Prolylcarboxypeptidase (PRCP as a new target for obesity treatment
Directory of Open Access Journals (Sweden)
Shariat-Madar Z
2010-04-01
Full Text Available B Shariat-Madar1, D Kolte2, A Verlangieri2, Z Shariat-Madar21College of Literature, Science, and the Arts, University of Michigan, Ann Arbor MI, USA; 2School of Pharmacy, Department of Pharmacology, University of Mississippi, University, MS, USAAbstract: Recently, we serendipitously discovered that mice with the deficiency of the enzyme prolylcarboxypeptidase (PRCP have elevated α-melanocyte-stimulating hormone (α-MSH levels which lead to decreased food intake and weight loss. This suggests that PRCP is an endogenous inactivator of α-MSH and an appetite stimulant. Since a modest weight loss can have the most profound influence on reducing cardiovascular risk factors, the inhibitors of PRCP would be emerging as a possible alternative for pharmacotherapy in high-risk patients with obesity and obesity-related disorders. The discovery of a new biological activity of PRCP in the PRCP-deficient mice and studies of α-MSH function indicate the importance and complexity of the hypothalamic pro-opiomelanocortin (POMC system in altering food intake. Identifying a role for PRCP in regulating α-MSH in the brain may be a critical step in enhancing our understanding of how the brain controls food intake and body weight. In light of recent findings, the potential role of PRCP in regulating fuel homeostasis is critically evaluated. Further studies of the role of PRCP in obesity are much needed.Keywords: prolylcarboxypeptidase, melanocyte-stimulating harmone, appetite, weight loss, cardiovascular risk, obesity
A digestive prolyl carboxypeptidase in Tenebrio molitor larvae.
Goptar, Irina A; Shagin, Dmitry A; Shagina, Irina A; Mudrik, Elena S; Smirnova, Yulia A; Zhuzhikov, Dmitry P; Belozersky, Mikhail A; Dunaevsky, Yakov E; Oppert, Brenda; Filippova, Irina Yu; Elpidina, Elena N
2013-06-01
Prolyl carboxypeptidase (PRCP) is a lysosomal proline specific serine peptidase that also plays a vital role in the regulation of physiological processes in mammals. In this report, we isolate and characterize the first PRCP in an insect. PRCP was purified from the anterior midgut of larvae of a stored product pest, Tenebrio molitor, using a three-step chromatography strategy, and it was determined that the purified enzyme was a dimer. The cDNA of PRCP was cloned and sequenced, and the predicted protein was identical to the proteomic sequences of the purified enzyme. The substrate specificity and kinetic parameters of the enzyme were determined. The T. molitor PRCP participates in the hydrolysis of the insect's major dietary proteins, gliadins, and is the first PRCP to be ascribed a digestive function. Our collective data suggest that the evolutionary enrichment of the digestive peptidase complex in insects with an area of acidic to neutral pH in the midgut is a result of the incorporation of lysosomal peptidases, including PRCP. Published by Elsevier Ltd.
S28 peptidases: lessons from a seemingly 'dysfunctional' family of two
Directory of Open Access Journals (Sweden)
Kozarich John W
2010-06-01
Full Text Available Abstract A recent paper in BMC Structural Biology reports the crystal structure of human prolylcarboxypeptidase (PRCP, one of the two members of the S28 peptidase family. Comparison of the substrate-binding site of PRCP with that of its family partner, dipeptidyl dipeptidase 7 (DPP7, helps to explain the different enzymatic activities of these structurally similar proteins, and also reveals a novel apparent charge-relay system in PRCP involving the active-site catalytic histidine. See research article: http://www.biomedcentral.com/1472-6807/10/16/ Commentary The S28 serine peptidase family is something of an enzymatic odd couple. While showing low sequence similarity to all proteins except each other, the two known family members appear to be at odds functionally; one, prolylcarboxypeptidase (PRCP, is a carboxypeptidase that cleaves single hydrophobic residues from the carboxyl termini of proteins that end with a Pro-X motif (where X is any hydrophobic amino acid, while the other, human dipeptidyl peptidase (DPP7, is an aminopeptidase that cleaves amino-terminal X-Pro dipeptides. The structural basis of this orthogonal specificity would undoubtedly be interesting, and a recent report in BMC Structural Biology from the Merck Global Structural Biology group (Soisson et al. 1 has now met that expectation. In addition they reveal a new wrinkle to the iconic catalytic triad common to most serine hydrolases. The practical pharmaceutical interest in both these enzymes as potential drug targets is at present speculative. PRCP can inactivate a number of peptide hormones, such as angiotensin II, III and prekallikrein, implicating a role for the enzyme in hypertension, tissue proliferation and smooth-muscle growth. These properties suggest that this enzyme may well be a useful target for hypertension and anti-inflammatory therapy 2. Another (non-S28 family dipeptidyl dipeptidase (DPP4 is a major drug target in type 2 diabetes, and Merck has already
Prolyl carboxypeptidase in Agouti-related Peptide neurons modulates food intake and body weight
Directory of Open Access Journals (Sweden)
Giuseppe Bruschetta
2018-04-01
Full Text Available Objective: Prolyl carboxypeptidase (PRCP plays a role in the regulation of energy metabolism by inactivating hypothalamic α-melanocyte stimulating hormone (α-MSH levels. Although detected in the arcuate nucleus, limited PRCP expression has been observed in the arcuate POMC neurons, and its site of action in regulating metabolism is still ill-defined. Methods: We performed immunostaining to assess the localization of PRCP in arcuate Neuropeptide Y/Agouti-related Peptide (NPY/AgRP neurons. Hypothalamic explants were then used to assess the intracellular localization of PRCP and its release at the synaptic levels. Finally, we generated a mouse model to assess the role of PRCP in NPY/AgRP neurons of the arcuate nucleus in the regulation of metabolism. Results: Here we show that PRCP is expressed in NPY/AgRP-expressing neurons of the arcuate nucleus. In hypothalamic explants, stimulation by ghrelin increased PRCP concentration in the medium and decreased PRCP content in synaptic extract, suggesting that PRCP is released at the synaptic level. In support of this, hypothalamic explants from mice with selective deletion of PRCP in AgRP neurons (PrcpAgRPKO showed reduced ghrelin-induced PRCP concentration in the medium compared to controls mice. Furthermore, male PrcpAgRPKO mice had decreased body weight and fat mass compared to controls. However, this phenotype was sex-specific as female PrcpAgRPKO mice show metabolic differences only when challenged by high fat diet feeding. The improved metabolism of PrcpAgRPKO mice was associated with reduced food intake and increased energy expenditure, locomotor activity, and hypothalamic α-MSH levels. Administration of SHU9119, a potent melanocortin receptor antagonist, selectively in the PVN of PrcpAgRPKO male mice increased food intake to a level similar to that of control mice. Conclusions: Altogether, our data indicate that PRCP is released at the synaptic levels and that PRCP in AgRP neurons contributes to
The two faces of endogenous DNA editing enzymes: Promoting ...
International Development Research Centre (IDRC) Digital Library (Canada)
The two faces of endogenous DNA editing enzymes: Promoting gene mutations as well as genome repair. Type B lymphocytes are a specific type of white blood cell within our immune system. They produce and export antibodies which seek out, attach to, and neutralize microbes and toxins. A unique way that B ...
DUOX enzyme activity promotes AKT signalling in prostate cancer cells.
Pettigrew, Christopher A; Clerkin, John S; Cotter, Thomas G
2012-12-01
Reactive oxygen species (ROS) and oxidative stress are related to tumour progression, and high levels of ROS have been observed in prostate tumours compared to normal prostate. ROS can positively influence AKT signalling and thereby promote cell survival. The aim of this project was to establish whether the ROS generated in prostate cancer cells positively regulate AKT signalling and enable resistance to apoptotic stimuli. In PC3 cells, dual oxidase (DUOX) enzymes actively generate ROS, which inactivate phosphatases, thereby maintaining AKT phosphorylation. Inhibition of DUOX by diphenylene iodium (DPI), intracellular calcium chelation and small-interfering RNA (siRNA) resulted in lower ROS levels, lower AKT and glycogen synthase kinase 3β (GSK3β) phosphorylation, as well as reduced cell viability and increased susceptibility to apoptosis stimulating fragment (FAS) induced apoptosis. This report shows that ROS levels in PC3 cells are constitutively maintained by DUOX enzymes, and these ROS positively regulate AKT signalling through inactivating phosphatases, leading to increased resistance to apoptosis.
An examination of neuromuscular and metabolic fatigue thresholds
International Nuclear Information System (INIS)
Bergstrom, Haley C; Housh, Terry J; Cochrane, Kristen C; Jenkins, Nathaniel D M; Lewis, Robert W Jr; Traylor, Daniel A; Schmidt, Richard J; Johnson, Glen O; Cramer, Joel T; Zuniga, Jorge M
2013-01-01
This study examined the relationships among the physical working capacity at the fatigue threshold (PWC FT ), the power outputs associated with the gas exchange threshold (PGET) and the respiratory compensation point (PRCP), and critical power (CP) to identify possible physiological mechanisms underlying the onset of neuromuscular fatigue. Ten participants (mean ± SD age: 20 ± 1 years) performed a maximal incremental cycle ergometer test to determine the PWC FT , PGET, and PRCP. CP was determined from the 3 min all-out test. The PWC FT (197 ± 55 W), PRCP (212 ± 50 W), and CP (208 ± 63 W) were significantly greater than the PGET (168 ± 40 W), but there were no significant differences among the PWC FT , PRCP, and CP. All thresholds were significantly inter-4 (r = 0.794–0.958). The 17% greater estimates for the PWC FT than PGET were likely related to differences in the physiological mechanisms that underlie these fatigue thresholds, while the non-significant difference and high correlation between the PWC FT and the PRCP suggested that hyperkalemia may underlie both thresholds. Furthermore, it is possible that the 5% lower estimate of the PWC FT than CP could more accurately reflect the demarcation of the heavy from severe exercise intensity domains. (paper)
Artificial Enzymes, "Chemzymes"
DEFF Research Database (Denmark)
Bjerre, Jeannette; Rousseau, Cyril Andre Raphaël; Pedersen, Lavinia Georgeta M
2008-01-01
Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models that successf......Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models...... that successfully perform Michaelis-Menten catalysis under enzymatic conditions (i.e., aqueous medium, neutral pH, ambient temperature) and for those that do, very high rate accelerations are seldomly seen. This review will provide a brief summary of the recent developments in artificial enzymes, so called...... "Chemzymes", based on cyclodextrins and other molecules. Only the chemzymes that have shown enzyme-like activity that has been quantified by different methods will be mentioned. This review will summarize the work done in the field of artificial glycosidases, oxidases, epoxidases, and esterases, as well...
Directory of Open Access Journals (Sweden)
Sheikh Hasna Habib
2016-01-01
Full Text Available Salinity is a major environmental stress that limits crop production worldwide. In this study, we characterized plant growth-promoting rhizobacteria (PGPR containing 1-aminocyclopropane-1-carboxylate (ACC deaminase and examined their effect on salinity stress tolerance in okra through the induction of ROS-scavenging enzyme activity. PGPR inoculated okra plants exhibited higher germination percentage, growth parameters, and chlorophyll content than control plants. Increased antioxidant enzyme activities (SOD, APX, and CAT and upregulation of ROS pathway genes (CAT, APX, GR, and DHAR were observed in PGPR inoculated okra plants under salinity stress. With some exceptions, inoculation with Enterobacter sp. UPMR18 had a significant influence on all tested parameters under salt stress, as compared to other treatments. Thus, the ACC deaminase-containing PGPR isolate Enterobacter sp. UPMR18 could be an effective bioresource for enhancing salt tolerance and growth of okra plants under salinity stress.
Directory of Open Access Journals (Sweden)
Tauchi Ryoji
2012-03-01
Full Text Available Abstract Background Chondroitin sulfate proteoglycans are major inhibitory molecules for neural plasticity under both physiological and pathological conditions. The chondroitin sulfate degrading enzyme chondroitinase ABC promotes functional recovery after spinal cord injury, and restores experience-dependent plasticity, such as ocular dominance plasticity and fear erasure plasticity, in adult rodents. These data suggest that the sugar chain in a proteoglycan moiety is essential for the inhibitory activity of proteoglycans. However, the significance of the core protein has not been studied extensively. Furthermore, considering that chondroitinase ABC is derived from bacteria, a mammalian endogenous enzyme which can inactivate the proteoglycans' activity is desirable for clinical use. Methods The degradation activity of ADAMTS-4 was estimated for the core proteins of chondroitin sulfate proteoglycans, that is, brevican, neurocan and phosphacan. To evaluate the biological significance of ADMATS-4 activity, an in vitro neurite growth assay and an in vivo neuronal injury model, spinal cord contusion injury, were employed. Results ADAMTS-4 digested proteoglycans, and reversed their inhibition of neurite outgrowth. Local administration of ADAMTS-4 significantly promoted motor function recovery after spinal cord injury. Supporting these findings, the ADAMTS-4-treated spinal cord exhibited enhanced axonal regeneration/sprouting after spinal cord injury. Conclusions Our data suggest that the core protein in a proteoglycan moiety is also important for the inhibition of neural plasticity, and provides a potentially safer tool for the treatment of neuronal injuries.
Directory of Open Access Journals (Sweden)
Alexander G Bulakhov
Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable
Zhang, Yan; Hong, Xiu-mei; Xing, Hou-xun; Li, Jian-ping; Huo, Yong; Xu, Xi-ping
2009-10-20
Marked interindividual variation exists in blood pressure response to benazepril, which is considered to have genetic basis. Our objectives were to evaluate whether the E112D polymorphism in the prolylcarboxypeptidase (PRCP) gene has impact on blood pressure response to benazepril. Hypertensive patients from Huoqiu County and Yuexi County of Anhui Province received daily treatment with an oral dosage of 10 mg benazepril for 15 days. Genotypes of the E112D polymorphism in the PRCP gene were determined by TaqMan SNP genotyping assay. Multivariate linear and Logistic regressions using generalized estimating equation model were performed in a total of 1092 patients to evaluate the association of PRCP genotypes and blood pressure response to benazepril. Patients carrying ED or DD genotype had a less systolic blood pressure reduction (adjusted beta = -3.7 + or - 1.1, P benazepril treatment in hypertensive patients of Anhui Province, China.
Enzyme-Catalyzed Transetherification of Alkoxysilanes
Directory of Open Access Journals (Sweden)
Peter G. Taylor
2013-01-01
Full Text Available We report the first evidence of an enzyme-catalyzed transetherification of model alkoxysilanes. During an extensive enzymatic screening in the search for new biocatalysts for silicon-oxygen bond formation, we found that certain enzymes promoted the transetherification of alkoxysilanes when tert-butanol or 1-octanol were used as the reaction solvents.
International Nuclear Information System (INIS)
Ida, Katsuya; Nakamura, Satoshi; Muro, Hiroyuki; Takai, Michikatsu; Kaneko, Masao
1995-01-01
Radiation-induced carcinogenesis of the rat liver using iridium-192 seeds as an intrahepatic radioactive source was studied by enzyme histochemical means. Rats were divided into six groups according to various combinations of one or two iridium-192 or stainless steel seeds and whether they were given a diet containing 0.05% phenobarbital (PB) or a basal diet (BD). Each group were sacrificed at 20, 40, and 60 weeks after intrahepatic insertion of the iridium-192 or stainless steel seeds. γ-Glutamyl transpeptidase (GGT), glucose-6-phosphatase (G6Pase), and adenosine triphosphatase (ATPase) were stained in the liver tissues, and GGT-positive foci were quantified. Liver neoplasm was not evident, but enzyme-altered foci (EAF) were induced by γ-ray irradiation. At every point (20, 40, and 60 weeks) after the insertion of the seeds, the GGT-positive area was larger in the rats given PB than those given BD. Moreover, despite the iridium-192 radioactivity decay, EAF developed continuously in the rats given PB, and persisted in those given BD from 40 to 60 weeks after insertion. These results indicated that phenobarbital promotes the development of EAF initiated by irradiation, as it promotes the process of chemical carcinogenesis in the rat liver. (author)
Expression of lignocellulolytic enzymes in Pichia pastoris
Directory of Open Access Journals (Sweden)
Mellitzer Andrea
2012-05-01
Full Text Available Abstract Background Sustainable utilization of plant biomass as renewable source for fuels and chemical building blocks requires a complex mixture of diverse enzymes, including hydrolases which comprise the largest class of lignocellulolytic enzymes. These enzymes need to be available in large amounts at a low price to allow sustainable and economic biotechnological processes. Over the past years Pichia pastoris has become an attractive host for the cost-efficient production and engineering of heterologous (eukaryotic proteins due to several advantages. Results In this paper codon optimized genes and synthetic alcohol oxidase 1 promoter variants were used to generate Pichia pastoris strains which individually expressed cellobiohydrolase 1, cellobiohydrolase 2 and beta-mannanase from Trichoderma reesei and xylanase A from Thermomyces lanuginosus. For three of these enzymes we could develop strains capable of secreting gram quantities of enzyme per liter in fed-batch cultivations. Additionally, we compared our achieved yields of secreted enzymes and the corresponding activities to literature data. Conclusion In our experiments we could clearly show the importance of gene optimization and strain characterization for successfully improving secretion levels. We also present a basic guideline how to correctly interpret the interplay of promoter strength and gene dosage for a successful improvement of the secretory production of lignocellulolytic enzymes in Pichia pastoris.
Yao, Xiangyang; Li, Guilan; Lü, Chaotian; Xu, Hui; Yin, Zhimin
2012-10-01
Arctigenin, a natural dibenzylbutyrolactone lignan compound, has been reported to possess anti-inflammatory properties. Previous works showed that arctigenin decreased lipopolysaccharide (LPS)-induced iNOS at transcription level. However, whether arctigenin could regulate iNOS at the post-translational level is still unclear. In the present study, we demonstrated that arctigenin promoted the degradation of iNOS which is expressed under LPS stimulation in murine macrophage-like RAW 264.7 cells. Such degradation of iNOS protein is due to CHIP-associated ubiquitination and proteasome-dependency. Furthermore, arctigenin decreased iNOS phosphorylation through inhibiting ERK and Src activation, subsequently suppressed iNOS enzyme activity. In conclusion, our research displays a new finding that arctigenin can promote the ubiqitination and degradation of iNOS after LPS stimulation. iNOS activity regulated by arctigenin is likely to involve a multitude of crosstalking mechanisms. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Reinhard Klein
2008-01-01
Full Text Available Gene directed-enzyme prodrug therapy (GDEPT is an approach for sensitization of tumor cells to an enzymatically activated, otherwise nontoxic, prodrug. Cytochrome P450 2B1 (CYP2B1 metabolizes the prodrugs cyclophosphamide (CPA and ifosfamide (IFA to produce the cytotoxic substances phosphoramide mustard and isophosphoramide mustard as well as the byproduct acrolein. We have constructed a retroviral promoter conversion (ProCon vector for breast cancer GDEPT. The vector allows expression of CYP2B1 from the mouse mammary tumor virus (MMTV promoter known to be active in the mammary glands of transgenic animals. It is anticipated to be used for the generation of encapsulated viral vector producing cells which, when placed inside or close to a tumor, will act as suppliers of the therapeutic CYP2B1 protein as well as of the therapeutic vector itself. The generated vector was effectively packaged by virus producing cells and allowed the production of high levels of enzymatically active CYP2B1 in infected cells which sensitized them to killing upon treatment with both IFA and CPA. Determination of the respective IC50 values demonstrated that the effective IFA dose was reduced by sixteen folds. Infection efficiencies in vivo were determined using a reporter gene-bearing vector in a mammary cancer cell-derived xenograft tumor mouse model.
Bhattacharya, Abhishek; Pletschke, Brett I
2014-01-01
The enzymatic conversion of lignocellulosic biomass into biofuels has been identified as an excellent strategy to generate clean energy. However, the current process is cost-intensive as an effective immobilization approach to reuse the enzyme(s) has been a major challenge. The present study introduces the concept and application of novel magnetic cross-linked enzyme aggregates (mag-CLEAs). Both mag-CLEAs and calcium-mag-CLEAs (Ca-mag-CLEAs) exhibited a 1.35 fold higher xylanase activity compared to the free enzyme and retained more than 80.0% and 90.0% activity, respectively, after 136h of incubation at 50°C, compared to 50% activity retained by CLEAs. A 7.4 and 9.0 fold higher sugar release from lime-pretreated and NH4OH pre-treated sugar bagasse, respectively, was achieved with Ca-mag-CLEAs compared to the free enzymes. The present study promotes the successful application of mag-CLEAs and Ca-mag-CLEAs as carrier free immobilized enzymes for the effective hydrolysis of lignocellulolytic biomass and associated biofuel feedstocks. Copyright © 2014 Elsevier Inc. All rights reserved.
Peroxidase enzymes regulate collagen extracellular matrix biosynthesis.
DeNichilo, Mark O; Panagopoulos, Vasilios; Rayner, Timothy E; Borowicz, Romana A; Greenwood, John E; Evdokiou, Andreas
2015-05-01
Myeloperoxidase and eosinophil peroxidase are heme-containing enzymes often physically associated with fibrotic tissue and cancer in various organs, without any direct involvement in promoting fibroblast recruitment and extracellular matrix (ECM) biosynthesis at these sites. We report herein novel findings that show peroxidase enzymes possess a well-conserved profibrogenic capacity to stimulate the migration of fibroblastic cells and promote their ability to secrete collagenous proteins to generate a functional ECM both in vitro and in vivo. Mechanistic studies conducted using cultured fibroblasts show that these cells are capable of rapidly binding and internalizing both myeloperoxidase and eosinophil peroxidase. Peroxidase enzymes stimulate collagen biosynthesis at a post-translational level in a prolyl 4-hydroxylase-dependent manner that does not require ascorbic acid. This response was blocked by the irreversible myeloperoxidase inhibitor 4-amino-benzoic acid hydrazide, indicating peroxidase catalytic activity is essential for collagen biosynthesis. These results suggest that peroxidase enzymes, such as myeloperoxidase and eosinophil peroxidase, may play a fundamental role in regulating the recruitment of fibroblast and the biosynthesis of collagen ECM at sites of normal tissue repair and fibrosis, with enormous implications for many disease states where infiltrating inflammatory cells deposit peroxidases. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Fouling-induced enzyme immobilization for membrane reactors
DEFF Research Database (Denmark)
Luo, Jianquan; Meyer, Anne S.; Jonsson, Gunnar Eigil
2013-01-01
A simple enzyme immobilization method accomplished by promoting membrane fouling formation is proposed. The immobilization method is based on adsorption and entrapment of the enzymes in/on the membrane. To evaluate the concept, two membrane orientations, skin layer facing feed (normal mode......, but the reverse mode allowed for higher enzyme loading and stability, and irreversible fouling (i.e. pore blocking) developed more readily in the support structure than in the skin layer. Compared with an enzymatic membrane reactor (EMR) with free enzymes, the novel EMR with enzymes immobilized in membrane......) and support layer facing feed (reverse mode), were used to immobilize alcohol dehydrogenase (ADH, EC 1.1.1.1) and glutamate dehydrogenase (GDH, EC 1.4.1.3), respectively. The nature of the fouling in each mode was determined by filtration fouling models. The permeate flux was larger in the normal mode...
Liang, Hao; Jiang, Shuhui; Yuan, Qipeng; Li, Guofeng; Wang, Feng; Zhang, Zijie; Liu, Juewen
2016-03-21
Preserving enzyme activity and promoting synergistic activity via co-localization of multiple enzymes are key topics in bionanotechnology, materials science, and analytical chemistry. This study reports a facile method for co-immobilizing multiple enzymes in metal coordinated hydrogel nanofibers. Specifically, four types of protein enzymes, including glucose oxidase, Candida rugosa lipase, α-amylase, and horseradish peroxidase, were respectively encapsulated in a gel nanofiber made of Zn(2+) and adenosine monophosphate (AMP) with a simple mixing step. Most enzymes achieved quantitative loading and retained full activity. At the same time, the entrapped enzymes were more stable against temperature variation (by 7.5 °C), protease attack, extreme pH (by 2-fold), and organic solvents. After storing for 15 days, the entrapped enzyme still retained 70% activity while the free enzyme nearly completely lost its activity. Compared to nanoparticles formed with AMP and lanthanide ions, the nanofiber gels allowed much higher enzyme activity. Finally, a highly sensitive and selective biosensor for glucose was prepared using the gel nanofiber to co-immobilize glucose oxidase and horseradish peroxidase for an enzyme cascade system. A detection limit of 0.3 μM glucose with excellent selectivity was achieved. This work indicates that metal coordinated materials using nucleotides are highly useful for interfacing with biomolecules.
DEFF Research Database (Denmark)
Fosbøl, Philip Loldrup; Gladis, Arne; Thomsen, Kaj
The enzyme Carbonic Anhydrase (CA) can accelerate the absorption rate of CO2 into aqueous solutions by several-fold. It exist in almost all living organisms and catalyses different important processes like CO2 transport, respiration and the acid-base balances. A new technology in the field...... of carbon capture is the application of enzymes for acceleration of typically slow ternary amines or inorganic carbonates. There is a hidden potential to revive currently infeasible amines which have an interesting low energy consumption for regeneration but too slow kinetics for viable CO2 capture. The aim...... of this work is to discuss the measurements of kinetic properties for CA promoted CO2 capture solvent systems. The development of a rate-based model for enzymes will be discussed showing the principles of implementation and the results on using a well-known ternary amine for CO2 capture. Conclusions...
Potential effects of plant growth promoting rhizobacteria ...
African Journals Online (AJOL)
Damping off caused by Sclerotium rolfsii on cowpea results in yield losses with serious socioeconomic implication. Induction of defense responses by plant growth promoting rhizobacteria (PGPR) is largely associated with the production of defense enzyme phenyl ammonia lyase (PAL) and oxidative enzymes like ...
Novel enzymes for the degradation of cellulose
Directory of Open Access Journals (Sweden)
Horn Svein
2012-07-01
Full Text Available Abstract The bulk terrestrial biomass resource in a future bio-economy will be lignocellulosic biomass, which is recalcitrant and challenging to process. Enzymatic conversion of polysaccharides in the lignocellulosic biomass will be a key technology in future biorefineries and this technology is currently the subject of intensive research. We describe recent developments in enzyme technology for conversion of cellulose, the most abundant, homogeneous and recalcitrant polysaccharide in lignocellulosic biomass. In particular, we focus on a recently discovered new type of enzymes currently classified as CBM33 and GH61 that catalyze oxidative cleavage of polysaccharides. These enzymes promote the efficiency of classical hydrolytic enzymes (cellulases by acting on the surfaces of the insoluble substrate, where they introduce chain breaks in the polysaccharide chains, without the need of first “extracting” these chains from their crystalline matrix.
Halophiles and their enzymes: Negativity put to good use
DasSarma, Shiladitya; DasSarma, Priya
2015-01-01
Halophilic microorganisms possess stable enzymes that function in very high salinity, an extreme condition that leads to denaturation, aggregation, and precipitation of most other proteins. Genomic and structural analyses have established that the enzymes of halophilic Archaea and many halophilic Bacteria are negatively charged due to an excess of acidic over basic residues, and altered hydrophobicity, which enhance solubility and promote function in low water activity conditions. Here, we provide an update on recent bioinformatic analysis of predicted halophilic proteomes as well as experimental molecular studies on individual halophilic enzymes. On-going efforts on discovery and utilization of halophiles and their enzymes for biotechnology, including biofuel applications are also considered. PMID:26066288
Halophiles and their enzymes: negativity put to good use.
DasSarma, Shiladitya; DasSarma, Priya
2015-06-01
Halophilic microorganisms possess stable enzymes that function in very high salinity, an extreme condition that leads to denaturation, aggregation, and precipitation of most other proteins. Genomic and structural analyses have established that the enzymes of halophilic Archaea and many halophilic Bacteria are negatively charged due to an excess of acidic over basic residues, and altered hydrophobicity, which enhance solubility and promote function in low water activity conditions. Here, we provide an update on recent bioinformatic analysis of predicted halophilic proteomes as well as experimental molecular studies on individual halophilic enzymes. Recent efforts on discovery and utilization of halophiles and their enzymes for biotechnology, including biofuel applications are also considered. Copyright © 2015 Elsevier Ltd. All rights reserved.
Development of chimeric gene promoters responsive to hypoxia and ionizing radiation
International Nuclear Information System (INIS)
Zheng Aiqing; Yu Jinming
2004-01-01
The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy
Directory of Open Access Journals (Sweden)
Momein H. El-Katatny
2010-01-01
Full Text Available A plant growth-promoting rhizobacterium (Azospirillum brasilense strain Az and a biocontrol fungus (Trichoderma harzianum strain T24 have been evaluated for their individual and combined production of hydrolytic enzymes, nitrogen fixation and their possible role in growth promotion of tomato seedlings. The studied organisms were inoculated as free or calcium alginate-encapsulated cells. All freshly prepared macrobeads showed high encapsulation capacity (EC/% of inocula compared with dry macrobeads. Results of enzyme production did not exhibit consistent pattern of the effect of encapsulation process on enzyme production. Beads entrapping bacterial and/or fungal cells were used successfully in 3 repeated cycles in the presence of fresh sterile culture medium in each growth cycle. Enzyme production by immobilized bacterial and/or fungal cells increased as the growth cycles were repeated. Co-culturing of A. brasilense with T. harzianum (free or immobilized in semisolid nitrogen deficient medium (N-free medium enabled A. brasilense to fix nitrogen on pectin, chitin and carboxymethyl cellulose. The activity of nitrogen fixation by A. brasilense in the case of single and combined cultures with Trichoderma (using dry encapsulated beads into the sterile soil increased with the addition of carbon source. Most of inoculations with free or alginate macrobead formulations of T. harzianum and/or A. brasilense showed significant increase in the growth parameters of tomato seedlings. The root system grew more profusely in the case of all seeds treated with A. brasilense. The growth parameters of Az/T24-treated seeds using dry coimmobilized macrobeads were higher than those of the untreated control. Moreover, the effect was improved significantly in soil enriched with different C sources. Enhanced tomato seedling growth after the co-inoculation could be due to the synergistic effect of both Trichoderma and Azospirillum. Finally, co-inoculation with Azospirillum
Impact of Bee Venom Enzymes on Diseases and Immune Responses.
Hossen, Md Sakib; Shapla, Ummay Mahfuza; Gan, Siew Hua; Khalil, Md Ibrahim
2016-12-27
Bee venom (BV) is used to treat many diseases and exhibits anti-inflammatory, anti-bacterial, antimutagenic, radioprotective, anti-nociceptive immunity promoting, hepatocyte protective and anti-cancer activity. According to the literature, BV contains several enzymes, including phospholipase A2 (PLA2), phospholipase B, hyaluronidase, acid phosphatase and α-glucosidase. Recent studies have also reported the detection of different classes of enzymes in BV, including esterases, proteases and peptidases, protease inhibitors and other important enzymes involved in carbohydrate metabolism. Nevertheless, the physiochemical properties and functions of each enzyme class and their mechanisms remain unclear. Various pharmacotherapeutic effects of some of the BV enzymes have been reported in several studies. At present, ongoing research aims to characterize each enzyme and elucidate their specific biological roles. This review gathers all the current knowledge on BV enzymes and their specific mechanisms in regulating various immune responses and physiological changes to provide a basis for future therapies for various diseases.
Impact of Bee Venom Enzymes on Diseases and Immune Responses
Directory of Open Access Journals (Sweden)
Md. Sakib Hossen
2016-12-01
Full Text Available Bee venom (BV is used to treat many diseases and exhibits anti-inflammatory, anti-bacterial, antimutagenic, radioprotective, anti-nociceptive immunity promoting, hepatocyte protective and anti-cancer activity. According to the literature, BV contains several enzymes, including phospholipase A2 (PLA2, phospholipase B, hyaluronidase, acid phosphatase and α-glucosidase. Recent studies have also reported the detection of different classes of enzymes in BV, including esterases, proteases and peptidases, protease inhibitors and other important enzymes involved in carbohydrate metabolism. Nevertheless, the physiochemical properties and functions of each enzyme class and their mechanisms remain unclear. Various pharmacotherapeutic effects of some of the BV enzymes have been reported in several studies. At present, ongoing research aims to characterize each enzyme and elucidate their specific biological roles. This review gathers all the current knowledge on BV enzymes and their specific mechanisms in regulating various immune responses and physiological changes to provide a basis for future therapies for various diseases.
A Comprehensive Enzyme Kinetic Exercise for Biochemistry
Barton, Janice S.
2011-01-01
This article describes a comprehensive treatment of experimental enzyme kinetics strongly coupled to electronic data acquisition and use of spreadsheets to organize data and perform linear and nonlinear least-squares analyses, all in a manner that promotes development of important reasoning skills. Kinetic parameters are obtained for the stable…
Little enzyme; Shoryo no tobun ga koso wo kappatsuka
Energy Technology Data Exchange (ETDEWEB)
NONE
1999-06-05
It was discovered that the enzymatic heat-resistance increased by the addition of the trehalose in which the researcher of Institute of Physical and Chemical Research (it is given) is one of the disaccharides to the enzyme process. By this, it becomes possible that enzyme reaction is more promoted under the high temperature. They obtained this idea, because the yeast formed the trehalose over the room temperature for the protection of self it. In the example of some enzyme reaction, the about 20 times the speed has been obtained under 60 degrees C in comparison with the under ordinary temperature. Too the similar example has mainly been otherwise accepted. (translated by NEDO)
Laccase Enzymes in Inocula Pleurotus spp
Directory of Open Access Journals (Sweden)
Nora García-Oduardo
2017-01-01
Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.
Tunable promoters in systems biology
DEFF Research Database (Denmark)
Mijakovic, Ivan; Petranovic, Dina; Jensen, Peter Ruhdal
2005-01-01
The construction of synthetic promoter libraries has represented a major breakthrough in systems biology, enabling the subtle tuning of enzyme activities. A number of tools are now available that allow the modulation of gene expression and the detection of changes in expression patterns. But, how...
Directory of Open Access Journals (Sweden)
Cong Zhang
2018-03-01
Full Text Available In the pond culture of juvenile Eriocheir sinensis, a high limb-impairment rate seriously affects the culture success. Therefore, it is particularly important to artificially promote limb regeneration. This study evaluated the effects of melatonin on cheliped regeneration, digestive ability, and immunity, as well as its relationship with the eyestalk. It was found that the injection of melatonin significantly increased the limb regeneration rate compared with the saline group (P < 0.05. The qRT-PCR results of growth-related genes showed that the level of EcR-mRNA (ecdysteroid receptor and Chi-mRNA (chitinase expression was significantly increased following the melatonin injection, while the expression of MIH-mRNA (molt-inhibiting hormone was significantly decreased (P < 0.05. Melatonin significantly increased lipase activity (P < 0.05. We observed that the survival rates of limb-impaired and unilateral eyestalk-ablated crabs were substantially improved following melatonin treatment, whereas the survival of the unilateral eyestalk-ablated crabs was significantly decreased compared with the control group (P < 0.05. Furthermore, the results of serum immune and antioxidant capacity revealed that melatonin significantly increased the total hemocyte counts (THC, hemocyanin content, total antioxidant capacity (T-AOC, acid phosphatase (ACP, and glutathione peroxidase activity (GSH-Px, whereas the immune-related parameters were significantly decreased in eyestalk-ablated crabs (P < 0.05. Therefore, these findings indicate that melatonin exerts a protective effect on organism injury, which could promote limb regeneration by up-regulating the expression of growth-related genes, improve digestive enzyme activity, and strengthen the immune response, particularly antioxidant capacity.
Energy Technology Data Exchange (ETDEWEB)
Sohn, Y. H.; Kim, S. W.; Lee, K. S.; Mo, J. Y. [Dongguk University, Seoul (Korea, Republic of)
2010-04-15
Proton irradiations in the cells were significantly decreased cell viability but increased the QR activity in a dose-dependent manner. Cell viability was 92.3%, 88.4%, 81.8%, 72.4%, 68.9% at doses of 0.5, 2, 8, 16, and 32 Gy, respectively. At doses of 2, 8, 16, and 32 Gy, QR activity was increased 1.27-, 1.31-, 1.45- and 2.08-fold. However, negligible GST activity in the cells was detected and the activity was not changed by proton irradiation. Proton irradiation also increased GSH contents by 1.18- and 1.21-fold at doses of 0.5 and 2 Gy. In contrast, the ODC activity, a key enzyme in polyamine biosynthesis and tumor promotion, was decreased in a dose-dependent manner. We also investigated anti-metastatic effects of proton beam irradiation in breast cancer cells. Invasion and wound healing assay showed that metastatic activities in breast cancer cells were significantly decreased in a dose-dependent manner by proton beam irradiation. In zymography of MMP-9, the activity was slightly diminished. These results suggest that breast cancer chemopreventive potential was increased with proton irradiation by increasing the QR activity and the GSH levels and by inhibiting the ODC activity.
International Nuclear Information System (INIS)
Sohn, Y. H.; Kim, S. W.; Lee, K. S.; Mo, J. Y.
2010-04-01
Proton irradiations in the cells were significantly decreased cell viability but increased the QR activity in a dose-dependent manner. Cell viability was 92.3%, 88.4%, 81.8%, 72.4%, 68.9% at doses of 0.5, 2, 8, 16, and 32 Gy, respectively. At doses of 2, 8, 16, and 32 Gy, QR activity was increased 1.27-, 1.31-, 1.45- and 2.08-fold. However, negligible GST activity in the cells was detected and the activity was not changed by proton irradiation. Proton irradiation also increased GSH contents by 1.18- and 1.21-fold at doses of 0.5 and 2 Gy. In contrast, the ODC activity, a key enzyme in polyamine biosynthesis and tumor promotion, was decreased in a dose-dependent manner. We also investigated anti-metastatic effects of proton beam irradiation in breast cancer cells. Invasion and wound healing assay showed that metastatic activities in breast cancer cells were significantly decreased in a dose-dependent manner by proton beam irradiation. In zymography of MMP-9, the activity was slightly diminished. These results suggest that breast cancer chemopreventive potential was increased with proton irradiation by increasing the QR activity and the GSH levels and by inhibiting the ODC activity.
Abdel-Azeim, Safwat
2015-06-22
Here, we report an integrated quantum mechanics/molecular mechanics (QM/MM) study of the bio-organometallic reaction pathway of the 2H+/2e- reduction of (E)-4-hydroxy-3-methylbut-2-enyl pyrophosphate (HMBPP) into the so called universal terpenoids precursors isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), promoted by the IspH enzyme. Our results support the viability of the bio-organometallic pathway from rotation of the OH group of HMBPP away from the [Fe4S4] cluster at the core of the catalytic site, to be engaged in a H-bond with Glu126. This rotation is synchronous with π-coordination of the C2=C3 double bond of HMBPP to the apical Fe atom of the [Fe4S4] cluster. Dehydroxylation of HMBPP is triggered by a proton transfer from Glu126 to the OH group of HMBPP. The reaction pathway is completed by competitive proton transfer from the terminal phosphate group to the C2 or C4 atom of HMBPP.
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Effect of turmeric on xenobiotic metabolising enzymes.
Goud, V K; Polasa, K; Krishnaswamy, K
1993-07-01
Diet contains several substances capable of inhibiting chemical carcinogenesis. It is known that such inhibitors may either act directly by scavenging the reactive substances or indirectly by promoting mechanisms which enhance detoxification. Turmeric which contains curcumin both in vitro and in vivo is an active antimutagen. Studies were therefore conducted to evaluate the effects of turmeric on xenobiotic metabolising enzymes in hepatic tissue of rats fed turmeric ranging from 0.5-10% in the diet. Enzymes such as aryl hydrocarbon hydroxylase, UDP glucuronyl transferase and glutathione-S-transferase were assayed after four weeks of turmeric fed diets. No significant differences were seen in the activating enzyme AHH. However, UDPGT was significantly elevated in rats fed 10% turmeric while GSHT registered a significant increase in 5 and 10% turmeric fed diet as compared to controls and 0.5-1.0% turmeric fed animals. The results suggest that turmeric may increase detoxification systems in addition to its anti-oxidant properties. Curcumin perhaps is the active principle in turmeric. Turmeric used widely as a spice would probably mitigate the effects of several dietary carcinogens.
Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...
Prier, Christopher K; Arnold, Frances H
2015-11-11
Despite the astonishing breadth of enzymes in nature, no enzymes are known for many of the valuable catalytic transformations discovered by chemists. Recent work in enzyme design and evolution, however, gives us good reason to think that this will change. We describe a chemomimetic biocatalysis approach that draws from small-molecule catalysis and synthetic chemistry, enzymology, and molecular evolution to discover or create enzymes with non-natural reactivities. We illustrate how cofactor-dependent enzymes can be exploited to promote reactions first established with related chemical catalysts. The cofactors can be biological, or they can be non-biological to further expand catalytic possibilities. The ability of enzymes to amplify and precisely control the reactivity of their cofactors together with the ability to optimize non-natural reactivity by directed evolution promises to yield exceptional catalysts for challenging transformations that have no biological counterparts.
Enzyme specific activity in functionalized nanoporous supports
International Nuclear Information System (INIS)
Lei Chenghong; Soares, Thereza A; Shin, Yongsoon; Liu Jun; Ackerman, Eric J
2008-01-01
Here we reveal that enzyme specific activity can be increased substantially by changing the protein loading density (P LD ) in functionalized nanoporous supports so that the enzyme immobilization efficiency (I e , defined as the ratio of the specific activity of the immobilized enzyme to the specific activity of the free enzyme in solution) can be much higher than 100%. A net negatively charged glucose oxidase (GOX) and a net positively charged organophosphorus hydrolase (OPH) were entrapped spontaneously in NH 2 - and HOOC-functionalized mesoporous silica (300 A, FMS) respectively. The specific activity of GOX entrapped in FMS increased with decreasing P LD . With decreasing P LD , I e of GOX in FMS increased from 150%. Unlike GOX, OPH in HOOC-FMS showed increased specific activity with increasing P LD . With increasing P LD , the corresponding I e of OPH in FMS increased from 100% to>200%. A protein structure-based analysis of the protein surface charges directing the electrostatic interaction-based orientation of the protein molecules in FMS demonstrates that substrate access to GOX molecules in FMS is limited at high P LD , consequently lowering the GOX specific activity. In contrast, substrate access to OPH molecules in FMS remains open at high P LD and may promote a more favorable confinement environment that enhances the OPH activity
Recent Progress and Development of Crystal Structure Analysis of Enzymes and Other Proteins
Tanokura, Masaru; Nagata, Koji; Miyazono, Ken-Ichi; Miyakawa, Takuya; Okai, Masahiko
Structural biology has made tremendous progress in this decade. Here we briefly introduce the Target Proteins Research Program, a national project promoted by the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan. The program aims to reveal the structure and function of proteins that are of great importance in both academic research and industrial application. We also summarize the results of structure-function analyses of (i) transcriptional regulatory proteins useful for the breading of drought and heat stress tolerant crops, (ii) useful enzymes for the production of chiral compounds, and (iii) useful enzymes for the degradation of environmental pollution substances. These results can be utilized in various areas of industries, to enhance food production, to improve the efficiency of pharmaceutical compound production, and to promote the bioremediation of contaminated soil and water.
Angiotensin-converting enzyme inhibition in diabetic nephropathy
DEFF Research Database (Denmark)
Parving, H H; Rossing, P; Hommel, E
1995-01-01
The aim of our prospective study was to evaluate putative progression promoters, kidney function, and prognosis during long-term treatment with angiotensin-converting enzyme inhibition in insulin-dependent diabetes mellitus patients suffering from diabetic nephropathy. Eighteen consecutive......, albuminuria (geometric mean +/- antilog SE) 982 +/- 1.2 micrograms/min, and GFR 98 +/- 5 mL/min/1.73 m2. Angiotensin-converting enzyme inhibition induced a significant reduction during the whole treatment period of blood pressure (137/85 +/- 3/1 mm Hg; P ....01), and the rate of decline in GFR was 4.4 +/- 0.7 mL/min/yr, in contrast to previous reports of 10 to 14 mL/min/yr (natural history). Univariate analysis revealed a significant correlation between the rate of decline in GFR and mean arterial blood pressure (r = 0.58, P = 0.01), albuminuria (r = 0.67, P
Yeates, Eniola Funmilayo Aduke; Tesco, Giuseppina
2016-07-22
The β-site amyloid precursor protein-cleaving enzyme (BACE1) is the rate-limiting enzyme in the production of amyloid-β, the toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. Our previous studies have shown that BACE1 is degraded via the lysosomal pathway and that that depletion of the trafficking molecule Golgi-localized γ-ear-containing ARF-binding protein 3 (GGA3) results in increased BACE1 levels and activity because of impaired lysosomal degradation. We also determined that GGA3 regulation of BACE1 levels requires its ability to bind ubiquitin. Accordingly, we reported that BACE1 is ubiquitinated at lysine 501 and that lack of ubiquitination at lysine 501 produces BACE1 stabilization. Ubiquitin conjugation is a reversible process mediated by deubiquitinating enzymes. The ubiquitin-specific peptidase 8 (USP8), an endosome-associated deubiquitinating enzyme, regulates the ubiquitination, trafficking, and lysosomal degradation of several plasma membrane proteins. Here, we report that RNAi-mediated depletion of USP8 reduced levels of both ectopically expressed and endogenous BACE1 in H4 human neuroglioma cells. Moreover, USP8 depletion increased BACE1 ubiquitination, promoted BACE1 accumulation in the early endosomes and late endosomes/lysosomes, and decreased levels of BACE1 in the recycling endosomes. We also found that decreased BACE1 protein levels were accompanied by a decrease in BACE1-mediated amyloid precursor protein cleavage and amyloid-β levels. Our findings demonstrate that USP8 plays a key role in the trafficking and degradation of BACE1 by deubiquitinating lysine 501. These studies suggest that therapies able to accelerate BACE1 degradation (e.g. by increasing BACE1 ubiquitination) may represent a potential treatment for Alzheimer disease. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Yeates, Eniola Funmilayo Aduke; Tesco, Giuseppina
2016-01-01
The β-site amyloid precursor protein-cleaving enzyme (BACE1) is the rate-limiting enzyme in the production of amyloid-β, the toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. Our previous studies have shown that BACE1 is degraded via the lysosomal pathway and that that depletion of the trafficking molecule Golgi-localized γ-ear-containing ARF-binding protein 3 (GGA3) results in increased BACE1 levels and activity because of impaired lysosomal degradation. We also determined that GGA3 regulation of BACE1 levels requires its ability to bind ubiquitin. Accordingly, we reported that BACE1 is ubiquitinated at lysine 501 and that lack of ubiquitination at lysine 501 produces BACE1 stabilization. Ubiquitin conjugation is a reversible process mediated by deubiquitinating enzymes. The ubiquitin-specific peptidase 8 (USP8), an endosome-associated deubiquitinating enzyme, regulates the ubiquitination, trafficking, and lysosomal degradation of several plasma membrane proteins. Here, we report that RNAi-mediated depletion of USP8 reduced levels of both ectopically expressed and endogenous BACE1 in H4 human neuroglioma cells. Moreover, USP8 depletion increased BACE1 ubiquitination, promoted BACE1 accumulation in the early endosomes and late endosomes/lysosomes, and decreased levels of BACE1 in the recycling endosomes. We also found that decreased BACE1 protein levels were accompanied by a decrease in BACE1-mediated amyloid precursor protein cleavage and amyloid-β levels. Our findings demonstrate that USP8 plays a key role in the trafficking and degradation of BACE1 by deubiquitinating lysine 501. These studies suggest that therapies able to accelerate BACE1 degradation (e.g. by increasing BACE1 ubiquitination) may represent a potential treatment for Alzheimer disease. PMID:27302062
Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika
2012-01-01
Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471
International Nuclear Information System (INIS)
Nosheen, A.; Bano, A.
2014-01-01
The present investigation deals with the role of Plant Growth Promoting Rhizobacteria and chemical fertilizers alone or in combination on urease, invertase and phosphatase activities of rhizospheric soil and also on general impact on growth of safflower cvv. Thori and Saif-32. The PGPR (Azospirillum brasilense and Azotobacter vinelandii) were applied at 10/sup 6/ cells/mL as seed inoculation prior to sowing. Chemical fertilizers were applied at full (Urea 60 Kg ha/sup -1/ and Diammonium phosphate (DAP) 30 Kg ha/sup -1/), half (Urea 30 Kg ha/sup -1/ and DAP 15 Kg ha/sup -1/) and quarter doses (Urea 15 Kg ha-1 and DAP 7.5 Kg ha/sup -1/) during sowing. The chemical fertilizers and PGPR enhanced urease and invertase activities of soil. Presence of PGPR in combination with quarter and half doses of chemical fertilizers further augmented their effect on soil enzymes activities. The soil phosphatase activity was greater in Azospirillum and Azotobacter in combination with half dose of chemical fertilizers. Maximum increase in leaf melondialdehyde content was recorded in full dose of chemical fertilizers whereas coinoculation treatment exhibited significant reduction in cv. Thori. Half and quarter dose of chemical fertilizers increased the shoot length of safflower whereas maximum increase in leaf protein was recorded in Azotobacter in combination with full dose of chemical fertilizers. Root length was improved by Azospirillum and Azotobacter in combination with quarter dose of chemical fertilizers. Leaf area and chlorophyll contents were significantly improved by Azotobacter in combination with half dose of chemical fertilizers. It is inferred that PGPR can supplement 50 % chemical fertilizers for better plant growth and soil health. (author)
Extracellular functions of glycolytic enzymes of parasites: unpredicted use of ancient proteins.
