the control cells. The peptide suppressed oxidative burst in activated neutrophils in a concentration-dependent manner. In addition, the peptide reduced glucose oxidase-induced skin edema in mice at a dose-dependent bell-shape manner. Apart from thermal and chemical-induced skin irritation this novel peptide might be of potential use in chronic dermal disorders such as psoriasis and pemphigus as well as non-dermal inflammatory diseases like multiple sclerosis, arthritis and colitis
Short-term biomarkers of tumor promotion in mouse skin treated with petroleum middle distillates.
Walborg, E F; DiGiovanni, J; Conti, C J; Slaga, T J; Freeman, J J; Steup, D R; Skisak, C M
1998-10-01
Topical application of certain petroleum middle distillates (PMD) to mice produces skin tumors after long latency, and initiation/promotion protocols indicate that this effect is associated with their tumor promoting activity. Since induction of sustained, potentiated epidermal hyperplasia is predictive of promoting activity, five compositionally distinct PMD [hydrodesulfurized kerosene (API 81-07); hydrodesulfurized PMD (API 81-10); odorless light petroleum hydrocarbons; severely hydrotreated light vacuum distillate (LVD); and lightly refined paraffinic oil (LRPO)] were assessed for their effects on epidermal hyperplasia. PMD were administered (2 x/week for 2 weeks) to skin of CD-1 mice. Four quantitative biomarkers of epidermal hyperplasia were evaluated: epidermal thickness, number of nucleated epidermal cells per unit length of basement membrane, labeling (BrdUrd) index of epidermal cells, and induction of epidermal ornithine decarboxylase (ODC) activity. As positive controls, 12-O-tetradecanoylphorbol-13-acetate (TPA) and n-dodecane were utilized. PMD-induced skin irritation was evaluated visually and/or histopathologically. All five PMD produced dose-dependent, skin irritation and epidermal hyperplasia. On a weight basis the magnitude of the maximal PMD-induced effects was similar to that produced by n-dodecane, but > 1000-fold less than that produced by TPA. Epidermal hyperplasia and subacute skin irritancy produced by the five PMD were similar. Of the four short-term markers of tumor promotion assessed, labeling index and epidermal ODC activity were predictive of the relative promoting activities of those PMD for which tumorigenicity bioassay data are available, i.e., API 81-07 > API 81-10 > LRPO. An apparent discrepancy to the predictability of epidermal ODC activity occurred with LRPO:toluene [1:1 (v/v)]. This mixture is nontumorigenic, yet significantly induced epidermal ODC activity. This mixture, however, produced severe epidermal toxicity that
Significance of hair-dye base-induced sensory irritation.
Fujita, F; Azuma, T; Tajiri, M; Okamoto, H; Sano, M; Tominaga, M
2010-06-01
Oxidation hair-dyes, which are the principal hair-dyes, sometimes induce painful sensory irritation of the scalp caused by the combination of highly reactive substances, such as hydrogen peroxide and alkali agents. Although many cases of severe facial and scalp dermatitis have been reported following the use of hair-dyes, sensory irritation caused by contact of the hair-dye with the skin has not been reported clearly. In this study, we used a self-assessment questionnaire to measure the sensory irritation in various regions of the body caused by two model hair-dye bases that contained different amounts of alkali agents without dyes. Moreover, the occipital region was found as an alternative region of the scalp to test for sensory irritation of the hair-dye bases. We used this region to evaluate the relationship of sensitivity with skin properties, such as trans-epidermal water loss (TEWL), stratum corneum water content, sebum amount, surface temperature, current perception threshold (CPT), catalase activities in tape-stripped skin and sensory irritation score with the model hair-dye bases. The hair-dye sensitive group showed higher TEWL, a lower sebum amount, a lower surface temperature and higher catalase activity than the insensitive group, and was similar to that of damaged skin. These results suggest that sensory irritation caused by hair-dye could occur easily on the damaged dry scalp, as that caused by skin cosmetics reported previously.
Corvaro, M; Gehen, S; Andrews, K; Chatfield, R; Macleod, F; Mehta, J
2017-10-01
Analysis of the prevalence of health effects in large scale databases is key in defining testing strategies within the context of Integrated Approaches on Testing and Assessment (IATA), and is relevant to drive policy changes in existing regulatory toxicology frameworks towards non-animal approaches. A retrospective analysis of existing results from in vivo skin irritation, eye irritation, and skin sensitisation studies on a database of 223 agrochemical formulations is herein published. For skin or eye effects, high prevalence of mild to non-irritant formulations (i.e. per GHS, CLP or EPA classification) would generally suggest a bottom-up approach. Severity of erythema or corneal opacity, for skinor eye effects respectively, were the key drivers for classification, consistent with existing literature. The reciprocal predictivity of skin versus eye irritation and the good negative predictivity of the GHS additivity calculation approach (>85%) provided valuable non-testing evidence for irritation endpoints. For dermal sensitisation, concordance on data from three different methods confirmed the high false negative rate for the Buehler method in this product class. These results have been reviewed together with existing literature on the use of in vitro alternatives for agrochemical formulations, to propose improvements to current regulatory strategies and to identify further research needs. Copyright © 2017 Elsevier Inc. All rights reserved.
Skin irritation, false positives and the local lymph node assay: a guideline issue?
Basketter, David A; Kimber, Ian
2011-10-01
Since the formal validation and regulatory acceptance of the local lymph node assay (LLNA) there have been commentaries suggesting that the irritant properties of substances can give rise to false positives. As toxicology aspires to progress rapidly towards the age of in vitro alternatives, it is of increasing importance that issues relating to assay selectivity and performance are understood fully, and that true false positive responses are distinguished clearly from those that are simply unpalatable. In the present review, we have focused on whether skin irritation per se is actually a direct cause of true false positive results in the LLNA. The body of published work has been examined critically and considered in relation to our current understanding of the mechanisms of skin irritation and skin sensitisation. From these analyses it is very clear that, of itself, skin irritation is not a cause of false positive results. The corollary is, therefore, that limiting test concentrations in the LLNA for the purpose of avoiding skin irritation may lead, unintentionally, to false negatives. Where a substance is a true false positive in the LLNA, the classic example being sodium lauryl sulphate, explanations for that positivity will have to reach beyond the seductive, but incorrect, recourse to its skin irritation potential. Copyright © 2011 Elsevier Inc. All rights reserved.
Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.
Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M
2016-09-01
Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Swinkels, O.Q.J.; Kucharekova, M.; Prins, M.; Gerritsen, M.J.P.; van der Valk, P.G.M.; van de Kerkhof, P.C.M. [University of Nijmegen, Nijmegen (Netherlands). Medical Center
2003-02-01
Dithranol has been a mainstay in the treatment of psoriasis for more than 80 years. Although a safe approach, the irritation of the clinically uninvolved perilesional skin remains a major limitation of this treatment. Corticosteroids and coal tar solution have an anti-inflammatory potential. The aim of the present study was to investigate the clinical and cell-biological effects of two topical corticosteroids and a coal tar preparation on dithranol-irritated skin. The expression of epidermal proliferation, differentiation and inflammation markers and the clinical irritation scores indicate that the application of a high potency corticosteroid is the best approach to minimise dithranol irritation.
DEFF Research Database (Denmark)
Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole
2009-01-01
To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...
Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.
Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui
2018-01-01
Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.
Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate.
De Jongh, Cindy M; Verberk, Maarten M; Withagen, Carien E T; Jacobs, John J L; Rustemeyer, Thomas; Kezic, Sanja
2006-06-01
Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels and the skin response to a single and a repeated irritation test. This study also aimed to determine changes in SC cytokine levels after repeated irritation. Transepidermal water loss (TEWL) and erythema were measured in 20 volunteers after single 24-hr exposure to 1% sodium lauryl sulfate (SLS), and during and after repeated exposure to 0.1% SLS over a 3-week period. SC cytokine levels were measured from an unexposed skin site and from the repeatedly exposed site. Interleukin (IL)-1alpha decreased by 30% after repeated exposure, while IL-1RA increased 10-fold and IL-8 increased fourfold. Baseline IL-1RA and IL-8 values were predictors of TEWL and erythema after single exposure (r = 0.55-0.61). 6 subjects showed barrier recovery during repeated exposure. Baseline IL-1RA and IL-8 levels are likely to be indicators of higher skin irritability after single exposure to SLS. Barrier repair in some of the subjects might explain the lack of agreement between the TEWL response after single and repeated irritation.
Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin
DEFF Research Database (Denmark)
Kamstrup, M.; Faurschou, A.; Gniadecki, R.
2008-01-01
In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...
Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...
African Journals Online (AJOL)
ADOWIE PERE
ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...
Long-term repetitive sodium lauryl sulfate-induced irritation of the skin: an in vivo study.
Branco, Nara; Lee, Ivy; Zhai, Hongbo; Maibach, Howard I
2005-11-01
Skin may adapt to topical irritants through accommodation. This study focuses on long-term exposure to irritants and attempts to demonstrate accommodation. Sodium lauryl sulfate (SLS) induced irritant contact dermatitis at 3 concentrations (0.025% to 0.075%). Distilled water, acetone and an empty chamber served as controls. Experimental compounds were applied to forearms of 7 healthy volunteers for 24 hr before replacing by a fresh chamber for 6 non-consecutive weeks over 103 days. Possible accommodation was quantified by visual scoring (erythema and dryness) and by bioengineering parameters: transepidermal water loss (TEWL), capacitance, chromametry and laser Doppler flowmetry (LDF). Significant erythema, dryness, elevated TEWL, skin colour reflectance and LDF values occurred during the exposure periods. Upon repeat exposure, an immediate and augmented response in erythema, TEWL, skin colour reflectance and LDF developed. However, irritant skin changes were not sustained. Irritation parameters return to baseline after cessation of exposure. There was no evidence of sustained irritation or accommodation after the last exposure. Study findings do not document sustained accommodation or adaptive hyposensitivity after long-term repetitive irritant exposure under these test conditions. Alternative models should be developed to prove or disprove the accommodation hypothesis.
Lönnqvist, Susanna; Briheim, Kristina; Kratz, Gunnar
2016-02-01
Testing of irritant compounds has traditionally been performed on animals and human volunteers. Animal testing should always be restricted and for skin irritancy mice and rabbits hold poor predictive value for irritant potential in humans. Irritant testing on human volunteers is restricted by the duration subjects can be exposed, and by the subjectivity of interpreting the visual signs of skin irritation. We propose an irritant testing system using viable human full thickness skin with the loss of cell viability in the exposed skin area as end point measurement. Skin was exposed to sodium dodecyl sulfate (SDS) at 20% concentration by non-occluded topical exposure to establish a positive control response and subsequent test compounds were statistically compared with the 20% SDS response. Cell viability and metabolism were measured with 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. The model presents correlation between increased concentration of SDS and decreased viability of cells in the exposed skin area (R(2) = 0.76). We propose the model to be used for cytotoxicity testing of irritant compounds. With fully intact barrier function, the model comprises all cells present in the skin with quantifiable end point measurement.
Kilo, Sonja; Zonnur, Nina; Uter, Wolfgang; Göen, Thomas; Drexler, Hans
2015-10-01
Occupational exposure to carbon disulfide (CS2) leads to inhalative and dermal uptake and thereby to internal exposure. In order to prevent occupational contact dermatitis, gloves and skin protection creams are used at the workplace. The aim of the study was the evaluation of the influence of personal skin protection and irritation on the internal exposure to CS2 of employees in the viscose industry. One hundred and eighty-two male CS2-exposed employees were included in the study and were examined regarding working conditions, use of personal protective measures und skin status. Personal air monitoring and biological monitoring was performed and the 'relative internal exposure' (RIE, internal exposure in relation to external exposure) calculated. A multiple regression analysis calculated the influence of skin protection and irritation on CS2 uptake. Usage of skin protection creams and gloves (and both in combination) while working was associated with a significantly higher RIE indicating a higher dermal penetration of CS2. Equally, irritated skin and younger age was associated with a higher internal burden. Gloves and skin protection creams are useful for preventing occupational skin diseases. However, when handling skin-resorptive substances like CS2, they can increase internal exposure or skin irritation. Therefore, we recommend the careful consideration of benefits and risks of protective creams and gloves at the workplace. © The Author 2015. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.
Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells
International Nuclear Information System (INIS)
Ronald Sluyter; Kylie S Yuen; Gary M Halliday
2001-01-01
There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc
Freeman, J J; Federici, T M; McKee, R H
1993-07-28
Two-year skin carcinogenicity studies were conducted in C3H mice to assess the effects of irritation and selected compositional parameters on the carcinogenic potential of four petroleum liquids. Three samples (lightly refined paraffinic oil, LRPO; lightly hydrodesulfurized specialty oil, LHSO; jet fuel, JF) can be generically classified as middle distillates, i.e. distillation occurs between 350 and 700 degrees F (175-370 degrees C). The fourth sample was a Steam Cracked Gas Oil (SCGO) that distilled within the same range. In studies that assess the effects of irritation on tumorigenicity, LRPO was tested undiluted or was diluted to 50% and 25% in either mineral oil (which eliminated irritation of the skin) or toluene (which did not). Undiluted LRPO elicited tumors in 8% of the mice. Both dilution procedures eliminated tumorigenic potential. Thus, it was possible to maintain a visible level of skin irritation equivalent to that elicited by undiluted LRPO without inducing tumors. SCGO elicited a chronic irritant state grossly equivalent to LRPO but was not tumorigenic. Jet Fuel A (JF) was tested undiluted using both a standard skin painting protocol and an intermittent dosing schedule in which treatment was suspended periodically to allow skin irritation to resolve. The standard treatment protocol of JF resulted in both marked skin irritation and tumors in 44% of the mice. However, using the intermittent schedule, the tumor yield was reduced to 2%. Collectively these data demonstrate that tumor formation is not a necessary sequelae to chronic skin irritation. Conversely, prevention of a marked chronic irritant state was accompanied by decreased tumor yield. These data suggest that the chronic irritant state may be a necessary but not sufficient condition for tumor formation. In studies to assess the effects of compositional parameters, a lightly hydrodesulfurized specialty oil (LHSO) similar to LRPO but refined to have negligible levels of sulfur compounds (3 ppm
Ethnic differences in objective and subjective skin irritation response: an international study.
Lee, E; Kim, S; Lee, J; Cho, S-A; Shin, K
2014-08-01
Due to global marketing in the cosmetics industry, it is important to assess ethnic population susceptibility when evaluating the safety of cosmetic products or chemicals. To investigate ethnic variations in skin irritation response to positive irritants. Clinical testing was performed in four countries on two ethnic groups - Asian and Caucasian. We performed patch tests on the subjects' back with 0.5% aqueous sodium lauryl sulfate (SLS) and 0.15% retinol prepared in 1,3-butylene glycol. Stinging tests were performed using 5% aqueous lactic acid and 0.001% (w/v) capsaicin prepared in 10% ethanol solution separately. The incidence of self-perceived skin sensitivity was similar in the two ethnic groups. However, the incidence of adverse skin reaction to cosmetics appeared significantly higher in Asian (33.0%) than in Caucasian subjects (11.3%). For standard positive irritants such as 0.5% aqueous SLS solution, Asian subjects showed significantly higher scores than Caucasian subjects. The incidence of positive reaction to the 0.15% retinol patch test tended to be higher in Asian than in Caucasian subjects. Our data also showed that neurosensitivity to 5% lactic acid and 0.001% capsaicin was higher in Asian than in Caucasian subjects. Although self-reported skin sensitivity does not appear to differ according to ethnicity, there are ethnic differences in objective and subjective skin irritation responses to several standard positive materials. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
Walters, Russel M; Gandolfi, Lisa; Mack, M Catherine; Fevola, Michael; Martin, Katharine; Hamilton, Mathew T; Hilberer, Allison; Barnes, Nicole; Wilt, Nathan; Nash, Jennifer R; Raabe, Hans A; Costin, Gertrude-Emilia
2016-12-01
The personal care industry is focused on developing safe, more efficacious, and increasingly milder products, that are routinely undergoing preclinical and clinical testing before becoming available for consumer use on skin. In vitro systems based on skin reconstructed equivalents are now established for the preclinical assessment of product irritation potential and as alternative testing methods to the classic Draize rabbit skin irritation test. We have used the 3-D EpiDerm™ model system to evaluate tissue viability and primary cytokine interleukin-1α release as a way to evaluate the potential dermal irritation of 224 non-ionic, amphoteric and/or anionic surfactant-containing formulations, or individual raw materials. As part of our testing programme, two representative benchmark materials with known clinical skin irritation potential were qualified through repeated testing, for use as references for the skin irritation evaluation of formulations containing new surfactant ingredients. We have established a correlation between the in vitro screening approach and clinical testing, and are continually expanding our database to enhance this correlation. This testing programme integrates the efforts of global manufacturers of personal care products that focus on the development of increasingly milder formulations to be applied to the skin, without the use of animal testing. 2016 FRAME.
DEFF Research Database (Denmark)
Suihko, C.; Serup, J.
2008-01-01
demonstrated the applicability of fluorescence CLSM for a detailed study of experimental skin irritants in vivo. Essential findings were disturbed and widened cell borders, swelling of keratinocytes by PA and induction of a parakeratotic shift by SLS with clusters of keratinocytes holding nuclei...... more complicated than reflectance CLSM and may not be applicable to any irritant. SLS applied epicutaneously interacted with the skin surface and coupling to the microscope and was thus found to be more difficult to study technically than PA. PA dissolved in isopropanol is for technical reasons...
Augmentation of skin response by exposure to a combination of allergens and irritants - a review
DEFF Research Database (Denmark)
Pedersen, Line Kynemund; Johansen, Jeanne Duus; Held, Elisabeth
2004-01-01
Clinical experimental studies on contact dermatitis (CD) often evaluate the effect of one allergen or one irritant at a time. In real life, the skin is often exposed to more allergens, more irritants or allergens and irritants in combination. This combined exposure may potentially influence irrit...
In vivo skin penetration of macromolecules in irritant contact dermatitis.
Abdel-Mottaleb, Mona M A; Lamprecht, Alf
2016-12-30
Recently, a selective preferential accumulation of polymeric nanoparticles (in the size range around 100nm) has been observed in the follicular system of dermatitis skin. The present investigation aimed at clearly investigating the effect of irritant contact dermatitis on the barrier permeability for colloidal systems below this size range, namely quantum dots and hydrophilic macromolecules. Irritant dermatitis was induced in mice and the penetrability of quantum dots (5nm) and hydrophilic dextran molecules has been tracked in both healthy and inflamed skin using confocal laser scanning microscopy. The selective accumulation of the quantum dots was clearly observed in inflamed skin while hydrophilic dextran behaved similarly in both healthy and inflamed skin. The therapeutic potential for the transdermal delivery of peptide drugs through inflamed skin has been also tested in rats. Results revealed that the transdermal permeation of insulin and calcitonin was not significantly enhanced in dermatitis compared to healthy skin. On the other side, permeation through stripped skin was significantly higher. However, the effect was limited and shorter compared to the SC injection where t min was 0.5h and 2h with a 70% and 46% reduction in blood glucose levels for the stripped skin and the SC injection respectively. Similarly, t min was 4h and 8h with area under the curve of 161±65% and 350±97% for the stripped skin and the SC injection respectively. In conclusion, the changes in skin permeability accompanied with skin inflammation did not affect its permeability to peptide drugs. Our findings also underline that experiments with the tape stripped skin model as a surrogate for inflamed skin can risk misleading conclusions due to significant difference of skin permeability between the tape stripped skin and inflamed skin. Copyright © 2016 Elsevier B.V. All rights reserved.
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
Directory of Open Access Journals (Sweden)
Raj Victor
2011-08-01
Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
2011-01-01
Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061
Wang, Liang; Shen, Tong; Zhou, Cheng-fan; Yu, Jun-feng; Zhu, Qi-xing
2009-04-01
To study the changes of nitric oxide (NO) in the BALB/c hairless mice skin after trichloroethylene (TCE) irritation and the protection of ginkgo biloba extract (GbE) and vitamin E (VE). 132 BALB/c hairless mice were randomly divided into blank control group, solvent group (olive oil), TCE groups (20%TCE, 40%TCE, 80%TCE and 100%TCE), GbE groups (0.1%GbE, 1%GbE and 10%GbE) and VE groups (5%VE, 10% VE and 20% VE), with 11 animals in each group, 5 for acute irritation test and 6 for the cumulative irritation test. The skin irritation was observed, and the levels of NO in the dorsal skin of BALB/C hairless mice were detected. The kit of NO was used to detect the levels of NO in the dorsal skin of BALB/c hairless mice. (1) The skin presented erythema and edema after TCE irritation both in acute irritation and cumulative irritation test and the skin inflammation showed time-dose effect relationship; the mice skin was protected in GbE or VE groups. (2) In the acute stimulation test, the levels of NO in 80%TCE group (69.895 +/- 9.605 micromol/mg pro) and 100%TCE group (77.273 +/- 9.290 micromol/mg pro) were significantly different compared with blank control group and solvent control group (P skin of BALB/c hairless mice and induce the significant increase of the NO levels. GbE and VE can protect the skin from TCE irritation damage.
Directory of Open Access Journals (Sweden)
Yira Bermudez
Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months...
Influence of epidermal hydration on the friction of human skin against textiles
Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.
Influence of epidermal hydration on the friction of human skin against textile
Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between
Less skin irritation from alcohol-based disinfectant than from detergent used for hand disinfection
DEFF Research Database (Denmark)
Pedersen, L K; Held, E; Johansen, J D
2005-01-01
and forearms of 17 healthy volunteers. A control area was included. After 4 weeks an SLS patch was applied to each area. Irritant reactions were quantified with a visual score recording and measurements of transepidermal water loss (TEWL) and skin colour were performed on days 1, 5, 11, 38 and 40. RESULTS...... was found on the disinfectant-treated area compared with the control area and detergent area, and a similar trend was found for TEWL, although it was not statistically significant. CONCLUSION: Alcohol-based disinfectant caused less visible skin irritation and less skin barrier disruption than the use...
Kremer, M; Lang, E; Berger, A C
2000-09-01
Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human
Experimental study on skin irritation of bone spur powder on rabbit
Ma, Zhenzhen; Zhang, Xuhui; Hao, Shaojun; Shen, Huiling; Wang, Huamin; Ji, Xianghui; Zhang, Zhengchen; Huang, Youling
2018-04-01
To observe the effect of bone powder of rabbit skin, provide the basis for the safety of clinical use of bone powder, 24 rabbits were randomly divided into 6 groups, complete skin test and damaged skin test each divided into 3 groups (n=4), high, low, 3 doses tested daily administered 1 times, continuous administration for 7 days, in 24 hours after the last administration of drug residues, wash with warm water, the removal of L hours after drug for 24 hours, 48 hours, 72 hours and seventh days, observed and recorded to apply position before administration and administration during the skin no erythema and edema, and observe the smear Parts of any pigmentation, bleeding, rough skin or thin skin etc., record the occurrence time and duration time. Through comparative observation, intact skin group before administration and dosing period, there were no erythema and edema, pigmentation, bleeding, rough skin or thin skin etc., there is no difference with the control group; the damaged skin group after administration of 1 to 5 days, each rabbit skin there are different degrees of erythema and edema, especially to skin injury after 24-48 hours is obvious, 2 days (48 hours) after 4 days gradually reduced, significantly subsided after 6 days, erythema and edema phenomenon subsided completely, not out of blood, pigmentation, rough skin or thin skin and so on. The bone spur powder has no irritation on the intact skin of rabbits. The bone spur powder has moderate irritation on the damaged skin of rabbits, but after 48 hours, the stimulation reaction subsided spontaneously, which is caused by the inflammatory reaction caused by skin injury, rather than the medication. The bone spur powder is safe for clinical use.
Assessment of Irritation and Sensitization Potential of Eight Baby Skin Care Products.
Galzote, Carlos; Thomas, Mini; Sachdev, Mukta
2016-10-01
Ethnic differences in skin sensitivity suggest that greater emphasis be focused on understanding a product's effect in diverse populations. The irritation and/or sensitization potential of 8 baby skin care products in Indian adults were evaluated using cumulative irritation tests (CIT) and human repeat insult patch testing (HRIPT) protocols. Healthy males or females aged 18 to 65 years of Indian ethnicity were treated with each of 6 products (cream, hair oil, lotion, body wash, shampoo, and baby soap) using CIT (n = 25) and HRIPT (n = 200). Baby powder and baby oil were evaluated by CIT (n = 25) and HRIPT (n = 107) in separate studies. CITs were conducted over 14 days; HRIPTs were conducted over 10 weeks. In both CIT and HRIPT, most products were considered mild, with no irritation. Baby soap and powder elicited reactions in the HRIPT induction phase, with positive challenge phase reactions (3 subjects), but were affirmed to be nonallergenic in the rechallenge phase. In these studies, 8 baby skin care products were evaluated by both CIT and HRIPT in Indian adults. The results of the studies indicated that all of the tested products were nonallergenic and nonirritating. J Drugs Dermatol. 2016;15(10):1244-1248.
Predicting human epidermal melanin concentrations for different skin tones
CSIR Research Space (South Africa)
Smit, Jacoba E
2011-07-01
Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...
TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.
Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina
2012-10-01
Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.
DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B
2012-01-01
Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.
Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.
Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der
2003-01-01
The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol
Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang
2018-02-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Olsen, W.M.; Kirkhus, B. (Oslo Univ. (Norway))
1989-09-01
The cell cycle traverse of epidermal basal cells 24 h after in vivo exposure of ultraviolet B (UVB) irradiation was studied by immunochemical staining of incorporated bromodeoxyuridine (BrdU) and bivariate BrdU/DNA flow cytometric analysis. The results were compared with the cell kinetic patterns following topical application of the skin carcinogen methylnitrosourea (MNU) as well as the skin irritant cantharidin. The cell cycle traverse in hairless mouse epidermis 24 h after in vivo exposure to UVB seemed to be a combination of the cell kinetic effects following chemical skin carcinogens and skin irritants. UVB irradiation induced both a delay in transit time through S phase, probably due to DNA damage and subsequent repair, as well as a reduction in the total cell cycle time consistent with rapid regenerative proliferation. (author).
Shih, Barbara B; Farrar, Mark D; Cooke, Marcus S; Osman, Joanne; Langton, Abigail K; Kift, Richard; Webb, Ann R; Berry, Jacqueline L; Watson, Rachel E B; Vail, Andy; de Gruijl, Frank R; Rhodes, Lesley E
2018-05-03
Public health guidance recommends limiting sun-exposure to sub-sunburn levels, but it's unknown whether these can gain vitamin D (for musculoskeletal health) whilst avoiding epidermal DNA damage (initiates skin cancer). Well-characterised healthy humans of all skin types (I-VI; lightest to darkest skin) were exposed to a low dose-series of solar simulated UVR of 20-80% their individual sunburn threshold dose (minimal erythemal dose, MED). Significant UVR dose-responses were seen for serum 25(OH)D and whole epidermal CPD, with as little as 0.2 MED concurrently producing 25(OH)D and CPD. Notably, fractional MEDs generated equivalent levels of whole epidermal CPD and 25(OH)D across all skin types. Crucially, we demonstrated an epidermal gradient of CPD formation strongly correlated with skin darkness (r=0.74; Pskin types, ranging from darkest skin, where high CPD levels occurred superficially with none in the germinative basal layer, through to lightest skin where CPD were induced evenly across the epidermal depth. Darker skin people can be encouraged to utilise sub-sunburn UVR-exposure to enhance their vitamin D. In lighter skin people, basal cell damage occurs concurrent with vitamin D synthesis at exquisitely low UVR levels, providing an explanation for their high skin cancer incidence; greater caution is required. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...
Li, Z; Hu, L; Elias, PM; Man, M-Q
2018-01-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...
Anti-epidermal growth factor receptor skin toxicity: a matter of topical hydration.
Ferrari, Daris; Codecà, Carla; Bocci, Barbara; Crepaldi, Francesca; Violati, Martina; Viale, Giulia; Careri, Carmela; Caldiera, Sarah; Bordin, Veronica; Luciani, Andrea; Zonato, Sabrina; Cassinelli, Gabriela; Foa, Paolo
2016-02-01
Skin toxicity is a frequent complication of anti-epidermal growth factor receptor therapy, which can be an obstacle in maintaining the dose intensity and may negatively impact on the clinical outcome of cancer patients. Skin lesions depend on the disruption of the keratinocyte development pathways and no treatment is clearly effective in resolving the cutaneous alterations frequently found during anti-epidermal growth factor receptor therapy. Among systemic treatments, oral tetracycline proved to be useful in preventing skin manifestations. We describe the case of a patient affected by metastatic colorectal cancer, for whom a combination of chemotherapy and cetuximab was used as second-line treatment. The patient developed a symptomatic papulopustular skin rash that disappeared completely after a twice-daily application of a hydrating and moisturizing cream, mainly consisting of a mixture of paraffin, silicone compounds, and macrogol. The marked cutaneous amelioration allowed the patient to continue cetuximab without any further symptoms and was associated with a partial radiological response.
Epidermal differential impedance sensor for conformal skin hydration monitoring.
Huang, Xian; Yeo, Woon-Hong; Liu, Yuhao; Rogers, John A
2012-12-01
We present the design and use of an ultrathin, stretchable sensor system capable of conformal lamination onto the skin, for precision measurement and spatial mapping of levels of hydration. This device, which we refer to as a class of 'epidermal electronics' due to its 'skin-like' construction and mode of intimate integration with the body, contains miniaturized arrays of impedance-measurement electrodes arranged in a differential configuration to compensate for common-mode disturbances. Experimental results obtained with different frequencies and sensor geometries demonstrate excellent precision and accuracy, as benchmarked against conventional, commercial devices. The reversible, non-invasive soft contact of this device with the skin makes its operation appealing for applications ranging from skin care, to athletic monitoring to health/wellness assessment.
International Nuclear Information System (INIS)
Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.
1975-01-01
Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin
Schwitulla, J; Brasch, J; Löffler, H; Schnuch, A; Geier, J; Uter, W
2014-07-01
As previous observations have indicated an inter-relationship between irritant and allergic skin reactions we analysed data of synchronous allergen and sodium lauryl sulfate (SLS) patch tests in terms of a relationship between SLS responsiveness and allergic patch test reactions. To analyse differences in terms of allergen-specific and overall reaction profiles between patients with vs. those without an irritant reaction to SLS. Clinical data of 26 879 patients patch tested from 2008 to 2011 by members of the Information Network of Departments of Dermatology were analysed. After descriptive analyses, including the MOAHLFA index, the positivity ratio and the reaction index, a negative binomial hurdle model was adopted to investigate the correlation between SLS reactivity and positive patch test reactions. Men, patients aged ≥ 40 years and patients with an occupational dermatitis background were over-represented in the SLS-reactive group. Patients with an irritant reaction to SLS showed a higher proportion of weak positive reactions, as well as more questionable and irritant reactions to contact allergens than patients not reactive to SLS. The risk of an additional positive patch test reaction increased by 22% for SLS-reactive patients compared with those who were SLS negative. The marked association between SLS reactivity and the number of positive reactions in patch test patients may be due to nonspecific increased skin reactivity at the moment of patch testing only. However, increased SLS reactivity could also be due to longer-lasting enhanced skin irritability, which may have promoted (poly-)sensitization. Further studies, for example with longitudinal data on patients repeatedly patch tested with SLS and contact allergens, are necessary. © 2014 British Association of Dermatologists.
Zhai, H; Willard, P; Maibach, H I
1999-10-01
The effectiveness of skin protective formulations was evaluated in a previously-described in vivo human model. All formulations failed to inhibit ammonium hydroxide and urea irritation. Only paraffin wax in cetyl alcohol statistically (plauryl sulfate irritation. Paraffin wax in cetyl alcohol was quantitatively the most effective formulation. These results suggest that some formulations may provide protective effects against certain, but not all, irritants or allergens.
Dicationic alkylammonium bromide gemini surfactants. Membrane perturbation and skin irritation.
Directory of Open Access Journals (Sweden)
João A S Almeida
Full Text Available Dicationic alkylammonium bromide gemini surfactants represent a class of amphiphiles potentially effective as skin permeation enhancers. However, only a limited number of studies has been dedicated to the evaluation of the respective cytotoxicity, and none directed to skin irritation endpoints. Supported on a cell viability study, the cytotoxicity of gemini surfactants of variable tail and spacer length was assessed. For this purpose, keratinocyte cells from human skin (NCTC 2544 cell line, frequently used as a model for skin irritation, were employed. The impact of the different gemini surfactants on the permeability and morphology of model vesicles was additionally investigated by measuring the leakage of calcein fluorescent dye and analyzing the NMR spectra of ³¹P, respectively. Detail on the interaction of gemini molecules with model membranes was also provided by a systematic differential scanning calorimetry (DSC and molecular dynamics (MD simulation. An irreversible impact on the viability of the NCTC 2544 cell line was observed for gemini concentrations higher than 25 mM, while no cytotoxicity was found for any of the surfactants in a concentration range up to 10 mM. A higher cytotoxicity was also found for gemini surfactants presenting longer spacer and shorter tails. The same trend was obtained in the calorimetric and permeability studies, with the gemini of longest spacer promoting the highest degree of membrane destabilization. Additional structural and dynamical characterization of the various systems, obtained by ³¹P NMR and MD, provide some insight on the relationship between the architecture of gemini surfactants and the respective perturbation mechanism.
Energy Technology Data Exchange (ETDEWEB)
Kosten, Ilona J.; Spiekstra, Sander W. [Department of Dermatology, VU University Medical Center, Amsterdam (Netherlands); Gruijl, Tanja D. de [Department of Dermatology Medical Oncology, VU University Medical Center, Amsterdam (Netherlands); Gibbs, Susan, E-mail: s.gibbs@acta.nl [Department of Dermatology, VU University Medical Center, Amsterdam (Netherlands); Department of Oral Cell Biology, Academic Center for Dentistry (ACTA), Amsterdam (Netherlands)
2015-08-15
After allergen or irritant exposure, Langerhans cells (LC) undergo phenotypic changes and exit the epidermis. In this study we describe the unique ability of MUTZ-3 derived Langerhans cells (MUTZ-LC) to display similar phenotypic plasticity as their primary counterparts when incorporated into a physiologically relevant full-thickness skin equivalent model (SE-LC). We describe differences and similarities in the mechanisms regulating LC migration and plasticity upon allergen or irritant exposure. The skin equivalent consisted of a reconstructed epidermis containing primary differentiated keratinocytes and CD1a{sup +} MUTZ-LC on a primary fibroblast-populated dermis. Skin equivalents were exposed to a panel of allergens and irritants. Topical exposure to sub-toxic concentrations of allergens (nickel sulfate, resorcinol, cinnamaldehyde) and irritants (Triton X-100, SDS, Tween 80) resulted in LC migration out of the epidermis and into the dermis. Neutralizing antibody to CXCL12 blocked allergen-induced migration, whereas anti-CCL5 blocked irritant-induced migration. In contrast to allergen exposure, irritant exposure resulted in cells within the dermis becoming CD1a{sup −}/CD14{sup +}/CD68{sup +} which is characteristic of a phenotypic switch of MUTZ-LC to a macrophage-like cell in the dermis. This phenotypic switch was blocked with anti-IL-10. Mechanisms previously identified as being involved in LC activation and migration in native human skin could thus be reproduced in the in vitro constructed skin equivalent model containing functional LC. This model therefore provides a unique and relevant research tool to study human LC biology in situ under controlled in vitro conditions, and will provide a powerful tool for hazard identification, testing novel therapeutics and identifying new drug targets. - Highlights: • MUTZ-3 derived Langerhans cells integrated into skin equivalents are fully functional. • Anti-CXCL12 blocks allergen-induced MUTZ-LC migration.
DEFF Research Database (Denmark)
Andersen, Flemming; Hedegaard, Kathryn; Petersen, Thomas Kongstad
2007-01-01
BACKGROUND: So-called anti-irritants are added to cosmetic formulations because of their alleged beneficial effect on irritated skin. Documentation for these claims is often limited. However, glycerol has shown anti-irritant properties in experimentally induced irritation from sodium lauryl sulfate...... volunteers. METHODS: Irritation was induced by 3 daily arm washes for a week with 10% sodium lauryl sulfate on one arm and 30% NON on the other. To maintain irritation, for the next 12 days volunteers washed their arms twice daily with the irritants. Treatments were applied immediately after washing....... The treatments (including vehicle and no treatment) were randomized to sites using a Latin square design. The reactions were evaluated clinically and instrumentally. LIMITATIONS: Study was designed to only detect potent anti-irritants. CONCLUSION: Glycerol reduced the irritant effect of both sodium lauryl...
Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I
2000-08-01
The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.
Horita, Kotomi; Horita, Daisuke; Tomita, Hiroyuki; Yasoshima, Mitsue; Yagami, Akiko; Matsunaga, Kayoko
2017-05-01
Animal testing for cosmetics was banned in the European Union (EU) in 2013; therefore, human tests to predict and ensure skin safety such as the patch test or usage test are now in demand in Japan as well as in the EU. In order to investigate the effects of different bases on the findings of tests to predict skin irritation, we performed patch testing (PT) and the repeated application test (RAT) using sodium lauryl sulfate (SLS), a well-known irritant, dissolved in 6 different base agents to examine the effects of these bases on skin irritation by SLS. The bases for PT were distilled water, 50% ethanol, 100% ethanol, a gel containing 50% ethanol, white petrolatum, and hydrophilic cream. The concentrations of SLS were 0.2% and 0.5%. Twelve different base combinations were applied to the normal back skin of 19 individuals for 24h. RAT was performed with distilled water, 50% ethanol, 100% ethanol, a gel containing 50% ethanol, white petrolatum, and hydrophilic cream containing SLS at concentrations of 0.2%, 2%, and 5%, being applied to the arms of the same PT subjects. The test preparation of each base was applied at the same site, with 0.2% SLS being used in the first week, 2% SLS in the following week, and 5% SLS in the final week. The results of PT revealed that skin irritation scores varied when SLS at the same concentration was dissolved in a different base. The results of RAT showed that although skin irritation appeared with every base at a concentration of 5%, the positive rate was approximately the same. In conclusion, our results suggest that skin irritation elicited in PT depends on the base, while in RAT, it does not depend on the type of base employed. Copyright © 2017 Elsevier B.V. All rights reserved.
Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.
2013-01-01
Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445
Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana
2016-11-01
Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031
Directory of Open Access Journals (Sweden)
Filipović Mila
2016-01-01
Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031
Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.
Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F
2005-09-15
Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.
Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun
2016-02-01
Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Short-term effects of alcohol-based disinfectant and detergent on skin irritation
DEFF Research Database (Denmark)
Pedersen, Line Kynemund; Held, Elisabeth; Johansen, Jeanne Duus
2005-01-01
of 15 volunteers. A control area was included. After 4 weeks, a sodium lauryl sulfate patch was applied to each area. Irritant reactions were quantified by visual score, transepidermal water loss (TEWL) and skin colour at baseline, D3, D8, D35 and D37. As evaluated by clinical assessment, detergent...
Grigore, M; Furtunescu, F; Minca, D; Costache, M; Garbe, C; Simionescu, O
2018-03-10
Eye and skin share the embryological origin. Both are established risk factors in epidermal skin cancer. There are few reports using iris colour classification scales, most of them analyse colour in general or are too complex to use in daily practice. To investigate which iris colour pattern is associated with epidermal skin cancer in a S-E European Caucasian population. A case-control study was conducted on 480 patients: 229 skin cancers patients and 251 controls (dermatological patients free of skin cancers) admitted in two medical clinics of Dermatology in Bucharest, between October 2011 and May 2014. High-resolution iris photographs were taken for each patient. Three parameters of the iris were analysed individually and in association patterns for each patient: periphery, collaret and freckles. The most frequent iris colour pattern associated with epidermal skin cancer was blue periphery with light brown collaret and freckles present. In terms of individual parameters, the strongest indicators for skin cancer patients were blue periphery and blue collaret. The results of this study sustain the hypothesis that blue periphery with light brown collaret and freckles iris pattern is a reliable phenotypic marker for epidermal skin cancer. The results of this study differ from previous reports in which skin cancer risk was associated with a homogeneous blue iris. We account these differences in the characteristics of the recruited patients (S-E European, skin type II and III). The assessment of iris colour patterns is an easy and inexpensive detection tool in skin cancer risk assessment. © 2018 European Academy of Dermatology and Venereology.
Epidermal hydrogen peroxide is not increased in lesional and non-lesional skin of vitiligo.
Zailaie, Mohammad Z
2017-01-01
It is widely believed that the loss of the epidermal melanocytes in vitiligo is basically due to excessive oxidative stress. Previous research work described abnormal elevation of the absolute concentration of the epidermal hydrogen peroxide (H 2 O 2 ) in lesional and non-lesional skin of vitiligo. Based on this finding, our primary research objective was to use this feature as a screening marker in individuals at a great risk of developing vitiligo. Ninety-six patients of non-segmental vitiligo (NSV) of varying durations, skin phototypes, and treatment modalities (psoralen UVA-, narrow band UVB-treated) were recruited for this study. Raman spectroscopic measurements, using an external probehead, of the lesional and non-lesional skin were obtained, and the resulting spectra were analyzed using the Opus software package of the MultiRam spectrometer and the intensity of the peak at 875 cm -1 that represents the absolute concentration of H 2 O 2 was calculated. Contrary to previous reports, in patients of skin phototype IV, the absolute concentrations of H 2 O 2 in non-lesional and lesional NSV of all groups were non-significantly decreased compared to normal control. In patients of NSV of skin phototype V, the decrease in the absolute concentrations of H 2 O 2 was not significant in the untreated group, and a slight non-significant increase in the NBUVB-treated group was noted. However, in the PUVA-treated group, the non-lesional skin demonstrated significant increase in the absolute concentration of H 2 O 2 , whereas the lesional skin showed only a slight non-significant increase compared to normal control. In NSV patients of skin phototype VI who were previously treated with PUVA, the non-lesional skin showed a slight non-significant increase in the absolute concentration of H 2 O 2 ; however, the lesional skin showed a marked significant decrease compared to normal control and the non-lesional skin. Thereof, one can conclude that the epidermal H 2 O 2 is not
Williams, C; Wilkinson, M; McShane, P; Pennington, D; Fernandez, C; Pierce, S
2011-06-01
Healthcare-associated infection is an important worldwide problem that could be reduced by better hand hygiene practice. However, an increasing number of healthcare workers are experiencing irritant contact dermatitis of the hands as a result of repeated hand washing. This may lead to a reduced level of compliance with regard to hand hygiene. To assess whether a measure of acute irritation by hand soaps could predict the effects of repeated usage over a 2-week period. In a double-blind, randomized comparison study, the comparative irritation potential of four different hand soaps was assessed over a 24-h treatment period. The effect of repeated hand washing with the hand soap products over a 2-week period in healthy adult volunteers on skin barrier function was then determined by assessment of transepidermal water loss (TEWL), epidermal hydration and a visual assessment using the Hand Eczema Severity Index (HECSI) at days 0, 7 and 14. A total of 121 subjects from the 123 recruited completed phase 1 of the study. All four products were seen to be significantly different from each other in terms of the irritant reaction observed and all products resulted in a significantly higher irritation compared with the no-treatment control. Seventy-nine of the initial 121 subjects were then enrolled into the repeated usage study. A statistically significant worsening of the clinical condition of the skin as measured by HECSI was seen from baseline to day 14 in those subjects repeatedly washing their hands with two of the four soap products (products C and D) with P-values of 0·02 and 0·01, respectively. Subclinical assessment of the skin barrier function by measuring epidermal hydration was significantly increased from baseline to day 7 after repeated hand washing with products A, B and D but overall no significant change was seen in all four products tested by day 14. A statistically significant increase in TEWL at day 14 was seen for product A (P = 0·02) indicating a
Del Rosso, James Q; Kircik, Leon H
2013-07-01
Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.
Is dermatitis palmaris sicca an irritant contact dermatitis?
Chen, Fu-Juan; Liu, Zhen; Zhou, Ying; Chen, Yong-Hua; Fan, Yi-Ming
2013-01-01
Dermatitis palmaris sicca (DPS) is a common dry-fissured palmar dermatitis in Asian women. It may be an irritant contact dermatitis, but the immunophenotype of the cells in its infiltrate is unknown. The aim of this study was to evaluate the role of inflammatory cells in the pathogenesis of DPS. Patch testing was done in 68 patients with DPS, 87 subjects with hand eczema, and 31 healthy subjects. Immunophenotyping of cutaneous inflammatory cells was performed in 8 patients with DPS, 10 subjects with hand eczema, and 8 healthy individuals. Positive patch rates were higher in patients with DPS and those with hand eczema compared with healthy controls, but strong positive (++ or +++) reactions in DPS were fewer compared with hand eczema. Density of CD3, CD4, CD8, and CD68 cells in skin lesions of DPS and hand eczema was significantly higher than that in normal skin. Sparse CD20 cells were present only in hand eczema. Compared with hand eczema, the number of CD3, CD8, CD68, and dermal CD1a cells decreased, but epidermal CD1a cells and CD4/CD8 ratio increased in DPS. The absolute lack of CD20 cells and relative scarcity of dermal CD8 and CD1a cells in skin lesions might be insufficient to induce contact hypersensitivity, so DPS may be an irritant but not allergic contact dermatitis.
Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi
2011-09-01
Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.
Fluhr, J W; Kelterer, D; Fuchs, S; Kaatz, M; Grieshaber, R; Kleesz, P; Elsner, P
2005-01-01
Biogenic amines are potential irritants e.g. in fish-, meat-, milk- and egg-processing professions like cooks, butchers and bakers. The aim of this study was to test the irritative and barrier-disrupting properties of the biogenic amines ammonium hydroxide (AM), dimethylamine (DMA) and trimethylamine (TMA). A repeated sequential irritation of 30 min twice per day was performed over a total of 4 days (tandem repeated irritation test) on the back of 20 healthy volunteers of both sexes with AM, DMA, TMA and sodium lauryl sulphate (SLS). The epidermal barrier function was assessed with a Tewameter TM 210, stratum corneum surface pH was measured with a Skin-pH-Meter 900, inflammation was assessed with a Chromameter CR-300 on the a* axis for redness and a visual score was recorded. All tested biogenic amines (AM, DMA and TMA) induced a barrier disruption and a pH increase paralleled with a 1-day-delayed onset of inflammatory signs. These effects were further enhanced and accelerated by a sequential application of SLS together with the biogenic amines, and inflammation occurred earlier than with the single compounds. Acetic acid (AA) in contrast did only show mild barrier disruption and no significant inflammatory signs. Our system allowed a ranking of the different compounds in their irritative potential in the tandem irritation with SLS: SLS > NaOH > TMA > AA > AM > DMA. The results are suggestive that in the food-processing industry the simultaneous contact with biogenic amines and harmful detergents like SLS should be minimized. Copyright 2005 S. Karger AG, Basel.
Morphology and epidermal thickness of normal skin imaged by optical coherence tomography
DEFF Research Database (Denmark)
Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars
2008-01-01
colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...
Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour
International Nuclear Information System (INIS)
Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.
1996-01-01
Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)
Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C
2013-06-01
In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Jordan, Laura
2016-11-01
Occupational irritant contact dermatitis (OICD) is a dif cult and hard to manage condition. It occurs more frequently in certain occupations where contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing heightens the risk. Treatment for OICD includes patient education in addition to physical, topical, and systemic therapies. To review the pathogenesis and treatment options for OICD and evaluate the ef cacy of a selective skin-care regimen involv- ing a hand protectant cream alone as well as combined with a repair cream and speci c cleanser. A single-center open study was performed comprising 42 healthy male and female adult volunteers prone to occupational irritant contact dermatitis due to frequent wet work or contact with detergents. Between day 0 and day 7, subjects applied a hand protectant cream as needed on both hands (at least twice daily). On days 7 to 14, subjects applied a hand protectant cream and cleanser as needed on both hands (at least twice daily) as well as a repair cream each evening. A diary log was given to each volunteer for application control and for a subjective evaluation of daily tolerability. In these subjects prone to occupational irritant contact dermatitis, the hand protectant cream applied during the initial 7-day period was effective in restoring the damaged skin barrier and improving the stratum corneum hydration. A regimen that combined the hand protectant and repair creams with a speci c cleanser during a further 7-day period allowed contin- ued improvement of skin hydration and additional clinical bene ts while respecting the skin barrier function. The results of this study support the use of a 3-step approach for patients who are at risk of repeated exposure to external irritants. J Drugs Dermatol. 2016;15(suppl 11):s81-85..
A 90-day toxicity study of the effects of petroleum middle distillates on the skin of C3H mice.
Freeman, J J; McKee, R H; Phillips, R D; Plutnick, R T; Scala, R A; Ackerman, L J
1990-01-01
Petroleum middle distillates (PMDs) elicit skin tumors in mouse epidermal carcinogenesis studies. The response is characterized by a long latency with only a small percentage of animals developing tumors. Although the carcinogenic activity of certain other petroleum hydrocarbons largely depends upon the presence of polycyclic aromatic hydrocarbons (PAHs), many PMDs contain relatively low concentrations of PAHs. PMDs are also irritating to mouse skin, and chronic irritation may be involved in the development of skin tumors. This study was conducted to investigate the patterns of cutaneous irritation elicited by topical application of PMDs having compositional differences. The three PMDs selected for study were a steam cracked gas oil (SCGO), a lightly refined paraffinic oil (LRPO), and a jet fuel (JF). Male C3H/HeNCr1BR mice (25/group) were treated topically (37.5 microliters 2x/week for 13 weeks) with 10%, 50% or 100% (undiluted) concentrations of each PMD. Catalytically cracked clarified oil (CCCO, 10%), a potent carcinogen to mouse skin, was also tested. The vehicle was a noncarcinogenic mineral oil with a viscosity of 90 SUS. Cutaneous changes were evaluated by gross observations and light microscopy. Cutaneous irritation was the only significant toxic response in this study. Neither the vehicle nor any of the 10% PMD concentrations produced significant cutaneous irritation. The 10% CCCO and 50% PMD treatments all elicited slight to moderate proliferative and inflammatory changes in mouse skin. Ulcers were also observed microscopically in mice treated with 10% CCCO and 50% SCGO. The 100% SCGO treatment produced evidence of necrosis on Days 1-7 but not later in the study despite continued treatment. In contrast, the irritating effects of 100% LRPO were not evident until 2-3 weeks of study, and at study completion were characterized by moderately severe inflammatory and proliferative changes. The effects of 100% JF were qualitatively similar to 100% LRPO but less
Retinoic Acid-Induced Epidermal Transdifferentiation in Skin
Directory of Open Access Journals (Sweden)
Yoshihiro Akimoto
2014-06-01
Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.
Irritant Contact Dermatitis : Diagnosis and Risk Factors
Schuttelaar, Maria; Johansen, Jeanne Duus; Lepoittevin, Jean-Pierre; Thyssen, Jacob P.
2016-01-01
Irritant contact dermatitis is frequent and is induced by direct and repeated contact with skin irritants such as detergents, abrasives, solvents and physical factors such as dry air and occlusion (by wearing gloves) but also water. When dermatitis has developed, even a minimal skin irritation, like
Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst
2013-02-01
Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.
Up-regulation of the chemokine CCL21 in the skin of subjects exposed to irritants
Directory of Open Access Journals (Sweden)
Kuznitzky Raquel
2004-04-01
Full Text Available Abstract Background Expression of murine CCL21 by dermal lymphatic endothelial cells (LEC has been demonstrated to be one of the most important steps in Langerhans cell emigration from skin. Previously, our group and others have found that this chemokine is up-regulated in different human inflammatory skin diseases mediated by diverse specific immune responses. This study was carried out to investigate the involvement of CCL21 in human skin after challenge with irritant agents responsible for inducing Irritant Contact Dermatitis (ICD. Results Eleven normal individuals were challenged with different chemical or physical irritants. Two patients with Allergic Contact Dermatitis (ACD were also challenged with the relevant antigen in order to have a positive control for CCL21 expression. Macroscopic as well as microscopic responses were evaluated. We observed typical ICD responses with mostly mononuclear cells in perivascular areas, but a predominance of polymorphonuclear cells away from the inflamed blood vessels and in the epidermis at 24 hours. Immunohistochemical studies showed up-regulation of CCL21 by lymphatic endothelial cells in all the biopsies taken from ICD and ACD lesions compared to normal skin. Kinetic study at 10, 48, 96 and 168 hours after contact with a classical irritant (sodium lauryl sulphate showed that the expression of CCL21 was increased in lymphatic vessels at 10 hours, peaked at 48 hours, and then gradually declined. There was a strong correlation between CCL21 expression and the macroscopic response (r = 0.69; p = 0.0008, but not between CCL21 and the number of infiltrating cells in the lesions. Conclusions These results provide new evidence for the role of CCL21 in inflammatory processes. Since the up-regulation of this chemokine was observed in ICD and ACD, it is tempting to speculate that this mechanism operates independently of the type of dermal insult, facilitating the emigration of CCR7+ cells.
Directory of Open Access Journals (Sweden)
Sayedali Fatemi
2016-01-01
Full Text Available Background: Strontium, zinc, and potassium salts have been demonstrated to inhibit irritation and inflammation when applied topically. Particularly, strontium chloride (SC and potassium nitrate (KN are reported to reduce skin and tooth sensitivity. The aim of the present study was to compare the anti-irritant effects of four inorganic salts and assign the ingredient which can suppress skin irritation due to chemical or environmental exposure, more effectively. We compared the anti-inflammatory effects of SC, strontium nitrate (SN, KN, and zinc chloride (ZC. Materials and Methods: This double-blind trial was conducted on 32 healthy volunteers with sensitive skin. Irritation was induced by 24 h exposure with 1.0% sodium lauryl sulfate on arms.. Treatments were applied by an ointment of SN, SC hexahydrate, KN, and ZC and their 1%, 3%, and 5% (w/v concentrations were prepared. The dosage was twice daily for 6 days to the irritated areas. Skin reactions were evaluated instrumentally. Results: SC had a beneficial effect that was significant overall. All other treatments exert a protective effect in skin barrier function but not significantly. With the exception of ZC, all test substances improved skin hydration but the effect of SC was significant. In respect of colorimetric assessment, all treatments, excluding ZC, reduced erythema significantly compared with an untreated control 7 days after treatment start. There was no support for a dose-response effect. Conclusion: Analysis of the biometric measurements revealed that the strontium salts are best, not treating is worst, and there is little difference between the other treatments. Hence, the skin care products containing SC and SN may reduce the signs and symptoms of irritant contact dermatitis.
Geburek, Florian; Ohnesorge, Bernhard; Deegen, Eckehard; Doeleke, Renate; Hewicker-Trautwein, Marion
2005-12-01
We report the historical, clinical and histopathological characteristics of skin lesions in biopsies from 37 heavy draught horses with chronic pastern dermatitis. The skin lesions were divided into four macroscopic groups: scaling (group I, n=5), hyperkeratotic and hyperplastic plaque-like lesions (group II, n=14), nodular skin masses (group III, n=16) and verrucous skin lesions (group IV, n=2). The principal histological findings were hyperkeratosis and epidermal hyperplasia. There was a gradual increase in epidermal hyperplasia from groups I to IV, suggesting that the lesions represent different stages of disease. In all cases, there was perivascular dermatitis dominated by T lymphocytes with an increase in MHC class II-positive dendritic-like cells. Immunohistochemical labelling for cytokeratins CK5/6(4), CK10 and CK14 indicated a change in their expression pattern. This correlated with the degree of epidermal hyperplasia, indicating abnormal differentiation of keratinocytes. There was a statistically significant correlation between the severity of skin lesions and several other factors including increasing age, increasing cannon circumference, prominence of anatomical structures such as fetlock tufts of hairs, ergots and chestnuts, and bulges in the fetlock region.
[Progress in epidermal stem cells].
Wang, Li-Juan; Wang, You-Liang; Yang, Xiao
2010-03-01
Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.
月田, 佳寿美; 竹田, 千佐子; 長谷川, 智子; 白川, かおる
2003-01-01
Purpose: To clarify epidermal effects of bed bathing using bar soap and water-dissolved liquid soap (liquid soap). Method: The subjects were 33 healthy female college students. Subjects' arms were cleaned by two methods, using bar soap and liquid soap. The following objective data were collected from the subjects: skin sebum, moisturization, pH, and feelings of skin conditions (rashes, redness, itchiness, and irritation). Results : 1. Cleansing effects of both methods on oily dirt seemed no d...
Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong
2016-12-01
: Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.
Hicks, Shari P.; Swindells, Kirsty J.; Middelkamp-Hup, Maritza A.; Sifakis, Martine A.; González, Ernesto; González, Salvador
2003-01-01
BACKGROUND: The pathogenesis of irritant contact dermatitis and its modulation according to skin color is not well understood. Reflectance confocal microscopy (RCM) enables high-resolution, real-time, in-vivo imaging of human skin. OBJECTIVE: The goal of our study was to use RCM to determine whether
Fujimura, T; Shimotoyodome, Y; Nishijima, T; Sugata, K; Taguchi, H; Moriwaki, S
2017-02-01
Irritancy levels of surfactants on human skin have not been clarified completely. The relationships between skin damage and changes of skin properties caused by various surfactants were investigated using non-invasive measurements. Aqueous solutions of seven kinds of anionic, non-ionic, and amphoteric surfactants were exposed to the inside of forearm skin of 20 human subjects in two separate studies using the cup method. Hydration of the stratum corneum (SC), transepidermal water loss (TEWL), pH, skin surface roughness, and contents of the SC were measured before and after one exposure and after five and nine consecutive exposures to various surfactants. The discontinuation ratio of subjects for testing in each surfactant was determined by skin irritation symptoms and was defined as the degree of skin damage. Significant changes were observed only in hydration, TEWL, and natural moisturizing factors (NMF) content in the SC following surfactant exposure. A significant correlation was observed between the discontinuation ratio of each surfactant and the changes of hydration, TEWL, and NMF. Especially, the change of SC hydration showed an excellent correlation with the discontinuation ratio both for single (r = 0.942, P hydration of the SC is equivalent to the skin damage caused by surfactants, and therefore is the most suitable indicator to evaluate the irritation of surfactants on the skin. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Stimulation of allogeneic lymphocytes by skin epidermal cells in the rat
International Nuclear Information System (INIS)
Tanaka, S.; Sakai, A.
1979-01-01
The ability of skin epidermal cells to induce allogeneic lymphocytes into proliferation was examined in mixed skin cell-lymphocyte culture reaction (MSLR). The stimulatng capacity of skin cells was reduced significantly by trypsin digestion, although the damage was repaired by incubation at 37 C for 3 hr. The optimal concentration of mitomycin C for treatment of stimulating cells in the MSLR differed from that in mixed lymphocyte culture reaction (MLR). Irradiation rendered them three to four times more stimulatory than did mitomycin C. Removal of adherent cells from responding cells by passage through a nylon-wool column gave a substantial elevation of the MSLR. The lymphocytes cocultured with skin cells in the primary MSLR incorporated 3 H-thymidine, with the peak at the 6th day of culture. If the lymphocytes primed in the MSLR were restimulated with skin cells from the same stimulating strain, the primed lymphocytes responded promptly and in great magnitude
Energy Technology Data Exchange (ETDEWEB)
Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)
2016-07-08
Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.
Casari, Alice; Farnetani, Francesca; De Pace, Barbara; Losi, Amanda; Pittet, Jean-Christophe; Pellacani, Giovanni; Longo, Caterina
2017-03-01
Irritant contact dermatitis is caused by skin barrier damage. Vitamin E is an antioxidant that is commonly used in cosmetics to prevent photo-damage. To show the usefulness of reflectance confocal microscopy in the assessment of irritant skin damage caused by sodium lauryl sulfate (SLS) and of the protective action of vitamin E applied prior to skin irritation. Ten healthy volunteers were enrolled. Irritation was induced by the application of a patch test containing SLS 5% aq. for 24 h. Three sites were compared: one site on which a product with vitamin E was applied before SLS treatment, one site on which the same product was applied after SLS treatment, and one control site (SLS only). Each site was evaluated with reflectance confocal microscopy, providing in vivo tissue images at nearly histological resolution. We also performed a computerized analysis of the VivaStack® images. Reflectance confocal microscopy is able to identify signs of skin irritation and the preventive effect of vitamin E application. Reflectance confocal microscopy is useful in the objective assessment of irritative skin damage. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo
2016-09-06
Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.
Directory of Open Access Journals (Sweden)
Shadmehr Demehri
2008-05-01
Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.
Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
Groeber, F; Schober, L; Schmid, F F; Traube, A; Kolbus-Hernandez, S; Daton, K; Hoffmann, S; Petersohn, D; Schäfer-Korting, M; Walles, H; Mewes, K R
2016-10-01
To replace the Draize skin irritation assay (OECD guideline 404) several test methods based on reconstructed human epidermis (RHE) have been developed and were adopted in the OECD test guideline 439. However, all validated test methods in the guideline are linked to RHE provided by only three companies. Thus, the availability of these test models is dependent on the commercial interest of the producer. To overcome this limitation and thus to increase the accessibility of in vitro skin irritation testing, an open source reconstructed epidermis (OS-REp) was introduced. To demonstrate the capacity of the OS-REp in regulatory risk assessment, a catch-up validation study was performed. The participating laboratories used in-house generated OS-REp to assess the set of 20 reference substances according to the performance standards amending the OECD test guideline 439. Testing was performed under blinded conditions. The within-laboratory reproducibility of 87% and the inter-laboratory reproducibility of 85% prove a high reliability of irritancy testing using the OS-REp protocol. In addition, the prediction capacity was with an accuracy of 80% comparable to previous published RHE based test protocols. Taken together the results indicate that the OS-REp test method can be used as a standalone alternative skin irritation test replacing the OECD test guideline 404. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Coumarin derivatives, but not coumarin itself, cause skin irritation via topical delivery.
Pan, Tai-Long; Wang, Pei-Wen; Aljuffali, Ibrahim A; Leu, Yann-Lii; Hung, Yi-Yun; Fang, Jia-You
2014-04-21
Coumarin and its derivatives are widely employed as a fragrance in cosmetics and skin care products. The skin absorption level and possible disruption to the skin by topical application of coumarins were evaluated in this study. Percutaneous absorption of osthole, daphnoretin, coumarin, byakangelicin, and 7-hydroxycoumarin was assessed in vitro and in vivo. Skin physiology measurements and immunoblotting were utilized as methodologies for validating toxicity. The relationship between structures and permeation/toxicity of coumarins was elucidated. Both equimolar concentration and saturated solubility in 30% ethanol were used as the applied dose. Osthole with the most lipophilic characteristic demonstrated the greatest skin accumulation, followed by coumarin and 7-hydroxycoumarin. Coumarin was the permeant with the highest flux across the skin. The trend of in vivo deposition was consistent with that of the in vitro profiles. Skin uptake of osthole was 8-fold higher than that of coumarin. Hair follicles played a significant role as a pathway for transport of coumarin according to the examination of follicular accumulation. Osthole and 7-hydroxycoumarin slightly, but significantly, enhanced transepidermal water loss after a consecutive 5-day administration. The immunoblotting profiling verified the role of proliferation in skin damage induced by osthole, byakangelicin, and 7-hydroxycoumarin. The proliferation-related proteins examined in this work included glucose-regulated proteins, cytokeratin, and C-myc. Daphnoretin and coumarin showed a negligible alteration on protein biomarkers. The experimental results suggested that skin irritation caused by coumarins was mainly derived from the analogs but not from coumarin itself. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.
Kawano, Ken-Ichi; Umemura, Kazuo
2013-05-01
The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Covens, P; Berus, D; Caveliers, V; Struelens, L; Vanhavere, F; Verellen, D
2013-01-01
Skin contamination with radiopharmaceuticals can occur during biomedical research and daily nuclear medicine practice as a result of accidental spills, after contact with bodily fluids of patients or by inattentively touching contaminated materials. Skin dose assessment should be carried out by repeated quantification to map the course of the contamination together with the use of appropriate skin dose rate conversion factors. Contamination is generally characterised by local spots on the palmar surface of the hand and complete decontamination is difficult as a result of percutaneous absorption. This specific issue requires special consideration as to the skin dose rate conversion factors as a measure for the absorbed dose rate to the basal layer of the epidermis. In this work we used Monte Carlo simulations to study the influence of the contamination area, the epidermal thickness and the percutaneous absorption on the absorbed skin dose rate conversion factors for a set of 39 medical radionuclides. The results show that the absorbed dose to the basal layer of the epidermis can differ by up to two orders of magnitude from the operational quantity H p (0.07) when using an appropriate epidermal thickness in combination with the effect of percutaneous absorption. (paper)
Immune sensitization against epidermal antigens in polymorphous light eruption
International Nuclear Information System (INIS)
Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.
1991-01-01
To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption
Directory of Open Access Journals (Sweden)
Daniela GUZMÁN-URIBE
Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.
Pastushenko, I; Prieto-Torres, L; Gilaberte, Y; Blanpain, C
2015-11-01
Stem cells are characterized by their ability to self-renew and differentiate into the different cell lineages of their tissue of origin. The discovery of stem cells in adult tissues, together with the description of specific markers for their isolation, has opened up new lines of investigation, expanding the horizons of biomedical research and raising new hope in the treatment of many diseases. In this article, we review in detail the main characteristics of the stem cells that produce the specialized cells of the skin (epidermal, mesenchymal, and melanocyte stem cells) and their potential implications and applications in diseases affecting the skin. Part I deals with the principal characteristics and potential applications of epidermal stem cells in dermatology. Copyright © 2015 Elsevier España, S.L.U. and AEDV. All rights reserved.
CSIR Research Space (South Africa)
Karsten, AE
2008-10-01
Full Text Available Effect of Wavelength, Epidermal Thickness and Skin Type on the Required Dose for Photodynamic Therapy A.E. Karsten1,2 1CSIR National Laser Centre, Biophotonics Group, PO Box 395, Pretoria, 0001, South Africa 2Physics Department, Faculty of Natural... a certain depth in the skin. For most laser treatments and diagnostics apllications, wavelengths ranging between 600 and 1 000 nm are used. 1.1 Photodynamic therapy (PDT) In South Africa, as in many other countries, cancer is a major health...
Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.
2000-01-01
Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal
Cotovio, José; Grandidier, Marie-Hélène; Lelièvre, Damien; Bremond, Christelle; Amsellem, Carolle; Maloug, Saber; Ovigne, Jean-Marc; Loisel-Joubert, Sophie; Lee, Aline Van Der; Minondo, Anne-Marie; Capallere, Christophe; Bertino, Béatrice; Alépée, Nathalie; Tinois-Tessonneaud, Estelle; de Fraissinette, Anne De Brugerolle; Meunier, Jean-Roch; Leclaire, Jacques
2010-03-01
The 7th amendment of the EU Cosmetics Directive led to the ban of eye irritation testing for cosmetic ingredients in animals, effective from March 11th 2009. Over the last 20years, many efforts have been made to find reliable and relevant alternative methods. The SkinEthic HCE model was used to evaluate the in vitro eye irritancy potential of substances from a cosmetic industry portfolio. An optimized protocol based on a specific 1-h treatment and a 16-h post-treatment incubation period was first assessed on a set of 102 substances. The prediction model (PM) based on a 50% viability cut-off, allowed to draw up two classes (Irritants and Non-Irritants), with good associated sensitivity (86.2%) and specificity (83.5%). To check the robustness of the method, the evaluated set was expanded up to 435 substances. Final performances maintained a high level and were characterized by an overall accuracy value > 82% when using EU or GHS classification rules. Results showed that the SkinEthic HCE test method is a promising in vitro tool for the prediction of eye irritancy. Optimization datasets were shared with the COLIPA Eye Irritation Project Team and ECVAM experts, and reviewed as part of an ongoing progression to enter an ECVAM prospective validation study for eye irritation. Copyright (c) 2009 Elsevier Ltd. All rights reserved.
Park, Yoon-Hee; Jeong, Sang Hoon; Yi, Sang Min; Hyeok Choi, Byeong; Kim, Yu-Ri; Kim, In-Kyoung; Kim, Meyoung-Kon; Son, Sang Wook
2011-07-01
The human skin equivalent model (HSEM) is well known as an attractive alternative model for evaluation of dermal toxicity. However, only limited data are available on the usefulness of an HSEM for nanotoxicity testing. This study was designed to investigate cutaneous toxicity of polystyrene and TiO2 nanoparticles using cultured keratinocytes, an HSEM, and an animal model. In addition, we also evaluated the skin sensitization potential of nanoparticles using a local lymph node assay with incorporation of BrdU. Findings from the present study indicate that polystyrene and TiO2 nanoparticles do not induce phototoxicity, acute cutaneous irritation, or skin sensitization. Results from evaluation of the HSEMs correspond well with those from animal models. Our findings suggest that the HSEM might be a useful alternative model for evaluation of dermal nanotoxicity.
International Nuclear Information System (INIS)
Park, Yoon-Hee; Jeong, Sang Hoon; Yi, Sang Min; Choi, Byeong Hyeok; Son, Sang Wook; Kim, Yu-Ri; Kim, In-Kyoung; Kim, Meyoung-Kon
2011-01-01
The human skin equivalent model (HSEM) is well known as an attractive alternative model for evaluation of dermal toxicity. However, only limited data are available on the usefulness of an HSEM for nanotoxicity testing. This study was designed to investigate cutaneous toxicity of polystyrene and TiO 2 nanoparticles using cultured keratinocytes, an HSEM, and an animal model. In addition, we also evaluated the skin sensitization potential of nanoparticles using a local lymph node assay with incorporation of BrdU. Findings from the present study indicate that polystyrene and TiO 2 nanoparticles do not induce phototoxicity, acute cutaneous irritation, or skin sensitization. Results from evaluation of the HSEMs correspond well with those from animal models. Our findings suggest that the HSEM might be a useful alternative model for evaluation of dermal nanotoxicity.
Ortonne, J-P; Queille-Roussel, C
2007-09-01
Medical skin care products are topical preparations with mainly moisturizing properties. A new line of medical skin products with an excellent tolerability profile and improved hydration for dry skin has been developed, but beneficial effects have not yet been investigated on damaged skin. To investigate if these products maintain barrier function and hydration status, improve subjective symptoms due to irritant contact dermatitis and to prove their tolerability on damaged skin. Single-centre, blinded, randomized, controlled study in 20 healthy Caucasian women. 5% sodium lauryl sulphate solution was used to induce skin irritation. Two sites on the inside surface of both forearms of each subject were treated daily for 5 days (irritation period). Lipo Cream, Lipo Milk (water-in-oil emulsions) and Lipo Ointment (water-free formulation) were applied twice daily to three of the four test sites on days 1-5. The fourth site was used as a control. Visual readings, subjective symptom assessments, transepidermal water loss (TEWL) and colorimetric measurements, corneometry and skin microrelief macrophotographies were done on days 1-6. On day 6, TEWL was increased vs baseline on all sites; however, TEWL with Lipo Cream or Lipo Ointment was significantly lower than control. At day 6, skin capacitance was 94%, 100% and 85% of baseline value for the cream, milk and ointment, respectively, versus 72% for control. All test products were well tolerated. Lipo Line products showed both protective properties against epidermal dysfunction and significant hydrating effect.
Clemmensen, Anders; Andersen, Klaus E; Clemmensen, Ole; Tan, Qihua; Petersen, Thomas K; Kruse, Torben A; Thomassen, Mads
2010-09-01
The pathogenesis of irritant contact dermatitis (ICD) is poorly understood, and genes participating in the epidermal response to chemical irritants are only partly known. It is commonly accepted that different irritants have different mechanisms of action in the development of ICD. To define the differential molecular events induced in the epidermis by different irritants, we collected sequential biopsies ((1/2), 4, and 24 hours after a single exposure and at day 11 after repeated exposure) from human volunteers exposed to either sodium lauryl sulfate (SLS) or nonanoic acid (NON). Gene expression analysis using high-density oligonucleotide microarrays (representing 47,000 transcripts) revealed essentially different pathway responses (1/2)hours after exposure: NON transiently induced the IL-6 pathway as well as a number of mitogen-activated signaling cascades including extracellular signal-regulated kinase and growth factor receptor signaling, whereas SLS transiently downregulated cellular energy metabolism pathways. Differential expression of the cyclooxygenase-2 and matrix metalloproteinase 3 transcripts was confirmed immunohistochemically. After cumulative exposure, 883 genes were differentially expressed, whereas we identified 23 suggested common biomarkers for ICD. In conclusion, we bring new insights into two hitherto less well-elucidated phases of skin irritancy: the very initial as well as the late phase after single and cumulative mild exposures, respectively.
Skin moisturization mechanisms: new data.
Bonté, F
2011-05-01
The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Manwaring, John, E-mail: manwaring.jd@pg.com [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Rothe, Helga [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany); Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A. [Procter & Gamble Inc., Mason Business Center, Mason, OH 45040 (United States); Hewitt, Nicola J. [SWS, Erzhausen (Germany); Goebel, Carsten [Procter & Gamble Service GmbH, Sulzbacher Str. 40, 65823 Schwalbach am Taunus (Germany)
2015-09-01
Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K{sub m} and V{sub max} values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C{sub max} was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human
International Nuclear Information System (INIS)
Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J.; Baker, Timothy R.; Troutman, John A.; Hewitt, Nicola J.; Goebel, Carsten
2015-01-01
Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis–Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte K m and V max values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and C max was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. - Highlights: • An entirely in silico/in vitro approach to predict in vivo exposure to dermally applied hair dyes • Skin penetration and epidermal conversion assessed in human skin explants and
Huang, Huey-Chun; Chang, Tsong-Min
2008-08-01
Stratum corneum intercellular lipids, such as ceramides, play an important role in the regulation of skin water barrier homeostasis and water-holding capacity. Aim To evaluate the potential water retention capacity of control emulsion and three oil-in-water (o/w) emulsions containing ceramide 1, ceramide 3, or both. Fifteen healthy Asian women (age, 20-30 years) with healthy skin, pretreated with sodium lauryl sulfate (SLS), applied the tested emulsions twice daily over a period of 28 days. Skin hydration and transepidermal water loss (TEWL) values were measured on the indicated days with a Corneometer(R)825 and a TEWAMETER TM210, respectively. The maximum increase in skin humidity was reached after 4 weeks, with values of 21.9 +/- 1.8% and 8.9 +/- 0.9% for emulsion C and control emulsion, respectively. The maximum decrease in TEWL was also reached after 4 weeks, with values of 36.7 +/- 4.7% and 5.1 +/- 0.8% for the same emulsions. It can be concluded that all the tested ceramide-containing emulsions improved skin barrier function when compared with untreated skin. There was some indication that ceramides 1 and 3 contained in emulsion C might exert a beneficial synergistic effect on skin biochemical properties, such as skin hydration and TEWL, and play a key role in the protection mechanism against SLS irritation.
Parra, Alexander; Clares, Beatriz; Rosselló, Ana; Garduño-Ramírez, María L; Abrego, Guadalupe; García, María L; Calpena, Ana C
2016-03-30
The purpose of this study was the development of poly(d,l-lactide-co-glycolide) acid (PLGA) nanoparticles (NPs) for the dermal delivery of carprofen (CP). The developed nanovehicle was then lyophilized using hydroxypropyl-β-cyclodextrin (HPβCD) as cryoprotectant. The ex vivo permeation profiles were evaluated using Franz diffusion cells using three different types of skin membranes: human, porcine and bovine. Furthermore, biomechanical properties of skin (trans-epidermal water loss and skin hydration) were tested. Finally, the in vivo skin irritation and the anti-inflammatory efficacy were also assayed. Results demonstrated the achievement of NPs 187.32 nm sized with homogeneous distribution, negatively charged surface (-23.39 mV) and high CP entrapment efficiency (75.38%). Permeation studies showed similar diffusion values between human and porcine skins and higher for bovine. No signs of skin irritation were observed in rabbits. Topically applied NPs significantly decreased in vivo inflammation compared to the reference drug in a TPA-induced mouse ear edema model. Thus, it was concluded that NPs containing CP may be a useful tool for the dermal treatment of local inflammation. Copyright © 2016 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Park, Yoon-Hee; Jeong, Sang Hoon; Yi, Sang Min; Choi, Byeong Hyeok; Son, Sang Wook [Laboratory of Cell Signaling and Nanomedicine, Department of Dermatology and Division of Brain Korea 21 Project for Biomedical Science, Korea University College of Medicine, Seoul (Korea, Republic of); Kim, Yu-Ri; Kim, In-Kyoung; Kim, Meyoung-Kon [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)
2011-07-06
The human skin equivalent model (HSEM) is well known as an attractive alternative model for evaluation of dermal toxicity. However, only limited data are available on the usefulness of an HSEM for nanotoxicity testing. This study was designed to investigate cutaneous toxicity of polystyrene and TiO{sub 2} nanoparticles using cultured keratinocytes, an HSEM, and an animal model. In addition, we also evaluated the skin sensitization potential of nanoparticles using a local lymph node assay with incorporation of BrdU. Findings from the present study indicate that polystyrene and TiO{sub 2} nanoparticles do not induce phototoxicity, acute cutaneous irritation, or skin sensitization. Results from evaluation of the HSEMs correspond well with those from animal models. Our findings suggest that the HSEM might be a useful alternative model for evaluation of dermal nanotoxicity.
Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne
2017-01-01
Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...
Long-term organ culture of rabbit skin: Effect of EGF on epidermal structure in vitro
International Nuclear Information System (INIS)
Kondo, S.; Hozumi, Y.; Aso, K.
1990-01-01
A method is described for maintaining the epidermal structure of normal rabbit ear skin explants in organ culture for up to 12 weeks. Split-thickness skin specimens were put in diffusion chambers made of either millipore filters or bovine collagen membranes, and then submitted to a roller tube culture at 15 rpm and 36 degrees C. The culture medium was Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal calf serum (FCS) + 0.4 micrograms/ml hydrocortisone. The gas used in the culture tube was air + 5% CO2. Autoradiography revealed the incorporation of [3H]-glycine into the 68-kD keratin band of explants for up to 12 weeks, indicating that normal keratinization was maintained throughout the entire culture period. The turnover time of the epidermis from basal layer to granular layer was around 7 d in both the early and late stages of culture. The addition of epidermal growth factor (EGF) to the culture caused the epidermis to become acanthotic with orthokeratosis, but with high concentrations of EGF (greater than or equal to 10 ng/ml) parakeratosis and increased proliferation of the epidermis occurred. Dexamethasone (DMS) strongly inhibited the EGF effect
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.
Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B
2013-08-20
At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.
Directory of Open Access Journals (Sweden)
Erol Koç
2014-03-01
Full Text Available Background: Er: YAG lasers are precise ablation systems used in the treatment epidermal and dermal benign skin lesions. In this study, we restrospectively analysed efficiency of Er: YAG laser therapy in the treatment of epidermal and dermal benign skin lesions. Materials and Methods: We retrospectively investigated our clinical records of 116 patients treated with Er: YAG laser between April 2011 and April 2013. The clinical records of 103 patients (47 men, 56 women were included in our study. Of these 103 patients included in the study were xanthelasma, solar lentigo, epidermal nevus, seborrheic keratosis, nevus of ota, syringoma, cafe au lait macules (CALM and other than these. Treatment parameters, demographic features and before and after photographs of the lesions were investigated from patients’ records in order to evaluate efficiency of Er: YAG laser therapy. Results: Of these 103 patients included in the study were evaluated in 8 groups, described as xanthelasma (n=21, syringoma (n=17, solar lentigo (n=16, epidermal nevus (n=11, seborrheic keratosis (n=9, nevus of ota (n=5, CALM (n=3 and other than these (n=21. In the Er: YAG laser treatment, the average energy flow was 3-7 J/cm2, the average pulse duration was 300 ms, the average number of passes was 3-5 repeat, and the average pulse frequency was 3-7 Hz. While 4.9% of the patients showed no improvement, 59.2% showed marked improvement, 26.2% showed moderate improvement and 9.7% showed mild improvement. Treatment responses in xanthelasma, syringoma, epidermal nevus, solar lentigo and CALM lesions were statistically significant. Observed side effects were hyperpigmentation in 4 patients, hypopigmentation in 3 patients, hypertrophic scar in 2 patients and persistent erythema in one patient and the treatment was well tolerated by all the patients. Conclusion: Er: YAG laser is an effective and safe treatment option in the treatment of benign skin lesions especially in epidermal lesions.
Modern child skin care products as a basic treatment in atopic dermatitis
Directory of Open Access Journals (Sweden)
Shchegelskaya T.Yu.
2016-09-01
Full Text Available The aim of the proposed study is to demonstrate the benefits of using specialized cosmetic products as part of basic skin care for children with Atopic Dermatitis (AD. The epidermal barrier dysfunction is known to be the leading factor in pathogenesis of atopic dermatitis and it manifests as dry skin, imbalance in the composition of lipids of the stratum corneum and water-lipid mantle and alterations in the activity of proteases. Due to xerosis, the skin gets easily affected by allergens, irritants and pathogenic microorganisms, which triggers the "itch-scratch" cycle and can lead to AD exacerbation and significantly deteriorate the quality of life of the patient. The basic skin care using the moisturizing and soothing cosmetic products (emollients is acknowledged by all major Guidelines for treatment of AD as an important part of therapy. Significant improvements in skin status as well as the child's well-being can be achieved with use of this simple to understand skin care algorithm that includes proper skin cleansing, moisturizing and itch prevention.
Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo
2017-01-01
Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539
Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo
2017-03-09
Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.
Ko, Horng-Huey; Tsai, Yi-Ting; Yen, Ming-Hong; Lin, Chun-Ching; Liang, Chan-Jung; Yang, Tsung-Han; Lee, Chiang-Wen; Yen, Feng-Lin
2013-12-10
Many natural products used in preventive medicine have also been developed as cosmeceutical ingredients in skin care products, such as Scutellaria baicalensis and Gardenia jasminoides. Norartocarpetin is one of the antioxidant and antityrosinase activity compound in Artocarpus communis; however, the cytotoxicity, skin irritation and antimelanogenesis mechanisms of norartocarpetin have not been investigated yet. In the present study, cell viability in vitro and skin irritation in vivo are used to determine the safety of norartocarpetin. The melanogenesis inhibition of norartocarpetin was determined by cellular melanin content and tyrosinase in B16F10 melanoma cell. Moreover, we examined the related-melanogenesis protein by western blot analysis for elucidating the antimelanogenesis mechanism of norartocarpin. The result of the present study demonstrated that norartocarpetin not only present non-cytotoxic in B16F10 and human fibroblast cells but also non-skin irritation in mice. Moreover, our result also first found that norartocarpetin downregulated phospho-cAMP response element-binding (phospho-CREB) and microphthalmia-associated transcription factor (MITF) expression, which in turn decreased both synthesis of tyrosinases (TRP-1 and TRP-2) and cellular melanin content. This process is dependent on norartocarpetin phosphorylation by mitogen-activated protein kinases such as phospho-JNK and phospho-p38, and it results in decreased melanogenesis. The present study suggests that norartocarpetin could be used as a whitening agent in medicine and/or cosmetic industry and need further clinical study.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema
DEFF Research Database (Denmark)
Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM
2010-01-01
chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...
Matsumoto, Reiko; Sugimoto, Masazumi
2007-02-01
We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.
"Cut-and-paste" manufacture of multiparametric epidermal electronic systems
Lu, Nanshu; Yang, Shixuan; Wang, Pulin
2016-05-01
Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.
Milne, Catherine T; Saucier, Darlene; Trevellini, Chenel; Smith, Juliet
2011-01-01
Peristomal skin alterations under ostomy barrier wafers are a commonly reported problem. While a number of interventions to manage this issue have been reported, the use of a topically applied cyanoacrylate has received little attention. This case series describes the use of a topical cyanoacrylate for the management of peristomal skin alterations in persons living with an ostomy. Using a convenience sample, the topical cyanoacrylate dressing was applied to 11 patients with peristomal skin disruption under ostomy wafers in acute care and outpatient settings. The causes of barrier function interruption were also addressed to enhance outcomes. Patients were assessed for wound discomfort using a Likert Scale, time to healing, and number of appliance changes. Patient satisfaction was also examined. Average reported discomfort levels were 9.5 out of 10 at the initial peristomal irritation assessment visit decreased to 3.5 at the first wafer change and were absent by the second wafer change. Wafers had increasing wear time between changes in both settings with acute care patients responding faster. Epidermal resurfacing occurred within 10.2 days in outpatients and within 7 days in acute care patients. Because of the skin sealant action of this dressing, immediate adherence of the wafer was reported at all pouch changes.
Wollina, Uwe; Tchernev, Georgi; Lotti, Torello
2018-01-25
Non-melanoma skin cancer (NMSC) is the most common malignancy in humans. Targeted therapy with monoclonal antibody cetuximab is an option in case of advanced tumor or metastasis. We present and update of the use of cetuximab in NMSC searching PUBMED 2011-2017. The monoclonal antibody cetuximab against epidermal growth factor receptor (EGFR) has been investigated for its use in NMSC during the years 2011 to 2017 by a PUBMED research using the following items: "Non-melanoma skin cancer AND cetuximab," "cutaneous squamous cell carcinoma AND cetuximab," and "basal cell carcinoma AND cetuximab", and "cetuximab AND skin toxicity". Available data were analyzed including case reports. Current evidence of cetuximab efficacy in NMSC was mainly obtained in cutaneous SCC and to a lesser extend in BCC. Response rates vary for neoadjuvant, adjuvant, mono- and combined therapy with cetuximab. Management of cutaneous toxicities is necessary. Guidelines are available. Cetuximab is an option for recurrent or advanced NMSC of the skin. It seems to be justified particularly in very high-risk tumors. There is a need for phase III trials.
Menstrual cycle and skin reactivity
DEFF Research Database (Denmark)
Agner, T; Damm, P; Skouby, S O
1991-01-01
The hypothesis was tested that a cyclic variation exists in skin reactivity to irritant stimuli. Twenty-nine healthy women with regular menstrual cycles were challenged with sodium lauryl sulfate as an irritant patch test at day 1 and at days 9 through 11 of the menstrual cycle. The skin response...... to the applied irritant stimulus was evaluated by visual scoring and also quantified by measurements of transepidermal water loss, edema formation, and blood flow in the skin. The skin response to challenge with sodium lauryl sulfate was found to be significantly stronger at day 1 than at days 9 through 11...
Occupational irritant contact dermatitis due to petroleum naphtha
Aslı Aytekin; Arzu Karataş Toğral
2014-01-01
Irritant contact dermatitis (ICD) is responsible for the vast majority of occupational contact dermatitis and usually seen in professional groups working with wet hand. However, today, with the increasing business lines, employees are exposed to a variety of irritants. Occupational exposure to many chemicals and toxic irritants affect not only the skin, but also the other systems. Therefore, this situation resulting with loss of work and changes in business may become a public health problem....
von Grote, Erika C; Palaniswarmy, Kiruthi; Meckfessel, Matthew H
2016-12-01
Occupational irritant contact dermatitis (ICD) affecting the hands is a common and difficult-to-manage condition. Occupations that necessitate contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing elevate the risk of ICD. Management strategies that do not adequately prevent accumulated damage and repair skin, can develop into chronic dermatoses which negatively impact work productivity and quality of life. A 2-step skin-care regimen (Excipial Daily Protection Hand Cream (EP) and Excipial Rapid Repair Hand Cream (ER), Galderma Laboratories, L.P.) has been developed as a daily-use management strategy to protect and repair vulnerable hands. The protective barrier cream is formulated with aluminum chlorohydrate and designed for pre-exposure application to enhance the skin's natural protective barrier and minimize excessive moisture while wearing protective gloves. The repair cream, a lipid-rich formulation, is intended for post-exposure application to rehydrate and facilitate the skin's natural healing process. The results of 3 clinical studies highlighted in this review demonstrate how the use of a 2-step skin-care regimen offers a greater protective effect against ICD than the use of barrier cream alone, and also how the formulation of the barrier cream used in these studies helps minimize the occlusion effect caused by gloves and does not interfere with the antibacterial efficacy of an alcohol-based hand sanitizer. This 2-step skin-care regimen is effectively designed to manage and minimize the risk of ICD development in a variety of patients and provides clinicians an additional tool for helping patients manage ICD. J Drugs Dermatol. 2016;15(12):1504-1510.
International Nuclear Information System (INIS)
Olsen, W.M.; Elgjo, K.
1990-01-01
A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system
International Nuclear Information System (INIS)
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-01-01
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Energy Technology Data Exchange (ETDEWEB)
Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Improvement of arbutin trans-epidermal delivery using ...
African Journals Online (AJOL)
Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...
Preparation of irritant polymer samples for an in vitro round robin study.
Coleman, Kelly P; Grailer, Thomas P; McNamara, Lori R; Rollins, Beau L; Christiano, Nicholas J; Kandárová, Helena; De Jong, Wim H
2018-01-01
A round robin study using reconstructed human epidermis (RhE) tissues was conducted to test medical device polymer extracts for skin irritation potential. Test samples were four irritant and three non-irritant medical device polymers. Five of these polymer samples were developed and two were
Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme
2017-01-01
Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.
International Nuclear Information System (INIS)
Graem, N.
1986-01-01
Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue
Specific dermatological benefits associated with quantities of lotion transferred to the skin.
Farage, Miranda A; Esquerra, Juan; Cheng, Richard; Carpenter, Stacey; Bunasky, Kathryn; Gutshall, Denise; Lawrence, Ann; Messerschmidt, Andre
2017-11-02
A growing number of manufacturers are taking advantage of the ability of absorbent consumer products to deliver lotion to the skin. The lotion is included on these products to help protect the skin from adverse skin effects that can occur, including: (1) irritation, (2) over hydration of the stratum corneum, (3) dryness that can occur from extended exposure to highly absorbent consumer products, and (4) changes in pH. This manuscript presents results of a quantitative lotion transfer study of adult incontinence products. Resulting lotion transfer is compared to the results of several separate experiments in which specific skin benefits have been correlated to lotion concentrations. The behind-the-knee (BTK) lotion transfer protocol was used to quantitate lotion transfer from adult incontinence (AI) test products constructed using 2 lotion formulations and 2 configurations of lotion application. A modified arm patch protocol, in which skin sites of a measured dimension were pre-treated with specific volumes of lotion, was used to evaluate protective effects of lotion against exposure to irritants, and over hydration from wetted absorbent products. After a 6-hours continuous exposure in the BTK the 5-stripe lotion configuration products transferred (adjusted mean ± SE) 94 ± 11-104 ± 11 μg/cm 2 lotion. After 24 hours of wear, transfer had increased to 127 ± 22 and 149 ± 24 μg/cm 2 , respectively. The single-block configuration products transferred 289 ± 10-316 ± 10 μg/cm 2 (P = .04). Transfer after 24 hours of wear was 328 ± 23 and 472 ± 21 μg/cm 2 , respectively (P benefits. In studies evaluating protection against irritants, skin site pre-treated with lotion were patched with 0.5% sodium lauryl sulfate (SLS). Protective effects were assessed by visual assessment of erythema and trans-epidermal water loss (TEWL). In the first experiment, lotion pre-treatment concentrations as low as 165 μg/cm 2 exhibited significantly (P
Directory of Open Access Journals (Sweden)
Chin Keong Lim
2011-01-01
Full Text Available Chitosan is a copolymer of N-acetylglucosamine and glucosamine. A bilayer chitosan porous skin regenerating template (CPSRT has been developed for skin tissue engineering. The pore size of the CPSRT was assessed using a scanning electron microscopy (SEM. The in vitro cytocompatibility of the CPSRT was tested on primary human epidermal keratinocyte (pHEK cultures by measuring lactate dehydrogenase (LDH levels and skin irritation by western blot analysis of the interleukin-8 (IL-8 and tumor necrosis factor-α (TNF-α secretions. The ability of the CPSRT to support cell ingrowth was evaluated by seeding primary human dermal fibroblasts (pHDFs on the scaffold, staining the cells with live/dead stain, and imaging the construct by confocal microscopy (CLSM. The CPSRT with pore sizes ranging from 50 to 150 μm was cytocompatible because it did not provoke the additional production of IL-8 and TNF-α by pHEK cultures. Cultured pHDFs were able to penetrate the CPSRT and had increased in number on day 14. In conclusion, the CPSRT serves as an ideal template for skin tissue engineering.