Gómez-Arreaza, Amaranta; Acosta, Hector; Quiñones, Wilfredo; Concepción, Juan Luis; Michels, Paul A M; Avilán, Luisana
2014-02-01
In addition of their usual intracellular localization where they are involved in catalyzing reactions of carbohydrate and energy metabolism by glycolysis, multiple studies have shown that glycolytic enzymes of many organisms, but notably pathogens, can also be present extracellularly. In the case of parasitic protists and helminths, they can be found either secreted or attached to the surface of the parasites. At these extracellular localizations, these enzymes have been shown to perform additional, very different so-called "moonlighting" functions, such as acting as ligands for a variety of components of the host. Due to this recognition, different extracellular glycolytic enzymes participate in various important parasite-host interactions such as adherence and invasion of parasites, modulation of the host's immune and haemostatic systems, promotion of angiogenesis, and acquisition of specific nutrients by the parasites. Accordingly, extracellular glycolytic enzymes are important for the invasion of the parasites and their establishment in the host, and in determining their virulence. Copyright © 2014 Elsevier B.V. All rights reserved.
... Contact Us DONATE NOW GENERAL DONATION PURPLESTRIDE Pancreatic enzymes Home Facing Pancreatic Cancer Living with Pancreatic Cancer ... and see a registered dietitian. What are pancreatic enzymes? Pancreatic enzymes help break down fats, proteins and ...
Schoene, C; Bennett, S P; Howarth, M
2016-01-01
Enzymes often have marginal stability, with unfolding typically leading to irreversible denaturation. This sensitivity is a major barrier, both for de novo enzyme development and for expanding enzyme impact beyond the laboratory. Seeking an approach to enhance resilience to denaturation that could be applied to a range of different enzymes, we developed SpyRing cyclization. SpyRings contain genetically encoded SpyTag (13 amino acids) on the N-terminus and SpyCatcher (12kDa) on the C-terminus of the enzyme, so that the Spy partners spontaneously react together through an irreversible isopeptide bond. SpyRing cyclization gave major increases in thermal resilience, including on a model for enzyme evolution, β-lactamase, and an industrially important enzyme in agriculture and nutrition, phytase. We outline the SpyRing rationale, including comparison of SpyRing cyclization to other cyclization strategies. The cloning strategy is presented for the simple insertion of enzyme genes for recombinant expression. We discuss structure-based approaches to select suitable enzyme cyclization targets. Approaches to evaluate the cyclization reaction and its effect on enzyme resilience are described. We also highlight the use of differential scanning calorimetry to understand how SpyRing cyclization promotes enzyme refolding. Efficiently searching sequence space will continue to be important for enzyme improvement, but the SpyRing platform may be a valuable rational adjunct for conferring resilience. © 2016 Elsevier Inc. All rights reserved.
GSTT2 promoter polymorphisms and colorectal cancer risk
Directory of Open Access Journals (Sweden)
Ahn Sun-A
2007-01-01
Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.
International Nuclear Information System (INIS)
Zhong, Hua; Wang, Ruoxiang; Kelavkar, Uddhav; Wang, Christopher Y; Simons, Jonathan
2014-01-01
Hypoxia-inducible factor 1α (HIF-1α) is the regulatory subunit of the heterodimeric HIF-1 that plays a critical role in transcriptional regulation of genes in angiogenesis and hypoxic adaptation, while fatty acid metabolism mediated by lipoxygenases has been implicated in a variety of pathogeneses, including cancers. In this study, we report that 15-lipoxygenase 1 (15-LO1), a key member of the lipoxygenase family, promotes HIF-1α ubiquitination and degradation. Altering the level of 15-LO1 yields inverse changes in HIF-1α and HIF-1 transcriptional activity, under both normoxia and hypoxia, and even in CoCl 2 -treated cells where HIF-1α has been artificially elevated. The antagonistic effect of 15-LO1 is mediated by the Pro 564 /hydroxylation/26S proteasome system, while both the enzymatic activity and the intracellular membrane-binding function of 15-LO1 appear to contribute to HIF-1α suppression. Our findings provide a novel mechanism for HIF-1α regulation, in which oxygen-dependent HIF-1 activity is modulated by an oxygen-insensitive lipid metabolic enzyme
Measuring the Enzyme Activity of Arabidopsis Deubiquitylating Enzymes.
Kalinowska, Kamila; Nagel, Marie-Kristin; Isono, Erika
2016-01-01
Deubiquitylating enzymes, or DUBs, are important regulators of ubiquitin homeostasis and substrate stability, though the molecular mechanisms of most of the DUBs in plants are not yet understood. As different ubiquitin chain types are implicated in different biological pathways, it is important to analyze the enzyme characteristic for studying a DUB. Quantitative analysis of DUB activity is also important to determine enzyme kinetics and the influence of DUB binding proteins on the enzyme activity. Here, we show methods to analyze DUB activity using immunodetection, Coomassie Brilliant Blue staining, and fluorescence measurement that can be useful for understanding the basic characteristic of DUBs.
Characteristics of chalcone isomerase promoter in crabapple leaves ...
African Journals Online (AJOL)
Anthocyanins are secondary metabolites found in higher plants that contribute to the colors of plants and chalcone isomerase (CHI) is one of the key enzymes in anthocyanin biosynthetic pathway. What characteristic is CHI promoter known as the regulation sequence of CHI gene, has been rarely investigated. We isolated A ...
Overexpression of osteoprotegerin promotes preosteoblast differentiation to mature osteoblasts
Yu, Hongyou; de Vos, Paul; Ren, Yijin
OBJECTIVE: The hypothesis of the present study is that overexpression of osteoprotegerin (OPG) promotes preosteoblast maturation. MATERIALS AND METHODS: The preosteoblast cell line MC3T3-E1 was transfected with OPG overexpression. OPG expression was confirmed by enzyme-linked immunosorbent assay
Nanomaterials with enzyme-like characteristics (nanozymes): next-generation artificial enzymes.
Wei, Hui; Wang, Erkang
2013-07-21
Over the past few decades, researchers have established artificial enzymes as highly stable and low-cost alternatives to natural enzymes in a wide range of applications. A variety of materials including cyclodextrins, metal complexes, porphyrins, polymers, dendrimers and biomolecules have been extensively explored to mimic the structures and functions of naturally occurring enzymes. Recently, some nanomaterials have been found to exhibit unexpected enzyme-like activities, and great advances have been made in this area due to the tremendous progress in nano-research and the unique characteristics of nanomaterials. To highlight the progress in the field of nanomaterial-based artificial enzymes (nanozymes), this review discusses various nanomaterials that have been explored to mimic different kinds of enzymes. We cover their kinetics, mechanisms and applications in numerous fields, from biosensing and immunoassays, to stem cell growth and pollutant removal. We also summarize several approaches to tune the activities of nanozymes. Finally, we make comparisons between nanozymes and other catalytic materials (other artificial enzymes, natural enzymes, organic catalysts and nanomaterial-based catalysts) and address the current challenges and future directions (302 references).
[Advances on enzymes and enzyme inhibitors research based on microfluidic devices].
Hou, Feng-Hua; Ye, Jian-Qing; Chen, Zuan-Guang; Cheng, Zhi-Yi
2010-06-01
With the continuous development in microfluidic fabrication technology, microfluidic analysis has evolved from a concept to one of research frontiers in last twenty years. The research of enzymes and enzyme inhibitors based on microfluidic devices has also made great progress. Microfluidic technology improved greatly the analytical performance of the research of enzymes and enzyme inhibitors by reducing the consumption of reagents, decreasing the analysis time, and developing automation. This review focuses on the development and classification of enzymes and enzyme inhibitors research based on microfluidic devices.
Direct comparison of enzyme histochemical and immunohistochemical methods to localize an enzyme
van Noorden, Cornelis J. F.
2002-01-01
Immunohistochemical localization of enzymes is compared directly with localization of enzyme activity with (catalytic) enzyme histochemical methods. The two approaches demonstrate principally different aspects of an enzyme. The immunohistochemical method localizes the enzyme protein whether it is
Computational enzyme design: transitioning from catalytic proteins to enzymes.
Mak, Wai Shun; Siegel, Justin B
2014-08-01
The widespread interest in enzymes stem from their ability to catalyze chemical reactions under mild and ecologically friendly conditions with unparalleled catalytic proficiencies. While thousands of naturally occurring enzymes have been identified and characterized, there are still numerous important applications for which there are no biological catalysts capable of performing the desired chemical transformation. In order to engineer enzymes for which there is no natural starting point, efforts using a combination of quantum chemistry and force-field based protein molecular modeling have led to the design of novel proteins capable of catalyzing chemical reactions not catalyzed by naturally occurring enzymes. Here we discuss the current status and potential avenues to pursue as the field of computational enzyme design moves forward. Published by Elsevier Ltd.
Stabilization of enzymes in ionic liquids via modification of enzyme charge.
Nordwald, Erik M; Kaar, Joel L
2013-09-01
Due to the propensity of ionic liquids (ILs) to inactivate enzymes, the development of strategies to improve enzyme utility in these solvents is critical to fully exploit ILs for biocatalysis. We have developed a strategy to broadly improve enzyme utility in ILs based on elucidating the effect of charge modifications on the function of enzymes in IL environments. Results of stability studies in aqueous-IL mixtures indicated a clear connection between the ratio of enzyme-containing positive-to-negative sites and enzyme stability in ILs. Stability studies of the effect of [BMIM][Cl] and [EMIM][EtSO4 ] on chymotrypsin specifically found an optimum ratio of positively-charged amine-to-negatively-charged acid groups (0.39). At this ratio, the half-life of chymotrypsin was increased 1.6- and 4.3-fold relative to wild-type chymotrypsin in [BMIM][Cl] and [EMIM][EtSO4 ], respectively. The half-lives of lipase and papain were similarly increased as much as 4.0 and 2.4-fold, respectively, in [BMIM][Cl] by modifying the ratio of positive-to-negative sites of each enzyme. More generally, the results of stability studies found that modifications that reduce the ratio of enzyme-containing positive-to-negative sites improve enzyme stability in ILs. Understanding the impact of charge modification on enzyme stability in ILs may ultimately be exploited to rationally engineer enzymes for improved function in IL environments. Copyright © 2013 Wiley Periodicals, Inc.
Stabilization of oil-in-water emulsions by enzyme catalyzed oxidative gelation of sugar beet pectin
DEFF Research Database (Denmark)
Abang Zaidel, Dayang Norulfairuz; Chronakis, Ioannis S.; Meyer, Anne S.
2013-01-01
Enzyme catalyzed oxidative cross-linking of feruloyl groups can promote gelation of sugar beet pectin (SBP). It is uncertain how the enzyme kinetics of this cross-linking reaction are affected in emulsion systems and whether the gelation affects emulsion stability. In this study, SBP (2.5% w...... larger average particle sizes than the emulsions in which the SBP was homogenized into the emulsion system during emulsion preparation (referred as Mix B). Mix B type emulsions were stable. Enzyme catalyzed oxidative gelation of SBP helped stabilize the emulsions in Mix A. The kinetics of the enzyme...... catalyzed oxidative gelation of SBP was evaluated by small angle oscillatory measurements for horseradish peroxidase (HRP) (EC 1.11.1.7) and laccase (EC 1.10.3.2) catalysis, respectively. HRP catalyzed gelation rates, determined from the slopes of the increase of elastic modulus (G0) with time, were higher...
Visualization of enzyme activities inside earthworm biopores by in situ soil zymography
Thu Duyen Hoang, Thi; Razavi, Bahar. S.; Blagodatskaya, Evgenia; Kuzyakov, Yakov
2015-04-01
. In conclusion, earthworms contribute to the decomposition of carbohydrates through promoting enzyme activities involved in the C-cycle except for leucine aminopeptidase and cellobiohydrolase. References Spohn M, Kuzyakov Y. (2014) Spatial and temporal dynamics of hotspots of enzyme activity in soil as affected by living and dead roots - a soil zymography analysis, Plant Soil 379: 67-77
Enzyme detection by microfluidics
DEFF Research Database (Denmark)
2013-01-01
Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...... by that enzyme...
Enzyme-assisted peeling of cold water shrimps (Pandalus borealis)
DEFF Research Database (Denmark)
Dang, Tem Thi; Gringer, Nina; Jessen, Flemming
2018-01-01
An enzymatic method to facilitate the peeling of cold water shrimps (Pandalus borealis) was developed. The protease solutions were used to mature the shrimps to promote shell-loosening prior to peeling. The efficiency of peeling enzyme-treated shrimps was evaluated by a new quantitative measurement......L and 0.25% Exocut-A0 for 20 h resulted in the best peeling of shrimps (100% completely peeled shrimps, 3 mJ/g work and 89% meat yield). Reuse of the enzyme solution was possible due to a 95% retention rate of proteolytic activity after two 20-h cycles of maturation. The studied enzymatic maturation...... of shrimp. This approach would benefit the shrimp processing industry by 1) enhancing peeling efficiency that includes least efforts to remove the shell, high rate of completely peeled shrimps and high meat yield; 2) shortening the duration of maturation but still sufficiently loosening the shell...
Kotera, Masaaki; Nishimura, Yosuke; Nakagawa, Zen-ichi; Muto, Ai; Moriya, Yuki; Okamoto, Shinobu; Kawashima, Shuichi; Katayama, Toshiaki; Tokimatsu, Toshiaki; Kanehisa, Minoru; Goto, Susumu
2014-12-01
Genomics is faced with the issue of many partially annotated putative enzyme-encoding genes for which activities have not yet been verified, while metabolomics is faced with the issue of many putative enzyme reactions for which full equations have not been verified. Knowledge of enzymes has been collected by IUBMB, and has been made public as the Enzyme List. To date, however, the terminology of the Enzyme List has not been assessed comprehensively by bioinformatics studies. Instead, most of the bioinformatics studies simply use the identifiers of the enzymes, i.e. the Enzyme Commission (EC) numbers. We investigated the actual usage of terminology throughout the Enzyme List, and demonstrated that the partial characteristics of reactions cannot be retrieved by simply using EC numbers. Thus, we developed a novel ontology, named PIERO, for annotating biochemical transformations as follows. First, the terminology describing enzymatic reactions was retrieved from the Enzyme List, and was grouped into those related to overall reactions and biochemical transformations. Consequently, these terms were mapped onto the actual transformations taken from enzymatic reaction equations. This ontology was linked to Gene Ontology (GO) and EC numbers, allowing the extraction of common partial reaction characteristics from given sets of orthologous genes and the elucidation of possible enzymes from the given transformations. Further future development of the PIERO ontology should enhance the Enzyme List to promote the integration of genomics and metabolomics.
7 CFR 58.436 - Rennet, pepsin, other milk clotting enzymes and flavor enzymes.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Rennet, pepsin, other milk clotting enzymes and flavor enzymes. 58.436 Section 58.436 Agriculture Regulations of the Department of Agriculture (Continued... clotting enzymes and flavor enzymes. Enzyme preparations used in the manufacture of cheese shall be safe...
Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...
Stability of Enzymes in Granular Enzyme Products for Laundry Detergents
DEFF Research Database (Denmark)
Biran, Suzan; Bach, Poul; Simonsen, Ole
Enzymes have long been of interest to the detergent industry due to their ability to improve the cleaning efficiency of synthetic detergents, contribute to shortening washing times, and reduce energy and water consumption, provision of environmentally friendlier wash water effluents and fabric care....... However, incorporating enzymes in detergent formulations gives rise to numerous practical problems due to their incompatibility with and stability against various detergent components. In powdered detergent formulations, these issues can be partly overcome by physically isolating the enzymes in separate...... particles. However, enzymes may loose a significant part of their activity over a time period of several weeks. Possible causes of inactivation of enzymes in a granule may be related to the release of hydrogen peroxide from the bleaching chemicals in a moisture-containing atmosphere, humidity, autolysis...
Enzyme structure, enzyme function and allozyme diversity in ...
African Journals Online (AJOL)
In estimates of population genetic diversity based on allozyme heterozygosity, some enzymes are regularly more variable than others. Evolutionary theory suggests that functionally less important molecules, or parts of molecules, evolve more rapidly than more important ones; the latter enzymes should then theoretically be ...
Comparison of the Kinetic Promoters Piperazine and Carbonic Anhydrase for CO2 Absorption
DEFF Research Database (Denmark)
Gladis, Arne; Gundersen, Maria T.; Thomsen, Kaj
2017-01-01
Kinetic promoter that enhance the reaction kinetics with CO2 are enabling the use of the low heat of reaction of slow absorbing solvents like MDEA. Mass transfer experiments with 30 wt% MDEA promoted by either by 1.7 and 8.5g/L enzyme carbonic anhydrase (CA) or 5 wt% piperazine (PZ) where conduct...
International Nuclear Information System (INIS)
Kandpal, R.P.; Stempel, K.E.; Boyer, P.D.
1987-01-01
Addition of dimethyl sulfoxide promotes the formation of enzyme-bound ATP from medium P/sub i/ by mitochondrial F 1 adenosinetriphosphatase that has tightly bound ADP present. Measurements are reported of medium P/sub i/ ↔ H 18 OH exchange and of the dependence of formation of enzyme-bound ATP on P/sub i/ concentration. Attainment of an apparent equilibrium between medium P/sub i/ and bound ATP requires longer than 30 min, even though the rates of P/sub i/ binding and release after apparent equilibrium is reached would suffice for a faster approach to equilibrium. Slow protein conformational changes or other unknown modulating factors may be responsible for the slow rate of bound ATP formation. After apparent equilibrium is reached, each P/sub i/ that binds to the enzyme reversibly forms ATP about 50 times before being released to the medium. The rate of interconversion of bound ATP to bound ADP and P/sub i/ is much slower than that in the absence of dimethyl sulfoxide as measured with sufficient low ATP concentrations so that single-site catalysis is favored. Although the interconversion rate is slowed, the equilibrium constant for bound ATP formation from bound ADP and P/sub i/ is not far from unity. Dimethyl sulfoxide favors the formation of enzyme-bound ATP by promoting the competent binding of P/sub i/ to enzyme with ADP bound at a catalytic site rather than by promoting formation of bound ATP from bound ADP and P/sub i/
Carbonic Anhydrase: An Efficient Enzyme with Possible Global Implications
Directory of Open Access Journals (Sweden)
Christopher D. Boone
2013-01-01
Full Text Available As the global atmospheric emissions of carbon dioxide (CO2 and other greenhouse gases continue to grow to record-setting levels, so do the demands for an efficient and inexpensive carbon sequestration system. Concurrently, the first-world dependence on crude oil and natural gas provokes concerns for long-term availability and emphasizes the need for alternative fuel sources. At the forefront of both of these research areas are a family of enzymes known as the carbonic anhydrases (CAs, which reversibly catalyze the hydration of CO2 into bicarbonate. CAs are among the fastest enzymes known, which have a maximum catalytic efficiency approaching the diffusion limit of 108 M−1s−1. As such, CAs are being utilized in various industrial and research settings to help lower CO2 atmospheric emissions and promote biofuel production. This review will highlight some of the recent accomplishments in these areas along with a discussion on their current limitations.
Immobilized enzymes: understanding enzyme - surface interactions at the molecular level.
Hoarau, Marie; Badieyan, Somayesadat; Marsh, E Neil G
2017-11-22
Enzymes immobilized on solid supports have important and industrial and medical applications. However, their uses are limited by the significant reductions in activity and stability that often accompany the immobilization process. Here we review recent advances in our understanding of the molecular level interactions between proteins and supporting surfaces that contribute to changes in stability and activity. This understanding has been facilitated by the application of various surface-sensitive spectroscopic techniques that allow the structure and orientation of enzymes at the solid/liquid interface to be probed, often with monolayer sensitivity. An appreciation of the molecular interactions between enzyme and surface support has allowed the surface chemistry and method of enzyme attachement to be fine-tuned such that activity and stability can be greatly enhanced. These advances suggest that a much wider variety of enzymes may eventually be amenable to immobilization as green catalysts.
Gene activation regresses atherosclerosis, promotes health, and enhances longevity
Directory of Open Access Journals (Sweden)
Luoma Pauli V
2010-07-01
Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.
Directory of Open Access Journals (Sweden)
Soledad Cebrián-García
2018-06-01
Full Text Available A novel, environmentally friendly, and sustainable ultrasound-assisted methodology in the valorization of valeric acid to alkyl valerate using a biosilicified lipase from Candida antarctica is reported. This one-pot room temperature methodology of enzyme biosilicification leads to biosilicified lipases with improved activity and reaction efficiency as compared to free enzymes. Yields in the ultrasound-promoted esterification of valeric acid was ca. 90% in 2 h with 15% m/v of biosilicified lipase (Bio-lipase; 616 U/g biocatalyst enzymatic activity and a molar ratio 1:2 (valeric acid:ethanol, slightly superior to that observed by the free enzyme (75% conversion, 583U/g biocatalyst enzymatic activity. The reuse of enzymes in these conditions was tested and the results show a relatively good reusability of these biosilicified enzymes under the investigated conditions, particularly preserving fairly stable specific activities (616 vs. 430 U/g biocatalyst after four reuses.
Schallmey, Marcus; Koopmeiners, Julia; Wells, Elizabeth; Wardenga, Rainer; Schallmey, Anett
2014-12-01
Halohydrin dehalogenases are very rare enzymes that are naturally involved in the mineralization of halogenated xenobiotics. Due to their catalytic potential and promiscuity, many biocatalytic reactions have been described that have led to several interesting and industrially important applications. Nevertheless, only a few of these enzymes have been made available through recombinant techniques; hence, it is of general interest to expand the repertoire of these enzymes so as to enable novel biocatalytic applications. After the identification of specific sequence motifs, 37 novel enzyme sequences were readily identified in public sequence databases. All enzymes that could be heterologously expressed also catalyzed typical halohydrin dehalogenase reactions. Phylogenetic inference for enzymes of the halohydrin dehalogenase enzyme family confirmed that all enzymes form a distinct monophyletic clade within the short-chain dehydrogenase/reductase superfamily. In addition, the majority of novel enzymes are substantially different from previously known phylogenetic subtypes. Consequently, four additional phylogenetic subtypes were defined, greatly expanding the halohydrin dehalogenase enzyme family. We show that the enormous wealth of environmental and genome sequences present in public databases can be tapped for in silico identification of very rare but biotechnologically important biocatalysts. Our findings help to readily identify halohydrin dehalogenases in ever-growing sequence databases and, as a consequence, make even more members of this interesting enzyme family available to the scientific and industrial community. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Metagenomics as a Tool for Enzyme Discovery: Hydrolytic Enzymes from Marine-Related Metagenomes.
Popovic, Ana; Tchigvintsev, Anatoly; Tran, Hai; Chernikova, Tatyana N; Golyshina, Olga V; Yakimov, Michail M; Golyshin, Peter N; Yakunin, Alexander F
2015-01-01
This chapter discusses metagenomics and its application for enzyme discovery, with a focus on hydrolytic enzymes from marine metagenomic libraries. With less than one percent of culturable microorganisms in the environment, metagenomics, or the collective study of community genetics, has opened up a rich pool of uncharacterized metabolic pathways, enzymes, and adaptations. This great untapped pool of genes provides the particularly exciting potential to mine for new biochemical activities or novel enzymes with activities tailored to peculiar sets of environmental conditions. Metagenomes also represent a huge reservoir of novel enzymes for applications in biocatalysis, biofuels, and bioremediation. Here we present the results of enzyme discovery for four enzyme activities, of particular industrial or environmental interest, including esterase/lipase, glycosyl hydrolase, protease and dehalogenase.
Transformation of lacZ using different promoters in the commercially ...
African Journals Online (AJOL)
Yomi
2012-01-26
Jan 26, 2012 ... forced growth under unnatural conditions. In order to ... yezoensis include the gluc, cat, GUS and GFP genes. (Cheney et al. ... bacterial lacZ gene encodes the β-galactosidase enzyme which is capable of .... Table 1. Effect of viral promoters on transient β-galactosidase activity in microparticle bombarded G.
Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.
Azad, Kimi; Banerjee, Manidipa; Johnson, John E
2017-09-29
Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.
The surface science of enzymes
DEFF Research Database (Denmark)
Rod, Thomas Holm; Nørskov, Jens Kehlet
2002-01-01
One of the largest challenges to science in the coming years is to find the relation between enzyme structure and function. Can we predict which reactions an enzyme catalyzes from knowledge of its structure-or from its amino acid sequence? Can we use that knowledge to modify enzyme function......? To solve these problems we must understand in some detail how enzymes interact with reactants from its surroundings. These interactions take place at the surface of the enzyme and the question of enzyme function can be viewed as the surface science of enzymes. In this article we discuss how to describe...... catalysis by enzymes, and in particular the analogies between enzyme catalyzed reactions and surface catalyzed reactions. We do this by discussing two concrete examples of reactions catalyzed both in nature (by enzymes) and in industrial reactors (by inorganic materials), and show that although analogies...
Magnetically responsive enzyme powders
Energy Technology Data Exchange (ETDEWEB)
Pospiskova, Kristyna, E-mail: kristyna.pospiskova@upol.cz [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Safarik, Ivo, E-mail: ivosaf@yahoo.com [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Institute of Nanobiology and Structural Biology of GCRC, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)
2015-04-15
Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (−20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties. - Highlights: • Cross-linked enzyme powders were prepared in various liquid media. • Insoluble enzymes were magnetized using iron oxides particles. • Magnetic iron oxides particles were prepared by microwave-assisted synthesis. • Magnetic modification was performed under low (freezing) temperature. • Cross-linked powdered trypsin and lipase can be used repeatedly for reaction.
Giyatmi; Irianto, H E
Fermented fish products are very popular particularly in Southeast Asian countries. These products have unique characteristics, especially in terms of aroma, flavor, and texture developing during fermentation process. Proteolytic enzymes have a main role in hydrolyzing protein into simpler compounds. Fermentation process of fish relies both on naturally occurring enzymes (in the muscle or the intestinal tract) as well as bacteria. Fermented fish products processed using the whole fish show a different characteristic compared to those prepared from headed and gutted fish. Endogenous enzymes like trypsin, chymotrypsin, elastase, and aminopeptidase are the most involved in the fermentation process. Muscle tissue enzymes like cathepsins, peptidases, transaminases, amidases, amino acid decarboxylases, glutamic dehydrogenases, and related enzymes may also play a role in fish fermentation. Due to the decreased bacterial number during fermentation, contribution of microbial enzymes to proteolysis may be expected prior to salting of fish. Commercial enzymes are supplemented during processing for specific purposes, such as quality improvement and process acceleration. In the case of fish sauce, efforts to accelerate fermentation process and to improve product quality have been studied by addition of enzymes such as papain, bromelain, trypsin, pepsin, and chymotrypsin. © 2017 Elsevier Inc. All rights reserved.
Multifarious plant growth promotion by an entomopathogenic fungus Lecanicillium psalliotae.
Senthil Kumar, C M; Jacob, T K; Devasahayam, S; Thomas, Stephy; Geethu, C
2018-03-01
An entomopathogenic fungus, Lecanicillium psalliotae strain IISR-EPF-02 previously found infectious to cardamom thrips, Sciothrips cardamomi promoted plant growth in cardamom, Elettaria cardamomum. The isolate exhibited direct plant growth promoting traits by production of indole-3-acetic acid and ammonia and by solubilizing inorganic phosphate and zinc. It also showed indirect plant growth promoting traits by producing siderophores and cell wall-degrading enzymes like, α-amylases, cellulases and proteases. In pot culture experiments, application of the fungus at the root zone of cardamom seedlings significantly increased shoot and root length, shoot and root biomass, number of secondary roots and leaves and leaf chlorophyll content compared to untreated plants. This is the first report on the plant growth promoting traits of this fungus. The entomopathogenic and multifarious growth promoting traits of L. psalliotae strain IISR-EPF-02 suggest that it has great potential for exploitation in sustainable agriculture. Copyright © 2017 Elsevier GmbH. All rights reserved.
Thermodynamic activity-based intrinsic enzyme kinetic sheds light on enzyme-solvent interactions.
Grosch, Jan-Hendrik; Wagner, David; Nistelkas, Vasilios; Spieß, Antje C
2017-01-01
The reaction medium has major impact on biocatalytic reaction systems and on their economic significance. To allow for tailored medium engineering, thermodynamic phenomena, intrinsic enzyme kinetics, and enzyme-solvent interactions have to be discriminated. To this end, enzyme reaction kinetic modeling was coupled with thermodynamic calculations based on investigations of the alcohol dehydrogenase from Lactobacillus brevis (LbADH) in monophasic water/methyl tert-butyl ether (MTBE) mixtures as a model solvent. Substrate concentrations and substrate thermodynamic activities were varied separately to identify the individual thermodynamic and kinetic effects on the enzyme activity. Microkinetic parameters based on concentration and thermodynamic activity were derived to successfully identify a positive effect of MTBE on the availability of the substrate to the enzyme, but a negative effect on the enzyme performance. In conclusion, thermodynamic activity-based kinetic modeling might be a suitable tool to initially curtail the type of enzyme-solvent interactions and thus, a powerful first step to potentially understand the phenomena that occur in nonconventional media in more detail. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 33:96-103, 2017. © 2016 American Institute of Chemical Engineers.
2014-01-01
The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called “orphan enzymes”. The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to “local orphan enzymes” that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new
Effect of irradiation on immobilized enzymes compared with that on enzymes in solution
International Nuclear Information System (INIS)
Schachinger, L.; Schippel, C.; Altmann, E.; Diepold, B.; Yang, C.; Jaenike, M.; Hochhaeuser, E.
1985-01-01
Glucose oxidase and catalase were immobilized by attaching them to nylon fibers that had been treated with triethyloxonium-tetrafluoroborate, diaminohexane and glutaraldialdehyde according to Morris, Campell and Hornby (1975). This method assures that the enzymes are bound to a side chain of the polyamide structure. Enzyme activity (as measured by the O 2 -uptake and by microcalorimetry) was found to be unchanged after 2 years. The apparent Ksub(m)-constants of the immobilized enzymes with glucose were the same as those for enzymes in solution. GOD and catalase immobilized in poly(acrylamide) gel had the same Ksub(m)-value. Despite the high stability during storage, the radiation induced inactivation of enzymes immobilized on gel or chromosorb, an inorganic carrier, was of the same order of magnitude as that of the dissolved enzymes. The enzymes bound to nylon fibers showed a higher radiation sensitivity. This might have been caused by an additional attack on the binding site of the carrier. (orig.)
TALE factors poise promoters for activation by Hox proteins.
Choe, Seong-Kyu; Ladam, Franck; Sagerström, Charles G
2014-01-27
Hox proteins form complexes with TALE cofactors from the Pbx and Prep/Meis families to control transcription, but it remains unclear how Hox:TALE complexes function. Examining a Hoxb1b:TALE complex that regulates zebrafish hoxb1a transcription, we find maternally deposited TALE proteins at the hoxb1a promoter already during blastula stages. These TALE factors recruit histone-modifying enzymes to promote an active chromatin profile at the hoxb1a promoter and also recruit RNA polymerase II (RNAPII) and P-TEFb. However, in the presence of TALE factors, RNAPII remains phosphorylated on serine 5 and hoxb1a transcription is inefficient. By gastrula stages, Hoxb1b binds together with TALE factors to the hoxb1a promoter. This triggers P-TEFb-mediated transitioning of RNAPII to the serine 2-phosphorylated form and efficient hoxb1a transcription. We conclude that TALE factors access promoters during early embryogenesis to poise them for activation but that Hox proteins are required to trigger efficient transcription. Copyright © 2014 Elsevier Inc. All rights reserved.
Prakash, Heena; Chauhan, Prakram Singh; General, Thiyam; Sharma, A K
2018-03-29
Conversion of agro-industrial wastes to energy is an innovative approach for waste valorization and management which also mitigates environmental pollution. In this view, present study investigated the feasibility of producing bioethanol from banana peels using cocktail of depolymerizing enzyme/s. We isolated Geobacillus stearothermophilus HPA19 from natural resource which produces cocktail of thermo-alkali-stable xylano-pectino-cellulolytic enzyme/s using wheat bran within 24 h. The optimal temperature and pH for xylanase, filter paper cellulase and pectinase were 80, 70 and 80 °C, and 9.0, 8.0 and 9.0, respectively. Cocktail enzymes showed stability at high temperature (80 °C) and pH (10.0). Ni 2+ and Zn 2+ promoted the relative activity of xylanase and FPase, whereas Na + , Ca 2+ and K + promoted pectinase activity. Cocktail was assessed in saccharification of banana peel. Reducing sugar obtained (37.06 mg ml -1 ) after one variable at a time (OVAT) method is greatly influenced by enzyme dose. Further, response surface methodology was used to optimize saccharification leading to twofold increase in reducing sugar. Maximum ethanol production (21.1 gl -1 ) was achieved through fermentation giving the efficiency of 76.5% within 30 h. Hence utilization of waste biomass for production of value-added products through biotechnological intervention not only helps to combat environmental pollution but also contributes significantly to the economy.
Direct Electron Transfer of Enzymes in a Biologically Assembled Conductive Nanomesh Enzyme Platform.
Lee, Seung-Woo; Lee, Ki-Young; Song, Yong-Won; Choi, Won Kook; Chang, Joonyeon; Yi, Hyunjung
2016-02-24
Nondestructive assembly of a nanostructured enzyme platform is developed in combination of the specific biomolecular attraction and electrostatic coupling for highly efficient direct electron transfer (DET) of enzymes with unprecedented applicability and versatility. The biologically assembled conductive nanomesh enzyme platform enables DET-based flexible integrated biosensors and DET of eight different enzyme with various catalytic activities. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Corn and soybean meal metabolizable energy with the addition of exogenous enzymes for poultry
Directory of Open Access Journals (Sweden)
LRB Dourado
2009-03-01
Full Text Available Two metabolism assays were carried out to determine corn and soybean meal metabolizable energy when enzymes were added. In the first trial, 35 cockerels per studied feedstuff (corn and soybean meal were distributed in a completely randomized experimental design with four treatments of seven replicates of one bird each. The evaluated treatments were: ingredient (corn and soybean meal with no enzyme addition, with the addition of an enzyme complex (xylanase, amylase, protease - XAP, xylanase, or phytase. Precise feeding method was used to determine true metabolizable energy corrected for nitrogen balance (TMEn. The use of enzymes did not result in any differences (p>0.05 in soybean meal TMEn, but phytase improved corn TMEn in 2.3% (p=0.004. In the second trial, 280 seven-day-old broiler chicks were distributed in a completely randomized experimental design with seven treatments of five replicates of eight birds each. Treatments consisted of corn with no enzyme addition or with the addition of amylase, xylanase, phytase, XAP complex, XAP+phytase combination, or xylanase/ pectinase/β-glucanase complex (XPBG. Corn was supplemented with macro and trace minerals. Total excreta collection was used to determine apparent metabolizable energy corrected for nitrogen balance (AMEn. Differences were observed (p=0.08 in AMEn and dry matter metabolizability coefficient (p=0.03. The combination of the XAP complex with phytase promoted a 2.11% increase in corn AMEn values, and the remaining enzymes allowed increased between 0.86% and 1.66%.
The search of the target of promotion: Phenylbenzoate esterase activities in hen peripheral nerve
International Nuclear Information System (INIS)
Moretto, A.; Nicolli, A.; Lotti, M.
2007-01-01
Certain esterase inhibitors, such as carbamates, phosphinates and sulfonyl halides, do not cause neuropathy as some organophosphates, but they may exacerbate chemical or traumatic insults to axons. This phenomenon is called promotion of axonopathies. Given the biochemical and toxicological characteristics of these compounds, the hypothesis was made that the target of promotion is a phenyl valerate (PV) esterase similar to neuropathy target esterase (NTE), the target of organophosphate induced delayed polyneuropathy. However, attempts to identify a PV esterase in hen peripheral nerve have been, so far, unsuccessful. We tested several esters, other than PV, as substrates of esterases from crude homogenate of the hen peripheral nerve. The ideal substrate should be poorly hydrolysed by NTE but extensively by enzyme(s) that are insensitive to non-promoters, such as mipafox, and sensitive to promoters, such as phenyl methane sulfonyl fluoride (PMSF). When phenyl benzoate (PB) was used as substrate, about 65% of total activity was resistant to the non-promoter mipafox (up to 0.5 mM, 20 min, pH 8.0), that inhibits NTE and other esterases. More than 90% of this resistant activity was sensitive to the classical promoter PMSF (1 mM, 20 min, pH 8.0) with an IC 50 of about 0.08 mM (20 min, pH 8.0). On the contrary, the non-promoter p-toluene sulfonyl fluoride caused only about 10% inhibition at 0.5 mM. Several esterase inhibitors including, paraoxon, phenyl benzyl carbamate, di-n-butyl dichlorovinyl phosphate and di-isopropyl fluorophosphate, were tested both in vitro and in vivo for inhibition of this PB activity. Mipafox-resistant PMSF-sensitive PB esterase activity(ies) was inhibited by promoters but not by non promoters and neuropathic compounds
Enzymes for improved biomass conversion
Brunecky, Roman; Himmel, Michael E.
2016-02-02
Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.
Wu, Ching-Fang; Lee, Ching-Tai; Kuo, Yao-Hung; Chen, Tzu-Haw; Chang, Chi-Yang; Chang, I-Wei; Wang, Wen-Lun
2017-09-01
Patients with esophageal squamous cell carcinoma have poor survival and high recurrence rate, thus an effective prognostic biomarker is needed. Endothelin-converting enzyme-1 is responsible for biosynthesis of endothelin-1, which promotes growth and invasion of human cancers. The role of endothelin-converting enzyme-1 in esophageal squamous cell carcinoma is still unknown. Therefore, this study investigated the significance of endothelin-converting enzyme-1 expression in esophageal squamous cell carcinoma clinically. We enrolled patients with esophageal squamous cell carcinoma who provided pretreated tumor tissues. Tumor endothelin-converting enzyme-1 expression was evaluated by immunohistochemistry and was defined as either low or high expression. Then we evaluated whether tumor endothelin-converting enzyme-1 expression had any association with clinicopathological findings or predicted survival of patients with esophageal squamous cell carcinoma. Overall, 54 of 99 patients with esophageal squamous cell carcinoma had high tumor endothelin-converting enzyme-1 expression, which was significantly associated with lymph node metastasis ( p = 0.04). In addition, tumor endothelin-converting enzyme-1 expression independently predicted survival of patients with esophageal squamous cell carcinoma, and the 5-year survival was poorer in patients with high tumor endothelin-converting enzyme-1 expression ( p = 0.016). Among patients with locally advanced and potentially resectable esophageal squamous cell carcinoma (stage II and III), 5-year survival was poorer with high tumor endothelin-converting enzyme-1 expression ( p = 0.003). High tumor endothelin-converting enzyme-1 expression also significantly predicted poorer survival of patients in this population. In patients with esophageal squamous cell carcinoma, high tumor endothelin-converting enzyme-1 expression might indicate high tumor invasive property. Therefore, tumor endothelin-converting enzyme-1 expression
Nitrilase enzymes and their role in plant–microbe interactions
Howden, Andrew J. M.; Preston, Gail M.
2009-01-01
Summary Nitrilase enzymes (nitrilases) catalyse the hydrolysis of nitrile compounds to the corresponding carboxylic acid and ammonia, and have a wide range of industrial and biotechnological applications, including the synthesis of industrially important carboxylic acids and bioremediation of cyanide and toxic nitriles. Nitrilases are produced by a wide range of organisms, including plants, bacteria and fungi, but despite their biotechnological importance, the role of these enzymes in living organisms is relatively underexplored. Current research suggests that nitrilases play important roles in a range of biological processes. In the context of plant–microbe interactions they may have roles in hormone synthesis, nutrient assimilation and detoxification of exogenous and endogenous nitriles. Nitrilases are produced by both plant pathogenic and plant growth‐promoting microorganisms, and their activities may have a significant impact on the outcome of plant–microbe interactions. In this paper we review current knowledge of the role of nitriles and nitrilases in plants and plant‐associated microorganisms, and discuss how greater understanding of the natural functions of nitrilases could be applied to benefit both industry and agriculture. PMID:21255276
Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter
International Nuclear Information System (INIS)
Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi
2006-01-01
The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid
Mohamad, Nur Royhaila; Marzuki, Nur Haziqah Che; Buang, Nor Aziah; Huyop, Fahrul; Wahab, Roswanira Abdul
2015-01-01
The current demands of sustainable green methodologies have increased the use of enzymatic technology in industrial processes. Employment of enzyme as biocatalysts offers the benefits of mild reaction conditions, biodegradability and catalytic efficiency. The harsh conditions of industrial processes, however, increase propensity of enzyme destabilization, shortening their industrial lifespan. Consequently, the technology of enzyme immobilization provides an effective means to circumvent these concerns by enhancing enzyme catalytic properties and also simplify downstream processing and improve operational stability. There are several techniques used to immobilize the enzymes onto supports which range from reversible physical adsorption and ionic linkages, to the irreversible stable covalent bonds. Such techniques produce immobilized enzymes of varying stability due to changes in the surface microenvironment and degree of multipoint attachment. Hence, it is mandatory to obtain information about the structure of the enzyme protein following interaction with the support surface as well as interactions of the enzymes with other proteins. Characterization technologies at the nanoscale level to study enzymes immobilized on surfaces are crucial to obtain valuable qualitative and quantitative information, including morphological visualization of the immobilized enzymes. These technologies are pertinent to assess efficacy of an immobilization technique and development of future enzyme immobilization strategies. PMID:26019635
Enzyme inhibition by iminosugars
DEFF Research Database (Denmark)
López, Óscar; Qing, Feng-Ling; Pedersen, Christian Marcus
2013-01-01
Imino- and azasugar glycosidase inhibitors display pH dependant inhibition reflecting that both the inhibitor and the enzyme active site have groups that change protonation state with pH. With the enzyme having two acidic groups and the inhibitor one basic group, enzyme-inhibitor complexes...
Targeted enzyme prodrug therapies.
Schellmann, N; Deckert, P M; Bachran, D; Fuchs, H; Bachran, C
2010-09-01
The cure of cancer is still a formidable challenge in medical science. Long-known modalities including surgery, chemotherapy and radiotherapy are successful in a number of cases; however, invasive, metastasized and inaccessible tumors still pose an unresolved and ongoing problem. Targeted therapies designed to locate, detect and specifically kill tumor cells have been developed in the past three decades as an alternative to treat troublesome cancers. Most of these therapies are either based on antibody-dependent cellular cytotoxicity, targeted delivery of cytotoxic drugs or tumor site-specific activation of prodrugs. The latter is a two-step procedure. In the first step, a selected enzyme is accumulated in the tumor by guiding the enzyme or its gene to the neoplastic cells. In the second step, a harmless prodrug is applied and specifically converted by this enzyme into a cytotoxic drug only at the tumor site. A number of targeting systems, enzymes and prodrugs were investigated and improved since the concept was first envisioned in 1974. This review presents a concise overview on the history and latest developments in targeted therapies for cancer treatment. We cover the relevant technologies such as antibody-directed enzyme prodrug therapy (ADEPT), gene-directed enzyme prodrug therapy (GDEPT) as well as related therapies such as clostridial- (CDEPT) and polymer-directed enzyme prodrug therapy (PDEPT) with emphasis on prodrug-converting enzymes, prodrugs and drugs.
Enzyme-MOF (metal-organic framework) composites.
Lian, Xizhen; Fang, Yu; Joseph, Elizabeth; Wang, Qi; Li, Jialuo; Banerjee, Sayan; Lollar, Christina; Wang, Xuan; Zhou, Hong-Cai
2017-06-06
The ex vivo application of enzymes in various processes, especially via enzyme immobilization techniques, has been extensively studied in recent years in order to enhance the recyclability of enzymes, to minimize enzyme contamination in the product, and to explore novel horizons for enzymes in biomedical applications. Possessing remarkable amenability in structural design of the frameworks as well as almost unparalelled surface tunability, Metal-Organic Frameworks (MOFs) have been gaining popularity as candidates for enzyme immobilization platforms. Many MOF-enzyme composites have achieved unprecedented results, far outperforming free enzymes in many aspects. This review summarizes recent developments of MOF-enzyme composites with special emphasis on preparative techniques and the synergistic effects of enzymes and MOFs. The applications of MOF-enzyme composites, primarily in transferation, catalysis and sensing, are presented as well. The enhancement of enzymatic activity of the composites over free enzymes in biologically incompatible conditions is emphasized in many cases.
International Nuclear Information System (INIS)
Natarajan, M.; Hong, F.A.; Mohan, S.; Herman, T.S.
2003-01-01
Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span
DEFF Research Database (Denmark)
Gojkovic, Zoran; Knecht, Wolfgang; Warneboldt, J.
2004-01-01
The ability to propagate under anaerobic conditions is an essential and unique trait of brewer's or baker's yeast (Saccharomyces cervisiae). To understand the evolution of facultative anaerobiosis we studied the dependence of de novo pyrimidine biosynthesis, more precisely the fourth enzymic...... activity catalysed by dihydroorotate dehydrogenase (DHODase), on the enzymes of the respiratory chain in several yeast species. While the majority of yeasts possess a mitochondrial DHODase, Saccharomyces cerevisiae has a cytoplasmatic enzyme, whose activity is independent of the presence of oxygen. From....... We show that these two S. kluyveri enzymes, and their coding genes, differ in their dependence on the presence of oxygen. Only the cytoplasmic DHODase promotes growth in the absence of oxygen. Apparently a Saccharomyces yeast progenitor which had a eukaryotic-like mitochondrial DHODase acquired...
Ito, Tomohiro; Maeda, Takahiro; Goto, Kazunori; Miura, Takehito; Wakame, Koji; Nishioka, Hiroshi; Sato, Atsuya
2014-03-01
A novel enzyme-treated asparagus extract (ETAS) has been developed as a functional material produced from asparagus stem. Studies were conducted to determine the effect of ETAS on heat shock protein 70 (HSP70) expression and alleviation of stress. HeLa cells were treated with ETAS, and HSP70 mRNA and protein levels were measured using a reverse transcription-polymerase chain reaction (RT-PCR) assay and an enzyme-linked immunosorbent assay (ELISA), respectively. ETAS showed significant increases in HSP70 mRNA at more than 0.125 mg/mL and the protein at more than 1.0 mg/mL. The antistress effect was evaluated in a murine sleep-deprivation model. A sleep-deprivation stress load resulted in elevation of blood corticosterone and lipid peroxide concentrations, while supplementation with ETAS at 200 and 1000 mg/kg body weight was associated with significantly reduced levels of both stress markers, which were in the normal range. The HSP70 protein expression level in mice subjected to sleep-deprivation stress and supplemented with ETAS was significantly enhanced in stomach, liver, and kidney, compared to ETAS-untreated mice. A preliminary and small-sized human study was conducted among healthy volunteers consuming up to 150 mg/d of ETAS daily for 7 d. The mRNA expression of HSP70 in peripheral leukocytes was significantly elevated at intakes of 100 or 150 mg/d, compared to their baseline levels. Since HSP70 is known to be a stress-related protein and its induction leads to cytoprotection, the present results suggest that ETAS might exert antistress effects under stressful conditions, resulting from enhancement of HSP70 expression. © 2014 Institute of Food Technologists®
Energy Technology Data Exchange (ETDEWEB)
Mera, Paola E.; St. Maurice, Martin; Rayment, Ivan; Escalante-Semerena, Jorge C.; UW
2009-06-08
ATP:Corrinoid adenosyltransferases (ACAs) catalyze the transfer of the adenosyl moiety from ATP to cob(I)alamin via a four-coordinate cob(II)alamin intermediate. At present, it is unknown how ACAs promote the formation of the four-coordinate corrinoid species needed for activity. The published high-resolution crystal structure of the ACA from Lactobacillus reuteri (LrPduO) in complex with ATP and cob(II)alamin shows that the environment around the alpha face of the corrin ring consists of bulky hydrophobic residues. To understand how these residues promote the generation of the four-coordinate cob(II)alamin, variants of the human-type ACA enzyme from L. reuteri (LrPduO) were kinetically and structurally characterized. These studies revealed that residue Phe112 is critical in the displacement of 5,6-dimethylbenzimidazole (DMB) from its coordination bond with the Co ion of the ring, resulting in the formation of the four-coordinate species. An F112A substitution resulted in a 80% drop in the catalytic efficiency of the enzyme. The explanation for this loss of activity was obtained from the crystal structure of the mutant protein, which showed cob(II)alamin bound in the active site with DMB coordinated to the cobalt ion. The crystal structure of an LrPduO(F112H) variant showed a DMB-off/His-on interaction between the corrinoid and the enzyme, whose catalytic efficiency was 4 orders of magnitude lower than that of the wild-type protein. The analysis of the kinetic parameters of LrPduO(F112H) suggests that the F112H substitution negatively impacts product release. Substitutions of other hydrophobic residues in the Cbl binding pocket did not result in significant defects in catalytic efficiency in vitro; however, none of the variant enzymes analyzed in this work supported AdoCbl biosynthesis in vivo.