Manwaring, John; Rothe, Helga; Obringer, Cindy; Foltz, David J; Baker, Timothy R; Troutman, John A; Hewitt, Nicola J; Goebel, Carsten
2015-09-01
Approaches to assess the role of absorption, metabolism and excretion of cosmetic ingredients that are based on the integration of different in vitro data are important for their safety assessment, specifically as it offers an opportunity to refine that safety assessment. In order to estimate systemic exposure (AUC) to aromatic amine hair dyes following typical product application conditions, skin penetration and epidermal and systemic metabolic conversion of the parent compound was assessed in human skin explants and human keratinocyte (HaCaT) and hepatocyte cultures. To estimate the amount of the aromatic amine that can reach the general circulation unchanged after passage through the skin the following toxicokinetically relevant parameters were applied: a) Michaelis-Menten kinetics to quantify the epidermal metabolism; b) the estimated keratinocyte cell abundance in the viable epidermis; c) the skin penetration rate; d) the calculated Mean Residence Time in the viable epidermis; e) the viable epidermis thickness and f) the skin permeability coefficient. In a next step, in vitro hepatocyte Km and Vmax values and whole liver mass and cell abundance were used to calculate the scaled intrinsic clearance, which was combined with liver blood flow and fraction of compound unbound in the blood to give hepatic clearance. The systemic exposure in the general circulation (AUC) was extrapolated using internal dose and hepatic clearance, and Cmax was extrapolated (conservative overestimation) using internal dose and volume of distribution, indicating that appropriate toxicokinetic information can be generated based solely on in vitro data. For the hair dye, p-phenylenediamine, these data were found to be in the same order of magnitude as those published for human volunteers. Copyright © 2015. Published by Elsevier Inc.
Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou
2018-05-01
Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.
Epidermal stem cells: location, potential and contribution to cancer.
Ambler, C A; Määttä, A
2009-01-01
Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.
Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori
2017-08-01
To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.
Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...
International Nuclear Information System (INIS)
Ishikawa, T.; Kodama, K.; Matsumoto, J.; Takayama, S.
1984-01-01
We previously developed a quantitative autoradiographic technique with special forceps for measuring unscheduled DNA synthesis (UDS) in mouse skin after treatment with ultraviolet light in vivo. By this method, we investigated the relationship between the protective role of melanin and UV-induced DNA repair in black-and-white guinea pigs. Flat areas containing a sharp border between pigmented and unpigmented skin were selected. The skin of the selected areas was shaved and irradiated with short-wave UV (254 nm) or UV-AB (270 to 440 nm, emission peak at 312 nm) at various doses. Immediately after irradiation, the skin was clamped off with forceps, and an isotonic aqueous solution of [methyl- 3 H]thymidine was injected s.c. into the clamped off portion. UDS was clearly demonstrated as silver grains in this portion of the skin after irradiation with 254 nm UV or UV-AB. Errors due to individual differences were avoided by comparing the intensities of UDS in basal cells from pigmented skin and unpigmented skin of the same animals. Unexpectedly, in groups of animals treated with 254 nm UV or UV-AB, no difference in UDS in pigmented and unpigmented skin was seen at any UV dose. These results suggested that epidermal melanin granules do not significantly protect DNA of basal cells against 254 nm UV or UV-AB irradiation. Results of a study on the effect of the wavelength of irradiation on the UDS response of albino guinea pigs are also reported
DEFF Research Database (Denmark)
Ortiz, P.G.; Hansen, S.H.; Shah, V.P.
2008-01-01
Background: Determination of drug penetration in diseased skin represents a challenge. Objective: To compare dermal microdialysis and tape-strip sampling of drug penetration in normal skin and skin with irritant dermatitis. Methods: The two methodologies were employed simultaneously in 16 healthy...... methods. Results: Microdialysis showed a significant threefold increase in metronidazole penetration in skin with irritant dermatitis compared with unmodified skin. Conversely, the concentration of metronidazole in tape-strip samples was significantly decreased in irritant dermatitis. Conclusion......: The selection of sampling methodology should be based on the skin layer of interest as well as the integrity of the skin barrier. Whenever the dermal tissue is the target for topical treatment, microdialysis sampling should be the method of choice Udgivelsesdato: 2008...
Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing
Directory of Open Access Journals (Sweden)
Sabita N. Saldanha
2015-12-01
Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.
Rastogi, Anshu; Pospísil, Pavel
2010-08-01
All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.
Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna
2015-08-01
The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.
Szél, E; Polyánka, H; Szabó, K; Hartmann, P; Degovics, D; Balázs, B; Németh, I B; Korponyai, C; Csányi, E; Kaszaki, J; Dikstein, S; Nagy, K; Kemény, L; Erős, G
2015-12-01
Glycerol is known to possess anti-irritant and hydrating properties and previous studies suggested that xylitol may also have similar effects. Our aim was to study whether different concentrations of these polyols restore skin barrier function and soothe inflammation in sodium lauryl sulphate (SLS)-induced acute irritation. The experiments were performed on male SKH-1 hairless mice. The skin of the dorsal region was exposed to SLS (5%) for 3 h alone or together with 5% or 10% of glycerol respectively. Further two groups received xylitol solutions (8.26% and 16.52% respectively) using the same osmolarities, which were equivalent to those of the glycerol treatments. The control group was treated with purified water. Transepidermal water loss (TEWL) and skin hydration were determined. Microcirculatory parameters of inflammation were observed by means of intravital videomicroscopy (IVM). Furthermore, accumulation of neutrophil granulocytes and lymphocytes, the expression of inflammatory cytokines and SLS penetration were assessed, as well. Treatment with the 10% of glycerol and both concentrations of xylitol inhibited the SLS-induced elevation of TEWL and moderated the irritant-induced increase in dermal blood flow and in the number of leucocyte-endothelial interactions. All concentrations of the applied polyols improved hydration and prevented the accumulation of lymphocytes near the treatment site. At the mRNA level, neither glycerol nor xylitol influenced the expression of interleukin-1 alpha. However, expression of interleukin-1 beta was significantly decreased by the 10% glycerol treatment, while expression of tumour necrosis factor-alpha decreased upon the same treatment, as well as in response to xylitol. Higher polyol treatments decreased the SLS penetration to the deeper layers of the stratum corneum. Both of the analysed polyols exert considerable anti-irritant and anti-inflammatory properties, but the effective concentration of xylitol is lower than that of
International Nuclear Information System (INIS)
Nelson, Gail M.; Ahlborn, Gene J.; Delker, Don A.; Kitchin, Kirk T.; O'Brien, Thomas G.; Chen Yan; Kohan, Michael J.; Roop, Barbara C.; Ward, William O.; Allen, James W.
2007-01-01
Chronic arsenic exposure in humans is associated with cancers of the skin, lung, bladder and other tissues. There is evidence that folate deficiency may increase susceptibility to arsenic effects, including skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm sodium arsenite for 5 months. In the current study, K6/ODC mice maintained on either a folate deficient or folate sufficient diet were exposed to 0, 1, or 10 ppm sodium arsenite in the drinking water for 30 days. Total RNA was isolated from skin samples and gene expression analyzed using Affymetrix Mouse 430 2.0 GeneChips. Data from 24 samples, with 4 mice in each of the 6 treatment groups, were RMA normalized and analyzed by two-way ANOVA using GeneSpring TM . Top gene ontology (GO) categories for genes responding significantly to both arsenic treatment and folate deficiency include nucleotide metabolism and cell organization and biogenesis. For many of these genes, folate deficiency magnifies the response to arsenic treatment. In particular, expression of markers of epidermal differentiation, e.g., loricrin, small proline rich proteins and involucrin, was significantly reduced by arsenic in the folate sufficient animals, and reduced further or at a lower arsenic dose in the folate deficient animals. In addition, expression of a number of epidermal cell growth/proliferation genes and cellular movement genes was altered. These results indicate that arsenic disrupts the normal balance of cell proliferation and differentiation, and that folate deficiency exacerbates these effects, consistent with the view that folate deficiency is a nutritional susceptibility factor for arsenic-induced skin tumorigenesis
Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate
de Jongh, Cindy M.; Verberk, Maarten M.; Withagen, Carien E. T.; Jacobs, John J. L.; Rustemeyer, Thomas; Kezic, Sanja
2006-01-01
Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels
The organization of human epidermis: functional epidermal units and phi proportionality.
Hoath, Steven B; Leahy, D G
2003-12-01
The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.
Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine
2018-01-01
The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Possible role of epidermal keratinocytes in the construction of acupuncture meridians.
Denda, Mitsuhiro; Tsutsumi, Moe
2014-04-01
Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.
Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes
International Nuclear Information System (INIS)
Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.
2008-01-01
Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated
Cumulative irritation potential of topical retinoid formulations.
Leyden, James J; Grossman, Rachel; Nighland, Marge
2008-08-01
Localized irritation can limit treatment success with topical retinoids such as tretinoin and adapalene. The factors that influence irritant reactions have been shown to include individual skin sensitivity, the particular retinoid and concentration used, and the vehicle formulation. To compare the cutaneous tolerability of tretinoin 0.04% microsphere gel (TMG) with that of adapalene 0.3% gel and a standard tretinoin 0.025% cream. The results of 2 randomized, investigator-blinded studies of 2 to 3 weeks' duration, which utilized a split-face method to compare cumulative irritation scores induced by topical retinoids in subjects with healthy skin, were combined. Study 1 compared TMG 0.04% with adapalene 0.3% gel over 2 weeks, while study 2 compared TMG 0.04% with tretinoin 0.025% cream over 3 weeks. In study 1, TMG 0.04% was associated with significantly lower cumulative scores for erythema, dryness, and burning/stinging than adapalene 0.3% gel. However, in study 2, there were no significant differences in cumulative irritation scores between TMG 0.04% and tretinoin 0.025% cream. Measurements of erythema by a chromameter showed no significant differences between the test formulations in either study. Cutaneous tolerance of TMG 0.04% on the face was superior to that of adapalene 0.3% gel and similar to that of a standard tretinoin cream containing a lower concentration of the drug (0.025%).
Dautzenberg, K H W; Polderman, F N; van Suylen, R J; Moviat, M A M
2017-05-01
Both purpura fulminans and toxic epidermal necrolysis (TEN) are rare and life-threatening disorders with a high mortality. We present a case of suspected rapidly progressive, severe pneumococcal sepsis-induced purpura fulminans complicated by multiple organ failure, severe epidermolysis and cutaneous necrosis. We show the diagnostic challenge to differentiate between purpura fulminans and TEN, as the extensive epidermolysis in purpura fulminans may mimic TEN and we highlight the additional value of repeated skin biopsies and 16S rRNA gene sequencing.
Long, Yong; Li, Qing; Zhou, Bolan; Song, Guili; Li, Tao; Cui, Zongbin
2013-01-01
Fish skin serves as the first line of defense against a wide variety of chemical, physical and biological stressors. Secretion of mucus is among the most prominent characteristics of fish skin and numerous innate immune factors have been identified in the epidermal mucus. However, molecular mechanisms underlying the mucus secretion and immune activities of fish skin remain largely unclear due to the lack of genomic and transcriptomic data for most economically important fish species. In this study, we characterized the skin transcriptome of mud loach using Illumia paired-end sequencing. A total of 40364 unigenes were assembled from 86.6 million (3.07 gigabases) filtered reads. The mean length, N50 size and maximum length of assembled transcripts were 387, 611 and 8670 bp, respectively. A total of 17336 (43.76%) unigenes were annotated by blast searches against the NCBI non-redundant protein database. Gene ontology mapping assigned a total of 108513 GO terms to 15369 (38.08%) unigenes. KEGG orthology mapping annotated 9337 (23.23%) unigenes. Among the identified KO categories, immune system is the largest category that contains various components of multiple immune pathways such as chemokine signaling, leukocyte transendothelial migration and T cell receptor signaling, suggesting the complexity of immune mechanisms in fish skin. As for mucin biosynthesis, 37 unigenes were mapped to 7 enzymes of the mucin type O-glycan biosynthesis pathway and 8 members of the polypeptide N-acetylgalactosaminyltransferase family were identified. Additionally, 38 unigenes were mapped to 23 factors of the SNARE interactions in vesicular transport pathway, indicating that the activity of this pathway is required for the processes of epidermal mucus storage and release. Moreover, 1754 simple sequence repeats (SSRs) were detected in 1564 unigenes and dinucleotide repeats represented the most abundant type. These findings have laid the foundation for further understanding the secretary
Benny, Paula; Badowski, Cedric; Lane, E Birgitte; Raghunath, Michael
2015-01-01
Skin is one of the most accessible tissues for experimental biomedical sciences, and cultured skin cells represent one of the longest-running clinical applications of stem cell therapy. However, culture-generated skin mimetic multicellular structures are still limited in their application by the time taken to develop these constructs in vitro and by their incomplete differentiation. The development of a functional dermal-epidermal junction (DEJ) is one of the most sought after aspects of cultured skin, and one of the hardest to recreate in vitro. At the DEJ, dermal fibroblasts and epidermal keratinocytes interact to form an interlinked basement membrane of extracellular matrix (ECM), which forms as a concerted action of both keratinocytes and fibroblasts. Successful formation of this basement membrane is essential for take and stability of cultured skin autografts. We studied interactive matrix production by monocultures and cocultures of primary human keratinocytes and fibroblasts in an attempt to improve the efficiency of basement membrane production in culture using mixed macromolecular crowding (mMMC); resulting ECM were enriched with the deposition of collagens I, IV, fibronectin, and laminin 332 (laminin 5) and also in collagen VII, the anchoring fibril component. Our in vitro data point to fibroblasts, rather than keratinocytes, as the major cellular contributors of the DEJ. Not only did we find more collagen VII production and deposition by fibroblasts in comparison to keratinocytes, but also observed that decellularized fibroblast ECM stimulated the production and deposition of collagen VII by keratinocytes, over and above that of keratinocyte monocultures. In confrontation cultures, keratinocytes and fibroblasts showed spontaneous segregation and demarcation of cell boundaries by DEJ protein deposition. Finally, mMMC was used in a classical organotypic coculture protocol with keratinocytes seeded over fibroblast-containing collagen gels. Applied during
Rufini, Sara; Ciccacci, Cinzia; Politi, Cristina; Giardina, Emiliano; Novelli, Giuseppe; Borgiani, Paola
2015-11-01
Stevens-Johnson syndrome and toxic epidermal necrolysis are severe, life-threatening drug reactions involving skin and membranes mucous, which are associated with significant morbidity and mortality and triggered, especially by drug exposure. Different studies have demonstrated that drug response is a multifactorial character and that the interindividual variability in this response depends on both environmental and genetic factors. The last ones have a relevant significance. In fact, the identification of new specific genetic markers involved in the response to drugs, will be of great utility to establish a more personalized therapeutic approach and to prevent the appearance of these adverse reactions. In this review, we summarize recent progresses in the Pharmacogenetics studies related to Stevens-Johnson syndrome/toxic epidermal necrolysis reporting the major genetic factors identified in the last years as associated with the disease and highlighting the use of some of these genomic variants in the clinical practice.
Epidermal CYP2 family cytochromes P450
International Nuclear Information System (INIS)
Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.
2004-01-01
Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2001-01-01
...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Directory of Open Access Journals (Sweden)
Parate Sanjay N
1998-01-01
Full Text Available A total 120 cases of epidermal appendage tumours of skin were analysed and classified according to the classification provided by WHOâ€. Epidermal appendage tumours accounted for 12.87% of all skin tumours, of which 29.17% were benign and 70.83% were malignant. Most of the tumours (75.83% were in the head and face region. The most common tumour was basal cell epithelioma (55%.
The hairless guinea-pig as a model for treatment of cumulative irritation in humans
DEFF Research Database (Denmark)
Andersen, F; Hedegaard, K; Petersen, Thomas Kongsted
2006-01-01
dermatitis was induced with 10 min daily exposure for 5+4 days (no irritation on weekends) to 3% SLS aq. on the right and 30% nonanoic acid (NON) in n-propanol on the left volar forearm. Clinical scoring was performed daily; evaporimetry (total epidermal water loss (TEWL)), hydration and colorimetry were...
Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis
Directory of Open Access Journals (Sweden)
Kazuhiko Arima
2015-01-01
Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2003-01-01
...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Directory of Open Access Journals (Sweden)
Yong Long
Full Text Available Fish skin serves as the first line of defense against a wide variety of chemical, physical and biological stressors. Secretion of mucus is among the most prominent characteristics of fish skin and numerous innate immune factors have been identified in the epidermal mucus. However, molecular mechanisms underlying the mucus secretion and immune activities of fish skin remain largely unclear due to the lack of genomic and transcriptomic data for most economically important fish species. In this study, we characterized the skin transcriptome of mud loach using Illumia paired-end sequencing. A total of 40364 unigenes were assembled from 86.6 million (3.07 gigabases filtered reads. The mean length, N50 size and maximum length of assembled transcripts were 387, 611 and 8670 bp, respectively. A total of 17336 (43.76% unigenes were annotated by blast searches against the NCBI non-redundant protein database. Gene ontology mapping assigned a total of 108513 GO terms to 15369 (38.08% unigenes. KEGG orthology mapping annotated 9337 (23.23% unigenes. Among the identified KO categories, immune system is the largest category that contains various components of multiple immune pathways such as chemokine signaling, leukocyte transendothelial migration and T cell receptor signaling, suggesting the complexity of immune mechanisms in fish skin. As for mucin biosynthesis, 37 unigenes were mapped to 7 enzymes of the mucin type O-glycan biosynthesis pathway and 8 members of the polypeptide N-acetylgalactosaminyltransferase family were identified. Additionally, 38 unigenes were mapped to 23 factors of the SNARE interactions in vesicular transport pathway, indicating that the activity of this pathway is required for the processes of epidermal mucus storage and release. Moreover, 1754 simple sequence repeats (SSRs were detected in 1564 unigenes and dinucleotide repeats represented the most abundant type. These findings have laid the foundation for further understanding
New bioprinted skin, cosmetic in vitro model.
Cadau, Sebastien; Rival, Delphine; Andre-Frei, Valerie; Chavan M, Manasi; Fayol, Delphine; Salducci, Marine; Brisson, Bruno; Guillemot, Fabien
We developed a new evolution of three-dimensional skin equivalent due to the optimization of four-dimensional laser-assisted bioprinting and skin equivalent culture protocols. This allowed us to produce fully bioprinted skin equivalents that are closed to current skin equivalents and suitable to test cosmetic ingredients. Particularly, we performed preliminary evaluation of maturogens to improve the dermis maturation before the epidermal seeding and we designed a specific "micropattern" to reproduce the nonlinear aspect of the dermal-epidermal junction. Finally an active ingredient was applied during the production of the bioprinted skin equivalent.
Histological distinction between early allergic and irritant patch test reactions
DEFF Research Database (Denmark)
Vestergaard, L; Clemmensen, Ole; Sørensen, Flemming Brandt
1999-01-01
no recognizable changes except a slight follicular spongiosis in 1 patient. The 2 pathologists agreed independently on the correct classification in 6 out of 7 cases (p=0.0156). We tested an optimized model, selecting non-irritant allergens and a well-known irritant. Further investigations are needed to elucidate......Comparative light microscopic studies have revealed subtle differences between allergic and irritant reactions in the skin. In the search for specific differences, we focussed on the early inflammatory response. This pilot study was conducted to test the hypothesis that follicular spongiosis can...... differentiate between early allergic and irritant patch test reactions. 8 patients with known contact allergy to either colophony or quarternium-15 participated in the study. In each patient, allergic and irritant patch tests reactions were elicited, and 4-mm punch biopsies were taken after 6 8 h from...
Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age
Directory of Open Access Journals (Sweden)
Zobiri O
2012-02-01
Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test
Toxic epidermal necrolysis and Stevens-Johnson syndrome
Directory of Open Access Journals (Sweden)
French Lars E
2010-12-01
Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis
Culture technique of rabbit primary epidermal keratinocytes
Directory of Open Access Journals (Sweden)
Marini M
2012-10-01
Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.
Occupational allergic and irritant contact dermatitis in workers exposed to polyurethane foam
Directory of Open Access Journals (Sweden)
Marta Kieć-Świerczyńska
2014-04-01
Full Text Available Objectives: To evaluate sensitization to chemicals present in work environment after an outbreak of contact dermatitis in workers of vehicle equipment factory, exposed to polyurethane foam, based on 4,4'-diphenylmethane diisocyanate (MDI. Material and Methods: From among 300 employees, 21 individuals reporting work-related skin and/or respiratory tract symptoms underwent clinical examination, patch testing, skin prick tests, spirometry and MDI sIgE measurement in serum. Patch tests included isocyanates series, selected rubber additives, metals, fragrances, preservatives, and an antiadhesive agent. Results: Clinical examination revealed current eczema in the area of hands and/or forearms in 10 workers. Positive patch test reactions were found in 10 individuals, the most frequent to diaminodiphenylmethane and 4-phenylenediamine (7 persons. Reactions to an antiadhesive agent were assessed as irritant (5 workers. Except for sensitization to common aeroallergens, no significant abnormalities were found in the remaining tests. Occupational allergic contact dermatitis was diagnosed in 7 workers, irritant contact dermatitis in 10 and coexisiting allergic and irritant contact dermatitis in 3 workers. Conclusions: In workers manufacturing products from polyurethane foam, attention should be paid to the risk of developing contact dermatitis. Skin problems in our study group were attributable probably to insufficient protection of the skin.
Skin protection creams in medical settings: successful or evil?
Directory of Open Access Journals (Sweden)
Charlier Corinne
2008-07-01
Full Text Available Abstract Background Chronic exposure to mild irritants including cleansing and antiseptic products used for hand hygiene generates insults to the skin. To avoid unpleasant reactions, skin protection creams are commonly employed, but some fail to afford protection against a variety of xenobiotics. In this study, two skin protection creams were assayed comparatively looking for a protective effect if any against a liquid soap and an alcohol-based gel designed for hand hygiene in medical settings. Methods Corneosurfametry and corneoxenometry are two in vitro bioessays which were selected for their good reproducibility, sensitivity and ease of use. A Kruskal-Wallis ANOVA test followed by the Dunn test was realized to compare series of data obtained. Results Significant differences in efficacy were obtained between the two assayed skin protection creams. One of the two tested creams showed a real protective effect against mild irritants, but the other tested cream presented an irritant potential in its application with mild irritants. Conclusion The differences observed for the two tested skin protection creams were probably due to their galenic composition and their possible interactions with the offending products. As a result, the present in vitro bioassays showed contrasted effects of the creams corresponding to either a protective or an irritant effect on human stratum corneum.
Leptin promotes wound healing in the skin.
Directory of Open Access Journals (Sweden)
Susumu Tadokoro
Full Text Available Leptin, a 16 kDa anti-obesity hormone, exhibits various physiological properties. Interestingly, skin wound healing was proven to delay in leptin-deficient ob/ob mice. However, little is known on the mechanisms of this phenomenon. In this study, we attempted to elucidate a role of leptin in wound healing of skin.Immunohistochemical analysis was performed to confirm the expression of the leptin receptor (Ob-R in human and mouse skin. Leptin was topically administered to chemical wounds created in mouse back skin along with sustained-release absorbable hydrogel. The process of wound repair was histologically observed and the area of ulceration was measured over time. The effect of leptin on the proliferation, differentiation and migration of human epidermal keratinocytes was investigated.Ob-R was expressed in epidermal cells of human and mouse skin. Topical administration of leptin significantly promoted wound healing. Histological analysis showed more blood vessels in the dermal connective tissues in the leptin-treated group. The proliferation, differentiation/function and migration of human epidermal keratinocytes were enhanced by exogenous leptin.Topically administered leptin was proven to promote wound healing in the skin by accelerating proliferation, differentiation/function and migration of epidermal keratinocytes and enhancing angiogenesis around the wounded area. These results strongly suggest that topical administration of leptin may be useful as a treatment to promote wound healing in the skin.
"Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.
Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu
2015-11-04
Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
HYGIENIC CARE OF CHILDREN’S SKIN
Directory of Open Access Journals (Sweden)
R. Adam
2010-01-01
Full Text Available Children’s skin under nappy needs special defense from irritative action of urine and faeces and, therefore, prophylaxis of nappy dermatitis is necessary. It means that disposable nappy absorbing faeces and urine and special staff for skin cleaning should be used. There are several factors conductive to dermatitis: prolonged irritation with excrements, change of skin pH or increase of its hydratation and disorders of skin micro flora. During last decades there is a significant progress in understanding of these factors, and it resulted in production of more and more perfect stuff for defense of children’s skin. Improved design of nappies and development of pH-buffer wipes for babies increased the quality of skin care. Key words: children, skin, hygienic care.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(5:90-94
DEFF Research Database (Denmark)
Griffiths, C E; Dabelsteen, Erik; Voorhees, J J
1996-01-01
Topical all-trans retinoic acid (RA) produces a number of epidermal changes which are indistinguishable from those observed following treatment with a local irritant, namely sodium lauryl sulphate (SLS). This observation has led to criticism that the efficacy of RA in disorders such as photoageing...
Löffler, H; Happle, R
2003-01-01
The cutaneous reaction to detergents follows distinct kinetic rules: the duration of application and the irritant concentration are of major importance. The aim of this study was to evaluate the differences in kinetics of skin reaction between the standard irritant sodium lauryl sulfate (SLS), and 2 modern detergents: sodium laureth sulfate (SLES) and alkyl polyglucoside (APG). We performed patch testing with SLS and SLES (or APG) at different concentrations (0.125, 0.25, 0.5, 1.0 and 2.0%) and with different exposure times (6, 12 and 24 h). Evaluation was conducted by measurement of transepidermal water loss (TEWL) and laser Doppler flowmetry (LD) 24 h, 7 and 10 days after patch removal. We found a pronounced reaction to SLS, and a far milder one to SLES. Even at the highest concentration the skin reaction to APG was hard to detect. During the regeneration period (day 3-10) SLS showed even at day 10 an increased TEWL at all concentrations tested. The irritation due to SLES was convincingly detectable only up to day 7, whereas the APG-tested skin areas showed no significant reaction even at day 3. These results demonstrate the improvement in reduction of skin irritation achieved by development of novel detergents.
Immunohistochemical distribution of Ki67 in epidermis of thick glabrous skin of human digits.
Petrovic, Aleksandar; Petrovic, Vladimir; Milojkovic, Bobana; Nikolic, Ivan; Jovanovic, Dragan; Antovic, Aleksandra; Milic, Miroslav
2018-01-01
The glabrous skin on the flexor sides of hands and feet, compared to other integument regions, has thicker epidermis and more complex pattern of epidermal ridges, wherefore in microscopy is denominated as thick skin. The epidermis of this skin type has individually unique and permanent superficial patterns, called dermatoglyphics, which are maintained by regenerative potential of deep epidermal rete ridges, that interdigitate with adjacent dermis. Using light microscopy, we analyzed cadaveric big toes thick skin samples, described histology of deep epidermal ridges (intermediate, limiting, and transverse), and quantitatively evidenced their pattern of proliferation by immunohistochemical assessment of Ki67. Immunohistochemical distribution of Ki67 was confined to basal and suprabasal layers, with pattern of distribution specific for intermediate, limiting and transverse ridges that gradually transform within epidermal height. Deep epidermal ridges, interdigitating with dermal papillae, participate in construction of intricate epidermal base, whose possible role in epidermal regeneration was also discussed. Having a prominent morphology, this type of epidermis offers the best morphological insight in complexities of skin organization, and its understanding could challenge and improve currently accepted models of epidermal organization.
DEFF Research Database (Denmark)
Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar
2014-01-01
The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...
Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P
2017-06-01
Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.
Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra
2015-09-01
Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.
Directory of Open Access Journals (Sweden)
Roberto Gomes da Silva
2001-12-01
Full Text Available A transmissão de radiação ultravioleta de comprimentos de onda entre 250 e 360 nm através do pelame e da epiderme de bovinos foi determinada em laboratório, usando-se amostras de couro de animais recém-abatidos. A quantidade de radiação transmitida através do pelame depende da coloração e também das características estruturais do pelame (espessura da capa; comprimento, diâmetro, número e inclinação dos pêlos, pelas quais é definido o trajeto médio de um fóton pela massa de pêlos (L. A maior transmissão é proporcionada por pelames brancos com altos valores de L, ao passo que pelames negros em geral apresentam transmissão nula ou muito baixa. Quanto menos pigmentada a epiderme, maior a transmissão de radiação através da sua superfície. A melhor proteção é proporcionada por pelames negros com baixo valor de L sobre epiderme igualmente negra, mas em vista do aquecimento causado pela absorção de radiação térmica (em vacas Holandesas a temperatura das malhas negras atinge 44,1ºC ao mesmo tempo em que a das malhas brancas é 37,7ºC, a combinação ideal para ambientes tropicais é um pelame branco com baixo valor de L sobre epiderme negra, uma combinação dificilmente encontrada em animais de raças européias. Uma alternativa seria um pelame negro com um baixo valor de L. Animais vermelhos apresentam alta transmissão de radiação UV através da epiderme e do pelame, sendo desaconselhados para ambientes tropicais. Entretanto, foi observada uma vaca Holandesa com áreas isoladas de epiderme negra coberta com pelame branco, o que pode trazer perspectivas para uma seleção para combinações mais adequadas de epiderme e pelame em bovinos de raças européias.A laboratory study was carried on the transmission of ultraviolet radiation (UV, 250 to 360 nm wavelength through the haircoat and the skin of cattle. Fresh samples of skin were measured under a solar simulator, taking account of the pigmentation of hair and
Histological distinction between early allergic and irritant patch test reactions
DEFF Research Database (Denmark)
Vestergaard, L; Clemmensen, Ole; Sørensen, Flemming Brandt
1999-01-01
Comparative light microscopic studies have revealed subtle differences between allergic and irritant reactions in the skin. In the search for specific differences, we focussed on the early inflammatory response. This pilot study was conducted to test the hypothesis that follicular spongiosis can...... differentiate between early allergic and irritant patch test reactions. 8 patients with known contact allergy to either colophony or quarternium-15 participated in the study. In each patient, allergic and irritant patch tests reactions were elicited, and 4-mm punch biopsies were taken after 6 8 h from...... clinically equipotent reactions. Paired sets of slides were assessed blindly by 2 pathologists. 1 patient showing a pityrosporum folliculitis was excluded from the study. All biopsies from allergic patch tests were characterized by follicular spongiosis, while biopsies from irritant patch tests showed...
Liquid Crystal Gel Reduces Age Spots by Promoting Skin Turnover
Directory of Open Access Journals (Sweden)
Mina Musashi
2014-07-01
Full Text Available Studies have shown that liquid crystals structurally resembling the intercellular lipids in the stratum corneum can beneficially affect the skin when applied topically by stimulating the skin’s natural regenerative functions and accelerating epidermal turnover. In the present study, the effects of applying low concentrations of a liquid crystal gel of our own creation were evaluated using epidermal thickening in mouse skin as an assay for effective stimulation of epidermal turnover. A liquid crystal gel was also applied topically to human facial skin, and analysis was conducted using before-and-after photographs of age spots, measurements of L* values that reflect degree of skin pigmentation, single-layer samples of the stratum corneum obtained via tape-stripping, and measurements of trans-epidermal water loss that reflect the status of the skin’s barrier function. The results suggested that cost-effective creams containing as low as 5% liquid crystal gel might be effective and safely sold as skin care products targeting age spots and other problems relating to uneven skin pigmentation.
Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...
African Journals Online (AJOL)
REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.
Noninvasive evaluation of the barrier properties of the skin
Directory of Open Access Journals (Sweden)
Utz S.R.
2014-09-01
Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.
Energy Technology Data Exchange (ETDEWEB)
Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)
2017-02-01
Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.
The determination of the irritancy potential of surfactants using various methods of assessment.
Ciuchta, H P; Dodd, K T
1978-01-01
Several animal irritancy test methods whose criteria include sensory response, pain/discomfort or tissue damage were evaluated as to their ability to assess relative irritancy potential of the following surfactants: sodium lauryl polyether (12) sulfate (SLES), Miranol C2M (MC2M), Miranol MHT (MMHT), sodium coco methyl tauride (SCMT), triethanolamine lauryl sulfate (TEALS), ammonium lauryl sulfate (ALS) and sodium lauryl sulfate (SLS). Data from the mouse upper respiratory tract and mouse writhing tests indicated that SLES, MC2M and MMHT were the least irritating and SLS, ALS and TEALS were the most irritating. The blepharospasm test did not lend itself to this type of evaluation because sequential instillation of the surfactants produced eye anesthesia. Data from the Draize eye test indicated that SLES was the least irritating while MC2M was slightly more irritating. All other surfactants were equally irritating. The Draize skin test results showed that SLES again was the least irritating at all concentrations tested and that SLS and ALS along with TEALS and SCMT were the most irritating.
Genetic reversion of inherited skin disorders
Energy Technology Data Exchange (ETDEWEB)
Magnaldo, Thierry; Sarasin, Alain
2002-11-30
Human epidermis is a squamous stratified epithelium whose integrity relies on balanced processes of cell attachment, proliferation, and differentiation. In monogenic skin dermatoses, such as mecano-bullous diseases, or DNA repair deficiencies such as the xeroderma pigmentosum (XP), alterations of skin integrity may have devastating consequences as illustrated by the extremely high epidermal cancer proneness of XP patients. The lack of efficient pharmacological treatments, the easy accessibility of skin, and the possibility of long term culture and genetic manipulations ex vivo of epidermal keratinocytes, have encouraged approaches toward gene transfer and skin therapy prospects. We review here some of the human genetic disorders that exhibit major traits in skin, as well as requirements and difficulties inherent to approaches aimed at stable phenotypic correction.
Biochemistry of epidermal stem cells.
Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace
2013-02-01
The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Biochemistry of epidermal stem cells☆
Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace
2014-01-01
Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019
Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim
2017-07-01
The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical
Cutaneous irritancy of an ibuprofen medicated plaster in healthy volunteers.
Maganji, Manisha; Connolly, Mark P; Bhatt, Aomesh
2018-04-01
To assess the irritation and contact sensitization potential of a 200 mg ibuprofen medicated plaster. This double-blind, phase-1 placebo controlled study had two phases; the induction phase to evaluate the irritant potential of continuous application of the plaster, and the challenge phase to assess contact sensitivity (allergy). The cumulative irritancy potential was evaluated using an adaptation of the Shelanski method. Healthy adults (≥18 years of age) (N = 210) were treated simultaneously with one ibuprofen medicated and one placebo plaster applied in a randomized fashion to either the left or right side of the lower back. During the induction phase, plasters were applied on Days 1, 3, 5, 8, 10, 12, 15, 17, and 19 and the final plaster removed on Day 22. At each scheduled visit plasters and applications sites were assessed for degree of adhesion and skin irritation (score of 1 = no irritation to 7 = strong reaction spreading beyond test sites), respectively. The challenge phase followed a two-week washout period. A plaster was applied on Day 36 for 48 h and assessment occurred on Days 38, 39, and 40. The mean cumulative irritation score during the induction phase was lower for the ibuprofen medicated plaster than the placebo plaster (0.32 vs. 1.23, respectively). Three (1.4%) subjects experience a dermal reaction of grade ≥3 for the ibuprofen medicated plaster compared with 27 (12.7%) for the placebo plaster. Following challenge with ibuprofen or placebo plasters, 12 subjects (6.2%) with the ibuprofen medicated plaster and four (2.2%) with the placebo plaster had skin reaction of assessment grade higher than the induction phase. One subject for the ibuprofen and two for the placebo plaster had reactions with grade >2. No subjects showed an increase in sensitization on Day 39 or 40 compared with Day 38. The findings indicate that the both the irritancy and contact sensitization of the ibuprofen medicated plaster is acceptable.
p63 in skin development and ectodermal dysplasias
Koster, Maranke I.
2010-01-01
The transcription factor p63 is critically important for skin development and maintenance. Processes that require p63 include epidermal lineage commitment, epidermal differentiation, cell adhesion, and basement membrane formation. Not surprisingly, alterations in the p63 pathway underlie a subset of ectodermal dysplasias, developmental syndromes in which the skin and skin appendages do not develop normally. This review summarizes the current understanding of the role of p63 in normal development and ectodermal dysplasias. PMID:20445549
Could tight junctions regulate the barrier function of the aged skin?
Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš
2016-03-01
The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Black and white human skin differences
DEFF Research Database (Denmark)
Andersen, Klaus Ejner; Maibach, H I
1979-01-01
This review of black and white human skin differences emphasizes the alleged importance of factors other than the obvious, i.e., skin color. Physicochemical differences and differences in susceptibility to irritants and allergens suggest a more resistant black than white skin. Differences appear...
Getting under the skin of epidermal morphogenesis.
Fuchs, Elaine; Raghavan, Srikala
2002-03-01
At the surface of the skin, the epidermis serves as the armour for the body. Scientists are now closer than ever to understanding how the epidermis accomplishes this extraordinary feat, and is able to survive and replenish itself under the harshest conditions that face any tissue. By combining genetic engineering with cell-biological studies and with human genome data analyses, skin biologists are discovering the mechanisms that underlie the development and differentiation of the epidermis and hair follicles of the skin. This explosion of knowledge paves the way for new discoveries into the genetic bases of human skin disorders and for developing new therapeutics.
Morales-Hurtado, M; Zeng, X; Gonzalez-Rodriguez, P; Ten Elshof, J E; van der Heide, E
2015-06-01
Research on human skin interactions with healthcare and lifestyle products is a topic continuously attracting scientific studies over the past years. It is possible to evaluate skin mechanical properties based on human or animal experimentation, yet in addition to possible ethical issues, these samples are hard to obtain, expensive and give rise to highly variable results. Therefore, the design of a skin equivalent is essential. This paper describes the design and characterization of a new Epidermal Skin Equivalent (ESE). The material resembles the properties of epidermis and is a first approach to mimic the mechanical properties of the human skin structure, variable with the length scale. The ESE is based on a mixture of Polydimethyl Siloxane (PDMS) and Polyvinyl Alcohol (PVA) hydrogel cross-linked with Glutaraldehyde (GA). It was chemically characterized by XPS and FTIR measurements and its cross section was observed by macroscopy and cryoSEM. Confocal Microscope analysis on the surface of the ESE showed an arithmetic roughness (Ra) between 14-16 μm and contact angle (CA) values between 50-60°, both of which are close to the values of in vivo human skins reported in the literature. The Equilibrium Water Content (ECW) was around 33.8% and Thermo Gravimetric Analysis (TGA) confirmed the composition of the ESE samples. Moreover, the mechanical performance was determined by indentation tests and Dynamo Thermo Mechanical Analysis (DTMA) shear measurements. The indentation results were in good agreement with that of the target epidermis reported in the literature with an elastic modulus between 0.1-1.5 MPa and it showed dependency on the water content. According to the DTMA measurements, the ESE exhibits a viscoelastic behavior, with a shear modulus between 1-2.5MPa variable with temperature, frequency and the hydration of the samples. Copyright © 2015 Elsevier Ltd. All rights reserved.
Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique
2014-10-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment
Liquid Crystal Gel Reduces Age Spots by Promoting Skin Turnover
Mina Musashi; Ariella Coler-Reilly; Teruaki Nagasawa; Yoshiki Kubota; Satomi Kato; Yoko Yamaguchi
2014-01-01
Studies have shown that liquid crystals structurally resembling the intercellular lipids in the stratum corneum can beneficially affect the skin when applied topically by stimulating the skin’s natural regenerative functions and accelerating epidermal turnover. In the present study, the effects of applying low concentrations of a liquid crystal gel of our own creation were evaluated using epidermal thickening in mouse skin as an assay for effective stimulation of epidermal turnover. A liquid ...
Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing
2018-03-01
Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.
Modified methods for growing 3-D skin equivalents: an update.
Lamb, Rebecca; Ambler, Carrie A
2014-01-01
Artificial epidermis can be reconstituted in vitro by seeding primary epidermal cells (keratinocytes) onto a supportive substrate and then growing the developing skin equivalent at the air-liquid interface. In vitro skin models are widely used to study skin biology and for industrial drug and cosmetic testing. Here, we describe updated methods for growing 3-dimensional skin equivalents using de-vitalized, de-epidermalized dermis (DED) substrates including methods for DED substrate preparation, cell seeding, growth conditions, and fixation procedures.
Skin Barrier Function and Allergens
DEFF Research Database (Denmark)
Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan
2016-01-01
The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...
Occupational irritant contact dermatitis due to petroleum naphtha
Directory of Open Access Journals (Sweden)
Aslı Aytekin
2014-12-01
Full Text Available Irritant contact dermatitis (ICD is responsible for the vast majority of occupational contact dermatitis and usually seen in professional groups working with wet hand. However, today, with the increasing business lines, employees are exposed to a variety of irritants. Occupational exposure to many chemicals and toxic irritants affect not only the skin, but also the other systems. Therefore, this situation resulting with loss of work and changes in business may become a public health problem. The diagnosis of occupational contact dermatitis should not be limited only with tests for allergens, detailed history of exposure to workplace substances and careful examination of product safety forms are necessary. In addition, by establishing close relationship between occupational physicians and employers, preventive measures should be taken before similar diseases occur in other workers in the same work place. In order to highlight this issue, a 32-year-old male patient working in an invitation card fabric is presented in this case report. Irritant contact dermatitis secondary to “petroleum naphta” was present in the patient’s arms. Another important feature of this case, as far as we know, this is the first case of irritant contact dermatitis due to naphtha in the literature.
Directory of Open Access Journals (Sweden)
Sven van Eijl
Full Text Available BACKGROUND: Human skin has the capacity to metabolise foreign chemicals (xenobiotics, but knowledge of the various enzymes involved is incomplete. A broad-based unbiased proteomics approach was used to describe the profile of xenobiotic metabolising enzymes present in human skin and hence indicate principal routes of metabolism of xenobiotic compounds. Several in vitro models of human skin have been developed for the purpose of safety assessment of chemicals. The suitability of these epidermal models for studies involving biotransformation was assessed by comparing their profiles of xenobiotic metabolising enzymes with those of human skin. METHODOLOGY/PRINCIPAL FINDINGS: Label-free proteomic analysis of whole human skin (10 donors was applied and analysed using custom-built PROTSIFT software. The results showed the presence of enzymes with a capacity for the metabolism of alcohols through dehydrogenation, aldehydes through dehydrogenation and oxidation, amines through oxidation, carbonyls through reduction, epoxides and carboxylesters through hydrolysis and, of many compounds, by conjugation to glutathione. Whereas protein levels of these enzymes in skin were mostly just 4-10 fold lower than those in liver and sufficient to support metabolism, the levels of cytochrome P450 enzymes were at least 300-fold lower indicating they play no significant role. Four epidermal models of human skin had profiles very similar to one another and these overlapped substantially with that of whole skin. CONCLUSIONS/SIGNIFICANCE: The proteomics profiling approach was successful in producing a comprehensive analysis of the biotransformation characteristics of whole human skin and various in vitro skin models. The results show that skin contains a range of defined enzymes capable of metabolising different classes of chemicals. The degree of similarity of the profiles of the in vitro models indicates their suitability for epidermal toxicity testing. Overall, these
The irritant potential of n-propanol (nonanoic acid vehicle) in cumulative skin irritation
DEFF Research Database (Denmark)
Clemmensen, A; Andersen, F; Petersen, Thomas Kongsted
2008-01-01
have diverse mechanisms of action on the skin. We used sodium lauryl sulfate (SLS) and nonanoic acid (NON) in three different concentrations plus their vehicles, water and n-propanol, respectively, to validate our test models and to optimize test concentrations. METHODS: Healthy volunteer forearm skin...
Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.
Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J
2014-01-01
Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.
Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity
International Nuclear Information System (INIS)
Lowe, N.J.; Breeding, J.
1982-01-01
Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study
Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques
2015-06-01
Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.
Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice
Directory of Open Access Journals (Sweden)
Azahara Rodríguez-Luna
2017-12-01
Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.
Skin Diseases: Questions for Your Health Care Provider
Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Questions for Your Health Care Provider Past ... dermatitis worse? What are the most common irritants? Skin cancer What type of skin cancer do I ...
Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar
2004-01-01
Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...
Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian
2010-08-13
Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion
DEFF Research Database (Denmark)
Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore
2009-01-01
BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...
Morales Hurtado, Marina; Peppelman, P.; Zeng, Xiangqiong; van Erp, P.E.J.; van der Heide, Emile
2016-01-01
This research aims to analyse the interaction of three artificial skin equivalents and human skin against the main material components of artificial turf. The tribological performance of Lorica, Silicone Skin L7350 and a recently developed Epidermal Skin Equivalent (ESE) were studied and compared to
An Adhesive Patch-Based Skin Biopsy Device for Molecular Diagnostics and Skin Microbiome Studies.
Yao, Zuxu; Moy, Ronald; Allen, Talisha; Jansen, Burkhard
2017-10-01
A number of diagnoses in clinical dermatology are currently histopathologically confirmed and this image recognition-based confirmation generally requires surgical biopsies. The increasing ability of molecular pathology to corroborate or correct a clinical diagnosis based on objective gene expression, mutation analysis, or molecular microbiome data is on the horizon and would be further supported by a tool or procedure to collect samples non-invasively. This study characterizes such a tool in form of a 'bladeless' adhesive patch-based skin biopsy device. The performance of this device was evaluated through a variety of complementary technologies including assessment of sample biomass, electron microscopy demonstrating the harvesting of layers of epidermal tissue, and isolation of RNA and DNA from epidermal skin samples. Samples were obtained by application of adhesive patches to the anatomical area of interest. Biomass assessment demonstrated collection of approximately 0.3mg of skin tissue per adhesive patch and electron microscopy confirmed the nature of the harvested epidermal skin tissue. The obtained tissue samples are stored in a stable fashion on adhesive patches over a wide range of temperatures (-80oC to +60oC) and for extended periods of time (7 days or more). Total human RNA, human genomic DNA and microbiome DNA yields were 23.35 + 15.75ng, 27.72 + 20.71ng and 576.2 + 376.8pg, respectively, in skin samples obtained from combining 4 full patches collected non-invasively from the forehead of healthy volunteers. The adhesive patch skin sampling procedure is well tolerated and provides robust means to obtain skin tissue, RNA, DNA, and microbiome samples without involving surgical biopsies. The non-invasively obtained skin samples can be shipped cost effectively at ambient temperature by mail or standard courier service, and are suitable for a variety of molecular analyses of the skin microbiome as well as of keratinocytes, T cells, dendritic cells
Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.
1988-01-01
In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure
The Significance of Epidermal Lipid Metabolism in Whole-Body Physiology
DEFF Research Database (Denmark)
Kruse, Vibeke; Neess, Ditte; Færgeman, Nils J
2017-01-01
The skin is the largest sensory organ of the human body. The skin not only prevents loss of water and other components of the body, but also is involved in regulation of body temperature and serves as an essential barrier, protecting mammals from both routine and extreme environments. Given...... the importance of the skin in temperature regulation, it is surprising that adaptive alterations in skin functions and morphology only vaguely have been associated with systemic physiological responses. Despite that impaired lipid metabolism in the skin often impairs the epidermal permeability barrier...... and insulation properties of the skin, its role in regulating systemic physiology and metabolism is yet to be recognized....
Ectodermal dysplasia-skin fragility syndrome
Directory of Open Access Journals (Sweden)
Vijay S Adhe
2011-01-01
Full Text Available Ectodermal dysplasia-skin fragility (EDSF syndrome is a rare and first described inherited disorder of desmosomes. It occurs due to loss-of-function mutations in PKP1 gene resulting in poorly formed desmosomes and loss of desmosomal and epidermal integrity. We report a case of a 2-year-old Indian male child who presented with palmoplantar hyperkeratosis with fissuring, short, sparse, and easily pluckable scalp hair, nail dystrophy, and multiple erosions over the skin. Skin biopsy showed epidermal hyperplasia with widening of intercellular spaces. His developmental milestones were delayed but intelligence was normal. Echocardiography, X-ray chest, and electrocardiogram were normal. Very few cases of this syndrome have been reported in the literature. We consider this as the first case report from India.
Tight junction regulates epidermal calcium ion gradient and differentiation
International Nuclear Information System (INIS)
Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki
2011-01-01
Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.
Evaluation of the ophthalmic and dermal irritability of the OLEOMASAJE formulation
Directory of Open Access Journals (Sweden)
Maritza F. Díaz
2015-08-01
Full Text Available Context: Ozonized vegetable oils present germicidal effects which can be used as active principle in different cosmetological compositions. The thematic about of the corporal massage advantage have been very treatment by aesthetics, dermatologic and consumers. OLEOMASAJE formulation content ozonized sunflower oil OLEOZON as active principle active which present moisturizer and conditioner effects. Aims: To determine the possible dermal and ophthalmic irritability effects of the OLEOMASAJE. Methods: The trial was conducted in rabbits and the techniques described in the standardized procedures of the work established by the Center of Biological Research and Evaluations from Pharmacy and Food Institute of Havana University were used according to Norma ISO 10993-10. The ethical principles of the Good Practices of Laboratory were fulfilled to avoid suffering to the animals during the experimentation. Male rabbits with body weight between 2.05 and 2.48 kg were used. In the skin and the ocular structures the effects were observed immediately after of the application at 1, 24, 48 and 72 hours. Draize´s scale was applied to evaluate skin and ocular structures lesions. Results: The OLEOMASAJE formulation does not irritate de skin of the assayed rabbits. However, the ocular structures irritability index was of 4.5 after of first hour to apply of product. These wounds were missing before of 24 hours to apply of product. Conclusions: The OLEOMASAJE formulation obeys the indispensable requirements for the acceptance as cosmetic product and for it is used in corporal massage.
Johnson, Victor J; Auerbach, Scott S; Luster, Michael I; Waidyanatha, Suramya; Masten, Scott A; Wolfe, Mary S; Burleson, Florence G; Burleson, Gary R; Germolec, Dori R
2017-07-01
4-Methylcyclohexanemethanol (MCHM) is a flotation reagent used in fine coal beneficiation. On January 9, 2014, crude MCHM, a mixture containing predominantly MCHM, was inadvertently released into the Elk River, a municipal water source that serves about 300,000 people in the Charleston, WV area, resulting in temporary contamination of 15 percent of the state's tap water and causing significant dermal exposure. The current studies were undertaken to determine whether crude MCHM or MCHM has the potential to produce dermal irritancy and/or sensitization. BALB/c female mice were treated daily for 3 consecutive days by direct epicutaneous application of 25 μL of various concentrations of crude MCHM or MCHM to the dorsum of each ear. A mouse ear-swelling test was used to determine irritancy potential and was undertaken in combination with the standardized Local Lymph Node Assay (LLNA) to determine skin sensitizing potential. MCHM was found to produce skin irritation at concentrations above 20% and did not produce sensitization. Crude MCHM also produced irritation, although weaker, and in addition was found to be a weak to moderate skin sensitizer. The results are discussed in terms of potential human health hazard. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kano, Satoshi; 藤堂, 浩明; 杉江, 謙一; 藤本, 英哲; 中田, 圭一; 徳留, 嘉寛; 橋本, フミ惠; 杉林, 堅次
2010-01-01
Two reconstructed human skin models, EpiskinSM and EpiDermTM, have been approved as alternative membranes for skin corrosive/irritation experiments due to their close correlation with animal skin. Such reconstructed human skin models were evaluated as alternative membranes for skin permeation experiments. Seven drugs with different lipophilicities and almost the same molecular weight were used as test penetrants. Relationships were investigated between permeability coefficients (P values) of ...
Anti-irritants II: Efficacy against cumulative irritation
DEFF Research Database (Denmark)
Andersen, Flemming; Hedegaard, Kathryn; Petersen, Thomas Kongstad
2006-01-01
window of opportunity in which to demonstrate efficacy. Therefore, the effect of AI was studied in a cumulative irritation model by inducing irritant dermatitis with 10 min daily exposures for 5+4 days (no irritation on weekend) to 1% sodium lauryl sulfate on the right and 20% nonanoic acid on the left...
Skin protection in nursing work : promoting the use of gloves and hand alcohol
Jungbauer, FHW; van der Harst, J.J.; Groothoff, J.W.; Coenraads, PJ
Nursing has been identified as a wet-work occupation, with a high prevalence of occupational irritant contact dermatitis. Reduction of exposure to skin irritants contributes to the prevention of occupational skin disease in nurses. The role of the use of soap and water, hand alcohol and gloves in
International Nuclear Information System (INIS)
Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook
2010-01-01
Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.
Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.
2015-01-01
Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis
Evolution of dinosaur epidermal structures.
Barrett, Paul M; Evans, David C; Campione, Nicolás E
2015-06-01
Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Zhai, H; Willard, P; Maibach, H I
1998-03-01
2 acute irritants and 1 allergen were selected: sodium lauryl sulfate (SLS) representative of irritant household and occupational contact dermatitis, the combination of ammonium hydroxide (NH4OH) and urea to simulate diaper dermatitis, and Rhus to evaluate the effect of model protective materials. The putative protective materials and vehicle were applied to both ventral forearms of 10 subjects in each group, according to a randomized code. Test materials were spread over a marked 2.0 cm2 area, massaged in, allowed to dry for 30 min, and reapplied with another 30 min drying period. The model irritants and allergen were then applied (0.025 ml) to an Al-test occlusive patch, which in turn was placed for 24 h over each of the 8 designated sites. Inflammation was scored according to a clinical scale 72 h post-application. Paraffin wax plus Acetulan in cetyl alcohol, and beeswax plus Acetulan in cetyl alcohol, markedly (p < 0.001) suppressed SLS irritation. Paraffin wax plus beeswax in cetyl alcohol, and Acetulan in cetyl alcohol reduced NH4OH and urea irritation (p < 0.05), paraffin wax in cetyl alcohol significantly (p < 0.01) decreasing Rhus allergic contact dermatitis. This model, provides an easy approach to screening protectants. Its clinical significance requires comparison with an open rather than an occluded challenge.
Anti-irritants I: Dose-response in acute irritation
DEFF Research Database (Denmark)
Andersen, Flemming; Hedegaard, Kathryn; Petersen, Thomas Kongstad
2006-01-01
acute irritation in healthy volunteers. Each AI was used in 3 concentrations. Acute irritation was induced by occlusive tests with 1% sodium lauryl sulfate and 20% nonanoic acid in N-propanol. The irritant reactions were treated twice daily with AI-containing formulations from the time of removal...
Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.
Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De
2016-10-01
In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.
Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk
2010-02-01
Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.
Lee, Haerin; Park, Juhyun; Kim, Yeu-Chun
2018-02-01
Transdermal drug delivery is advantageous over other conventional drug administration routes. However, it can be inefficient because of the natural barrier of the stratum corneum which is the uppermost layer of the skin. A previous study verified that the treatment of magainin pore-forming peptide with N-lauroylsarcosine (NLS) on human skin can increase skin permeability by 47-fold. However, NLS is well known as a potential skin irritant. The irritation potential of NLS is known to decrease when mixed with sorbitan monolaurate (S20). Encouraged by these results, we combined S20 with magainin-NLS to enhance transdermal drug transport with less skin irritation. In this study, nine groups with magainin and NLS:S20 mixtures at different concentrations and weight fractions were screened to maximize their synergistic effect. To quantify the efficacy to toxicity ratio of each formulation, we defined the ratio as the "enhancement ratio/irritation potential (ER/IP)." The ER was observed by Franz cell diffusion of the target drug fluorescein, and the IP was measured by the cytotoxicity of the NIH/3T3 mouse fibroblast cell line. As a result, the magainin with the NLS:S20 mixture increased the permeability of porcine skin as well as decreased the toxicity. Among the various combinations, a formulation of 2% (w/v) NLS:S20 with a weight fraction of 0.6:0.4 had the largest ER/IP. ATR-FTIR spectroscopy of the formulations and skin was done to analyze the interactions in the formulations themselves and between the formulations and the skin. Both the intercellular lipidic route and transcellular route through the stratum corneum protein were involved in the delivery of fluorescein. This study turned pore-forming peptides into an efficient and safe penetration enhancer by combining them with other chemical penetration enhancers. Moreover, this discovery could be a possible method for enabling the transdermal delivery of macromolecules.
Generation of Genetically Modified Organotypic Skin Cultures Using Devitalized Human Dermis.
Li, Jingting; Sen, George L
2015-12-14
Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function and physiology of their in vivo tissue counterparts. This is exemplified by organotypic skin cultures which faithfully recapitulates the epidermal differentiation and stratification program. Primary human epidermal keratinocytes are genetically manipulable through retroviruses where genes can be easily overexpressed or knocked down. These genetically modified keratinocytes can then be used to regenerate human epidermis in organotypic skin cultures providing a powerful model to study genetic pathways impacting epidermal growth, differentiation, and disease progression. The protocols presented here describe methods to prepare devitalized human dermis as well as to genetically manipulate primary human keratinocytes in order to generate organotypic skin cultures. Regenerated human skin can be used in downstream applications such as gene expression profiling, immunostaining, and chromatin immunoprecipitations followed by high throughput sequencing. Thus, generation of these genetically modified organotypic skin cultures will allow the determination of genes that are critical for maintaining skin homeostasis.
Directory of Open Access Journals (Sweden)
Küppers V
2015-11-01
Full Text Available Volkmar Küppers,1 Michael Kemper,2 Christoph Abels2 1Gynecological Practice, Dysplasia-Clinic, Düsseldorf, Germany; 2Dr August Wolff GmbH & Co KG Arzneimittel, Bielefeld, Germany Abstract: Inadequate hygiene, aggressive cleansing, and chafing skin folds, as well as urine, feces, and sweat may trigger irritative contact dermatitis in the anogenital area. Serious recommendations for protection of the skin toward irritants include hygienic aspects and the use of appropriate skin care. Furthermore, preventing an accumulation of irritants on unprotected skin is mandatory. An intraindividual comparison study with 30 participants (17 female, 13 male; age: 44.2±8.3 years was performed to evaluate the properties of a newly developed water-in-oil (W/O balm on artificial sodium dodecyl sulfate-damaged epidermal barrier. The balm was applied 14 days twice daily, and transepidermal water loss and erythema were investigated. A significant improvement of both parameters after 12 days and even after 21 days could be confirmed. Two major clinical trials were performed to evaluate the safety and efficacy regarding protective and regenerative properties of the W/O balm on irritated skin in the anogenital area. Therefore, 29 children were enrolled (14 male, 15 female, age: 15.5±7.8 months in an open-labeled 4-week clinical study. The balm was used in the area under disposable diapers at least after diaper change or if required. Furthermore, in a second open, multicenter study, 43 women (mean age: 46.2±16.9 with predisposition to skin irritation in the outer anogenital region were included. The product was applied for 4 weeks 1–2 times daily. In both studies, skin tolerability, applicability, scent, spreadability, and removability of the balm were evaluated by participants and practitioners predominantly as good or even very good, also skin hydration, protection, and regeneration were judged positively. The studies confirmed that the newly developed W/O balm
Skin-resident stem cells and wound healing.
Iwata, Yohei; Akamatsu, Hirohiko; Hasebe, Yuichi; Hasegawa, Seiji; Sugiura, Kazumitsu
2017-01-01
CD271 is common stem cell marker for the epidermis and dermis. We assessed a kinetic movement of epidermal and dermal CD271 + cells in the wound healing process to elucidate the possible involvement with chronic skin ulcers. Epidermal CD271 + cells were proliferated and migrated from 3 days after wounding. Purified epidermal CD271 + cells expressed higher TGFβ2 and VEGFα transcripts than CD271 - cells. Delayed wound healing was observed in the aged mice compared with young mice. During the wound healing process, the peak of dermal CD271 + cell accumulation was delayed in aged mice compared with young mice. The expression levels of collagen-1, -3, -5, F4-80, EGF, FGF2, TGFβ1, and IL-1α were significantly increased in young mice compared with aged mice. Furthermore, purified dermal CD271 + cells expressed higher FGF2, EGF, PDGFB, and TGFβ1 gene transcripts than CD271 - cells. These results suggested that epidermal and dermal CD271 + cells were closely associated with wound healing process by producing various growth factors. Epidermal and dermal CD271 + cells in chronic skin ulcer patients were significantly reduced compared with healthy controls. Thus, both epidermal and dermal stem cells can play an important role in wound healing process.
Ghanavati, Zeinab; Orazizadeh, Mahmoud; Bayati, Vahid; Abbaspour, Mohammad Reza; Khorsandi, Layasadat; Mansouri, Esrafil; Neisi, Niloofar
2016-01-01
The organotypic co-culture is a well-known technique to examine cellular interactions and their roles in stem cell proliferation and differentiation. This study aims to evaluate the effects of dermal fibroblasts (DFs) on epidermal differentiation of adipose-derived stem cells (ASCs) using a three-dimensional (3D) organotypic co- culture technique. In this experimental research study, rat DFs and ASCs were isolated and cultured separately on electrospun polycaprolactone (PCL) matrices. The PCL matrices seeded by ASCs were superimposed on to the matrices seeded by DFs in order to create a 3D organotypic co-culture. In the control groups, PCL matrices seeded by ASCs were placed on matrices devoid of DFs. After 10 days, we assessed the expressions of keratinocyte-related genes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and expression of pan-cytokeratin protein by immunofluorescence in the differentiated keratinocyte-like cells from co- culture and control groups. Keratinocyte-like cell morphologies were also observed by scanning electron microscopy (SEM). The early, intermediate, and terminal differentiation keratinocyte markers-Cytokeratin14, Filaggrin, and Involucrin significantly expressed in the co-culture groups com- pared to the control ones (P<0.05). We observed pan-cytokeratin in keratinocyte-like cells of both groups by immunofluorescence. SEM observation of the co-culture groups showed that the differentiated keratinocyte-like cells developed a polygonal cobblestone shape, considered characteristic of keratinocytes. The 3D organotypic co-culture bilayered construct that consisted of DFs and ASCs was an effective technique for epidermal differentiation of ASCs. This co-culture might be useful for epidermal differentiation of stem cells for future applications in skin regeneration.
Steven johnsons syndrome and toxic epidermal necrolysis: A review
Directory of Open Access Journals (Sweden)
Sri ram Anne
2014-12-01
Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.
Skin decontamination of G, V, H L agents by Canadian reactive skin decontaminant lotion
Energy Technology Data Exchange (ETDEWEB)
Bide, R.W.; Sawyer, T.W.; DiNinno, V.L.; Armour, S.J.; Risk, D.J.
1993-05-13
The Canadian Reactive Skin Decontaminant Lotion (RSDL) is a reactive solution designed to be applied directly to skin for the decontamination and destruction of the classical chemical warfare agents. The solvent of the RSDL is very effective in dissolving liquid agents from the skin surface and the differential solubility of agents in the RSDL and the skin strongly favors retention of agents in the lotion. The active ingredient in the RSDL reacts rapidly and completely with G-agents, V-agents, mustard Lewisite producing relatively nontoxic products. The RSDL will dissolve and destroy agent thickened with acrylate polymers. The lotion is water soluble and readily removed from the skin. Since the RSDL is water soluble, it is active against water soluble agents even at high dilutions. For water insoluble agents, the activity is reduced as the water content rises above abrasive 50% due to insolubility of the agents. Skin and eye irritancy trials indicate that the RSDL is only a mild irritant to the eyes (equivalent to a chlorinated swimming pool) and to abraded skin. Acute toxicity trials showed that large oral and intraperitoneal doses were essentially non-toxic. The RSDL was fielded by the Canadian Forces for the Gulf Conflict. The RSDL may be used in open wounds for short periods. Wound decontamination and irrigation with RSDL diluted 1:1 with isotonic saline was recommended for the Gulf conflict.
Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat
Directory of Open Access Journals (Sweden)
Roberta Sartori
2016-06-01
Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.
Fartasch, Manigé; Diepgen, Thomas L; Drexler, Hans; Elsner, Peter; John, Swen Malte; Schliemann, Sibylle
2015-06-01
Job-related hand dermatitis heads up the list of reported occupational diseases. So-called skin products - understood to mean protective creams, skin cleansers and skin care products - are used for the primary and secondary prevention of job- related hand dermatitis. In the interests of evidence-based medicine, the only preventive measures and/or occupational skin products that should be used are those whose potential uses and efficacy are underpinned by scientific research. To this end, the Arbeitsgemeinschaft für Berufs- und Umweltdermatologie e.V. (Working Group for Occupational and Environmental Dermatology, ABD) of the DDG (German Dermatological Society) and the Deutsche Gesellschaft für Arbeits- und Umweltmedizin (German Society for Occupational and Environmental Medicine, DGAUM) have summed up the latest scientific findings and recommendations in the updated guideline. The benefit of the combined application of protective creams and skin care products in the primary and secondary prevention of work-related contact dermatitis has been widely confirmed by recent clinical-epidemiological studies. The guideline clearly explains the necessity of demonstrating the efficacy of protective creams and cleansing products by means of in vivo methods in the sense of repetitive applications. Transferable standardised testing systems designed to examine the irritation potential and thus the compatibility of occupational skin cleansers and the reduction of irritation by protective skin creams have now been developed and validated by multicentre studies for skin protection creams and cleansers. The status of the current assessment of the safety of occupational skin products is also summarised. © 2015 The Authors | Journal compilation © Blackwell Verlag GmbH, Berlin.
In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells
DEFF Research Database (Denmark)
Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K
2003-01-01
a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...
Epidermal response of rainbow trout to Ichthyobodo necator
DEFF Research Database (Denmark)
Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar
2014-01-01
Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...
Occupational irritant contact folliculitis associated with triphenyl tin fluoride (TPTF) exposure
DEFF Research Database (Denmark)
Andersen, Klaus Ejner; Petri, M
1982-01-01
Triphenyl tin fluoride (TPTF) is a bioactive organo-tin compound used in concentrations 2-12% as anti-foulants in boat paints. The chemical is moderately toxic to the skin. An occupational irritant contact folliculitis from TPTF in a marine paint plant worker is described. Contact allergy...
Pfuhler, Stefan
2013-01-01
Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594
Epidermal segmentation in high-definition optical coherence tomography.
Li, Annan; Cheng, Jun; Yow, Ai Ping; Wall, Carolin; Wong, Damon Wing Kee; Tey, Hong Liang; Liu, Jiang
2015-01-01
Epidermis segmentation is a crucial step in many dermatological applications. Recently, high-definition optical coherence tomography (HD-OCT) has been developed and applied to imaging subsurface skin tissues. In this paper, a novel epidermis segmentation method using HD-OCT is proposed in which the epidermis is segmented by 3 steps: the weighted least square-based pre-processing, the graph-based skin surface detection and the local integral projection-based dermal-epidermal junction detection respectively. Using a dataset of five 3D volumes, we found that this method correlates well with the conventional method of manually marking out the epidermis. This method can therefore serve to effectively and rapidly delineate the epidermis for study and clinical management of skin diseases.
Facial skin care products and cosmetics.
Draelos, Zoe Diana
2014-01-01
Facial skin care products and cosmetics can both aid or incite facial dermatoses. Properly selected skin care can create an environment for barrier repair aiding in the re-establishment of a healing biofilm and diminution of facial redness; however, skin care products that aggressively remove intercellular lipids or cause irritation must be eliminated before the red face will resolve. Cosmetics are an additive variable either aiding or challenging facial skin health. Copyright © 2014 Elsevier Inc. All rights reserved.
Benzalkonium chloride neutralizes the irritant effect of sodium dodecyl sulfate.
McFadden, J P; Holloway, D B; Whittle, E G; Basketter, D A
2000-11-01
When benzalkonium chloride (BKC), a cationic surfactant, is added to sodium dodecyl sulfate (SDS), an anionic surfactant, and used in patch testing, on the basis of their known physicochemical interaction, it is possible to predict that there will be a tendency towards a reduction in the expected irritant response when compared to SDS alone. The aim of this study was to investigate whether BKC could reduce the irritant response to SDS when applied after the SDS exposure. 54 non-atopic adult volunteers were recruited for the study. 20% SDS was applied for 2 h under occlusion. 1% BKC was then applied to the same site. Various controls, including SDS application followed by water for 2 h, were included. The irritant reaction was assessed at 24 h and 48 h. 40 of the 54 subjects had some reaction when SDS was applied for 2 h followed by either benzalkonium chloride or water control under occlusion. In comparison to water control, where BKC was applied after SDS, 20 of the 40 responders had a weaker reaction but only 4 had a stronger response. This study shows that BKC applied to skin exposed to SDS attenuates the resulting irritant reaction.
Epidermal cell death in frogs with chytridiomycosis
Directory of Open Access Journals (Sweden)
Laura A. Brannelly
2017-02-01
Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.
Keratins K2 and K10 are essential for the epidermal integrity of plantar skin.
Fischer, Heinz; Langbein, Lutz; Reichelt, Julia; Buchberger, Maria; Tschachler, Erwin; Eckhart, Leopold
2016-01-01
K1 and K2 are the main type II keratins in the suprabasal epidermis where each of them heterodimerizes with the type I keratin K10 to form intermediate filaments. In regions of the ears, tail, and soles of the mouse, only K2 is co-expressed with K10, suggesting that these keratins suffice to form a mechanically resilient cytoskeleton. To determine the effects of the suppression of both main keratins, K2 and K10, in the suprabasal plantar epidermis of the mouse. Krt2(-/-) Krt10(-/-) mice were generated by crossing Krt2(-/-) and Krt10(-/-) mice. Epidermal morphology of soles of hind-paws was examined macroscopically and histologically. Immunofluorescence analysis and quantitative PCR analysis were performed to analyze the expression of keratins in sole skin of wildtype and Krt2(-/-) Krt10(-/-) mice. Highly abundant proteins of the sole stratum corneum were determined by electrophoretic and chromatographic separation and subsequent mass spectrometry. K2 and K10 are the most prominent suprabasal keratins in normal mouse soles with the exception of the footpads where K1, K9 and K10 predominate. Mice lacking both K2 and K10 were viable and developed epidermal acanthosis and hyperkeratosis in inter-footpad epidermis of the soles. The expression of keratins K1, K9 and K16 was massively increased at the RNA and protein levels in the soles of Krt2(-/-) Krt10(-/-) mice. This study demonstrates that the loss of the main cytoskeletal components of plantar epidermis, i.e. K2 and K10, can be only partly compensated by the upregulation of other keratins. The thickening of the epidermis in the soles of Krt2(-/-) Krt10(-/-) mice may serve as a model for pathomechanistic aspects of palmoplantar keratoderma. Copyright © 2015. Published by Elsevier Ireland Ltd.
Phase II trial of epidermal growth factor ointment for patients with Erlotinib-related skin effects.
Hwang, In Gyu; Kang, Jung Hun; Oh, Sung Yong; Lee, Suee; Kim, Sung-Hyun; Song, Ki-Hoon; Son, Choonhee; Park, Min Jae; Kang, Myung Hee; Kim, Hoon Gu; Lee, Jeeyun; Park, Young Suk; Sun, Jong Mu; Kim, Hyun Jung; Kim, Chan Kyu; Yi, Seong Yoon; Jang, Joung-Soon; Park, Keunchil; Kim, Hyo-Jin
2016-01-01
The efficacy of erlotinib, the epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, has been demonstrated in patients with non-small cell lung cancer (NSCLC) and pancreatic cancer (PC). In the present study, we evaluated the effect of epidermal growth factor (EGF) ointment on erlotinib-related skin effects (ERSEs). This was an open-label, non-comparative, multicenter, phase II trial. The patients included those diagnosed with NSCLC or PC who were treated with erlotinib. The effectiveness of the ointment was defined as follows: (1) grade 2, 3, or 4 ERSEs downgraded to ≤ grade 1 or (2) grade 3 or 4 ERSEs downgraded to grade 2 and persisted for at least 2 weeks. Fifty-two patients from seven institutes in Korea were enrolled with informed consent. The final assessment included 46 patients (30 males, 16 females). According to the definition of effectiveness, the EGF ointment was effective in 36 (69.2%) intention to treat patients. There were no statistically significant differences in the effectiveness of the EGF ointment by gender (p = 0.465), age (p = 0.547), tumor type (p = 0.085), erlotinib dosage (p = 0.117), and number of prior chemotherapy sessions (p = 0.547). The grading for the average National Cancer Institute's Common Terminology Criteria for Adverse Events (NCI-CTCAE) rating of rash/acne and itching improved from 2.02 ± 0.83 to 1.13 ± 0.89 and 1.52 ± 0.84 to 0.67 ± 0.90, respectively (p reason for discontinuing the study was progression of cancer (37%). Based on the results, the EGF ointment is effective for ERSEs, regardless of gender, age, type of tumor, and dosage of erlotinib. The EGF ointment evenly improved all kinds of symptoms of ERSEs. ClinicalTrials.gov identifier: NCT01593995.
DEFF Research Database (Denmark)
Clemmensen, A; Andersen, F; Petersen, T K
2011-01-01
applied, we tested the efficacy of four anti-irritant compounds using the two different irritants sodium lauryl sulfate (SLS) and nonanoic acid (NON). Methods: In a randomized, double-blind, controlled trial, healthy volunteers were exposed to 5% SLS and 50% NON (the right and the left forearm...
Nessel, C S; Priston, R A; McKee, R H; Cruzan, G; Riley, A J; Hagemann, R; Plutnick, R T; Simpson, B J
1998-07-01
The role of skin irritation and other factors on the tumorigenic activity of petroleum middle distillates (PMDs) in mice was examined in a comprehensive research program. The program culminated in a 2-year dermal carcinogenicity study which compared the effects of equal weekly doses of irritating and nonirritating PMDs. Modified Ames mutagenicity studies and three- to seven-ring polycyclic aromatic compound (PAC) analyses indicated that the mutagenic activity of PMDs was correlated to PAC content. In subchronic and subacute studies, PMDs produced marked skin irritation which was ameliorated if the test samples were diluted in mineral oil. The reduction in irritation level was not a result of reduced dermal absorption. Straight-run kerosine (SRK), straight-run gas oil (SRGO), and catalytically cracked light cycle oil (LCO) were evaluated in the dermal carcinogenicity study. Test materials were applied either undiluted (2x/week) or as 28.5% (7x/week) or 50% (4x/week) concentrations in mineral oil for a total weekly dose of 100 microliters PMD per animal. All three materials produced moderate to marked skin irritation and increased tumor frequency when applied undiluted. When diluted, the irritant effects of SRK and SRGO, which contain low levels of PACs, were ameliorated, and there were no significant increases in tumors relative to controls. LCO, containing 8.7% three- to seven-ring PACs, increased tumor frequency when diluted, even when skin irritation was limited. These data indicate that the tumorigenic activity of straight-run MDs is likely a consequence of a nongenotoxic process, associated with frequent cell damage and repair. PMDs which contain low levels of three- to seven-ring PACs are unlikely to cause tumors in the absence of prolonged skin irritation. In addition, genotoxic mechanisms may also contribute to tumor formation for other PMDs containing higher levels of PACs, e.g., products blended with cracked stocks.
An ex vivo human skin model for studying skin barrier repair.
Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A
2015-01-01
In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Epidermal hydration levels in rosacea patients improve after minocycline therapy.
LENUS (Irish Health Repository)
Ní Raghallaigh, S
2013-12-06
Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.
Stoddard, Marie Alexia; Herrmann, Jennifer; Moy, Lauren; Moy, Ronald
2017-04-01
BACKGROUND: Atrophic scarring in skin of color is a common, permanent, and distressing result of uncontrolled acne vulgaris. Ablative lasers and chemical peels are frequently used to improve the appearance of atrophic scars, primarily through the stimulation of collagen and elastin; however, these treatment modalities are associated with risks, such as dyspigmentation and hypertrophic scarring, especially in patients with darker skin. OBJECTIVE: We evaluated the efficacy of topically applied synthetic epidermal growth factor (EGF) serum in reducing the appearance of atrophic acne scars in skin of color. METHODS: A single-center clinical trial was performed on twelve healthy men and women (average age 32.5) with Fitzpatrick Type IV-V skin and evidence of facial grade II-IV atrophic acne scars. Subjects applied topical EGF serum to the full-face twice daily for 12 weeks. Scar improvement was investigated at each visit using an Investigator Global Assessment (IGA), a Goodman grade, clinical photography, and patient self-assessment. RESULTS: Eleven subjects completed the trial. Compared to baseline, there was an improvement in mean IGA score from 3.36 (SEM = 0.15) to 2.18 (SEM = 0.33). Mean Goodman grade was reduced from 2.73 (SEM = 0.19) to 2.55 (SEM = 0.21). Of the eleven pairs of before and after photographs, nine were correctly chosen as the post-treatment image by a blind investigator. On self-assessment, 81% reported a "good" to "excellent" improvement in their scars compared to baseline (P = 0.004). CONCLUSION: Topical EGF may improve the appearance of atrophic acne scars in skin of color. Additional, larger studies should be conducted to better characterize improvement. J Drugs Dermatol. 2017;16(4):322-326..
Nutritional skin care : health effects of micronutrients and fatty acids
Boelsma, E.; Hendriks, H.F.J.; Roza, L.
2001-01-01
Human skin is continuously exposed to internal and external influences that may alter its condition and functioning. As a consequence, the skin may undergo alterations leading to photoaging, inflammation, immune dysfunction, imbalanced epidermal homeostasis, or other skin disorders. Modern
Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells
International Nuclear Information System (INIS)
Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui
2008-01-01
Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis
DEFF Research Database (Denmark)
Bandier, J; Carlsen, B C; Rasmussen, M A
2015-01-01
and AD phenotype on irritant response and skin regeneration. OBJECTIVES: To investigate the role of FLGnull and AD groups for skin reaction and recovery after sodium lauryl sulfate (SLS) irritation. METHODS: This is a case-control study comprising 67 subjects, including healthy controls and patients...
Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.
Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali
2016-03-01
Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Fismen, S; Hedberg, A; Fenton, K A
2009-01-01
Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...
Gentle cleansing and moisturizing for patients with atopic dermatitis and sensitive skin.
Cheong, Wai Kwong
2009-01-01
Atopic dermatitis is a common condition characterized by pruritus, inflammation, and dryness of the skin. Inflammation disrupts the barrier function of the stratum corneum, predisposing the skin to be dry, and increases susceptibility to irritants and secondary bacterial infection. Sensitive skin is common, reported by 40-50% of women and 30% of men in the US, Europe, and Japan. Basic requirements in managing eczema and sensitive skin include effective cleansers that do not compromise skin barrier integrity, alleviation of skin dryness, and restoration of skin barrier function through the use of therapeutic moisturizers. The selection of a skin cleanser is therefore an important part of managing these conditions. Studies have reported clinical improvement with the use of soap-free cleansers in combination with topical treatments. While topical corticosteroids and immunosuppressive agents are mainstays of treatment for atopic dermatitis, therapeutic moisturizers are important adjuncts. Moisturizers improve skin hydration, reduce susceptibility to irritation, restore the integrity of the stratum corneum, and enhance the efficacy of topical corticosteroids.
Safriani, R.; Sugihartini, N.; Yuliani, S.
2017-11-01
Essential oil of Syzigium aromaticum has been formulated in O/W and W/O creams as anti-inflammatory dosage form. The purpose of this study was to evaluate the physical characteristic and irritation index of S. aromaticum essential oil in O/W and W/O creams. The creams were made by fusion method. The creams then were evaluated the physical characteristic including pH, viscosity, spreadability and adhesivity. The irritation index was obtained by irritation skin test in male rabbit. The results showed that the W/O and O/W creams have the value of pH: 6.3 and 6.27; spreadability: 3,18 and 4.17 cm2; adhesivity: 5.59 and 0.07 minutes; viscosity: 4.43 and 2.88 Pa.S, respectively. The irritation test showed that the control enhancer caused mild irritation in both of W/O and O/W creams. These findings indicated that type of cream might influence the physical characteristic and irritation index of S. aromaticum essential oil cream.
Metabolic epidermal necrosis in two dogs with different underlying diseases.
Bond, R; McNeil, P E; Evans, H; Srebernik, N
1995-05-06
Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.
DEFF Research Database (Denmark)
Boone, Marc A L M; Jemec, Gregor B E; Del Marmol, V
2015-01-01
Differentiation of allergic contact dermatitis (ACD) and irritant contact dermatitis (ICD) is important because of different management requirements. Various non-invasive tests have been used in an attempt to improve diagnosis. In irritant dermatitis, thickening of the epidermis has been a constant...... was threefold. (1) To evaluate the correlation between HD-OCT features and clinical scores of allergic and irritant patch test reactions. (2) To explore the potential of HD-OCT in optimizing the visual patch test scoring. (3) To assess in vivo the cytological and 3-D micro-architectural differences in skin...... reaction types between doubtful positive ACD and ICD. Twenty-two volunteers were patch tested using potassium(VI)dichromate, cobalt(II)chloride, nickel(II) sulfate and palladium(II)chloride. Visual patch test scoring and HD-OCT assisted patch test scoring were performed at 48 and 96 h after patch test...
EGFR Activation and Ultraviolet Light‐Induced Skin Carcinogenesis
Directory of Open Access Journals (Sweden)
Taghrid B. El-Abaseri
2007-01-01
Full Text Available The epidermal growth factor receptor (EGFR regulates the proliferation of keratinocytes through multiple mechanisms that differ depending on the localization of the cell within the skin. Ultraviolet (UV irradiation, the main etiologic factor in the development of skin cancer, also activates the receptor. In this review, we discuss how the UV-induced activation of EGFR regulates the response of the skin to UV. UV-induced EGFR activation increases keratinocyte proliferation, suppresses apoptosis, and augments and accelerates epidermal hyperplasia in response to UV. Pharmacological inhibition of the UV-induced activation of EGFR in a genetically initiated mouse skin tumorigenesis model suppresses tumorigenesis and the activation of mitogen-activated protein (MAP kinases and phosphatidyl inositol-3-kinase (PI3K/AKT signaling pathways. EGFR has pleiotropic, complex, and cell-type-specific functions in cutaneous keratinocytes; suggesting that the receptor is an appropriate target for the development of molecularly targeted therapies for skin cancer and other pathologies.
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.
Directory of Open Access Journals (Sweden)
Aleksandra Piwko-Czuchra
Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.
Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.
Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina
2018-03-27
Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.
Directory of Open Access Journals (Sweden)
Victor Paromov
2011-01-01
Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.
Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis
International Nuclear Information System (INIS)
Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.
1986-01-01
Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers
Song, Aihua; Su, Zhen; Li, Sanming; Han, Fei
2015-01-01
In order to assess the preliminary safety and effectiveness of nanostructured lipid carriers-based flurbiprofen gel (FP NLC-gel), the acute irritation test, in vivo pharmacodynamics evaluation and pharmacokinetic study were investigated after topical application. No dropsy and erythema were observed after continuous dosing 7 d of FP NLC-gel on the rabbit skin, and the xylene-induced ear drossy could be inhibited by FP NLC-gel at different dosages. The maximum concentration of FP in rats muscle was 2.03 μg/g and 1.55 μg/g after oral and topical administration, respectively. While the peak concentration in untreated muscle after topical administration was only 0.37 μg/mL. And at any time, following topical administration the mean muscle-plasma concentration ratio Cmuscle/CPlasma was obviously higher than that following oral administration. Results indicated that FP could directly penetrate into the subcutaneous muscle tissue from the administration site. Thus, the developed FP NLC-gel could be a safe and effective vehicle for topical delivery of FP.
The hairless guinea-pig as a model for treatment of acute irritation in humans
DEFF Research Database (Denmark)
Andersen, F; Hedegaard, K; Fullerton, A
2006-01-01
BACKGROUND: The effect of six skin care formulations on experimentally induced acute irritation was studied in hairless guinea-pigs (HLGP) and in human volunteers (HV). The formulations were a basic cream, a carbomer cream and four modifications of the carbomer cream, containing either 10...... and colorimetry. RESULTS: The glycerol cream was the only product showing effects potentially better than no treatment in HV. CONCLUSION: The HLGP was too sensitive an animal model as a predictor for effect in humans. There was no difference in efficacy of the formulations against the two different irritants...
Vissers, W.H.P.M.; Muys, L.; Erp, P.E.J. van; Jong, E.M.G.J. de; Kerkhof, P.C.M. van de
2004-01-01
Inflammatory linear verrucous epidermal nevus (ILVEN) is a rare skin disorder with a clinical and histological resemblance to psoriasis. In the past clinical and histological criteria have been defined. However, there remains a discussion as to whether ILVEN is a disease entity distinct from linear
Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M
1992-07-01
Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.
Impact of inflammation on iron stores in involved and non-involved psoriatic skin
International Nuclear Information System (INIS)
Pinheiro, T.; Ynsa, M.D.; Alves, L.C.; Teixeira, P.; Ferreira, J.; Filipe, P.
2015-01-01
Accumulating evidence supports a role for cellular Fe in cell proliferation, inflammation, and disease tolerance. Psoriasis is a severe inflammatory and hyper proliferative condition of human skin whose aetiology remains poorly understood. Herein, we performed nuclear microscopy techniques to quantify with cellular resolution and high sensitivity the concentration of Fe in lesional (psoriatic plaques) and non-lesional adjacent skin of psoriatic patients. Fe contents were measured across skin depth and along epidermal strata either by quantitatively imaging Fe distribution in regions of interest, or by determining Fe profiles through analysis of sequential points along selected transepts. Both procedures require deconvolution of spectra to project quantitative elemental data through the application of different software codes. Using these approaches a detailed quantitative distribution of Fe was resolved. We show that in both lesional and non-lesional skin, the epidermal profiles of Fe contents showed a peak at the basal layer and that Fe concentration along the basal layer was not uniformly distributed. Typically, Fe levels were significantly higher in epidermal ridges relative to regions above dermal papillae. Lesional skin displayed excess Fe over extended regions above basal layer. In conclusion, we found significantly increased Fe deposits in the epidermis of psoriatic patients, particularly in areas of epidermal hyper proliferation. These findings suggest an important role for Fe in the pathogenesis of psoriasis. They also raise the possibility that manipulation of Fe levels in the skin may become relevant for the clinical management of psoriasis
Impact of inflammation on iron stores in involved and non-involved psoriatic skin
Energy Technology Data Exchange (ETDEWEB)
Pinheiro, T., E-mail: murmur@ctn.ist.utl.pt [Instituto de Bioengenharia e Biociências, Instituto Superior Técnico, Universidade de Lisboa (Portugal); Ynsa, M.D. [Centro de Micro-Análisis de Materiales, Universidad Autonoma de Madrid (Spain); Alves, L.C. [Centro de Ciências e Tecnologias Nucleares, Instituto Superior Técnico, Universidade de Lisboa (Portugal); Teixeira, P.; Ferreira, J.; Filipe, P. [Unidade de Investigação em Dermatologia, Instituto de Medicina Molecular, Faculdade de Medicina da Universidade de Lisboa (Portugal)
2015-04-01
Accumulating evidence supports a role for cellular Fe in cell proliferation, inflammation, and disease tolerance. Psoriasis is a severe inflammatory and hyper proliferative condition of human skin whose aetiology remains poorly understood. Herein, we performed nuclear microscopy techniques to quantify with cellular resolution and high sensitivity the concentration of Fe in lesional (psoriatic plaques) and non-lesional adjacent skin of psoriatic patients. Fe contents were measured across skin depth and along epidermal strata either by quantitatively imaging Fe distribution in regions of interest, or by determining Fe profiles through analysis of sequential points along selected transepts. Both procedures require deconvolution of spectra to project quantitative elemental data through the application of different software codes. Using these approaches a detailed quantitative distribution of Fe was resolved. We show that in both lesional and non-lesional skin, the epidermal profiles of Fe contents showed a peak at the basal layer and that Fe concentration along the basal layer was not uniformly distributed. Typically, Fe levels were significantly higher in epidermal ridges relative to regions above dermal papillae. Lesional skin displayed excess Fe over extended regions above basal layer. In conclusion, we found significantly increased Fe deposits in the epidermis of psoriatic patients, particularly in areas of epidermal hyper proliferation. These findings suggest an important role for Fe in the pathogenesis of psoriasis. They also raise the possibility that manipulation of Fe levels in the skin may become relevant for the clinical management of psoriasis.
Skin manifestations of growth hormone-induced diseases.
Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P
2016-09-01
The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.
Kendall, Alexandra C; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke C; Harwood, John L; Nicolaou, Anna
2017-09-01
Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, derivatives of the same sphingoid bases and various fatty acids, are produced by dermal and epidermal cells and perform signalling roles in cell functions ranging from differentiation to apoptosis. Supplementation with the n-3 polyunsaturated fatty acids (PUFA) eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have shown promise as therapeutic agents in a number of inflammatory skin conditions, altering the lipid profile of the skin and production of bioactive lipids such as the eicosanoids, docosanoids and endocannabinoids. In this study we wished to investigate whether EPA and DHA could also affect the ceramide profile in epidermis and dermis, and, in this way, contribute to formation of a robust lipid barrier and ceramide-mediated regulation of skin functions. Ex vivo skin explants were cultured for 6days, and supplemented with EPA or DHA (50μM). Liquid chromatography coupled to tandem mass spectrometry with electrospray ionisation was used to assess the prevalence of 321 individual ceramide species, and a number of sphingoid bases, phosphorylated sphingoid bases, and phosphorylated ceramides, within the dermis and epidermis. EPA augmented dermal production of members of the ceramide families containing Non-hydroxy fatty acids and Sphingosine or Dihydrosphingosine bases (CER[NS] and CER[NDS], respectively), while epidermal CER[EOH], CER[EOS] and CER[EOP] ceramides were not affected. DHA did not significantly affect ceramide production. Ceramide-1-phosphate levels in
Early changes produced in mouse skin by the application of three middle distillates.