Enzyme recycling in lignocellulosic biorefineries
DEFF Research Database (Denmark)
Jørgensen, Henning; Pinelo, Manuel
2017-01-01
platform. Cellulases are the most important enzymes required in this process, but the complex nature of lignocellulose requires several other enzymes (hemicellulases and auxiliary enzymes) for efficient hydrolysis. Enzyme recycling increases the catalytic productivity of the enzymes by reusing them...... for several batches of hydrolysis, and thereby reduces the overall cost associated with the hydrolysis. Research on this subject has been ongoing for many years and several promising technologies and methods have been developed and demonstrated. But only in a very few cases have these technologies been...... upscaled and tested in industrial settings, mainly because of many difficulties with recycling of enzymes from the complex lignocellulose hydrolyzate at industrially relevant conditions, i.e., high solids loadings. The challenges are associated with the large number of different enzymes required...
Ree, J.H.; Jeganathan, K.B.; Malureanu, L.; Deursen, J.M.A. van
2010-01-01
The anaphase-promoting complex/cyclosome (APC/C) E3 ubiquitin ligase functions with the E2 ubiquitin-conjugating enzyme UbcH10 in the orderly progression through mitosis by marking key mitotic regulators for destruction by the 26-S proteasome. UbcH10 is overexpressed in many human cancer types and
Directory of Open Access Journals (Sweden)
A. A. Tolkacheva
2017-01-01
Full Text Available Microbial enzyme preparations are increasingly replacing conventional chemical catalysts in a number of industrial processes. Such drugs, in addition to environmental friendliness and high activity, have a number of advantages over enzyme preparations of vegetable and animal origin, namely: the production of microbial enzymes in bioreactors is easily controlled and predictable; excreted microbiological enzymes are more stable than intracellular animals and plant enzymes; the genetic diversity of microorganisms makes it possible to produce enzyme preparations with a wide range of specificity; microbiological enzymes can be synthesized year-round, in contrast to the production of plant enzymes, which is often seasonal. The leaders of the world market of enzymes are proteases and amylases, which account for 25% and 15%, respectively. Over the past five years, the world market for carbohydrases, including mainly amylases, cellulases and xylanases, has been the fastest growing segment of the enzyme market with an aggregate annual growth rate of more than 7.0%. Another major product of the industrial enzyme market, which has a great potential for growth, is lipases. From the point of view of designation, the main part is represented by food and food enzymes. The Russian market continues to be unsaturated - the current supply is not able to meet the needs of the Russian feed and food industry in enzyme preparations. Enzyme preparations of domestic producers are in demand in forage production, while food industrial enterprises prefer imported products. The most significant enterprises in the enzymatic industry in Russia at the moment are Sibbiofarm, AgroSistema, Agroferment. In the light of the Russian policy of increasing food security, the development of the domestic enzyme industry is an extremely topical task.
Continuous enzyme reactions with immobilized enzyme tubes prepared by radiation cast-polymerization
International Nuclear Information System (INIS)
Kumakura, Minoru; Kaetsu, Isao
1986-01-01
Immobilized glucose oxidase tubes were prepared by radiation cast-polymerization of 2-hydroxyethyl methacrylate and tetraethyleneglycol diacrylate monomer at low temperatures. The immobilized enzyme tubes which were spirally set in a water bath were used as reactor, in which the enzyme activity varied with tube size and flow rate of the substrate. The conversion yield of the substrate in continuous enzyme reaction was about 80%. (author)
Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V
2010-04-30
Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.
Lambert, J M; Weinbreck, F; Kleerebezem, M
2008-09-24
The interest in efficient intestinal delivery of health-promoting substances is increasing. However, the delivery of vulnerable substances such as enzymes requires specific attention. The transit through the stomach, where the pH is very low, can be detrimental to the enzymatic activity of the protein to be delivered. Here, we describe the microencapsulation of the model enzyme bile salt hydrolase (Bsh) using whey protein-gum arabic microencapsulates for food-grade and targeted enzyme delivery in the proximal region of the small intestine. Furthermore, the efficacy of enteric coating microencapsulates for site-specific enzyme delivery was compared in vitro with living Lactobacillus plantarum WCFS1 bacteria that endogenously produce the Bsh enzyme. Microencapsulates allowed highly effective protection of the enzyme under gastric conditions. Moreover, Bsh release under intestinal conditions appeared to be very efficient, although in the presence of pancreatin, the Bsh activity decreased in time due to proteolytic degradation. In comparison, L. plantarum appeared to be capable to withstand gastric conditions as well as pancreatin challenge. Delivery using encapsulates and live bacteria each have different (dis)advantages that are discussed. In conclusion, live bacteria and food-grade microencapsulates provide alternatives for dedicated enteric delivery of specific enzymes, and the choice of enzyme to be delivered may determine which mode of delivery is most suitable.
The use of lac-type promoters in control analysis
DEFF Research Database (Denmark)
Jensen, Peter Ruhdal; Westerhoff, H. v.; Michelsen, Ole
1993-01-01
experimentally by constructing E. coli strains, in which the chromosomal atp operon is transcribed from the lacUV5 and the tacI promoter. We measured the concentration of the c subunit of H+-ATPase, and found that the expression of this enzyme could be modulated between non-detectable levels and up to five times...... the wild-type level. Thus, in the absence of inducer, no expression of atp genes could be detected when the atp operon was controlled by the lacUV5 promoter, and we estimate that the expression was less than 0.0025 times the wild-type level. We show that the introduction of a lac Y mutation facilitated...
Transcriptional regulation of the Bacillus subtilis menp1 promoter.
Qin, X; Taber, H W
1996-02-01
The Bacillus subtilis men genes encode biosynthetic enzymes for formation of the respiratory chain component menaquinone. The menp1 promoter previously was shown to be the primary cis element for menFD gene expression. In the present work, it was found that either supplementation with nonfermentable carbon sources or reutilization of glycolytic end products increased menp1 activity in the late postexponential phase. The effect on menp1 activity by a particular end product (such as acetoin or acetate) was prevented by blocking the corresponding pathway for end product utilization. Alteration of a TGAAA motif within the promoter region resulted in unregulated menp1 activity throughout the culture cycle, irrespective of the carbon source added.
Lu, Canhua; Nakayasu, Ernesto S; Zhang, Li-Qun; Luo, Zhao-Qing
2016-01-26
The morphology of bacterial cells is important for virulence, evasion of the host immune system, and coping with environmental stresses. The widely distributed Fic proteins (filamentation induced by cAMP) are annotated as proteins involved in cell division because of the presence of the HPFx[D/E]GN[G/K]R motif. We showed that the presence of Fic-1 from Pseudomonas fluorescens significantly reduced the yield of plasmid DNA when expressed in Escherichia coli or P. fluorescens. Fic-1 interacted with GyrB, a subunit of DNA gyrase, which is essential for bacterial DNA replication. Fic-1 catalyzed the AMPylation of GyrB at Tyr(109), a residue critical for binding ATP, and exhibited auto-AMPylation activity. Mutation of the Fic-1 auto-AMPylated site greatly reduced AMPylation activity toward itself and toward GyrB. Fic-1-dependent AMPylation of GyrB triggered the SOS response, indicative of DNA replication stress or DNA damage. Fic-1 also promoted the formation of elongated cells when the SOS response was blocked. We identified an α-inhibitor protein that we named anti-Fic-1 (AntF), encoded by a gene immediately upstream of Fic-1. AntF interacted with Fic-1, inhibited the AMPylation activity of Fic-1 for GyrB in vitro, and blocked Fic-1-mediated inhibition of DNA replication in bacteria, suggesting that Fic-1 and AntF comprise a toxin-antitoxin module. Our work establishes Fic-1 as an AMPylating enzyme that targets GyrB to inhibit DNA replication and may target other proteins to regulate bacterial morphology. Copyright © 2016, American Association for the Advancement of Science.
Bi, Xiaodong; Liu, Zhen
2014-12-16
Enzyme activity assay is an important method in clinical diagnostics. However, conventional enzyme activity assay suffers from apparent interference from the sample matrix. Herein, we present a new format of enzyme activity assay that can effectively eliminate the effects of the sample matrix. The key is a 96-well microplate modified with molecularly imprinted polymer (MIP) prepared according to a newly proposed method called boronate affinity-based oriented surface imprinting. Alkaline phosphatase (ALP), a glycoprotein enzyme that has been routinely used as an indicator for several diseases in clinical tests, was taken as a representative target enzyme. The prepared MIP exhibited strong affinity toward the template enzyme (with a dissociation constant of 10(-10) M) as well as superb tolerance for interference. Thus, the enzyme molecules in a complicated sample matrix could be specifically captured and cleaned up for enzyme activity assay, which eliminated the interference from the sample matrix. On the other hand, because the boronate affinity MIP could well retain the enzymatic activity of glycoprotein enzymes, the enzyme captured by the MIP was directly used for activity assay. Thus, additional assay time and possible enzyme or activity loss due to an enzyme release step required by other methods were avoided. Assay of ALP in human serum was successfully demonstrated, suggesting a promising prospect of the proposed method in real-world applications.
Yeast Extract Promotes Cell Growth and Induces Production of Polyvinyl Alcohol-Degrading Enzymes
Directory of Open Access Journals (Sweden)
Min Li
2011-01-01
Full Text Available Polyvinyl alcohol-degrading enzymes (PVAases have a great potential in bio-desizing processes for its low environmental impact and low energy consumption. In this study, the effect of yeast extract on PVAases production was investigated. A strategy of four-point yeast extract addition was developed and applied to maximize cell growth and PVAases production. As a result, the maximum dry cell weight achieved was 1.48 g/L and the corresponding PVAases activity was 2.99 U/mL, which are 46.5% and 176.8% higher than the control, respectively. Applying this strategy in a 7 L fermentor increased PVAases activity to 3.41 U/mL. Three amino acids (glycine, serine, and tyrosine in yeast extract play a central role in the production of PVAases. These results suggest that the new strategy of four-point yeast extract addition could benefit PVAases production.
Energy Technology Data Exchange (ETDEWEB)
Miller, J J; Brand, J C
1980-01-01
Acid or enzymic hydrolysis can be used to hydrolyze lactose. Advantages of both are compared and details of enzymic hydrolysis using yeast or fungal enzymes given. The new scheme outlined involves recycling lactase. Because lactose and lactase react to ultrafiltration (UF) membranes differently separation is possible. Milk or milk products are ultrafiltered to separate a concentrate from a lactose-rich permeate which is treated with lactase in a reactor until hydrolysis reaches a required level. The lactase can be removed by UF as it does not permeate the membrane, and it is recycled back to the reactor. Permeate from the second UF stage may or may not be recombined with the concentrate from the first stage to produce a low lactose product (analysis of a typical low-lactose dried whole milk is given). Batch or continuous processes are explained and a batch process without enzyme recovery is discussed. (Refs. 4).
Enzyme Mimics: Advances and Applications.
Kuah, Evelyn; Toh, Seraphina; Yee, Jessica; Ma, Qian; Gao, Zhiqiang
2016-06-13
Enzyme mimics or artificial enzymes are a class of catalysts that have been actively pursued for decades and have heralded much interest as potentially viable alternatives to natural enzymes. Aside from having catalytic activities similar to their natural counterparts, enzyme mimics have the desired advantages of tunable structures and catalytic efficiencies, excellent tolerance to experimental conditions, lower cost, and purely synthetic routes to their preparation. Although still in the midst of development, impressive advances have already been made. Enzyme mimics have shown immense potential in the catalysis of a wide range of chemical and biological reactions, the development of chemical and biological sensing and anti-biofouling systems, and the production of pharmaceuticals and clean fuels. This Review concerns the development of various types of enzyme mimics, namely polymeric and dendrimeric, supramolecular, nanoparticulate and proteinic enzyme mimics, with an emphasis on their synthesis, catalytic properties and technical applications. It provides an introduction to enzyme mimics and a comprehensive summary of the advances and current standings of their applications, and seeks to inspire researchers to perfect the design and synthesis of enzyme mimics and to tailor their functionality for a much wider range of applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Várnai, Anikó; Viikari, Liisa; Marjamaa, Kaisa; Siika-aho, Matti
2011-01-01
The adsorption of purified Trichoderma reesei cellulases (TrCel7A, TrCel6A and TrCel5A) and xylanase TrXyn11 and Aspergillus niger β-glucosidase AnCel3A was studied in enzyme mixture during hydrolysis of two pretreated lignocellulosic materials, steam pretreated and catalytically delignified spruce, along with microcrystalline cellulose (Avicel). The enzyme mixture was compiled to resemble the composition of commercial cellulase preparations. The hydrolysis was carried out at 35 °C to mimic the temperature of the simultaneous saccharification and fermentation (SSF). Enzyme adsorption was followed by analyzing the activity and the protein amount of the individual free enzymes in the hydrolysis supernatant. Most enzymes adsorbed quickly at early stages of the hydrolysis and remained bound throughout the hydrolysis, although the conversion reached was fairly high. Only with the catalytically oxidized spruce samples, the bound enzymes started to be released as the hydrolysis degree reached 80%. The results based on enzyme activities and protein assay were in good accordance. Copyright © 2010 Elsevier Ltd. All rights reserved.
Enzyme Teaching by a Virtual Laboratory
Directory of Open Access Journals (Sweden)
J.K. Sugai
2010-05-01
Full Text Available Biochemistry learning demands skills to obtaining and interpreting the experimental data. In a classical model of teaching involve student’s hands-on participation. However this model is expensive, not safe and should be carried out in a short and limited time course. With utilization of educational software these disadvantages are overcome, since the virtual activity could be realized at free full access, and is a tool for individual study. The aim of the present work is to present educational software focused on a virtual for undergraduate student of biochemistry courses. The software development was performed with the help of concept maps, ISIS Draw, ADOBE Photoshop and FLASH MX Program applied on the subject salivary amylase. It was possible to present the basic methodologies for study of the kinetic of enzyme. The substrate (starch consumption was determinate by iodine reaction, while the products (reducing sugars formation was evaluated by cupper-alkaline reaction. The protocols of the virtual experiments are present verbally as well as a subtitle. A set of exercises are disposable, which allowed an auto evaluation and a review of the subject. The experimental treatment involved the presentation of this hypermedia for Nutrition and Dentistry/UFSC undergraduate students as a tool for better comprehension of the theme and promoted the understanding of the kinetic of enzyme.
Characterising Complex Enzyme Reaction Data.
Directory of Open Access Journals (Sweden)
Handan Melike Dönertaş
Full Text Available The relationship between enzyme-catalysed reactions and the Enzyme Commission (EC number, the widely accepted classification scheme used to characterise enzyme activity, is complex and with the rapid increase in our knowledge of the reactions catalysed by enzymes needs revisiting. We present a manual and computational analysis to investigate this complexity and found that almost one-third of all known EC numbers are linked to more than one reaction in the secondary reaction databases (e.g., KEGG. Although this complexity is often resolved by defining generic, alternative and partial reactions, we have also found individual EC numbers with more than one reaction catalysing different types of bond changes. This analysis adds a new dimension to our understanding of enzyme function and might be useful for the accurate annotation of the function of enzymes and to study the changes in enzyme function during evolution.
Sirisha, V L; Jain, Ankita; Jain, Amita
Immobilized enzymes can be used in a wide range of processes. In recent years, a variety of new approaches have emerged for the immobilization of enzymes that have greater efficiency and wider usage. During the course of the last two decades, this area has rapidly expanded into a multidisciplinary field. This current study is a comprehensive review of a variety of literature produced on the different enzymes that have been immobilized on various supporting materials. These immobilized enzymes have a wide range of applications. These include applications in the sugar, fish, and wine industries, where they are used for removing organic compounds from waste water. This study also reviews their use in sophisticated biosensors for metabolite control and in situ measurements of environmental pollutants. Immobilized enzymes also find significant application in drug metabolism, biodiesel and antibiotic production, bioremediation, and the food industry. The widespread usage of immobilized enzymes is largely due to the fact that they are cheaper, environment friendly, and much easier to use when compared to equivalent technologies. © 2016 Elsevier Inc. All rights reserved.
Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.
2015-09-01
Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.
Enzyme stabilization for pesticide degradation
Energy Technology Data Exchange (ETDEWEB)
Rivers, D.B.; Frazer, F.R. III; Mason, D.W.; Tice, T.R.
1988-01-01
Enzymes offer inherent advantages and limitations as active components of formulations used to decontaminate soil and equipment contaminated with toxic materials such as pesticides. Because of the catalytic nature of enzymes, each molecule of enzyme has the potential to destroy countless molecules of a contaminating toxic compound. This degradation takes place under mild environmental conditions of pH, temperature, pressure, and solvent. The basic limitation of enzymes is their degree of stability during storage and application conditions. Stabilizing methods such as the use of additives, covalent crosslinking, covalent attachment, gel entrapment, and microencapsulation have been directed developing an enzyme preparation that is stable under extremes of pH, temperature, and exposure to organic solvents. Initial studies were conducted using the model enzymes subtilisin and horseradish peroxidase.
Enzyme Molecules in Solitary Confinement
Directory of Open Access Journals (Sweden)
Raphaela B. Liebherr
2014-09-01
Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.
Directory of Open Access Journals (Sweden)
Gregory Kohn
Full Text Available BACKGROUND: We recently characterized a specific inorganic triphosphatase (PPPase from Nitrosomonas europaea. This enzyme belongs to the CYTH superfamily of proteins. Many bacterial members of this family are annotated as predicted adenylate cyclases, because one of the founding members is CyaB adenylate cyclase from A. hydrophila. The aim of the present study is to determine whether other members of the CYTH protein family also have a PPPase activity, if there are PPPase activities in animal tissues and what enzymes are responsible for these activities. METHODOLOGY/PRINCIPAL FINDINGS: Recombinant enzymes were expressed and purified as GST- or His-tagged fusion proteins and the enzyme activities were determined by measuring the release of inorganic phosphate. We show that the hitherto uncharacterized E. coli CYTH protein ygiF is a specific PPPase, but it contributes only marginally to the total PPPase activity in this organism, where the main enzyme responsible for hydrolysis of inorganic triphosphate (PPP(i is inorganic pyrophosphatase. We further show that CyaB hydrolyzes PPP(i but this activity is low compared to its adenylate cyclase activity. Finally we demonstrate a high PPPase activity in mammalian and quail tissue, particularly in the brain. We show that this activity is mainly due to Prune, an exopolyphosphatase overexpressed in metastatic tumors where it promotes cell motility. CONCLUSIONS AND GENERAL SIGNIFICANCE: We show for the first time that PPPase activities are widespread in bacteria and animals. We identified the enzymes responsible for these activities but we were unable to detect significant amounts of PPP(i in E. coli or brain extracts using ion chromatography and capillary electrophoresis. The role of these enzymes may be to hydrolyze PPP(i, which could be cytotoxic because of its high affinity for Ca(2+, thereby interfering with Ca(2+ signaling.
Enzyme technology: Key to selective biorefining
DEFF Research Database (Denmark)
Meyer, Anne S.
2014-01-01
to the reaction is a unique trait of enzyme catalysis. Since enzyme selectivity means that a specific reaction is catalysed between particular species to produce definite products, enzymes are particularly fit for converting specific compounds in mixed biomass streams. Since enzymes are protein molecules...... their rational use in biorefinery processes requires an understanding of the basic features of enzymes and reaction traits with respect to specificity, kinetics, reaction optima, stability and structure-function relations – we are now at a stage where it is possible to use nature’s enzyme structures as starting...... point and then improve the functional traits by targeted mutation of the protein. The talk will display some of our recent hypotheses related to enzyme action, recently obtained results within knowledge-based enzyme improvements as well as cast light on research methods used in optimizing enzyme...
Prediction by promoter logic in bacterial quorum sensing.
Directory of Open Access Journals (Sweden)
Navneet Rai
2012-01-01
Full Text Available Quorum-sensing systems mediate chemical communication between bacterial cells, coordinating cell-density-dependent processes like biofilm formation and virulence-factor expression. In the proteobacterial LuxI/LuxR quorum sensing paradigm, a signaling molecule generated by an enzyme (LuxI diffuses between cells and allosterically stimulates a transcriptional regulator (LuxR to activate its cognate promoter (pR. By expressing either LuxI or LuxR in positive feedback from pR, these versatile systems can generate smooth (monostable or abrupt (bistable density-dependent responses to suit the ecological context. Here we combine theory and experiment to demonstrate that the promoter logic of pR - its measured activity as a function of LuxI and LuxR levels - contains all the biochemical information required to quantitatively predict the responses of such feedback loops. The interplay of promoter logic with feedback topology underlies the versatility of the LuxI/LuxR paradigm: LuxR and LuxI positive-feedback systems show dramatically different responses, while a dual positive/negative-feedback system displays synchronized oscillations. These results highlight the dual utility of promoter logic: to probe microscopic parameters and predict macroscopic phenotype.
Phage lytic enzymes: a history.
Trudil, David
2015-02-01
There are many recent studies regarding the efficacy of bacteriophage-related lytic enzymes: the enzymes of 'bacteria-eaters' or viruses that infect bacteria. By degrading the cell wall of the targeted bacteria, these lytic enzymes have been shown to efficiently lyse Gram-positive bacteria without affecting normal flora and non-related bacteria. Recent studies have suggested approaches for lysing Gram-negative bacteria as well (Briersa Y, et al., 2014). These enzymes include: phage-lysozyme, endolysin, lysozyme, lysin, phage lysin, phage lytic enzymes, phageassociated enzymes, enzybiotics, muralysin, muramidase, virolysin and designations such as Ply, PAE and others. Bacteriophages are viruses that kill bacteria, do not contribute to antimicrobial resistance, are easy to develop, inexpensive to manufacture and safe for humans, animals and the environment. The current focus on lytic enzymes has been on their use as anti-infectives in humans and more recently in agricultural research models. The initial translational application of lytic enzymes, however, was not associated with treating or preventing a specific disease but rather as an extraction method to be incorporated in a rapid bacterial detection assay (Bernstein D, 1997).The current review traces the translational history of phage lytic enzymes-from their initial discovery in 1986 for the rapid detection of group A streptococcus in clinical specimens to evolving applications in the detection and prevention of disease in humans and in agriculture.
Metz, D C; Pradhan, T K; Mrozinski, J E; Jensen, R T; Turner, R J; Patto, R J; Gardner, J D
1994-01-13
We used thapsigargin (TG), 2,5-di-tert-butyl-1,4-benzohydroquinone (BHQ) and cyclopiazonic acid (CPA), each of which inhibits microsomal Ca(2+)-ATPase, to evaluate the effects of this inhibition on cytoplasmic free calcium ([Ca2+]i) and secretagogue-stimulated enzyme secretion in rat pancreatic acini. Using single-cell microspectrofluorimetry of fura-2-loaded acini we found that all three agents caused a sustained increase in [Ca2+]i by mobilizing calcium from inositol-(1,4,5)-trisphosphate-sensitive intracellular calcium stores and by promoting influx of extracellular calcium. Concentrations of all three agents that increased [Ca2+]i potentiated the stimulation of enzyme secretion caused by secretagogues that activate adenylate cyclase but inhibited the stimulation of enzyme secretion caused by secretagogues that activate phospholipase C. With BHQ, potentiation of adenylate cyclase-mediated enzyme secretion occurred immediately whereas inhibition of phospholipase C-mediated enzyme secretion occurred only after several min of incubation. In addition, the effects of BHQ and CPA on both [Ca2+]i and secretagogue-stimulated enzyme secretion were reversed completely by washing whereas the actions of TG could not be reversed by washing. Concentrations of BHQ in excess of those that caused maximal changes in [Ca2+]i inhibited all modes of stimulated enzyme secretion by a mechanism that was apparently unrelated to changes in [Ca2+]i. Finally, in contrast to the findings with TG and BHQ, CPA inhibited bombesin-stimulated enzyme secretion over a range of concentrations that was at least 10-fold lower than the range of concentrations over which CPA potentiated VIP-stimulated enzyme secretion.
Leurs, Melanie; Tiller, Joerg C
2017-01-01
The properties of enzymes can be altered significantly by modification with polymers. Numerous different methods are known to obtain such polymer-enzyme conjugates (PECs). However, there is no universal method to render enzymes into PECs that are fully soluble in organic solvents. Here, we present a method, which achieves such high degree of modification of proteins that the majority of modified enzymes will be soluble in organic solvents. This is achieved by preparing poly(2-alkyloxazoline)s (POx) with an NH 2 end group and coupling this functional polymer via pyromellitic acid dianhydride onto the amino groups of the respective protein. The resulting PECs are capable of serving as surfactants for unmodified proteins, rendering the whole mixture organosoluble. Depending on the nature of the POx and the molecular weight and the nature of the enzyme, the PECs are soluble in chloroform or even toluene. Another advantage of this method is that the poly(2-alkyloxazoline) can be activated with the coupling agent and used for the enzyme conjugation without further purification. The POx-enzyme conjugates generated by this modification strategy show modulated catalytic activity in both, aqueous and organic, systems. © 2017 Elsevier Inc. All rights reserved.
Engineering Cellulase Enzymes for Bioenergy
Atreya, Meera Elizabeth
Sustainable energy sources, such as biofuels, offer increasingly important alternatives to fossil fuels that contribute less to global climate change. The energy contained within cellulosic biofuels derives from sunlight energy stored in the form of carbon-carbon bonds comprising sugars such as glucose. Second-generation biofuels are produced from lignocellulosic biomass feedstocks, including agricultural waste products and non-food crops like Miscanthus, that contain lignin and the polysaccharides hemicellulose and cellulose. Cellulose is the most abundant biological material on Earth; it is a polymer of glucose and a structural component of plant cell walls. Accessing the sugar is challenging, as the crystalline structure of cellulose resists degradation; biochemical and thermochemical means can be used to depolymerize cellulose. Cellulase enzymes catalyze the biochemical depolymerization of cellulose into glucose. Glucose can be used as a carbon source for growth of a biofuel-producing microorganism. When it converts glucose to a hydrocarbon fuel, this microbe completes the biofuels process of transforming sunlight energy into accessible, chemical energy capable of replacing non-renewable transportation fuels. Due to strong intermolecular interactions between polymer chains, cellulose is significantly more challenging to depolymerize than starch, a more accessible polymer of glucose utilized in first-generation biofuels processes (often derived from corn). While most mammals cannot digest cellulose (dietary fiber), certain fungi and bacteria produce cellulase enzymes capable of hydrolyzing it. These organisms secrete a wide variety of glycoside hydrolase and other classes of enzymes that work in concert. Because cellulase enzymes are slow-acting and expensive to produce, my aim has been to improve the properties of these enzymes as a means to make a cellulosic biofuels process possible that is more efficient and, consequently, more economical than current
Nitrilase enzymes and their role in plant-microbe interactions.
Howden, Andrew J M; Preston, Gail M
2009-07-01
Nitrilase enzymes (nitrilases) catalyse the hydrolysis of nitrile compounds to the corresponding carboxylic acid and ammonia, and have a wide range of industrial and biotechnological applications, including the synthesis of industrially important carboxylic acids and bioremediation of cyanide and toxic nitriles. Nitrilases are produced by a wide range of organisms, including plants, bacteria and fungi, but despite their biotechnological importance, the role of these enzymes in living organisms is relatively underexplored. Current research suggests that nitrilases play important roles in a range of biological processes. In the context of plant-microbe interactions they may have roles in hormone synthesis, nutrient assimilation and detoxification of exogenous and endogenous nitriles. Nitrilases are produced by both plant pathogenic and plant growth-promoting microorganisms, and their activities may have a significant impact on the outcome of plant-microbe interactions. In this paper we review current knowledge of the role of nitriles and nitrilases in plants and plant-associated microorganisms, and discuss how greater understanding of the natural functions of nitrilases could be applied to benefit both industry and agriculture. © 2009 The Authors. Journal compilation © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.
Samaratunga, Ashani; Kudina, Olena; Nahar, Nurun; Zakharchenko, Andrey; Minko, Sergiy; Voronov, Andriy; Pryor, Scott W
2015-03-01
Cellulase and β-glucosidase were adsorbed on a polyacrylic acid polymer brush grafted on silica nanoparticles to produce enzymogels as a form of enzyme immobilization. Enzyme loading on the enzymogels was increased to a saturation level of approximately 110 μg (protein) mg(-1) (particle) for each enzyme. Enzymogels with varied enzyme loadings were then used to determine the impact on hydrolysis rate and enzyme recovery. Soluble sugar concentrations during the hydrolysis of filter paper and Solka-Floc with the enzymogels were 45 and 53%, respectively, of concentrations when using free cellulase. β-Glucosidase enzymogels showed lower performance; hydrolyzate glucose concentrations were just 38% of those using free enzymes. Increasing enzyme loading on the enzymogels did not reduce net efficacy for cellulase and improved efficacy for β-glucosidase. The use of free cellulases and cellulase enzymogels resulted in hydrolyzates with different proportions of cellobiose and glucose, suggesting differential attachment or efficacy of endoglucanases, exoglucanases, and β-glucosidases present in cellulase mixtures. When loading β-glucosidase individually, higher enzyme loadings on the enzymogels produced higher hydrolyzate glucose concentrations. Approximately 96% of cellulase and 66 % of β-glucosidase were recovered on the enzymogels, while enzyme loading level did not impact recovery for either enzyme.
Shimomura, Yoshiharu; Murakami, Taro; Nakai, Naoya; Nagasaki, Masaru; Harris, Robert A
2004-06-01
Branched-chain amino acids (BCAAs) are essential amino acids that can be oxidized in skeletal muscle. It is known that BCAA oxidation is promoted by exercise. The mechanism responsible for this phenomenon is attributed to activation of the branched-chain alpha-keto acid dehydrogenase (BCKDH) complex, which catalyzes the second-step reaction of the BCAA catabolic pathway and is the rate-limiting enzyme in the pathway. This enzyme complex is regulated by a phosphorylation-dephosphorylation cycle. The BCKDH kinase is responsible for inactivation of the complex by phosphorylation, and the activity of the kinase is inversely correlated with the activity state of the BCKDH complex, which suggests that the kinase is the primary regulator of the complex. We found recently that administration of ligands for peroxisome proliferator-activated receptor-alpha (PPARalpha) in rats caused activation of the hepatic BCKDH complex in association with a decrease in the kinase activity, which suggests that promotion of fatty acid oxidation upregulates the BCAA catabolism. Long-chain fatty acids are ligands for PPARalpha, and the fatty acid oxidation is promoted by several physiological conditions including exercise. These findings suggest that fatty acids may be one of the regulators of BCAA catabolism and that the BCAA requirement is increased by exercise. Furthermore, BCAA supplementation before and after exercise has beneficial effects for decreasing exercise-induced muscle damage and promoting muscle-protein synthesis; this suggests the possibility that BCAAs are a useful supplement in relation to exercise and sports.
Lu, Tu-lin; Su, Lian-lin; Ji, De; Gu, Wei; Mao, Chun-qin
2015-09-01
Drugs are exogenous compounds for human bodies, and will be metabolized by many enzymes after administration. CYP450 enzyme, as a major metabolic enzyme, is an important phase I drug metabolizing enzyme. In human bodies, about 75% of drug metabolism is conducted by CYP450 enzymes, and CYP450 enzymes is the key factor for drug interactions between traditional Chinese medicine( TCM) -TCM, TCM-medicine and other drug combination. In order to make clear the interaction between metabolic enzymes and TCM metabolism, we generally chose the enzymatic activity as an evaluation index. That is to say, the enhancement or reduction of CYP450 enzyme activity was used to infer the inducing or inhibitory effect of active ingredients and extracts of traditional Chinese medicine on enzymes. At present, the common method for measuring metabolic enzyme activity is Cocktail probe drugs, and it is the key to select the suitable probe substrates. This is of great significance for study drug's absorption, distribution, metabolism and excretion (ADME) process in organisms. The study focuses on the interaction between TCMs, active ingredients, herbal extracts, cocktail probe substrates as well as CYP450 enzymes, in order to guide future studies.
BAKERY ENZYMES IN CEREAL TECHNOLOGIES
Directory of Open Access Journals (Sweden)
Václav Koman
2012-10-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE Bread is the most common and traditional food in the world. For years, enzymes such as malt and fungal alpha-amylase have been used in bread making. Due to the changes in the baking industry and the ever-increasing demand for more natural products, enzymes have gained real importance in bread-making. If an enzyme is added, it is often destroyed by the heat during the baking process. For generations, enzymes have been used for the improvement of texture and appearance, enhancement of nutritional values and generation of appealing flavours and aromas. Enzymes used in bakery industry constitute nearly one third of the market. The bakery products have undergone radical improvements in quality over the past years in terms of flavour, texture and shelf-life. The the biggest contributor for these improvementsis the usage of enzymes. Present work seeks to systematically describe bakery enzymes, their classification, benefits, usage and chemical reactions in the bread making process.doi:10.5219/193
Convergent evolution of caffeine in plants by co-option of exapted ancestral enzymes.
Huang, Ruiqi; O'Donnell, Andrew J; Barboline, Jessica J; Barkman, Todd J
2016-09-20
Convergent evolution is a process that has occurred throughout the tree of life, but the historical genetic and biochemical context promoting the repeated independent origins of a trait is rarely understood. The well-known stimulant caffeine, and its xanthine alkaloid precursors, has evolved multiple times in flowering plant history for various roles in plant defense and pollination. We have shown that convergent caffeine production, surprisingly, has evolved by two previously unknown biochemical pathways in chocolate, citrus, and guaraná plants using either caffeine synthase- or xanthine methyltransferase-like enzymes. However, the pathway and enzyme lineage used by any given plant species is not predictable from phylogenetic relatedness alone. Ancestral sequence resurrection reveals that this convergence was facilitated by co-option of genes maintained over 100 million y for alternative biochemical roles. The ancient enzymes of the Citrus lineage were exapted for reactions currently used for various steps of caffeine biosynthesis and required very few mutations to acquire modern-day enzymatic characteristics, allowing for the evolution of a complete pathway. Future studies aimed at manipulating caffeine content of plants will require the use of different approaches given the metabolic and genetic diversity revealed by this study.
Energy Technology Data Exchange (ETDEWEB)
Kim, Moon Il; Kim, Jungbae; Lee, Jinwoo; Jia, Hongfei; Na, Hyon Bin; Youn, Jongkyu; Kwak, Ja Hun; Dohnalkova, Alice; Grate, Jay W.; Wang, Ping; Hyeon, Taeghwan; Park, Hyun-Gyu; Chang, Ho Nam
2007-02-01
alpha-chymotrypsin (CT) and lipase (LP) were immobilized in hierarchically-ordered mesocellular mesoporous silica (HMMS) in a simple but effective way for the enzyme stabilization, which was achieved by the enzyme adsorption followed by glutaraldehyde (GA) crosslinking. This resulted in the formation of nanometer scale crosslinked enzyme aggregates (CLEAs) entrapped in the mesocellular pores of HMMS (37 nm), which did not leach out of HMMS through narrow mesoporous channels (13 nm). CLEA of alpha-chymotrypsin (CLEA-CT) in HMMS showed a high enzyme loading capacity and significantly increased enzyme stability. No activity decrease of CLEA-CT was observed for two weeks under even rigorously shaking condition, while adsorbed CT in HMMS and free CT showed a rapid inactivation due to the enzyme leaching and presumably autolysis, respectively. With the CLEA-CT in HMMS, however, there was no tryptic digestion observed suggesting that the CLEA-CT is not susceptible to autolysis. Moreover, CLEA of lipase (CLEA-LP) in HMMS retained 30% specific activity of free lipase with greatly enhanced stability. This work demonstrates that HMMS can be efficiently employed as host materials for enzyme immobilization leading to highly enhanced stability of the immobilized enzymes with high enzyme loading and activity.
Lambert, J.M.; Weinbreck, F.; Kleerebezem, M.
2008-01-01
The interest in efficient intestinal delivery of health-promoting substances is increasing. However, the delivery of vulnerable substances such as enzymes requires specific attention. The transit through the stomach, where the pH is very low, can be detrimental to the enzymatic activity of the
Energy Technology Data Exchange (ETDEWEB)
Bucke, C; Wiseman, A
1981-04-04
This article reviews the current state of the art of enzyme and cell immobilization and suggests advances which might be made during the 1980's. Current uses of immobilized enzymes include the use of glucoamylase in the production of glucose syrups from starch and glucose isomerase in the production of high fructose corn syrup. Possibilities for future uses of immobilized enzymes and cells include the utilization of whey and the production of ethanol.
Isolation and selection of plant growth-promoting bacteria associated with sugarcane
Directory of Open Access Journals (Sweden)
Ariana Alves Rodrigues
2016-06-01
Full Text Available Microorganisms play a vital role in maintaining soil fertility and plant health. They can act as biofertilizers and increase the resistance to biotic and abiotic stress. This study aimed at isolating and characterizing plant growth-promoting bacteria associated with sugarcane, as well as assessing their ability to promote plant growth. Endophytic bacteria from leaf, stem, root and rhizosphere were isolated from the RB 867515 commercial sugarcane variety and screened for indole acetic acid (IAA production, ability to solubilize phosphate, fix nitrogen and produce hydrogen cyanide (HCN, ammonia and the enzymes pectinase, cellulase and chitinase. A total of 136 bacteria were isolated, with 83 of them presenting some plant growth mechanism: 47 % phosphate solubilizers, 26 % nitrogen fixers and 57 % producing IAA, 0.7 % HCN and chitinase, 45 % ammonia, 30 % cellulose and 8 % pectinase. The seven best isolates were tested for their ability to promote plant growth in maize. The isolates tested for plant growth promotion belong to the Enterobacteriaceae family and the Klebsiella, Enterobacter and Pantoea genera. Five isolates promoted plant growth in greenhouse experiments, showing potential as biofertilizers.
Vogel, S. de; Wouters, K.A.D.; Gottschalk, R.W.H.; Schooten, F.J. van; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Weijenberg, M.P.; Engeland, M. van
2009-01-01
Aberrant DNA methylation affects carcinogenesis of colorectal cancer. Folate metabolizing enzymes may influence the bioavailability of methyl groups, whereas DNA and histone methyltransferases are involved in epigenetic regulation of gene expression. We studied associations of genetic variants of
Directory of Open Access Journals (Sweden)
Juan D Latorre
2016-10-01
Full Text Available Social concern about misuse of antibiotics as growth promoters (AGP and generation of multidrug-resistant bacteria have restricted the dietary inclusion of antibiotics in livestock feed in several countries. Direct-fed microbials (DFM are one of the multiple alternatives commonly evaluated as substitutes of AGP. Sporeformer bacteria from the genus Bacillus have been extensively investigated because of their extraordinary properties to form highly-resistant endospores, production of antimicrobial compounds and synthesize different exogenous enzymes. The purpose of the present study was to evaluate and select Bacillus spp. from environmental and poultry sources as DFM candidates, considering their enzyme production profile, biofilm synthesis capacity and pathogen-inhibition activity. Thirty one Bacillus isolates were screened for in vitro relative enzyme activity of amylase, protease, lipase and phytase using a selective media for each enzyme, with 3/31 strains selected as superior enzyme producers. These three isolates were identified as B. subtilis (1/3, and B. amyloliquefaciens (2/3 based on biochemical tests and 16S rRNA sequence analysis. For evaluation of biofilm synthesis, the generation of an adherent crystal violet-stained ring was determined in polypropylene tubes, resulting in 11/31 strains showing a strong biofilm formation. Moreover, all Bacillus strains were evaluated for growth inhibition activity against Salmonella enterica serovar Enteritidis (26/31, Escherichia coli (28/31 and Clostridioides difficile (29/31. Additionally, in previous in vitro and in vivo studies, these selected Bacillus strains have shown to be resistant to different biochemical conditions of the gastrointestinal tract of poultry. Results of the present study suggest that the selection and consumption of Bacillus-DFM, producing a variable set of enzymes and antimicrobial compounds may contribute to enhanced performance through improving nutrient digestibility
Enzyme activity and reserve mobilization during Macaw palm ( Acrocomia aculeata seed germination
Directory of Open Access Journals (Sweden)
Elisa Monteze Bicalho
2016-01-01
Full Text Available ABSTRACT Reserve mobilization in seeds occurs after visible germination, which is marked by the protrusion of the radicle or cotyledonary petiole, as in species of Arecaceae. Acrocomia aculeata (macaw palm, usually produces hard seeds whose endosperm has mannan-rich cell walls. We investigated the composition of storage compounds in macaw palm seed and the roles of two enzymes (endo-β-mannanase, α-galactosidase during and after germination. The seeds were firstly submitted to pre-established protocol to overcome dormancy and promote germination. Enzyme activity in both embryo and endosperm were assayed from the initiation of germinative activities until leaf sheath appearance, and the status of seed structures and reserve compounds were evaluated. Protein content of the embryo decreased with the initiation of imbibition while the lipid content began decreasing six days after removal of the operculum. Increases in enzyme activity and starch content were both observed after visible germination. We suggest that endo-β-mannanase and α-galactosidase become active immediately at germination, facilitating haustorium expansion and providing carbohydrates for initial seedling development. Protein is the first storage compound mobilized during early imbibition, and the observed increase in the starch content of the haustorium was related to lipid degradation in that organ and mannan degradation in the adjacent endosperm.
DEFF Research Database (Denmark)
Vang, Ole; Wallin, H.; Doehmer, J.
1993-01-01
The role of metabolism of tumour promoters on the inhibition of intercellular communication was investigated in a modified V79 metabolic cooperation system. V79 cells, which stably express different rat cytochrome P450 enzymes (CYP1A1, CYP1A2 or CYP2B1), were used in the metabolic cooperation assay...... B1 and 4-nitrobiphenyl, did not inhibit metabolic cooperation in either V79 cells expressing or cells not expressing cytochrome P450. We conclude that cytochrome P450-associated metabolism plays an important role in the inhibition of gap junctional intercellular communication of some tumour...... promoters. The modified metabolic cooperation assay presented here is valuable for detecting some inhibitory chemicals which have been 'false negative' in previous assays for gap junctional intercellular communication. The assay also discloses that cytochrome P450 metabolism alters intercellular...
Wösten-van Asperen, Roelie M.; Bos, Albert P.; Bem, Reinout A.; Dierdorp, Barbara S.; Dekker, Tamara; van Goor, Harry; Kamilic, Jelena; van der Loos, Chris M.; van den Berg, Elske; Bruijn, Martijn; van Woensel, Job B.; Lutter, René
2013-01-01
Angiotensin-converting enzyme and its effector peptide angiotensin II have been implicated in the pathogenesis of acute respiratory distress syndrome. Recently, angiotensin-converting enzyme 2 was identified as the counter-regulatory enzyme of angiotensin-converting enzyme that converts angiotensin
Wosten-van Asperen, Roelie M.; Bos, Albert; Bem, Reinout A.; Dierdorp, Barbara S.; Dekker, Tamara; van Goor, Harry; Kamilic, Jelena; van der Loos, Chris M.; van den Berg, Elske; Bruijn, Martijn; van Woensel, Job B.; Lutter, Rene
2013-01-01
Objective: Angiotensin-converting enzyme and its effector peptide angiotensin II have been implicated in the pathogenesis of acute respiratory distress syndrome. Recently, angiotensin-converting enzyme 2 was identified as the counter-regulatory enzyme of angiotensin-converting enzyme that converts
Ward, Keeran; Xi, Jingshu; Stuckey, David C
2015-12-01
The use of non-ionic colloidal liquid aphrons (CLAs) as a support for enzyme immobilisation was investigated. Formulation required the mixing of an aqueous-surfactant solution with a relatively non-polar solvent-surfactant solution, forming a solvent droplet surrounded by a thin stabilised aqueous film (soapy shell). Studies utilising anionic surfactants have showed increased retention, however, very little have been understood about the forces governing immobilisation. This study seeks to determine the effects of enzyme properties on CLA immobilisation by examining a non-ionic/non-polar solvent system comprised of two non-ionic surfactants, Tween 20 and 80, mineral oil and the enzymes lipase, aprotinin and α-chymotrypsin. From these results it was deduced that hydrophobic interactions strongly governed immobilisation. Confocal Scanning Laser Microscopy (CSLM) revealed that immobilisation was predominantly achieved by surface adsorption attributed to hydrophobic interactions between the enzyme and the CLA surface. Enzyme surface affinity was found to increase when added directly to the formulation (pre-manufacture addition), as opposed to the bulk continuous phase (post-manufacture addition), with α-chymotrypsin and aprotinin being the most perturbed, while lipase was relatively unaffected. The effect of zeta potential on immobilisation showed that enzymes adsorbed better closer to their pI, indicating that charge minimisation was necessary for immobilisation. Finally, the effect of increasing enzyme concentration in the aqueous phase resulted in an increase in adsorption for all enzymes due to cooperativity between protein molecules, with saturation occurring faster at higher adsorption rates. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Imura, Yoshiyuki; Molho, Melissa; Chuang, Chingkai; Nagy, Peter D.
2015-01-01
Mono- and multi-ubiquitination alters the functions and subcellular localization of many cellular and viral proteins. Viruses can co-opt or actively manipulate the ubiquitin network to support viral processes or suppress innate immunity. Using yeast (Saccharomyces cerevisiae) model host, we show that the yeast Rad6p (radiation sensitive 6) E2 ubiquitin-conjugating enzyme and its plant ortholog, AtUbc2, interact with two tombusviral replication proteins and these E2 ubiquitin-conjugating enzymes could be co-purified with the tombusvirus replicase. We demonstrate that TBSV RNA replication and the mono- and bi-ubiquitination level of p33 is decreased in rad6Δ yeast. However, plasmid-based expression of AtUbc2p could complement both defects in rad6Δ yeast. Knockdown of UBC2 expression in plants also decreases tombusvirus accumulation and reduces symptom severity, suggesting that Ubc2p is critical for virus replication in plants. We provide evidence that Rad6p is involved in promoting the subversion of Vps23p and Vps4p ESCRT proteins for viral replicase complex assembly. - Highlights: • Tombusvirus p33 replication protein interacts with cellular RAD6/Ubc2 E2 enzymes. • Deletion of RAD6 reduces tombusvirus replication in yeast. • Silencing of UBC2 in plants inhibits tombusvirus replication. • Mono- and bi-ubiquitination of p33 replication protein in yeast and in vitro. • Rad6p promotes the recruitment of cellular ESCRT proteins into the tombusvirus replicase
Energy Technology Data Exchange (ETDEWEB)
Imura, Yoshiyuki, E-mail: imura@brs.nihon-u.ac.jp; Molho, Melissa; Chuang, Chingkai; Nagy, Peter D., E-mail: pdnagy2@uky.edu
2015-10-15
Mono- and multi-ubiquitination alters the functions and subcellular localization of many cellular and viral proteins. Viruses can co-opt or actively manipulate the ubiquitin network to support viral processes or suppress innate immunity. Using yeast (Saccharomyces cerevisiae) model host, we show that the yeast Rad6p (radiation sensitive 6) E2 ubiquitin-conjugating enzyme and its plant ortholog, AtUbc2, interact with two tombusviral replication proteins and these E2 ubiquitin-conjugating enzymes could be co-purified with the tombusvirus replicase. We demonstrate that TBSV RNA replication and the mono- and bi-ubiquitination level of p33 is decreased in rad6Δ yeast. However, plasmid-based expression of AtUbc2p could complement both defects in rad6Δ yeast. Knockdown of UBC2 expression in plants also decreases tombusvirus accumulation and reduces symptom severity, suggesting that Ubc2p is critical for virus replication in plants. We provide evidence that Rad6p is involved in promoting the subversion of Vps23p and Vps4p ESCRT proteins for viral replicase complex assembly. - Highlights: • Tombusvirus p33 replication protein interacts with cellular RAD6/Ubc2 E2 enzymes. • Deletion of RAD6 reduces tombusvirus replication in yeast. • Silencing of UBC2 in plants inhibits tombusvirus replication. • Mono- and bi-ubiquitination of p33 replication protein in yeast and in vitro. • Rad6p promotes the recruitment of cellular ESCRT proteins into the tombusvirus replicase.
Allosteric regulation of epigenetic modifying enzymes.
Zucconi, Beth E; Cole, Philip A
2017-08-01
Epigenetic enzymes including histone modifying enzymes are key regulators of gene expression in normal and disease processes. Many drug development strategies to target histone modifying enzymes have focused on ligands that bind to enzyme active sites, but allosteric pockets offer potentially attractive opportunities for therapeutic development. Recent biochemical studies have revealed roles for small molecule and peptide ligands binding outside of the active sites in modulating the catalytic activities of histone modifying enzymes. Here we highlight several examples of allosteric regulation of epigenetic enzymes and discuss the biological significance of these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.
DGAT enzymes and triacylglycerol biosynthesis
Yen, Chi-Liang Eric; Stone, Scot J.; Koliwad, Suneil; Harris, Charles; Farese, Robert V.