Grasso, P; Sharratt, M; Ingram, A J
1988-01-01
It has been reported by the American Petroleum Institute (API) that dermal applications of certain middle distillates of mineral oils can result in high incidences of skin tumours in mice. This was unexpected as the polycyclic aromatic hydrocarbon (PAH) levels in these were below detection limits. To examine the possible role of tissue injury in the induction of tumours, the skin reactions produced by thrice weekly applications of three middle distillates similar to those tested by the API were examined grossly and histopathologically at intervals up to 6 weeks. Various reference materials and oils were used as controls. Preliminary histological examination showed that severe skin damage was present from week 1 onwards in mice treated with the three middle distillates, two of them producing epidermal loss and ulceration. Marked epidermal hyperplasia was produced by all three middle distillates. These findings support the view that regenerative epidermal hyperplasia due to repeated severe skin damage may have exerted a powerful promotional effect in the production of the skin tumours by middle distillates in the API study.
Energy Technology Data Exchange (ETDEWEB)
Su, Zhongchun; Ma, Huan; Wu, Zhengzheng [Institute of Biomedicine, National Engineering Research Center of Genetic Medicine, Key Lab for Genetic Medicine of Guangdong Province, Jinan University, Guangzhou 510632 (China); Zeng, Huilan [Department of Hematology, The First Affiliated Hospital, Jinan University, Guangzhou 510632 (China); Li, Zhizhong [Department of Bone, The First Affiliated Hospital, Jinan University, Guangzhou 510632 (China); Wang, Yuechun; Liu, Gexiu [Department of Physiology, School of Medicine, Jinan University, Guangzhou 510632 (China); Xu, Bin; Lin, Yongliang; Zhang, Peng [Grandhope Biotech Co., Ltd., Building D, #408, Guangzhou International Business Incubator, Guangzhou Science Park, Guangzhou 510663, Guangdong (China); Wei, Xing, E-mail: wei70@hotmail.com [Institute of Biomedicine, National Engineering Research Center of Genetic Medicine, Key Lab for Genetic Medicine of Guangdong Province, Jinan University, Guangzhou 510632 (China)
2014-11-01
Current therapy for skin wound healing still relies on skin transplantation. Many studies were done to try to find out ways to replace skin transplantation, but there is still no effective alternative therapy. In this study, decellularized scaffolds were prepared from pig peritoneum by a series of physical and chemical treatments, and scaffolds loaded with hyaluronic acid (HA) and epidermal growth factor (EGF) were tested for their effect on wound healing. MTT assay showed that EGF increased NIH3T3 cell viability and confirmed that EGF used in this study was biologically active in vitro. Scanning electron microscope (SEM) showed that HA stably attached to scaffolds even after soaking in PBS for 48 h. ELISA assay showed that HA increased the adsorption of EGF to scaffolds and sustained the release of EGF from scaffolds. Animal study showed that the wounds covered with scaffolds containing HA and EGF recovered best among all 4 groups and had wound healing rates of 49.86%, 70.94% and 87.41% respectively for days 10, 15 and 20 post-surgery compared to scaffolds alone with wound healing rates of 29.26%, 42.80% and 70.14%. In addition, the wounds covered with scaffolds containing EGF alone were smaller than no EGF scaffolds on days 10, 15 and 20 post-surgery. Hematoxylin–Eosin (HE) staining confirmed these results by showing that on days 10, 15 and 20 post-surgery, the thicker epidermis and dermis layers were observed in the wounds covered with scaffolds containing HA and EGF than scaffolds alone. In addition, the thicker epidermis and dermis layers were also observed in the wounds covered with scaffolds containing EGF than scaffolds alone. Skin appendages were observed on day 20 only in the wound covered with scaffolds containing HA and EGF. These results demonstrate that the scaffolds containing HA and EGF can enhance wound healing. - Highlights: • HA can increase the adsorption of EGF to decellularized scaffolds. • HA can sustain the release of EGF from
Directory of Open Access Journals (Sweden)
Chizh Boris A
2007-08-01
Full Text Available Abstract Background The Contact Heat Evoked Potential Stimulator (CHEPS rapidly stimulates cutaneous small nerve fibres, and resulting evoked potentials can be recorded from the scalp. We have studied patients with symptoms of sensory neuropathy and controls using CHEPS, and validated the findings using other objective measures of small nerve fibres i.e. the histamine-induced skin flare response and intra-epidermal fibres (IEF, and also quantitative sensory testing (QST, a subjective measure. Methods In patients with symptoms of sensory neuropathy (n = 41 and healthy controls (n = 9 we performed clinical examination, QST (monofilament, vibration and thermal perception thresholds, nerve conduction studies, histamine-induced skin flares and CHEPS. Skin punch biopsies were immunostained using standard ABC immunoperoxidase for the nerve marker PGP 9.5 or the heat and capsaicin receptor TRPV1. Immunoreactive IEF were counted per length of tissue section and epidermal thickness recorded. Results Amplitudes of Aδ evoked potentials (μV following face, arm or leg stimulation were reduced in patients (e.g. for the leg: mean ± SEM – controls 11.7 ± 1.95, patients 3.63 ± 0.85, p = 0.0032. Patients showed reduced leg skin flare responses, which correlated with Aδ amplitudes (rs = 0.40, p = 0.010. In patient leg skin biopsies, PGP 9.5- and TRPV1-immunoreactive IEF were reduced and correlated with Aδ amplitudes (PGP 9.5, rs = 0.51, p = 0.0006; TRPV1, rs = 0.48, p = 0.0012. Conclusion CHEPS appears a sensitive measure, with abnormalities observed in some symptomatic patients who did not have significant IEF loss and/or QST abnormalities. Some of the latter patients may have early small fibre dysfunction or ion channelopathy. CHEPS provides a clinically practical, non-invasive and objective measure, and can be a useful additional tool for the assessment of sensory small fibre neuropathy. Although further evaluation is required, the technique shows
Ultraviolet Radiations: Skin Defense-Damage Mechanism.
Mohania, Dheeraj; Chandel, Shikha; Kumar, Parveen; Verma, Vivek; Digvijay, Kumar; Tripathi, Deepika; Choudhury, Khushboo; Mitten, Sandeep Kumar; Shah, Dilip
2017-01-01
UV-radiations are the invisible part of light spectra having a wavelength between visible rays and X-rays. Based on wavelength, UV rays are subdivided into UV-A (320-400 nm), UV-B (280-320 nm) and UV-C (200-280 nm). Ultraviolet rays can have both harmful and beneficial effects. UV-C has the property of ionization thus acting as a strong mutagen, which can cause immune-mediated disease and cancer in adverse cases. Numbers of genetic factors have been identified in human involved in inducing skin cancer from UV-radiations. Certain heredity diseases have been found susceptible to UV-induced skin cancer. UV radiations activate the cutaneous immune system, which led to an inflammatory response by different mechanisms. The first line of defense mechanism against UV radiation is melanin (an epidermal pigment), and UV absorbing pigment of skin, which dissipate UV radiation as heat. Cell surface death receptor (e.g. Fas) of keratinocytes responds to UV-induced injury and elicits apoptosis to avoid malignant transformation. In addition to the formation of photo-dimers in the genome, UV also can induce mutation by generating ROS and nucleotides are highly susceptible to these free radical injuries. Melanocortin 1 receptor (MC1R) has been known to be implicated in different UV-induced damages such as pigmentation, adaptive tanning, and skin cancer. UV-B induces the formation of pre-vitamin D3 in the epidermal layer of skin. UV-induced tans act as a photoprotection by providing a sun protection factor (SPF) of 3-4 and epidermal hyperplasia. There is a need to prevent the harmful effects and harness the useful effects of UV radiations.
Grafting of human epidermal cells, presence and perspectives
Czech Academy of Sciences Publication Activity Database
Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.
2001-01-01
Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
International Nuclear Information System (INIS)
Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-01-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
Energy Technology Data Exchange (ETDEWEB)
Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-07-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.
Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells
International Nuclear Information System (INIS)
Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook
2011-01-01
Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.
Growth regulation in X-irradiated mouse skin
International Nuclear Information System (INIS)
Elgjo, K.; Devik, F.
1978-01-01
Extracts of hairless mouse skin were tested for their content of epidermal G 1 inhibitor and G 2 inhibitor at daily intervals after X-irradiation with 4 500 or 2 250 rad. After either dose the skin extracts lacked G 1 inhibitory activity on days 5 and 6 respectively after irradiation. This coincided with the time when the epidermal mitotic rate again became normal and started a period of over-shoot. The time interval of 5 to 6 days corresponds to the turnover time of the differentiating cells in hairless mouse back epidermis. The findings indicate that the proliferating cells in epidermis can respond to changes in local chalone concentration, even after X-irradiation at the tested doses, and that the irradiated epidermal cell population still retains some important properties inherent in a cybernetically regulated system. The local G 2 -inhibitory activity also varied after irradiation, but these variations could not be directly related to the corresponding mitotic rates. (author)
Taub, Amy; Bucay, Vivian; Keller, Gregory; Williams, Jay; Mehregan, Darius
2018-04-01
detected in either group as measured by Ki67-immunohistochemistry. Reduction in visible pores, superficial wrinkles, oiliness, pigmentation, and improvement of skin evenness, were statistically significant. A trend for improvement was also observed in skin elasticity, TEWL, and hydration; these did not achieve statistical significance. Ultrasound and histopathology demonstrated increases in dermal thickness in individual patients, without statistical significance. Comprehensive improvement in all 5 parameters, including visible pores, hyperpigmentation, superficial and deep wrinkles, and epidermal thickness, was statistically significant when the subset of participants assigned for histology in full formula group was compared with the placebo group participants. A 3-product skin care regimen containing alpha and beta defensins globally improves the visual appearance and structure of aging skin without irritation, dryness, or inflammation. Specifically, this regimen increases epidermal thickness, reduces appearance of pores, reduces wrinkles, and reduces melanin. This skin care regimen stimulates rejuvenation without evidence of increase of a marker of carcinogenic stimulation. This data is consistent with the hypothesis that a defensin-containing skin care regimen activates the body's own dormant stem cells to generate healthy new epidermal cells. J Drugs Dermatol. 2018;17(4):426-441. THIS ARTICLE HAD BEEN MADE AVAILABLE FREE OF CHARGE. PLEASE SCROLL DOWN TO ACCESS THE FULL TEXT OF THIS ARTICLE WITHOUT LOGGING IN. NO PURCHASE NECESSARY. PLEASE CONTACT THE PUBLISHER WITH ANY QUESTIONS.
Infant Skin Care Products: What Are the Issues?
Kuller, Joanne McManus
2016-10-01
Infant skin is susceptible to dryness and irritation from external factors, including topical skin care products not formulated for the infant's skin. This may increase the risk of contact dermatitis. Parents frequently express concern regarding potential harm from ingredients in skin care products and seek information. This is complicated by several skin care myths. The purpose of this literature review was to provide evidence-based information to educate parents on the use of products for preterm and term infants. Multiple searches using PubMed were conducted including the search terms "infant skin care," "infant products," "infant bath," "emollients," "diaper skin care," and "diaper wipes." Reference lists of comprehensive reviews were also scanned. Google searches were used to assess consumer information, product information, and regulatory guidelines. There is little scientific evidence to support safety of natural/organic products on infant skin. Raw materials originate from different sources, complicating testing and comparisons of ingredients. Research shows that cleansers formulated for infant skin do not weaken the skin barrier the way harsher soaps and detergents can. Oils with the lowest oleic acid content provide a lower risk of irritant contact dermatitis. Nurses must be informed about natural and organic products, preservatives, and fragrances and know the definition of commonly used marketing terms. Decisions regarding the use of infant products in preterm and term infants should be evidence based. More research is needed to support claims regarding the safety of products used on infant skin.
Minkis, Kira; Alam, Murad
2014-01-01
Ultrasound skin tightening is a noninvasive, nonablative method that allows for energy deposition into the deep dermal and subcutaneous tissue while avoiding epidermal heating. Ultrasound coagulation is confined to arrays of 1-mm(3) zones that include the superficial musculoaponeurotic system and connective tissue. This technology gained approval from the Food and Drug Administration as the first energy-based skin "lifting" device, specifically for lifting lax tissue on the neck, submentum, and eyebrows. Ultrasound has the unique advantage of direct visualization of treated structures during treatment. Ultrasound is a safe and efficacious treatment for mild skin tightening and lifting. Copyright © 2014 Elsevier Inc. All rights reserved.
Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure
2013-12-01
The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald
2012-05-01
Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.
Cassidy, Andrew J.; van Steensel, Maurice A. M.; Steijlen, Peter M.; van Geel, Michel; Velden, Jaap van der; Morley, Susan M.; Terrinoni, Alessandro; Melino, Gerry; Candi, Eleonora; McLean, W. H. Irwin
2005-01-01
Peeling skin syndrome is an autosomal recessive genodermatosis characterized by the shedding of the outer epidermis. In the acral form, the dorsa of the hands and feet are predominantly affected. Ultrastructural analysis has revealed tissue separation at the junction between the granular cells and the stratum corneum in the outer epidermis. Genomewide linkage analysis in a consanguineous Dutch kindred mapped the gene to 15q15.2 in the interval between markers D15S1040 and D15S1016. Two homozygous missense mutations, T109M and G113C, were found in TGM5, which encodes transglutaminase 5 (TG5), in all affected persons in two unrelated families. The mutation was present on the same haplotype in both kindreds, indicating a probable ancestral mutation. TG5 is strongly expressed in the epidermal granular cells, where it cross-links a variety of structural proteins in the terminal differentiation of the epidermis to form the cornified cell envelope. An established, in vitro, biochemical cross-linking assay revealed that, although T109M is not pathogenic, G113C completely abolishes TG5 activity. Three-dimensional modeling of TG5 showed that G113C lies close to the catalytic domain, and, furthermore, that this glycine residue is conserved in all known transglutaminases, which is consistent with pathogenicity. Other families with more-widespread peeling skin phenotypes lacked TGM5 mutations. This study identifies the first causative gene in this heterogeneous group of skin disorders and demonstrates that the protein cross-linking function performed by TG5 is vital for maintaining cell-cell adhesion between the outermost layers of the epidermis. PMID:16380904
Ethnic differences in the structural properties of facial skin.
Sugiyama-Nakagiri, Yoriko; Sugata, Keiichi; Hachiya, Akira; Osanai, Osamu; Ohuchi, Atsushi; Kitahara, Takashi
2009-02-01
Conspicuous facial pores are one type of serious aesthetic defects for many women. However, the mechanism(s) that underlie the conspicuousness of facial pores remains unclear. We previously characterized the epidermal architecture around facial pores that correlated with the appearance of those pores. A survey was carried out to elucidate ethnic-dependent differences in facial pore size and in epidermal architecture. The subjects included 80 healthy women (aged 30-39: Caucasians, Asians, Hispanics and African Americans) living in Dallas in the USA. First, surface replicas were collected to compare pore sizes of cheek skin. Second, horizontal cross-sectioned images from cheek skin were obtained non-invasively from the same subjects using in vivo confocal laser scanning microscopy (CLSM) and the severity of impairment of epidermal architecture around facial pores was determined. Finally, to compare racial differences in the architecture of the interfollicular epidermis of facial cheek skin, horizontal cross-sectioned images were obtained and the numbers of dermal papillae were counted. Asians had the smallest pore areas compared with other racial groups. Regarding the epidermal architecture around facial pores, all ethnic groups observed in this study had similar morphological features and African Americans showed substantially more severe impairment of architecture around facial pores than any other racial group. In addition, significant differences were observed in the architecture of the interfollicular epidermis between ethnic groups. These results suggest that facial pore size, the epidermal architecture around facial pores and the architecture of the interfollicular epidermis differ between ethnic groups. This might affect the appearance of facial pores.
Novel mechanisms for the vitamin D receptor (VDR) in the skin and in skin cancer.
Bikle, Daniel D; Oda, Yuko; Tu, Chia-Ling; Jiang, Yan
2015-04-01
The VDR acting with or without its principal ligand 1,25(OH)2D regulates two central processes in the skin, interfollicular epidermal (IFE) differentiation and hair follicle cycling (HFC). Calcium is an important co-regulator with 1,25(OH)2D at least of epidermal differentiation. Knockout of the calcium sensing receptor (CaSR) in addition to VDR accelerates the development of skin cancer in mice on a low calcium diet. Coactivators such as mediator 1 (aka DRIP205) and steroid receptor coactivator 3 (SRC3) regulate VDR function at different stages of the differentiation process, with Med 1 essential for hair follicle differentiation and early stages of epidermal differentiation and proliferation and SRC3 essential for the latter stages of differentiation including formation of the permeability barrier and innate immunity. The corepressor of VDR, hairless (HR), is essential for hair follicle cycling, although its effect on epidermal differentiation in vivo is minimal. In its regulation of HFC and IFE VDR controls two pathways-wnt/β-catenin and sonic hedgehog (SHH). In the absence of VDR these pathways are overexpressed leading to tumor formation. Whereas, VDR binding to β-catenin may block its activation of TCF/LEF1 sites, β-catenin binding to VDR may enhance its activation of VDREs. 1,25(OH)2D promotes but may not be required for these interactions. Suppression of SHH expression by VDR, on the other hand, requires 1,25(OH)2D. The major point of emphasis is that the role of VDR in the skin involves a number of novel mechanisms, both 1,25(OH)2D dependent and independent, that when disrupted interfere with IFE differentiation and HFC, predisposing to cancer formation. This article is part of a Special Issue entitled '17th Vitamin D Workshop'. Copyright © 2014 Elsevier Ltd. All rights reserved.
Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A
2013-09-07
Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.
Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter
2017-01-01
Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204
National Research Council Canada - National Science Library
Aberg, P
2001-01-01
... before and after application of chemicals on volar forearms of volunteers, Tegobetaine and sodium lauryl sulphate were used to induce the irritations, The spectra were filtered using orthogonal signal correction (OSC...
Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas
2013-01-01
Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.
Occupational contact dermatitis in the UK: a surveillance report from EPIDERM and OPRA.
Meyer, J D; Chen, Y; Holt, D L; Beck, M H; Cherry, N M
2000-05-01
Since February 1993 the EPIDERM surveillance scheme has collected data on occupational skin disease from consultant dermatologists in the UK. Reporting by occupational physicians to the scheme began in May 1994 and was superseded in January 1996 by the Occupational Physicians Reporting Activity (OPRA). The schemes currently receive reports on incident cases from 244 dermatologists and 790 occupational physicians. An estimated total of 9937 cases of contact dermatitis reported by dermatologists was calculated from surveillance data; 8129 contact dermatitis cases were estimated from reports by occupational physicians. The annual incidence of occupational contact dermatitis from dermatologist reports was 6.4 cases per 100,000 workers and 6.5 per 100,000 from reports by occupational physicians, an overall rate of 12.9 cases per 100,000 workers. Manufacturing industries account for the greatest number of cases seen by both sets of reporting physicians, with health care employment second. Reports from dermatologists also indicate high rates of dermatitis in the personal service industries (mainly hairdressers and barbers) and in agriculture. With the exception of an increase in cases seen in nurses in both schemes, the numbers and proportions of cases of contact dermatitis within occupations have remained fairly constant over the 6-year reporting period. Agents accounting for the highest number of allergic contact dermatitis cases were rubber (23.4% of allergic cases reported by dermatologists), nickel (18.2), epoxies and other resins (15.6), aromatic amines (8.6), chromium and chromates (8.1), fragrances and cosmetics (8.0), and preservatives (7.3). Soaps (22.0% of cases), wet work (19.8), petroleum products (8.7), solvents (8.0), and cutting oils and coolants (7.8) were the most frequently cited agents in cases of irritant dermatitis. The national scope of the data, together with the parallel structure by which both dermatologists and occupational physicians report
Directory of Open Access Journals (Sweden)
I. N. Zakharova
2014-01-01
Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.
Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.
Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi
2005-02-25
Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
Gibbs, S.; Corsini, E.; Spiekstra, S.W.; Galbiati, V.; Fuchs, H.W.; Degeorge, G.; Troese, M.; Hayden, P.; Deng, W.; Roggen, E.
2013-01-01
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low
DEFF Research Database (Denmark)
Boone, Marc; Draye, Jean Pierre; Verween, Gunther
2014-01-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...
Directory of Open Access Journals (Sweden)
Marlene K Wolfe
Full Text Available To prevent disease transmission, 0.05% chlorine solution is commonly recommended for handwashing in Ebola Treatment Units. In the 2014 West Africa outbreak this recommendation was widely extended to community settings, although many organizations recommend soap and hand sanitizer over chlorine. To evaluate skin irritation caused by frequent handwashing that may increase transmission risk in Ebola-affected communities, we conducted a randomized trial with 91 subjects who washed their hands 10 times a day for 28 days. Subjects used soap and water, sanitizer, or one of four chlorine solutions used by Ebola responders (calcium hypochlorite (HTH, sodium dichloroisocyanurate (NaDCC, and generated or pH-stabilized sodium hypochlorite (NaOCl. Outcomes were self-reported hand feel, irritation as measured by the Hand Eczema Score Index (HECSI (range 0-360, signs of transmission risk (e.g., cracking, and dermatitis diagnosis. All groups experienced statistically significant increases in HECSI score. Subjects using sanitizer had the smallest increases, followed by higher pH chlorine solutions (HTH and stabilized NaOCl, and soap and water. The greatest increases were among neutral pH chlorine solutions (NaDCC and generated NaOCl. Signs of irritation related to higher transmission risk were observed most frequently in subjects using soap and least frequently by those using sanitizer or HTH. Despite these irritation increases, all methods represented minor changes in HECSI score. Average HECSI score was only 9.10 at endline (range 1-33 and 4% (4/91 of subjects were diagnosed with dermatitis, one each in four groups. Each handwashing method has benefits and drawbacks: soap is widely available and inexpensive, but requires water and does not inactivate the virus; sanitizer is easy-to use and effective but expensive and unacceptable to many communities, and chlorine is easy-to-use but difficult to produce properly and distribute. Overall, we recommend Ebola
Wolfe, Marlene K; Wells, Emma; Mitro, Brittany; Desmarais, Anne Marie; Scheinman, Pamela; Lantagne, Daniele
2016-01-01
To prevent disease transmission, 0.05% chlorine solution is commonly recommended for handwashing in Ebola Treatment Units. In the 2014 West Africa outbreak this recommendation was widely extended to community settings, although many organizations recommend soap and hand sanitizer over chlorine. To evaluate skin irritation caused by frequent handwashing that may increase transmission risk in Ebola-affected communities, we conducted a randomized trial with 91 subjects who washed their hands 10 times a day for 28 days. Subjects used soap and water, sanitizer, or one of four chlorine solutions used by Ebola responders (calcium hypochlorite (HTH), sodium dichloroisocyanurate (NaDCC), and generated or pH-stabilized sodium hypochlorite (NaOCl)). Outcomes were self-reported hand feel, irritation as measured by the Hand Eczema Score Index (HECSI) (range 0-360), signs of transmission risk (e.g., cracking), and dermatitis diagnosis. All groups experienced statistically significant increases in HECSI score. Subjects using sanitizer had the smallest increases, followed by higher pH chlorine solutions (HTH and stabilized NaOCl), and soap and water. The greatest increases were among neutral pH chlorine solutions (NaDCC and generated NaOCl). Signs of irritation related to higher transmission risk were observed most frequently in subjects using soap and least frequently by those using sanitizer or HTH. Despite these irritation increases, all methods represented minor changes in HECSI score. Average HECSI score was only 9.10 at endline (range 1-33) and 4% (4/91) of subjects were diagnosed with dermatitis, one each in four groups. Each handwashing method has benefits and drawbacks: soap is widely available and inexpensive, but requires water and does not inactivate the virus; sanitizer is easy-to use and effective but expensive and unacceptable to many communities, and chlorine is easy-to-use but difficult to produce properly and distribute. Overall, we recommend Ebola responders and
Febriana, Sri Awalia; Soebono, Hardyanto; Coenraads, Pieter-Jan
2014-02-01
Shoe manufacturing workers are exposed daily to an extensive range of potential physical and chemical occupational hazards. Shoe manufacturing in Indonesia is one of the industrial sectors that has shown sustained growth amongst the newly industrialized countries (NICs). In this study, we investigated the possible potential exposure of the workers to physical and occupational hazards and determined the prevalence of occupational skin diseases at a shoe manufacturing factory in Indonesia. A cross-sectional study on the observation of the working process and an inventory and risk assessment of exposure to the chemicals used. Classification of chemicals as potential sensitizers/irritants and qualitative assessments of these chemicals were done. Workers were examined and interviewed using the Nordic Occupational Skin Questionnaire-2002/LONG. The risk of Occupational skin diseases (OSD) at the shoe factory was mainly related to the exposure of the workers' skin to potential physical and chemical hazards in hot and humid environmental conditions. From a total of 514 workers, 8.5 % reported current OSD and 4.8 % reported a history of OSD. Occupational skin diseases were diagnosed in 29 % of the workers by dermatologists and 7.6 % had an occupational contact dermatitis (OCD). Of the 39 workers with contact dermatitis, 33 consented to being patch tested, 14 (3 %) workers showed a positive results and considered as having an occupational allergic contact dermatitis (OACD) and 25 (4.9 %) had an occupational irritant contact dermatitis (OICD). We observed a repeated and prolonged exposure of the workers to numerous physical and chemical skin hazards at this factory.
Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis
Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin
2016-01-01
Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054
Dermal safety assessment of Arm & Hammer laundry products formulated for sensitive skin.
Frederick, Douglas M; Vorwerk, Linda; Gupta, Archana; Ghassemi, Annahita
2017-09-01
The prevalence of sensitive skin among the general population in industrialized countries is reported to be over 50%. Sensitive skin subjects often report significant reactions to contact with cosmetics, soaps and other consumer products. This paper describes the overall skin compatibility and mildness program for a newly developed, lightly fragranced, colorant free laundry product (i.e. Arm & Hammer™ Sensitive Skin plus Skin-Friendly Fresh Scent), specially formulated for individuals with sensitive skin. The skin mildness of the product was compared to Arm & Hammer™ Free & Clear liquid laundry detergent with no fragrance or colorant, and an established history of safe use by sensitive skin consumers. The test material was a liquid laundry product with a light scent formulated for sensitive skin consumers (Arm & Hammer™ Sensitive Skin plus Skin-Friendly Fresh Scent). The product was compared to commercially marketed products for sensitive skin with a history of skin safety in the marketplace, including: a very similar product formulation (Arm & Hammer™ Free & Clear with no fragrance), and several selected competitors' products. Studies were conducted among individuals with self-assessed sensitive skin (based on a questionnaire) using standard protocols for the Human Repeat Insult Patch Test (HRIPT), 10-Day Cumulative Irritation, the Wrist Band Wear test, and the Safety In-Use testing. Responses in all protocols were evaluated by visual scoring of potential dermatologic reactions, and recording any sensory effects at the time of the examination. In addition, sensory effects collected from panelists' daily diaries were also evaluated. The HRIPT confirmed that neither the fragrance alone, nor the product formulation with fragrance, induced contact sensitization in sensitive skin subjects. The 10-Day cumulative irritation study conducted using sensitive skin subjects showed highly favorable skin compatibility, and the test product was comparable to the control
Molecular Mechanisms of Mouse Skin Tumor Promotion
International Nuclear Information System (INIS)
Rundhaug, Joyce E.; Fischer, Susan M.
2010-01-01
Multiple molecular mechanisms are involved in the promotion of skin carcinogenesis. Induction of sustained proliferation and epidermal hyperplasia by direct activation of mitotic signaling pathways or indirectly in response to chronic wounding and/or inflammation, or due to a block in terminal differentiation or resistance to apoptosis is necessary to allow clonal expansion of initiated cells with DNA mutations to form skin tumors. The mitotic pathways include activation of epidermal growth factor receptor and Ras/Raf/mitogen-activated protein kinase signaling. Chronic inflammation results in inflammatory cell secretion of growth factors and cytokines such as tumor necrosis factor-α and interleukins, as well as production of reactive oxygen species, all of which can stimulate proliferation. Persistent activation of these pathways leads to tumor promotion
Paul, Michelle; Kaur, Pritinder; Herson, Marisa; Cheshire, Perdita; Cleland, Heather; Akbarzadeh, Shiva
2015-10-01
Tissue-engineered composite skin is a promising therapy for the treatment of chronic and acute wounds, including burns. Providing the wound bed with a dermal scaffold populated by autologous dermal and epidermal cellular components can further entice host cell infiltration and vascularization to achieve permanent wound closure in a single stage. However, the high porosity and the lack of a supportive basement membrane in most commercially available dermal scaffolds hinders organized keratinocyte proliferation and stratification in vitro and may delay re-epithelization in vivo. The objective of this study was to develop a method to enable the in vitro production of a human skin equivalent (HSE) that included a porous scaffold and dermal and epidermal cells expanded ex vivo, with the potential to be used for definitive treatment of skin defects in a single procedure. A collagen-glycosaminoglycan dermal scaffold (Integra(®)) was populated with adult fibroblasts. A near-normal skin architecture was achieved by the addition of coagulated human plasma to the fibroblast-populated scaffold before seeding cultured keratinocytes. This resulted in reducing scaffold pore size and improving contact surfaces. Skin architecture and basement membrane formation was further improved by the addition of aprotinin (a serine protease inhibitor) to the culture media to inhibit premature clot digestion. Histological assessment of the novel HSE revealed expression of keratin 14 and keratin 10 similar to native skin, with a multilayered neoepidermis morphologically comparable to human skin. Furthermore, deposition of collagen IV and laminin-511 were detected by immunofluorescence, indicating the formation of a continuous basement membrane at the dermal-epidermal junction. The proposed method was efficient in producing an in vitro near native HSE using the chosen off-the-shelf porous scaffold (Integra). The same principles and promising outcomes should be applicable to other biodegradable
Proof-of-concept: 3D bioprinting of pigmented human skin constructs.
Ng, Wei Long; Qi, Jovina Tan Zhi; Yeong, Wai Yee; Naing, May Win
2018-01-23
Three-dimensional (3D) pigmented human skin constructs have been fabricated using a 3D bioprinting approach. The 3D pigmented human skin constructs are obtained from using three different types of skin cells (keratinocytes, melanocytes and fibroblasts from three different skin donors) and they exhibit similar constitutive pigmentation (pale pigmentation) as the skin donors. A two-step drop-on-demand bioprinting strategy facilitates the deposition of cell droplets to emulate the epidermal melanin units (pre-defined patterning of keratinocytes and melanocytes at the desired positions) and manipulation of the microenvironment to fabricate 3D biomimetic hierarchical porous structures found in native skin tissue. The 3D bioprinted pigmented skin constructs are compared to the pigmented skin constructs fabricated by conventional a manual-casting approach; in-depth characterization of both the 3D pigmented skin constructs has indicated that the 3D bioprinted skin constructs have a higher degree of resemblance to native skin tissue in term of the presence of well-developed stratified epidermal layers and the presence of a continuous layer of basement membrane proteins as compared to the manually-cast samples. The 3D bioprinting approach facilitates the development of 3D in vitro pigmented human skin constructs for potential toxicology testing and fundamental cell biology research.
DEFF Research Database (Denmark)
Green, M R; Couchman, J R
1985-01-01
, the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...
Kandárová, Helena; Bendova, Hana; Letasiova, Silvia; Coleman, Kelly P; De Jong, Wim H; Jírova, Dagmar
2018-01-01
Several irritants were used in the in vitro irritation medical device round robin. The objective of this study was to verify their irritation potential using the human patch test (HPT), an in vitro assay, and in vivo data. The irritants were lactic acid (LA), heptanoic acid (HA), sodium dodecyl
Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan
2015-03-01
The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.
Tc-99m-MDP scintigraphy in the evaluation of epidermal nevus syndrome
International Nuclear Information System (INIS)
Barbosa, M.N.S.; Cunha, M.O.; Severiche, A.F.A.; Ramos, C.D.; Etchebehere, E.C.S.C.; Belangero, W.; Camargo, E.E.
1997-01-01
Full text: Epidermal nevus syndrome has been described as a congenital neurocutaneous disorder in which epidermal nevi are associated with malformations of other organs, commonly the skeleton and central nervous system. Ocular, cardiac, and genitourinary system abnormalities, as well as other skin lesions, may also be seen. A 19 year old patient with epidermal nevus syndrome, presenting congenital facial epidermal nevi and bone deformity of the lower limbs (shortening of the left leg, left thigh varum, bilateral genu valgum, and multiple pathological fractures), as referred to the nuclear medicine laboratory to evaluate involvement of other sites of the skeleton. Whole body bone scintigraphy performed with MDP-Tc-99m showed multiple small focal areas of increased uptake in the skeleton, mainly in the upper and lower limbs, posterior ribs, right acetabulum, right sacroiliac joint, and right greater trochanter, interpreted as pathological fractures at different stages of remodeling. The range of skeletal findings in this condition is quite diverse. Many of these findings can be attributed to local tissue overgrowth with deformities and advanced bone age, associate with pathological fractures
Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.
Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira
2012-03-01
As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.
Delineating the cell death mechanisms associated with skin electroporation.
Schultheis, Katherine; Smith, Trevor R F; Kiosses, William B; Kraynyak, Kimberly A; Wong, Amelia; Oh, Janet; Broderick, Kate Elizabeth
2018-06-28
The immune responses elicited following delivery of DNA vaccines to the skin has previously been shown to be significantly enhanced by the addition of electroporation (EP) to the treatment protocol. Principally, EP increases the transfection of pDNA into the resident skin cells. In addition to increasing the levels of in vivo transfection, the physical insult induced by EP is associated with activation of innate pathways which are believed to mediate an adjuvant effect, further enhancing DNA vaccine responses. Here, we have investigated the possible mechanisms associated with this adjuvant effect, primarily focusing on the cell death pathways associated with the skin EP procedure independent of pDNA delivery. Using the minimally invasive CELLECTRA®-3P intradermal electroporation device that penetrates the epidermal and dermal layers of the skin, we have investigated apoptotic and necrotic cell death in relation to the vicinity of the electrode needles and electric field generated. Employing the well-established TUNEL assay, we detected apoptosis beginning as early as one hour after EP and peaking at the 4 hour time point. The majority of the apoptotic events were detected in the epidermal region directly adjacent to the electrode needle. Using a novel propidium iodide in vivo necrotic cell death assay, we detected necrotic events concentrated in the epidermal region adjacent to the electrode. Furthermore, we detected up-regulation of calreticulin expression on skin cells after EP, thus labeling these cells for uptake by dendritic cells and macrophages. These results allow us to delineate the cell death mechanisms occurring in the skin following intradermal EP independently of pDNA delivery. We believe these events contribute to the adjuvant effect observed following electroporation at the skin treatment site.
Phillips, Kevin G.; Wang, Yun; Choudhury, Niloy; Levitz, David; Swanzey, Emily; Lagowski, James; Kulesz-Martin, Molly; Jacques, Steven
2012-02-01
Psoriasis is a common inflammatory skin disease resulting from genetic and environmental alterations of cutaneous immune responses responsible for skin homeostasis. While numerous therapeutic targets involved in the immunopathogenesis of psoriasis have been identified, the in vivo dynamics of psoriasis remains under investigated. To elucidate the spatial-temporal morphological evolution of psoriasis we undertook in vivo time course focus-tracked optical coherence tomography (OCT) imaging to non-invasively document dermal alterations due to immune cell infiltration and epidermal hyperplasia in an Imiquimod (IMQ) induced model of psoriasis-like inflammation in DBA2/C57Bl6 hybrid mice. Quantitative appraisal of dermal architectural changes was achieved through a three parameter fit of OCT axial scans in the dermis of the form A(z) = ρ exp(-mu;z +ɛ(z)). Ensemble averaging of the fit parameters over 2000 axial scans per mouse in each treatment arm revealed that the local dermal reflectivity ρ, decreased significantly in response to 6 day IMQ treatment (p = 0.0001), as did the standard deviation of the attenuation fluctuation std(ɛ(z)), (p = 0.04), in comparison to cream controls and day 1 treatments. No significant changes were observed in the average dermal attenuation rate, μ. Our results suggest these label-free OCT-based metrics can be deployed to investigate new therapeutic targets in animal models as well as aid in clinical staging of psoriasis in conjunction with the psoriasis area and severity index.
Epidermal electronics with advanced capabilities in near-field communication.
Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A
2015-02-25
Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B
2000-01-01
Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.
Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism
International Nuclear Information System (INIS)
He, D.; Lim, H.W.
1991-01-01
This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes
Morphological and clinical characteristics of the head epidermal skin carcinomas
Directory of Open Access Journals (Sweden)
Mijović M.
2015-01-01
Full Text Available The most common skin malignant tumor of the epidermoid origin are basal cell (BCC and squamous cell (SCC carcinoma. They occur at the photoexposed parts of the body in 90% of cases and are directly associated with skin damage caused by long term exposure to UV rays, usually in older persons and light skin. Almost 65,000 people die annually in the world from their consequences. The most important link in preventing the occurrence of these tumors is prevention, but their early identification allows adequate surgical treatment with sparing surrounding tissue. The main objective of this paper is to examine the histopathological and clinical-morphological characteristics of BCC and SCC of the skin of the head. The analysis included 439 cancer (297 (67.7% BCC, 126 (28.7% SCK and 16 (3.6% BCK + SCK, among which over 60% were diagnosed in men, usually in the seventh and eighth decade of life, with the highest incidence of BCC on the nose or on the skin of the upper half of the face and SCK on the lips or the skin of the lower half of face. All skin cancers of the head were more common on the right side. Clinical and morphological, most of the BCC were manifested by ulcerative form of average size 1.2cm and mixed histological type, and SCK by vegetative form of average size 1.55cm and histological grade I. The highest number of BCC and SCC was completly removed, in contrast to the combination of these two tumors among them in most cases the subsequent surgical intervention was necessary.
Directory of Open Access Journals (Sweden)
Constanze Jonak
Full Text Available BACKGROUND: In clinical diagnostics, as well as in routine dermatology, the increased need for non-invasive diagnosis is currently satisfied by reflectance laser scanning microscopy. However, this technique has some limitations as it relies solely on differences in the reflection properties of epidermal and dermal structures. To date, the superior method of fluorescence laser scanning microscopy is not generally applied in dermatology and predominantly restricted to fluorescein as fluorescent tracer, which has a number of limitations. Therefore, we searched for an alternative fluorophore matching a novel skin imaging device to advance this promising diagnostic approach. METHODOLOGY/PRINCIPAL FINDINGS: Using a Vivascope®-1500 Multilaser microscope, we found that the fluorophore Indocyanine-Green (ICG is well suited as a fluorescent marker for skin imaging in vivo after intradermal injection. ICG is one of few fluorescent dyes approved for use in humans. Its fluorescence properties are compatible with the application of a near-infrared laser, which penetrates deeper into the tissue than the standard 488 nm laser for fluorescein. ICG-fluorescence turned out to be much more stable than fluorescein in vivo, persisting for more than 48 hours without significant photobleaching whereas fluorescein fades within 2 hours. The well-defined intercellular staining pattern of ICG allows automated cell-recognition algorithms, which we accomplished with the free software CellProfiler, providing the possibility of quantitative high-content imaging. Furthermore, we demonstrate the superiority of ICG-based fluorescence microscopy for selected skin pathologies, including dermal nevi, irritant contact dermatitis and necrotic skin. CONCLUSIONS/SIGNIFICANCE: Our results introduce a novel in vivo skin imaging technique using ICG, which delivers a stable intercellular fluorescence signal ideal for morphological assessment down to sub-cellular detail. The application of
Andersen, Hjalte H; Melholt, Camilla; Hilborg, Sigurd D; Jerwiarz, Anne; Randers, Amalie; Simoni, Amalie; Elberling, Jesper; Arendt-Nielsen, Lars
2017-01-04
A frequent empirical observation is that cold-induced counter-irritation may attenuate itch. The aim of this randomized, single-blinded, exploratory study was to evaluate the counter-irritation effects of cold-stimulation and topical application of transient receptor potential TRPA1/M8-agonists (trans-cinnamaldehyde/L-menthol, respectively), on histamine-induced itch, wheals and neurogenic inflammation in 13 healthy volunteers. Histamine 1% was applied to the volar forearms using skin prick-test lancets. Recorded outcome-parameters were itch intensity, wheal reactions, and neurogenic inflammation (measured by laser-speckle perfusion-imaging). Homotopic thermal counter-irritation was performed with 6 temperatures, ranging from 4°C to 37°C, using a 3 × 3-cm thermal stimulator. Chemical "cold-like" counter-irritation was conducted with 40% L-menthol and 10% trans-cinnamaldehyde, while 5% doxepin was used as a positive antipruritic control/comparator. Cold counter-irritation stimuli from 4°C to 22°C inhibited itch in a stimulus-intensity-dependent manner (p cold-like" counter-irritation with both L-menthol and trans-cinnamaldehyde had antipruritic efficacy similar to doxepin (p Cold-induced counter-irritation had an inhibitory effect on histaminergic itch, suggesting that agonists of cold transduction receptors could be of potential antipruritic value.
Mawson, Anthony R; Eriator, Ike; Karre, Sridhar
2015-01-12
Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.
Oral warfarin intake affects skin inflammatory cytokine responses in rats.
Aleksandrov, Aleksandra Popov; Mirkov, Ivana; Zolotarevski, Lidija; Ninkov, Marina; Mileusnic, Dina; Kataranovski, Dragan; Kataranovski, Milena
2017-09-01
Warfarin is an anticoagulant used in prevention/prophylaxis of thromboembolism. Besides the effects on coagulation, non-hemorrhagic reactions have also been documented. Although cutaneous reactions were reported in some patients, the impact on skin immunity was not explored. In the present paper, the effect of 30-day oral warfarin intake on skin cytokine responses in rats was analyzed. Increased release of inflammatory cytokines (TNF, IL-1β and IL-10) was noted by skin explants from rats which received warfarin, but without effect on IL-6. No impact on epidermal cell cytokine secretion was seen, except a tendency of an increase of IL-6 response to stimulation with microbial product lipopolysaccharide (LPS). Topical application of contact allergen dinitrochlorobenzene (DNCB) resulted in slight (numerical solely) increase of TNF release by skin explants of warfarin-treated animals, while epidermal cells responded by increased secretion of all four cytokines examined. The data presented provide new information on the potential of oral warfarin to modulate skin innate immune activity. Copyright © 2017 Elsevier B.V. All rights reserved.
Kendall, Alexandra; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke; Harwood, John L.; Nicolaou, Anna
2017-01-01
Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, deri...
Ezerskaia, A.; Pereira, S.F.; Urbach, Paul; Varghese, Babu; Popp, Jürgen; Tuchin, Valery V.; Matthews, Dennis L.; Pavone, Francesco S.
2016-01-01
Skin health characterized by a system of water and lipids in Stratum Corneum provide protection from harmful external elements and prevent trans-epidermal water loss. Skin hydration (moisture) and sebum (skin surface lipids) are considered to be important factors in skin health; a right balance
Effects of soap-water wash on human epidermal penetration.
Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard
2016-08-01
Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the
Association of Diet With Skin Histological Features in UV-B-Exposed Mice.
Bhattacharyya, Tapan K; Hsia, Yvonne; Weeks, David M; Dixon, Tatiana K; Lepe, Jessica; Thomas, J Regan
2017-09-01
Long-term exposure to solar radiation produces deleterious photoaging of the skin. It is not known if diet can influence skin photoaging. To study the influence of a calorie-restricted diet and an obesity diet in mice exposed to long-term UV-B irradiation to assess if there is an association between diet and histopathological response to UV-B irradiation. In this animal model study in an academic setting, the dorsal skin of SKH1 hairless mice receiving normal, calorie-restricted, and obesity diets was exposed to UV-B irradiation 3 times a week for 10 weeks and were compared with corresponding controls. The mice were placed in the following groups, with 8 animals in each group: (1) intact control (C) with regular diet and no UV-B exposure, (2) intact control with UV-B exposure (CR), (3) calorie-restricted diet (CrC), (4) calorie-restricted diet with UV-B exposure (CrR), (5) obesity diet (OC), and (6) obesity diet with UV-B exposure (OR). The experiment was conducted during October through December 2013. Tissue processing and histological analysis were completed in 2016. Histomorphometric analysis was performed on paraffin-embedded skin sections stained by histological and immunohistochemical methods for estimation of epidermal thickness, epidermal proliferating cell nuclear antigen index, collagen I, elastic fibers, fibroblasts, mast cells, dermal cellularity, and adipose layer ratio. Changes in wrinkles were noted. Hairless female mice (age range, 6-8 weeks) were obtained. With a normal diet, changes from UV-B irradiation occurred in epidermal thickness, epidermal proliferating cell nuclear antigen index, collagen I, elastic fibers, fibroblasts, and mast cells, which were modestly influenced by an obesity diet. Calorie restriction influenced the skin in nonirradiated control animals, with higher values for most variables. After UV-B exposure in animals with calorie restriction, epidermal thickness was increased, but other variables were unaffected. Animals
Pediatric Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Halted by Etanercept.
Gavigan, Geneviève M; Kanigsberg, Nordau D; Ramien, Michele L
2018-02-01
We report a case of an 11-year-old female with Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) overlap, most likely triggered by sulfamethoxazole-trimethoprim, who was treated with the combination of methylprednisolone, cyclosporine, and etanercept. Her condition stabilized and her skin involvement did not progress after the addition of etanercept. To our knowledge, this is the first report of etanercept for pediatric SJS/TEN.
International Nuclear Information System (INIS)
Hunter, R.D.
1985-01-01
Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment
A Case of Peeling Skin Syndrome.
Singhal, Anil K; Yadav, Devendra K; Soni, Bajrang; Arya, Savita
2017-01-01
Peeling skin syndrome is a very rare autosomal recessive disease characterized by widespread painless peeling of the skin in superficial sheets. Etiology is still unknown with an autosomal recessive inheritance. Less than 100 cases have been reported in the medical literature. We present a 32-year-old man having asymptomatic peeling of skin since birth. Sheets of skin were peeling from his neck, trunk, and extremities, following friction or rubbing especially if pre-soaked in water but sparing palm and soles. Histologically, there was epidermal separation at the level of stratum corneum, just above the stratum granulosum. This case is being presented due to its rarity.
A case of peeling skin syndrome
Directory of Open Access Journals (Sweden)
Anil K Singhal
2017-01-01
Full Text Available Peeling skin syndrome is a very rare autosomal recessive disease characterized by widespread painless peeling of the skin in superficial sheets. Etiology is still unknown with an autosomal recessive inheritance. Less than 100 cases have been reported in the medical literature. We present a 32-year-old man having asymptomatic peeling of skin since birth. Sheets of skin were peeling from his neck, trunk, and extremities, following friction or rubbing especially if pre-soaked in water but sparing palm and soles. Histologically, there was epidermal separation at the level of stratum corneum, just above the stratum granulosum. This case is being presented due to its rarity.
Directory of Open Access Journals (Sweden)
Singh Sanjay
1991-01-01
Full Text Available Six commonly used shampoos were tested for their relative irritancies using Kligman and Wooding′s technique. Shampoos in increasing order of irritancies were Halo egg, Aqua dermis, Clinic plus, Sunsilk, Velvette black and Mediker.
Stem Cells in Skin Regeneration, Wound Healing, and Their Clinical Applications.
Ojeh, Nkemcho; Pastar, Irena; Tomic-Canic, Marjana; Stojadinovic, Olivera
2015-10-23
The skin is the largest organ of the body and has an array of functions. Skin compartments, epidermis, and hair follicles house stem cells that are indispensable for skin homeostasis and regeneration. These stem cells also contribute to wound repair, resulting in restoration of tissue integrity and function of damaged tissue. Unsuccessful wound healing processes often lead to non-healing wounds. Chronic wounds are caused by depletion of stem cells and a variety of other cellular and molecular mechanisms, many of which are still poorly understood. Current chronic wound therapies are limited, so the search to develop better therapeutic strategies is ongoing. Adult stem cells are gaining recognition as potential candidates for numerous skin pathologies. In this review, we will discuss epidermal and other stem cells present in the skin, and highlight some of the therapeutic applications of epidermal stem cells and other adult stem cells as tools for cell/scaffold-based therapies for non-healing wounds and other skin disorders. We will also discuss emerging concepts and offer some perspectives on how skin tissue-engineered products can be optimized to provide efficacious therapy in cutaneous repair and regeneration.
Stratum corneum biomarkers for inflammatory skin diseases
Koppes, S.A.
2017-01-01
This thesis focusses on development of biomarkers, obtained by a non-invasive sampling method, for skin inflammatory diseases relevant for occupational settings; irritant contact dermatitis (ICD), allergic contact dermatitis (ACD) and atopic dermatitis (AD). In various studies, in which different
Franssen, M.E.J.; Boezeman, J.B.M.; Kerkhof, P.C.M. van de; Erp, P.E.J. van
2004-01-01
BACKGROUND: Monitoring dynamics of different cell populations in solid tissues using flow cytometry has several limitations. The interaction and changes in epidermal subpopulations in hyperproliferative skin disorders such as psoriasis, a very common chronic inflammatory skin disease, may, however,
Ponec, Maria; El Ghalbzouri, Abdoelwaheb; Dijkman, Remco; Kempenaar, Johanna; van der Pluijm, Gabri; Koolwijk, Pieter
2004-01-01
A human skin equivalent from a single skin biopsy harboring keratinocytes and melanocytes in the epidermal compartment, and fibroblasts and microvascular dermal endothelial cells in the dermal compartment was developed. The results of the study revealed that the nature of the extracellular matrix of the dermal compartments plays an important role in establishment of endothelial network in vitro. With rat-tail type I collagen matrices only lateral but not vertical expansion of endothelial networks was observed. In contrast, the presence of extracellular matrix of entirely human origin facilitated proper spatial organization of the endothelial network. Namely, when human dermal fibroblasts and microvascular endothelial cells were seeded on the bottom of an inert filter and subsequently epidermal cells were seeded on top of it, fibroblasts produced extracellular matrix throughout which numerous branched tubes were spreading three-dimensionally. Fibroblasts also facilitated the formation of basement membrane at the epidermal/matrix interface. Under all culture conditions, fully differentiated epidermis was formed with numerous melanocytes present in the basal epidermal cell layer. The results of the competitive RT-PCR revealed that both keratinocytes and fibroblasts expressed VEGF-A, -B, -C, aFGF and bFGF mRNA, whereas fibroblasts also expressed VEGF-D mRNA. At protein level, keratinocytes produced 10 times higher amounts of VEGF-A than fibroblasts did. The generation of multicellular skin equivalent from a single human skin biopsy will stimulate further developments for its application in the treatment of full-thickness skin defects. The potential development of biodegradable, biocompatible material suitable for these purposes is a great challenge for future research.
Zheng, Yin; Ouyang, Wu-Qing; Wei, Yun-Peng; Syed, Shahid Faraz; Hao, Chao-Shuang; Wang, Bo-Zhen; Shang, Yan-Hong
Nanoemulsions (NEs) are used as transdermal drug delivery systems for systematic therapeutic purposes. We hypothesized that the skin permeation profile of an NE could be modulated by incorporating it into a hydrogel containing differing proportions of thickening agent. The objectives of this study were as follows: 1) to determine the stability and skin irritability of NE gels (NGs) containing 1%, 2%, and 3% (w/w) Carbopol ® 934 (CP934) (termed NG1, NG2, and NG3, respectively); 2) to compare the skin permeation profiles and drug deposition patterns of the NGs; and 3) to visualize the drug delivery routes of the NGs. Terbinafine and citral were incorporated into the NGs as model drugs. Ex vivo skin permeation tests indicated that the percutaneous flux rates of terbinafine decreased in the order NE (215 μg/cm 2 ) > NG1 (213 μg/cm 2 ) > NG2 (123 μg/cm 2 ) > NG3 (74.3 μg/cm 2 ). The flux rates of citral decreased in the order NE (1,026 μg/cm 2 ) > NG1 (1,021 μg/cm 2 ) > NG2 (541 μg/cm 2 ) > NG3 (353 μg/cm 2 ). The NGs accumulated greater amounts of the drugs in the stratum corneum and less in the epidermis/dermis than did the NE ( P drug delivery routes from skin appendages to intercellular paths. Histological images suggested that perturbations to the skin structure, specifically the size of the epidermal intercellular spaces and the separation distance of dermal collagen bundles, could be significantly minimized by increasing the proportion of CP934. These results suggest that adjustments of the CP934 proportions can be used to modulate the skin permeation profiles of NGs for specific therapeutic purposes.
... your belly area), constipation (when you can't poop), and diarrhea (when you poop too much). If you have irritable bowel syndrome, ... food particles are also known as stool, a bowel movement, or poop. Here's why an intestine gets "irritable." ...
Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren
2017-01-01
The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report fo...
Svaasand, Lars O; Nelson, J Stuart
2004-01-01
The physical basis for optimization of wavelength, pulse duration, and cooling for laser-induced selective photothermolysis of hair follicles in human skin is discussed. The results indicate that the most important optimization parameter is the cooling efficiency of the technique utilized for epidermal protection. The optical penetration is approximately the same for lasers at 694, 755, and 800 nm. The penetration of radiation from Nd:yttrium-aluminum-garnet lasers at 1064 nm is, however, somewhat larger. Photothermal damage to the follicle is shown to be almost independent of laser pulse duration up to 100 ms. The results reveal that epidermal cooling by a 30-80-ms-long cryogen spurt immediately before laser exposure is the only efficient technique for laser pulse durations less than 10 ms. For longer pulse durations in the 30-100 ms range, protection can be done efficiently by skin cooling during laser exposure. For laser pulses of 100 ms, an extended precooling period, e.g., by bringing a cold object into good thermal contact with the skin for about 1 s, can be of value. Thermal quenching of laser induced epidermal temperature rise after pulsed exposure can most efficiently be done with a 20 ms cryogen spurt applied immediately after irradiation. (c) 2004 Society of Photo-Optical Instrumentation Engineers.
Skin barrier properties in patients with recessive X-linked ichthyosis
DEFF Research Database (Denmark)
Johansen, J D; Ramsing, D; Vejlsgaard, G
1995-01-01
Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...
Photodynamic therapy improves the ultraviolet-irradiated hairless mice skin
Jorge, Ana Elisa S.; Hamblin, Michael R.; Parizotto, Nivaldo A.; Kurachi, Cristina; Bagnato, Vanderlei S.
2014-03-01
Chronic exposure to ultraviolet (UV) sunlight causes premature skin aging. In light of this fact, photodynamic therapy (PDT) is an emerging modality for treating cancer and other skin conditions, however its response on photoaged skin has not been fully illustrated by means of histopathology. For this reason, the aim of this study was analyze whether PDT can play a role on a mouse model of photoaging. Hence, SKH-1 hairless mice were randomly allocated in two groups, UV and UV/PDT. The mice were daily exposed to an UV light source (280-400 nm: peak at 350 nm) for 8 weeks followed by a single PDT session using 20% 5-aminolevulinic acid (ALA) topically. After the proper photosensitizer accumulation within the tissue, a non-coherent red (635 nm) light was performed and, after 14 days, skin samples were excised and processed for light microscopy, and their sections were stained with hematoxylin-eosin (HE) and Masson's Trichrome. As a result, we observed a substantial epidermal thickening and an improvement in dermal collagen density by deposition of new collagen fibers on UV/PDT group. These findings strongly indicate epidermal and dermal restoration, and consequently skin restoration. In conclusion, this study provides suitable evidences that PDT improves the UV-irradiated hairless mice skin, supporting this technique as an efficient treatment for photoaged skin.
Connexins and pannexins in the integumentary system: the skin and appendages.
Faniku, Chrysovalantou; Wright, Catherine S; Martin, Patricia E
2015-08-01
The integumentary system comprises the skin and its appendages, which includes hair, nails, feathers, sebaceous and eccrine glands. In this review, we focus on the expression profile of connexins and pannexins throughout the integumentary system in mammals, birds and fish. We provide a picture of the complexity of the connexin/pannexin network illustrating functional importance of these proteins in maintaining the integrity of the epidermal barrier. The differential regulation and expression of connexins and pannexins during skin renewal, together with a number of epidermal, hair and nail abnormalities associated with mutations in connexins, emphasize that the correct balance of connexin and pannexin expression is critical for maintenance of the skin and its appendages with both channel and non-channel functions playing profound roles. Changes in connexin expression during both hair and feather regeneration provide suggestions of specialized communication compartments. Finally, we discuss the potential use of zebrafish as a model for connexin skin biology, where evidence mounts that differential connexin expression is involved in skin patterning and pigmentation.
The epidermal biosynthesis of cholecalciferol (vitamin D3)
International Nuclear Information System (INIS)
Beadle, P.C.
1977-01-01
An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)
McKnight, Braden; Seidel, Rachel; Moy, Ron
2015-10-01
Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.
A co-cultured skin model based on cell support membranes
International Nuclear Information System (INIS)
Dai, N.-T.; Yeh, M.-K.; Liu, Demeral David; Adams, E.F.; Chiang, C.-H.; Yen, C.-Y.; Shih, C.-M.; Sytwu, H.-K.; Chen, Tim-Mo; Wang, H.-J.; Williamson, M.R.; Coombes, A.G.A.
2005-01-01
Tissue engineering of skin based on collagen: PCL biocomposites using a designed co-culture system is reported. The collagen: PCL biocomposites having collagen: PCL (w/w) ratios of 1:4, 1:8, and 1:20 have been proven to be biocompatible materials to support both adult normal human epidermal Keratinocyte (NHEK) and mouse 3T3 fibroblast growth in cell culture, respectively, by Dai, Coombes, et al. in 2004. Films of collagen: PCL biocomposites were prepared using non-crosslinking method by impregnation of lyophilized collagen mats with PCL/dichloromethane solutions followed by solvent evaporation. To mimic the dermal/epidermal structure of skin, the 1:20 collagen: PCL biocomposites were selected for a feasibility study of a designed co-culture technique that would subsequently be used for preparing fibroblast/biocomposite/keratinocyte skin models. A 55.3% increase in cell number was measured in the designed co-culture system when fibroblasts were seeded on both sides of a biocomposite film compared with cell culture on one surface of the biocomposite in the feasibility study. The co-culture of human keratinocytes and 3T3 fibroblasts on each side of the membrane was therefore studied using the same co-culture system by growing keratinocytes on the top surface of membrane for 3 days and 3T3 fibroblasts underneath the membrane for 6 days. Scanning electron microscopy (SEM) and immunohistochemistry assay revealed good cell attachment and proliferation of both human keratinocytes and 3T3 fibroblasts with these two types of cells isolated well on each side of the membrane. Using a modified co-culture technique, a co-cultured skin model presenting a confluent epidermal sheet on one side of the biocomposite film and fibroblasts populated on the other side of the film was developed successfully in co-culture system for 28 days under investigations by SEM and immunohistochemistry assay. Thus, the design of a co-culture system based on 1:20 (w/w) collagen: PCL biocomposite
Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin.
Pellerin, Laurence; Henry, Julie; Hsu, Chiung-Yueh; Balica, Stéfana; Jean-Decoster, Catherine; Méchin, Marie-Claire; Hansmann, Britta; Rodriguez, Elke; Weindinger, Stefan; Schmitt, Anne-Marie; Serre, Guy; Paul, Carle; Simon, Michel
2013-04-01
Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by a disturbed epidermal barrier. In a subset of patients, this is explained by nonsense mutations in the gene encoding filaggrin (FLG). We sought to evaluate the respective role of FLG mutations and proinflammatory cytokines and to assess the expression of FLG, hornerin (HRNR), and FLG2, 2 FLG-like proteins, which are involved in epidermal barrier functions, in normal skin and both lesional and nonlesional skin of patients with AD. An FLG-genotyped cohort of 73 adults with AD and 73 aged-matched control subjects was analyzed by using immunohistochemistry and immunoblotting. Normal primary human keratinocytes were differentiated in either the absence or presence of IL-4, IL-13, and IL-25. Compared with control subjects, FLG, HRNR, and FLG2 were detected at significantly lower levels in the skin of patients with AD, irrespective of their FLG genotype. The reduction was greater in lesional compared with nonlesional skin. In addition, the proFLG/FLG ratio was found to be higher in the skin of wild-type patients than in control subjects. Cytokine treatment of keratinocytes induced a dramatic reduction in FLG, FLG2, and HRNR expression both at the mRNA and protein levels. The stratum corneum of lesional but also clinically unaffected skin of adults with AD is abnormal, with reduced expression of FLG and FLG-like proteins. In addition to nonsense mutations, proinflammatory cytokines and some defects in the proFLG processing can contribute to the FLG downregulation. Our study suggests that skin inflammation reduces the expression of FLG-like proteins, contributing to the AD-related epidermal barrier dysfunction. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Meckfessel, Matthew H; Brandt, Staci
2014-07-01
Ceramides (CERs) are epidermal lipids that are important for skin barrier function. Much research has been devoted to identifying the numerous CERs found in human skin and their function. Alterations in CER content are associated with a number of skin diseases such as atopic dermatitis. Newer formulations of skin-care products have incorporated CERs into their formulations with the goal of exogenously applying CERs to help skin barrier function. CERs are a complex class of molecules and because of their growing ubiquity in skin-care products, a clear understanding of their role in skin and use in skin-care products is essential for clinicians treating patients with skin diseases. This review provides an overview of the structure, function, and importance of skin CERs in diseased skin and how CERs are being used in skin-care products to improve or restore skin barrier function. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
A novel role of RASSF9 in maintaining epidermal homeostasis.
Directory of Open Access Journals (Sweden)
Chiou-Mei Lee
Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.
Epidermal stem cells response to radiative genotoxic stress
International Nuclear Information System (INIS)
Marie, Melanie
2013-01-01
Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global
DEFF Research Database (Denmark)
Green, M R; Couchman, J R
1984-01-01
on the binding distribution of [125I]EGF, representing the tissue localization of available EGF receptors, during embryonic rat skin development including hair follicle formation and the adult hair growth cycle. At 16 days embryonic development a relatively low receptor density is seen over all the epidermal...... condensates marking the first stage of hair follicle development. This restricted and temporary loss of EGF receptors above these specialized mesenchymal condensates implies a role for the EGF receptor and possibly EGF or an EGF-like ligand in stimulating the epithelial downgrowth required for hair follicle...... development. In the anagen hair bulb, receptors for EGF are detected over the outer root sheath and the epithelial cell layers at the base of the follicle and show a correlation with the areas of epithelial proliferation in the hair bulb. During the catagen and telogen phases of the hair cycle, receptors...
High resolution skin colorimetry, strain mapping and mechanobiology.
Devillers, C; Piérard-Franchimont, C; Schreder, A; Docquier, V; Piérard, G E
2010-08-01
Skin colours are notoriously different between individuals. They are governed by ethnicities and phototypes, and further influenced by a variety of factors including photoexposures and sustained mechanical stress. Indeed, mechanobiology is a feature affecting the epidermal melanization. High-resolution epiluminescence colorimetry helps in deciphering the effects of forces generated by Langer's lines or relaxed skin tension lines on the melanocyte activity. The same procedure shows a prominent laddering pattern of melanization in striae distensae contrasting with the regular honeycomb pattern in the surrounding skin.
Walker, S L; Morris, J; Chu, A C; Young, A R
1994-01-01
The UVB sunscreen 2-ethylhexyl-4'-methoxycinnamate was evaluated in hairless albino mouse skin for its ability to inhibit UVR-induced (i) oedema, (ii) epidermal Langerhans cell (Ia+) depletion and (iii) suppression of the alloactivating capacity of epidermal cells (mixed epidermal cell-lymphocyte reaction, MECLR). The sunscreen, prepared at 9% in ethanol or a cosmetic lotion, was applied prior to UVB/UVA irradiation. In some experiments there was a second application halfway through the irradiation. Single applications in both vehicles gave varying degrees of protection from oedema and Langerhans cell depletion but afforded no protection from suppression of MECLR. When the sunscreens were applied twice there was improved protection from oedema and Langerhans cell depletion and complete protection was afforded from suppression of MECLR. There was a clear linear relationship between Langerhans cell numbers and oedema with and without sunscreen application. The relationship between Langerhans cell numbers and MECLR was more complex. These data confirm published discrepancies between protection from oedema (a model for human erythema) and endpoints with immunological significance, but show that 2-ethylhexyl-4'-methoxycinnamate can afford complete immunoprotection, although protection is dependent on the application rate and vehicle.
Abadie, S; Jardet, C; Colombelli, J; Chaput, B; David, A; Grolleau, J-L; Bedos, P; Lobjois, V; Descargues, P; Rouquette, J
2018-05-01
Human skin is composed of the superimposition of tissue layers of various thicknesses and components. Histological staining of skin sections is the benchmark approach to analyse the organization and integrity of human skin biopsies; however, this approach does not allow 3D tissue visualization. Alternatively, confocal or two-photon microscopy is an effective approach to perform fluorescent-based 3D imaging. However, owing to light scattering, these methods display limited light penetration in depth. The objectives of this study were therefore to combine optical clearing and light-sheet fluorescence microscopy (LSFM) to perform in-depth optical sectioning of 5 mm-thick human skin biopsies and generate 3D images of entire human skin biopsies. A benzyl alcohol and benzyl benzoate solution was used to successfully optically clear entire formalin fixed human skin biopsies, making them transparent. In-depth optical sectioning was performed with LSFM on the basis of tissue-autofluorescence observations. 3D image analysis of optical sections generated with LSFM was performed by using the Amira ® software. This new approach allowed us to observe in situ the different layers and compartments of human skin, such as the stratum corneum, the dermis and epidermal appendages. With this approach, we easily performed 3D reconstruction to visualise an entire human skin biopsy. Finally, we demonstrated that this method is useful to visualise and quantify histological anomalies, such as epidermal hyperplasia. The combination of optical clearing and LSFM has new applications in dermatology and dermatological research by allowing 3D visualization and analysis of whole human skin biopsies. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Susan John
Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.
cFLIP Regulates Skin Homeostasis and Protects against TNF-Induced Keratinocyte Apoptosis
Directory of Open Access Journals (Sweden)
Diana Panayotova-Dimitrova
2013-10-01
Full Text Available FADD, caspase-8, and cFLIP regulate the outcome of cell death signaling. Mice that constitutively lack these molecules die at an early embryonic age, whereas tissue-specific constitutive deletion of FADD or caspase-8 results in inflammatory skin disease caused by increased necroptosis. The function of cFLIP in the skin in vivo is unknown. In contrast to tissue-specific caspase-8 knockout, we show that mice constitutively lacking cFLIP in the epidermis die around embryonic days 10 and 11. When cFLIP expression was abrogated in adult skin of cFLIPfl/fl-K14CreERtam mice, severe inflammation of the skin with concomitant caspase activation and apoptotic, but not necroptotic, cell death developed. Apoptosis was dependent of autocrine tumor necrosis factor production triggered by loss of cFLIP. In addition, epidermal cFLIP protein was lost in patients with severe drug reactions associated with epidermal apoptosis. Our data demonstrate the importance of cFLIP for the integrity of the epidermis and for silencing of spontaneous skin inflammation.
DEFF Research Database (Denmark)
Mellergaard, Stig; Nielsen, Else
1997-01-01
and the disease prevalence in the present case, the disease pattern showed evident similarities with formerly described oxygen deficiency-induced outbreaks of lymphocystis and epidermal papilloma in dab in the Kattegat. In 1988, the prevalence of lymphocystis and epidermal papilloma increased significantly...
DEFF Research Database (Denmark)
Kuntsche, Judith; Herre, Angela; Fahr, Alfred
2013-01-01
barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...
Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.
Draelos, Zoe D
2005-01-01
The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.
Stratum corneum damage and ex vivo porcine skin water absorption - a pilot study
DEFF Research Database (Denmark)
Duch Lynggaard, C; Bang Knudsen, D; Jemec, G B E
2009-01-01
A simple ex vivo screening technique would be of interest for mass screening of substances for potential barrier disruptive qualities. Ex vivo water absorption as a marker of skin barrier integrity was studied on pig ear skin. Skin water absorption was quantified by weighing and weight changes were...... found to reflect prehydration barrier damage. It is suggested that this simple model may be elaborated to provide a rapid, economical screening tool for potential skin irritants....
Occupational skin diseases in Czech healthcare workers from 1997 to 2009.
Machovcová, A; Fenclová, Z; Pelclová, D
2013-04-01
The healthcare sector ranked in second place among economic sectors in the Czech Republic, with about 11.4 % of all occupational diseases in 2009. Skin diseases constituted about 20 % of all occupational diseases. The aim of this study was to analyze the causes and trends in allergic and irritant-induced skin diseases in the healthcare sector. The data concerning occupational skin diseases (Chapter IV of the Czech List of Occupational Diseases, non-infectious skin illnesses) in the healthcare sector were analyzed from the Czech National Registry of Occupational Diseases from 1997 until 2009. The trends in the total counts and most frequent causes were evaluated. During the past 13 years, a total of 545 skin diseases were acknowledged in healthcare workers. Allergic contact dermatitis was diagnosed in 464 (85 %), irritant contact dermatitis in 71 (13 %) and contact urticaria in 10 subjects (2 %). Ninety-five percent of the patients were females. The overall incidence in individual years varied between 1.0 and 2.9 cases per 10,000 full-time employees per year. Disinfectants were the most frequent chemical agents causing more than one third of all allergic skin diseases (38 %), followed by rubber components (32 %) and cleaning agents (10 %). A general downward trend of diagnosed cases of occupational skin diseases in heath care workers in the Czech Republic over the past 13 years was demonstrated.
In vivo diagnosis of skin cancer using polarized and multiple scattered light spectroscopy
Bartlett, Matthew Allen
This thesis research presents the development of a non-invasive diagnostic technique for distinguishing between skin cancer, moles, and normal skin using polarized and multiple scattered light spectroscopy. Polarized light incident on the skin is single scattered by the epidermal layer and multiple scattered by the dermal layer. The epidermal light maintains its initial polarization while the light from the dermal layer becomes randomized and multiple scattered. Mie theory was used to model the epidermal light as the scattering from the intercellular organelles. The dermal signal was modeled as the diffusion of light through a localized semi-homogeneous volume. These models were confirmed using skin phantom experiments, studied with in vitro cell cultures, and applied to human skin for in vivo testing. A CCD-based spectroscopy system was developed to perform all these experiments. The probe and the theory were tested on skin phantoms of latex spheres on top of a solid phantom. We next extended our phantom study to include in vitro cells on top of the solid phantom. Optical fluorescent microscope images revealed at least four distinct scatterers including mitochondria, nucleoli, nuclei, and cell membranes. Single scattering measurements on the mammalian cells consistently produced PSD's in the size range of the mitochondria. The clinical portion of the study consisted of in vivo measurements on cancer, mole, and normal skin spots. The clinical study combined the single scattering model from the phantom and in vitro cell studies with the diffusion model for multiple scattered light. When parameters from both layers were combined, we found that a sensitivity of 100% and 77% can be obtained for detecting cancers and moles, respectively, given the number of lesions examined.
Draelos, Zoe D; Fowler, Joseph; Larsen, Walter G; Hornby, Sidney; Walters, Russel M; Appa, Yohini
2015-10-01
Although mild, fragrance-free, nonfoaming cleansers generally are recommended for individuals with sensitive skin, many consumers choose fragranced foaming cleansers. The addition of hydrophobically modified polymers (HMPs) to mild facial cleansers has been shown to improve product tolerability in individuals with sensitive skin while facilitating foaming. The objective of the 2 studies reported here was to assess the tolerability of a mild, HMP-containing, foaming facial cleanser with a fragrance that was free of common allergens and irritating essential oils in patients with sensitive skin. In the first study, 8 participants with clinically diagnosed fragrance sensitivity used a gentle foaming HMP-containing facial cleanser with or without fragrance for 3 weeks. Both cleansers improved global disease severity, irritation, and erythema with similar cleansing effectiveness. The second study was a 3-week, prospective, double-blind, randomized, 2-center study of 153 participants with clinically diagnosed sensitive skin. In this study, the fragranced gentle foaming cleanser with HMP was as well tolerated as a benchmark gentle, fragrance-free, nonfoaming cleanser. Itching, irritation, and desquamation were most improved from baseline in both groups. The participant-rated effectiveness of the cleanser with HMP was similar or better than the benchmark cleanser after 3 weeks of use. In conclusion, the gentle facial cleanser with HMPs and a fragrance offers a new option for adults with sensitive skin who may prefer, and commonly use, a fragranced and foaming product.
Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice
Energy Technology Data Exchange (ETDEWEB)
Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)
2011-06-15
We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.
International Nuclear Information System (INIS)
Chua, Melvin Lee Kiang; Somaiah, Navita; Bourne, Sara; Daley, Frances; A'Hern, Roger; Nuta, Otilia; Davies, Sue; Herskind, Carsten; Pearson, Ann; Warrington, Jim; Helyer, Sarah; Owen, Roger; Yarnold, John; Rothkamm, Kai
2011-01-01
Purpose: The aim of this study was to compare inter-individual and inter-cell type variation in DNA double-strand break (DSB) repair following in vivo irradiation of human skin. Materials and methods: Duplicate 4 mm core biopsies of irradiated and unirradiated skin were collected from 35 patients 24 h after 4 Gy exposure using 6 MeV electrons. Residual DSB were quantified by scoring 53BP1 foci in dermal fibroblasts, endothelial cells, superficial keratinocytes and basal epidermal cells. Results: Coefficients of inter-individual variation for levels of residual foci 24 h after in vivo irradiation of skin were 39.9% in dermal fibroblasts, 44.3% in endothelial cells, 32.9% in superficial keratinocytes and 46.4% in basal epidermal cells (p < 0.001, ANOVA). In contrast, the coefficient of inter-cell type variation for residual foci levels was only 11.3% in human skin between the different epidermal and dermal cells (p = 0.034, ANOVA). Foci levels between the different skin cell types were correlated (Pearson's R = 0.855-0.955, p < 0.001). Conclusions: Patient-specific factors appear to be more important than cell type-specific factors in determining residual foci levels following in vivo irradiation of human skin.
Casterton, P L; Potts, L F; Klein, B D
1994-08-01
11 surfactant raw materials with potential applications in light-duty liquid cleaning products were evaluated in vitro using a human skin analogue (ATS SKIN(2) Model ZK1100) for predicting cytotoxicity (MTT reduction) and inflammation [prostaglandin E(2) (PGE(2)) release]. Two of the 11 raw materials, both in the same compound family, were selected to be individually combined with each of the other nine in a 90:10 (raw:selected raw) mixture. Selection criteria were based on desired performance characteristics and low irritation potential as suggested from the individual surfactant assay data. To determine whether irritation potential was mitigated, MTT and PGE(2) scores were again determined for each of the 18 combinations with the resulting data being compared with the untreated raw material data. A plot of the data indicated that one of two selected materials may have an 'anti-irritant' effect. For raw materials with intrinsic MTT scores of less than 50 mug/ml and with the original data corrected for possible dilution effects, a statistical comparison between individual raw materials and the two sets of combinations was done using a one-sample analysis. Both cytotoxicity (MTT) and inflammation (PGE(2)) were significantly decreased by the milder of the two selected raw materials. By factoring the data into future new product decisions, this methodology has become a useful and practical tool for Amway product development.
Piret, Jocelyne; Laforest, Geneviève; Bussières, Martin; Bergeron, Michel G
2008-03-01
The safety of an ethylene oxide/propylene oxide gel formulation containing sodium lauryl sulfate (2%, w/w), that could be a potent candidate as a topical microbicide, has been evaluated. More specifically, the subchronic (26- and 52-week) toxicity of the formulation when applied intravaginally as well as its irritating potential for the rectal, penile, eye, skin and buccal mucosa have been examined in animal models. The results showed that the vaginal administration of the gel formulation containing sodium lauryl sulfate once and twice daily (with doses 12 +/- 2 h apart) for 26 weeks to rats and for 52 weeks to rabbits induced slight to moderate histopathological alterations. When the formulation was applied intrarectally to male and female rabbits once and twice daily (with doses 12 +/- 2 h apart) for 14 days, no macroscopic or microscopic changes were reported. For both vaginal and rectal dosing, no effect was seen on the haematology, coagulation and serum chemistry parameters as well as on the body weight of animals and the relative organ weights. Other sporadic macroscopic and histopathological findings were incidental in origin and of no toxicological significance. The gel formulation containing sodium lauryl sulfate was considered as mildly irritating for the penile mucosa of rabbits, non-irritating for the eye of rabbits, mildly irritating for the skin in a rabbit model and non-irritating for the hamster cheek pouch. It is suggested that the gel formulation containing sodium lauryl sulfate is safe for most tissues that could be exposed to the product under normal use.
International Nuclear Information System (INIS)
Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.
1996-01-01
UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)
Gardien, K.L.M.; Marck, R.E.; Bloemen, M.C.T.; Waaijman, T.; Gibbs, S.; Uhlrich, M.M.W.; Middelkoop, E.
2016-01-01
Standard treatment for large burns is transplantation with meshed split skin autografts (SSGs). A disadvantage of this treatment is that healing is accompanied by scar formation. Application of autologous epidermal cells (keratinocytes and melanocytes) may be a suitable therapeutic alternative,
Directory of Open Access Journals (Sweden)
Ugne Cizauskaite
2018-06-01
Full Text Available The increased interest in natural cosmetics has resulted in a higher market demand for preservative-free products based on herbal ingredients. An innovative W/O/W type emulsions containing herbal extracts were prepared directly; its cation form was induced by an ethanolic rosemary extract and stabilized using weak herbal gels. Due to the wide phytochemical composition of herbal extracts and the presence of alcohol in the emulsion system, which can cause skin irritation, sensitization or dryness when applied topically, the safety of the investigated drug delivery system is necessary. The aim of our study was to estimate the potential of W/O/W emulsions based on natural ingredients for skin irritation and phototoxicity using reconstructed 3D epidermis models in vitro and to evaluate in vivo its effect on human skin moisture, sebum content and pigmentation by biomedical examination using a dermatoscopic camera and corneometer. According to the results obtained after in vitro cell viability test the investigated emulsion was neither irritant nor phototoxic to human skin keratinocytes. W/O/W emulsion did not cause skin dryness in vivo, despite the fact that it contained ethanol. We can conclude that the emulsion is safe for use as a leave-on product due to the positive effect on human skin characteristics or as a semisolid pharmaceutical base where active compounds could be encapsulated.
Grhl3 and Lmo4 play coordinate roles in epidermal migration.
Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M
2008-09-01
In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.
Omi, Tokuya; Sato, Shigeru; Numano, Kayoko; Kawana, Seiji
2010-02-01
Chemical peeling of the skin is commonly used as a means to treat photoaging, but the mechanism underlying its efficacy has not yet been fully clarified. We recently conducted chemical peeling of the skin with glycolic acid and lactic acid and observed it at the ultrastructural level. No changes in the horny layer or the upper epidermal layer were observed but there was dissociation and vacuolation between the basal cells and increases in vimentin filaments within fibroblasts and endothelial cells were seen. These findings suggest that chemical peeling of the skin with this type of agent directly induces collagen formation within the dermis and thus directly stimulates remodeling of the dermis.
Directory of Open Access Journals (Sweden)
Carlos M. S. Dutok
2015-01-01
Full Text Available The common use of Pouteria mammosa (L. Cronquist, “Mamey or Zapote,” in food and ethnobotanic medicine shows its low or absent toxicity as fruit extracts prepared from seeds. However, it is essential to conduct security trials to scientifically support their use in drug therapy. This study evaluated the aqueous and hydroalcoholic extract (25% Acute Oral Toxicity, obtained from the seeds of P. mammosa, in Sprague Dawley rats and dermal and eye irritability in New Zealand rabbits. The 404 and 405 acute dermal and eye irritation/corrosion guidelines were used, as well as the 423 Acute Oral Toxicity guideline, Acute Toxic Class Method of the Organization for Economic Cooperation and Development (OECD. The aqueous extract was located in the following category: not classified as toxic (CTA 5, while hydroalcoholic extract at 25% was classified as dangerous (CTA 4. Both extracts can be used without side reaction that irritates the skin which permitted classification as potentially not irritant. P. mammosa in the two extracts caused mild and reversible eye irritation, and it was classified as slightly irritating.
Síndrome de intestino irritable y diverticulosis
Kestenberg Himelfar, Abraham; Fundación Valle de Lili
1998-01-01
Síndrome de intestino irritable (SII)/ ¿Cómo funciona el sistema digestivo?/¿Qué es el síndrome de intestino irritable?/¿Cuáles son los síntomas del síndrome de intestino irritable?/¿Qué causa el síndrome de intestino irritable?/¿Qué papel juega la tensión emocional en el origen del síndrome de intestino irritable?/¿Cómo saber si el problema es síndrome de intestino irritable o si es algo diferente?/¿Cómo se debe tratar el síndrome de intestino irritable?/¿Se deben evitar algunos alimentos?/¿...
Directory of Open Access Journals (Sweden)
Evan L. Carpenter
2018-05-01
Full Text Available Exposure to ultraviolet B (UVB irradiation of the skin leads to numerous dermatological concerns including skin cancer and accelerated aging. Natural product glucosinolate derivatives, like sulforaphane, have been shown to exhibit chemopreventive and photoprotective properties. In this study, we examined meadowfoam (Limnanthes alba glucosinolate derivatives, 3-methoxybenzyl isothiocyanate (MBITC and 3-methoxyphenyl acetonitrile (MPACN, for their activity in protecting against the consequences of UV exposure. To that end, we have exposed human primary epidermal keratinocytes (HPEKs and 3D human skin reconstructed in vitro (EpiDermTM FT-400 to UVB insult and investigated whether MBITC and MPACN treatment ameliorated the harmful effects of UVB damage. Activity was determined by the compounds’ efficacy in counteracting UVB-induced DNA damage, matrix-metalloproteinase (MMP expression, and proliferation. We found that in monolayer cultures of HPEK, MBITC and MPACN did not protect against a UVB-induced loss in proliferation and MBITC itself inhibited cell proliferation. However, in human reconstructed skin-equivalents, MBITC and MPACN decrease epidermal cyclobutane pyrimidine dimers (CPDs and significantly reduce total phosphorylated γH2A.X levels. Both MBITC and MPACN inhibit UVB-induced MMP-1 and MMP-3 expression indicating their role to prevent photoaging. Both compounds, and MPACN in particular, showed activity against UVB-induced proliferation as indicated by fewer epidermal PCNA+ cells and prevented UVB-induced hyperplasia as determined by a reduction in reconstructed skin epidermal thickness (ET. These data demonstrate that MBITC and MPACN exhibit promising anti-photocarcinogenic and anti-photoaging properties in the skin microenvironment and could be used for therapeutic interventions.
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen
2017-06-16
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen
2017-01-01
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Skin Health Connected to the Use of Absorbent Hygiene Products: A Review.
Bender, Johanna Karlsson; Faergemann, Jan; Sköld, Maria
2017-09-01
Over the past 50 years, absorbent hygiene products such as baby diapers and incontinence products have become essential features of modern day life. Through innovation and enhanced technology, their design, composition and performance have been dramatically upgraded from their early forms, and they have transformed the lives of millions of people, improving their quality of life. Skin health related to the use of absorbent hygiene products has accordingly also greatly improved. Still, the wearing of absorbent hygiene products will affect the skin, and for some users the changes in microclimate, mechanical interactions and the exposure to urine and faeces may result in irritant contact dermatitis, i.e. diaper dermatitis (DD) or incontinence-associated dermatitis (IAD). Babies with developing skin and the elderly with deteriorating skin functions who are the most frequent users of absorbent hygiene products are more vulnerable to the causal factors. Although irritant reactions are the most common, allergic contact dermatitis should be considered if a DD/IAD fails to improve by recommended actions. There is also a connection between IAD and pressure ulcer development of which it is important to be aware. A holistic approach of using high-quality absorbent hygiene products in combination with appropriate skin care will help maintaining good skin health.
A review of patient and skin characteristics associated with skin tears.
Rayner, R; Carville, K; Leslie, G; Roberts, P
2015-09-01
Skin tears are the most common wound among the elderly and have the potential to cause infection, form chronic wounds, reduce quality of life and increase health-care costs. Our aim was to identify studies that reviewed patient and skin characteristics associated with skin tears. A review of skin tear studies reported in the English literature between 1980 and 2013 was undertaken using the following electronic databases: PubMed, Medline, CINAHL, Embase, Scopus, Evidence Based and Medicine Reviews (EBM). Search terms included aged, skin, tears or lacerations, skin tearing, geri tear, epidermal tear and prevalence. There were 343 articles found with using the search terms. After abstract review nine were found to be relevant to the search. The principle findings from these eight published articles and one unpublished study revealed that the most common patient characteristics were a history of skin tears, impaired mobility and impaired cognition. Skin characteristics associated with skin tears included senile purpura, ecchymosis and oedema. This review provides an overview of identified patient and skin characteristics that predispose the elderly to skin tears and exposes the lack of research within this domain. R. Rayner is a recipient of a 2013 Australian Postgraduate Award, Curtin University Postgraduate Scholarship and a Wound Management Cooperative Research Centre (CRC) PhD stipend. The School of Nursing, Midwifery and Paramedicine, Curtin University and the Silver Chain Group, Western Australia are participants in the Wound Management Innovation CRC. No conflict of interest exists among the authors.
Impact of one-layer assumption on diffuse reflectance spectroscopy of skin
Hennessy, Ricky; Markey, Mia K.; Tunnell, James W.
2015-02-01
Diffuse reflectance spectroscopy (DRS) can be used to noninvasively measure skin properties. To extract skin properties from DRS spectra, you need a model that relates the reflectance to the tissue properties. Most models are based on the assumption that skin is homogenous. In reality, skin is composed of multiple layers, and the homogeneity assumption can lead to errors. In this study, we analyze the errors caused by the homogeneity assumption. This is accomplished by creating realistic skin spectra using a computational model, then extracting properties from those spectra using a one-layer model. The extracted parameters are then compared to the parameters used to create the modeled spectra. We used a wavelength range of 400 to 750 nm and a source detector separation of 250 μm. Our results show that use of a one-layer skin model causes underestimation of hemoglobin concentration [Hb] and melanin concentration [mel]. Additionally, the magnitude of the error is dependent on epidermal thickness. The one-layer assumption also causes [Hb] and [mel] to be correlated. Oxygen saturation is overestimated when it is below 50% and underestimated when it is above 50%. We also found that the vessel radius factor used to account for pigment packaging is correlated with epidermal thickness.
Instrument-related Skin Disorders in Musicians.
Patruno, Cataldo; Napolitano, Maddalena; La Bella, Serena; Ayala, Fabio; Balato, Nicola; Cantelli, Mariateresa; Balato, Anna
2016-01-01
Among artists, musicians may suffer from occupational skin problems; notwithstanding, these conditions have been rarely reviewed. The characteristics of individual performer and the type of instrument will determine the kind of disease. Moreover, the hours that the musician spent to advance artistic skill may influence the severity. The frequency and risk factors of instrument-related skin disorders in musicians from southern Italy were analyzed. An observational study was conducted in 628 musicians. A questionnaire including questions related to age, sex, instrument played, musical activity, previous or current skin disorders, and impact of skin symptoms on music making was submitted. Of 628 musicians, 199 (31.7%) reported suffering from at least 1 skin disease. Cutaneous diseases likely directly correlated with the use of the musical instrument were found in 129 (20.5%) of the 628 subjects. In particular, different patterns of irritant contact dermatitis were found. Skin conditions may be a significant problem in professional instrumentalists. They are mainly related to musical activity. Preventive measures should be established.
International Nuclear Information System (INIS)
Archambeau, J.O.
1987-01-01
This presentation lists gross and histologic changes produced by irradiation of the skin that have been quantified. It examines available cell kinetic radiobiological and morphological variables to identify interactions that occur between component populations. The dose response data of the hair and epidermal, fibrocytic, and endothelial cell populations are examined and a rank ordering is attempted. The contribution of the radiosensitivity of these populations to defining the dose tolerance of the skin is discussed. Future clinical needs are considered. The intent is to quantify or define tissue population changes in the irradiated skin so that the data may serve as guidelines to aid the radiation therapist to select therapy schedules that preserve skin function while improving cancer control
Cosmetic Potential of Marine Fish Skin Collagen
Directory of Open Access Journals (Sweden)
Ana L. Alves
2017-10-01
Full Text Available Many cosmetic formulations have collagen as a major component because of its significant benefits as a natural humectant and moisturizer. This industry is constantly looking for innovative, sustainable, and truly efficacious products, so marine collagen based formulations are arising as promising alternatives. A solid description and characterization of this protein is fundamental to guarantee the highest quality of each batch. In the present study, we present an extensive characterization of marine-derived collagen extracted from salmon and codfish skins, targeting its inclusion as component in cosmetic formulations. Chemical and physical characterizations were performed using several techniques such as sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE, Fourier Transformation Infrared (FTIR spectroscopy rheology, circular dichroism, X-ray diffraction, humidity uptake, and a biological assessment of the extracts regarding their irritant potential. The results showed an isolation of type I collagen with high purity but with some structural and chemical differences between sources. Collagen demonstrated a good capacity to retain water, thus being suitable for dermal applications as a moisturizer. A topical exposure of collagen in a human reconstructed dermis, as well as the analysis of molecular markers for irritation and inflammation, exhibited no irritant potential. Thus, the isolation of collagen from fish skins for inclusion in dermocosmetic applications may constitute a sustainable and low-cost platform for the biotechnological valorization of fish by-products.
Salinas, M L; Ogura, T; Soffchi, L
2001-02-01
It was found that needle-like calcium oxalate crystals, raphides, are found abundantly in all tissues of Agave tequilana plants; thus, 1 droplet (0.03 ml) of juice pressed from leaves contains 100-150 crystals, 30-500 microm in length, sharpened at both ends. In tequila distilleries, 5/6 of the workers who handle the agave stems have experienced the characteristic irritation. In contrast, only 1/3 of workers in agave plantations who harvest agave plants, complain of the irritation. It is confirmed that all the irritation suffered in both distilleries and plantations takes place at bodily locations where the plants come into contact with the worker's skin in the course of their work.
Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.
Crawford, Melissa; Dagnino, Lina
2017-10-02
The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.
[Skin hydration and hydrating products].
Duplan, H; Nocera, T
2018-05-01
One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.
Isolation and In Vitro Characterization of Epidermal Stem Cells
DEFF Research Database (Denmark)
Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak
2017-01-01
flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...
Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland
2014-01-01
The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.
International Nuclear Information System (INIS)
Ejaz, A.; Raza, N.; Iftikhar, N.; Muzzafar, F.