2008-01-01
Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, and the use of molecular tools, including mice deficient in either enzyme, has shed light on their functions. Although DGAT enzymes are involved in TG synthesis, they have distinct protein sequences and differ in their biochemical, cellular, and physiological functions. Both enzymes may be useful as therapeutic targets for diseases. Here we review the current knowledge of DGAT enzymes, focusing on new advances since the cloning of their genes, including possible roles in human health and diseases. PMID:18757836
de novo computational enzyme design.
Zanghellini, Alexandre
2014-10-01
Recent advances in systems and synthetic biology as well as metabolic engineering are poised to transform industrial biotechnology by allowing us to design cell factories for the sustainable production of valuable fuels and chemicals. To deliver on their promises, such cell factories, as much as their brick-and-mortar counterparts, will require appropriate catalysts, especially for classes of reactions that are not known to be catalyzed by enzymes in natural organisms. A recently developed methodology, de novo computational enzyme design can be used to create enzymes catalyzing novel reactions. Here we review the different classes of chemical reactions for which active protein catalysts have been designed as well as the results of detailed biochemical and structural characterization studies. We also discuss how combining de novo computational enzyme design with more traditional protein engineering techniques can alleviate the shortcomings of state-of-the-art computational design techniques and create novel enzymes with catalytic proficiencies on par with natural enzymes. Copyright © 2014 Elsevier Ltd. All rights reserved.
Measurement of enzyme activity.
Harris, T K; Keshwani, M M
2009-01-01
To study and understand the nature of living cells, scientists have continually employed traditional biochemical techniques aimed to fractionate and characterize a designated network of macromolecular components required to carry out a particular cellular function. At the most rudimentary level, cellular functions ultimately entail rapid chemical transformations that otherwise would not occur in the physiological environment of the cell. The term enzyme is used to singularly designate a macromolecular gene product that specifically and greatly enhances the rate of a chemical transformation. Purification and characterization of individual and collective groups of enzymes has been and will remain essential toward advancement of the molecular biological sciences; and developing and utilizing enzyme reaction assays is central to this mission. First, basic kinetic principles are described for understanding chemical reaction rates and the catalytic effects of enzymes on such rates. Then, a number of methods are described for measuring enzyme-catalyzed reaction rates, which mainly differ with regard to techniques used to detect and quantify concentration changes of given reactants or products. Finally, short commentary is given toward formulation of reaction mixtures used to measure enzyme activity. Whereas a comprehensive treatment of enzymatic reaction assays is not within the scope of this chapter, the very core principles that are presented should enable new researchers to better understand the logic and utility of any given enzymatic assay that becomes of interest.
DEFF Research Database (Denmark)
Olsen, Line; Bressendorff, Simon; Troelsen, Jesper T
2005-01-01
The intestinal alkaline phosphatase gene (ALPI) encodes a digestive brush-border enzyme, which is highly upregulated during small intestinal epithelial cell differentiation. To identify new putative promoter motifs responsible for the regulation of ALPI expression during differentiation of the en...
Transcriptional regulation of the Bacillus subtilis menp1 promoter.
Qin, X; Taber, H W
1996-01-01
The Bacillus subtilis men genes encode biosynthetic enzymes for formation of the respiratory chain component menaquinone. The menp1 promoter previously was shown to be the primary cis element for menFD gene expression. In the present work, it was found that either supplementation with nonfermentable carbon sources or reutilization of glycolytic end products increased menp1 activity in the late postexponential phase. The effect on menp1 activity by a particular end product (such as acetoin or ...
Reilly, Morgann C; Kim, Joonhoon; Lynn, Jed; Simmons, Blake A; Gladden, John M; Magnuson, Jon K; Baker, Scott E
2018-02-01
Plant biomass, once reduced to its composite sugars, can be converted to fuel substitutes. One means of overcoming the recalcitrance of lignocellulose is pretreatment followed by enzymatic hydrolysis. However, currently available commercial enzyme cocktails are inhibited in the presence of residual pretreatment chemicals. Recent studies have identified a number of cellulolytic enzymes from bacteria that are tolerant to pretreatment chemicals such as ionic liquids. The challenge now is generation of these enzymes in copious amounts, an arena where fungal organisms such as Aspergillus niger have proven efficient. Fungal host strains still need to be engineered to increase production titers of heterologous protein over native enzymes, which has been a difficult task. Here, we developed a forward genetics screen coupled with whole-genome resequencing to identify specific lesions responsible for a protein hyper-production phenotype in A. niger. This strategy successfully identified novel targets, including a low-affinity glucose transporter, MstC, whose deletion significantly improved secretion of recombinant proteins driven by a glucoamylase promoter.
Energy Technology Data Exchange (ETDEWEB)
Reilly, Morgann C. [Joint BioEnergy Institute, Emeryville, CA (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Kim, Joonhoon [Joint BioEnergy Institute, Emeryville, CA (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Lynn, Jed [Joint BioEnergy Institute, Emeryville, CA (United States); Wright-Patterson Air Force Base, Dayton, OH (United States); Simmons, Blake A. [Joint BioEnergy Institute, Emeryville, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Gladden, John M. [Joint BioEnergy Institute, Emeryville, CA (United States); Sandia National Lab. (SNL-CA), Livermore, CA (United States); Magnuson, Jon K. [Joint BioEnergy Institute, Emeryville, CA (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott E. [Joint BioEnergy Institute, Emeryville, CA (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2018-01-06
Plant biomass, once reduced to its composite sugars, can be converted to fuel substitutes. One means of overcoming the recalcitrance of lignocellulose is pretreatment followed by enzymatic hydrolysis. However, currently available commercial enzyme cocktails are inhibited in the presence of residual pretreatment chemicals. Recent studies have identified a number of cellulolytic enzymes from bacteria that are tolerant to pretreatment chemicals such as ionic liquids. The challenge now is generation of these enzymes in copious amounts, an arena where fungal organisms such as Aspergillus niger have proven efficient. Fungal host strains still need to be engineered to increase production titers of heterologous protein over native enzymes, which has been a difficult task. Here, we developed a forward genetics screen coupled with whole-genome resequencing to identify specific lesions responsible for a protein hyper-production phenotype in A. niger. This strategy successfully identified novel targets, including a low-affinity glucose transporter, MstC, whose deletion significantly improved secretion of recombinant proteins driven by a glucoamylase promoter.
Moglia, Andrea; Acquadro, Alberto; Eljounaidi, Kaouthar; Milani, Anna M.; Cagliero, Cecilia; Rubiolo, Patrizia; Genre, Andrea; Cankar, Katarina; Beekwilder, Jules; Comino, Cinzia
2016-01-01
Globe artichoke (Cynara cardunculus L. var. scolymus) is a rich source of compounds promoting human health (phytonutrients), among them caffeoylquinic acids (CQAs), mainly represented by chlorogenic acid (CGA), and dicaffeoylquinic acids (diCQAs). The enzymes involved in their biosynthesis belong
Thermodynamics of Enzyme-Catalyzed Reactions Database
SRD 74 Thermodynamics of Enzyme-Catalyzed Reactions Database (Web, free access) The Thermodynamics of Enzyme-Catalyzed Reactions Database contains thermodynamic data on enzyme-catalyzed reactions that have been recently published in the Journal of Physical and Chemical Reference Data (JPCRD). For each reaction the following information is provided: the reference for the data, the reaction studied, the name of the enzyme used and its Enzyme Commission number, the method of measurement, the data and an evaluation thereof.
Schoonen, Lise; Nolte, Roeland J. M.; van Hest, Jan C. M.
2016-07-01
The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions.The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions. Electronic supplementary information (ESI) available: Experimental procedures for the cloning, expression, and purification of all proteins, as well as supplementary figures and calculations. See DOI: 10.1039/c6nr04181g
International Nuclear Information System (INIS)
Dickinson, D.B.
1975-01-01
Enzymes and metabolic pathways, by which starch and cell wall polysaccharides are formed, were investigated in order to learn how these processes are regulated and to identify the enzymatic regulatory mechanisms involved. Germinating lily pollen was used for studies of cell wall formation, and pollen and maize endosperm for studies of starch biosynthesis. Hexokinase being the first step in conversion of hexoses to starch, wall polysaccharides and respiratory substrates, maize endosperm enzyme was assayed by its conversion of 14 C-hexose to 14 C-hexose-6-P, and rapid separation of the two labelled compounds on anion-exchange paper. This enzyme did not appear to be under tight regulation by feed-back inhibition or activation, nor to be severely inhibited by glucose-6-P or activated by citrate. ADP-glucose pyrophosphorylase and other pyrophosphorylases were assayed radiochemically with 14 C-glucose-1-P (forward direction) or 32-PPsub(i) (reverse direction). They showed that the maize endosperm enzyme was activated by the glycolytic intermediates fructose-6-P and 3-phosphoglycerate, and that low levels of the enzyme were present in the high sucrose-low starch mutant named shrunken-2. Under optimal in-vitro assay conditions, the pollen enzyme reacted four times faster than the observed in-vivo rate of starch accumulation. Biogenesis of plant cell wall polysaccharides requires the conversion of hexose phosphates to various sugar nucleotides and utilization of the latter by the appropriate polysaccharide synthetases. Lily pollen possesses a β-1,3-glucan synthetase which is activated up to six-fold by β-linked oligosaccharides. Hence, the in-vivo activity of this enzyme may be modulated by such effector molecules
Chen, Hui; Huang, Rui; Zhang, Y-H Percival
2017-06-01
The precise control of multiple heterologous enzyme expression levels in one Escherichia coli strain is important for cascade biocatalysis, metabolic engineering, synthetic biology, natural product synthesis, and studies of complexed proteins. We systematically investigated the co-expression of up to four thermophilic enzymes (i.e., α-glucan phosphorylase (αGP), phosphoglucomutase (PGM), glucose 6-phosphate dehydrogenase (G6PDH), and 6-phosphogluconate dehydrogenase (6PGDH)) in E. coli BL21(DE3) by adding T7 promoter or T7 terminator of each gene for multiple genes in tandem, changing gene alignment, and comparing one or two plasmid systems. It was found that the addition of T7 terminator after each gene was useful to decrease the influence of the upstream gene. The co-expression of the four enzymes in E. coli BL21(DE3) was demonstrated to generate two NADPH molecules from one glucose unit of maltodextrin, where NADPH was oxidized to convert xylose to xylitol. The best four-gene co-expression system was based on two plasmids (pET and pACYC) which harbored two genes. As a result, apparent enzymatic activities of the four enzymes were regulated to be at similar levels and the overall four-enzyme activity was the highest based on the formation of xylitol. This study provides useful information for the precise control of multi-enzyme-coordinated expression in E. coli BL21(DE3).
DNA-Based Enzyme Reactors and Systems
Directory of Open Access Journals (Sweden)
Veikko Linko
2016-07-01
Full Text Available During recent years, the possibility to create custom biocompatible nanoshapes using DNA as a building material has rapidly emerged. Further, these rationally designed DNA structures could be exploited in positioning pivotal molecules, such as enzymes, with nanometer-level precision. This feature could be used in the fabrication of artificial biochemical machinery that is able to mimic the complex reactions found in living cells. Currently, DNA-enzyme hybrids can be used to control (multi-enzyme cascade reactions and to regulate the enzyme functions and the reaction pathways. Moreover, sophisticated DNA structures can be utilized in encapsulating active enzymes and delivering the molecular cargo into cells. In this review, we focus on the latest enzyme systems based on novel DNA nanostructures: enzyme reactors, regulatory devices and carriers that can find uses in various biotechnological and nanomedical applications.
Georlette, D.; Bentahir, M.; Claverie, P.; Collins, T.; D'amico, S.; Delille, D.; Feller, G.; Gratia, E.; Hoyoux, A.; Lonhienne, T.; Meuwis, M.-a.; Zecchinon, L.; Gerday, Ch.
In the last few years, increased attention has been focused on enzymes produced by cold-adapted micro-organisms. It has emerged that psychrophilic enzymes represent an extremely powerful tool in both protein folding investigations and for biotechnological purposes. Such enzymes are characterised by an increased thermosensitivity and, most of them, by a higher catalytic efficiency at low and moderate temperatures, when compared to their mesophilic counterparts. The high thermosensitivity probably originates from an increased flexibility of either a selected area of the molecular edifice or the overall protein structure, providing enhanced abilities to undergo conformational changes during catalysis at low temperatures. Structure modelling and recent crystallographic data have allowed to elucidate the structural parameters that could be involved in this higher resilience. It was demonstrated that each psychrophilic enzyme adopts its own adaptive strategy. It appears, moreover, that there is a continuum in the strategy of protein adaptation to temperature, as the previously mentioned structural parameters are implicated in the stability of thermophilic proteins. Additional 3D crystal structures, site-directed and random mutagenesis experiments should now be undertaken to further investigate the stability-flexibility-activity relationship.
2009 Cellulosomes, Cellulases & Other Carbohydrate Modifying Enzymes GRC
Energy Technology Data Exchange (ETDEWEB)
Gilbert, Harry [Univ. of Newcastle, Callaghan, NSW (Australia)
2009-07-26
The 2009 Gordon Conference on Cellulosomes, Cellulases & Other Carbohydrate Modifying Enzymes will present cutting-edge research on the enzymatic degradation of cellulose and other plant cell wall polysaccharides. The Conference will feature a wide range of topics that includes the enzymology of plant structural degradation, regulation of the degradative apparatus, the mechanism of protein complex assembly, the genomics of cell wall degrading organisms, the structure of the substrate and the industrial application of the process particularly within the biofuel arena. Indeed the deployment of plant cell wall degrading enzymes in biofuel processes will be an important feature of the meeting. It should be emphasized that the 2009 Conference will be expanded to include, in addition to cellulase research, recent advances in other plant cell wall degrading enzymes, and contributions from people working on hemicellulases and pectinases will be particularly welcome. Invited speakers represent a variety of scientific disciplines, including biochemistry, structural biology, genetics and cell biology. The interplay between fundamental research and its industrial exploitation is a particularly important aspect of the meeting, reflecting the appointment of the chair and vice-chair from academia and industry, respectively. The meeting will provide opportunities for junior scientists and graduate students to present their work in poster format and exchange ideas with more established figures in the field. Indeed, some poster presenters will be selected for short talks. The collegial atmosphere of this Conference, with programmed discussion sessions as well as opportunities for informal gatherings in the afternoons and evenings, provides an avenue for scientists from different disciplines to brainstorm and promotes cross-disciplinary collaborations in the various research areas represented. The Conference is likely to be heavily subscribed so we would recommend that you submit
Enzyme Engineering for In Situ Immobilization.
Rehm, Fabian B H; Chen, Shuxiong; Rehm, Bernd H A
2016-10-14
Enzymes are used as biocatalysts in a vast range of industrial applications. Immobilization of enzymes to solid supports or their self-assembly into insoluble particles enhances their applicability by strongly improving properties such as stability in changing environments, re-usability and applicability in continuous biocatalytic processes. The possibility of co-immobilizing various functionally related enzymes involved in multistep synthesis, conversion or degradation reactions enables the design of multifunctional biocatalyst with enhanced performance compared to their soluble counterparts. This review provides a brief overview of up-to-date in vitro immobilization strategies while focusing on recent advances in enzyme engineering towards in situ self-assembly into insoluble particles. In situ self-assembly approaches include the bioengineering of bacteria to abundantly form enzymatically active inclusion bodies such as enzyme inclusions or enzyme-coated polyhydroxyalkanoate granules. These one-step production strategies for immobilized enzymes avoid prefabrication of the carrier as well as chemical cross-linking or attachment to a support material while the controlled oriented display strongly enhances the fraction of accessible catalytic sites and hence functional enzymes.
[The rise of enzyme engineering in China].
Li, Gaoxiang
2015-06-01
Enzyme engineering is an important part of the modern biotechnology. Industrial biocatalysis is considered the third wave of biotechnology following pharmaceutical and agricultural waves. In 25 years, China has made a mighty advances in enzyme engineering research. This review focuses on enzyme genomics, enzyme proteomics, biosynthesis, microbial conversion and biosensors in the Chinese enzyme engineering symposiums and advances in enzyme preparation industry in China.
Park, Yoon Mee; Lee, Hwa Jeong; Jeong, Jae-Ho; Kook, Joong-Ki; Choy, Hyon E; Hahn, Tae-Wook; Bang, Iel Soo
2015-12-01
Nitric oxide (NO) inactivates iron-sulfur enzymes in bacterial amino acid biosynthetic pathways, causing amino acid auxotrophy. We demonstrate that exogenous supplementation with branched-chain amino acids (BCAA) can restore the NO resistance of hmp mutant Salmonella Typhimurium lacking principal NO-metabolizing enzyme flavohemoglobin, and of mutants further lacking iron-sulfur enzymes dihydroxy-acid dehydratase (IlvD) and isopropylmalate isomerase (LeuCD) that are essential for BCAA biosynthesis, in an oxygen-dependent manner. BCAA supplementation did not affect the NO consumption rate of S. Typhimurium, suggesting the BCAA-promoted NO resistance independent of NO metabolism. BCAA supplementation also induced intracellular survival of ilvD and leuCD mutants at wild-type levels inside RAW 264.7 macrophages that produce constant amounts of NO regardless of varied supplemental BCAA concentrations. Our results suggest that the NO-induced BCAA auxotrophy of Salmonella, due to inactivation of iron-sulfur enzymes for BCAA biosynthesis, could be rescued by bacterial taking up exogenous BCAA available in oxic environments.
Enzyme structure and interaction with inhibitors
International Nuclear Information System (INIS)
London, R.E.
1983-01-01
This article reviews some of the results of studies on the 13 C-labeled enzyme dihydrofolate reductase (DHFR). Nuclear magnetic resonance (NMR) techniques are used in combination with isotopic labeling to learn about the structure and dynamics of this enzyme. 13 C-labeling is used for the purpose of studying enzyme/substrate and enzyme/inhibitor interactions. A second set of studies with DHFR was designed to investigate the basis for the high affinity between the inhibitor methotrexate and DHFR. The label was placed on the inhibitor, rather than the enzyme
Positron emitter labeled enzyme inhibitors
International Nuclear Information System (INIS)
Fowler, J.S.; MacGregor, R.R.; Wolf, A.P.; Langstrom, B.
1990-01-01
This invention involves a new strategy for imagining and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography
Compounds from silicones alter enzyme activity in curing barnacle glue and model enzymes.
Rittschof, Daniel; Orihuela, Beatriz; Harder, Tilmann; Stafslien, Shane; Chisholm, Bret; Dickinson, Gary H
2011-02-17
Attachment strength of fouling organisms on silicone coatings is low. We hypothesized that low attachment strength on silicones is, in part, due to the interaction of surface available components with natural glues. Components could alter curing of glues through bulk changes or specifically through altered enzyme activity. GC-MS analysis of silicone coatings showed surface-available siloxanes when the coatings were gently rubbed with a cotton swab for 15 seconds or given a 30 second rinse with methanol. Mixtures of compounds were found on 2 commercial and 8 model silicone coatings. The hypothesis that silicone components alter glue curing enzymes was tested with curing barnacle glue and with commercial enzymes. In our model, barnacle glue curing involves trypsin-like serine protease(s), which activate enzymes and structural proteins, and a transglutaminase which cross-links glue proteins. Transglutaminase activity was significantly altered upon exposure of curing glue from individual barnacles to silicone eluates. Activity of purified trypsin and, to a greater extent, transglutaminase was significantly altered by relevant concentrations of silicone polymer constituents. Surface-associated silicone compounds can disrupt glue curing and alter enzyme properties. Altered curing of natural glues has potential in fouling management.
Prediction of Wild-type Enzyme Characteristics
DEFF Research Database (Denmark)
Geertz-Hansen, Henrik Marcus
of biotechnology, including enzyme discovery and characterization. This work presents two articles on sequence-based discovery and functional annotation of enzymes in environmental samples, and two articles on analysis and prediction of enzyme thermostability and cofactor requirements. The first article presents...... a sequence-based approach to discovery of proteolytic enzymes in metagenomes obtained from the Polar oceans. We show that microorganisms living in these extreme environments of constant low temperature harbour genes encoding novel proteolytic enzymes with potential industrial relevance. The second article...... presents a web server for the processing and annotation of functional metagenomics sequencing data, tailored to meet the requirements of non-bioinformaticians. The third article presents analyses of the molecular determinants of enzyme thermostability, and a feature-based prediction method of the melting...
Therapeutic Enzymes: Applications and Approaches to Pharmacological Improvement.
Yari, Maryam; Ghoshoon, Mohammad B; Vakili, Bahareh; Ghasemi, Younes
2017-01-01
Among therapeutic proteins, enzymes represent small and of course profitable market. They can be used to treat important, rare, and deadly diseases. Enzyme therapy is the only available treatment for certain disorders. Here, pharmaceutical enzymes are reviewed. They are categorized in four main groups, enzymes in replacement therapy, enzymes in cancer treatment, enzymes for fibrinolysis, and finally enzymes that are used topically for various treatments. Furthermore, enzyme gene therapy and future perspective of therapeutic enzymes are mentioned in brief. There are many important approved enzymes in pharmaceutical market. Several approaches such as point mutation, fusion protein designing, glycoengineering, and PEGylation were used to achieve improved enzymes. Although sometimes enzymes were engineered to facilitate production and purification process, appropriate delivery to target sites, extending half-life, and reducing immunogenicity are among the main goals of engineering approaches. Overall, enzymes play a critical role in treatment of common and rare diseases. Evaluation of new enzymes as well as improvement of approved enzymes are of the most important challenges in biotechnology. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Directory of Open Access Journals (Sweden)
Edivaldo Domingues Velini
2005-01-01
Full Text Available This work was aimed at locating Eucalyptus ESTs corresponding to the PROTOX or PPO enzyme (Protoporphyrinogen IX oxidase, E.C. 1.3.3.4 directly related to resistance to herbicides that promote oxidative stress, changing the functionality of this enzyme. PROTOX, which is the site of action of diphenyl-ether (oxyfluorfen, lactofen, fomesafen, oxadiazole (oxadiazon and oxadiargyl, and aryl triazolinone (sulfentrazone and carfentrazone herbicides, acts on the synthesis route of porphyrins which is associated with the production of chlorophyll a, catalases, and peroxidases. One cluster and one single read were located, with e-values better than e-70, associated to PROTOX. The alignment results between amino acid sequences indicated that this enzyme is adequately represented in the ESTs database of the FORESTs project.
International Nuclear Information System (INIS)
Besanger, Travis R.; Hodgson, Richard J.; Green, James R.A.; Brennan, John D.
2006-01-01
Our group recently reported on the application of protein-doped monolithic silica columns for immobilized enzyme reactor chromatography, which allowed screening of enzyme inhibitors present in mixtures using mass spectrometry for detection. The enzyme was immobilized by entrapment within a bimodal meso/macroporous silica material prepared by a biocompatible sol-gel processing route. While such columns proved to be useful for applications such as screening of protein-ligand interactions, significant amounts of entrapped proteins leached from the columns owing to the high proportion of macropores within the materials. Herein, we describe a detailed study of factors affecting the morphology of protein-doped bioaffinity columns and demonstrate that specific pH values and concentrations of poly(ethylene glycol) can be used to prepare essentially mesoporous columns that retain over 80% of initially loaded enzyme in an active and accessible form and yet still retain sufficient porosity to allow pressure-driven flow in the low μL/min range. Using the enzyme γ-glutamyl transpeptidase (γ-GT), we further evaluated the catalytic constants of the enzyme entrapped in capillary columns with different silica morphologies as a function of flowrate and backpressure using the enzyme reactor assay mode. It was found that the apparent activity of the enzyme was highest in mesoporous columns that retained high levels of enzyme. In such columns, enzyme activity increased by ∼2-fold with increases in both flowrate (from 250 to 1000 nL/min) and backpressure generated (from 500 to 2100 psi) during the chromatographic activity assay owing to increases in k cat and decreases in K M , switching from diffusion controlled to reaction controlled conditions at ca. 2000 psi. These results suggest that columns with minimal macropore volumes (<5%) are advantageous for the entrapment of soluble proteins for bioaffinity and bioreactor chromatography
Rhodotorula glutinis-potential source of lipids, carotenoids, and enzymes for use in industries.
Kot, Anna M; Błażejak, Stanisław; Kurcz, Agnieszka; Gientka, Iwona; Kieliszek, Marek
2016-07-01
Rhodotorula glutinis is capable of synthesizing numerous valuable compounds with a wide industrial usage. Biomass of this yeast constitutes sources of microbiological oils, and the whole pool of fatty acids is dominated by oleic, linoleic, and palmitic acid. Due to its composition, the lipids may be useful as a source for the production of the so-called third-generation biodiesel. These yeasts are also capable of synthesizing carotenoids such as β-carotene, torulene, and torularhodin. Due to their health-promoting characteristics, carotenoids are commonly used in the cosmetic, pharmaceutical, and food industries. They are also used as additives in fodders for livestock, fish, and crustaceans. A significant characteristic of R. glutinis is its capability to produce numerous enzymes, in particular, phenylalanine ammonia lyase (PAL). This enzyme is used in the food industry in the production of L-phenylalanine that constitutes the substrate for the synthesis of aspartame-a sweetener commonly used in the food industry.
Zhang, Yin-Jie; Dai, Yuan; Hu, Yong; Ma, Yun-Tong; Xu, Shi-Jun; Wang, Yong-Yan
2013-09-01
To study the effect of Tongluo Xingnao effervescent tablet on learning and memory of dementia rats induced by injection of Abeta25-35 in hippocampus and expression of insulin-degrading enzyme in hippocampus, in order to provide basis for preventing and treating senile dementia. The dementia rat model was established by injecting Abeta25-35 in hippocampus. The rats were divided into the model control group, the Aricept (1.4 mg x kg(-1)) group, and Tongluo Xingnao effervescent tablet high dose (7.56 g x kg(-1)), middle dose (3.78 g x kg(-1)) and low dose (1.59 g x kg(-1)) groups. A sham operation group was established by injecting normal saline in hippocampus. The rats were orally given drugs for 90 days, once a day. Their learning and memory were tested by using Morris water maze. Immunohistochemistry and image analysis were utilized for a quantitative analysis on the expression of insulin-degrading enzyme in hippocampus. Tongluo Xingnao effervescent tablet could significantly shorten the escape latency of rats in the directional navigation test, prolong the retention time in the first quadrant dwell, decrease the retention time in the third quadrant dwell, increase the frequency of crossing the platform, show a more notable statistical significance than the model control group (P tablet has the effects of improving learning and memory capacity of AD rats and promoting the expression of insulin-degrading enzyme in hippocampus. Its effect in promoting intelligence will be related to increased insulin-degrading enzyme in hippocampus.
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
Energy Technology Data Exchange (ETDEWEB)
Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)
2012-07-06
Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
International Nuclear Information System (INIS)
Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi
2012-01-01
Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the
Toward mechanistic classification of enzyme functions.
Almonacid, Daniel E; Babbitt, Patricia C
2011-06-01
Classification of enzyme function should be quantitative, computationally accessible, and informed by sequences and structures to enable use of genomic information for functional inference and other applications. Large-scale studies have established that divergently evolved enzymes share conserved elements of structure and common mechanistic steps and that convergently evolved enzymes often converge to similar mechanisms too, suggesting that reaction mechanisms could be used to develop finer-grained functional descriptions than provided by the Enzyme Commission (EC) system currently in use. Here we describe how evolution informs these structure-function mappings and review the databases that store mechanisms of enzyme reactions along with recent developments to measure ligand and mechanistic similarities. Together, these provide a foundation for new classifications of enzyme function. Copyright © 2011 Elsevier Ltd. All rights reserved.
Production of Enzymes from Marine Actinobacteria.
Zhao, X Q; Xu, X N; Chen, L Y
Marine actinobacteria are well recognized for their capabilities to produce valuable natural products, which have great potential for applications in medical, agricultural, and fine chemical industries. In addition to producing unique enzymes responsible for biosynthesis of natural products, many marine actinobacteria also produce hydrolytic enzymes which are able to degrade various biopolymers, such as cellulose, xylan, and chitin. These enzymes are important to produce biofuels and biochemicals of interest from renewable biomass. In this chapter, the recent reports of novel enzymes produced by marine actinobacteria are reviewed, and advanced technologies that can be applied to search for novel marine enzymes as well as for improved enzyme production by marine actinobacteria are summarized, which include ribosome engineering, genome mining, as well as synthetic biology studies. © 2016 Elsevier Inc. All rights reserved.
Zymography methods for visualizing hydrolytic enzymes
Vandooren, Jennifer; Geurts, Nathalie; Martens, Erik; Van den Steen, Philippe E.; Opdenakker, Ghislain
2013-01-01
Zymography is a technique for studying hydrolytic enzymes on the basis of substrate degradation. It is a powerful., but often misinterpreted, tool. yielding information on potential. hydrolytic activities, enzyme forms and the locations of active enzymes. In this Review, zymography techniques are compared in terms of advantages, limitations and interpretations. With in gel zymography, enzyme forms are visualized according to their molecular weights. Proteolytic activities are localized in tis...
Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes
Energy Technology Data Exchange (ETDEWEB)
Hong, J. S.; Kim, D.H.
1981-01-01
Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.
DEFF Research Database (Denmark)
Andrade Santacoloma, Paloma de Gracia
are affected (in a positive or negative way) by the presence of the other enzymes and compounds in the media. In this thesis the concept of multi-enzyme in-pot term is adopted for processes that are carried out by the combination of enzymes in a single reactor and implemented at pilot or industrial scale...... features of the process and provides the information required to structure the process model by using a step-by-step procedure with the required tools and methods. In this way, this framework increases efficiency of the model development process with respect to time and resources needed (fast and effective....... In this way the model parameters that drives the main dynamic behavior can be identified and thus a better understanding of this type of processes. In order to develop, test and verify the methodology, three case studies were selected, specifically the bi-enzyme process for the production of lactobionic acid...
Photoperiodism and Enzyme Activity
Queiroz, Orlando; Morel, Claudine
1974-01-01
Metabolic readjustments after a change from long days to short days appear, in Kalanchoe blossfeldiana, to be achieved through the operation of two main mechanisms: variation in enzyme capacity, and circadian rhythmicity. After a lag time, capacity in phosphoenolpyruvate carboxylase and capacity in aspartate aminotransferase increase exponentially and appear to be allometrically linked during 50 to 60 short days; then a sudden fall takes place in the activity of the former. Malic enzyme and alanine aminotransferase behave differently. Thus, the operation of the two sections of the pathway (before and after the malate step) give rise to a continuously changing functional compartmentation in the pathway. Circadian rhythmicity, on the other hand, produces time compartmentation through phase shifts and variation in amplitude, independently for each enzyme. These characteristics suggest that the operation of a so-called biological clock would be involved. We propose the hypothesis that feedback regulation would be more accurate and efficient when applied to an already oscillating, clock-controlled enzyme system. PMID:16658749
DEFF Research Database (Denmark)
Baum, Andreas
the understanding of the structural properties of the extracted pectin. Secondly, enzyme kinetics of biomass converting enzymes was examined in terms of measuring enzyme activity by spectral evolution profiling utilizing FTIR. Chemometric multiway methods were used to analyze the tensor datasets enabling the second......-order calibration advantage (reference Theory of Analytical chemistry). As PAPER 3 illustrates the method is universally applicable without the need of any external standards and was exemplified by performing quantitative enzyme activity determinations for glucose oxidase, pectin lyase and a cellolytic enzyme blend...... (Celluclast 1.5L). In PAPER 4, the concept is extended to quantify enzyme activity of two simultaneously acting enzymes, namely pectin lyase and pectin methyl esterase. By doing so the multiway methods PARAFAC, TUCKER3 and NPLS were compared and evaluated towards accuracy and precision....
Liu, Lin; Lee, Wang-Sik; Doray, Balraj; Kornfeld, Stuart
2017-06-16
Several lysosomal enzymes currently used for enzyme replacement therapy in patients with lysosomal storage diseases contain very low levels of mannose 6-phosphate, limiting their uptake via mannose 6-phosphate receptors on the surface of the deficient cells. These enzymes are produced at high levels by mammalian cells and depend on endogenous GlcNAc-1-phosphotransferase α/β precursor to phosphorylate the mannose residues on their glycan chains. We show that co-expression of an engineered truncated GlcNAc-1-phosphotransferase α/β precursor and the lysosomal enzyme of interest in the producing cells resulted in markedly increased phosphorylation and cellular uptake of the secreted lysosomal enzyme. This method also results in the production of highly phosphorylated acid β-glucocerebrosidase, a lysosomal enzyme that normally has just trace amounts of this modification.
Serdemetan antagonizes the Mdm2-HIF1α axis leading to decreased levels of glycolytic enzymes.
Directory of Open Access Journals (Sweden)
Jason A Lehman
Full Text Available Serdemetan (JNJ-26854165, an antagonist to Mdm2, was anticipated to promote the activation of p53. While regulation of p53 by Mdm2 is important, Mdm2 also regulates numerous proteins involved in diverse cellular functions. We investigated if Serdemetan would alter the Mdm2-HIF1α axis and affect cell survival in human glioblastoma cells independently of p53. Treatment of cells with Serdemetan under hypoxia resulted in a decrease in HIF1α levels. HIF1α downstream targets, VEGF and the glycolytic enzymes (enolase, phosphoglycerate kinase1/2, and glucose transporter 1, were all decreased in response to Serdemetan. The involvement of Mdm2 in regulating gene expression of glycolytic enzymes raises the possibility of side effects associated with therapeutically targeting Mdm2.
Evaluation of pressure tuning of enzymes
DEFF Research Database (Denmark)
Naghshineh, Mahsa
and high energy consumption. Therefore, searching for an environmentally friendly method of pectin extraction is a task for science and industry. Employment of hydrolytic enzymes may represent a green approach to obtain intact pectin polymer. However, the low stability/activity of enzymes, and low polymer...... yield of enzymatic extraction limits the application of enzyme in pectin production. There is evidence that emerging technology of high hydrostatic pressure processing can result in stabilization and activation of some enzymes. Therefore, the use of high hydrostatic pressure in combination with enzyme...... (cellulase/xylanase: 50/0, 50/25, 50/50, 25/50, and 0/50 U/g lime peel) at ambient pressure, 100 and 200 MPa were used to extract pectin from dried lime peel waste. It was found that pressure level, type and concentration of enzyme significantly influenced pectin yield and degree of esterification (DE...
Photoreactivating enzyme from Escherichia coli
International Nuclear Information System (INIS)
Snapka, R.M.; Fuselier, C.O.
1977-01-01
Escherichia coli photoreactivating enzyme (PRE) has been purified in large amounts from an E.coli strain lysogenic for a defective lambda bacteriophage carrying the phr gene. The resulting enzyme had a pH optimum of 7.2 and an ionic strength optimum of 0.18. It consisted of an apoprotein and cofactor, both of which were necessary for catalytic activity. The apoprotein had a monomer molecular weight of 35,200 and showed stable aggregates under denaturing conditions. The amino acid analysis of the E.coli enzyme was very similar to that of the photoreactivating enzyme from orchid seedlings (Cattelya aurantiaca). Both had arginine at the amino terminus. The cofactor, like the holoenzyme, showed absorption, magnetic circular dichroism, and emission properties indicative of an adenine moiety. Although the isolated enzyme had an action spectrum which peaked at about 360 nm, neither the cofactor, apoenzyme nor holoenzyme showed any detectable absorption between 300 and 400 nm. (author)
Practical steady-state enzyme kinetics.
Lorsch, Jon R
2014-01-01
Enzymes are key components of most biological processes. Characterization of enzymes is therefore frequently required during the study of biological systems. Steady-state kinetics provides a simple and rapid means of assessing the substrate specificity of an enzyme. When combined with site-directed mutagenesis (see Site-Directed Mutagenesis), it can be used to probe the roles of particular amino acids in the enzyme in substrate recognition and catalysis. Effects of interaction partners and posttranslational modifications can also be assessed using steady-state kinetics. This overview explains the general principles of steady-state enzyme kinetics experiments in a practical, rather than theoretical, way. Any biochemistry textbook will have a section on the theory of Michaelis-Menten kinetics, including derivations of the relevant equations. No specific enzymatic assay is described here, although a method for monitoring product formation or substrate consumption over time (an assay) is required to perform the experiments described. © 2014 Elsevier Inc. All rights reserved.
Photoreactivating enzyme from Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Snapka, R M; Fuselier, C O [California Univ., Irvine (USA)
1977-05-01
Escherichia coli photoreactivating enzyme (PRE) has been purified in large amounts from an E.coli strain lysogenic for a defective lambda bacteriophage carrying the phr gene. The resulting enzyme had a pH optimum of 7.2 and an ionic strength optimum of 0.18. It consisted of an apoprotein and cofactor, both of which were necessary for catalytic activity. The apoprotein had a monomer molecular weight of 35,200 and showed stable aggregates under denaturing conditions. The amino acid analysis of the E.coli enzyme was very similar to that of the photoreactivating enzyme from orchid seedlings (Cattelya aurantiaca). Both had arginine at the amino terminus. The cofactor, like the holoenzyme, showed absorption, magnetic circular dichroism, and emission properties indicative of an adenine moiety. Although the isolated enzyme had an action spectrum which peaked at about 360 nm, neither the cofactor, apoenzyme nor holoenzyme showed any detectable absorption between 300 and 400 nm.
Enzymes for Enhanced Oil Recovery (EOR)
Energy Technology Data Exchange (ETDEWEB)
Nasiri, Hamidreza
2011-04-15
Primary oil recovery by reservoir pressure depletion and secondary oil recovery by waterflooding usually result in poor displacement efficiency. As a consequence there is always some trapped oil remaining in oil reservoirs. Oil entrapment is a result of complex interactions between viscous, gravity and capillary forces. Improving recovery from hydrocarbon fields typically involves altering the relative importance of the viscous and capillary forces. The potential of many EOR methods depends on their influence on fluid/rock interactions related to wettability and fluid/fluid interactions reflected in IFT. If the method has the potential to change the interactions favorably, it may be considered for further investigation, i.e. core flooding experiment, pilot and reservoir implementation. Enzyme-proteins can be introduced as an enhanced oil recovery method to improve waterflood performance by affecting interactions at the oil-water-rock interfaces. An important part of this thesis was to investigate how selected enzymes may influence wettability and capillary forces in a crude oil-brine-rock system, and thus possibly contribute to enhanced oil recovery. To investigate further by which mechanisms selected enzyme-proteins may contribute to enhance oil recovery, groups of enzymes with different properties and catalytic functions, known to be interfacially active, were chosen to cover a wide range of possible effects. These groups include (1) Greenzyme (GZ) which is a commercial EOR enzyme and consists of enzymes and stabilizers (surfactants), (2) The Zonase group consists of two types of pure enzyme, Zonase1 and Zonase2 which are protease enzymes and whose catalytic functions are to hydrolyze (breakdown) peptide bonds, (3) The Novozyme (NZ) group consists of three types of pure enzyme, NZ2, NZ3 and NZ6 which are esterase enzymes and whose catalytic functions are to hydrolyze ester bonds, and (4) Alpha-Lactalbumin ( -La) which is an important whey protein. The effect of
Leoni, L; Ciervo, A; Orsi, N; Visca, P
1996-01-01
The pvdA gene, encoding the enzyme L-ornithine N5-oxygenase, catalyzes a key step of the pyoverdin biosynthetic pathway in Pseudomonas aeruginosa. Expression studies with a promoter probe vector made it possible to identify three tightly iron-regulated promoter regions in the 5.9-kb DNA fragment upstream of pvdA. The promoter governing pvdA expression was located within the 154-bp sequence upstream of the pvdA translation start site. RNA analysis showed that expression of PvdA is iron regulat...
PPARγ transcriptionally regulates the expression of insulin-degrading enzyme in primary neurons
International Nuclear Information System (INIS)
Du, Jing; Zhang, Lang; Liu, Shubo; Zhang, Chi; Huang, Xiuqing; Li, Jian; Zhao, Nanming; Wang, Zhao
2009-01-01
Insulin-degrading enzyme (IDE) is a protease that has been demonstrated to play a key role in degrading both Aβ and insulin and deficient in IDE function is associated with Alzheimer's disease (AD) and type 2 diabetes mellitus (DM2) pathology. However, little is known about the cellular and molecular regulation of IDE expression. Here we show IDE levels are markedly decreased in DM2 patients and positively correlated with the peroxisome proliferator-activated receptor γ (PPARγ) levels. Further studies show that PPARγ plays an important role in regulating IDE expression in rat primary neurons through binding to a functional peroxisome proliferator-response element (PPRE) in IDE promoter and promoting IDE gene transcription. Finally, we demonstrate that PPARγ participates in the insulin-induced IDE expression in neurons. These results suggest that PPARγ transcriptionally induces IDE expression which provides a novel mechanism for the use of PPARγ agonists in both DM2 and AD therapies.
Directory of Open Access Journals (Sweden)
sima Hashemipour
2014-01-01
Full Text Available Background : Changes of serum minerals and vitamin D have been reported in anticonvulsant drugs user patients. The present study aimed at comparing the changes of serum minerals and vitamin D among two groups of enzyme-inducing and non enzyme-inducing anticonvulsant drug users. Methods: In this study 22 patients treated with enzyme-inducing drugs (carbamazepin, phenytoin, phenobarbital were compared to 25 patients of matched sex, age, and BMI treated with non enzyme-inducing drugs (sodium evaporate, lamotrigine. Serum calcium, phosphate, parathormone, and 25-hydroxy vitamin D were calculated in both groups. Calcium was measured by Calorimetery method. Parathormone and vitamin D were measured using ELISA method. Results: The mean serum vitamin D level was lower in enzyme-inducing than non enzyme-inducing drugs users (15.9±8.3 and 24.2±14.8, P=0.02. Frequency of vitamin D deficiency was higher in enzyme-inducing compared to non enzyme-inducing drugs users, 84% and 48% , respectively (P=0.016. The mean serum calcium level was significantly lower in enzyme-inducing drugs users. (8.7±0.2 vs. 9.0± 0.7, p= 0.05. Four percent in enzyme-inducing group compared to twenty four percent of non enzyme-inducing group had secondary hyperparathyroidism (P=0.016. Conclusion: While vitamin D deficiency is more frequent in enzyme-inducing drug users, secondary hyperparathyroidism is less frequent.
Directory of Open Access Journals (Sweden)
Joshua T Schiffer
Full Text Available Most chronic viral infections are managed with small molecule therapies that inhibit replication but are not curative because non-replicating viral forms can persist despite decades of suppressive treatment. There are therefore numerous strategies in development to eradicate all non-replicating viruses from the body. We are currently engineering DNA cleavage enzymes that specifically target hepatitis B virus covalently closed circular DNA (HBV cccDNA, the episomal form of the virus that persists despite potent antiviral therapies. DNA cleavage enzymes, including homing endonucleases or meganucleases, zinc-finger nucleases (ZFNs, TAL effector nucleases (TALENs, and CRISPR-associated system 9 (Cas9 proteins, can disrupt specific regions of viral DNA. Because DNA repair is error prone, the virus can be neutralized after repeated cleavage events when a target sequence becomes mutated. DNA cleavage enzymes will be delivered as genes within viral vectors that enter hepatocytes. Here we develop mathematical models that describe the delivery and intracellular activity of DNA cleavage enzymes. Model simulations predict that high vector to target cell ratio, limited removal of delivery vectors by humoral immunity, and avid binding between enzyme and its DNA target will promote the highest level of cccDNA disruption. Development of de novo resistance to cleavage enzymes may occur if DNA cleavage and error prone repair does not render the viral episome replication incompetent: our model predicts that concurrent delivery of multiple enzymes which target different vital cccDNA regions, or sequential delivery of different enzymes, are both potentially useful strategies for avoiding multi-enzyme resistance. The underlying dynamics of cccDNA persistence are unlikely to impact the probability of cure provided that antiviral therapy is given concurrently during eradication trials. We conclude by describing experiments that can be used to validate the model, which
Papaleo, Elena; Tiberti, Matteo; Invernizzi, Gaetano; Pasi, Marco; Ranzani, Valeria
2011-11-01
The identification of molecular mechanisms underlying enzyme cold adaptation is a hot-topic both for fundamental research and industrial applications. In the present contribution, we review the last decades of structural computational investigations on cold-adapted enzymes in comparison to their warm-adapted counterparts. Comparative sequence and structural studies allow the definition of a multitude of adaptation strategies. Different enzymes carried out diverse mechanisms to adapt to low temperatures, so that a general theory for enzyme cold adaptation cannot be formulated. However, some common features can be traced in dynamic and flexibility properties of these enzymes, as well as in their intra- and inter-molecular interaction networks. Interestingly, the current data suggest that a family-centered point of view is necessary in the comparative analyses of cold- and warm-adapted enzymes. In fact, enzymes belonging to the same family or superfamily, thus sharing at least the three-dimensional fold and common features of the functional sites, have evolved similar structural and dynamic patterns to overcome the detrimental effects of low temperatures.
Merz, Michael; Eisele, Thomas; Berends, Pieter; Appel, Daniel; Rabe, Swen; Blank, Imre; Stressler, Timo; Fischer, Lutz
2015-06-17
Flavourzyme is sold as a peptidase preparation from Aspergillus oryzae. The enzyme preparation is widely and diversely used for protein hydrolysis in industrial and research applications. However, detailed information about the composition of this mixture is still missing due to the complexity. The present study identified eight key enzymes by mass spectrometry and partially by activity staining on native polyacrylamide gels or gel zymography. The eight enzymes identified were two aminopeptidases, two dipeptidyl peptidases, three endopeptidases, and one α-amylase from the A. oryzae strain ATCC 42149/RIB 40 (yellow koji mold). Various specific marker substrates for these Flavourzyme enzymes were ascertained. An automated, time-saving nine-step protocol for the purification of all eight enzymes within 7 h was designed. Finally, the purified Flavourzyme enzymes were biochemically characterized with regard to pH and temperature profiles and molecular sizes.
Hui, Qianru; Wang, Mian; Wang, Pei; Ma, Ya; Gu, Zhenxin; Yang, Runqiang
2018-01-01
Phytic acid as a phosphorus storage vault provides phosphorus for plant development. It is an anti-nutritional factor for humans and some animals. However, its degradation products lower inositol phosphates have positive effects on human health. In this study, the effect of gibberellic acid (GA) on phytic acid degradation under calcium lactate (Ca) existence was investigated. The results showed that Ca + GA treatment promoted the growth status, hormone metabolism and phytic acid degradation in germinating soybean. At the same time, the availability of phosphorus, the activity of phytic acid degradation-associated enzyme and phosphoinositide-specific phospholipase C (PI-PLC) increased. However, the relative genes expression of phytic acid degradation-associated enzymes did not vary in accordance with their enzymes activity. The results revealed that GA could mediate the transport and function of calcium and a series of physiological and biochemical changes to regulate phytic acid degradation of soybean sprouts. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
DEFF Research Database (Denmark)
Iglesias-Gato, Diego; Chuan, Yin-Choy; Jiang, Ning
2015-01-01
BackgroundUbiquitination is a highly dynamic and reversible process with a central role in cell homeostasis. Deregulation of several deubiquitinating enzymes has been linked to tumor development but their specific role in prostate cancer progression remains unexplored.MethodsRNAi screening was us...
Monovalent Cation Activation of the Radical SAM Enzyme Pyruvate Formate-Lyase Activating Enzyme.
Shisler, Krista A; Hutcheson, Rachel U; Horitani, Masaki; Duschene, Kaitlin S; Crain, Adam V; Byer, Amanda S; Shepard, Eric M; Rasmussen, Ashley; Yang, Jian; Broderick, William E; Vey, Jessica L; Drennan, Catherine L; Hoffman, Brian M; Broderick, Joan B
2017-08-30
Pyruvate formate-lyase activating enzyme (PFL-AE) is a radical S-adenosyl-l-methionine (SAM) enzyme that installs a catalytically essential glycyl radical on pyruvate formate-lyase. We show that PFL-AE binds a catalytically essential monovalent cation at its active site, yet another parallel with B 12 enzymes, and we characterize this cation site by a combination of structural, biochemical, and spectroscopic approaches. Refinement of the PFL-AE crystal structure reveals Na + as the most likely ion present in the solved structures, and pulsed electron nuclear double resonance (ENDOR) demonstrates that the same cation site is occupied by 23 Na in the solution state of the as-isolated enzyme. A SAM carboxylate-oxygen is an M + ligand, and EPR and circular dichroism spectroscopies reveal that both the site occupancy and the identity of the cation perturb the electronic properties of the SAM-chelated iron-sulfur cluster. ENDOR studies of the PFL-AE/[ 13 C-methyl]-SAM complex show that the target sulfonium positioning varies with the cation, while the observation of an isotropic hyperfine coupling to the cation by ENDOR measurements establishes its intimate, SAM-mediated interaction with the cluster. This monovalent cation site controls enzyme activity: (i) PFL-AE in the absence of any simple monovalent cations has little-no activity; and (ii) among monocations, going down Group 1 of the periodic table from Li + to Cs + , PFL-AE activity sharply maximizes at K + , with NH 4 + closely matching the efficacy of K + . PFL-AE is thus a type I M + -activated enzyme whose M + controls reactivity by interactions with the cosubstrate, SAM, which is bound to the catalytic iron-sulfur cluster.