2008-01-01
To compare the efficacy and safety of Jessner's solution with 30% salicylic acid as superficial chemical peeling agents in treating epidermal melasma in Asian skin. Sixty consenting patients with epidermal melasma were randomly divided into two groups. Group A was treated with Jessner's solution and Group B with 30% salicylic acid. Baseline Melasma Area Severity Index (MASI) score was noted and peeling started at 2-weekly intervals. Sunscreen in morning and moisturizer at night were prescribed in all patients. MASI score and adverse effects were recorded biweekly. Treatment was stopped at 12 weeks and patients were followed-up at 4 weekly intervals for further 12 weeks. Final MASI score and adverse effects were noted at the end of follow-up period. Mean MASI scores were compared using paired sample t-test and one-way ANOVA. Difference in baseline, treatment end and follow-up end MASI scores was not statistically significant between the two groups (p=0.54, 0.26, and 0.55 respectively). On the other hand, within group analysis of difference between pre and posttreatment MASI score was highly significant in both groups (p < 0.0001). Adverse effects were mild and comparable in both groups. Jessner's solution and 30% salicylic acid are equally effective and safe peeling agents for use in epidermal melasma in Asian skin. (author)
Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus
Directory of Open Access Journals (Sweden)
Naser Tayyebi Meibodi
2011-01-01
Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.
Growth of melanocytes in human epidermal cell cultures
International Nuclear Information System (INIS)
Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.
1990-01-01
Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient
Langerhans cell precursors acquire RANK/CD265 in prenatal human skin.
Schöppl, Alice; Botta, Albert; Prior, Marion; Akgün, Johnnie; Schuster, Christopher; Elbe-Bürger, Adelheid
2015-01-01
The skin is the first barrier against foreign pathogens and the prenatal formation of a strong network of various innate and adaptive cells is required to protect the newborn from perinatal infections. While many studies about the immune system in healthy and diseased adult human skin exist, our knowledge about the cutaneous prenatal/developing immune system and especially about the phenotype and function of antigen-presenting cells such as epidermal Langerhans cells (LCs) in human skin is still scarce. It has been shown previously that LCs in healthy adult human skin express receptor activator of NF-κB (RANK), an important molecule prolonging their survival. In this study, we investigated at which developmental stage LCs acquire this important molecule. Immunofluorescence double-labeling of cryostat sections revealed that LC precursors in prenatal human skin either do not yet [10-11 weeks of estimated gestational age (EGA)] or only faintly (13-15 weeks EGA) express RANK. LCs express RANK at levels comparable to adult LCs by the end of the second trimester. Comparable with adult skin, dermal antigen-presenting cells at no gestational age express this marker. These findings indicate that epidermal leukocytes gradually acquire RANK during gestation - a phenomenon previously observed also for other markers on LCs in prenatal human skin. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.
Gaspar, L R; Campos, P M B G Maia
2007-10-01
different non-invasive Biophysics Techniques in order to evaluate hydration and anti-aging effects of these formulations as well as erythema to assess skin irritation. Histopathology, viable epidermal thickness as well as the number of epidermal cell layers were also evaluated. It was observed that both UV filters combinations (photounstable one containing OMC, AVB and MBC and photostable one containing OMC, BP-3 and OC) enhanced vitamin A photostability and F4 was more photostable than F3, in terms of vitamin A. In vivo efficacy studies showed that F2, F3 and F4 enhanced the viable epidermal thickness, the number of epidermal cell layers, TEWL and Uv/Ue parameter, when compared to the vehicle, which can suggest that they enhanced viable epidermis hydration and acted in cell renewal. However formulation 2 (containing only vitamins), which was the most photounstable formulation, provoked an irritation on hairless mouse skin, and consequently it cannot be considered as safe as the other formulations. It can be concluded that both UV filters combinations did not influence the hydration and anti-aging effects of the formulations containing the vitamins under study and reduced the skin irritation observed when the vitamins were present in the formulation. In addition, the photostable UV-filters combination had the highest recovery of vitamin A in the photostability studies. Finally, it could be suggested that the presence of UV-filters can be considered interesting for the reduction of skin irritation and the most suitable formulation was the one containing the combinations of vitamins A, C and E with photostable UV-filters.
Augustine, Robin
2018-05-12
Significant progress has been made over the past few decades in the development of in vitro-engineered substitutes that mimic human skin, either as grafts for the replacement of lost skin, or for the establishment of in vitro human skin models. Tissue engineering has been developing as a novel strategy by employing the recent advances in various fields such as polymer engineering, bioengineering, stem cell research and nanomedicine. Recently, an advancement of 3D printing technology referred as bioprinting was exploited to make cell loaded scaffolds to produce constructs which are more matching with the native tissue. Bioprinting facilitates the simultaneous and highly specific deposition of multiple types of skin cells and biomaterials, a process that is lacking in conventional skin tissue-engineering approaches. Bioprinted skin substitutes or equivalents containing dermal and epidermal components offer a promising approach in skin bioengineering. Various materials including synthetic and natural biopolymers and cells with or without signalling molecules like growth factors are being utilized to produce functional skin constructs. This technology emerging as a novel strategy to overcome the current bottle-necks in skin tissue engineering such as poor vascularization, absence of hair follicles and sweat glands in the construct.
Etanercept therapy for toxic epidermal necrolysis.
Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio
2014-08-01
Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Topical Nano and Microemulsions for Skin Delivery
Directory of Open Access Journals (Sweden)
Christofori M. R. R. Nastiti
2017-09-01
Full Text Available Nanosystems such as microemulsions (ME and nanoemulsions (NE offer considerable opportunities for targeted drug delivery to and via the skin. ME and NE are stable colloidal systems composed of oil and water, stabilised by a mixture of surfactants and cosurfactants, that have received particular interest as topical skin delivery systems. There is considerable scope to manipulate the formulation components and characteristics to achieve optimal bioavailability and minimal skin irritancy. This includes the incorporation of established chemical penetration enhancers to fluidize the stratum corneum lipid bilayers, thus reducing the primary skin barrier and increasing permeation. This review discusses nanosystems with utility in skin delivery and focuses on the composition and characterization of ME and NE for topical and transdermal delivery. The mechanism of skin delivery across the stratum corneum and via hair follicles is reviewed with particular focus on the influence of formulation.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Epidermal nevus syndrome associated with unusual neurological, ocular, and skeletal features
Directory of Open Access Journals (Sweden)
Reena Sharma
2012-01-01
Full Text Available Epidermal nevus syndrome (ENS is a rare disease, the pathogenesis of which is largely elusive. We, hereby, report an exclusive case of a 20-year-old man with verrucous ENS presented with dark colored papules and plaques along the Blaschko′s lines present over the head and neck area along with fleshy growth in both eyes since birth. Limb length discrepancy and kyphoscoliosis were remarkable. Skin biopsy was compatible with verrucous epidermal nevus while the biopsy of the ocular lesion confirmed complex choristoma. MRI brain revealed calcification in the right temporal lobe. Bilateral arachnoid cyst in the middle cranial fossa, scleral osteoma in the posterior part of the right eyeball, and deformed calvarium were evident on CECT skull and orbit. The present illustration emphasizes the importance of a punctilious work up of the case.
Ezerskaia, A.; Pereira, S.F.; Urbach, Paul; Varghese, Babu; Popp, Jürgen; Tuchin, Valery V.; Matthews, Dennis L.; Pavone, Francesco S.
2016-01-01
Skin health characterized by a system of water and lipids in Stratum Corneum provide protection from harmful external elements and prevent trans-epidermal water loss. Skin hydration (moisture) and sebum (skin surface lipids) are considered to be important factors in skin health; a right balance between these components is an indication of skin health and plays a central role in protecting and preserving skin integrity. In this manuscript we present an infrared spectroscopic method for simulta...
Bio-integrated electronics and sensor systems
Yeo, Woon-Hong; Webb, R. Chad; Lee, Woosik; Jung, Sungyoung; Rogers, John A.
2013-05-01
Skin-mounted epidermal electronics, a strategy for bio-integrated electronics, provide an avenue to non-invasive monitoring of clinically relevant physiological signals for healthcare applications. Current conventional systems consist of single-point sensors fastened to the skin with adhesives, and sometimes with conducting gels, which limits their use outside of clinical settings due to loss of adhesion and irritation to the user. In order to facilitate extended use of skin-mounted healthcare sensors without disrupting everyday life, we envision electronic monitoring systems that integrate seamlessly with the skin below the notice of the user. This manuscript reviews recent significant results towards our goal of wearable electronic sensor systems for long-term monitoring of physiological signals. Ultra-thin epidermal electronic systems (EES) are demonstrated for extended use on the skin, in a conformal manner, including during everyday bathing and sleeping activities. We describe the assessment of clinically relevant physiological parameters, such as electrocardiograms (ECG), electromyograms (EMG), electroencephalograms (EEG), temperature, mechanical strain and thermal conductivity, using examples of multifunctional EES devices. Additionally, we demonstrate capability for real life application of EES by monitoring the system functionality, which has no discernible change, during cyclic fatigue testing.
Innate sensing of microbial products promotes wound-induced skin cancer
Hoste, Esther; Arwert, Esther N.; Lal, Rohit; South, Andrew P.; Salas-Alanis, Julio C.; Murrell, Dedee F.; Donati, Giacomo; Watt, Fiona M.
2015-01-01
The association between tissue damage, chronic inflammation and cancer is well known. However, the underlying mechanisms are unclear. Here we characterize a mouse model in which constitutive epidermal extracellular-signal-regulated kinase-MAP-kinase signalling results in epidermal inflammation, and skin wounding induces tumours. We show that tumour incidence correlates with wound size and inflammatory infiltrate. Ablation of tumour necrosis factor receptor (TNFR)-1/-2, Myeloid Differentiation primary response gene 88 or Toll-like receptor (TLR)-5, the bacterial flagellin receptor, but not other innate immune sensors, in radiosensitive leukocytes protects against tumour formation. Antibiotic treatment inhibits, whereas injection of flagellin induces, tumours in a TLR-5-dependent manner. TLR-5 is also involved in chemical-induced skin carcinogenesis in wild-type mice. Leukocytic TLR-5 signalling mediates upregulation of the alarmin HMGB1 (High Mobility Group Box 1) in wound-induced papillomas. HMGB1 is elevated in tumours of patients with Recessive Dystrophic Epidermolysis Bullosa, a disease characterized by chronic skin damage. We conclude that in our experimental model the combination of bacteria, chronic inflammation and wounding cooperate to trigger skin cancer. PMID:25575023
Reconstruction of living bilayer human skin equivalent utilizing human fibrin as a scaffold.
Mazlyzam, A L; Aminuddin, B S; Fuzina, N H; Norhayati, M M; Fauziah, O; Isa, M R; Saim, L; Ruszymah, B H I
2007-05-01
Our aim of this study was to develop a new methodology for constructing a bilayer human skin equivalent to create a more clinical compliance skin graft composite for the treatment of various skin defects. We utilized human plasma derived fibrin as the scaffold for the development of a living bilayer human skin equivalent: fibrin-fibroblast and fibrin-keratinocyte (B-FF/FK SE). Skin cells from six consented patients were culture-expanded to passage 1. For B-FF/FK SE formation, human fibroblasts were embedded in human fibrin matrix and subsequently another layer of human keratinocytes in human fibrin matrix was stacked on top. The B-FF/FK SE was then transplanted to athymic mice model for 4 weeks to evaluate its regeneration and clinical performance. The in vivo B-FF/FK SE has similar properties as native human skin by histological analysis and expression of basal Keratin 14 gene in the epidermal layer and Collagen type I gene in the dermal layer. Electron microscopy analysis of in vivo B-FF/FK SE showed well-formed and continuous epidermal-dermal junction. We have successfully developed a technique to engineer living bilayer human skin equivalent using human fibrin matrix. The utilization of culture-expanded human skin cells and fibrin matrix from human blood will allow a fully autologous human skin equivalent construction.
van der Aar, Angelic M. G.; Picavet, Daisy I.; Muller, Femke J.; de Boer, Leonie; van Capel, Toni M. M.; Zaat, Sebastian A. J.; Bos, Jan D.; Janssen, Hans; George, Thaddeus C.; Kapsenberg, Martien L.; van Ham, S. Marieke; Teunissen, Marcel B. M.; de Jong, Esther C.
2013-01-01
The mechanisms preventing detrimental T-cell responses against commensal skin bacteria remain elusive. Using monocyte-derived and skin-derived dendritic cells (DCs), we demonstrate that epidermal Langerhans cells (LCs), the DCs in the most superficial layer of the skin, have a poor capacity to
STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT
Directory of Open Access Journals (Sweden)
V.F. Zhernosek
2011-01-01
Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.
Directory of Open Access Journals (Sweden)
V. D. El'kin
2017-01-01
Full Text Available We present a clinical case of ichthyosis hystrix, a rare genetic ichthyosiform dermatosis. Specifics of the disease are related to the complexity of differential diagnosis and verification of the diagnosis, because clinical manifestation of ichthyosis hystrix is similar with that of verrucous epidermal nevus. Clinical particulars of both nosologies are characterized by bizarre and widespread skin lesions of spicular hyperkeratotic growth, located along Blaschko lines. The exclusive feature of the clinical case described is a long-term (20 years clinical and laboratory monitoring of the patient. The literature review provides brief information on etiology, pathogenesis, clinical features, differential diagnosis, and pathomorphology of ichthyosis hystrix and verrucous epidermal nevus.
A homolog of Drosophila grainy head is essential for epidermal integrity in mice.
Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M
2005-04-15
The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.
Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey
2016-02-01
Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.
A review of toxic epidermal necrolysis management in Japan
Directory of Open Access Journals (Sweden)
Yuri Kinoshita
2017-01-01
Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.
Loveren H van; Jong WH de; Garssen J; LPI
1998-01-01
Prediction of human cutaneous irritation and sensitization in view of hazard identification has primarily relied on the use of laboratory animals. Such studies in laboratory animals have been very instrumental in the detection of potential contact sensitizing agents. There are however many
Natural considerations for skin of color.
Baumann, Leslie; Rodriguez, David; Taylor, Susan C; Wu, Jessica
2006-12-01
Changing US demographics indicate that dermatologists will treat an increasing number of individuals of color. Early research on cutaneous anatomy and physiology was performed mostly in white populations. However, new research is elucidating similarities and differences in skin of color and white skin with regard to skin barrier, pigmentation, and sensitivity. Two of the most important issues are skin lightening and brightening. Products for use on skin of color typically should be gentle because of the proclivity of more deeply pigmented skin to develop pigmentary abnormalities in response to skin irritation or trauma. Increasing patient interest in natural remedies has been matched by research on the use of natural ingredients in dermatology. The relative gentleness of many of these products, coupled with excellent efficacy, makes natural ingredients such as soy and licorice excellent choices in the treatment of disorders such as postinflammatory hyperpigmentation (PIH) and melasma. For daily skin care, ingredients such as oatmeal and feverfew are good choices for gentle cleansing and moisturizing of dry, sensitive, or ashy skin. Sun protection is an increasing concern due to rising rates of melanoma. Several botanical products are useful in augmenting photoprotection with conventional sunscreens.
DEFF Research Database (Denmark)
Horiguchi, Y; Fine, J D; Couchman, J R
1991-01-01
was identical to that observed in neonatal and adult human skin. These findings demonstrate that active remodelling of the dermo-epidermal junction occurs during at least the first two trimesters, and affects not only basement membrane-associated structures but also specific antigens.......Recent studies have demonstrated that skin basement membrane components are expressed within the dermo-epidermal junction in an orderly sequence during human foetal development. We have investigated the ultrastructural localization of basement membrane-related antigens in human foetal skin...... at different developmental ages using two monoclonal antibodies to a well-characterized basement membrane-associated heparan sulphate proteoglycan. A series of foetal skin specimens (range, 54-142 gestational days) were examined using an immunoperoxidase immunoelectron microscopic technique. In specimens...
Directory of Open Access Journals (Sweden)
Codruta-Dana Pitis
2015-12-01
Full Text Available The prevalence of contact dermatitis (CD in Europe varies between 6.7% and 10.6% depending on the sector of activity. Professional CD (PCD has an important economic impact − 30% of the budget compensation for occupational disease. In Romania, the prevalence of PCD is underestimated, with an even distribution of cases with respect to the allergic or irritative mechanism. A retrospective clinical study was conducted; target population being the patients admitted in Occupational Medicine Clinic Cluj-Napoca between 2003 and 2011. Objectives of study were: specifying the prevalence range of allergic CD (ACD / irritative CD (ICD among occupational/work-related diseases, the distribution of allergic/irritative CD (A/ICD for different sectors of activity and establishing the correlation between atopy and A/ICD. We have applied allergy skin tests - prick (environmental allergens and patch (occupational allergens. Inclusion criteria were: -documented occupational exposure at skin allergens/irritants; -the atopy state; -diagnostic established at discharge. Patients with recurrent chronic urticaria, angioedema, hypereosinophilic syndrome have been excluded. Statistical analysis was done using SPSS software. The study indicated a similar prevalence for A/ICD, with similar distribution. Prevalence above average has been recorded in the metallurgy sector (A/ICD, in health care sector (ACD, respectively, textile industry (ICD. The correlation atopy-ACD has proved to be lower compared to previous reports. Regarding ICD, the diagnostic was confirmed frequently to non-atopic persons. We strongly recommend the compliance with a multidisciplinary protocol for the management of A/ICD, individualized for specific activity sectors or even work stations.
Enhancing blood donor skin disinfection using natural oils.
Alabdullatif, Meshari; Boujezza, Imen; Mekni, Mohamed; Taha, Mariam; Kumaran, Dilini; Yi, Qi-Long; Landoulsi, Ahmed; Ramirez-Arcos, Sandra
2017-12-01
Effective donor skin disinfection is essential in preventing bacterial contamination of blood components with skin flora bacteria like Staphylococcus epidermidis. Cell aggregates of S. epidermidis (biofilms) are found on the skin and are resistant to the commonly used donor skin disinfectants chlorhexidine-gluconate and isopropyl alcohol. It has been demonstrated that essential oils synergistically enhance the antibacterial activity of chlorhexidine-gluconate. The objective of this study was to test plant-extracted essential oils in combination with chlorhexidine-gluconate or chlorhexidine-gluconate plus isopropyl alcohol for their ability to eliminate S. epidermidis biofilms. The composition of oils extracted from Artemisia herba-alba, Lavandula multifida, Origanum marjoram, Rosmarinus officinalis, and Thymus capitatus was analyzed using gas chromatography-mass spectrometry. A rabbit model was used to assess skin irritation caused by the oils. In addition, the anti-biofilm activity of the oils used alone or in combination with chlorhexidine-gluconate or chlorhexidine-gluconate plus isopropyl alcohol was tested against S. epidermidis biofilms. Essential oil concentrations 10%, 20%, and 30% were chosen for anti-biofilm assays, because skin irritation was observed at concentrations greater than 30%. All oils except for O. marjoram had anti-biofilm activity at these three concentrations. L. multifida synergistically enhanced the anti-biofilm activity of chlorhexidine-gluconate and resulted in the highest anti-biofilm activity observed when combined with chlorhexidine-gluconate plus isopropyl alcohol. Gas chromatography-mass spectrometry revealed that the main component contributing to the activity of L. multifida oil was a natural terpene alcohol called linalool. The anti-biofilm activity of chlorhexidine-gluconate plus isopropyl alcohol can be greatly enhanced by L. multifida oil or linalool. Therefore, these components could potentially be used to improve blood
Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen
2012-05-01
The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.
Treatment modalities for hyperpigmented skin lesions: A brief overview
Directory of Open Access Journals (Sweden)
Yan Teng Khoo
2016-07-01
Full Text Available Skin hyperpigmentation involves a broad range of skin conditions, including epidermal pigmented lesions, dermal pigmented lesions, and mixed pigmented lesions. Treatment includes various modalities such as brightening cream, chemical peeling, and laser therapy. Responses to various treatment modalities can be quite varied depending on the type of treatment and the degree of pigmentation. Sometimes a lesion can lighten or even partially disappear, while other lesions may recur. This paper provides a brief overview of treatment modalities available for hyperpigmented skin lesions including the importance of photoprotection, various types of brightening creams, suitable types of chemical peels, specific laser therapies targeted for skin hyperpigmentation, and surgery.
Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors
International Nuclear Information System (INIS)
Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili
2013-01-01
High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors
Nisbet, Stephanie
Data were generated from three studies to assess the tolerability and acceptability of a prototype cosmetic lip balm. Dermatological assessments of topical compatibility (primary and cumulative irritability and sensitization), photoirritant and topical photosensitizer potential, and acceptability for safe use of a prototype cosmetic lip balm on sensitive skin are summarized. In Study 1, the product was applied to the volunteers' backs under a semiocclusive patch followed by patch removal/reapplication over 6 weeks to assess the irritant and allergic potential of the product. Dermatological assessments were performed at the beginning and end of the study or when there was evidence of positivity or adverse event. Study 2 was conducted by applying the product to the volunteers' backs under a semiocclusive patch, followed by patch removal/reapplication and irradiation of the test area with ultraviolet A (UVA) radiation at various intervals over 5 weeks. Dermatological assessments were performed to assess the product's role in the induction of photoirritancy and photosensitization. Clinical and subjective assessments for acceptability were obtained during Study 3 in volunteers with a diagnosis of sensitive skin and those who used the product as per instructions for use during the study period. The data generated from the three studies demonstrated no evidence of primary or cumulative dermal irritation or of dermal sensitization. In addition, no photoirritation potential or photosensitization potential was observed. As assessed by dermatologic monitoring and subject diary entries, the prototype lip balm did not cause irritation or sensitization reactions when used for 28 days in volunteers with a diagnosis of sensitive skin. Based on these findings, the prototype lip balm can be considered suitable for use for people with sensitive skin.
Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.
Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab
2011-03-01
OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.
Directory of Open Access Journals (Sweden)
Ayako Uto-Konomi
Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.
Borrego, Leopoldo; Hernández, Noelia; Hernández, Zaida; Peñate, Yeray
2016-05-01
Povidone-iodine solution is an antiseptic that is used worldwide as surgical paint and is considered to have a low irritant potential. Post-surgical severe irritant dermatitis has been described after the misuse of this antiseptic in the surgical setting. Between January 2011 and June 2013, 27 consecutive patients with post-surgical contact dermatitis localized outside of the surgical incision area were evaluated. Thirteen patients were also available for patch testing. All patients developed dermatitis the day after the surgical procedure. Povidone-iodine solution was the only liquid in contact with the skin of our patients. Most typical lesions were distributed in a double lumbar parallel pattern, but they were also found in a random pattern or in areas where a protective pad or an occlusive medical device was glued to the skin. The patch test results with povidone-iodine were negative. Povidone-iodine-induced post-surgical dermatitis may be a severe complication after prolonged surgical procedures. As stated in the literature and based on the observation that povidone-iodine-induced contact irritant dermatitis occurred in areas of pooling or occlusion, we speculate that povidone-iodine together with occlusion were the causes of the dermatitis epidemic that occurred in our surgical setting. Povidone-iodine dermatitis is a problem that is easily preventable through the implementation of minimal routine changes to adequately dry the solution in contact with the skin. © 2015 The International Society of Dermatology.
Reduction of skin damage from transcutaneous oxygen electrodes using a spray on dressing.
Evans, N J; Rutter, N
1986-01-01
A spray on, copolymer acrylic dressing (Op-Site) was used to limit the skin damage caused by a transcutaneous oxygen electrode and its adhesive ring. Two identical electrodes were applied to the abdominal skin of 10 preterm infants, one on untreated skin, the other after application of Op-Site. It was found that Op-Site prevented the epidermal damage (as measured by transepidermal water loss) that occurs when the adhesive ring is removed from untreated skin. It did not interfere with transcut...
Penetration and delivery characteristics of repetitive microjet injection into the skin.
Römgens, Anne M; Rem-Bronneberg, Debbie; Kassies, Roel; Hijlkema, Markus; Bader, Dan L; Oomens, Cees W J; van Bruggen, Michel P B
2016-07-28
Drugs can be delivered transdermally using jet injectors, which can be an advantageous route compared to oral administration. However, these devices inject large volumes deep into the skin or tissues underneath the skin often causing bruising and pain. This may be prevented by injecting smaller volumes at lower depth in a repetitive way using a microjet injection device. Such a device could be used to apply drugs in a controllable and sustainable manner. However, the efficacy of microjet injection has been rarely examined. In this study, the penetration and delivery capacity was examined of a repetitive microjet injection device. Various experiments were performed on epidermal and full-thickness ex vivo human as well as ex vivo porcine skin samples. Results revealed that microjets with a velocity exceeding 90m/s penetrated an epidermal skin sample with a delivery efficiency of approximately 96%. In full-thickness human skin, the delivery efficiency drastically decreased to a value of approximately 12%. Experiments on full-thickness skin revealed that the microjets penetrated to a depth corresponding to the transition between the papillary and reticular dermis. This depth did not further increase with increasing number of microjets. In vivo studies on rats indicated that intact insulin was absorbed into the systemic circulation. Hence, the microjet injection device was able to deliver medication into the skin, although the drug delivery efficiency should be increased. Copyright © 2016 Elsevier B.V. All rights reserved.
Bragulla, Hermann; Hirschberg, Ruth M
2003-08-15
Accessory organs of the integument are locally modified parts of the potentially feather-bearing skin in birds (e.g., the rhamphotheca, claws, or scales), and of the potentially hairy skin in mammals (e.g., the rhinarium, nails, claws, or hooves). These special parts of the integument are characterised by a modified structure of their epidermal, dermal and subcutaneous layers. The developmental processes of these various integumentary structures in birds and mammals show both similarities and differences. For example, the development of the specialised epidermal structures of both feathers and the hoof capsule is influenced by the local three-dimensional configuration of the dermis. However, in feathers, in contrast to hooves, the arrangement of the corneous cells is only partially a direct result of the particular arrangement and shape of the dermal surface of the papillary body. Whereas the diameter of the feather papilla, as well as the number, length, and width of dermal ridges on the surface of the feather papilla influence the three-dimensional architecture of the feather rami, there is no apparent direct correlation between the dermo-epidermal interface and the development of the highly ordered architecture of the radii and hamuli in the feather vane. In order to elucidate this morphogenic problem and the problem of locally different processes of keratinisation and cornification, the structure and development of feathers in birds are compared to those of the hoof capsule in horses. The equine hoof is the most complex mammalian integumentary structure, which is determined directly by the dermal surface of the papillary body. Perspectives for further research on the development of modified integumentary structures, such as the role of the dermal microangioarchitecture and the selective adhesion and various differentiation pathways of epidermal cells, are discussed. Copyright 2003 Wiley-Liss, Inc.
Occupational skin problems in construction workers.
Shah, Kartik R; Tiwari, Rajnarayan R
2010-10-01
Construction workers handle cement which has constituents to produce both irritant contact dermatitis and corrosive effects (from alkaline ingredients, such as lime) and sensitization, leading to allergic contact dermatitis (from ingredients, such as chromium). The present study has been carried out among unorganized construction workers to find the prevalence of skin problems. The present cross-sectional study was conducted in 92 construction workers of Ahmedabad and Vadodara. All the workers were subjected to clinical examination after collection of information regarding demographic characteristics, occupational characteristics and clinical history on a predesigned proforma. Of them, 47.8% had morbid skin conditions. Frictional callosities in palm were observed in 18 (19.6%) subjects while 4 (4.3%) subjects had contact dermatitis. Other conditions included dry, fissured and scaly skin, infectious skin lesion, tinea cruris, lesion and ulcers on hands and/or soles. The skin conditions were common in the age group of 20-25 years, males, those having ≥1 year exposure and those working for longer hours. Half of the workers not using personal protective equipment had reported skin-related symptoms.
Toxic epidermal necrolysis due to concomitant use of lamotrigine and valproic acid
Directory of Open Access Journals (Sweden)
Sukhjot Kaur
2013-01-01
Full Text Available Anti-epileptic drugs can be associated with a wide spectrum of cutaneous adverse reactions ranging from simple maculopapular rashes to more severe and life threatening reactions like Stevens-Johnson syndrome and toxic epidermal necrolysis. These rashes are well documented with older antiepileptic drugs like phenytoin, phenobarbitone and carbamazapine. Lamotrigine is a newer, unrelated antiepileptic drug that causes skin rashes in 3-10% of new users. Higher starting dose or rapid escalation, concurrent treatment with valproic acid, and a previous history of a rash with other antiepileptic drugs are well recognized risk factors for lamotrigine related serious rashes. We report two patients with toxic epidermal necrolysis, resulting from concomitant use of lamotrigine and valproic acid. It is emphasized that clinicians adhere to the recommended dosage guidelines and adopt a slow dose titration when initiating treatment with lamotrigine.
Directory of Open Access Journals (Sweden)
Parisa Kakanj
2013-07-01
Full Text Available Mutations in the hedgehog pathway drive the formation of tumors in many different organs, including the development of basal cell carcinoma in the skin. However, little is known about the role of epidermal Indian hedgehog (Ihh in skin physiology. Using mouse genetics, we identified overlapping and distinct functions of Ihh in different models of epidermal tumorigenesis. Epidermal deletion of Ihh resulted in increased formation of benign squamous papilloma. Strikingly, Ihh-deficient mice showed an increase in malignant squamous cell carcinoma and developed lung and lymph node metastases. In a sebaceous gland tumor model, Ihh deficiency inhibited tumor cell differentiation. More mechanistically, IHH stimulated cell proliferation by activating the transcription factor GLI2 in human keratinocytes and human tumors. Thus, our results uncover important functions for Ihh signaling in controlling proliferation, differentiation, malignant progression, and metastasis of epithelial cancer, establishing Ihh as a gatekeeper for controlling the grade of tumor malignancy.
Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin
DEFF Research Database (Denmark)
Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith
2008-01-01
study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...
Epidermal inclusion cyst in male breast: mammographic and ultrasonographic findings in three cases
International Nuclear Information System (INIS)
Cubells, M.; Gil de Ramales, V.; Bulto, J. A.; Morcillo, E.; Celma, J.
2000-01-01
Three cases of histologically diagnosed epidermal inclusion cysts in male breast are presented. This is a very uncommon condition that results from the inclusion of epidermal remnants beneath the skin, which form a keratin-filled cystic cavity. The clinical presentation is that of palpable breast masses showing medium-to-high density in mammography. They are well defined and do not present calcifications. Ultrasound discloses their cystic form, with moderate posterior reinforcement, although they do not appear as anechoic cysts. Characteristically, echoes are detected in the interior that correspond to the degeneration keratin. The differential diagnosis should include cysts complicated by infection or hemorrhage, fibroadenomas with low echogenicity and even tumors of neoplastic origin. Color Doppler ultrasound disclosed the absence of internal vascularisation, a circumstance that indicated the benignity of the lesion. (Author) 9 refs
Gonzales-Castañeda, Cynthia; Rivera, Valery; Chirinos, Ana Lucía; Evelson, Pablo; Gonzales, Gustavo Francisco
2011-08-01
Skin exposure to ultraviolet (UV) B radiation leads to epidermal damage and generation of reactive oxygen species. The photoprotective effect of extracts of three varieties of leaves (red, yellow, and black) from maca (Lepidium meyenii), a plant from the Peruvian highlands, was assessed in mouse skin exposed to UVB radiation. The hydroalcoholic extracts of three varieties of maca leaves were applied topically to the dorsal skin of young-adult male mice prior to exposition to UVB radiation. The three varieties had UVA/UVB absorptive properties and presented antioxidant activity, being highest with red maca, followed by black and yellow maca. The three varieties of maca leaves prevented the development of sunburn cells, epidermal hyperplasia, leukocytic infiltration, and other alterations produced by UVB radiation. Mice treated with black maca showed the highest superoxide dismutase levels, and mice treated with black and yellow maca showed higher catalase levels in skin, whereas red maca protected the skin and liver against significant increases in the lipid peroxidation activity observed in the unprotected animals. The presence of significant antioxidant activity and the inhibition of lipid peroxidation suggest that the observed protection could be partly attributable to this mechanism. © 2011 The International Society of Dermatology.
Hyaluronate fragments reverse skin atrophy by a CD44-dependent mechanism.
Directory of Open Access Journals (Sweden)
Gürkan Kaya
2006-12-01
Full Text Available BACKGROUND: Skin atrophy is a common manifestation of aging and is frequently accompanied by ulceration and delayed wound healing. With an increasingly aging patient population, management of skin atrophy is becoming a major challenge in the clinic, particularly in light of the fact that there are no effective therapeutic options at present. METHODS AND FINDINGS: Atrophic skin displays a decreased hyaluronate (HA content and expression of the major cell-surface hyaluronate receptor, CD44. In an effort to develop a therapeutic strategy for skin atrophy, we addressed the effect of topical administration of defined-size HA fragments (HAF on skin trophicity. Treatment of primary keratinocyte cultures with intermediate-size HAF (HAFi; 50,000-400,000 Da but not with small-size HAF (HAFs; 400,000 Da induced wild-type (wt but not CD44-deficient (CD44-/- keratinocyte proliferation. Topical application of HAFi caused marked epidermal hyperplasia in wt but not in CD44-/- mice, and significant skin thickening in patients with age- or corticosteroid-related skin atrophy. The effect of HAFi on keratinocyte proliferation was abrogated by antibodies against heparin-binding epidermal growth factor (HB-EGF and its receptor, erbB1, which form a complex with a particular isoform of CD44 (CD44v3, and by tissue inhibitor of metalloproteinase-3 (TIMP-3. CONCLUSIONS: Our observations provide a novel CD44-dependent mechanism for HA oligosaccharide-induced keratinocyte proliferation and suggest that topical HAFi application may provide an attractive therapeutic option in human skin atrophy.
Protective effect of mango (Mangifera indica L.) against UVB-induced skin aging in hairless mice.
Song, Jae Hyoung; Bae, Eun Young; Choi, Goya; Hyun, Jin Won; Lee, Mi Young; Lee, Hye Won; Chae, Sungwook
2013-04-01
Mangifera indica L. (Anacardiaceae) is a medicinal plant whose extracts have been described as an antioxidant with anti-inflammatory and immunomodulatory activities. Skin aging is a consequence of chronic sun exposure to the sun and therefore ultraviolet (UV) radiation. Naturally occurring antioxidants are known to reduce skin aging. Therefore, the aim of the present study was to evaluate the protective role of mango extract against UVB-induced skin aging in hairless mice. HR-1 hairless male mice (6 weeks old) were divided into three groups: control (n = 5), UVB-treated vehicle (n = 5), and UVB-treated mango extract (n = 5) groups. UVB-irradiated mice from the mango extract group were orally administered 0.1 ml of water containing 100 mg of mango extract/kg body weight per day. The inhibitory activity of mango extract on wrinkle formation was determined by the analysis of the skin replica, epidermal thickness based on histological examination, and damage to collagen fiber. The mean length of wrinkles in UVB-treated vehicle group significantly improved after the oral administration of mango extract, which significantly inhibited the increase in epidermal thickness and epidermal hypertrophy (P mango extract by Masson's trichrome staining. These results indicate that mango extract showed anti-photoaging activity in UVB-irradiated hairless mice. © 2013 John Wiley & Sons A/S.
Kamo, Atsuko; Tominaga, Mitsutoshi; Kamata, Yayoi; Kaneda, Kazuyuki; Ko, Kyi C; Matsuda, Hironori; Kimura, Utako; Ogawa, Hideoki; Takamori, Kenji
2014-12-01
Epidermal hyperinnervation, which is thought to underlie intractable pruritus, has been observed in patients with atopic dermatitis (AD). The epidermal expression of axonal guidance molecules has been reported to regulate epidermal hyperinnervation. Previously, we showed that the excimer lamp has antihyperinnervative effects in nonpruritic dry-skin model mice, although epidermal expression of axonal guidance molecules was unchanged. Therefore, we investigated the antipruritic effects of excimer lamp irradiation and its mechanism of action. A single irradiation of AD model mice significantly inhibited itch-related behavior 1 day later, following improvement in the dermatitis score. In addition, irradiation of nerve fibers formed by cultured dorsal root ganglion neurons increased bleb formation and decreased nerve fiber expression of nicotinamide mononucleotide adenylyl transferase 2, suggesting degenerative changes in these fibers. We also analyzed whether attaching a cutoff excimer filter (COF) to the lamp, thus decreasing cytotoxic wavelengths, altered hyperinnervation and the production of cyclobutane pyrimidine dimer (CPD), a DNA damage marker, in dry-skin model mice. Irradiation with COF decreased CPD production in keratinocytes, as well as having an antihyperinnervative effect, indicating that the antipruritic effects of excimer lamp irradiation with COF are due to induction of epidermal nerve degeneration and reduced DNA damage.
Sugiyama-Nakagiri, Y; Naoe, A; Ohuchi, A; Kitahara, T
2011-04-01
Conspicuous facial pores are one type of serious aesthetic defects for many women. However, the mechanism(s) that underlie the conspicuousness of facial pores remains unclear. We previously characterized the epidermal architecture around facial pores that correlates with the appearance of those pores in various ethnic groups including Japanese. The goal of this study was to evaluate the possible relationships between facial pore size, the severity of impairment of epidermal architecture around facial pores and sebum output levels to investigate the possible role of IGF-1 in the pathogenesis of conspicuous facial pores. The subjects consisted of 38 healthy Japanese women (aged 22-41 years). IGF-1 was measured using immunoradiometric assay. Surface replicas were collected to compare pore sizes of cheek skin and horizontal cross-section images of cheek skin were obtained non-invasively from the same subjects using in vivo confocal laser scanning microscopy and the severity of impairment of epidermal architecture around facial pores was determined. The skin surface lipids of each subject were collected from their cheeks and lipid classes were determined using gas chromatography/flame ionization detection. The serum level of IGF-1 correlated significantly with total pore area (R = 0.36, P facial pores (R = 0.43, P pore area (R = 0.32, P facial skin characteristics including facial pore size and with the severity of impairment of epidermal architecture around facial pores. © 2010 The Authors. Journal compilation © 2010 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Irritability and Anxiety Severity Among Youth With Anxiety
Cornacchio, Danielle; Crum, Kathleen I.; Coxe, Stefany; Pincus, Donna B.; Comer, Jonathan S.
2015-01-01
Objective Most research on irritability and child psychopathology has focused on depressive disorders, bipolar disorder, and/or oppositional defiant disorder (ODD). Less is known about relationships between child anxiety and irritability and moderators of such associations. Method Structural equation modeling (SEM) examined associations between anxiety severity and irritability in a large sample of treatment-seeking youth with anxiety disorders (N=663, ages 7–19 years, M=12.25), after accounting for comorbid depressive disorders and ODD. Additional analyses examined whether associations were moderated by child gender, age, and generalized anxiety disorder (GAD) status. Results There was a direct link between child anxiety and irritability even after accounting for comorbid depressive disorders and ODD. Links between child anxiety and irritability were robust across child gender and age. Further, relationships between child anxiety and irritability were comparable across youth with and without GAD, suggesting that the anxiety–irritability link is relevant across child anxiety disorders and not circumscribed to youth with GAD. Conclusion Findings add to an increasing body of evidence linking child irritability to a range of internalizing and externalizing psychopathologies, and suggest that child anxiety assessment should systematically incorporate irritability evaluations. Further, youth in clinical settings displaying irritability should be assessed for the presence of anxiety. Moreover, treatments for childhood anxiety may do well to incorporate new treatment modules as needed that specifically target problems of irritability. PMID:26703910
Klar, Agnes S; Biedermann, Thomas; Michalak, Katarzyna; Michalczyk, Teresa; Meuli-Simmen, Claudia; Scherberich, Arnaud; Meuli, Martin; Reichmann, Ernst
2017-12-01
There is accumulating evidence that interactions between epidermal melanocytes and stromal cells play an important role in the regulation of skin pigmentation. In this study we established a pigmented dermo-epidermal skin model, melDESS, of human origin to investigate the effects of distinct stromal cells on melanogenesis. melDESS is a complex, clinically relevant skin equivalent composed of an epidermis containing both melanocytes and keratinocytes. Its dermal compartment consists either of adipose tissue-derived stromal cells, dermal fibroblasts (Fbs), or a mixture of both cell types. These skin substitutes were transplanted for 5 weeks on the backs of immuno-incompetent rats and analyzed. Gene expression and Western blot analyses showed a significantly higher expression of transforming growth factor-β1 by adipose tissue-derived stromal cells compared with dermal Fbs. In addition, we showed that melanocytes responded to the increased levels of transforming growth factor-β1 by down-regulating the expression of key melanogenic enzymes such as tyrosinase. This caused decreased melanin synthesis and, consequently, greatly reduced pigmentation of melDESS. The conclusions are of utmost clinical relevance, namely that adipose tissue-derived stromal cells derived from the hypodermis fail to appropriately interact with epidermal melanocytes, thus preventing the sustainable restoration of the patient's native skin color in bioengineered skin grafts. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Identification and comparative analysis of the epidermal differentiation complex in snakes
Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2017-01-01
The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630
Use of autologous tissue engineered skin to treat porcine full-thickness skin defects
Institute of Scientific and Technical Information of China (English)
CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang
2005-01-01
Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.
Masaki, Hitoshi; Yamashita, Yuki; Kyotani, Daiki; Honda, Tatsuya; Takano, Kenichi; Tamura, Toshiyasu; Mizutani, Taeko; Okano, Yuri
2018-03-30
Skin hydration is generally assessed using the parameters of skin surface water content (SWC) and trans-epidermal water loss (TEWL). To date, few studies have characterized skin conditions using correlations between skin hydration parameters and corneocyte parameters. The parameters SWC and TEWL allow the classification of skin conditions into four distinct Groups. The purpose of this study was to assess the characteristics of skin conditions classified by SWC and TEWL for correlations with parameters from corneocytes. A human volunteer test was conducted that measured SWC and TEWL. As corneocyte-derived parameters, the size and thick abrasion ratios, the ratio of sulfhydryl groups and disulfide bonds (SH/SS) and CP levels were analyzed. Volunteers were classified by their median SWC and TEWL values into 4 Groups: Group I (high SWC/low TEWL), Group II (high SWC/high TEWL), Group III (low SWC/low TEWL), and Group IV (low SWC/high TEWL). Group IV showed a significantly smaller size of corneocytes. Groups III and IV had significantly higher thick abrasion ratios and CP levels. Group I had a significantly lower SH/SS value. The SWC/TEWL value showed a decline in order from Group I to Group IV. Groups classified by their SWC and TEWL values showed characteristic skin conditions. We propose that the SWC and TEWL ratio is a comprehensive parameter to assess skin conditions. © 2018 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Pawel K Mazur
Full Text Available BACKGROUND: The Ras and Notch signaling pathways are frequently activated during development to control many diverse cellular processes and are often dysregulated during tumorigenesis. To study the role of Notch and oncogenic Kras signaling in a progenitor cell population, Pdx1-Cre mice were utilized to generate conditional oncogenic Kras(G12D mice with ablation of Notch1 and/or Notch2. METHODOLOGY/PRINCIPAL FINDINGS: Surprisingly, mice with activated Kras(G12D and Notch1 but not Notch2 ablation developed skin papillomas progressing to squamous cell carcinoma providing evidence for Pdx1 expression in the skin. Immunostaining and lineage tracing experiments indicate that PDX1 is present predominantly in the suprabasal layers of the epidermis and rarely in the basal layer. Further analysis of keratinocytes in vitro revealed differentiation-dependent expression of PDX1 in terminally differentiated keratinocytes. PDX1 expression was also increased during wound healing. Further analysis revealed that loss of Notch1 but not Notch2 is critical for skin tumor development. Reasons for this include distinct Notch expression with Notch1 in all layers and Notch2 in the suprabasal layer as well as distinctive p21 and β-catenin signaling inhibition capabilities. CONCLUSIONS/SIGNIFICANCE: Our results provide strong evidence for epidermal expression of Pdx1 as of yet not identified function. In addition, this finding may be relevant for research using Pdx1-Cre transgenic strains. Additionally, our study confirms distinctive expression and functions of Notch1 and Notch2 in the skin supporting the importance of careful dissection of the contribution of individual Notch receptors.