Ma, Rendi; Yuan, Hali; An, Jing; Hao, Xiaoyun; Li, Hongbin
2018-01-01
GDSL lipase (GLIP) plays a pivotal role in plant cell growth as a multifunctional hydrolytic enzyme. Herein, a cotton (Gossypium hirsutum L. cv Xuzhou 142) GDSL lipase gene (GhGLIP) was obtained from developing ovules and fibers. The GhGLIP cDNA contained an open reading frame (ORF) of 1,143 base pairs (bp) and encodes a putative polypeptide of 380 amino acid residues. Sequence alignment indicated that GhGLIP includes four enzyme catalytic amino acid residue sites of Ser (S), Gly (G), Asn (N) and His (H), located in four conserved blocks. Phylogenetic tree analysis showed that GhGLIP belongs to the typical class IV lipase family with potential functions in plant secondary metabolism. Subcellular distribution analysis demonstrated that GhGLIP localized to the nucleus, cytoplasm and plasma membrane. GhGLIP was expressed predominantly at 5-15 day post anthesis (dpa) in developing ovules and elongating fibers, measured as mRNA levels and enzyme activity. Ectopic overexpression of GhGLIP in Arabidopsis plants resulted in enhanced seed development, including length and fresh weight. Meanwhile, there was increased soluble sugar and protein storage in transgenic Arabidopsis plants, coupled with the promotion of lipase activity. Moreover, the expression of cotton GhGLIP is induced by ethylene (ETH) treatment in vitro. A 1,954-bp GhGLIP promoter was isolated and expressed high activity in driving green fluorescence protein (GFP) expression in tobacco leaves. Cis-acting element analysis of the GhGLIP promoter (pGhGLIP) indicated the presence of an ethylene-responsive element (ERE), and transgenic tobacco leaves with ectopic expression of pGhGLIP::GFP-GUS showed increased GUS activity after ETH treatment. In summary, these results suggest that GhGLIP is a functional enzyme involved in ovule and fiber development and performs significant roles in seed development.
21 CFR 864.9400 - Stabilized enzyme solution.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Stabilized enzyme solution. 864.9400 Section 864... and Blood Products § 864.9400 Stabilized enzyme solution. (a) Identification. A stabilized enzyme... enzyme solutions include papain, bromelin, ficin, and trypsin. (b) Classification. Class II (performance...
Directory of Open Access Journals (Sweden)
Shailee V. Tiwari
2018-02-01
Full Text Available Herein, we report an environmentally friendly, rapid, and convenient ionic liquid ([Et3NH][HSO4]-promoted facile synthesis of ethyl 4-(6-substituted-4-oxo-4H-chromen-3-yl-6-methyl-2-thioxo/oxo-1,2,3,4-tetrahydropyrimidine-5-carboxylate derivatives 4(a–f and 4-(6-substituted-4-oxo-4H-chromen-3-yl-6-methyl-2-thioxo/oxo-1,2,3,4-tetrahydropyrimidine-5- carbohydrazide derivatives 6(a–f. All the synthesized derivatives 4(a–f and 6(a–f were evaluated for their in vitro antifungal and antibacterial activity, by method recommended by National Committee for Clinical Laboratory Standards (NCCLS. The compound 6c bearing a fluoro group on the chromone ring and oxygen and a hydrazino group (–NHNH2 on the pyrimidine ring, was found to be the most potent antibacterial compound amongst the synthesized derivatives. The compound 6f bearing a methoxy group (–OCH3 on the chromone ring and sulphur group on the pyrimidine ring, was found to exhibit equipotent antifungal activity when compared with the standard drug miconazole. A d-alanine-d-alanine ligase (DdlB enzyme assay study and an ergosterol extraction and quantitation assay study were performed to predict the mode of action of the synthesized compounds. A molecular docking study was performed to predict the binding interactions with receptors and mode of action of the synthesized derivatives. Further, analysis of the ADMET parameters for the synthesized compounds has shown that these compounds have good oral drug-like properties and can be developed as oral drug candidates. To establish the antimicrobial selectivity and safety, the most active compounds 6c and 6f were further tested for cytotoxicity against the human cancer cell line HeLa and were found to be non-cytotoxic in nature. An in vivo acute oral toxicity study was also performed for the most active compounds 6c and 6f and the results indicated that the compounds are non-toxic in nature.
Castor Oil Transesterification Catalysed by Liquid Enzymes
DEFF Research Database (Denmark)
Andrade, Thalles; Errico, Massimiliano; Christensen, Knud Villy
2017-01-01
In the present work, biodiesel production by reaction of non-edible castor oil with methanol under enzymatic catalysis is investigated. Two liquid enzymes were tested: Eversa Transform and Resinase HT. Reactions were performed at 35 °C and with a molar ratio of methanol to oil of 6:1. The reaction...... time was 8 hours. Stepwise addition of methanol was necessary to avoid enzyme inhibition by methanol. In order to minimize the enzyme costs, the influence of enzyme activity loss during reuse of both enzymes was evaluated under two distinct conditions. In the former, the enzymes were recovered...... and fully reused; in the latter, a mixture of 50 % reused and 50 % fresh enzymes was tested. In the case of total reuse after three cycles, both enzymes achieved only low conversions. The biodiesel content in the oil-phase using Eversa Transform was 94.21 % for the first cycle, 68.39 % in the second, and 33...
A virus-based single-enzyme nanoreactor
Comellas Aragones, M.; Engelkamp, H.; Claessen, V.I.; Sommerdijk, N.A.J.M.; Rowan, A.E.; Christianen, P.C.M.; Maan, J.C.; Verduin, B.J.M.; Cornelissen, J.J.L.M.; Nolte, R.J.M.
2007-01-01
Most enzyme studies are carried out in bulk aqueous solution, at the so-called ensemble level, but more recently studies have appeared in which enzyme activity is measured at the level of a single molecule, revealing previously unseen properties. To this end, enzymes have been chemically or
PROCESS FOR DUST-FREE ENZYME MANUFACTURE
Andela, C.; Feijen, Jan; Dillissen, Marc
1994-01-01
New enzyme granules are provided with improved properties. The granules are based on core particles having a good pore size and pore size distribution to allow an enzyme solution to enter into the particle. Accordingly, the core material comprises the enzyme in liquid form, thus eliminating the
Applications of Microbial Enzymes in Food Industry
Directory of Open Access Journals (Sweden)
Binod Parameswaran
2018-01-01
Full Text Available The use of enzymes or microorganisms in food preparations is an age-old process. With the advancement of technology, novel enzymes with wide range of applications and specificity have been developed and new application areas are still being explored. Microorganisms such as bacteria, yeast and fungi and their enzymes are widely used in several food preparations for improving the taste and texture and they offer huge economic benefits to industries. Microbial enzymes are the preferred source to plants or animals due to several advantages such as easy, cost-effective and consistent production. The present review discusses the recent advancement in enzyme technology for food industries. A comprehensive list of enzymes used in food processing, the microbial source of these enzymes and the wide range of their application are discussed.
Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.
Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J
2018-05-01
Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.
Energy Technology Data Exchange (ETDEWEB)
Li, Minjing [School of Environmental Studies, China University of Geosciences, Wuhan 430074 People' s Republic of China; Gao, Yuqian [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Qian, Wei-Jun [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Shi, Liang [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Liu, Yuanyuan [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Nelson, William C. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Nicora, Carrie D. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Resch, Charles T. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Thompson, Christopher [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Yan, Sen [School of Environmental Studies, China University of Geosciences, Wuhan 430074 People' s Republic of China; Fredrickson, James K. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Zachara, John M. [Pacific Northwest National Laboratory, Richland, WA 99354 USA; Liu, Chongxuan [Pacific Northwest National Laboratory, Richland, WA 99354 USA; School of Environmental Science and Engineering, Southern University of Science and Technology, Shenzhen 518055 People' s Republic of China
2017-07-13
Microbially mediated biogeochemical processes are catalyzed by enzymes that control the transformation of carbon, nitrogen, and other elements in environment. The dynamic linkage between enzymes and biogeochemical species transformation has, however, rarely been investigated because of the lack of analytical approaches to efficiently and reliably quantify enzymes and their dynamics in soils and sediments. Herein, we developed a signature peptide-based technique for sensitively quantifying dissimilatory and assimilatory enzymes using nitrate-reducing enzymes in a hyporheic zone sediment as an example. Moreover, the measured changes in enzyme concentration were found to correlate with the nitrate reduction rate in a way different from that inferred from biogeochemical models based on biomass or functional genes as surrogates for functional enzymes. This phenomenon has important implications for understanding and modeling the dynamics of microbial community functions and biogeochemical processes in environments. Our results also demonstrate the importance of enzyme quantification for the identification and interrogation of those biogeochemical processes with low metabolite concentrations as a result of faster enzyme-catalyzed consumption of metabolites than their production. The dynamic enzyme behaviors provide a basis for the development of enzyme-based models to describe the relationship between the microbial community and biogeochemical processes.
NRSA enzyme decomposition model data
U.S. Environmental Protection Agency — Microbial enzyme activities measured at more than 2000 US streams and rivers. These enzyme data were then used to predict organic matter decomposition and microbial...
Directory of Open Access Journals (Sweden)
Chinnusamy Viswanathan
2010-04-01
Full Text Available Abstract Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908
Heavy enzymes--experimental and computational insights in enzyme dynamics.
Swiderek, Katarzyna; Ruiz-Pernía, J Javier; Moliner, Vicent; Tuñón, Iñaki
2014-08-01
The role of protein motions in the chemical step of enzyme-catalyzed reactions is the subject of an open debate in the scientific literature. The systematic use of isotopically substituted enzymes has been revealed as a useful tool to quantify the role of these motions. According to the Born-Oppenheimer approximation, changing the mass of the protein does not change the forces acting on the system but alters the frequencies of the protein motions, which in turn can affect the rate constant. Experimental and theoretical studies carried out in this field are presented in this article and discussed in the framework of Transition State Theory. Copyright © 2014 Elsevier Ltd. All rights reserved.
Consumer attitudes to enzymes in food production
DEFF Research Database (Denmark)
Søndergaard, Helle Alsted; Grunert, Klaus G.; Scholderer, Joachim
2005-01-01
The use of enzymes in food production has potential benefits for both food manufacturers and consumers. A central question is how consumers react to new ways of producing foods with enzymes. This study investigates the formation of consumer attitudes to different enzyme production methods in three...... European countries. Results show that consumers are most positive towards non-GM enzyme production methods. The enzyme production method is by far the most important factor for the formation of buying intentions compared to price and benefits. Results also show that environmental concern and attitudes...... to technological progress are the socio-political attitudes that have the highest predictive value regarding attitudes to enzyme production methods....
Analysis of the promoters involved in enterocin AS-48 expression.
Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel
2014-01-01
The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Analysis of the promoters involved in enterocin AS-48 expression.
Directory of Open Access Journals (Sweden)
Rubén Cebrián
Full Text Available The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2 and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2 promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2 promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.
Immobilization of Enzymes in Polymer Supports.
Conlon, Hugh D.; Walt, David R.
1986-01-01
Two experiments in which an enzyme is immobilized onto a polymeric support are described. The experiments (which also demonstrate two different polymer preparations) involve: (1) entrapping an enzyme in an acrylamide polymer; and (2) reacting the amino groups on the enzyme's (esterase) lysine residues with an activated polymer. (JN)
Brouns, Stan J J; Walther, Jasper; Snijders, Ambrosius P L; van de Werken, Harmen J G; Willemen, Hanneke L D M; Worm, Petra; de Vos, Marjon G J; Andersson, Anders; Lundgren, Magnus; Mazon, Hortense F M; van den Heuvel, Robert H H; Nilsson, Peter; Salmon, Laurent; de Vos, Willem M; Wright, Phillip C; Bernander, Rolf; van der Oost, John
2006-09-15
The pentose metabolism of Archaea is largely unknown. Here, we have employed an integrated genomics approach including DNA microarray and proteomics analyses to elucidate the catabolic pathway for D-arabinose in Sulfolobus solfataricus. During growth on this sugar, a small set of genes appeared to be differentially expressed compared with growth on D-glucose. These genes were heterologously overexpressed in Escherichia coli, and the recombinant proteins were purified and biochemically studied. This showed that D-arabinose is oxidized to 2-oxoglutarate by the consecutive action of a number of previously uncharacterized enzymes, including a D-arabinose dehydrogenase, a D-arabinonate dehydratase, a novel 2-keto-3-deoxy-D-arabinonate dehydratase, and a 2,5-dioxopentanoate dehydrogenase. Promoter analysis of these genes revealed a palindromic sequence upstream of the TATA box, which is likely to be involved in their concerted transcriptional control. Integration of the obtained biochemical data with genomic context analysis strongly suggests the occurrence of pentose oxidation pathways in both Archaea and Bacteria, and predicts the involvement of additional enzyme components. Moreover, it revealed striking genetic similarities between the catabolic pathways for pentoses, hexaric acids, and hydroxyproline degradation, which support the theory of metabolic pathway genesis by enzyme recruitment.
Enzymic oxidation of carbon monoxide. II
Energy Technology Data Exchange (ETDEWEB)
Yagi, T
1959-01-01
An enzyme which catalyzes the oxidation of carbon monoxide into carbon dioxide was obtained in a cell free state from Desulfovibrio desulfuricans. The enzyme activity was assayed manometrically by measuring the rate of gas uptake under the atmosphere of carbon monoxide in the presence of benzyl-viologen as an oxidant. The optimum pH range was 7 to 8. The activity was slightly suppressed by illumination. The enzyme was more stable than hydrogenase or formate dehydrogenase against the heat treatment, suggesting that it is a different entity from these enzymes. In the absence of an added oxidant, the enzyme preparation produced hydrogen gas under the atmosphere of carbon monoxide. The phenomenon can be explained assuming the reductive decomposition of water. 17 references, 4 figures, 2 tables.
Production of cellulolytic enzymes from ascomycetes
DEFF Research Database (Denmark)
Hansen, Gustav Hammerich; Lübeck, Mette; Frisvad, Jens Christian
2015-01-01
Optimizing production of cellulose degrading enzymes is of great interest in order to increase the feasibility of constructing biorefinery facilities for a sustainable supply of energy and chemical products. The ascomycete phylum has a large potential for the production of cellulolytic enzymes....... Although numerous enzymatic profiles have already been unraveled, the research has been covering only a limited number of species and genera, thus leaving many ascomycetes to be analyzed. Such analysis requires choosing appropriate media and cultivation methods that ensure enzyme profiles with high...... specificities and activities. However, the choice of media, cultivation methods and enzyme assays highly affect the enzyme activity profile observed. This review provides an overview of enzymatic profiles for several ascomycetes covering phylogenetically distinct genera and species. The profiles of cellulose...
Computational Biochemistry-Enzyme Mechanisms Explored.
Culka, Martin; Gisdon, Florian J; Ullmann, G Matthias
2017-01-01
Understanding enzyme mechanisms is a major task to achieve in order to comprehend how living cells work. Recent advances in biomolecular research provide huge amount of data on enzyme kinetics and structure. The analysis of diverse experimental results and their combination into an overall picture is, however, often challenging. Microscopic details of the enzymatic processes are often anticipated based on several hints from macroscopic experimental data. Computational biochemistry aims at creation of a computational model of an enzyme in order to explain microscopic details of the catalytic process and reproduce or predict macroscopic experimental findings. Results of such computations are in part complementary to experimental data and provide an explanation of a biochemical process at the microscopic level. In order to evaluate the mechanism of an enzyme, a structural model is constructed which can be analyzed by several theoretical approaches. Several simulation methods can and should be combined to get a reliable picture of the process of interest. Furthermore, abstract models of biological systems can be constructed combining computational and experimental data. In this review, we discuss structural computational models of enzymatic systems. We first discuss various models to simulate enzyme catalysis. Furthermore, we review various approaches how to characterize the enzyme mechanism both qualitatively and quantitatively using different modeling approaches. © 2017 Elsevier Inc. All rights reserved.
Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin
2014-01-01
The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.
Sana, Barindra; Chia, Kuan Hui Burton; Raghavan, Sarada S; Ramalingam, Balamurugan; Nagarajan, Niranjan; Seayad, Jayasree; Ghadessy, Farid J
2017-01-01
Lignin is a potential biorefinery feedstock for the production of value-added chemicals including vanillin. A huge amount of lignin is produced as a by-product of the paper industry, while cellulosic components of plant biomass are utilized for the production of paper pulp. In spite of vast potential, lignin remains the least exploited component of plant biomass due to its extremely complex and heterogenous structure. Several enzymes have been reported to have lignin-degrading properties and could be potentially used in lignin biorefining if their catalytic properties could be improved by enzyme engineering. The much needed improvement of lignin-degrading enzymes by high-throughput selection techniques such as directed evolution is currently limited, as robust methods for detecting the conversion of lignin to desired small molecules are not available. We identified a vanillin-inducible promoter by RNAseq analysis of Escherichia coli cells treated with a sublethal dose of vanillin and developed a genetically programmed vanillin-sensing cell by placing the 'very green fluorescent protein' gene under the control of this promoter. Fluorescence of the biosensing cell is enhanced significantly when grown in the presence of vanillin and is readily visualized by fluorescence microscopy. The use of fluorescence-activated cell sorting analysis further enhances the sensitivity, enabling dose-dependent detection of as low as 200 µM vanillin. The biosensor is highly specific to vanillin and no major response is elicited by the presence of lignin, lignin model compound, DMSO, vanillin analogues or non-specific toxic chemicals. We developed an engineered E. coli cell that can detect vanillin at a concentration as low as 200 µM. The vanillin-sensing cell did not show cross-reactivity towards lignin or major lignin degradation products including vanillin analogues. This engineered E. coli cell could potentially be used as a host cell for screening lignin-degrading enzymes that
Cellulolytic enzyme compositions and uses thereof
Energy Technology Data Exchange (ETDEWEB)
Iyer, Prashant; Gaspar, Armindo Ribiero; Croonenberghs, James; Binder, Thomas P.
2017-07-25
The present invention relates enzyme composition comprising a cellulolytic preparation and an acetylxylan esterase (AXE); and the used of cellulolytic enzyme compositions for hydrolyzing acetylated cellulosic material. Finally the invention also relates to processes of producing fermentation products from acetylated cellulosic materials using a cellulolytic enzyme composition of the invention.
Directory of Open Access Journals (Sweden)
M.G. Mithra
2017-08-01
Full Text Available Two strategies leading to enzyme saving during saccharification of pretreated lignocellulo-starch biomass (LCSB was investigated which included reducing enzyme dosage by varying their levels in enzyme cocktails and enhancing the fermentable sugar yield in enzyme-reduced systems using detoxification chemicals. Time course release of reducing sugars (RS during 24–120 h was significantly higher when an enzyme cocktail containing full dose of cellulase (16 FPU/g cellulose along with half dose each of xylanase (1.5 mg protein/g hemicelluloses and Stargen (12.5 μl/g biomass was used to saccharify conventional dilute sulphuric acid (DSA pretreated biomass compared to a parallel system where only one-fourth the dose of the latter two enzymes was used. The reduction in RS content in the 120 h saccharified mash to the extent of 3–4 g/L compared to the system saccharified with full complement of the three enzymes could be overcome considerably by supplementing the system (half dose of two enzymes with detoxification chemical mix incorporating Tween 20, PEG 4000 and sodium borohydride. Microwave (MW-assisted DSA pretreated biomass on saccharification with enzyme cocktail having full dose of cellulase and half dose of Stargen along with detoxification chemicals gave significantly higher RS yield than DSA pretreated system saccharified using three enzymes. The study showed that xylanase could be eliminated during saccharification of MW-assisted DSA pretreated biomass without affecting RS yield when detoxification chemicals were also supplemented. The Saccharification Efficiency and Overall Conversion Efficiency were also high for the MW-assisted DSA pretreated biomass. Since whole slurry saccharifcation of pretreated biomass is essential to conserve fermentable sugars in LCSB saccharification, detoxification of soluble inhibitors is equally important as channelling out of insoluble lignin remaining in the residue. As one of the major factors contributing
Cellulase enzyme and biomass utilization
African Journals Online (AJOL)
STORAGESEVER
2009-06-03
Jun 3, 2009 ... human population grows and economic development. However, the current .... conditions and the production cost of the related enzyme system. Therefore ... Given the importance of this enzyme to these so many industries,.
Photosynthetic fuel for heterologous enzymes
DEFF Research Database (Denmark)
Mellor, Silas Busck; Vavitsas, Konstantinos; Nielsen, Agnieszka Janina Zygadlo
2017-01-01
of reducing power. Recent work on the metabolic engineering of photosynthetic organisms has shown that the electron carriers such as ferredoxin and flavodoxin can be used to couple heterologous enzymes to photosynthetic reducing power. Because these proteins have a plethora of interaction partners and rely...... on electrostatically steered complex formation, they form productive electron transfer complexes with non-native enzymes. A handful of examples demonstrate channeling of photosynthetic electrons to drive the activity of heterologous enzymes, and these focus mainly on hydrogenases and cytochrome P450s. However......, competition from native pathways and inefficient electron transfer rates present major obstacles, which limit the productivity of heterologous reactions coupled to photosynthesis. We discuss specific approaches to address these bottlenecks and ensure high productivity of such enzymes in a photosynthetic...
Yang, Qingjie; Yuan, Dawei; Shi, Lianxuan; Capell, Teresa; Bai, Chao; Wen, Nuan; Lu, Xiaodan; Sandmann, Gerhard; Christou, Paul; Zhu, Changfu
2012-10-01
The accumulation of carotenoids in plants depends critically on the spatiotemporal expression profiles of the genes encoding enzymes in the carotenogenic pathway. We cloned and characterized the Gentiana lutea zeaxanthin epoxidase (GlZEP) promoter to determine its role in the regulation of carotenogenesis, because the native gene is expressed at high levels in petals, which contain abundant chromoplasts. We transformed tomato (Solanum lycopersicum cv. Micro-Tom) plants with the gusA gene encoding the reporter enzyme β-glucuronidase (GUS) under the control of the GlZEP promoter, and investigated the reporter expression profile at the mRNA and protein levels. We detected high levels of gusA expression and GUS activity in chromoplast-containing flowers and fruits, but minimal levels in immature fruits containing green chloroplasts, in sepals, leaves, stems and roots. GlZEP-gusA expression was strictly associated with fruit development and chromoplast differentiation, suggesting an evolutionarily-conserved link between ZEP and the differentiation of organelles that store carotenoid pigments. The impact of our results on current models for the regulation of carotenogenesis in plants is discussed.
Rivière, Guillaume; Lienhard, Daniel; Andrieu, Thomas; Vieau, Didier; Frey, Brigitte M; Frey, Felix J
2011-04-01
Somatic angiotensin-converting enzyme (sACE) is crucial in cardiovascular homeostasis and displays a tissue-specific profile. Epigenetic patterns modulate genes expression and their alterations were implied in pathologies including hypertension. However, the influence of DNA methylation and chromatin condensation state on the expression of sACE is unknown. We examined whether such epigenetic mechanisms could participate in the control of sACE expression in vitro and in vivo. We identified two CpG islands in the human ace-1 gene 3 kb proximal promoter region. Their methylation abolished the luciferase activity of ace-1 promoter/reporter constructs transfected into human liver (HepG2), colon (HT29), microvascular endothelial (HMEC-1) and lung (SUT) cell lines (p sACE mRNA expression cell-type specifically (p sACE mRNA expression in the lungs and liver (p = 0.05), but not in the kidney. In conclusion, the expression level of somatic ACE is modulated by CpG-methylation and histone deacetylases inhibition. The basal methylation pattern of the promoter of the ace-1 gene is cell-type specific and correlates to sACE transcription. DNMT inhibition is associated with altered methylation of the ace-1 promoter and a cell-type and tissue-specific increase of sACE mRNA levels. This study indicates a strong influence of epigenetic mechanisms on sACE expression.
Research progress of nanoparticles as enzyme mimetics
Hu, XiaoNa; Liu, JianBo; Hou, Shuai; Wen, Tao; Liu, WenQi; Zhang, Ke; He, WeiWei; Ji, YingLu; Ren, HongXuan; Wang, Qi; Wu, XiaoChun
2011-10-01
Natural enzymes as biological catalysts possess remarkable advantages, especially their highly efficient and selective catalysis under mild conditions. However, most natural enzymes are proteins, thus exhibiting an inherent low durability to harsh reaction conditions. Artificial enzyme mimetics have been pursued extensively to avoid this drawback. Quite recently, some inorganic nanoparticles (NPs) have been found to exhibit unique enzyme mimetics. In addition, their much higher stability overcomes the inherent disadvantage of natural enzymes. Furthermore, easy mass-production and low cost endow them more benefits. As a new member of artificial enzyme mimetics, they have received intense attention. In this review article, major progress in this field is summarized and future perspectives are highlighted.
Badhan, Ajay; Wang, Yu-Xi; Gruninger, Robert; Patton, Donald; Powlowski, Justin; Tsang, Adrian; McAllister, Tim A
2015-01-01
Identification of recalcitrant factors that limit digestion of forages and the development of enzymatic approaches that improve hydrolysis could play a key role in improving the efficiency of meat and milk production in ruminants. Enzyme fingerprinting of barley silage fed to heifers and total tract indigestible fibre residue (TIFR) collected from feces was used to identify cell wall components resistant to total tract digestion. Enzyme fingerprinting results identified acetyl xylan esterases as key to the enhanced ruminal digestion. FTIR analysis also suggested cross-link cell wall polymers as principal components of indigested fiber residues in feces. Based on structural information from enzymatic fingerprinting and FTIR, enzyme pretreatment to enhance glucose yield from barley straw and alfalfa hay upon exposure to mixed rumen-enzymes was developed. Prehydrolysis effects of recombinant fungal fibrolytic hydrolases were analyzed using microassay in combination with statistical experimental design. Recombinant hemicellulases and auxiliary enzymes initiated degradation of plant structural polysaccharides upon application and improved the in vitro saccharification of alfalfa and barley straw by mixed rumen enzymes. The validation results showed that microassay in combination with statistical experimental design can be successfully used to predict effective enzyme pretreatments that can enhance plant cell wall digestion by mixed rumen enzymes.
Development of enzymes and enzyme systems by genetic engineering to convert biomass to sugars
TITLE Development of Enzymes and Enzyme Systems by Genetic Engineering to Convert Biomass to Sugars ABSTRACT Plant cellulosic material is one of the most viable renewable resources for the world’s fuel and chemical feedstock needs. Currently ethanol derived from corn starch is the most common li...
How Do Enzymes 'Meet' Nanoparticles and Nanomaterials?
Chen, Ming; Zeng, Guangming; Xu, Piao; Lai, Cui; Tang, Lin
2017-11-01
Enzymes are fundamental biological catalysts responsible for biological regulation and metabolism. The opportunity for enzymes to 'meet' nanoparticles and nanomaterials is rapidly increasing due to growing demands for applications in nanomaterial design, environmental monitoring, biochemical engineering, and biomedicine. Therefore, understanding the nature of nanomaterial-enzyme interactions is becoming important. Since 2014, enzymes have been used to modify, degrade, or make nanoparticles/nanomaterials, while numerous nanoparticles/nanomaterials have been used as materials for enzymatic immobilization and biosensors and as enzyme mimicry. Among the various nanoparticles and nanomaterials, metal nanoparticles and carbon nanomaterials have received extensive attention due to their fascinating properties. This review provides an overview about how enzymes meet nanoparticles and nanomaterials. Copyright © 2017 Elsevier Ltd. All rights reserved.
Watching Individual Enzymes at Work
Blank, Kerstin; Rocha, Susana; De Cremer, Gert; Roeffaers, Maarten B. J.; Uji-i, Hiroshi; Hofkens, Johan
Single-molecule fluorescence experiments are a powerful tool to analyze reaction mechanisms of enzymes. Because of their unique potential to detect heterogeneities in space and time, they have provided unprecedented insights into the nature and mechanisms of conformational changes related to the catalytic reaction. The most important finding from experiments with single enzymes is the generally observed phenomenon that the catalytic rate constants fluctuate over time (dynamic disorder). These fluctuations originate from conformational changes occurring on time scales, which are similar to or slower than that of the catalytic reaction. Here, we summarize experiments with enzymes that show dynamic disorder and introduce new experimental strategies showing how single-molecule fluorescence experiments can be applied to address other open questions in medical and industrial enzymology, such as enzyme inactivation processes, reactant transfer in cascade reactions, and the mechanisms of interfacial catalysis.
Advances in enzyme bioelectrochemistry
Directory of Open Access Journals (Sweden)
ANDRESSA R. PEREIRA
Full Text Available ABSTRACT Bioelectrochemistry can be defined as a branch of Chemical Science concerned with electron-proton transfer and transport involving biomolecules, as well as electrode reactions of redox enzymes. The bioelectrochemical reactions and system have direct impact in biotechnological development, in medical devices designing, in the behavior of DNA-protein complexes, in green-energy and bioenergy concepts, and make it possible an understanding of metabolism of all living organisms (e.g. humans where biomolecules are integral to health and proper functioning. In the last years, many researchers have dedicated itself to study different redox enzymes by using electrochemistry, aiming to understand their mechanisms and to develop promising bioanodes and biocathodes for biofuel cells as well as to develop biosensors and implantable bioelectronics devices. Inside this scope, this review try to introduce and contemplate some relevant topics for enzyme bioelectrochemistry, such as the immobilization of the enzymes at electrode surfaces, the electron transfer, the bioelectrocatalysis, and new techniques conjugated with electrochemistry vising understand the kinetics and thermodynamics of redox proteins. Furthermore, examples of recent approaches in designing biosensors and biofuel developed are presented.
Thermometric enzyme linked immunosorbent assay: TELISA.
Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K
1977-08-11
A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.
Directory of Open Access Journals (Sweden)
Lin Yuan
Full Text Available Three hundred one-day-old male broiler chickens (Ross-308 were fed corn-soybean basal diets containing non-starch polysaccharide (NSP enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI and average daily gain (ADG were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05. Feed-to-gain ratio (FGR was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05. Apparent digestibility of crude protein (ADCP was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05. Cholecystokinin (CCK level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05, but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05, respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05. However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05. The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05. Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased
Mesoscopic dynamics of diffusion-influenced enzyme kinetics.
Chen, Jiang-Xing; Kapral, Raymond
2011-01-28
A particle-based mesoscopic model for enzyme kinetics is constructed and used to investigate the influence of diffusion on the reactive dynamics. Enzymes and enzyme-substrate complexes are modeled as finite-size soft spherical particles, while substrate, product, and solvent molecules are point particles. The system is evolved using a hybrid molecular dynamics-multiparticle collision dynamics scheme. Both the nonreactive and reactive dynamics are constructed to satisfy mass, momentum, and energy conservation laws, and reversible reaction steps satisfy detailed balance. Hydrodynamic interactions among the enzymes and complexes are automatically accounted for in the dynamics. Diffusion manifests itself in various ways, notably in power-law behavior in the evolution of the species concentrations. In accord with earlier investigations, regimes where the product production rate exhibits either monotonic or nonmonotonic behavior as a function of time are found. In addition, the species concentrations display both t(-1/2) and t(-3/2) power-law behavior, depending on the dynamical regime under investigation. For high enzyme volume fractions, cooperative effects influence the enzyme kinetics. The time dependent rate coefficient determined from the mass action rate law is computed and shown to depend on the enzyme concentration. Lifetime distributions of substrate molecules newly released in complex dissociation events are determined and shown to have either a power-law form for rebinding to the same enzyme from which they were released or an exponential form for rebinding to different enzymes. The model can be used and extended to explore a variety of issues related concentration effects and diffusion on enzyme kinetics.
Mesoscopic dynamics of diffusion-influenced enzyme kinetics
Chen, Jiang-Xing; Kapral, Raymond
2011-01-01
A particle-based mesoscopic model for enzyme kinetics is constructed and used to investigate the influence of diffusion on the reactive dynamics. Enzymes and enzyme-substrate complexes are modeled as finite-size soft spherical particles, while substrate, product, and solvent molecules are point particles. The system is evolved using a hybrid molecular dynamics-multiparticle collision dynamics scheme. Both the nonreactive and reactive dynamics are constructed to satisfy mass, momentum, and energy conservation laws, and reversible reaction steps satisfy detailed balance. Hydrodynamic interactions among the enzymes and complexes are automatically accounted for in the dynamics. Diffusion manifests itself in various ways, notably in power-law behavior in the evolution of the species concentrations. In accord with earlier investigations, regimes where the product production rate exhibits either monotonic or nonmonotonic behavior as a function of time are found. In addition, the species concentrations display both t^{-1/2} and t^{-3/2} power-law behavior, depending on the dynamical regime under investigation. For high enzyme volume fractions, cooperative effects influence the enzyme kinetics. The time dependent rate coefficient determined from the mass action rate law is computed and shown to depend on the enzyme concentration. Lifetime distributions of substrate molecules newly released in complex dissociation events are determined and shown to have either a power-law form for rebinding to the same enzyme from which they were released or an exponential form for rebinding to different enzymes. The model can be used and extended to explore a variety of issues related concentration effects and diffusion on enzyme kinetics.
ENZYME RESISTANCE OF GENETICALLY MODIFIED STARCH POTATOES
Directory of Open Access Journals (Sweden)
A. Sh. Mannapova
2015-01-01
Full Text Available Here in this article the justification of expediency of enzyme resistant starch use in therapeutic food products is presented . Enzyme resistant starch is capable to resist to enzymatic hydrolysis in a small intestine of a person, has a low glycemic index, leads to decrease of postprandial concentration of glucose, cholesterol, triglycerides in blood and insulin reaction, to improvement of sensitivity of all organism to insulin, to increase in sense of fulness and to reduction of adjournment of fats. Resistant starch makes bifidogenшс impact on microflora of a intestine of the person, leads to increase of a quantity of lactobacillus and bifidobacterium and to increased production of butyric acid in a large intestine. In this regard the enzyme resistant starch is an important component in food for prevention and curing of human diseases such as diabetes, obesity, colitis, a cancer of large and direct intestine. One method is specified by authors for imitation of starch digestion in a human body. This method is based on the definition of an enzyme resistance of starch in vitro by its hydrolysis to glucose with application of a glucoamylase and digestive enzyme preparation Pancreatin. This method is used in researches of an enzyme resistance of starch, of genetically modified potato, high amylose corn starch Hi-Maize 1043 and HYLON VII (National Starch Food Innovation, USA, amylopectin and amylose. It is shown that the enzyme resistance of the starch emitted from genetically modified potatoes conforms to the enzyme resistance of the high amylose corn starch “Hi-Maize 1043 and HYLON VII starch”, (National Starch Food Innovation, the USA relating to the II type of enzyme resistant starch. It is established that amylopectin doesn't have the enzyme resistant properties. The results of researches are presented. They allow us to make the following conclusion: amylose in comparison with amylopectin possesses higher enzyme resistance and gives to
Structure and function of α-glucan debranching enzymes
DEFF Research Database (Denmark)
Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte
2016-01-01
α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....
Lowry, O.; Mcdougal, D., Jr.; Nemeth, Patti M.; Maggie, M.-Y. Chi; Pusateri, M.; Carter, J.; Manchester, J.; Norris, Beverly; Krasnov, I.
1990-01-01
The individual fibers of any individual muscle vary greatly in enzyme composition, a fact which is obscured when enzyme levels of a whole muscle are measured. The purpose of this study was therefore to assess the changes due to weightless on the enzyme patterns composed by the individual fibers within the flight muscles. In spite of the limitation in numbers of muscles examined, it is apparent that: (1) that the size of individual fibers (i.e., their dry weight) was reduced about a third, (2) that this loss in dry mass was accompanied by changes in the eight enzymes studied, and (3) that these changes were different for the two muscles, and different for the two enzyme groups. In the soleus muscle the absolute amounts of the three enzymes of oxidative metabolism decreased about in proportion to the dry weight loss, so that their concentration in the atrophic fibers was almost unchanged. In contrast, there was little loss among the four enzymes of glycogenolysis - glycolysis so that their concentrations were substantially increased in the atrophic fibers. In the TA muscle, these seven enzymes were affected in just the opposite direction. There appeared to be no absolute loss among the oxidative enzymes, whereas the glycogenolytic enzymes were reduced by nearly half, so that the concentrations of the first metabolic group were increased within the atrophic fibers and the concentrations of the second group were only marginally decreased. The behavior of hexokinase was exceptional in that it did not decrease in absolute terms in either type of muscle and probably increased as much as 50 percent in soleus. Thus, their was a large increase in concentration of this enzyme in the atrophied fibers of both muscles. Another clear-cut finding was the large increase in the range of activities of the glycolytic enzymes among individual fibers of TA muscles. This was due to the emergence of TA fibers with activities for enzymes of this group extending down to levels as low as
On the Temperature Dependence of Enzyme-Catalyzed Rates.
Arcus, Vickery L; Prentice, Erica J; Hobbs, Joanne K; Mulholland, Adrian J; Van der Kamp, Marc W; Pudney, Christopher R; Parker, Emily J; Schipper, Louis A
2016-03-29
One of the critical variables that determine the rate of any reaction is temperature. For biological systems, the effects of temperature are convoluted with myriad (and often opposing) contributions from enzyme catalysis, protein stability, and temperature-dependent regulation, for example. We have coined the phrase "macromolecular rate theory (MMRT)" to describe the temperature dependence of enzyme-catalyzed rates independent of stability or regulatory processes. Central to MMRT is the observation that enzyme-catalyzed reactions occur with significant values of ΔCp(‡) that are in general negative. That is, the heat capacity (Cp) for the enzyme-substrate complex is generally larger than the Cp for the enzyme-transition state complex. Consistent with a classical description of enzyme catalysis, a negative value for ΔCp(‡) is the result of the enzyme binding relatively weakly to the substrate and very tightly to the transition state. This observation of negative ΔCp(‡) has important implications for the temperature dependence of enzyme-catalyzed rates. Here, we lay out the fundamentals of MMRT. We present a number of hypotheses that arise directly from MMRT including a theoretical justification for the large size of enzymes and the basis for their optimum temperatures. We rationalize the behavior of psychrophilic enzymes and describe a "psychrophilic trap" which places limits on the evolution of enzymes in low temperature environments. One of the defining characteristics of biology is catalysis of chemical reactions by enzymes, and enzymes drive much of metabolism. Therefore, we also expect to see characteristics of MMRT at the level of cells, whole organisms, and even ecosystems.
Tatsumi, E; Konishi, Y; Tsujiyama, S
2016-11-01
To examine the activities of residual enzymes in dried shiitake mushrooms, which are a traditional foodstuff in Japanese cuisine, for possible applications in food processing. Polysaccharide-degrading enzymes remained intact in dried shiitake mushrooms and the activities of amylase, β-glucosidase and pectinase were high. A potato digestion was tested using dried shiitake powder. The enzymes reacted with potato tuber specimens to solubilize sugars even under a heterogeneous solid-state condition and that their reaction modes were different at 38 and 50 °C. Dried shiitake mushrooms have a potential use in food processing as an enzyme preparation.
Förster, Nadja; Mewis, Inga; Glatt, Hansruedi; Haack, Michael; Brigelius-Flohé, Regina; Schreiner, Monika; Ulrichs, Christian
2016-11-09
Leaves of Moringa oleifera are used by tribes as biological cancer medicine. Scientific investigations with M. oleifera conducted so far have almost exclusively used total plant extracts. Studies on the activity of single compounds are missing. Therefore, the biological effects of the two main aromatic multi-glycosylated glucosinolates of M. oleifera were investigated in the present study. The cytotoxic effects of M. oleifera glucosinolates were identified for HepG2 cells (NRU assay), for V79-MZ cells (HPRT assay, SCE assay), and for two Salmonella typhimurium strains (Ames test). Genotoxic effects of these glucosinolates were not observed (Ames test, HPRT assay, and SCE assay). Reporter gene assays revealed a significant increase in the ARE-dependent promoter activity of NQO1 and GPx2 indicating an activation of the Nrf2 pathway by M. oleifera glucosinolates. Since both enzymes can also be induced via activation of the AhR, plasmids containing promoters of both enzymes mutated in the respective binding sites (pGL3enh-hNQO1-ARE, pGL3enh-hNQO1-XRE, pGL3bas-hGPX2-mutARE, pGL3bas-hGPX2-mutXRE) were transfected. Analyses revealed that the majority of the stimulating effects was mediated by the ARE motif, whereas the XRE motif played only a minor role. The stimulating effects of M. oleifera glucosinolates could be demonstrated both at the transcriptional (reporter gene assay, real time-PCR) and translational levels (enzyme activity) making them interesting compounds for further investigation.
Kim, Hyun-Woo; Nam, Joo-Youn; Kang, Seok-Tae; Kim, Dong-Hoon; Jung, Kyung-Won; Shin, Hang-Sik
2012-04-01
Extracellular enzymes offer active catalysis for hydrolysis of organic solid wastes in anaerobic digestion. To evidence the quantitative significance of hydrolytic enzyme activities for major waste components, track studies of thermophilic and mesophilic anaerobic sequencing-batch reactors (TASBR and MASBR) were conducted using a co-substrate of real organic wastes. During 1day batch cycle, TASBR showed higher amylase activity for carbohydrate (46%), protease activity for proteins (270%), and lipase activity for lipids (19%) than MASBR. In particular, the track study of protease identified that thermophilic anaerobes degraded protein polymers much more rapidly. Results revealed that differences in enzyme activities eventually affected acidogenic and methanogenic performances. It was demonstrated that the superior nature of enzymatic capability at thermophilic condition led to successive high-rate acidogenesis and 32% higher CH(4) recovery. Consequently, these results evidence that the coupling thermophilic digestion with sequencing-batch operation is a viable option to promote enzymatic hydrolysis of organic particulates. Copyright © 2012 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Solis, C.; Oliver, A.; Andrade, E.; Ruvalcaba-Sil, J.L.; Romero, I.; Celis, H.
1999-01-01
Zinc is a necessary component in the action and structural stability of many enzymes. Some of them are well characterized, but in others, Zn stoichiometry and its association is not known. PIXE has been proven to be a suitable technique for analyzing metallic proteins embedded in electrophoresis gels. In this study, PIXE has been used to investigate the Zn content of enzymes that are known to carry Zn atoms. These include the carbonic anhydrase, an enzyme well characterized by other methods and the cytoplasmic pyrophosphatase of Rhodospirillum rubrum that is known to require Zn to be stable but not how many metal ions are involved or how they are bound to the enzyme. Native proteins have been purified by polyacrylamide gel electrophoresis and direct identification and quantification of Zn in the gel bands was performed with an external proton beam of 3.7 MeV energy
Enzymes - important players in green chemistry
Directory of Open Access Journals (Sweden)
Agata Tarczykowska
2017-09-01
Full Text Available Green chemistry has become a worldwide approach that leads to sustainable growth through application and development of its principles. A lot of work has to be put into designing new processes comprising of materials which do not emit pollutants to the atmosphere. Inventing new safer methods and finding less harmful products can be challenging. Enzymes are a great hope of scientists in the field of green chemistry. Enzymes as catalysts require mild conditions therefore it is a great way of saving resources such as energy or water. Processes with the use of enzymes have become more feasible by being more cost effective and eco friendly. Taking into account the benefits of green chemistry, enzyme biocatalysis has quickly replaced traditional chemical processes in several fields, and this substitution is going to reach even more areas because of new emerging technologies in enzyme engineering.
Zymography methods for visualizing hydrolytic enzymes.
Vandooren, Jennifer; Geurts, Nathalie; Martens, Erik; Van den Steen, Philippe E; Opdenakker, Ghislain
2013-03-01
Zymography is a technique for studying hydrolytic enzymes on the basis of substrate degradation. It is a powerful, but often misinterpreted, tool yielding information on potential hydrolytic activities, enzyme forms and the locations of active enzymes. In this Review, zymography techniques are compared in terms of advantages, limitations and interpretations. With in gel zymography, enzyme forms are visualized according to their molecular weights. Proteolytic activities are localized in tissue sections with in situ zymography. In vivo zymography can pinpoint proteolytic activity to sites in an intact organism. Future development of novel substrate probes and improvement in detection and imaging methods will increase the applicability of zymography for (reverse) degradomics studies.
Enzymes from Higher Eukaryotes for Industrial Biocatalysis
Directory of Open Access Journals (Sweden)
Zhibin Liu
2004-01-01
Full Text Available The industrial production of fine chemicals, feed and food ingredients, pharmaceuticals, agrochemicals and their respective intermediates relies on an increasing application of biocatalysis, i.e. on enzyme or whole-cell catalyzed conversions of molecules. Simple procedures for discovery, cloning and over-expression as well as fast growth favour fungi, yeasts and especially bacteria as sources of biocatalysts. Higher eukaryotes also harbour an almost unlimited number of potential biocatalysts, although to date the limited supply of enzymes, the high heterogeneity of enzyme preparations and the hazard of infectious contaminants keep some interesting candidates out of reach for industrial bioprocesses. In the past only a few animal and plant enzymes from agricultural waste materials were employed in food processing. The use of bacterial expression strains or non-conventional yeasts for the heterologous production of efficient eukaryotic enzymes can overcome the bottleneck in enzyme supply and provide sufficient amounts of homogenous enzyme preparations for reliable and economically feasible applications at large scale. Ideal enzymatic processes represent an environmentally friendly, »near-to-completion« conversion of (mostly non-natural substrates to pure products. Recent developments demonstrate the commercial feasibility of large-scale biocatalytic processes employing enzymes from higher eukaryotes (e.g. plants, animals and also their usefulness in some small-scale industrial applications.
Process for preparing multilayer enzyme coating on a fiber
Kim, Jungbae [Richland, WA; Kwak, Ja Hun [Richland, WA; Grate, Jay W [West Richland, WA
2009-11-03
A process for preparing high stability, high activity biocatalytic materials is disclosed and processes for using the same. The process involves coating of a material or fiber with enzymes and enzyme aggregate providing a material or fiber with high biocatalytic activity and stability useful in heterogeneous environments. In one illustrative approach, enzyme "seeds" are covalently attached to polymer nanofibers followed by treatment with a reagent that crosslinks additional enzyme molecules to the seed enzymes forming enzyme aggregates thereby improving biocatalytic activity due to increased enzyme loading and enzyme stability. This approach creates a useful new biocatalytic immobilized enzyme system with potential applications in bioconversion, bioremediation, biosensors, and biofuel cells.
Adalbjörnsson, Björn V; Toogood, Helen S; Fryszkowska, Anna; Pudney, Christopher R; Jowitt, Thomas A; Leys, David; Scrutton, Nigel S
2010-01-25
We report the crystal structure of a thermophilic "ene" reductase (TOYE) isolated from Thermoanaerobacter pseudethanolicus E39. The crystal structure reveals a tetrameric enzyme and an active site that is relatively large compared to most other structurally determined and related Old Yellow Enzymes. The enzyme adopts higher order oligomeric states (octamers and dodecamers) in solution, as revealed by sedimentation velocity and multiangle laser light scattering. Bead modelling indicates that the solution structure is consistent with the basic tetrameric structure observed in crystallographic studies and electron microscopy. TOYE is stable at high temperatures (T(m)>70 degrees C) and shows increased resistance to denaturation in water-miscible organic solvents compared to the mesophilic Old Yellow Enzyme family member, pentaerythritol tetranitrate reductase. TOYE has typical ene-reductase properties of the Old Yellow Enzyme family. There is currently major interest in using Old Yellow Enzyme family members in the preparative biocatalysis of a number of activated alkenes. The increased stability of TOYE in organic solvents is advantageous for biotransformations in which water-miscible organic solvents and biphasic reaction conditions are required to both deliver novel substrates and minimize product racemisation.
The Enzyme Function Initiative†
Gerlt, John A.; Allen, Karen N.; Almo, Steven C.; Armstrong, Richard N.; Babbitt, Patricia C.; Cronan, John E.; Dunaway-Mariano, Debra; Imker, Heidi J.; Jacobson, Matthew P.; Minor, Wladek; Poulter, C. Dale; Raushel, Frank M.; Sali, Andrej; Shoichet, Brian K.; Sweedler, Jonathan V.
2011-01-01
The Enzyme Function Initiative (EFI) was recently established to address the challenge of assigning reliable functions to enzymes discovered in bacterial genome projects; in this Current Topic we review the structure and operations of the EFI. The EFI includes the Superfamily/Genome, Protein, Structure, Computation, and Data/Dissemination Cores that provide the infrastructure for reliably predicting the in vitro functions of unknown enzymes. The initial targets for functional assignment are selected from five functionally diverse superfamilies (amidohydrolase, enolase, glutathione transferase, haloalkanoic acid dehalogenase, and isoprenoid synthase), with five superfamily-specific Bridging Projects experimentally testing the predicted in vitro enzymatic activities. The EFI also includes the Microbiology Core that evaluates the in vivo context of in vitro enzymatic functions and confirms the functional predictions of the EFI. The deliverables of the EFI to the scientific community include: 1) development of a large-scale, multidisciplinary sequence/structure-based strategy for functional assignment of unknown enzymes discovered in genome projects (target selection, protein production, structure determination, computation, experimental enzymology, microbiology, and structure-based annotation); 2) dissemination of the strategy to the community via publications, collaborations, workshops, and symposia; 3) computational and bioinformatic tools for using the strategy; 4) provision of experimental protocols and/or reagents for enzyme production and characterization; and 5) dissemination of data via the EFI’s website, enzymefunction.org. The realization of multidisciplinary strategies for functional assignment will begin to define the full metabolic diversity that exists in nature and will impact basic biochemical and evolutionary understanding, as well as a wide range of applications of central importance to industrial, medicinal and pharmaceutical efforts. PMID
The Enzyme Function Initiative.
Gerlt, John A; Allen, Karen N; Almo, Steven C; Armstrong, Richard N; Babbitt, Patricia C; Cronan, John E; Dunaway-Mariano, Debra; Imker, Heidi J; Jacobson, Matthew P; Minor, Wladek; Poulter, C Dale; Raushel, Frank M; Sali, Andrej; Shoichet, Brian K; Sweedler, Jonathan V
2011-11-22
The Enzyme Function Initiative (EFI) was recently established to address the challenge of assigning reliable functions to enzymes discovered in bacterial genome projects; in this Current Topic, we review the structure and operations of the EFI. The EFI includes the Superfamily/Genome, Protein, Structure, Computation, and Data/Dissemination Cores that provide the infrastructure for reliably predicting the in vitro functions of unknown enzymes. The initial targets for functional assignment are selected from five functionally diverse superfamilies (amidohydrolase, enolase, glutathione transferase, haloalkanoic acid dehalogenase, and isoprenoid synthase), with five superfamily specific Bridging Projects experimentally testing the predicted in vitro enzymatic activities. The EFI also includes the Microbiology Core that evaluates the in vivo context of in vitro enzymatic functions and confirms the functional predictions of the EFI. The deliverables of the EFI to the scientific community include (1) development of a large-scale, multidisciplinary sequence/structure-based strategy for functional assignment of unknown enzymes discovered in genome projects (target selection, protein production, structure determination, computation, experimental enzymology, microbiology, and structure-based annotation), (2) dissemination of the strategy to the community via publications, collaborations, workshops, and symposia, (3) computational and bioinformatic tools for using the strategy, (4) provision of experimental protocols and/or reagents for enzyme production and characterization, and (5) dissemination of data via the EFI's Website, http://enzymefunction.org. The realization of multidisciplinary strategies for functional assignment will begin to define the full metabolic diversity that exists in nature and will impact basic biochemical and evolutionary understanding, as well as a wide range of applications of central importance to industrial, medicinal, and pharmaceutical efforts.
Enzyme-lipid complex. Koso-shishitsu fukugotai
Energy Technology Data Exchange (ETDEWEB)
Okahata, Y; Ijiro, K [Tokyo Inst. of Technology., Tokyo (Japan)
1990-08-01
Enzyme, as unstable against organic solvent, being to be designed not to be quenched, organic solvent was tried to be made soluble by making enzyme-lipid complex. By mixing aqueous solution of enzyme with aqueous dispersion liquid of lipid, white powder was obtaind. Enzyme has monomolecular film through which reaction substance passes. Lipase-lipid complex, of which monomolecular film is qualified by hydrogen and other soft linkages, homogeneously dissolves in organic solvent and has a high activity, not given by the conventional qualification method. That activity being applied, asymmetrical esterificating reaction of alcohol could be done in organic solvent, containing high concentration reactive substance. While substance selectivity, not known in water, was obtained. Through reaction of amine with amino acid dielectrics in isooctane solvent by {alpha}-chymotrypsin-lipid complex, was indicated an exact substance selectivity. Enzyme-lipid complex dissolving in organic solvent, monomolecular film can be formed without being quenched on aqueous surface, which film can be utilized as sensor film. 10 refs., 5 figs. 1 tab.
Biomedical Applications of Enzymes From Marine Actinobacteria.
Kamala, K; Sivaperumal, P
Marine microbial enzyme technologies have progressed significantly in the last few decades for different applications. Among the various microorganisms, marine actinobacterial enzymes have significant active properties, which could allow them to be biocatalysts with tremendous bioactive metabolites. Moreover, marine actinobacteria have been considered as biofactories, since their enzymes fulfill biomedical and industrial needs. In this chapter, the marine actinobacteria and their enzymes' uses in biological activities and biomedical applications are described. © 2017 Elsevier Inc. All rights reserved.
Muruganandam, Gopinath; Raasakka, Arne; Myllykoski, Matti; Kursula, Inari; Kursula, Petri
2017-05-16
Eukaryotic tRNA splicing is an essential process in the transformation of a primary tRNA transcript into a mature functional tRNA molecule. 5'-phosphate ligation involves two steps: a healing reaction catalyzed by polynucleotide kinase (PNK) in association with cyclic phosphodiesterase (CPDase), and a sealing reaction catalyzed by an RNA ligase. The enzymes that catalyze tRNA healing in yeast and higher eukaryotes are homologous to the members of the 2H phosphoesterase superfamily, in particular to the vertebrate myelin enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase). We employed different biophysical and biochemical methods to elucidate the overall structural and functional features of the tRNA healing enzymes yeast Trl1 PNK/CPDase and lancelet PNK/CPDase and compared them with vertebrate CNPase. The yeast and the lancelet enzymes have cyclic phosphodiesterase and polynucleotide kinase activity, while vertebrate CNPase lacks PNK activity. In addition, we also show that the healing enzymes are structurally similar to the vertebrate CNPase by applying synchrotron radiation circular dichroism spectroscopy and small-angle X-ray scattering. We provide a structural analysis of the tRNA healing enzyme PNK and CPDase domains together. Our results support evolution of vertebrate CNPase from tRNA healing enzymes with a loss of function at its N-terminal PNK-like domain.
Enzyme-Powered Pumps: From Fundamentals to Applications
Ortiz-Rivera, Isamar
Non-mechanical nano and microfluidic devices that function without the aid of an external power source, and can be tailored to meet specific needs, represent the next generation of smart devices. Recently, we have shown that surface-bound enzymes can act as pumps driving large-scale fluid flows in the presence of any substance that triggers the enzymatic reaction (e.g. substrate, co-factor, or biomarker). The fluid velocities attained in such systems depend directly on the enzymatic reaction rate and the concentration of the substance that initiates enzymatic catalysis. The use of biochemical reactions to power a micropump offers the advantages of specificity, sensitivity, and selectively, eliminating at the same time the need of an external power source, while providing biocompatibility. More importantly, these self-powered pumps overcome a significant obstacle in nano- and micro-fluidics: the need to use external pressure-driven pumps to push fluids through devices. Certainly, the development of enzyme-powered devices opens up new venues in biochemical engineering, particularly in the biomedical field. The work highlighted in this dissertation covers all the studies performed with enzyme-powered pumps, from the development of the micropump design, to the efforts invested in understanding the enzyme pump concept as a whole. The data collected to date, aims to expand our knowledge about enzyme-powered micropumps from the inside out: not only by exploring the different applications of these devices at the macroscale, but also by investigating in depth the mechanism of pump activation behind these systems. Specifically, we have focused on: (1) The general features that characterize the pumping behavior observed in enzyme-powered pumps, as well as the optimization of the device, (2) the possible mechanisms behind fluid motion, including the role of enzyme coverage and/or activity on the transduction of chemical energy into mechanical fluid flow in these devices
Digestive enzymes of some earthworms.
Mishra, P C; Dash, M C
1980-10-15
4 species of tropical earthworms differed with regard to enzyme activity. The maximum activity of protease and of cellulase occurred in the posterior region of the gut of the earthworms. On the average Octochaetona surensis shows maximum activity and Drawida calebi shows minimum activity for all the enzymes studied.
Activity assessment of microbial fibrinolytic enzymes.
Kotb, Essam
2013-08-01
Conversion of fibrinogen to fibrin inside blood vessels results in thrombosis, leading to myocardial infarction and other cardiovascular diseases. In general, there are four therapy options: surgical operation, intake of antiplatelets, anticoagulants, or fibrinolytic enzymes. Microbial fibrinolytic enzymes have attracted much more attention than typical thrombolytic agents because of the expensive prices and the side effects of the latter. The fibrinolytic enzymes were successively discovered from different microorganisms, the most important among which is the genus Bacillus. Microbial fibrinolytic enzymes, especially those from food-grade microorganisms, have the potential to be developed as functional food additives and drugs to prevent or cure thrombosis and other related diseases. There are several assay methods for these enzymes; this may due to the insolubility of substrate, fibrin. Existing assay methods can be divided into three major groups. The first group consists of assay of fibrinolytic activity with natural proteins as substrates, e.g., fibrin plate methods. The second and third groups of assays are suitable for kinetic studies and are based on the determination of hydrolysis of synthetic peptide esters. This review will deal primarily with the microorganisms that have been reported in literature to produce fibrinolytic enzymes and the first review discussing the methods used to assay the fibrinolytic activity.
Purification and characterization of extracellular amylolytic enzyme ...
African Journals Online (AJOL)
In the present study, the amylase enzyme producing potential of four different Aspergillus species was analyzed. The extracted amylase enzyme was purified by diethyl amino ethyl (DEAE) cellulose and Sephadex G-50 column chromatography and the enzyme activity was measured by using synthetic substrate starch.
Interaction and modulation of two antagonistic cell wall enzymes of mycobacteria.
Directory of Open Access Journals (Sweden)
Erik C Hett
2010-07-01
Full Text Available Bacterial cell growth and division require coordinated cell wall hydrolysis and synthesis, allowing for the removal and expansion of cell wall material. Without proper coordination, unchecked hydrolysis can result in cell lysis. How these opposing activities are simultaneously regulated is poorly understood. In Mycobacterium tuberculosis, the resuscitation-promoting factor B (RpfB, a lytic transglycosylase, interacts and synergizes with Rpf-interacting protein A (RipA, an endopeptidase, to hydrolyze peptidoglycan. However, it remains unclear what governs this synergy and how it is coordinated with cell wall synthesis. Here we identify the bifunctional peptidoglycan-synthesizing enzyme, penicillin binding protein 1 (PBP1, as a RipA-interacting protein. PBP1, like RipA, localizes both at the poles and septa of dividing cells. Depletion of the ponA1 gene, encoding PBP1 in M. smegmatis, results in a severe growth defect and abnormally shaped cells, indicating that PBP1 is necessary for viability and cell wall stability. Finally, PBP1 inhibits the synergistic hydrolysis of peptidoglycan by the RipA-RpfB complex in vitro. These data reveal a post-translational mechanism for regulating cell wall hydrolysis and synthesis through protein-protein interactions between enzymes with antagonistic functions.
[Automated analyzer of enzyme immunoassay].
Osawa, S
1995-09-01
Automated analyzers for enzyme immunoassay can be classified by several points of view: the kind of labeled antibodies or enzymes, detection methods, the number of tests per unit time, analytical time and speed per run. In practice, it is important for us consider the several points such as detection limits, the number of tests per unit time, analytical range, and precision. Most of the automated analyzers on the market can randomly access and measure samples. I will describe the recent advance of automated analyzers reviewing their labeling antibodies and enzymes, the detection methods, the number of test per unit time and analytical time and speed per test.
Munteanu, Cristian Robert
2014-01-01
Comparison of Enzymes / Non-Enzymes Proteins Classification Models Based on 3D, Composition, Sequences and Topological Indices, German Conference on Bioinformatics (GCB), Potsdam, Germany (September, 2007)
Early evolution of efficient enzymes and genome organization
Directory of Open Access Journals (Sweden)
Szilágyi András
2012-10-01
Full Text Available Abstract Background Cellular life with complex metabolism probably evolved during the reign of RNA, when it served as both information carrier and enzyme. Jensen proposed that enzymes of primordial cells possessed broad specificities: they were generalist. When and under what conditions could primordial metabolism run by generalist enzymes evolve to contemporary-type metabolism run by specific enzymes? Results Here we show by numerical simulation of an enzyme-catalyzed reaction chain that specialist enzymes spread after the invention of the chromosome because protocells harbouring unlinked genes maintain largely non-specific enzymes to reduce their assortment load. When genes are linked on chromosomes, high enzyme specificity evolves because it increases biomass production, also by reducing taxation by side reactions. Conclusion The constitution of the genetic system has a profound influence on the limits of metabolic efficiency. The major evolutionary transition to chromosomes is thus proven to be a prerequisite for a complex metabolism. Furthermore, the appearance of specific enzymes opens the door for the evolution of their regulation. Reviewers This article was reviewed by Sándor Pongor, Gáspár Jékely, and Rob Knight.
Contemporary enzyme based technologies for bioremediation: A review.
Sharma, Babita; Dangi, Arun Kumar; Shukla, Pratyoosh
2018-03-15
The persistent disposal of xenobiotic compounds like insecticides, pesticides, fertilizers, plastics and other hydrocarbon containing substances is the major source of environmental pollution which needs to be eliminated. Many contemporary remediation methods such as physical, chemical and biological are currently being used, but they are not sufficient to clean the environment. The enzyme based bioremediation is an easy, quick, eco-friendly and socially acceptable approach used for the bioremediation of these recalcitrant xenobiotic compounds from the natural environment. Several microbial enzymes with bioremediation capability have been isolated and characterized from different natural sources, but less production of such enzymes is a limiting their further exploitation. The genetic engineering approach has the potential to get large amount of recombinant enzymes. Along with this, enzyme immobilization techniques can boost the half-life, stability and activity of enzymes at a significant level. Recently, nanozymes may offer the potential bioremediation ability towards a broad range of pollutants. In the present review, we have described a brief overview of the microbial enzymes, different enzymes techniques (genetic engineering and immobilization of enzymes) and nanozymes involved in bioremediation of toxic, carcinogenic and hazardous environmental pollutants. Copyright © 2018 Elsevier Ltd. All rights reserved.
A thermodynamic and theoretical view for enzyme regulation.
Zhao, Qinyi
2015-01-01
Precise regulation is fundamental to the proper functioning of enzymes in a cell. Current opinions about this, such as allosteric regulation and dynamic contribution to enzyme regulation, are experimental models and substantially empirical. Here we proposed a theoretical and thermodynamic model of enzyme regulation. The main idea is that enzyme regulation is processed via the regulation of abundance of active conformation in the reaction buffer. The theoretical foundation, experimental evidence, and experimental criteria to test our model are discussed and reviewed. We conclude that basic principles of enzyme regulation are laws of protein thermodynamics and it can be analyzed using the concept of distribution curve of active conformations of enzymes.
Activation of interfacial enzymes at membrane surfaces
DEFF Research Database (Denmark)
Mouritsen, Ole G.; Andresen, Thomas Lars; Halperin, Avi
2006-01-01
A host of water-soluble enzymes are active at membrane surfaces and in association with membranes. Some of these enzymes are involved in signalling and in modification and remodelling of the membranes. A special class of enzymes, the phospholipases, and in particular secretory phospholipase A2 (s...
Convective flow reversal in self-powered enzyme micropumps.
Ortiz-Rivera, Isamar; Shum, Henry; Agrawal, Arjun; Sen, Ayusman; Balazs, Anna C
2016-03-08
Surface-bound enzymes can act as pumps that drive large-scale fluid flows in the presence of their substrates or promoters. Thus, enzymatic catalysis can be harnessed for “on demand” pumping in nano- and microfluidic devices powered by an intrinsic energy source. The mechanisms controlling the pumping have not, however, been completely elucidated. Herein, we combine theory and experiments to demonstrate a previously unreported spatiotemporal variation in pumping behavior in urease-based pumps and uncover the mechanisms behind these dynamics. We developed a theoretical model for the transduction of chemical energy into mechanical fluid flow in these systems, capturing buoyancy effects due to the solution containing nonuniform concentrations of substrate and product. We find that the qualitative features of the flow depend on the ratios of diffusivities δ=D(P)/D(S) and expansion coefficients β=β(P)/β(S) of the reaction substrate (S) and product (P). If δ>1 and δ>β (or if δself-powered fluidic devices.
Rethinking fundamentals of enzyme action.
Northrop, D B
1999-01-01
Despite certain limitations, investigators continue to gainfully employ concepts rooted in steady-state kinetics in efforts to draw mechanistically relevant inferences about enzyme catalysis. By reconsidering steady-state enzyme kinetic behavior, this review develops ideas that allow one to arrive at the following new definitions: (a) V/K, the ratio of the maximal initial velocity divided by the Michaelis-Menten constant, is the apparent rate constant for the capture of substrate into enzyme complexes that are destined to yield product(s) at some later point in time; (b) the maximal velocity V is the apparent rate constant for the release of substrate from captured complexes in the form of free product(s); and (c) the Michaelis-Menten constant K is the ratio of the apparent rate constants for release and capture. The physiologic significance of V/K is also explored to illuminate aspects of antibiotic resistance, the concept of "perfection" in enzyme catalysis, and catalytic proficiency. The conceptual basis of congruent thermodynamic cycles is also considered in an attempt to achieve an unambiguous way for comparing an enzyme-catalyzed reaction with its uncatalyzed reference reaction. Such efforts promise a deeper understanding of the origins of catalytic power, as it relates to stabilization of the reactant ground state, stabilization of the transition state, and reciprocal stabilizations of ground and transition states.
Islam, Shah Md Asraful; Yeasmin, Shabina; Islam, Md Saiful; Islam, Md Shariful
2017-07-01
The binding affinity of organophosphate hydrolase enzyme (OphB) with soil particles in relation to the isoelectric point (pI) was studied. Immobilization of OphB with soil particles was observed by confocal microscopy, Fourier transform infrared spectroscopy (FT-IR), and Atomic force microscopy (AFM). The calculated pI of OphB enzyme was increased from 8.69 to 8.89, 9.04 and 9.16 by the single, double and triple mutant of OphB enzyme, respectively through the replacement of negatively charged aspartate with positively charged histidine. Practically, the binding affinity was increased to 5.30%, 11.50%, and 16.80% for single, double and triple mutants, respectively. In contrast, enzyme activity of OphB did not change by the mutation of the enzyme. On the other hand, adhesion forces were gradually increased for wild type OphB enzyme (90 pN) to 96, 100 and 104 pN for single, double and triple mutants of OphB enzyme, respectively. There was an increasing trend of binding affinity and adhesion force by the increase of isoelectric point (pI) of OphB enzyme. Copyright © 2017 Elsevier Inc. All rights reserved.
Park, Chul Min; Lee, Kyunghoon; Jun, Sun-Hee; Song, Sang Hoon; Song, Junghan
2017-08-15
Deficiencies in erythrocyte metabolic enzymes are associated with hereditary hemolytic anemia. Here, we report the development of a novel multiplex enzyme assay for six major enzymes, namely glucose-6-phosphate dehydrogenase, pyruvate kinase, pyrimidine 5'-nucleotidase, hexokinase, triosephosphate isomerase, and adenosine deaminase, deficiencies in which are implicated in erythrocyte enzymopathies. To overcome the drawbacks of traditional spectrophotometric enzyme assays, the present assay was based on ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). The products of the six enzymes were directly measured by using ion pairing UPLC-MS/MS, and the precision, linearity, ion suppression, optimal sample amounts, and incubation times were evaluated. Eighty-three normal individuals and 13 patients with suspected enzymopathy were analyzed. The UPLC running time was within 5min. No ion suppression was observed at the retention time for the products or internal standards. We selected an optimal dilution factor and incubation time for each enzyme system. The intra- and inter-assay imprecision values (CVs) were 2.5-12.1% and 2.9-14.3%, respectively. The linearity of each system was good, with R 2 values >0.97. Patient samples showed consistently lower enzyme activities than those from normal individuals. The present ion paring UPLC-MS/MS assay enables facile and reproducible multiplex evaluation of the activity of enzymes implicated in enzymopathy-associated hemolytic anemia. Copyright © 2017 Elsevier B.V. All rights reserved.
Seeing & Feeling How Enzymes Work Using Tangible Models
Lau, Kwok-chi
2013-01-01
This article presents a tangible model used to help students tackle some misconceptions about enzyme actions, particularly the induced-fit model, enzyme-substrate complementarity, and enzyme inhibition. The model can simulate how substrates induce a change in the shape of the active site and the role of attraction force during enzyme-substrate…
Mycelial growth interactions and mannan-degrading enzyme ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... enzymes (Frost and Moss, 1987). However, microbial enzymes are more in use due to cheaper substrates and ease of process modification. In microbial enzyme and biomass production, defined mixed culture method in which more than one organism grows simultaneously can result in increased biomass ...
The mechanisms of Excited states in enzymes
DEFF Research Database (Denmark)
Petersen, Frederic Nicolas Rønne; Bohr, Henrik
2010-01-01
Enzyme catalysis is studied on the basis of excited state processes, which are of electronic, vibrational and thermal nature. The ways of achieving the excited state, such as photo-absorption and ligand binding, are discussed and exemplified by various cases of enzymes.......Enzyme catalysis is studied on the basis of excited state processes, which are of electronic, vibrational and thermal nature. The ways of achieving the excited state, such as photo-absorption and ligand binding, are discussed and exemplified by various cases of enzymes....
Li, Xiaofeng; Suhar, Tom; Glass, Lateca; Rajaraman, Ganesh
2014-03-03
Enzyme reaction phenotyping is employed extensively during the early stages of drug discovery to identify the enzymes responsible for the metabolism of new chemical entities (NCEs). Early identification of metabolic pathways facilitates prediction of potential drug-drug interactions associated with enzyme polymorphism, induction, or inhibition, and aids in the design of clinical trials. Incubation of NCEs with human recombinant enzymes is a popular method for such work because of the specificity, simplicity, and high-throughput nature of this approach for phenotyping studies. The availability of a relative abundance factor and calculated intersystem extrapolation factor for the expressed recombinant enzymes facilitates easy scaling of in vitro data, enabling in vitro-in vivo extrapolation. Described in this unit is a high-throughput screen for identifying enzymes involved in the metabolism of NCEs. Emphasis is placed on the analysis of the human recombinant enzymes CYP1A2, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP2B6, and CYP3A4, including the calculation of the intrinsic clearance for each. Copyright © 2014 John Wiley & Sons, Inc. All rights reserved.
Combined effects of pectic enzymes on the degradation of pectin polysaccharides of banana fruit
International Nuclear Information System (INIS)
Jheng, G.; Jiang, Y.; Ghen, Y.; Yang, S.
2011-01-01
Pectin polysaccharide is one of the major components of the primary cellular wall in the middle lamella of plant tissues. The degradation of pectin polysaccharide contributes to fruit softening. In this study, water-soluble pectin (WSP) and acid-soluble pectin (ASP) were isolated from pulp tissues of banana fruit at various ripening stages, and combinations of the enzymes such as polygalcturonase (PG), pectin methylesterase (PME) and beta-galactosidase (beta-Gal) were used to investigate the effect on the degradation of WSP and ASP. PG promoted the degradation of pectin polysaccharides, especially in ASP. An enhanced effect of the degradation of WSP and ASP from various ripening banana fruit was observed in the presence of PME. In addition, beta-Gal accelerated slightly the degradation of WSP and ASP in the presence of PG. Overall, PG, PME and beta-Gal can coordinate to promote the degradation of pectin polysaccharides of banana fruit, resulting in fruit softening. (author)
Spherezymes: A novel structured self-immobilisation enzyme technology
Directory of Open Access Journals (Sweden)
Arumugam Cherise
2008-01-01
Full Text Available Abstract Background Enzymes have found extensive and growing application in the field of chemical organic synthesis and resolution of chiral intermediates. In order to stabilise the enzymes and to facilitate their recovery and recycle, they are frequently immobilised. However, immobilisation onto solid supports greatly reduces the volumetric and specific activity of the biocatalysts. An alternative is to form self-immobilised enzyme particles. Results Through addition of protein cross-linking agents to a water-in-oil emulsion of an aqueous enzyme solution, structured self-immobilised spherical enzyme particles of Pseudomonas fluorescens lipase were formed. The particles could be recovered from the emulsion, and activity in aqueous and organic solvents was successfully demonstrated. Preliminary data indicates that the lipase tended to collect at the interface. Conclusion The immobilised particles provide a number of advantages. The individual spherical particles had a diameter of between 0.5–10 μm, but tended to form aggregates with an average particle volume distribution of 100 μm. The size could be controlled through addition of surfactant and variations in protein concentration. The particles were robust enough to be recovered by centrifugation and filtration, and to be recycled for further reactions. They present lipase enzymes with the active sites selectively orientated towards the exterior of the particle. Co-immobilisation with other enzymes, or other proteins such as albumin, was also demonstrated. Moreover, higher activity for small ester molecules could be achieved by the immobilised enzyme particles than for free enzyme, presumably because the lipase conformation required for catalysis had been locked in place during immobilisation. The immobilised enzymes also demonstrated superior activity in organic solvent compared to the original free enzyme. This type of self-immobilised enzyme particle has been named spherezymes.
Spatial distribution of enzyme activities in the rhizosphere
Razavi, Bahar S.; Zarebanadkouki, Mohsen; Blagodatskaya, Evgenia; Kuzyakov, Yakov
2015-04-01
The rhizosphere, the tiny zone of soil surrounding roots, certainly represents one of the most dynamic habitat and interfaces on Earth. Activities of enzymes produced by both plant roots and microbes are the primary biological drivers of organic matter decomposition and nutrient cycling. That is why there is an urgent need in spatially explicit methods for the determination of the rhizosphere extension and enzyme distribution. Recently, zymography as a new technique based on diffusion of enzymes through the 1 mm gel plate for analysis has been introduced (Spohn & Kuzyakov, 2013). We developed the zymography technique to visualize the enzyme activities with a higher spatial resolution. For the first time, we aimed at quantitative imaging of enzyme activities as a function of distance from the root tip and the root surface in the soil. We visualized the two dimensional distribution of the activity of three enzymes: β-glucosidase, phosphatase and leucine amino peptidase in the rhizosphere of maize using fluorogenically labelled substrates. Spatial-resolution of fluorescent images was improved by direct application of a substrate saturated membrane to the soil-root system. The newly-developed direct zymography visualized heterogeneity of enzyme activities along the roots. The activity of all enzymes was the highest at the apical parts of individual roots. Across the roots, the enzyme activities were higher at immediate vicinity of the roots (1.5 mm) and gradually decreased towards the bulk soil. Spatial patterns of enzyme activities as a function of distance from the root surface were enzyme specific, with highest extension for phosphatase. We conclude that improved zymography is promising in situ technique to analyze, visualize and quantify spatial distribution of enzyme activities in the rhizosphere hotspots. References Spohn, M., Kuzyakov, Y., 2013. Phosphorus mineralization can be driven by microbial need for carbon. Soil Biology & Biochemistry 61: 69-75
Review of the biochemical basis of enzyme immunoassays
International Nuclear Information System (INIS)
Klingler, W.
1982-01-01
The ever increasing number of radioimmunological determination poses problems allied with the handling of radioactive substances. In recent years various non-radioactive methods have been developed, among which the enzyme immunoassay is already in routine use. Homogeneous and heterogeneous enzyme immunoassays are described. Criteria for enzymes, substrates and enzyme-substrate reactions are listed. (orig.) [de
Enzymic conversion of starch to glucose
Energy Technology Data Exchange (ETDEWEB)
1964-08-19
Corn is steeped in a SO/sub 2/ solution for 30 to 40 hours, coarsely ground, separated from the germ, and filtered. A 35% suspension of the germ-free corn, still containing fibers, hull, and gluten, is treated with Ca(OH)/sub 2/ to raise the pH to 6.5 to 7.0. A starch-liquifying enzyme is added and after a 2 hours treatment at 85/sup 0/ the liquefied starch is cooled to 60/sup 0/ and the pH is adjusted to 4.5 to 5.0 with H/sub 2/SO/sub 4/. A saccharifying enzyme is now added. After 40 to 81 hours, a raw glucose solution is obtained and is freed from fibers and gluten by filtration. The commercial starch-liquifying enzymes are designated HT-1000 and Neozyme 3 LC (liquid). The saccharifying enzymes are Diazyme or Diazyme L 30 (liquid). The solid enzymes are used at a level up to 0.1% by weight of the starch. Up to 100% conversion of starch into glucose is achieved.
Preliminary characterization of digestive enzymes in freshwater mussels
Sauey, Blake W.; Amberg, Jon J.; Cooper, Scott T.; Grunwald, Sandra K.; Newton, Teresa J.; Haro, Roger J.
2015-01-01
Resource managers lack an effective chemical tool to control the invasive zebra mussel Dreissena polymorpha. Zebra mussels clog water intakes for hydroelectric companies, harm unionid mussel species, and are believed to be a reservoir of avian botulism. Little is known about the digestive physiology of zebra mussels and unionid mussels. The enzymatic profile of the digestive glands of zebra mussels and native threeridge (Amblema plicata) and plain pocketbook mussels (Lampsilis cardium) are characterized using a commercial enzyme kit, api ZYM, and validated the kit with reagent-grade enzymes. A linear correlation was shown for only one of nineteen enzymes, tested between the api ZYM kit and a specific enzyme kit. Thus, the api ZYM kit should only be used to make general comparisons of enzyme presence and to observe trends in enzyme activities. Enzymatic trends were seen in the unionid mussel species, but not in zebra mussels sampled 32 days apart from the same location. Enzymatic classes, based on substrate, showed different trends, with proteolytic and phospholytic enzymes having the most change in relative enzyme activity.
Bacterial Enzymes and Antibiotic Resistance- Oral Presentation
Energy Technology Data Exchange (ETDEWEB)
Maltz, Lauren [SLAC National Accelerator Lab., Menlo Park, CA (United States)
2015-08-25
By using protein crystallography and X-ray diffraction, structures of bacterial enzymes were solved to gain a better understanding of how enzymatic modification acts as an antibacterial resistance mechanism. Aminoglycoside phosphotransferases (APHs) are one of three aminoglycoside modifying enzymes that confer resistance to the aminoglycoside antibiotics via enzymatic modification, rendering many drugs obsolete. Specifically, the APH(2”) family vary in their substrate specificities and also in their preference for the phosphate donor (ADP versus GDP). By solving the structures of members of the APH(2”) family of enzymes, we can see how domain movements are important to their substrate specificity. Our structure of the ternary complex of APH(2”)-IIIa with GDP and kanamycin, when compared to the known structures of APH(2”)-IVa, reveals that there are real physical differences between these two enzymes, a structural finding that explains why the two enzymes differ in their preferences for certain aminoglycosides. Another important group of bacterial resistance enzymes are the Class D β-lactamases. Oxacillinase carbapenemases (OXAs) are part of this enzyme class and have begun to confer resistance to ‘last resort’ drugs, most notably carbapenems. Our structure of OXA-143 shows that the conformational flexibility of a conserved hydrophobic residue in the active site (Val130) serves to control the entry of a transient water molecule responsible for a key step in the enzyme’s mechanism. Our results provide insight into the structural mechanisms of these two different enzymes.
Overproduction of ligninolytic enzymes
Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas
2014-06-17
Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.
Evaluation of thermostable enzymes for bioethanol processing
DEFF Research Database (Denmark)
Skovgaard, Pernille Anastasia
of fermentable sugars (glucose) as cellulose is tightly linked to hemicellulose and lignin. Lignocellulose is disrupted during pretreatment, but to degrade cellulose to single sugars, lignocellulolytic enzymes such as cellulases and hemicellulases are needed. Lignocellulolytic enzymes are costly...... for the ioethanol production, but the expenses can be reduced by using thermostable enzymes, which are known for their increased stability and inhibitor olerance. However, the advantage of using thermostable enzymes has not been studied thoroughly and more knowledge is needed for development of bioethanol processes....... Enzymes are added to the bioethanol process after pretreatment. For an efficient sugar and ethanol yield, the solids content of biomass is normally increased, which results in highly viscous slurries that are difficult to mix. Therefore, the first enzymatic challenge is to ensure rapid reduction...
Fungal enzymes in the attine ant symbiosis
DEFF Research Database (Denmark)
de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan
the more basal attine genera use substrates such as flowers, plant debris, small twigs, insect feces and insect carcasses. This diverse array of fungal substrates across the attine lineage implies that the symbiotic fungus needs different enzymes to break down the plant material that the ants provide...... or different efficiencies of enzyme function. Fungal enzymes that degrade plant cell walls may have functionally co-evolved with the ants in this scenario. We explore this hypothesis with direct measurements of enzyme activity in fungus gardens in 12 species across 8 genera spanning the entire phylogeny...... and diversity of life-styles within the attine clade. We find significant differences in enzyme activity between different genera and life-styles of the ants. How these findings relate to attine ant coevolution and crop optimization are discussed....
Self-powered enzyme micropumps
Sengupta, Samudra; Patra, Debabrata; Ortiz-Rivera, Isamar; Agrawal, Arjun; Shklyaev, Sergey; Dey, Krishna K.; Córdova-Figueroa, Ubaldo; Mallouk, Thomas E.; Sen, Ayusman
2014-05-01
Non-mechanical nano- and microscale pumps that function without the aid of an external power source and provide precise control over the flow rate in response to specific signals are needed for the development of new autonomous nano- and microscale systems. Here we show that surface-immobilized enzymes that are independent of adenosine triphosphate function as self-powered micropumps in the presence of their respective substrates. In the four cases studied (catalase, lipase, urease and glucose oxidase), the flow is driven by a gradient in fluid density generated by the enzymatic reaction. The pumping velocity increases with increasing substrate concentration and reaction rate. These rechargeable pumps can be triggered by the presence of specific analytes, which enables the design of enzyme-based devices that act both as sensor and pump. Finally, we show proof-of-concept enzyme-powered devices that autonomously deliver small molecules and proteins in response to specific chemical stimuli, including the release of insulin in response to glucose.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Furong; Yu, Xuming [Department of Pharmacology, School of Basic Medical Sciences, Wuhan University, Wuhan 430071 (China); He, Chunyan [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Wuhan University, Wuhan 430071 (China); Ouyang, Xiufang; Wu, Jinhua; Li, Jie; Zhang, Junjie; Duan, Xuejiao [Department of Pharmacology, School of Basic Medical Sciences, Wuhan University, Wuhan 430071 (China); Wan, Yu [Department of Physiology, School of Basic Medical Sciences, Wuhan University, Wuhan 430071 (China); Yue, Jiang, E-mail: yuejiang@whu.edu.cn [Department of Pharmacology, School of Basic Medical Sciences, Wuhan University, Wuhan 430071 (China)
2015-12-15
The arachidonic acid (AA) metabolizing enzymes are the potential therapeutic targets of cardiovascular diseases (CVDs). As sex differences have been shown in the risk and outcome of CVDs, we investigated the regulation of heart AA metabolizing enzymes (COXs, LOXs, and CYPs) by sex-dependent growth hormone (GH) secretory patterns. The pulsatile (masculine) GH secretion at a physiological concentration decreased CYP1A1 and CYP2J3 mRNA levels more efficiently in the H9c2 cells compared with the constant (feminine) GH secretion; however, CYP1B1 mRNA levels were higher following the pulsatile GH secretion. Sex differences in CYP1A1, CYP1B1, and CYP2J11 mRNA levels were observed in both the wild-type and GHR deficient mice. No sex differences in the mRNA levels of COXs, LOXs, or CYP2E1 were observed in the wild-type mice. The constant GH infusion induced heart CYP1A1 and CYP2J11, and decreased CYP1B1 in the male C57/B6 mice constantly infused with GH (0.4 μg/h, 7 days). The activity of rat Cyp2j3 promoter was inhibited by the STAT5B protein, but was activated by C/EBPα (CEBPA). Compared with the constant GH administration, the levels of the nuclear phosphorylated STAT5B protein and its binding to the rat Cyp2j3 promoter were higher following the pulsatile GH administration. The constant GH infusion decreased the binding of the nuclear phosphorylated STAT5B protein to the mouse Cyp2j11 promoter. The data suggest the sexually dimorphic transcription of heart AA metabolizing enzymes, which might alter the risk and outcome of CVDs. GHR-STAT5B signal transduction pathway may be involved in the sex difference in heart CYP2J levels. - Highlights: • The transcription of heart Cyp1a1, Cyp1b1 and Cyp2j genes is sexually dimorphic. • There are no sex differences in the mRNA levels of heart COXs, LOXs, or CYP2E1. • GHR-STAT5B pathway is involved in sexually dimorphic transcription of heart Cpy2j genes. • Heart CYPs-mediated metabolism pathway of arachidonic acid may be sex
International Nuclear Information System (INIS)
Zhang, Furong; Yu, Xuming; He, Chunyan; Ouyang, Xiufang; Wu, Jinhua; Li, Jie; Zhang, Junjie; Duan, Xuejiao; Wan, Yu; Yue, Jiang
2015-01-01
The arachidonic acid (AA) metabolizing enzymes are the potential therapeutic targets of cardiovascular diseases (CVDs). As sex differences have been shown in the risk and outcome of CVDs, we investigated the regulation of heart AA metabolizing enzymes (COXs, LOXs, and CYPs) by sex-dependent growth hormone (GH) secretory patterns. The pulsatile (masculine) GH secretion at a physiological concentration decreased CYP1A1 and CYP2J3 mRNA levels more efficiently in the H9c2 cells compared with the constant (feminine) GH secretion; however, CYP1B1 mRNA levels were higher following the pulsatile GH secretion. Sex differences in CYP1A1, CYP1B1, and CYP2J11 mRNA levels were observed in both the wild-type and GHR deficient mice. No sex differences in the mRNA levels of COXs, LOXs, or CYP2E1 were observed in the wild-type mice. The constant GH infusion induced heart CYP1A1 and CYP2J11, and decreased CYP1B1 in the male C57/B6 mice constantly infused with GH (0.4 μg/h, 7 days). The activity of rat Cyp2j3 promoter was inhibited by the STAT5B protein, but was activated by C/EBPα (CEBPA). Compared with the constant GH administration, the levels of the nuclear phosphorylated STAT5B protein and its binding to the rat Cyp2j3 promoter were higher following the pulsatile GH administration. The constant GH infusion decreased the binding of the nuclear phosphorylated STAT5B protein to the mouse Cyp2j11 promoter. The data suggest the sexually dimorphic transcription of heart AA metabolizing enzymes, which might alter the risk and outcome of CVDs. GHR-STAT5B signal transduction pathway may be involved in the sex difference in heart CYP2J levels. - Highlights: • The transcription of heart Cyp1a1, Cyp1b1 and Cyp2j genes is sexually dimorphic. • There are no sex differences in the mRNA levels of heart COXs, LOXs, or CYP2E1. • GHR-STAT5B pathway is involved in sexually dimorphic transcription of heart Cpy2j genes. • Heart CYPs-mediated metabolism pathway of arachidonic acid may be sex
Directory of Open Access Journals (Sweden)
Xiangping Tan
2014-01-01
Full Text Available Here the spatial distribution of soil enzymatic properties in agricultural land was evaluated on a county-wide (567 km2 scale in Changwu, Shaanxi Province, China. The spatial variations in activities of five hydrolytic enzymes were examined using geostatistical methods. The relationships between soil enzyme activities and other soil properties were evaluated using both an integrated total enzyme activity index (TEI and the geometric mean of enzyme activities (GME. At the county scale, soil invertase, phosphatase, and catalase activities were moderately spatially correlated, whereas urease and dehydrogenase activities were weakly spatially correlated. Correlation analysis showed that both TEI and GME were better correlated with selected soil physicochemical properties than single enzyme activities. Multivariate regression analysis showed that soil OM content had the strongest positive effect while soil pH had a negative effect on the two enzyme activity indices. In addition, total phosphorous content had a positive effect on TEI and GME in orchard soils, whereas alkali-hydrolyzable nitrogen and available potassium contents, respectively, had negative and positive effects on these two enzyme indices in cropland soils. The results indicate that land use changes strongly affect soil enzyme activities in agricultural land, where TEI provides a sensitive biological indicator for soil quality.
International Nuclear Information System (INIS)
Jiang, Yu Ping; Cheng, Fei; Zhou, Yan Hong; Xia, Xiao Jian; Mao, Wei Hua; Shi, Kai; Chen, Zhi Xiang; Yu, Jing Quan
2012-01-01
Highlights: ► Activity of certain Calvin cycle enzymes and CO 2 assimilation are induced by BRs. ► BRs upregulate the activity of the ascorbate–glutathione cycle in the chloroplasts. ► BRs increase the chloroplast thiol reduction state. ► A BR-induced reducing environment increases the stability of photosynthetic enzymes. -- Abstract: Brassinosteroids (BRs) play important roles in plant growth, development, photosynthesis and stress tolerance; however, the mechanism underlying BR-enhanced photosynthesis is currently unclear. Here, we provide evidence that an increase in the BR level increased the quantum yield of PSII, activities of Rubisco activase (RCA) and fructose-1,6-bisphosphatase (FBPase), and CO 2 assimilation. BRs upregulated the transcript levels of genes and activity of enzymes involved in the ascorbate–glutathione cycle in the chloroplasts, leading to an increased ratio of reduced (GSH) to oxidized (GSSG) glutathione in the chloroplasts. An increased GSH/GSSG ratio protected RCA from proteolytic digestion and increased the stability of redox-sensitive enzymes in the chloroplasts. These results strongly suggest that BRs are capable of regulating the glutathione redox state in the chloroplasts through the activation of the ascorbate–glutathione cycle. The resulting increase in the chloroplast thiol reduction state promotes CO 2 assimilation, at least in part, by enhancing the stability and activity of redox-sensitive photosynthetic enzymes through post-translational modifications.
Directed evolution of enzymes using microfluidic chips
Pilát, Zdeněk.; Ježek, Jan; Šmatlo, Filip; Kaůka, Jan; Zemánek, Pavel
2016-12-01
Enzymes are highly versatile and ubiquitous biological catalysts. They can greatly accelerate large variety of reactions, while ensuring appropriate catalytic activity and high selectivity. These properties make enzymes attractive biocatalysts for a wide range of industrial and biomedical applications. Over the last two decades, directed evolution of enzymes has transformed the field of protein engineering. We have devised microfluidic systems for directed evolution of haloalkane dehalogenases in emulsion droplets. In such a device, individual bacterial cells producing mutated variants of the same enzyme are encapsulated in microdroplets and supplied with a substrate. The conversion of a substrate by the enzyme produced by a single bacterium changes the pH in the droplet which is signalized by pH dependent fluorescence probe. The droplets with the highest enzymatic activity can be separated directly on the chip by dielectrophoresis and the resultant cell lineage can be used for enzyme production or for further rounds of directed evolution. This platform is applicable for fast screening of large libraries in directed evolution experiments requiring mutagenesis at multiple sites of a protein structure.
Lysosomal enzyme activation in irradiated mammary tumors
International Nuclear Information System (INIS)
Clarke, C.; Wills, E.D.
1976-01-01
Lysosomal enzyme activity of C3H mouse mammary tumors was measured quantitatively by a histochemical method. Following whole-body doses of 3600 rad or less no changes were observed in the lysosomal enzyme activity for 12 hr after the irradiation, but very large increases in acid phosphatase and β-naphthylamidase activity were, however, observed 24 hr after irradiation. Significant increases in enzyme activity were detected 72 hr after a dose of 300 rad and the increases of enzyme activity were dose dependent over the range 300 to 900 rad. Testosterone (80 mg/kg) injected into mice 2 hr before irradiation (850 rad) caused a significant increase of lysosomal enzyme activity over and above that of the same dose of irradiation alone. If the tumor-bearing mice were given 95 percent oxygen/5 percent carbon dioxide to breathe for 8 min before irradiation the effect of 850 rad on lysosomal acid phosphatase was increased to 160 percent/that of the irradiation given alone. Activitation of lysosomal enzymes in mammary tumors is an important primary or secondary consequence of radiation
Visualization of enzyme activities inside earthworm pores
Hoang, Duyen; Razavi, Bahar S.
2015-04-01
In extremely dynamic microhabitats as bio-pores made by earthworm, the in situ enzyme activities are assumed as a footprint of complex biotic interactions. Our study focused on the effect of earthworm on the enzyme activities inside bio-pores and visualizing the differences between bio-pores and earthworm-free soil by zymography technique (Spohn and Kuzyakov, 2013). For the first time, we aimed at quantitative imaging of enzyme activities in bio-pores. Lumbricus terrestris L. was placed into transparent box (15×20×15cm). After two weeks when bio-pore systems were formed by earthworms, we visualized in situ enzyme activities of five hydrolytic enzymes (β-glucosidase, cellobiohydrolase, chitinase, xylanase, leucine-aminopeptidase, and phosphatase. Zymography showed higher activity of β-glucosidase, chitinase, xylanase and phosphatase in biopores comparing to bulk soil. However, the differences in activity of cellobiohydrolase and leucine aminopeptidase between bio-pore and bulk soil were less pronounced. This demonstrated an applicability of zymography approach to monitor and to distinguish the in situ activity of hydrolytic enzymes in soil biopores.
Substrate-driven chemotactic assembly in an enzyme cascade
Zhao, Xi; Palacci, Henri; Yadav, Vinita; Spiering, Michelle M.; Gilson, Michael K.; Butler, Peter J.; Hess, Henry; Benkovic, Stephen J.; Sen, Ayusman
2018-03-01
Enzymatic catalysis is essential to cell survival. In many instances, enzymes that participate in reaction cascades have been shown to assemble into metabolons in response to the presence of the substrate for the first enzyme. However, what triggers metabolon formation has remained an open question. Through a combination of theory and experiments, we show that enzymes in a cascade can assemble via chemotaxis. We apply microfluidic and fluorescent spectroscopy techniques to study the coordinated movement of the first four enzymes of the glycolysis cascade: hexokinase, phosphoglucose isomerase, phosphofructokinase and aldolase. We show that each enzyme independently follows its own specific substrate gradient, which in turn is produced by the preceding enzymatic reaction. Furthermore, we find that the chemotactic assembly of enzymes occurs even under cytosolic crowding conditions.
Enzymes as Biocatalysts for Lipid-based Bioproducts Processing
DEFF Research Database (Denmark)
Cheong, Ling-Zhi; Guo, Zheng; Fedosov, Sergey
2012-01-01
Bioproducts are materials, chemicals and energy derived from renewable biological resources such as agriculture, forestry, and biologically-derived wastes. To date, the use of enzymes as biocatalysts for lipid-based bioproducts processing has shown marked increase. This is mainly due to the fact...... that cost benefit derived from enzymatic processing such as enzyme specificity, higher product purity and lesser or none toxic waste disposal has surpassed the cost of biocatalysts itself. This chapter provided insights into distinct enzymes characteristics essential in industrial processing especially...... enzymes kinetics. Understanding of enzyme kinetics is important especially in designing efficient reaction set-ups including type of bioreactors, reaction conditions and reusability of biocatalysts to ensure efficient running cost. A brief review of state-of-the-art in industrial applications of enzymes...
Almonacid, Daniel E; Yera, Emmanuel R; Mitchell, John B O; Babbitt, Patricia C
2010-03-12
Functionally analogous enzymes are those that catalyze similar reactions on similar substrates but do not share common ancestry, providing a window on the different structural strategies nature has used to evolve required catalysts. Identification and use of this information to improve reaction classification and computational annotation of enzymes newly discovered in the genome projects would benefit from systematic determination of reaction similarities. Here, we quantified similarity in bond changes for overall reactions and catalytic mechanisms for 95 pairs of functionally analogous enzymes (non-homologous enzymes with identical first three numbers of their EC codes) from the MACiE database. Similarity of overall reactions was computed by comparing the sets of bond changes in the transformations from substrates to products. For similarity of mechanisms, sets of bond changes occurring in each mechanistic step were compared; these similarities were then used to guide global and local alignments of mechanistic steps. Using this metric, only 44% of pairs of functionally analogous enzymes in the dataset had significantly similar overall reactions. For these enzymes, convergence to the same mechanism occurred in 33% of cases, with most pairs having at least one identical mechanistic step. Using our metric, overall reaction similarity serves as an upper bound for mechanistic similarity in functional analogs. For example, the four carbon-oxygen lyases acting on phosphates (EC 4.2.3) show neither significant overall reaction similarity nor significant mechanistic similarity. By contrast, the three carboxylic-ester hydrolases (EC 3.1.1) catalyze overall reactions with identical bond changes and have converged to almost identical mechanisms. The large proportion of enzyme pairs that do not show significant overall reaction similarity (56%) suggests that at least for the functionally analogous enzymes studied here, more stringent criteria could be used to refine
Directory of Open Access Journals (Sweden)
Daniel E Almonacid
2010-03-01
Full Text Available Functionally analogous enzymes are those that catalyze similar reactions on similar substrates but do not share common ancestry, providing a window on the different structural strategies nature has used to evolve required catalysts. Identification and use of this information to improve reaction classification and computational annotation of enzymes newly discovered in the genome projects would benefit from systematic determination of reaction similarities. Here, we quantified similarity in bond changes for overall reactions and catalytic mechanisms for 95 pairs of functionally analogous enzymes (non-homologous enzymes with identical first three numbers of their EC codes from the MACiE database. Similarity of overall reactions was computed by comparing the sets of bond changes in the transformations from substrates to products. For similarity of mechanisms, sets of bond changes occurring in each mechanistic step were compared; these similarities were then used to guide global and local alignments of mechanistic steps. Using this metric, only 44% of pairs of functionally analogous enzymes in the dataset had significantly similar overall reactions. For these enzymes, convergence to the same mechanism occurred in 33% of cases, with most pairs having at least one identical mechanistic step. Using our metric, overall reaction similarity serves as an upper bound for mechanistic similarity in functional analogs. For example, the four carbon-oxygen lyases acting on phosphates (EC 4.2.3 show neither significant overall reaction similarity nor significant mechanistic similarity. By contrast, the three carboxylic-ester hydrolases (EC 3.1.1 catalyze overall reactions with identical bond changes and have converged to almost identical mechanisms. The large proportion of enzyme pairs that do not show significant overall reaction similarity (56% suggests that at least for the functionally analogous enzymes studied here, more stringent criteria could be used to
A Theoretical Approach to Engineering a New Enzyme
International Nuclear Information System (INIS)
Anderson, Greg; Gomatam, Ravi; Behera, Raghu N.