Liang, Xiao; Huang, Xiaolu; Zhou, Yiwen; Jin, Rui; Li, Qingfeng
2016-07-01
Skin tissue expansion is a clinical procedure for skin regeneration to reconstruct cutaneous defects that can be accompanied by severe complications. The transplantation of mesenchymal stem cells (MSCs) has been proven effective in promoting skin expansion and helping to ameliorate complications; however, systematic understanding of its mechanism remains unclear. MSCs from luciferase-Tg Lewis rats were intravenously transplanted into a rat tissue expansion model to identify homing and transdifferentiation. To clarify underlying mechanisms, a systematic approach was used to identify the differentially expressed genes between mechanically stretched human MSCs and controls. The biological significance of these changes was analyzed through bioinformatic methods. We further investigated genes and pathways of interest to disclose their potential role in mechanical stretching-induced skin regeneration. Cross sections of skin samples from the expanded group showed significantly more luciferase(+) and stromal cell-derived factor 1α (SDF-1α)(+), luciferase(+)keratin 14(+), and luciferase(+)CD31(+) cells than the control group, indicating MSC transdifferentiation into epidermal basal cells and endothelial cells after SDF-1α-mediated homing. Microarray analysis suggested upregulation of genes related to hypoxia, vascularization, and cell proliferation in the stretched human MSCs. Further investigation showed that the homing of MSCs was blocked by short interfering RNA targeted against matrix metalloproteinase 2, and that mechanical stretching-induced vascular endothelial growth factor A upregulation was related to the Janus kinase/signal transducer and activator of transcription (Jak-STAT) and Wnt signaling pathways. This study determines that mechanical stretching might promote skin regeneration by upregulating MSC expression of genes related to hypoxia, vascularization, and cell proliferation; enhancing transplanted MSC homing to the expanded skin; and
Sonsmann, F K; Strunk, M; Gediga, K; John, C; Schliemann, S; Seyfarth, F; Elsner, P; Diepgen, T L; Kutz, G; John, S M
2014-05-01
To date, there are no legally binding requirements concerning product testing in cosmetics. This leads to various manufacturer-specific test methods and absent transparent information on skin cleansing products. A standardized in vivo test procedure for assessment of cleansing efficacy and corresponding barrier impairment by the cleaning process is needed, especially in the occupational context where repeated hand washing procedures may be performed at short intervals. For the standardization of the cleansing procedure, an Automated Cleansing Device (ACiD) was designed and evaluated. Different smooth washing surfaces of the equipment for ACiD (incl. goat hair, felt, felt covered with nitrile caps) were evaluated regarding their skin compatibility. ACiD allows an automated, fully standardized skin washing procedure. Felt covered with nitrile as washing surface of the rotating washing units leads to a homogenous cleansing result and does not cause detectable skin irritation, neither clinically nor as assessed by skin bioengineering methods (transepidermal water loss, chromametry). Automated Cleansing Device may be useful for standardized evaluation of the cleansing effectiveness and parallel assessment of the corresponding irritancy potential of industrial skin cleansers. This will allow objectifying efficacy and safety of industrial skin cleansers, thus enabling market transparency and facilitating rational choice of products. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Bhardwaj, Supriya; Rani, Seema; Srivastava, Niharika; Kumar, Ravinder; Parsad, Davinder
2017-03-01
Non-segmental vitiligo (NSV) results from autoimmune destruction of melanocytes. The altered levels of various cytokines have been proposed in the pathogenesis of vitiligo. However, the exact immune mechanisms have not yet been fully elucidated. To investigate the role of epidermal and systemic cytokines in active and stable NSV patients. Serum levels of inflammatory cytokines were checked in 42 active and 30 stable NSV patients with 30 controls. The lesional, perilesional and normal skin sections were subjected to H&E staining. The mRNA expression of inflammatory cytokines and their respective receptors were assessed by quantitative PCR in lesional skin of both active and stable NSV skin. The MITF and IL-17A were immunolocalized in lesional, perilesional and normal skin tissue. Significant increase in the expression of inflammatory cytokines, IL-17A, IL-1β and TGF-β was observed in active patients, whereas no change was observed in stable patients. A marked reduction in epidermal thickness was observed in lesional skin sections. Significant increase in IL-17A and significant decrease in microphthalmia associated transcription factor (MITF) expression was observed in lesional and perilesional skin sections. Moreover, qPCR analysis showed significant alterations in the mRNA levels of IL-17A, IL-1β, IFN-γ, TGF-β and their respective receptors in active and stable vitiligo patient samples. Increased levels of IL-17A and IL-1β cytokines and decreased expression of MITF suggested a possible role of these cytokines in dysregulation of melanocytic activity in the lesional skin and hence might be responsible for the progression of active vitiligo. Copyright © 2016 Elsevier Ltd. All rights reserved.
Acyl-CoA binding protein and epidermal barrier function
DEFF Research Database (Denmark)
Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J
2014-01-01
The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...
Interdisciplinary management of EGFR-inhibitor-induced skin reactions: a German expert opinion.
Potthoff, K; Hofheinz, R; Hassel, J C; Volkenandt, M; Lordick, F; Hartmann, J T; Karthaus, M; Riess, H; Lipp, H P; Hauschild, A; Trarbach, T; Wollenberg, A
2011-03-01
Anti-epidermal growth factor receptor treatment strategies, i.e. monoclonal antibodies such as cetuximab and panitumumab, or epidermal growth factor receptor (EGFR) small molecule tyrosine kinase inhibitors, such as erlotinib and gefitinib, have expanded the treatment options for different tumor types. Dermatologic toxic effects are the most common side-effects of EGFR inhibitor therapy. They can profoundly affect the patient's quality of life. The aim of this study was to provide interdisciplinary expert recommendations on how to treat patients with skin reactions undergoing anti-EGFR treatment. An expert panel from Germany with expertise in medical oncology, dermatology or clinical pharmacology was convened to develop expert recommendations based on published peer-reviewed literature. The expert recommendations for the state-of-the-art treatment of skin reactions induced by EGFR inhibitor therapy include recommendations for diagnostics and grading as well as grade-specific and stage-adapted treatment approaches and preventive measures. It was concluded that EGFR-inhibitor-related dermatologic reactions should always be treated combining basic care of the skin and a specific therapy adapted to stage and grade of skin reaction. For grade 2 and above, specific treatment recommendations for early- and later-stage skin reactions induced by EGFR-inhibitor therapy were proposed. This paper presents a German national expert opinion for the treatment of skin reactions in patients receiving EGFR inhibitor therapy.
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
Energy Technology Data Exchange (ETDEWEB)
Gibbs, Susan, E-mail: S.Gibbs@VUMC.nl [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Corsini, Emanuela [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Spiekstra, Sander W. [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Galbiati, Valentina [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Fuchs, Horst W. [CellSystems GmbH, Troisdorf (Germany); DeGeorge, George; Troese, Matthew [MB Research Labs, Spinnerstown, PA (United States); Hayden, Patrick; Deng, Wei [MatTek Corporation, Ashland, MA (United States); Roggen, Erwin [3Rs Management and Consultancy (Denmark)
2013-10-15
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC{sub 50}) with human and animal data showed a superior correlation with human DSA{sub 05} (μg/cm{sup 2}) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA{sub 05} = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA{sub 05} data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
International Nuclear Information System (INIS)
Gibbs, Susan; Corsini, Emanuela; Spiekstra, Sander W.; Galbiati, Valentina; Fuchs, Horst W.; DeGeorge, George; Troese, Matthew; Hayden, Patrick; Deng, Wei; Roggen, Erwin
2013-01-01
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC 50 ) with human and animal data showed a superior correlation with human DSA 05 (μg/cm 2 ) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA 05 = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA 05 data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency • EC50 (chemical
Tissue-Engineered Skin Substitute Enhances Wound Healing after Radiation Therapy.
Busra, Mohd Fauzi bin Mh; Chowdhury, Shiplu Roy; bin Ismail, Fuad; bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj
2016-03-01
When given in conjunction with surgery for treating cancer, radiation therapy may result in impaired wound healing, which, in turn, could cause skin ulcers. In this study, bilayer and monolayer autologous skin substitutes were used to treat an irradiated wound. A single dose of 30 Gy of linear electron beam radiation was applied to the hind limb of nude mice before creating the skin lesion (area of 78.6 mm). Monolayer tissue-engineered skin substitutes (MTESSs) were prepared by entrapping cultured keratinocytes in fibrin matrix, and bilayer tissue-engineered skin substitutes (BTESSs) were prepared by entrapping keratinocytes and fibroblasts in separate layers. Bilayer tissue-engineered skin substitute and MTESS were implanted to the wound area. Gross appearance and wound area were analyzed to evaluate wound healing efficiency. Skin regeneration and morphological appearance were observed via histological and electron microscopy. Protein expressions of transforming growth factor β1 (TGF-β1), platelet-derived growth factor BB (PDGF-BB), and vascular endothelial growth factor (VEGF) in skin regeneration were evaluated by immunohistochemistry (IHC). Macroscopic observation revealed that at day 13, treatments with BTESS completely healed the irradiated wound, whereas wound sizes of 1.1 ± 0.05 and 6.8 ± 0.14 mm were measured in the MTESS-treated and untreated control groups, respectively. Hematoxylin-eosin (H&E) analysis showed formation of compact and organized epidermal and dermal layers in the BTESS-treated group, as compared with MTESS-treated and untreated control groups. Ultrastructural analysis indicates maturation of skin in BTESS-treated wound evidenced by formation of intermediate filament bundles in the dermal layer and low intercellular space in the epidermal layer. Expressions of TGF-β1, PDGF-BB, and VEGF were also higher in BTESS-treated wounds, compared with MTESS-treated wounds. These results indicate that BTESS is the preferred treatment for
Wang, Zheng; Mu, Hong-Jie; Zhang, Xue-Mei; Ma, Peng-Kai; Lian, Sheng-Nan; Zhang, Feng-Pu; Chu, Sheng-Ying; Zhang, Wen-Wen; Wang, Ai-Ping; Wang, Wen-Yan; Sun, Kao-Xiang
2015-01-01
Rotigotine is a potent and selective D1, D2, and D3 dopaminergic receptor agonist. Due to an extensive first-pass effect, it has a very low oral bioavailability (approximately 0.5% in rats). The present investigation aimed to develop a microemulsion-based hydrogel for transdermal rotigotine delivery with lower application site reactions. Pseudoternary phase diagrams were constructed to determine the region of oil in water (o/w)-type microemulsion. Central composite design was used to support the pseudoternary phase diagrams and to select homogeneous and stable microemulsions with an optimal amount of rotigotine permeation within 24 hours. In vitro skin permeation experiments were performed, using Franz diffusion cells, to compare rotigotine-loaded microemulsions with rotigotine solutions in oil. The optimized formulation was used to prepare a microemulsion-based hydrogel, which was subjected to bioavailability and skin irritancy studies. The selected formulations of rotigotine-loaded microemulsions had enhanced flux and permeation coefficients compared with rotigotine in oil. The optimum microemulsion contained 68% water, 6.8% Labrafil(®), 13.44% Cremophor(®) RH40, 6.72% Labrasol(®), and 5.04% Transcutol(®) HP; the drug-loading rate was 2%. To form a microemulsion gel, 1% Carbomer 1342 was added to the microemulsion. The bioavailability of the rotigotine-loaded microemulsion gel was 105.76%±20.52% with respect to the marketed rotigotine patch (Neupro(®)). The microemulsion gel irritated the skin less than Neupro. A rotigotine microemulsion-based hydrogel was successfully developed, and an optimal formulation for drug delivery was identified. This product could improve patient compliance and have broad marketability.
Molecular basis of retinol anti-ageing properties in naturally aged human skin in vivo.
Shao, Y; He, T; Fisher, G J; Voorhees, J J; Quan, T
2017-02-01
Retinoic acid has been shown to improve the aged-appearing skin. However, less is known about the anti-ageing effects of retinol (ROL, vitamin A), a precursor of retinoic acid, in aged human skin in vivo. This study aimed to investigate the molecular basis of ROL anti-ageing properties in naturally aged human skin in vivo. Sun-protected buttock skin (76 ± 6 years old, n = 12) was topically treated with 0.4% ROL and its vehicle for 7 days. The effects of topical ROL on skin epidermis and dermis were evaluated by immunohistochemistry, in situ hybridization, Northern analysis, real-time RT-PCR and Western analysis. Collagen fibrils nanoscale structure and surface topology were analysed by atomic force microscopy. Topical ROL shows remarkable anti-ageing effects through three major types of skin cells: epidermal keratinocytes, dermal endothelial cells and fibroblasts. Topical ROL significantly increased epidermal thickness by stimulating keratinocytes proliferation and upregulation of c-Jun transcription factor. In addition to epidermal changes, topical ROL significantly improved dermal extracellular matrix (ECM) microenvironment; increasing dermal vascularity by stimulating endothelial cells proliferation and ECM production (type I collagen, fibronectin and elastin) by activating dermal fibroblasts. Topical ROL also stimulates TGF-β/CTGF pathway, the major regulator of ECM homeostasis, and thus enriched the deposition of ECM in aged human skin in vivo. 0.4% topical ROL achieved similar results as seen with topical retinoic acid, the biologically active form of ROL, without causing noticeable signs of retinoid side effects. 0.4% topical ROL shows remarkable anti-ageing effects through improvement of the homeostasis of epidermis and dermis by stimulating the proliferation of keratinocytes and endothelial cells, and activating dermal fibroblasts. These data provide evidence that 0.4% topical ROL is a promising and safe treatment to improve the naturally aged human skin
Energy Technology Data Exchange (ETDEWEB)
Wang, Wenjie [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China); Luo, Judong [Department of Radiotherapy, Changzhou Tumor Hospital, Soochow University, Changzhou (China); Sheng, Wenjiong; Xue, Jiao; Li, Ming [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Ji, Jiang [Department of Dermatology, the Second Affiliated Hospital of Soochow University, Suzhou (China); Liu, Pengfei [Department of Gastroenterology, the Affiliated Jiangyin Hospital of Southeast University, Jiangyin (China); Zhang, Xueguang [Institute of Medical Biotechnology and Jiangsu Stem Cell Key Laboratory, Medical College of Soochow University, Suzhou (China); Cao, Jianping [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Zhang, Shuyu, E-mail: zhang.shuyu@hotmail.com [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China)
2016-06-01
Purpose: To investigate the molecular changes underlying the pathogenesis of radiation-induced skin fibrosis. Methods and Materials: Rat skin was irradiated to 30 or 45 Gy with an electron beam. Protein expression in fibrotic rat skin and adjacent normal tissues was quantified by label-free protein quantitation. Human skin cells HaCaT and WS-1 were treated by x-ray irradiation, and the proteasome activity was determined with a fluorescent probe. The effect of proteasome inhibitors on Transforming growth factor Beta (TGF-B) signaling was measured by Western blot and immunofluorescence. The efficacy of bortezomib in wound healing of rat skin was assessed by the skin injury scale. Results: We found that irradiation induced epidermal and dermal hyperplasia in rat and human skin. One hundred ninety-six preferentially expressed and 80 unique proteins in the irradiated fibrotic skin were identified. Through bioinformatic analysis, the ubiquitin-proteasome pathway showed a significant fold change and was investigated in greater detail. In vitro experiments demonstrated that irradiation resulted in a decline in the activity of the proteasome in human skin cells. The proteasome inhibitor bortezomib suppressed profibrotic TGF-β downstream signaling but not TGF-β secretion stimulated by irradiation in HaCaT and WS-1 cells. Moreover, bortezomib ameliorated radiation-induced skin injury and attenuated epidermal hyperplasia. Conclusion: Our findings illustrate the molecular changes during radiation-induced skin fibrosis and suggest that targeting the ubiquitin-proteasome system would be an effective countermeasure.
McNamara, Maria E; Zhang, Fucheng; Kearns, Stuart L; Orr, Patrick J; Toulouse, André; Foley, Tara; Hone, David W E; Rogers, Chris S; Benton, Michael J; Johnson, Diane; Xu, Xing; Zhou, Zhonghe
2018-05-25
Feathers are remarkable evolutionary innovations that are associated with complex adaptations of the skin in modern birds. Fossilised feathers in non-avian dinosaurs and basal birds provide insights into feather evolution, but how associated integumentary adaptations evolved is unclear. Here we report the discovery of fossil skin, preserved with remarkable nanoscale fidelity, in three non-avian maniraptoran dinosaurs and a basal bird from the Cretaceous Jehol biota (China). The skin comprises patches of desquamating epidermal corneocytes that preserve a cytoskeletal array of helically coiled α-keratin tonofibrils. This structure confirms that basal birds and non-avian dinosaurs shed small epidermal flakes as in modern mammals and birds, but structural differences imply that these Cretaceous taxa had lower body heat production than modern birds. Feathered epidermis acquired many, but not all, anatomically modern attributes close to the base of the Maniraptora by the Middle Jurassic.
Proteomic profiling reveals candidate markers for arsenic-induced skin keratosis.
Guo, Zhiling; Hu, Qin; Tian, Jijing; Yan, Li; Jing, Chuanyong; Xie, Heidi Qunhui; Bao, Wenjun; Rice, Robert H; Zhao, Bin; Jiang, Guibin
2016-11-01
Proteomics technology is an attractive biomarker candidate discovery tool that can be applied to study large sets of biological molecules. To identify novel biomarkers and molecular targets in arsenic-induced skin lesions, we have determined the protein profile of arsenic-affected human epidermal stratum corneum by shotgun proteomics. Samples of palm and foot sole from healthy subjects were analyzed, demonstrating similar protein patterns in palm and sole. Samples were collected from the palms of subjects with arsenic keratosis (lesional and adjacent non-lesional samples) and arsenic-exposed subjects without lesions (normal). Samples from non-exposed healthy individuals served as controls. We found that three proteins in arsenic-exposed lesional epidermis were consistently distinguishably expressed from the unaffected epidermis. One of these proteins, the cadherin-like transmembrane glycoprotein, desmoglein 1 (DSG1) was suppressed. Down-regulation of DSG1 may lead to reduced cell-cell adhesion, resulting in abnormal epidermal differentiation. The expression of keratin 6c (KRT6C) and fatty acid binding protein 5 (FABP5) were significantly increased. FABP5 is an intracellular lipid chaperone that plays an essential role in fatty acid metabolism in human skin. This raises a possibility that overexpression of FABP5 may affect the proliferation or differentiation of keratinocytes by altering lipid metabolism. KRT6C is a constituent of the cytoskeleton that maintains epidermal integrity and cohesion. Abnormal expression of KRT6C may affect its structural role in the epidermis. Our findings suggest an important approach for future studies of arsenic-mediated toxicity and skin cancer, where certain proteins may represent useful biomarkers of early diagnoses in high-risk populations and hopefully new treatment targets. Further studies are required to understand the biological role of these markers in skin pathogenesis from arsenic exposure. Copyright © 2016 Elsevier Ltd
Protective effects of oleum curcumae wenchowensis on skin damage due to UVB
International Nuclear Information System (INIS)
Wang Zhicheng; Zhao Hongguang; Du Xiang; Li Yanbo; Guo Wei; Gong Shouliang; Xiao Jian; Yao Chongshun; Li Xiaokun
2006-01-01
Objective: To study the protective effects of oleum curcumae wenchowensis on skin damage exposed to UVB and its mechanism, and to provide the experimental basis for the protection of skin damage exposed to UVB. Methods: The skin of guinea pigs was exposed to UVB (28.38 J/cm 2 · 30 d) to establish the oxidative damage model. The skin erythema and the rough were observed during the experiment; the thickness of epiderm and the number of fibroblast were observed under light microscope after the experiment. The activities of GSH-Px, SOD, CAT and T-AOC and the contain of MDA in the supernate of skin homogenate were detected with biochemical methods. Results: The epiderm in UVB exposure group and blank group thickened, but that in protective group weren't observed; the number of fibroblast in UVB exposure group and blank group decreased, while that in protective group increased, but that in control group didn't. The content of MDA in the supemate of skin homogenate in UVB exposure group and blank group increased, but that in protective group deceased, and the activities of GSH-Px, SOD, CAT and T-AOC in UVB exposure group and blank group decreased, but those in protective group increased, and control group had no change. Conclusions: Oleum curcumae wenchowensis has the protective effects on skin damage exposed to UVB, which may be mediated by increasing the contain of antioxidases and eliminating the flee radical. (authors)
Resident Rounds: Part III - Case Report: Betel Quid Induced Irritant Contact Dermatitis of the Hand.
Mathieu, Regine J; Cheraghi, Nikoo; Russo, Marian A
2016-06-01
Betel quid is a drug used in Far East Asia, India, and the South Pacific. The habit of betel quid chewing is widely reported to cause oral cancer and tooth and gum disease. However, skin disease due to betel quid use is underreported. We report a case of irritant contact dermatitis to betel quid components in a 35-year-old male betel quid user who presented for evaluation of a persistent rash on his fingertips.
p120-catenin mediates inflammatory responses in the skin
DEFF Research Database (Denmark)
Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen
2006-01-01
but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...
Skin Stem Cell Hypotheses and Long Term Clone Survival - Explored Using Agent-based Modelling
Li, X.; Upadhyay, A.K.; Bullock, A.J.; Dicolandrea, T.; Xu, J.; Binder, R.L.; Robinson, M.K.; Finlay, D.R.; Mills, K.J.; Bascom, C.C.; Kelling, C.K.; Isfort, R.J.; Haycock, J.W.; MacNeil, S.; Smallwood, R.H.
2013-01-01
Epithelial renewal in skin is achieved by the constant turnover and differentiation of keratinocytes. Three popular hypotheses have been proposed to explain basal keratinocyte regeneration and epidermal homeostasis: 1) asymmetric division (stem-transit amplifying cell); 2) populational asymmetry (progenitor cell with stochastic fate); and 3) populational asymmetry with stem cells. In this study, we investigated lineage dynamics using these hypotheses with a 3D agent-based model of the epiderm...
Wound-Related Allergic/Irritant Contact Dermatitis.
Alavi, Afsaneh; Sibbald, R Gary; Ladizinski, Barry; Saraiya, Ami; Lee, Kachiu C; Skotnicki-Grant, Sandy; Maibach, Howard
2016-06-01
To provide information from a literature review about the prevention, recognition, and treatment for contact dermatitis. This continuing education activity is intended for physicians and nurses with an interest in skin and wound care. After participating in this educational activity, the participant should be better able to:1. Identify signs and symptoms of and diagnostic measures for contact dermatitis.2. Identify causes and risks for contact dermatitis.3. Select appropriate treatment for contact dermatitis and its prevention. Contact dermatitis to wound care products is a common, often neglected problem. A review was conducted to identify articles relevant to contact dermatitis.A PubMed English-language literature review was conducted for appropriate articles published between January 2000 and December 2015.Contact dermatitis is both irritant (80% of cases) or allergic (20% of cases). Frequent use of potential contact allergens and impaired barrier function of the skin can lead to rising sensitization in patients with chronic wounds. Common known allergens to avoid in wound care patients include fragrances, colophony, lanolin, and topical antibiotics.Clinicians should be cognizant of the allergens in wound care products and the potential for sensitization. All medical devices, including wound dressings, adhesives, and bandages, should be labeled with their complete ingredients, and manufacturers should be encouraged to remove common allergens from wound care products, including topical creams, ointments, and dressings.
Tunnell, James W; Chang, David W; Johnston, Carol; Torres, Jorge H; Patrick, Charles W; Miller, Michael J; Thomsen, Sharon L; Anvari, Bahman
2003-06-01
Increasing radiant exposure offers a means to increase treatment efficacy during laser-mediated treatment of vascular lesions, such as port-wine stains; however, excessive radiant exposure decreases selective vascular injury due to increased heat generation within the epidermis and collateral damage to perivascular collagen. To determine if cryogen spray cooling could be used to maintain selective vascular injury (ie, prevent epidermal and perivascular collagen damage) when using high radiant exposures (16-30 J/cm2). Observational study. Academic hospital and research laboratory. Twenty women with normal abdominal skin (skin phototypes I-VI). Skin was irradiated with a pulsed dye laser (wavelength = 585 nm; pulse duration = 1.5 milliseconds; 5-mm-diameter spot) using various radiant exposures (8-30 J/cm2) without and with cryogen spray cooling (50- to 300-millisecond cryogen spurts). Hematoxylin-eosin-stained histologic sections from each irradiated site were examined for the degree of epidermal damage, maximum depth of red blood cell coagulation, and percentage of vessels containing perivascular collagen coagulation. Long cryogen spurt durations (>200 milliseconds) protected the epidermis in light-skinned individuals (skin phototypes I-IV) at the highest radiant exposure (30 J/cm2); however, epidermal protection could not be achieved in dark-skinned individuals (skin phototypes V-VI) even at the lowest radiant exposure (8 J/cm2). The red blood cell coagulation depth increased with increasing radiant exposure (to >2.5 mm for skin phototypes I-IV and to approximately 1.2 mm for skin phototypes V-VI). In addition, long cryogen spurt durations (>200 milliseconds) prevented perivascular collagen coagulation in all skin types. Cryogen spurt durations much longer than those currently used in therapy (>200 milliseconds) may be clinically useful for protecting the epidermis and perivascular tissues when using high radiant exposures during cutaneous laser therapies
Lange, Julia; Weil, Frederik; Riegler, Christoph; Groeber, Florian; Rebhan, Silke; Kurdyn, Szymon; Alb, Miriam; Kneitz, Hermann; Gelbrich, Götz; Walles, Heike; Mielke, Stephan
2016-10-01
Human artificial skin models are increasingly employed as non-animal test platforms for research and medical purposes. However, the overall histopathological quality of such models may vary significantly. Therefore, the effects of manufacturing protocols and donor sources on the quality of skin models built-up from fibroblasts and keratinocytes derived from juvenile foreskins is studied. Histo-morphological parameters such as epidermal thickness, number of epidermal cell layers, dermal thickness, dermo-epidermal adhesion and absence of cellular nuclei in the corneal layer are obtained and scored accordingly. In total, 144 full-thickness skin models derived from 16 different donors, built-up in triplicates using three different culture conditions were successfully generated. In univariate analysis both media and donor age affected the quality of skin models significantly. Both parameters remained statistically significant in multivariate analyses. Performing general linear model analyses we could show that individual medium-donor-interactions influence the quality. These observations suggest that the optimal choice of media may differ from donor to donor and coincides with findings where significant inter-individual variations of growth rates in keratinocytes and fibroblasts have been described. Thus, the consideration of individual medium-donor-interactions may improve the overall quality of human organ models thereby forming a reproducible test platform for sophisticated clinical research. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fajuyigbe, Damilola; Lwin, Su M; Diffey, Brian L; Baker, Richard; Tobin, Desmond J; Sarkany, Robert P E; Young, Antony R
2018-02-02
Epidermal DNA damage, especially to the basal layer, is an established cause of keratinocyte cancers (KCs). Large differences in KC incidence (20- to 60-fold) between white and black populations are largely attributable to epidermal melanin photoprotection in the latter. The cyclobutane pyrimidine dimer (CPD) is the most mutagenic DNA photolesion; however, most studies suggest that melanin photoprotection against CPD is modest and cannot explain the considerable skin color-based differences in KC incidence. Along with melanin quantity, solar-simulated radiation-induced CPD assessed immediately postexposure in the overall epidermis and within 3 epidermal zones was compared in black West Africans and fair Europeans. Melanin in black skin protected against CPD by 8.0-fold in the overall epidermis and by 59.0-, 16.5-, and 5.0-fold in the basal, middle, and upper epidermis, respectively. Protection was related to the distribution of melanin, which was most concentrated in the basal layer of black skin. These results may explain, at least in part, the considerable skin color differences in KC incidence. These data suggest that a DNA protection factor of at least 60 is necessary in sunscreens to reduce white skin KC incidence to a level that is comparable with that of black skin.-Fajuyigbe, D., Lwin, S. M., Diffey, B. L., Baker, R., Tobin, D. J., Sarkany, R. P. E., Young, A. R. Melanin distribution in human epidermis affords localized protection against DNA photodamage and concurs with skin cancer incidence difference in extreme phototypes.
Skin hydration and cooling effect produced by the Voltaren® vehicle gel.
Hug, Agnes M; Schmidts, Thomas; Kuhlmann, Jens; Segger, Dörte; Fotopoulos, Grigorios; Heinzerling, Johanna
2012-05-01
Voltaren vehicle gel is the carrier substance of the topical Voltaren products. This vehicle gel is especially formulated to be easily applied on the skin, while providing some sensory benefits. The present study aims to substantiate the widely perceived hydrating and cooling effect of Voltaren vehicle gel. Volar forearm skin hydration and transepidermal water loss (TEWL) were measured and user satisfaction was evaluated by questionnaires, after application in 31 healthy, female volunteers. The cooling effect was investigated for 40 min with thermal imaging on 12 forearm sites of six healthy subjects. Voltaren vehicle gel application increased skin hydration by 13.1% (P = 0.0002) when compared with the untreated site, 8 h after the final treatment after 2 weeks. TEWL decreased on both treated (0.37 g/m(2) /h) and untreated (0.74 g/m(2) /h) forearm sites after 2 weeks (8 h after last treatment), demonstrating a relative increase of 6.5% in water loss. Voltaren vehicle gel application resulted in a rapid reduction of skin surface temperature by 5.1°C after only 3 min with an average maximum reduction of 5.8°C after 10 min. The cooling effect was experienced by 94% subjects, while 74% felt that their skin became softer. No adverse events, including skin irritation, were reported during the study and by the 37 participants. This study showed a statistically significant increase in skin hydration as well as a rapid cooling effect lasting approximately 30 min, after application of Voltaren vehicle gel. The small relative increase in water loss may be attributed to an additional skin surface water loss secondary to the increased water content brought into the skin by the Voltaren vehicle gel. The use did not induce any skin irritation and was found acceptable to use by the majority of participants. © 2011 John Wiley & Sons A/S.
Directory of Open Access Journals (Sweden)
Yung-Yi Lee
2013-06-01
Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.
Modulation of accelerated repopulation in mouse skin during daily irradiation
International Nuclear Information System (INIS)
Trott, K.-R.; Shirazi, A.; Heasman, F.
1999-01-01
Background and purpose: The timing of acceleration of repopulation in the epidermis during daily irradiation is related to the development of skin erythema and epidermal hypoplasia. Therefore, the relationship between impairment of the epidermal barrier function, the dermal inflammatory response and epidermal hypoplasia with the acceleration of repopulation was investigated.Materials and purpose: Skin fields of approximately 1 cm 2 on the thighs of TUC mice were given five daily fractions of 3 Gy in each week followed by top-up doses at the end of the first, the second, or the third week to determine residual epidermal tolerance and to calculate repopulation rates in weeks 1, 2, or 3. Systemic modulation of repopulation was attempted by daily indomethacine during fractionated irradiation whereas tape stripping or UV-B exposure before the start of fractionated irradiation attempted local modulation. In parallel experiments, the water permeability coefficient of the epidermis was determined ex vivo by studying transepidermal transport of tritiated water.Results: Without modulation, no repopulation was found in the first week of daily fractionation but repopulation compensated 30% of the dose given in week two and 70% of the dose given in week three. Only tape stripping before the start of fractionated irradiation accelerated repopulation in week one. UV-B had no effect on repopulation although it stimulated proliferation as much as tape stripping. Indomethacin did not suppress acceleration of repopulation. A significant increase in transepidermal water loss was found but only after repopulation had already accelerated.Conclusions: Acceleration of repopulation in mouse epidermis during daily-fractionated irradiation is not related to the simultaneous development of an inflammatory response. Also, the loss of the epidermal barrier function is not involved in the development of the acceleration response, which rather seems to be triggered directly by the decreased
Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren
2017-10-23
The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.
Irritable bowel syndrome: contemporary nutrition management strategies.
Mullin, Gerard E; Shepherd, Sue J; Chander Roland, Bani; Ireton-Jones, Carol; Matarese, Laura E
2014-09-01
Irritable bowel syndrome is a complex disorder whose pathophysiology involves alterations in the enteric microbiota, visceral hypersensitivity, gut immune/barrier function, hypothalamic-pituitary-adrenal axis regulation, neurotransmitters, stress response, psychological factors, and more. The importance of diet in the management of irritable bowel syndrome has taken center stage in recent times as the literature validates the relationship of certain foods with the provocation of symptoms. Likewise, a number of elimination dietary programs have been successful in alleviating irritable bowel syndrome symptoms. Knowledge of the dietary management strategies for irritable bowel syndrome will help guide nutritionists and healthcare practitioners to deliver optimal outcomes. This tutorial reviews the nutrition management strategies for irritable bowel syndrome. © 2014 American Society for Parenteral and Enteral Nutrition.
Directory of Open Access Journals (Sweden)
Qiaoli Li
2011-11-01
Zebrafish (Danio rerio can serve as a model system to study heritable skin diseases. The skin is rapidly developed during the first 5–6 days of embryonic growth, accompanied by expression of skin-specific genes. Transmission electron microscopy (TEM of wild-type zebrafish at day 5 reveals a two-cell-layer epidermis separated from the underlying collagenous stroma by a basement membrane with fully developed hemidesmosomes. Scanning electron microscopy (SEM reveals an ordered surface contour of keratinocytes with discrete microridges. To gain insight into epidermal morphogenesis, we have employed morpholino-mediated knockdown of the abca12 and snap29 genes, which are crucial for secretion of lipids and intracellular trafficking of lamellar granules, respectively. Morpholinos, when placed on exon-intron junctions, were >90% effective in preventing the corresponding gene expression when injected into one- to four-cell-stage embryos. By day 3, TEM of abca12 morphants showed accumulation of lipid-containing electron-dense lamellar granules, whereas snap29 morphants showed the presence of apparently empty vesicles in the epidermis. Evaluation of epidermal morphogenesis by SEM revealed similar perturbations in both cases in the microridge architecture and the development of spicule-like protrusions on the surface of keratinocytes. These morphological findings are akin to epidermal changes in harlequin ichthyosis and CEDNIK syndrome, autosomal recessive keratinization disorders due to mutations in the ABCA12 and SNAP29 genes, respectively. The results indicate that interference of independent pathways involving lipid transport in the epidermis can result in phenotypically similar perturbations in epidermal morphogenesis, and that these fish mutants can serve as a model to study the pathomechanisms of these keratinization disorders.
Kharbikar, Bhushan N.; Kumar S., Harish; Kr., Sindhu; Srivastava, Rohit
2015-12-01
Chemotherapy Induced Nausea and Vomiting (CINV) is a serious health concern in the treatment of cancer patients. Conventional routes for administering anti-emetics (i.e. oral and parenteral) have several drawbacks such as painful injections, poor patient compliance, dependence on skilled personnel, non-affordability to majority of population (parenteral), lack of programmability and suboptimal bioavailability (oral). Hence, we have developed a trans-epidermal antiemetic drug delivery patch using out-of-plane hollow silicon microneedle array. Microneedles are pointed micron-scale structures that pierce the epidermal layer of skin to reach dermal blood vessels and can directly release the drug in their vicinity. They are painless by virtue of avoiding significant contact with dermal sensory nerve endings. This alternate approach gives same pharmacodynamic effects as par- enteral route at a sparse drug-dose requirement, hence negligible side-effects and improved patient compliance. Microneedle design attributes were derived by systematic study of human skin anatomy, natural micron-size structures like wasp-sting and cactus-spine and multi-physics simulations. We used deep reactive ion etching with Bosch process and optimized recipe of gases to fabricate high-aspect-ratio hollow silicon microneedle array. Finally, microneedle array and polydimethylsiloxane drug reservoir were assembled to make finished anti-emetic patch. We assessed microneedles mechanical stability, physico-chemical properties and performed in-vitro, ex- vivo and in-vivo studies. These studies established functional efficacy of the device in trans-epidermal delivery of anti-emetics, its programmability, ease of use and biosafety. Thus, out-of-plane hollow silicon microneedle array trans-epidermal antiemetic patch is a promising strategy for painless and effective management of CINV at low cost in mainstream healthcare.
[ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].
Song, Zhifang; Liu, Dewu
2014-07-01
To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.
Directory of Open Access Journals (Sweden)
Camilla Dal Bosco
2014-03-01
Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.
International Nuclear Information System (INIS)
Hufbauer, M.; Lazic, D.; Akguel, B.; Brandsma, J.L.; Pfister, H.; Weissenborn, S.J.
2010-01-01
Human papillomavirus 8 (HPV8) is involved in skin cancer development in epidermodysplasia verruciformis patients. Transgenic mice expressing HPV8 early genes (HPV8-CER) developed papillomas, dysplasias and squamous cell carcinomas. UVA/B-irradiation and mechanical wounding of HPV8-CER mouse skin led to prompt papilloma induction in about 3 weeks. The aim of this study was to analyze the kinetics and level of transgene expression in response to skin irritations. Transgene expression was already enhanced 1 to 2 days after UVA/B-irradiation or tape-stripping and maintained during papilloma development. The enhanced transgene expression could be assigned to UVB and not to UVA. Papilloma development was thus always paralleled by an increased transgene expression irrespective of the type of skin irritation. A knock-down of E6 mRNA by tattooing HPV8-E6-specific siRNA led to a delay and a lower incidence of papilloma development. This indicates that the early increase of viral oncogene expression is crucial for induction of papillomatosis.
Microneedle-Mediated Delivery of Copper Peptide Through Skin.
Li, Hairui; Low, Yong Sheng Jason; Chong, Hui Ping; Zin, Melvin T; Lee, Chi-Ying; Li, Bo; Leolukman, Melvina; Kang, Lifeng
2015-08-01
Copper peptide (GHK-Cu) plays an important role in skin regeneration and wound healing. However, its skin absorption remains challenging due to its hydrophilicity. Here we use polymeric microneedle array to pre-treat skin to enhance GHK-Cu skin penetration. Two in vitro skin models were used to assess the capability of microneedles in facilitating skin delivery of GHK-Cu. Histological assay and confocal laser scanning microscopy were performed to characterize and quantify the microconduits created by the microneedles inside skin. Cellular and porcine models were used to evaluate the safety of microneedle-assisted copper peptide delivery. The depth and percentage of microneedle penetration were correlated with application forces, which in turn influenced the extent of enhancement in the skin permeability of GHK-Cu. In 9 h, 134 ± 12 nanomoles of peptide and 705 ± 84 nanomoles of copper permeated though the microneedle treated human skin, while almost no peptide or copper permeated through intact human skin. No obvious signs of skin irritation were observed with the use of GHK-Cu after microneedle pretreatment. It is effective and safe to enhance the skin permeation of GHK-Cu by using microneedles. This approach may be useful to deliver similar peptides or minerals through skin.
Aging and senescence of skin cells in culture
DEFF Research Database (Denmark)
Rattan, Suresh
2015-01-01
Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...
Iron deposition in skin of patients with haemochromatosis
International Nuclear Information System (INIS)
Pinheiro, T.; Silva, J.N.; Alves, L.C.; Filipe, P.
2003-01-01
Haemochromatosis is the most common inherited liver disease in Caucasians and the most common autosomal recessive genetic disorder. It is characterized by inappropriately high iron absorption resulting in progressive iron overload in parenchymal organs such as liver, heart, pancreas, pituitary, joints, and skin. Upon early detection, haemochromatosis can be a manageable chronic disease but, if undetected, is potentially fatal. Skin biopsies were obtained from patients and from healthy donors. Images of the elemental distributions in skin were obtained using nuclear microscopy techniques (nuclear microprobe, NMP). Elemental profiles along skin, and intra-, and extra-cellular iron concentrations, were determined. Results for patients with haemochromatosis were cross-examined with morphologic features and with data obtained for healthy skin. Skin iron content is much increased in patients with haemochromatosis when compared with healthy subjects. Extensive iron deposits are observed at dermis, at the dermo-epidermal interface, at upper epidermis layers and at stratum corneum. Iron deposition was observed preferentially at cell boundaries or at the interstitial matrix
Standards for the Protection of Skin Barrier Function.
Giménez-Arnau, Ana
2016-01-01
The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.
Skin β-endorphin mediates addiction to UV light.
Fell, Gillian L; Robinson, Kathleen C; Mao, Jianren; Woolf, Clifford J; Fisher, David E
2014-06-19
UV light is an established carcinogen, yet evidence suggests that UV-seeking behavior has addictive features. Following UV exposure, epidermal keratinocytes synthesize proopiomelanocortin (POMC) that is processed to melanocyte-stimulating hormone, inducing tanning. We show that, in rodents, another POMC-derived peptide, β-endorphin, is coordinately synthesized in skin, elevating plasma levels after low-dose UV. Increases in pain-related thresholds are observed and reversed by pharmacologic opioid antagonism. Opioid blockade also elicits withdrawal signs after chronic UV exposure. This effect was sufficient to guide operant behavioral choices to avoidance of opioid withdrawal (conditioned place aversion). These UV-induced nociceptive and behavioral effects were absent in β-endorphin knockout mice and in mice lacking p53-mediated POMC induction in epidermal keratinocytes. Although primordial UV addiction, mediated by the hedonic action of β-endorphin and anhedonic effects of withdrawal, may theoretically have enhanced evolutionary vitamin D biosynthesis, it now may contribute to the relentless rise in skin cancer incidence in humans. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Burns, F.J.
1987-01-01
The work outlined in this report includes: epidermal DNA strand breaks and radiation penetration; activation of oncogenes in radiation induced rat skin tumors; and rat skin carcinogenesis by neon ions. The effect of radiation penetration on DNA single strand breaks has been studied extensively in rat and mouse epidermis. The results show clearly that the number of strand breaks per unit dose in the epidermal DNA is reduced by 50% to 65% when the radiation penetration is reduced from 1.0 mm to 0.2 mm. This penetration effect on DNA strand breaks was not seen in mouse epidermal cell lines growing in plastic dishes. The results imply that DNA strand breakage in superficial cells is partially dependent on the radiation dose to underlying tissue. The phenomenon is not mediated by systemic interactions as it was observed in irradiated explanted skin. The oncogene activation pattern in the radiation-induced skin tumors was found to be tumor dependent. Either K-ras activation or c-myc amplification or both was observed in each tumor analyzed so far. Even benign fibromas exhibited c-myc amplification. The carcinogenicity of high penetration electrons (2.0 MeV) was determined in preparation for similar studies with a neon ion beam at the Berkeley Bevelac. The principal finding so far is a large excess of connective tissue tumors, fibromas (benign) and sarcomas (malignant). 59 refs., 1 tab
Kulkarni, Raghavendra V; Sreedhar, V; Mutalik, Srinivas; Setty, C Mallikarjun; Sa, Biswanath
2010-11-01
Interpenetrating network (IPN) hydrogel membranes of sodium alginate (SA) and poly(vinyl alcohol) (PVA) were prepared by solvent casting method for transdermal delivery of an anti-hypertensive drug, prazosin hydrochloride. The prepared membranes were thin, flexible and smooth. The X-ray diffraction studies indicated the amorphous dispersion of drug in the membranes. Differential scanning calorimetric analysis confirmed the IPN formation and suggests that the membrane stiffness increases with increased concentration of glutaraldehyde (GA) in the membranes. All the membranes were permeable to water vapors depending upon the extent of cross-linking. The in vitro drug release study was performed through excised rat abdominal skin; drug release depends on the concentrations of GA in membranes. The IPN membranes extended drug release up to 24 h, while SA and PVA membranes discharged the drug quickly. The primary skin irritation and skin histopathology study indicated that the prepared IPN membranes were less irritant and safe for skin application. Copyright © 2010 Elsevier B.V. All rights reserved.
Skin Fungi from Colonization to Infection.
de Hoog, Sybren; Monod, Michel; Dawson, Tom; Boekhout, Teun; Mayser, Peter; Gräser, Yvonne
2017-07-01
Humans are exceptional among vertebrates in that their living tissue is directly exposed to the outside world. In the absence of protective scales, feathers, or fur, the skin has to be highly effective in defending the organism against the gamut of opportunistic fungi surrounding us. Most (sub)cutaneous infections enter the body by implantation through the skin barrier. On intact skin, two types of fungal expansion are noted: (A) colonization by commensals, i.e., growth enabled by conditions prevailing on the skin surface without degradation of tissue, and (B) infection by superficial pathogens that assimilate epidermal keratin and interact with the cellular immune system. In a response-damage framework, all fungi are potentially able to cause disease, as a balance between their natural predilection and the immune status of the host. For this reason, we will not attribute a fixed ecological term to each species, but rather describe them as growing in a commensal state (A) or in a pathogenic state (B).
Dhondt, Marijke M M; Adriaens, Els; Roey, Jens Van; Remon, Jean Paul
2005-08-01
The purpose of this study was to evaluate the local tolerance of vaginal gels (three gels containing dapivirine, the placebo gel, and Conceptrol) with the Slug Mucosal Irritation test and to compare the results with those of the rabbit vaginal irritation test. The irritation potential on the slug mucosa was assessed by the mucus production caused by a repeated treatment for 5 successive days. Additionally, membrane damage was estimated by the protein and enzyme release. By means of a classification prediction model the formulations were classified into four irritation classes. The effect of a 10-day intravaginal application of the gels on the rabbit vaginal and cervical mucosa was evaluated by means of macroscopic and microscopic examination. The placebo and dapivirine gels induced no irritation of the slug mucosa (low mucus production and protein release, no enzyme release) and no vaginal or cervical irritation in rabbits. Conceptrol caused severe irritation of the slug mucosa (increased mucus production, protein release, and enzyme release) and irritation of the rabbit vagina and cervix. The results obtained with the Slug Mucosal Irritation test were comparable to those of the rabbit vaginal irritation test.
Boralevi, F; Hubiche, T; Léauté-Labrèze, C; Saubusse, E; Fayon, M; Roul, S; Maurice-Tison, S; Taïeb, A
2008-02-01
Sensitization to atopens is an early phenomenon that overlaps with the onset of atopic dermatitis (AD) in infancy. Early epidermal barrier impairment may facilitate the epicutaneous penetration of atopens. To correlate transepidermal water loss (TEWL) and aeroallergen sensitization in infants with AD. In this cross-sectional study we enrolled 59 AD children and 30 controls aged 3-12 months. Transepidermal water loss in uninvolved skin, specific immunoglobulin E, atopy patch test (APT) and skin prick tests were performed with respect to seven aeroallergens, i.e., Dermatophagoides pteronyssinus, D. farinae, cat, dog, birch pollen, ambrosia, and cockroach. Environmental conditions were assessed by a questionnaire, and the house dust mite (HDM) concentration was determined in dust samples. Eighty-nine percent of AD infants had a positive APT vs one out of eleven controls. AD infants had a significantly higher mean TEWL than controls (27.4 vs 11.1 g/m(2)/h, P cats, and dogs at home. This study confirms the high prevalence of delayed sensitization to indoor and outdoor aeroallergens in AD infants, and shows that the higher the TEWL, the higher the prevalence of sensitization to aeroallergens. These data are in favor of a major role of a constitutive epidermal barrier impairment in determining early atopen sensitization in infants with AD.