2016-01-01
Density function theory, a subfield of quantum mechanics (QM), in combination with molecular mechanics (MM) has opened the way to engineer new artificial enzymes. Herein, we report theoretical calculations done using QM/MM to examine whether the regioselectivity and rate of chlorination of the enzyme chloroperoxidase can be improved by replacing the vanadium of this enzyme with niobium through dialysis. Our calculations show that a niobium substituted chloroperoxidase will be able to enter the initial steps of the catalytic cycle for chlorination. Although the protonation state of the niobium substituted enzyme is calculated to be different from than that of the natural vanadium substituted enzyme, our calculations show that the catalytic cycle can still proceed forward. Using natural bond orbitals, we analyse the electronic differences between the niobium substituted enzyme and the natural enzyme. We conclude by briefly examining how good of a model QM/MM provides for understanding the mechanism of catalysis of chloroperoxidase. (paper)
Induction of drug-metabolizing enzymes: mechanisms and consequences
Energy Technology Data Exchange (ETDEWEB)
Okey, A.B.; Roberts, E.A.; Harper, P.A.; Denison, M.S.
1986-04-01
The activity of many enzymes that carry out biotransformation of drugs and environmental chemicals can be substantially increased by prior exposure of humans or animals to a wide variety of foreign chemicals. Increased enzyme activity is due to true enzyme induction mediated by increased synthesis of mRNAs which code for specific drug-metabolizing enzymes. Several species of cytochrome P-450 are inducible as are certain conjugating enzymes such as glutathione S-transferases, glucuronosyl transferases, and epoxide hydrolases. Induction of drug-metabolizing enzymes has been shown in several instances to alter the efficacy of some therapeutic agents. Induction of various species of cytochrome P-450 also is known to increase the rate at which potentially toxic reactive metabolic intermediates are formed from drugs or environmental chemicals. Overall, however, induction of drug-metabolizing enzymes appears to be a beneficial adaptive response for organisms living in a ''chemically-hostile'' world.48 references.
21 CFR 184.1063 - Enzyme-modified lecithin.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Enzyme-modified lecithin. 184.1063 Section 184.1063... Listing of Specific Substances Affirmed as GRAS § 184.1063 Enzyme-modified lecithin. (a) Enzyme-modified lecithin is prepared by treating lecithin with either phospholipase A2 (EC 3.1.1.4) or pancreatin. (b) The...
Matrix Metalloproteinase Enzyme Family
Directory of Open Access Journals (Sweden)
Ozlem Goruroglu Ozturk
2013-04-01
Full Text Available Matrix metalloproteinases play an important role in many biological processes such as embriogenesis, tissue remodeling, wound healing, and angiogenesis, and in some pathological conditions such as atherosclerosis, arthritis and cancer. Currently, 24 genes have been identified in humans that encode different groups of matrix metalloproteinase enzymes. This review discuss the members of the matrix metalloproteinase family and their substrate specificity, structure, function and the regulation of their enzyme activity by tissue inhibitors. [Archives Medical Review Journal 2013; 22(2.000: 209-220
Janssen, B.M.G.; Engelen, W.; Merkx, M.
2015-01-01
DNA-templated reversible assembly of an enzyme–inhibitor complex is presented as a new and highly modular approach to control enzyme activity. TEM1-ß-lactamase and its inhibitor protein BLIP were conjugated to different oligonucleotides, resulting in enzyme inhibition in the presence of template
Directing filtration to optimize enzyme immobilization in reactive membranes
DEFF Research Database (Denmark)
Luo, Jianquan; Marpani, Fauziah; Brites, Rita
2014-01-01
enzymatic reaction efficiency were evaluated in terms of enzyme loading, conversion rate and biocatalytic stability. Alcohol dehydrogenase (ADH) was selected as a model enzyme. Lower pressure, higher enzyme concentration and lower pH resulted in higher irreversible fouling resistance and lower permeate flux....... High pH during immobilization produced increased permeate flux but declines in conversion rates, likely because of the weak immobilization resulting from strong electrostatic repulsion between enzymes and membrane. The results showed that pore blocking as a fouling mechanism permitted a higher enzyme...... loading but generated more permeability loss, while cake layer formation increased enzyme stability but resulted in low loading rate. Low pH (near isoelectric point) favored hydrophobic and electrostatic adsorption of enzymes on the membrane, which reduced the enzyme stability. Neutral pH, however...
Network analysis of metabolic enzyme evolution in Escherichia coli
Directory of Open Access Journals (Sweden)
Kraulis Per
2004-02-01
Full Text Available Abstract Background The two most common models for the evolution of metabolism are the patchwork evolution model, where enzymes are thought to diverge from broad to narrow substrate specificity, and the retrograde evolution model, according to which enzymes evolve in response to substrate depletion. Analysis of the distribution of homologous enzyme pairs in the metabolic network can shed light on the respective importance of the two models. We here investigate the evolution of the metabolism in E. coli viewed as a single network using EcoCyc. Results Sequence comparison between all enzyme pairs was performed and the minimal path length (MPL between all enzyme pairs was determined. We find a strong over-representation of homologous enzymes at MPL 1. We show that the functionally similar and functionally undetermined enzyme pairs are responsible for most of the over-representation of homologous enzyme pairs at MPL 1. Conclusions The retrograde evolution model predicts that homologous enzymes pairs are at short metabolic distances from each other. In general agreement with previous studies we find that homologous enzymes occur close to each other in the network more often than expected by chance, which lends some support to the retrograde evolution model. However, we show that the homologous enzyme pairs which may have evolved through retrograde evolution, namely the pairs that are functionally dissimilar, show a weaker over-representation at MPL 1 than the functionally similar enzyme pairs. Our study indicates that, while the retrograde evolution model may have played a small part, the patchwork evolution model is the predominant process of metabolic enzyme evolution.
Enzyme based soil stabilization for unpaved road construction
Directory of Open Access Journals (Sweden)
Renjith Rintu
2017-01-01
Full Text Available Enzymes as soil stabilizers have been successfully used in road construction in several countries for the past 30 years. However, research has shown that the successful application of these enzymes is case specific, emphasizing that enzyme performance is dependent on subgrade soil type, condition and the type of enzyme used as the stabilizer. A universal standard or a tool for road engineers to assess the performance of stabilized unbound pavements using well-established enzymes is not available to date. The research aims to produce a validated assessment tool which can be used to predict strength enhancement within a generalized statistical framework. The objective of the present study is to identify new materials for developing the assessment tool which supports enzyme based stabilization, as well as to identify the correct construction sequence for such new materials. A series of characterization tests were conducted on several soil types obtained from proposed construction sites. Having identified the suitable soil type to mix with the enzyme, a trial road construction has been performed to investigate the efficiency of the enzyme stabilization along with the correct construction sequence. The enzyme stabilization has showed significant improvement of the road performance as was evidenced from the test results which were based on site soil obtained before and after stabilization. The research will substantially benefit the road construction industry by not only replacing traditional construction methods with economical/reliable approaches, but also eliminating site specific tests required in current practice of enzyme based road construction.
Enhanced Oil Recovery with Application of Enzymes
DEFF Research Database (Denmark)
Khusainova, Alsu
Enzymes have recently been reported as effective enhanced oil recovery (EOR) agents. Both laboratory and field tests demonstrated significant increase in the ultimate oil production. Up to16% of additional oil was produced in the laboratory conditions and up to 269 barrels of additional oil per day...... were recovered in the field applications. The following mechanisms were claimed to be responsible for the enhancement of the oil production due to enzymes: wettability improvement of the rock surface; formation of the emulsions; reduction of oil viscosity; and removal of high molecular weight paraffins....... However, the positive effect of enzymes on oil recovery is not that obvious. In most of the studies commercial enzyme products composed of enzymes, surfactants and stabilisers were used. Application of such samples makes it difficult to assign a positive EOR effect to a certain compound, as several...
Tokarz, Paulina; Kaarniranta, Kai; Blasiak, Janusz
2013-10-01
Cells in aerobic condition are constantly exposed to reactive oxygen species (ROS), which may induce damage to biomolecules, including proteins, nucleic acids and lipids. In normal circumstances, the amount of ROS is counterbalanced by cellular antioxidant defence, with its main components-antioxidant enzymes, DNA repair and small molecular weight antioxidants. An imbalance between the production and neutralization of ROS by antioxidant defence is associated with oxidative stress, which plays an important role in the pathogenesis of many age-related and degenerative diseases, including age-related macular degeneration (AMD), affecting the macula-the central part of the retina. The retina is especially prone to oxidative stress due to high oxygen pressure and exposure to UV and blue light promoting ROS generation. Because oxidative stress has an established role in AMD pathogenesis, proper functioning of antioxidant defence may be crucial for the occurrence and progression of this disease. Antioxidant enzymes play a major role in ROS scavenging and changes of their expression or/and activity are reported to be associated with AMD. Therefore, the enzymes in the retina along with their genes may constitute a perspective target in AMD prevention and therapy.
Concentration profiles near an activated enzyme.
Park, Soohyung; Agmon, Noam
2008-09-25
When a resting enzyme is activated, substrate concentration profile evolves in its vicinity, ultimately tending to steady state. We use modern theories for many-body effects on diffusion-influenced reactions to derive approximate analytical expressions for the steady-state profile and the Laplace transform of the transient concentration profiles. These show excellent agreement with accurate many-particle Brownian-dynamics simulations for the Michaelis-Menten kinetics. The steady-state profile has a hyperbolic dependence on the distance of the substrate from the enzyme, albeit with a prefactor containing the complexity of the many-body effects. These are most conspicuous for the substrate concentration at the surface of the enzyme. It shows an interesting transition as a function of the enzyme turnover rate. When it is high, the contact concentration decays monotonically to steady state. However, for slow turnover it is nonmonotonic, showing a minimum due to reversible substrate binding, then a maximum due to diffusion of new substrate toward the enzyme, and finally decay to steady state. Under certain conditions one can obtain a good estimate for the critical value of the turnover rate constant at the transition.
Improving Aspergillus carbonarius crude enzymes for lignocellulose hydrolysis
DEFF Research Database (Denmark)
Hansen, Gustav Hammerich
and single enzyme supplementation. Fungal strains were screened in order to determine crude enzyme extracts that could be supplemented as boosters of A. carbonarius own crude enzyme extract, when applied in lignocellulose hydrolysis. The fungi originated from different environmental niches, which all had...... for their potential in hydrolysis of wheat straw both by application of monocultures and by supplementing to crude enzymes of A. carbonarius. For the crude enzymes from solid cultivations there were eight isolates that showed synergistic interaction resulting in doubling and tripling of the glucose release in wheat...... straw hydrolysis. A completely different profile of synergy was observed for crude enzymes from liquid cultivations, as there were only three isolates that enhanced glucose release. Only one of these three isolates had shown synergistic effects when cultivated in a solid medium. The screening...
Directory of Open Access Journals (Sweden)
Sung In Lim
2015-04-01
Full Text Available Photosynthesis consists of a series of reactions catalyzed by redox enzymes to synthesize carbohydrates using solar energy. In order to take the advantage of solar energy, many researchers have investigated artificial photosynthesis systems mimicking the natural photosynthetic enzymatic redox reactions. These redox reactions usually require cofactors, which due to their high cost become a key issue when constructing an artificial photosynthesis system. Combining a photosensitizer and an Rh-based electron mediator (RhM has been shown to photocatalytically regenerate cofactors. However, maintaining the high concentration of cofactors available for efficient enzymatic reactions requires a high concentration of the expensive RhM; making this process cost prohibitive. We hypothesized that conjugation of an electron mediator to a redox enzyme will reduce the amount of electron mediators necessary for efficient enzymatic reactions. This is due to photocatalytically regenerated NAD(PH being readily available to a redox enzyme, when the local NAD(PH concentration near the enzyme becomes higher. However, conventional random conjugation of RhM to a redox enzyme will likely lead to a substantial loss of cofactor regenerating capacity and enzymatic activity. In order to avoid this issue, we investigated whether bioconjugation of RhM to a permissive site of a redox enzyme retains cofactor regenerating capacity and enzymatic activity. As a model system, a RhM was conjugated to a redox enzyme, formate dehydrogenase obtained from Thiobacillus sp. KNK65MA (TsFDH. A RhM-containing azide group was site-specifically conjugated to p-azidophenylalanine introduced to a permissive site of TsFDH via a bioorthogonal strain-promoted azide-alkyne cycloaddition and an appropriate linker. The TsFDH-RhM conjugate exhibited retained cofactor regenerating capacity and enzymatic activity.
Enzyme-based antifouling coatings: a review
DEFF Research Database (Denmark)
Olsen, Stefan Møller; Pedersen, Leif Toudal; Laursen, M.H.
2007-01-01
A systematic overview is presented of the literature that reports the antifouling (AF) protection of underwater structures via the action of enzymes. The overall aim of this review is to assess the state of the art of enzymatic AF technology, and to highlight the obstacles that have to be overcome...... for successful development of enzymatic AF coatings. The approaches described in the literature are divided into direct and indirect enzymatic AF, depending on the intended action of the enzymes. Direct antifouling is used when the enzymes themselves are active antifoulants. Indirect antifouling refers...
Electro-ultrafiltration of industrial enzyme solutions
DEFF Research Database (Denmark)
Enevoldsen, Ann Dorrit; Hansen, Erik Børresen; Jonsson, Gunnar Eigil
2007-01-01
To reduce the problems with fouling and concentration polarization during crossflow ultrafiltration of industrial enzyme solutions an electric field is applied across the membrane. The filtration performance during electro-ultrafiltration (EUF) has been tested with several enzymes. Results show...
Epigenetics of dominance for enzyme activity
Indian Academy of Sciences (India)
Unknown
dimer over a wide range of H+ concentrations accounts for the epigenetics of dominance for enzyme activity. [Trehan K S ... The present study has been carried on acid phosphatase .... enzyme activity over mid parent value (table 3, col. 13),.
Gene expression and activity of antioxidant enzymes in rice plants, cv. BRS AG, under saline stress.
Rossatto, Tatiana; do Amaral, Marcelo Nogueira; Benitez, Letícia Carvalho; Vighi, Isabel Lopes; Braga, Eugenia Jacira Bolacel; de Magalhães Júnior, Ariano Martins; Maia, Mara Andrade Colares; da Silva Pinto, Luciano
2017-10-01
The rice cultivar ( Oryza sativa L.) BRS AG, developed by Embrapa Clima Temperado, is the first cultivar designed for purposes other than human consumption. It may be used in ethanol production and animal feed. Different abiotic stresses negatively affect plant growth. Soil salinity is responsible for a serious reduction in productivity. Therefore, the objective of this study was to evaluate the gene expression and the activity of antioxidant enzymes (SOD, CAT, APX and GR) and identify their functions in controlling ROS levels in rice plants, cultivar BRS AG, after a saline stress period. The plants were grown in vitro with two NaCl concentrations (0 and 136 mM), collected at 10, 15 and 20 days of cultivation. The results indicated that the activity of the enzymes evaluated promotes protection against oxidative stress. Although, there was an increase of reactive oxygen species, there was no increase in MDA levels. Regarding genes encoding isoforms of antioxidant enzymes, it was observed that OsSOD3 - CU/Zn , OsSOD2 - Cu/Zn , OsSOD - Cu/Zn , OsSOD4 - Cu/Zn , OsSODCc1 - Cu/Zn , OsSOD - Fe , OsAPX1 , OsCATB and OsGR2 were the most responsive. The increase in the transcription of all genes among evaluated isoforms, except for OsAPX6 , which remained stable, contributed to the increase or the maintenance of enzyme activity. Thus, it is possible to infer that the cv. BRS AG has defense mechanisms against salt stress.
Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert
2016-01-15
The glycoside hydrolase 70 (GH70) family originally was established for glucansucrase enzymes found solely in lactic acid bacteria synthesizing α-glucan polysaccharides from sucrose (e.g., GtfA). In recent years, we have characterized GtfB and related Lactobacillus enzymes as 4,6-α-glucanotransferase enzymes. These GtfB-type enzymes constitute the first GH70 subfamily of enzymes that are unable to act on sucrose as a substrate but are active with maltodextrins and starch, cleave α1→4 linkages, and synthesize linear α1→6-glucan chains. The GtfB disproportionating type of activity results in the conversion of malto-oligosaccharides into isomalto/malto-polysaccharides with a relatively high percentage of α1→6 linkages. This paper reports the identification of the members of a second GH70 subfamily (designated GtfC enzymes) and the characterization of the Exiguobacterium sibiricum 255-15 GtfC enzyme, which is also inactive with sucrose and displays 4,6-α-glucanotransferase activity with malto-oligosaccharides. GtfC differs from GtfB in synthesizing isomalto/malto-oligosaccharides. Biochemically, the GtfB- and GtfC-type enzymes are related, but phylogenetically, they clearly constitute different GH70 subfamilies, displaying only 30% sequence identity. Whereas the GtfB-type enzyme largely has the same domain order as glucansucrases (with α-amylase domains A, B, and C plus domains IV and V), this GtfC-type enzyme differs in the order of these domains and completely lacks domain V. In GtfC, the sequence of conserved regions I to IV of clan GH-H is identical to that in GH13 (I-II-III-IV) but different from that in GH70 (II-III-IV-I because of a circular permutation of the (β/α)8 barrel. The GtfC 4,6-α-glucanotransferase enzymes thus represent structurally and functionally very interesting evolutionary intermediates between α-amylase and glucansucrase enzymes. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Energy Technology Data Exchange (ETDEWEB)
Choy, B.B.K.
1991-01-01
Mammalian ribonucleotide reductase is a highly regulated, rate-limiting activity responsible for converting ribonucleoside diphosphates to the deoxyribonucleotide precursors of DNA. The enzyme consists of two nonidentical proteins called M1 and M2, both of which are required for activity. Hydroxyurea is an antitumor agent which inhibits ribonucleotide reductase by interacting with the M2 component specifically at a unique tyrosyl free radical. Studies were conducted on a series of drug resistant mouse cell lines, selected by a step-wise procedure for increasing levels of resistance to the cytotoxic effects of hydroxyurea. Each successive drug selection step leading to the isolation of highly resistant cells was accompanied by stable elevations in cellular resistance and ribonucleotide reductase activity. The drug resistant cell lines exhibited gene amplification of the M2 gene, elevated M2 mRNA, and M2 protein. In addition to M2 gene amplification, posttranscriptional modulation also occurred during the drug selection. Studies of the biosynthesis rates with exogenously added iron suggest a role for iron in regulating the level of M2 protein when cells are cultured in the presence of hydroxyurea. The hydroxyurea-inactivated ribonucleotide reductase protein M2 has a destabilized iron centre, which readily releases iron. Altered expression of ferritin appears to be required for the development of hydroxyurea resistance in nammalian cells. The results show an interesting relationship between the expressions of ribonucleotide reductase and ferritin. The phorbol ester tumor promoter, TPA, is also able to alter the expression of M2. TPA was able to induce M2 mRNA levels transiently up to 18-fold within 1/2 hour. This rapid and large elevation of ribonucleotide reductase suggests that the enzyme may play a role in tumor promotion. Studies of the M2 promoter region were undertaken to better understand the mechanism of TPA induction of M2.
DNA methylation analysis of the angiotensin converting enzyme (ACE gene in major depression.
Directory of Open Access Journals (Sweden)
Peter Zill
Full Text Available BACKGROUND: The angiotensin converting enzyme (ACE has been repeatedly discussed as susceptibility factor for major depression (MD and the bi-directional relation between MD and cardiovascular disorders (CVD. In this context, functional polymorphisms of the ACE gene have been linked to depression, to antidepressant treatment response, to ACE serum concentrations, as well as to hypertension, myocardial infarction and CVD risk markers. The mostly investigated ACE Ins/Del polymorphism accounts for ~40%-50% of the ACE serum concentration variance, the remaining half is probably determined by other genetic, environmental or epigenetic factors, but these are poorly understood. MATERIALS AND METHODS: The main aim of the present study was the analysis of the DNA methylation pattern in the regulatory region of the ACE gene in peripheral leukocytes of 81 MD patients and 81 healthy controls. RESULTS: We detected intensive DNA methylation within a recently described, functional important region of the ACE gene promoter including hypermethylation in depressed patients (p = 0.008 and a significant inverse correlation between the ACE serum concentration and ACE promoter methylation frequency in the total sample (p = 0.02. Furthermore, a significant inverse correlation between the concentrations of the inflammatory CVD risk markers ICAM-1, E-selectin and P-selectin and the degree of ACE promoter methylation in MD patients could be demonstrated (p = 0.01 - 0.04. CONCLUSION: The results of the present study suggest that aberrations in ACE promoter DNA methylation may be an underlying cause of MD and probably a common pathogenic factor for the bi-directional relationship between MD and cardiovascular disorders.
Key Building Blocks via Enzyme-Mediated Synthesis
Fischer, Thomas; Pietruszka, Jörg
Biocatalytic approaches to valuable building blocks in organic synthesis have emerged as an important tool in the last few years. While first applications were mainly based on hydrolases, other enzyme classes such as oxidoreductases or lyases moved into the focus of research. Nowadays, a vast number of biotransformations can be found in the chemical and pharmaceutical industries delivering fine chemicals or drugs. The mild reaction conditions, high stereo-, regio-, and chemoselectivities, and the often shortened reaction pathways lead to economical and ecological advantages of enzymatic conversions. Due to the enormous number of enzyme-mediated syntheses, the present chapter is not meant to be a complete review, but to deliver comprehensive insights into well established enzymatic systems and recent advances in the application of enzymes in natural product synthesis. Furthermore, it is focused on the most frequently used enzymes or enzyme classes not covered elsewhere in the present volume.
Directory of Open Access Journals (Sweden)
Ana-Maria Buga
Full Text Available Because most human stroke victims are elderly, studies of experimental stroke in the aged rather than the young rat model may be optimal for identifying clinically relevant cellular responses, as well for pinpointing beneficial interventions.We employed the Affymetrix platform to analyze the whole-gene transcriptome following temporary ligation of the middle cerebral artery in aged and young rats. The correspondence, heat map, and dendrogram analyses independently suggest a differential, age-group-specific behaviour of major gene clusters after stroke. Overall, the pattern of gene expression strongly suggests that the response of the aged rat brain is qualitatively rather than quantitatively different from the young, i.e. the total number of regulated genes is comparable in the two age groups, but the aged rats had great difficulty in mounting a timely response to stroke. Our study indicates that four genes related to neuropathic syndrome, stress, anxiety disorders and depression (Acvr1c, Cort, Htr2b and Pnoc may have impaired response to stroke in aged rats. New therapeutic options in aged rats may also include Calcrl, Cyp11b1, Prcp, Cebpa, Cfd, Gpnmb, Fcgr2b, Fcgr3a, Tnfrsf26, Adam 17 and Mmp14. An unexpected target is the enzyme 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 in aged rats, a key enzyme in the cholesterol synthesis pathway. Post-stroke axonal growth was compromised in both age groups.We suggest that a multi-stage, multimodal treatment in aged animals may be more likely to produce positive results. Such a therapeutic approach should be focused on tissue restoration but should also address other aspects of patient post-stroke therapy such as neuropathic syndrome, stress, anxiety disorders, depression, neurotransmission and blood pressure.
Escherichia coli photoreactivating enzyme: purification and properties
International Nuclear Information System (INIS)
Snapka, R.M.; Sutherland, B.M.
1980-01-01
Researchers have purified large quantities of Escherichia coli photoreactivating enzyme to apparent homogeneity and have studied its physical and chemical properties. The enzyme has a molecular weight of 36,800 and a S/sub 20,w/ 0 of 3.72 S. Amino acid analysis revealed an apparent absence of tryptophan, a low content of aromatic residues, and the presence of no unusual amino acids. The N terminus is arginine. The purified enzyme contained up to 13% carbohydrate by weight. The carbohydrate was composed of mannose, galactose, glucose, and N-acetylglucosamine. The enzyme is also associated with RNA containing uracil, adenine, guanine, and cytosine with no unusual bases detected
Enzyme adsorption at solid-liquid interfaces
Duinhoven, S.
1992-01-01
Enzymes are proteins with the capacity of catalysing various reactions. Nowadays two types of enzymes, proteases and lipases, are available for use in detergent formulations for household and industrial laundry washing. Proteases are capable of catalysing the hydrolysis of proteins while
Directory of Open Access Journals (Sweden)
A. Jalilian
2008-06-01
Full Text Available The oxidation of low-density lipoproteins and cell membrane lipids is believed to play an integral role in the development of fatty streak lesions, an initial step in coronary artery disease (CAD. Paraoxonase-1 (PON1 is an enzyme associated with the high-density lipoprotein (HDL particle. PON1 protects LDL from oxidative modification by hydrolyzing lipid peroxides, suggestive of a role for PON1 in the development of CAD. The present study tested the hypothesis that Paraoxonase-1 promoter polymorphism T(-107C could be a risk factor for severity of CAD in Iranian population. Paraoxonase-1 promoter genotypes were determined in 300 consecutive subjects (> 40 years old who underwent coronary angiography (150 subjects with >50% stenosis served as cases [CAD+] and 150 subjects with < 20% stenosis served as controls [CAD-]. PON1 promoter genotypes were determined by PCR and BSTU1 restriction enzyme digestion. CAD+ Subjects did not show any significant differences in the distribution of PON1 promoter genotypes as compared to CAD- Subjects (P = 0.075. However the analysis of PON1 promoter genotypes distribution showed a higher percentage of (-107 TT among CAD+ compared with CAD- (P = 0.027. After controlling for other risk factors, the T(-107C polymorphism had interaction with age (P = 0.012, but did not show any interaction with other risk factors such as BMI ,gender, smoking, diabetes, level of HDL-C, LDL-C, triglyceride and Total cholesterol. These data suggest that the TT genotype may represent a genetic risk factor for Coronary artery disease in Iranian population.
Internal Diffusion-Controlled Enzyme Reaction: The Acetylcholinesterase Kinetics.
Lee, Sangyun; Kim, Ji-Hyun; Lee, Sangyoub
2012-02-14
Acetylcholinesterase is an enzyme with a very high turnover rate; it quenches the neurotransmitter, acetylcholine, at the synapse. We have investigated the kinetics of the enzyme reaction by calculating the diffusion rate of the substrate molecule along an active site channel inside the enzyme from atomic-level molecular dynamics simulations. In contrast to the previous works, we have found that the internal substrate diffusion is the determinant of the acetylcholinesterase kinetics in the low substrate concentration limit. Our estimate of the overall bimolecular reaction rate constant for the enzyme is in good agreement with the experimental data. In addition, the present calculation provides a reasonable explanation for the effects of the ionic strength of solution and the mutation of surface residues of the enzyme. The study suggests that internal diffusion of the substrate could be a key factor in understanding the kinetics of enzymes of similar characteristics.
Database of ligand-induced domain movements in enzymes
Directory of Open Access Journals (Sweden)
Hayward Steven
2009-03-01
Full Text Available Abstract Background Conformational change induced by the binding of a substrate or coenzyme is a poorly understood stage in the process of enzyme catalysed reactions. For enzymes that exhibit a domain movement, the conformational change can be clearly characterized and therefore the opportunity exists to gain an understanding of the mechanisms involved. The development of the non-redundant database of protein domain movements contains examples of ligand-induced domain movements in enzymes, but this valuable data has remained unexploited. Description The domain movements in the non-redundant database of protein domain movements are those found by applying the DynDom program to pairs of crystallographic structures contained in Protein Data Bank files. For each pair of structures cross-checking ligands in their Protein Data Bank files with the KEGG-LIGAND database and using methods that search for ligands that contact the enzyme in one conformation but not the other, the non-redundant database of protein domain movements was refined down to a set of 203 enzymes where a domain movement is apparently triggered by the binding of a functional ligand. For these cases, ligand binding information, including hydrogen bonds and salt-bridges between the ligand and specific residues on the enzyme is presented in the context of dynamical information such as the regions that form the dynamic domains, the hinge bending residues, and the hinge axes. Conclusion The presentation at a single website of data on interactions between a ligand and specific residues on the enzyme alongside data on the movement that these interactions induce, should lead to new insights into the mechanisms of these enzymes in particular, and help in trying to understand the general process of ligand-induced domain closure in enzymes. The website can be found at: http://www.cmp.uea.ac.uk/dyndom/enzymeList.do
Adefegha, Stephen Adeniyi
2017-12-27
Functional foods describe the importance of foods in promoting health and preventing diseases aside their primary role of providing the body with the required amount of essential nutrients such as proteins, carbohydrates, vitamins, fats, and oils needed for its healthy survival. This review explains the interaction of functional food bioactive compounds including polyphenols (phenolic acids [hydroxybenzoic acids and hydroxycinnamic acids], flavonoids [flavonols, flavones, flavanols, flavanones, isoflavones, proanthocyanidins], stilbenes, and lignans), terpenoids, carotenoids, alkaloids, omega-3 and polyunsaturated fatty acids, among others with critical enzymes (α- amylase, α- glucosidase, angiotensin-I converting enzyme [ACE], acetylcholinesterase [AChE], and arginase) linked to some degenerative diseases (type-2 diabetes, cardiovascular diseases [hypertension], neurodegenerative diseases [Alzheimer's disease] and erectile dysfunction). Different functional food bioactive compounds may synergistically/additively confer an overwhelming protection against these degenerative diseases by modulating/altering the activities of these critical enzymes of physiological importance.
Extracellular enzyme kinetics scale with resource availability
Sinsabaugh, Robert L.; Belnap, Jayne; Findlay, Stuart G.; Follstad Shah, Jennifer J.; Hill, Brian H.; Kuehn, Kevin A.; Kuske, Cheryl; Litvak, Marcy E.; Martinez, Noelle G.; Moorhead, Daryl L.; Warnock, Daniel D.
2014-01-01
Microbial community metabolism relies on external digestion, mediated by extracellular enzymes that break down complex organic matter into molecules small enough for cells to assimilate. We analyzed the kinetics of 40 extracellular enzymes that mediate the degradation and assimilation of carbon, nitrogen and phosphorus by diverse aquatic and terrestrial microbial communities (1160 cases). Regression analyses were conducted by habitat (aquatic and terrestrial), enzyme class (hydrolases and oxidoreductases) and assay methodology (low affinity and high affinity substrates) to relate potential reaction rates to substrate availability. Across enzyme classes and habitats, the scaling relationships between apparent Vmax and apparent Km followed similar power laws with exponents of 0.44 to 0.67. These exponents, called elasticities, were not statistically distinct from a central value of 0.50, which occurs when the Km of an enzyme equals substrate concentration, a condition optimal for maintenance of steady state. We also conducted an ecosystem scale analysis of ten extracellular hydrolase activities in relation to soil and sediment organic carbon (2,000–5,000 cases/enzyme) that yielded elasticities near 1.0 (0.9 ± 0.2, n = 36). At the metabolomic scale, the elasticity of extracellular enzymatic reactions is the proportionality constant that connects the C:N:P stoichiometries of organic matter and ecoenzymatic activities. At the ecosystem scale, the elasticity of extracellular enzymatic reactions shows that organic matter ultimately limits effective enzyme binding sites. Our findings suggest that one mechanism by which microbial communities maintain homeostasis is regulating extracellular enzyme expression to optimize the short-term responsiveness of substrate acquisition. The analyses also show that, like elemental stoichiometry, the fundamental attributes of enzymatic reactions can be extrapolated from biochemical to community and ecosystem scales.
Implantable enzyme amperometric biosensors.
Kotanen, Christian N; Moussy, Francis Gabriel; Carrara, Sandro; Guiseppi-Elie, Anthony
2012-05-15
The implantable enzyme amperometric biosensor continues as the dominant in vivo format for the detection, monitoring and reporting of biochemical analytes related to a wide range of pathologies. Widely used in animal studies, there is increasing emphasis on their use in diabetes care and management, the management of trauma-associated hemorrhage and in critical care monitoring by intensivists in the ICU. These frontier opportunities demand continuous indwelling performance for up to several years, well in excess of the currently approved seven days. This review outlines the many challenges to successful deployment of chronically implantable amperometric enzyme biosensors and emphasizes the emerging technological approaches in their continued development. The foreign body response plays a prominent role in implantable biotransducer failure. Topics considering the approaches to mitigate the inflammatory response, use of biomimetic chemistries, nanostructured topographies, drug eluting constructs, and tissue-to-device interface modulus matching are reviewed. Similarly, factors that influence biotransducer performance such as enzyme stability, substrate interference, mediator selection and calibration are reviewed. For the biosensor system, the opportunities and challenges of integration, guided by footprint requirements, the limitations of mixed signal electronics, and power requirements, has produced three systems approaches. The potential is great. However, integration along the multiple length scales needed to address fundamental issues and integration across the diverse disciplines needed to achieve success of these highly integrated systems, continues to be a challenge in the development and deployment of implantable amperometric enzyme biosensor systems. Copyright © 2012 Elsevier B.V. All rights reserved.
Enzymes: principles and biotechnological applications
Robinson, Peter K.
2015-01-01
Enzymes are biological catalysts (also known as biocatalysts) that speed up biochemical reactions in living organisms, and which can be extracted from cells and then used to catalyse a wide range of commercially important processes. This chapter covers the basic principles of enzymology, such as classification, structure, kinetics and inhibition, and also provides an overview of industrial applications. In addition, techniques for the purification of enzymes are discussed. PMID:26504249
Enzymes: The possibility of production and applications
Directory of Open Access Journals (Sweden)
Petronijević Živomir B.
2003-01-01
Full Text Available Enzymes are biological catalysts with increasing application in the food pharmaceutical, cosmetic, textile and chemical industry. They are also important as reagents in chemical analysis, leather fabrications and as targets for the design of new drugs. Keeping in mind the growing need to replace classical chemical processes by alternative ones, because of ever growing environmental pollution, it is important that enzyme and other biotechnological processes are economical. Therefore, price decrease and stability and enzyme preparation efficiency increase are required more and more. This paper presents a short review of methods for yield increase and the improvement of the quality of enzyme products as commercial products, as well as a review of the possibilities of their application.
Glycolytic Enzymes Coalesce in G Bodies under Hypoxic Stress
Directory of Open Access Journals (Sweden)
Meiyan Jin
2017-07-01
Full Text Available Glycolysis is upregulated under conditions such as hypoxia and high energy demand to promote cell proliferation, although the mechanism remains poorly understood. We find that hypoxia in Saccharomyces cerevisiae induces concentration of glycolytic enzymes, including the Pfk2p subunit of the rate-limiting phosphofructokinase, into a single, non-membrane-bound granule termed the “glycolytic body” or “G body.” A yeast kinome screen identifies the yeast ortholog of AMP-activated protein kinase, Snf1p, as necessary for G-body formation. Many G-body components identified by proteomics are required for G-body integrity. Cells incapable of forming G bodies in hypoxia display abnormal cell division and produce inviable daughter cells. Conversely, cells with G bodies show increased glucose consumption and decreased levels of glycolytic intermediates. Importantly, G bodies form in human hepatocarcinoma cells in hypoxia. Together, our results suggest that G body formation is a conserved, adaptive response to increase glycolytic output during hypoxia or tumorigenesis.
Positional isotope exchange studies on enzyme using NMR spectroscopy
International Nuclear Information System (INIS)
Matsunaga, T.O.
1987-01-01
The isotopically enriched compounds, 18 O-β,γ-ATP and 18 O bridge-labeled pyrophosphate, synthesized previously in this laboratory, were used to investigate and measure the exchange vs. turnover of substrates and products from their central complexes in four selected enzyme systems. Using hi-field 31 P NMR, we were able to differentiate between 18 O labeled in the bridge vs. the non-bridge positions by virtue of the isotope shift upon the phosphorus nuclei. The bridge to non-bridge scrambling of the label was quantitated and the exchange vs. turnover ratios under a variety of conditions was determined. Using the substrate inhibitor carboxycreatinine, PIX experiments with 18 O-β,γ-ATP and creatine kinase were conducted. It was shown that carboxycreatinine and creatine kinase promoted exchange of the 18 O label as determined by NMR. We have concluded that carboxycreatinine is either a substrate that catalyzes very slow turnover or it catalyzes exchange by a dissociative (SN 1 /sub P/) type of mechanism
21 CFR 864.4400 - Enzyme preparations.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Enzyme preparations. 864.4400 Section 864.4400 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Specimen Preparation Reagents § 864.4400 Enzyme...
Polyphenol Oxidase Enzyme and Inactivation Methods
Directory of Open Access Journals (Sweden)
Leman Yılmaz
2018-03-01
Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.
Enzymes are a sweet way to do business
Energy Technology Data Exchange (ETDEWEB)
1980-01-04
The use of enzymes in industry is growing steadily. This artic discusses some areas of enzyme research: included are enzyme treatments for the production of high-fructose corn syrup and ethanol for gasohol blends, enzyme research focusing on cellulose breakdown, especially from municipal waste and pulp and paper waste to produce ethanol and the conversion of soybeans into a protein-rich powder. The enzymatic process for nitrogen fixation in the nodules of certain leguminous plants and in medical diagnostics are also mentioned.
Recent advances in rational approaches for enzyme engineering
Directory of Open Access Journals (Sweden)
Kerstin Steiner
2012-09-01
Full Text Available Enzymes are an attractive alternative in the asymmetric syntheses of chiral building blocks. To meet the requirements of industrial biotechnology and to introduce new functionalities, the enzymes need to be optimized by protein engineering. This article specifically reviews rational approaches for enzyme engineering and de novo enzyme design involving structure-based approaches developed in recent years for improvement of the enzymes’ performance, broadened substrate range, and creation of novel functionalities to obtain products with high added value for industrial applications.
The ultrasound technology for modifying enzyme activity
Directory of Open Access Journals (Sweden)
Meliza Lindsay
2016-06-01
Full Text Available Enzymes are protein complexes compounds widely studied and used due to their ability to catalyze reactions. The food processing mainly aims the inactivation of enzymes due to various undesirable effects. However, there are many processes that can be optimized by its catalytic activity. In this context, different technologies have been applied both to inactivate or to improve the enzymes efficiency. The Ultrasound technology emerges as an alternative mainly applied to achieve the enzyme inactivation. On the contrary, very few investigations show the ability of this technology under certain conditions to achieve the opposite effect (i.e. increase the catalytic activity of enzymes. The objective of this study was to correlate the ultrasonic energy delivered to the sample (J/mL with the residual enzymatic activity and explain the possible mechanisms which results in the enzymatic activation/inactivation complex behavior. The activity of POD in coconut water was evaluated as a model. The enzymatic activity initially increased, followed by reduction with a trend to enzyme inactivation. This complex behavior is directly related to the applied ultrasonic energy and their direct mechanical effects on the product, as well as the effect in the enzymatic infinite intermediate states and its structural conformation changes. The obtained results are useful for both academic and industrial perspectives.
Directory of Open Access Journals (Sweden)
Ueno Keisuke
2012-04-01
Full Text Available Abstract Background Structural genomics approaches, particularly those solving the 3D structures of many proteins with unknown functions, have increased the desire for structure-based function predictions. However, prediction of enzyme function is difficult because one member of a superfamily may catalyze a different reaction than other members, whereas members of different superfamilies can catalyze the same reaction. In addition, conformational changes, mutations or the absence of a particular catalytic residue can prevent inference of the mechanism by which catalytic residues stabilize and promote the elementary reaction. A major hurdle for alignment-based methods for prediction of function is the absence (despite its importance of a measure of similarity of the physicochemical properties of catalytic sites. To solve this problem, the physicochemical features radially distributed around catalytic sites should be considered in addition to structural and sequence similarities. Results We showed that radial distribution functions (RDFs, which are associated with the local structural and physicochemical properties of catalytic active sites, are capable of clustering oxidoreductases and transferases by function. The catalytic sites of these enzymes were also characterized using the RDFs. The RDFs provided a measure of the similarity among the catalytic sites, detecting conformational changes caused by mutation of catalytic residues. Furthermore, the RDFs reinforced the classification of enzyme functions based on conventional sequence and structural alignments. Conclusions Our results demonstrate that the application of RDFs provides advantages in the functional classification of enzymes by providing information about catalytic sites.
Isolation and sequencing analysis on the seed-specific promoter from soybean
Institute of Scientific and Technical Information of China (English)
CAIYIN Qinggele; LI Mingchun; WEI Dongsheng; CAI Yi; XING Laijun
2007-01-01
,and confirmed by Southern Blot Analysis.Fluorometric and histochemical analysis of GUS enzyme activity of the transgenic Arabidopsis thaliana plants support our original suggestions.Therefore,the seed-specific promoter BCSP666 is obtained and characterized.
Development of the Enzyme-Substrate Interactions Concept Inventory
Bretz, Stacey Lowery; Linenberger, Kimberly J.
2012-01-01
Enzyme function is central to student understanding of multiple topics within the biochemistry curriculum. In particular, students must understand how enzymes and substrates interact with one another. This manuscript describes the development of a 15-item Enzyme-Substrate Interactions Concept Inventory (ESICI) that measures student understanding…
Directory of Open Access Journals (Sweden)
Ansaya Thonpho
Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.
Bioethanol from lignocellulose - pretreatment, enzyme immobilization and hydrolysis kinetics
DEFF Research Database (Denmark)
Tsai, Chien Tai
, the cost of enzyme is still the bottle neck, re-using the enzyme is apossible way to reduce the input of enzyme in the process. In the point view of engineering, the prediction of enzymatic hydrolysis kinetics under different substrate loading, enzyme combination is usful for process design. Therefore...... lignocellulose is the required high cellulase enzyme dosages that increase the processing costs. One method to decrease the enzyme dosage is to re-use BG, which hydrolyze the soluble substrate cellobiose. Based on the hypothesis that immobilized BG can be re-used, how many times the enzyme could be recycled...... liquid and pretreatment time can be reduced, the influence of substrate concentration, pretreatment time and temperature were investigated and optimized. Pretreatment of barley straw by [EMIM]Ac, correlative models were constructed using 3 different pretreatment parameters (temperature, time...
Subcellular localization of pituitary enzymes
Smith, R. E.
1970-01-01
A cytochemical procedure is reported for identifying subcellular sites of enzymes hydrolyzing beta-naphthylamine substrates, and to study the sites of reaction product localization in cells of various tissues. Investigations using the substrate Leu 4-methoxy-8-naphthylamine, a capture with hexonium pararosaniline, and the final chelation of osmium have identified the hydrolyzing enzyme of rat liver cells; this enzyme localized on cell membranes with intense deposition in the areas of the parcanaliculi. The study of cells in the anterior pituitary of the rat showed the deposition of reaction product on cell membrane; and on the membranes of secretion granules contained within the cell. The deposition of reaction product on the cell membrane however showed no increase or decrease with changes in the physiological state of the gland and release of secretion granules from specific cells.
Sediment enzymes are proteins that are produced by microorganisms living in the sediment or soil. They are indicators of key ecosystem processes and can help determine which nutrients are affecting the biological community of a waterbody.
21 CFR 862.2500 - Enzyme analyzer for clinical use.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Enzyme analyzer for clinical use. 862.2500 Section... Instruments § 862.2500 Enzyme analyzer for clinical use. (a) Identification. An enzyme analyzer for clinical use is a device intended to measure enzymes in plasma or serum by nonkinetic or kinetic measurement of...
Enzymes involved in organellar DNA replication in photosynthetic eukaryotes.
Moriyama, Takashi; Sato, Naoki
2014-01-01
Plastids and mitochondria possess their own genomes. Although the replication mechanisms of these organellar genomes remain unclear in photosynthetic eukaryotes, several organelle-localized enzymes related to genome replication, including DNA polymerase, DNA primase, DNA helicase, DNA topoisomerase, single-stranded DNA maintenance protein, DNA ligase, primer removal enzyme, and several DNA recombination-related enzymes, have been identified. In the reference Eudicot plant Arabidopsis thaliana, the replication-related enzymes of plastids and mitochondria are similar because many of them are dual targeted to both organelles, whereas in the red alga Cyanidioschyzon merolae, plastids and mitochondria contain different replication machinery components. The enzymes involved in organellar genome replication in green plants and red algae were derived from different origins, including proteobacterial, cyanobacterial, and eukaryotic lineages. In the present review, we summarize the available data for enzymes related to organellar genome replication in green plants and red algae. In addition, based on the type and distribution of replication enzymes in photosynthetic eukaryotes, we discuss the transitional history of replication enzymes in the organelles of plants.
Fujii, Mikio; Kitagawa, Yasuyuki; Iida, Shui; Kato, Keisuke; Ono, Machiko
2015-11-15
The dihedral angle θ of the diphosphate part of NAD(P) were investigated to distinguish the differences in the binding-conformation of NAD(P) to enzymes and to create an enzyme taxonomy. Furthermore, new inhibitors with fixed dihedral angles showed that enzymes could recognize the differences in the dihedral angle θ. We suggest the taxonomy and the dihedral angle θ are important values for chemists to consider when designing inhibitors and drugs that target enzymes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Marine Enzymes: Production and Applications for Human Health.
Rao, T Eswara; Imchen, M; Kumavath, R
Marine microbial enzymes have wide applications in bioindustries. Selection of microorganisms for enzyme production at the industrial level requires good yield and high production rate. A number of enzymes such as amylase, caseinase, lipase, gelatinase, and DNases have been discovered from microbes isolated from extreme marine environments. Such enzymes are thermostable, tolerant to a varied range of pH and other harsh conditions required in industrial applications. Novelty in their structure and characteristics has shown promising scope to the researchers in academia and industry. In this chapter, we present a bird's eye view on recent research works in the field of enzyme production from marine origin as well as their potential biological applications relevant to human health. © 2017 Elsevier Inc. All rights reserved.
DGAT enzymes and triacylglycerol biosynthesis
Yen, Chi-Liang Eric; Stone, Scot J.; Koliwad, Suneil; Harris, Charles; Farese, Robert V.
2008-01-01
Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, ...
Enzyme-driven mechanisms in biocorrosion
Basséguy, Régine
2007-01-01
Objectives (abstract of presentation): Recent works carried out in our team concerning enzymes and biocorrosion are presented at the meeting. For aerobic conditions, the direct catalysis of the reduction of oxygen on steel by enzymes or porphyrin was proved and a local electrochemical analysis technique (SVET) was developed to visualize the localization of the catalysis. On anaerobic conditions, the influence of phosphate species and other weak acids on the water reduction on steel was shown....
Enzymes- An Existing and Promising Tool of Food Processing Industry.
Ray, Lalitagauri; Pramanik, Sunita; Bera, Debabrata
2016-01-01
The enzyme catalyzed process technology has enormous potential in the food sectors as indicated by the recent patents studies. It is very well realized that the adaptation of the enzyme catalyzed process depends on the availability of enzyme in affordable prices. Enzymes may be used in different food sectors like dairy, fruits & vegetable processing, meat tenderization, fish processing, brewery and wine making, starch processing and many other. Commercially only a small number of enzymes are used because of several factors including instability of enzymes during processing and high cost. More and more enzymes for food technology are now derived from specially selected or genetically modified microorganisms grown in industrial scale fermenters. Enzymes with microbial source have commercial advantages of using microbial fermentation rather than animal and plant extraction to produce food enzymes. At present only a relatively small number of enzymes are used commercially in food processing. But the number is increasing day by day and field of application will be expanded more and more in near future. The purpose of this review is to describe the practical applications of enzymes in the field of food processing.
Aβ-degrading enzymes: potential for treatment of Alzheimer disease.
Miners, James Scott; Barua, Neil; Kehoe, Patrick Gavin; Gill, Steven; Love, Seth
2011-11-01
There is increasing evidence that deficient clearance of β-amyloid (Aβ) contributes to its accumulation in late-onset Alzheimer disease (AD). Several Aβ-degrading enzymes, including neprilysin (NEP), insulin-degrading enzyme, and endothelin-converting enzyme reduce Aβ levels and protect against cognitive impairment in mouse models of AD. The activity of several Aβ-degrading enzymes rises with age and increases still further in AD, perhaps as a physiological response to minimize the buildup of Aβ. The age- and disease-related changes in expression of more recently recognized Aβ-degrading enzymes (e.g. NEP-2 and cathepsin B) remain to be investigated, and there is strong evidence that reduced NEP activity contributes to the development of cerebral amyloid angiopathy. Regardless of the role of Aβ-degrading enzymes in the development of AD, experimental data indicate that increasing the activity of these enzymes (NEP in particular) has therapeutic potential in AD, although targeting their delivery to the brain remains a major challenge. The most promising current approaches include the peripheral administration of agents that enhance the activity of Aβ-degrading enzymes and the direct intracerebral delivery of NEP by convection-enhanced delivery. In the longer term, genetic approaches to increasing the intracerebral expression of NEP or other Aβ-degrading enzymes may offer advantages.
Studies on Ganoderma lucidum III. production of pectolytic enzymes
Energy Technology Data Exchange (ETDEWEB)
Chang, L.S.; Tseng, T.C.
1986-07-01
Pectolytic enzymes produced by Ganoderma lucidum B in culture and polypropylene bags were investigated. Two pectolytic enzymes, i.e., endo-polygalacturonase (endo-PG) and endo-pectic methyl trans-eliminase (endo-PMTE) were obtained from crude enzymes of G. lucidum B extract from mycelia polypropylene bags. The endo-PMTE has to optimal pH at 4.5 and 8.0. The enzyme stimulated by Ca/sup + +/ ion and preferred only pectin; the enzyme activity decreased at temperature above 50/sup 0/C. The endo-PMTE a and endo-PMTE b, obtained from polypropylene bag with mycelia of G. lucidum B, were purified by 60-80% ammonium sulfate fractionation, Sephadex G-100 gel filtration, DEAE-cellulose ion exchange column chromatography and isoelectric focusing, showing pI at 8.2 and 5.5. Disc gel electrophoresis confirmed two peaks corresponding to endo-PMTE a and b as isoenzymes. Pectolytic enzymes purified by 60-80% ammonium sulfate fraction macerated potato disc and it was more active than the crude enzyme. At pH 4.5, maceration of potato disc by pectolytic enzymes more effective than those at pH 8.0 or 7.0. At pH 8.0, Ca/sup + +/ ion stimulate pectolytic enzyme activities and accelerated maceration.
Enzyme Catalysis and the Gibbs Energy
Ault, Addison
2009-01-01
Gibbs-energy profiles are often introduced during the first semester of organic chemistry, but are less often presented in connection with enzyme-catalyzed reactions. In this article I show how the Gibbs-energy profile corresponds to the characteristic kinetics of a simple enzyme-catalyzed reaction. (Contains 1 figure and 1 note.)
Discovery of enzymes for toluene synthesis from anoxic microbial communities
DEFF Research Database (Denmark)
Beller, Harry R.; Rodrigues, Andria V.; Zargar, Kamrun
2018-01-01
Microbial toluene biosynthesis was reported in anoxic lake sediments more than three decades ago, but the enzyme catalyzing this biochemically challenging reaction has never been identified. Here we report the toluene-producing enzyme PhdB, a glycyl radical enzyme of bacterial origin that catalyzes...... phenylacetate decarboxylation, and its cognate activating enzyme PhdA, a radical S-adenosylmethionine enzyme, discovered in two distinct anoxic microbial communities that produce toluene. The unconventional process of enzyme discovery from a complex microbial community (>300,000 genes), rather than from...... a microbial isolate, involved metagenomics- and metaproteomics-enabled biochemistry, as well as in vitro confirmation of activity with recombinant enzymes. This work expands the known catalytic range of glycyl radical enzymes (only seven reaction types had been characterized previously) and aromatic...
Archaeal Enzymes and Applications in Industrial Biocatalysts.
Littlechild, Jennifer A
2015-01-01
Archaeal enzymes are playing an important role in industrial biotechnology. Many representatives of organisms living in "extreme" conditions, the so-called Extremophiles, belong to the archaeal kingdom of life. This paper will review studies carried by the Exeter group and others regarding archaeal enzymes that have important applications in commercial biocatalysis. Some of these biocatalysts are already being used in large scale industrial processes for the production of optically pure drug intermediates and amino acids and their analogues. Other enzymes have been characterised at laboratory scale regarding their substrate specificity and properties for potential industrial application. The increasing availability of DNA sequences from new archaeal species and metagenomes will provide a continuing resource to identify new enzymes of commercial interest using both bioinformatics and screening approaches.
hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro
International Nuclear Information System (INIS)
Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan
2007-01-01
Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)
Directory of Open Access Journals (Sweden)
akram songol
2016-06-01
Full Text Available Introduction: Pectinase enzyme is one of the most important industrial enzymes which isolated from a wide variety of microorganisms such as bacteria and filamentous fungi. This enzyme has been usually used in the fruit and textile industry. In this study, the isolation and optimization of pectinase-producing fungi on decaying rotten fruits were studied. Materials and methods: Isolation and screening of pectinase producing fungi performed through plate culture on pectin medium and staining with Lugol's iodine solution. The best strains were identified by ITS1, 4 sequencing as Aspergillus fumigatus, Rhizopus oryzae, Penicilium chrysogenum. The enzyme production was optimized by application of the five factorial design, each at three levels. These factors are carbon sources (whey, glucose and stevia, ammonium sulfate, manganese sulfate, temperature, and pH. Pectinase concentration was measured by the Miller method. Results: The results indicate that optimum condition for enzyme production for three fungi strains was obtained at 32 °C, pH = 6, 3g / L manganese sulfate, 2.75g / L of ammonium sulfate and 10g / L of each carbon source. The best experiment in obtaining the optimum enzyme contained 1.328 mg / ml of glucose for Aspergillus niger 1.284 and 1.039 mg / ml of whey for Rhizopus oryzae and Penicilium chrysogenum. Molecular weight of enzyme was about 40 and 37 kDa which was obtained by SDS- PAGE. Discussion and conclusion: The results indicate that three strains could grow in a wide range of carbon source, pH and temperature, which could be a good candidate for industrial application.
In-vitro engineering of novel bioactivity in the natural enzymes
Directory of Open Access Journals (Sweden)
Vishvanath Tiwari
2016-10-01
Full Text Available Enzymes catalyze various biochemical functions with high efficiency and specificity. In-vitro design of the enzyme leads to novel bioactivity in this natural biomolecule that give answers of some vital questions like crucial residues in binding with substrate, molecular evolution, cofactor specificity etc. Enzyme engineering technology involves directed evolution, rational designing, semi-rational designing and structure-based designing using chemical modifications. Similarly, combined computational and in-vitro evolution approaches together help in artificial designing of novel bioactivity in the natural enzyme. DNA shuffling, error prone PCR and staggered extension process are used to artificially redesign active site of enzyme, which can alter its efficiency and specificity. Modifications of the enzyme can lead to the discovery of new path of molecular evolution, designing of efficient enzymes, locating active sites and crucial residues, shift in substrate and cofactor specificity. The methods and thermodynamics of in-vitro designing of the enzyme are also discussed. Similarly, engineered thermophilic and psychrophilic enzymes attain substrate specificity and activity of mesophilic enzymes that may also be beneficial for industry and therapeutics.
Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133
2009-01-01
Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581
Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133
Directory of Open Access Journals (Sweden)
Lindberg Pia
2009-03-01
Full Text Available Abstract Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp. To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence.
Lafi, Feras Fawzi; Bokhari, Ameerah; Alam, Intikhab; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged
2016-01-01
We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.
Lafi, Feras Fawzi
2016-07-28
We isolated the plant endophytic bacterium Cupriavidus gilardii strain JZ4 from the roots of the desert plant Tribulus terrestris, collected from the Jizan region, Saudi Arabia. We report here the draft genome sequence of JZ4, together with several enzymes related to plant growth-promoting activity, environmental adaption, and antifungal activity.
Energy Technology Data Exchange (ETDEWEB)
Kunz, S.; Schmitz, H.J.; Schrenk, D. [Kaiserslautern Univ. (Germany). Dept. of Food Chemistry and Environmental Toxicology; Buchmann, A.; Schwarz, M. [Tuebingen Univ. (Germany). Inst. of Toxicology; Schilling, B.; Paepke, O. [ERGO Research, Hamburg (Germany); Robertson, L.W.; Lehmler, H.J. [Iowa Univ, Iowa City, IA (United States). Dept. of Occupational and Environmental Health
2004-09-15
Polychlorinated biphenyls (PCBs) are potent persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumor-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxin-like' and 'non-dioxin-like' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxin-like' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxin-like' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. The tumor-promoting potency of several PCBs has been demonstrated in two-stage initiation-promotion experiments in rat liver. Preneoplastic cell clones, targets for tumor promotion, can be identified as phenotypically altered foci showing characteristic enzyme patterns including the decreased activity of adenosine triphosphatase (ATPase) or the increased expression of the placental form of gluthatione S-transferase (GSTP). In the present study, the effect of the 'non-dioxin-like' 2,4,4'-trichlorobiphenyl (PCB 28) and 2,2',4,5,5'-pentachlorobiphenyl (PCB 101) on the promotion of enzyme-altered hepatic foci was investigated in female Wistar rats after initiation with diethylnitrosamine (DEN).
Lignin-degrading enzyme activities.
Chen, Yi-ru; Sarkanen, Simo; Wang, Yun-Yan
2012-01-01
Over the past three decades, the activities of four kinds of enzyme have been purported to furnish the mechanistic foundations for macromolecular lignin depolymerization in decaying plant cell walls. The pertinent fungal enzymes comprise lignin peroxidase (with a relatively high redox potential), manganese peroxidase, an alkyl aryl etherase, and laccase. The peroxidases and laccase, but not the etherase, are expressed extracellularly by white-rot fungi. A number of these microorganisms exhibit a marked preference toward lignin in their degradation of lignocellulose. Interestingly, some white-rot fungi secrete both kinds of peroxidase but no laccase, while others that are equally effective express extracellular laccase activity but no peroxidases. Actually, none of these enzymes has been reported to possess significant depolymerase activity toward macromolecular lignin substrates that are derived with little chemical modification from the native biopolymer. Here, the assays commonly employed for monitoring the traditional fungal peroxidases, alkyl aryl etherase, and laccase are described in their respective contexts. A soluble native polymeric substrate that can be isolated directly from a conventional milled-wood lignin preparation is characterized in relation to its utility in next-generation lignin-depolymerase assays.
DEFF Research Database (Denmark)
Papaleo, Elena; Casiraghi, Nicola; Arrigoni, Alberto
2012-01-01
The ubiquitin (Ub) system controls almost every aspect of eukaryotic cell biology. Protein ubiquitination depends on the sequential action of three classes of enzymes (E1, E2 and E3). E2 Ub-conjugating enzymes have a central role in the ubiquitination pathway, interacting with both E1 and E3...
Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung
2016-05-10
Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.
The ultrasound technology for modifying enzyme activity
Directory of Open Access Journals (Sweden)
Meliza Lindsay Rojas
2016-01-01
Full Text Available Enzymes are protein complexes compounds widely studied and used due to their ability to catalyze reactions. The food processing mainly a ims the inactivation of enzymes due to various undesirable effects. However, there are many processes that can be optimized by its catalytic activity. In this context, different technologies have been applied both to inactivate or to improve the enzymes ef ficiency. The Ultrasound technology emerges as an alternative mainly applied to achieve the enzyme inactivation. On the contrary, very few investigations show the ability of this technology under certain conditions to achieve the opposite effect (i.e. increase the catalytic activity of enzymes. The objective of this study was to correlate the ultrasonic energy delivered to the sample (J/mL with the residual enzymatic activity and explain the possible mechanisms which results in the enzymatic activation/in activation complex behavior. The activity of POD in coconut water was evaluated as a model. The enzymatic activity initially increased, followed by reduction with a trend to enzyme inactivation. This complex behavior is directly related to the applied ultr asonic energy and their direct mechanical effects on the product, as well as the effect in the enzymatic infinite intermediate states and its structural conformation changes. The obtained results are useful for both academic and industrial perspectives.
Karl J. Romanowicz; Evan S. Kane; Lynette R. Potvin; Aleta L. Daniels; Randy Kolka; Erik A. Lilleskov
2015-01-01
Aims. Our objective was to assess the impacts of water table position and plant functional groups on peatland extracellular enzyme activity (EEA) framed within the context of the enzymic latch hypothesis. Methods. We utilized a full factorial experiment with 2 water table (WT) treatments (high and low) and 3 plant functional...
Kinetics of enzyme action: essential principles for drug hunters
National Research Council Canada - National Science Library
Stein, Ross L
2011-01-01
... field. Beginning with the most basic principles pertaining to simple, one-substrate enzyme reactions and their inhibitors, and progressing to a thorough treatment of two-substrate enzymes, Kinetics of Enzyme Action...
Zhang, Qi; Chen, Shuo; Wang, Hua; Yu, Hongtao
2018-03-14
Hydrogen peroxide (H 2 O 2 ) is a key reactant in the Fenton process. As a byproduct of enzymatic reaction, H 2 O 2 can be obtained via catalytical oxidation of glucose using glucose oxidase in the presence of O 2 . Another oxidation product (gluconic acid) can suitably adjust the microenvironmental pH contributing to the Fe 3+ /Fe 2+ cycle in the Fenton reaction. Enzymes are extremely efficient at catalyzing a variety of reactions with high catalytic activity, substrate specificity, and yields in living organisms. Inspired by the multiple functions of natural multienzyme systems, an exquisite nanozyme-modified α-FeOOH/porous carbon (PC) biomimetic catalyst constructed by in situ growth of glucose oxidase-mimicking Au nanoparticles and crystallization of adsorbed ferric ions within carboxyl into hierarchically PC is developed as an efficient enzyme-Fenton catalyst. The products (H 2 O 2 , ∼4.07 mmol·L -1 ) of the first enzymatic reaction are immediately used as substrates for the second Fenton-like reaction to generate the valuable • OH (∼96.84 μmol·L -1 ), thus mimicking an enzyme cascade pathway. α-FeOOH nanocrystals, attached by C-O-Fe bondings, are encapsulated into the mesoporous PC frameworks, facilitating the electron transfer between α-FeOOH and the PC support and greatly suppressing iron leaching. This study paves a new avenue for designing biomimetic enzyme-based Fenton catalysts mimicking a natural system for • OH production.
Directory of Open Access Journals (Sweden)
Aebi Stefan
2008-10-01
Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.
DEFF Research Database (Denmark)
Axelsen, K.B.; Venema, K.; Jah, T.
1999-01-01
in an extension of the C-terminus unique to plant H+-ATPases, Alteration of residues in both regions led to increased binding of yeast 14-3-3 protein to the plasma membrane of transformed cells. Taken together, our data suggest that modification of residues in two regions of the C-terminal regulatory domain......The plasma membrane H+-ATPase is a proton pump belonging to the P-type ATPase superfamily and is important for nutrient acquisition in plants, The H+-ATPase is controlled by an autoinhibitory C-terminal regulatory domain and is activated by 14-3-3 proteins which bind to this part of the enzyme......+-ATPase. The enzymes were characterized by their ability to promote growth in acidic conditions and to promote H+ extrusion from intact cells, both of which are measures of plasma membrane H+-ATPase activity, and were also characterized with respect to kinetic properties such as affinity for H+ and ATP. Residues...
Cell age dependent variations in oxidative protective enzymes
International Nuclear Information System (INIS)
Blakely, E.A.; Chang, P.Y.; Lommel, L.; Tobias, C.A.
1986-01-01
Activity levels of antioxidant enzymes were correlated before and after heavy-ion exposures with cellular radiosensitivity. In preliminary feasibility experiments with human T-1 cells relatively high antioxidant enzyme levels were shown in the unirradiated G 1 phase prior to the normal DNA synthetic phase. Endogenous cellular levels of three antioxidant enzymes were measured at various times in the unirradiated human T-1 cell division cycle. The enzymes measured were: catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GSHPX). Unlike the case in Chinese hamster V79 cells the early data with the synchronized human cell show that in very early G 1 phase (e.g., approximately 1.5 hours after mitotic selection) there are significant peaks in the levels (U/mg cell protein) of both CAT and SOD. Both enzymes show increases as the unirradiated cells progressed from mitosis into G 1 phase while the levels of GSHPX measured in duplicate samples were somewhat more variable than was the case for the other two enzymes. Studies were made in collaboration with the Armed Forces Radiobiology Research Institute
Delayed effects of radiation on enzymes in erythrocytes
International Nuclear Information System (INIS)
Li Jinying; Zhang Weiping; Liu Benti
1998-01-01
Objective: To study the delayed effects of radiation on the enzymes in erythrocytes. Methods: The activity of 8 enzymes, related glycolysis, hexose monophosphate shunt, nucleotide metabolism, redox reaction and esterase in erythrocytes of five patients with bone marrow form of acute radiation sickness (ARS) were assayed at 1,2,3 and 6 years after exposure to 60 Co radiation. Results: The decreased activities of glucose-6-phosphate dehydrogenase (G6PD), pyruvate kinase (PK), NADH-methemoglobin reductase (MR) during the stage of crisis and of acetylcholinesterase (ACE) during the stage of convalescence were recovered to varying extent, whereas the lowered activities of the first three enzymes in some cases remained unchanged. There was no correlation between the enzyme activity and the radiation dose as well as the age of the patients. Conclusion: It is demonstrated that the delayed effects of radiation damage to erythrocyte enzymes are most significant in PK of glycolysis, G6PD of hexose monophosphate shunt and MR of redox reaction. It is suggested that the genes related to the synthesis of erythrocyte enzymes may be damaged by radiation
DNA Methylation Analysis of the Angiotensin Converting Enzyme (ACE) Gene in Major Depression
Zill, Peter; Baghai, Thomas C.; Schüle, Cornelius; Born, Christoph; Früstück, Clemens; Büttner, Andreas; Eisenmenger, Wolfgang; Varallo-Bedarida, Gabriella; Rupprecht, Rainer; Möller, Hans-Jürgen; Bondy, Brigitta
2012-01-01
Background The angiotensin converting enzyme (ACE) has been repeatedly discussed as susceptibility factor for major depression (MD) and the bi-directional relation between MD and cardiovascular disorders (CVD). In this context, functional polymorphisms of the ACE gene have been linked to depression, to antidepressant treatment response, to ACE serum concentrations, as well as to hypertension, myocardial infarction and CVD risk markers. The mostly investigated ACE Ins/Del polymorphism accounts for ∼40%–50% of the ACE serum concentration variance, the remaining half is probably determined by other genetic, environmental or epigenetic factors, but these are poorly understood. Materials and Methods The main aim of the present study was the analysis of the DNA methylation pattern in the regulatory region of the ACE gene in peripheral leukocytes of 81 MD patients and 81 healthy controls. Results We detected intensive DNA methylation within a recently described, functional important region of the ACE gene promoter including hypermethylation in depressed patients (p = 0.008) and a significant inverse correlation between the ACE serum concentration and ACE promoter methylation frequency in the total sample (p = 0.02). Furthermore, a significant inverse correlation between the concentrations of the inflammatory CVD risk markers ICAM-1, E-selectin and P-selectin and the degree of ACE promoter methylation in MD patients could be demonstrated (p = 0.01 - 0.04). Conclusion The results of the present study suggest that aberrations in ACE promoter DNA methylation may be an underlying cause of MD and probably a common pathogenic factor for the bi-directional relationship between MD and cardiovascular disorders. PMID:22808171
Glorieux, Christophe; Calderon, Pedro Buc
2017-09-26
This review is centered on the antioxidant enzyme catalase and will present different aspects of this particular protein. Among them: historical discovery, biological functions, types of catalases and recent data with regard to molecular mechanisms regulating its expression. The main goal is to understand the biological consequences of chronic exposure of cells to hydrogen peroxide leading to cellular adaptation. Such issues are of the utmost importance with potential therapeutic extrapolation for various pathologies. Catalase is a key enzyme in the metabolism of H2O2 and reactive nitrogen species, and its expression and localization is markedly altered in tumors. The molecular mechanisms regulating the expression of catalase, the oldest known and first discovered antioxidant enzyme, are not completely elucidated. As cancer cells are characterized by an increased production of reactive oxygen species (ROS) and a rather altered expression of antioxidant enzymes, these characteristics represent an advantage in terms of cell proliferation. Meanwhile, they render cancer cells particularly sensitive to an oxidant insult. In this context, targeting the redox status of cancer cells by modulating catalase expression is emerging as a novel approach to potentiate chemotherapy.
Determining the safety of enzymes used in animal feed.
Pariza, Michael W; Cook, Mark
2010-04-01
The purpose of this paper is to provide guidance for evaluating the safety of enzyme preparations used in animal feed. Feed enzymes are typically added to animal feed to increase nutrient bioavailability by acting on feed components prior to or after consumption, i.e., within the gastrointestinal tract. In contrast, food processing enzymes are generally used during processing and then inactivated or removed prior to consumption. The enzymes used in both applications are almost always impure mixtures of active enzyme and other metabolites from the production strain, hence similar safety evaluation procedures for both are warranted. We propose that the primary consideration should be the safety of the production strain and that the decision tree mechanism developed previously for food processing enzymes (Pariza and Johnson, 2001) is appropriate for determining the safety of feed enzymes. Thoroughly characterized non-pathogenic, non-toxigenic microbial strains with a history of safe use in enzyme manufacture are also logical candidates for generating safe strain lineages, from which additional strains may be derived via genetic modification by traditional and non-traditional strategies. For new feed enzyme products derived from a safe strain lineage, it is important to ensure a sufficiently high safety margin for the intended use, and that the product complies with appropriate specifications for chemical and microbial contamination. Copyright 2009 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wanvisa Udomsinprasert
Full Text Available Biliary atresia (BA is a progressive fibroinflammatory liver disease. Autotaxin (ATX has a profibrotic effect resulting from lysophosphatidic acid activity. The purpose of this study was to examine ATX expression and ATX promoter methylation in peripheral blood leukocytes and liver tissues from BA patients and controls and investigate their associations with outcome parameters in BA patients.A total of 130 subjects (65 BA patients and 65 age-matched controls were enrolled. DNA was extracted from circulating leukocytes and liver tissues of BA patients and from and age-matched controls. ATX promoter methylation status was determined by bisulfite pyrosequencing. ATX expression was analyzed using quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay.Decreased methylation of specific CpGs were observed at the ATX promoter in BA patients. Subsequent analysis revealed that BA patients with advanced stage had lower methylation levels of ATX promoter than those with early stage. ATX promoter methylation levels were found to be associated with hepatic dysfunction in BA. In addition, ATX expression was significantly elevated and correlated with a decrease in ATX promoter methylation in BA patients compared to the controls. Furthermore, promoter hypomethylation and overexpression of ATX were inversely associated with jaundice status, hepatic dysfunction, and liver stiffness in BA patients.Accordingly, it has been hypothesized that ATX promoter methylation and ATX expression in peripheral blood may serve as possible biomarkers reflecting the progression of liver fibrosis in postoperative BA. These findings suggest that the promoter hypomethylation and overexpression of ATX might play a contributory role in the pathogenesis of liver fibrosis in BA.
Dotan, I; Shechter, I
1983-10-15
The effect of the thiols glutathione (GSH), dithiothreitol (DTT), and dithioerythritol (DTE) on the conversion of an inactive, latent form (El) of rat liver 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase, EC 1.1.1.34) to a catalyticaly active form (Ea) is examined. Latent hepatic microsomal HMG-CoA reductase is activated to a similar degree of activation by DTT and DTE and to a lower extent by GSH. All three thiols affect both Km and Vmax values of the enzyme toward HMG-CoA and NADPH. Studies of the effect of DTT on the affinity binding of HMG-CoA reductase to agarose-hexane-HMG-CoA (AG-HMG-CoA) resin shows that thiols are necessary for the binding of the enzyme to the resin. Removal of DTT from AG-HMG-CoA-bound soluble Ea (active enzyme) does not cause dissociation of the enzyme from the resin at low salt concentrations. Substitution of DTT by NADPH does not promote binding of soluble El (latent enzyme) to AG-HMG-CoA. The enzymatic activity of Ea in the presence of DTT and GSH indicates that these thiols compete for the same binding site on the enzyme. Diethylene glycol disulfide (ESSE) and glutathione disulfide (GSSG) inhibit the activity of Ea. ESSE is more effective for the inhibition of Ea than GSSG, causing a higher degree of maximal inhibition and affecting the enzymatic activity at lower concentrations. A method is described for the rapid conversion of soluble purified Ea to El using gel-filtration chromatography on Bio-Gel P-4 columns. These combined results point to the importance of the thiol/disulfide ratio for the modulation of hepatic HMG-CoA reductase activity.
Microbial genetic engineering and enzyme technology
Energy Technology Data Exchange (ETDEWEB)
Hollenberg, C.P.; Sahm, H.
1987-01-01
In a series of up-to-date contributions BIOTEC 1 has experts discussing the current topics in microbial gene technology and enzyme technology and speculating on future developments. Bacterial and yeast systems for the production of interferons, growth hormone or viral antigenes are described as well as the impact of gene technology on plants. Exciting is the prospect of degrading toxic compounds in our environment by microorganisms tuned in the laboratory. Enzymes are the most effective catalysts we know. They exhibit a very high substrate- and stereospecificity. These properties make enzymes extremely attractive as industrial catalysts, leading to new production processes that are non-polluting and save both energy and raw materials. (orig.) With 135 figs., 36 tabs.
Intestinal enzyme distribution after supralethal irradiation
Energy Technology Data Exchange (ETDEWEB)
Becciolini, A; Gerber, G B; Buracchi, A; Deroo, J [Florence Univ. (Italy). Istituto di Radiologia; Centre d' Etude de l' Energie Nucleaire, Mol (Belgium). Dept. de Radiobiologie)
1977-07-01
The activity of some intestinal enzymes has been studied after 2 kR irradiation. Brush border enzymes, maltase and leucineaminopeptidase (LAP) show an increase 20 hours after irradiation, while after 72 hours their activities are reduced to very low levels. Lysosomal enzymes show a completely different behaviour: acid phosphatase activity increases only 72 hours after irradiation, whereas ..beta.. glucuronidase increases significantly after 20 hours and reaches values two or three times higher than controls after 72 hours. The histologic picture at the first interval after irradiation shows gross alterations in the crypt region, but the villi appear nearly normal. Seventy-two hours after irradiation the whole epithelium is affected and very numerous leukocytes are present in the stroma.
DEFF Research Database (Denmark)
Sigurdardóttir, Sigyn Björk; Lehmann, Jonas; Ovtar, Simona
2018-01-01
Enzyme immobilization is an established method for the enhancement of enzyme stability and reusability, two factors that are of great importance for industrial biocatalytic applications. Immobilization can be achieved by different methods and on a variety of carrier materials, both organic and in...
Biochemical characterization of thermostable cellulase enzyme from ...
African Journals Online (AJOL)
user
2012-05-29
May 29, 2012 ... tested for their ability to produce cellulase complex enzyme by growing on a defined substrates as well ... In the current industrial processes, cellulolytic enzymes ... energy sources such as glucose, ethanol, hydrogen and.
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H; Brun, Reto; Carballeira, Néstor M
2010-11-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 μg/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 μg/ml), and Leishmania donovani (IC(50) values 4.1-13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.
2010-01-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty
Leznicki, A. J.; Bandurski, R. S.
1988-01-01
The first enzyme-catalyzed reaction leading from indole-3-acetic acid (IAA) to the myo-inositol esters of IAA is the synthesis of indole-3-acetyl-1-O-beta-D-glucose from uridine-5'-diphosphoglucose (UDPG) and IAA. The reaction is catalyzed by the enzyme, UDPG-indol-3-ylacetyl glucosyl transferase (IAA-glucose-synthase). This work reports methods for the assay of the enzyme and for the extraction and partial purification of the enzyme from kernels of Zea mays sweet corn. The enzyme has an apparent molecular weight of 46,500 an isoelectric point of 5.5, and its pH optimum lies between 7.3 and 7.6. The enzyme is stable to storage at zero degrees but loses activity during column chromatographic procedures which can be restored only fractionally by addition of column eluates. The data suggest either multiple unknown cofactors or conformational changes leading to activity loss.
Biomass degrading enzymes from Penicillium – cloning and characterization
DEFF Research Database (Denmark)
Krogh, Kristian Bertel Rømer
2008-01-01
. Størstedelen af den forskning, der er foregået indenfor cellulosenedbrydende enzymer er med enzymer produceret af svampen Trichoderma reesei. Under mit Ph.D.studium har jeg undersøgt biomassenedbrydende enzymer fra forskellige Penicillium arter. Hovedvægten af forskningen har været indenfor...... cellulosenedbrydende enzymer.Penicillium arter er blandt de hyppigst forekommende mikroorganismer i skovjord, hvori der netop nedbrydes store mængder plantemateriale. Ved en sammenligning af produktionen af biomassenedbrydende enzymer fra forskellige Penicillium arter blev der fundet flere interessante enzymsystemer...... reaktionstid ved den enzymatisk hydrolyse hvor de enkelte sukkermolekyler bliver frigivet, hvorfor enzymstabilitet er særdeles væsentlig, når et rentabelt cellulosenedbrydende enzymsystem skal sammensættes. De nødvendige enzymer for en fuldstændig hydrolyse af cellulose blev oprenset, klonet, produceret...
International Nuclear Information System (INIS)
Nagata, Seiki; Minamikawa, Tetsuhiro; Park, Yung-Dae; Nishimura, Tsunehiko; Yutani, Chikao; Ohmori, Fumio; Sakakibara, Hiroshi; Nimura, Yasuharu
1986-01-01
Asymmetric septal hypertrophy with abnormal thallium scintigram and elevated cardiac enzymes were observed in five patients and were studied with special reference to the clinical significance of their clinicopathological features. They were not familial cardiomyopathy patients. Two of the five patients (Cases 1 and 2) exhibited the clinical features characteristic of hypertrophic cardiomyopathy without abnormal thallium perfusion and serum cardiac enzyme levels. A right endomyocardial biopsy for Case 1 disclosed myocardial fibrosis in addition to hypertrophy and disarray of myocardial fibers. The left ventricular cavities of two other patients (Cases 4 and 5) tended to be dilated with signs of impaired systolic function and asymmetric septal hypertrophy. A regional area of reduced thickness was observed in the medial portion of the left ventricular posterior wall of Case 4. The remaining case (Case 3) exhibited left ventricular dilatation and reduced left ventricular systolic function, disproportionate hypertrophy, and had clinical signs of congestive heart failure. Necropsy disclosed massive fibrosis and diffuse disarray of myocardial fibers. Some patients with familial hypertrophic cardiomyopathy progress to exhibit clinical features of dilated cardiomyopathy in the termimal stages, and have massive fibrosis of the myocardium histologically. Thallium scintigraphic abnormalities and elevated serum levels of cardiac enzymes, especially the LDH 1 isoenzyme, in patients with hypertrophic cardiomyopathy may be a meaningful indicator of such progression in its early stages. The five patients in the present study exhibited a variety of clinical and histological features which may comprise a spectrum of clinical conditions during the progression from hypertrophic cardiomyopathy to a condition like dilated cardiomyopathy, similar to that in familial patients. This progression and the factors promoting it should be studied further in the near future. (author)
Directory of Open Access Journals (Sweden)
Daryl L Moorhead
2013-08-01
Full Text Available We re-examined data from a recent litter decay study to determine if additional insights could be gained to inform decomposition modeling. Rinkes et al. (2013 conducted 14-day laboratory incubations of sugar maple (Acer saccharum or white oak (Quercus alba leaves, mixed with sand (0.4% organic C content or loam (4.1% organic C. They measured microbial biomass C, carbon dioxide efflux, soil ammonium, nitrate, and phosphate concentrations, and β-glucosidase (BG, β-N-acetyl-glucosaminidase (NAG, and acid phosphatase (AP activities on days 1, 3, and 14. Analyses of relationships among variables yielded different insights than original analyses of individual variables. For example, although respiration rates per g soil were higher for loam than sand, rates per g soil C were actually higher for sand than loam, and rates per g microbial C showed little difference between treatments. Microbial biomass C peaked on day 3 when biomass-specific activities of enzymes were lowest, suggesting uptake of litter C without extracellular hydrolysis. This result refuted a common model assumption that all enzyme production is constitutive and thus proportional to biomass, and/or indicated that part of litter decay is independent of enzyme activity. The length and angle of vectors defined by ratios of enzyme activities (BG/NAG versus BG/AP represent relative microbial investments in C (length, and N and P (angle acquiring enzymes. Shorter lengths on day 3 suggested low C limitation, whereas greater lengths on day 14 suggested an increase in C limitation with decay. The soils and litter in this study generally had stronger P limitation (angles > 45˚. Reductions in vector angles to < 45˚ for sand by day 14 suggested a shift to N limitation. These relational variables inform enzyme-based models, and are usually much less ambiguous when obtained from a single study in which measurements were made on the same samples than when extrapolated from separate studies.
Radiation sterilization of enzyme hybrids with biodegradable polymers
International Nuclear Information System (INIS)
Furuta, Masakazu; Oka, Masahito; Hayashi, Toshio
2002-01-01
Ionizing radiations, which have already been utilized for the sterilization of medical supplies as well as gas fumigation, should be the final candidate to decontaminate 'hybrid' biomaterials containing bio-active materials including enzymes because irradiation induces neither heat nor substances affecting the quality of the materials and our health. In order to check the feasibility of 60 Co-gamma rays on these materials, we selected commercial proteases including papain and bromelain hybridized with commercial activated chitosan beads and demonstrated that these enzyme-hybrids suspended in water showed the significant radiation durability of more than twice as much as free enzyme solution at 25-kGy irradiation. Enhanced thermal and storage stability of the enzyme hybrids were not affected by the same dose level of irradiation, either, indicating that commercial irradiation sterilization method is applicable to enzyme hybrids without modification
Spectrophotometric Enzyme Assays for High-Throughput Screening
Directory of Open Access Journals (Sweden)
Jean-Louis Reymond
2004-01-01
Full Text Available This paper reviews high-throughput screening enzyme assays developed in our laboratory over the last ten years. These enzyme assays were initially developed for the purpose of discovering catalytic antibodies by screening cell culture supernatants, but have proved generally useful for testing enzyme activities. Examples include TLC-based screening using acridone-labeled substrates, fluorogenic assays based on the β-elimination of umbelliferone or nitrophenol, and indirect assays such as the back-titration method with adrenaline and the copper-calcein fluorescence assay for aminoacids.
Energy Technology Data Exchange (ETDEWEB)
Jiang, Yu Ping; Cheng, Fei; Zhou, Yan Hong; Xia, Xiao Jian; Mao, Wei Hua; Shi, Kai [Department of Horticulture, Zijingang Campus, Zhejiang University, Yuhangtang Road 866, Hangzhou 310058 (China); Chen, Zhi Xiang [Department of Horticulture, Zijingang Campus, Zhejiang University, Yuhangtang Road 866, Hangzhou 310058 (China); Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47907-2054 (United States); Yu, Jing Quan, E-mail: jqyu@zju.edu.cn [Department of Horticulture, Zijingang Campus, Zhejiang University, Yuhangtang Road 866, Hangzhou 310058 (China); Key Laboratory of Horticultural Plants Growth, Development and Quality Improvement, Ministry of Agriculture of China, Yuhangtang Road 866, Hangzhou 310058 (China)
2012-09-28
Highlights: Black-Right-Pointing-Pointer Activity of certain Calvin cycle enzymes and CO{sub 2} assimilation are induced by BRs. Black-Right-Pointing-Pointer BRs upregulate the activity of the ascorbate-glutathione cycle in the chloroplasts. Black-Right-Pointing-Pointer BRs increase the chloroplast thiol reduction state. Black-Right-Pointing-Pointer A BR-induced reducing environment increases the stability of photosynthetic enzymes. -- Abstract: Brassinosteroids (BRs) play important roles in plant growth, development, photosynthesis and stress tolerance; however, the mechanism underlying BR-enhanced photosynthesis is currently unclear. Here, we provide evidence that an increase in the BR level increased the quantum yield of PSII, activities of Rubisco activase (RCA) and fructose-1,6-bisphosphatase (FBPase), and CO{sub 2} assimilation. BRs upregulated the transcript levels of genes and activity of enzymes involved in the ascorbate-glutathione cycle in the chloroplasts, leading to an increased ratio of reduced (GSH) to oxidized (GSSG) glutathione in the chloroplasts. An increased GSH/GSSG ratio protected RCA from proteolytic digestion and increased the stability of redox-sensitive enzymes in the chloroplasts. These results strongly suggest that BRs are capable of regulating the glutathione redox state in the chloroplasts through the activation of the ascorbate-glutathione cycle. The resulting increase in the chloroplast thiol reduction state promotes CO{sub 2} assimilation, at least in part, by enhancing the stability and activity of redox-sensitive photosynthetic enzymes through post-translational modifications.
DEFF Research Database (Denmark)
Pedersen, Jakob Madsen; Fredsøe, Jacob Christian; Rødgaard, Morten Terpager
2012-01-01
To investigate the role of DNA topoisomerases in transcription, we have studied global gene expression in Saccharomyces cerevisiae cells deficient for topoisomerases I and II and performed single-gene analyses to support our findings. The genome-wide studies show a general transcriptional down......-regulation upon lack of the enzymes, which correlates with gene activity but not gene length. Furthermore, our data reveal a distinct subclass of genes with a strong requirement for topoisomerases. These genes are characterized by high transcriptional plasticity, chromatin regulation, TATA box presence......-depth analysis of the inducible PHO5 gene reveals that topoisomerases are essential for binding of the Pho4p transcription factor to the PHO5 promoter, which is required for promoter nucleosome removal during activation. In contrast, topoisomerases are dispensable for constitutive transcription initiation...
Primordial-like enzymes from bacteria with reduced genomes.
Ferla, Matteo P; Brewster, Jodi L; Hall, Kelsi R; Evans, Gary B; Patrick, Wayne M
2017-08-01
The first cells probably possessed rudimentary metabolic networks, built using a handful of multifunctional enzymes. The promiscuous activities of modern enzymes are often assumed to be relics of this primordial era; however, by definition these activities are no longer physiological. There are many fewer examples of enzymes using a single active site to catalyze multiple physiologically-relevant reactions. Previously, we characterized the promiscuous alanine racemase (ALR) activity of Escherichia coli cystathionine β-lyase (CBL). Now we have discovered that several bacteria with reduced genomes lack alr, but contain metC (encoding CBL). We characterized the CBL enzymes from three of these: Pelagibacter ubique, the Wolbachia endosymbiont of Drosophila melanogaster (wMel) and Thermotoga maritima. Each is a multifunctional CBL/ALR. However, we also show that CBL activity is no longer required in these bacteria. Instead, the wMel and T. maritima enzymes are physiologically bi-functional alanine/glutamate racemases. They are not highly active, but they are clearly sufficient. Given the abundance of the microorganisms using them, we suggest that much of the planet's biochemistry is carried out by enzymes that are quite different from the highly-active exemplars usually found in textbooks. Instead, primordial-like enzymes may be an essential part of the adaptive strategy associated with streamlining. © 2017 The Authors. Molecular Microbiology Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Yeu-Long Jiang
2013-08-01
Full Text Available This paper describes a light-addressed electrolytic system used to perform an electrodeposition of enzyme-entrapped chitosan membranes for multiplexed enzyme-based bioassays using a digital micromirror device (DMD. In this system, a patterned light illumination is projected onto a photoconductive substrate serving as a photo-cathode to electrolytically produce hydroxide ions, which leads to an increased pH gradient. The high pH generated at the cathode can cause a local gelation of chitosan through sol-gel transition. By controlling the illumination pattern on the DMD, a light-addressed electrodeposition of chitosan membranes with different shapes and sizes, as well as multiplexed micropatterning, was performed. The effect of the illumination time of the light pattern on the dimensional resolution of chitosan membrane formation was examined experimentally. Moreover, multiplexed enzyme-based bioassay of enzyme-entrapped chitosan membranes was also successfully demonstrated through the electrodeposition of the chitosan membranes with various shapes/sizes and entrapping different enzymes. As a model experiment, glucose and ethanol were simultaneously detected in a single detection chamber without cross-talk using shape-coded chitosan membranes entrapped with glucose oxidase (GOX, peroxidase (POD, and Amplex Red (AmR or alcohol oxidase (AOX, POD, and AmR by using same fluorescence indicator (AmR.
The dynamic basis of energy transduction in enzymes.
Somogyi, B; Welch, G R; Damjanovich, S
1984-09-06
The most important idea underlying our treatment herein is the unity of the enzyme molecule and the medium. Appreciation of this relationship is vital, if enzymology is to graduate from its present reductionistic status to a more holistic posture. Enzymes are biological entities firstly, and isolated objects of physicochemical analysis secondly. Perhaps the most crucial 'biological lesson', particularly apropos of enzymes in intermediary metabolism, concerns the 'cytosociology' of enzyme action in vivo [94,128]. The natural habitat of many enzymes in the living cell is far different from that in bulk aqueous solution in vitro. In order to obtain a real grasp of the nature of enzyme function, one must ultimately couch enzymology in concepts emerging from contemporary cell biology [95]. Notwithstanding, analysis precedes synthesis; and one must needs begin with the individual enzyme molecule. The trenchant efforts of the physical chemist and the organic chemist have produced a wealth of information on the nature of the binding and catalytic events at the enzyme active site. While it is not yet possible to explain precisely the complete sequence of events in the catalytic process, nevertheless, the basic mechanisms by which enzymes effect catalysis (i.e., reduce activation energy) now seem apparent [81,129]. The new frontier is to be found, in exploring the dynamic role of the protein matrix [17]. Not only does the protein provide the 3-D scaffolding for active-site processes, but, more importantly, it serves as the local solvent for the bound chemical subsystem. Thus, the dynamical aspects of enzyme catalysis (for thermally based systems) must arise from the fluctuational properties of the protein molecule. This notion is the common denominator in all of the models in subsection IIC. It is the anisotropic nature of this fluctuational behavior, which would characterize the energy-transduction phenomenon leading to localized catalytic events at the active-site. In
Development of a commercial enzymes system for lignocellulosic biomass saccharification
Energy Technology Data Exchange (ETDEWEB)
Kumar, Manoj
2012-12-20
DSM Innovation Inc., in its four year effort was able to evaluate and develop its in-house DSM fungal cellulolytic enzymes system to reach enzyme efficiency mandates set by DoE Biomass program MYPP goals. DSM enzyme cocktail is uniquely active at high temperature and acidic pH, offering many benefits and product differentiation in 2G bioethanol production. Under this project, strain and process development, ratio optimization of enzymes, protein and genetic engineering has led to multitudes of improvement in productivity and efficiency making development of a commercial enzyme system for lignocellulosic biomass saccharification viable. DSM is continuing further improvement by additional biodiversity screening, protein engineering and overexpression of enzymes to continue to further lower the cost of enzymes for saccharification of biomass.
Enzyme alterations in mediastine during and after radiotherapy. 2
International Nuclear Information System (INIS)
Alheit, H.D.; Alheit, C.; Herrmann, T.
1986-01-01
Results are presented estimating the serum activity of transaminases (ASAT and ALAT) in 72 patients after mediastinal irradiation. During and after mediastinal irradiation both enzymes showed essentially a parallel reaction. One day after irradiation a decrease of enzymes in patients who were irradiated with high single dosis (5 Gy) was observed, while patients irradiated with low or middle single dosis showed an increase of enzyme activity. A different temporal enzyme reaction is discussed to be the cause for this reaction in dependence on the applied single dose so that in patients with high single doses an initial enzyme increase caused by the radiation insult has changed into a following decrease under the starting level at the first control 24 hours later. Because patients without mediastinal tumors react in the same manner, the normal tissue surrounding the tumor is discussed to be the original place of enzyme secretion. Up to the end of irradiation a decrease of enzymes was observed in patients with high single dose or with high total dose (60 Gy) which is interpreted as an enzyme deficiency in tissue in consequence of destruction in formation places. In patients with middle total and low single doses an enzyme increase is registered with a still sufficient restoration capacity of the tissue discussed to be the cause of it. An enzyme increase, observed from the end of irradiation to the control date 3 to 6 months after irradiation, is mainly caused by a tumor progression (increased rate of liver metastases, especially in bronchial carcinoma) and can still be intensified by occurrence of pulmonal or cardiac radioreactions. (author)
Recent advances in enzyme extraction strategies: A comprehensive review.
Nadar, Shamraja S; Pawar, Rohini G; Rathod, Virendra K
2017-08-01
The increasing interest of industrial enzymes demands for development of new downstream strategies for maximizing enzyme recovery. The significant efforts have been focused on the development of newly adapted technologies to purify enzymes in catalytically active form. Recently, an aqueous two phase system (ATPS) is emerged as powerful tools for efficient extraction and purification of enzymes due to their versatility, lower cost, process integration capability and easy scale-up. The present review gives an overview of effect of parameters such as tie line length, pH, neutral salts, properties of polymer and salt involved in traditional polymer/polymer and polymer/salt ATPS for enzyme recovery. Further, advanced ATPS have been developed based on alcohols, surfactants, micellar compounds to avoid tedious recovery steps for getting desired enzyme. In order to improve the selectivity and efficiency of ATPS, recent approaches of conventional ATPS combined with different techniques like affinity ligands, ionic liquids, thermoseparating polymers and microfluidic device based ATPS have been reviewed. Moreover, three phase partitioning is also highlighted for enzymes enrichment as a blooming technology for efficiently integrated bioseparation techniques. At the end, it includes an overview of CLEAs technology and organic-inorganic nanoflowers preparation as novel strategies for simultaneous extraction, purification and immobilization of enzymes. Copyright © 2017 Elsevier B.V. All rights reserved.
Trakarnpaiboon, Srisakul; Srisuk, Nantana; Piyachomkwan, Kuakoon; Sakai, Kenji; Kitpreechavanich, Vichien
2017-09-14
In the present study, solid-state fermentation for the production of raw starch degrading enzyme was investigated by thermotolerant Rhizopus microsporus TISTR 3531 using a combination of agro-industrial wastes as substrates. The obtained crude enzyme was applied for hydrolysis of raw cassava starch and chips at low temperature and subjected to nonsterile ethanol production using raw cassava chips. The agro-industrial waste ratio was optimized using a simplex axial mixture design. The results showed that the substrate mixture consisting of rice bran:corncob:cassava bagasse at 8 g:10 g:2 g yielded the highest enzyme production of 201.6 U/g dry solid. The optimized condition for solid-state fermentation was found as 65% initial moisture content, 35°C, initial pH of 6.0, and 5 × 10 6 spores/mL inoculum, which gave the highest enzyme activity of 389.5 U/g dry solid. The enzyme showed high efficiency on saccharification of raw cassava starch and chips with synergistic activities of commercial α-amylase at 50°C, which promotes low-temperature bioethanol production. A high ethanol concentration of 102.2 g/L with 78% fermentation efficiency was achieved from modified simultaneous saccharification and fermentation using cofermentation of the enzymatic hydrolysate of 300 g raw cassava chips/L with cane molasses.
Shao, Ying; Chernaya, Valeria; Johnson, Candice; Yang, William Y; Cueto, Ramon; Sha, Xiaojin; Zhang, Yi; Qin, Xuebin; Sun, Jianxin; Choi, Eric T; Wang, Hong; Yang, Xiao-feng
2016-02-01
To determine whether the expression of histone modification enzymes is regulated in physiological and pathological conditions, we took an experimental database mining approach pioneered in our labs to determine a panoramic expression profile of 164 enzymes in 19 human and 17 murine tissues. We have made the following significant findings: (1) Histone enzymes are differentially expressed in cardiovascular, immune, and other tissues; (2) our new pyramid model showed that heart and T cells are among a few tissues in which histone acetylation/deacetylation, and histone methylation/demethylation are in the highest varieties; and (3) histone enzymes are more downregulated than upregulated in metabolic diseases and regulatory T cell (Treg) polarization/ differentiation, but not in tumors. These results have demonstrated a new working model of "Sand out and Gold stays," where more downregulation than upregulation of histone enzymes in metabolic diseases makes a few upregulated enzymes the potential novel therapeutic targets in metabolic diseases and Treg activity.
Effect of cadmium on lung lysosomal enzymes in vitro
International Nuclear Information System (INIS)
Giri, S.N.; Hollinger, M.A.
1995-01-01
Labilization of lysosomal enzymes is often associated with the general process of inflammation. The present study investigated the effect of the pneumotoxin cadmium on the release and activity of two lung lysosomal enzymes. Incubation of rat lung lysosomes with cadmium resulted in the release of β-glucuronidase but not acid phosphatase. The failure to ''release'' acid phosphatase appears to be the result of a direct inhibitory effect of cadmium on this enzyme. The K I for cadmium was determined to be 26.3 μM. The differential effect of cadmium on these two lysosomal enzymes suggests that caution should be exercised in selecting the appropriate enzyme marker for assessing lysosomal fragility in the presence of this toxicant. Furthermore, the differential basal release rate of the two enzymes from lung lysosomes may reflect the cellular heterogeneity of the lung. (orig.)
Effect of Alpinia zerumbet components on antioxidant and skin diseases-related enzymes
Directory of Open Access Journals (Sweden)
Chompoo Jamnian
2012-07-01
Full Text Available Abstract Background The skin is chronically exposed to endogenous and environmental pro-oxidant agents, leading to the harmful generation of reactive oxygen species. Antioxidant is vital substances which possess the ability to protect the body from damage cause by free radicals induce oxidative stress. Alpinia zerumbet, a traditionally important economic plant in Okinawa, contains several interesting bioactive constituents and possesses health promoting properties. In this regard, we carried out to test the inhibitory effect of crude extracts and isolated compounds from A. zerumbet on antioxidant and skin diseases-related enzymes. Methods The antioxidant activities were examined by DPPH, ABTS and PMS-NADH radical scavenging. Collagenase, elastase, hyaluronidase and tyrosinase were designed for enzymatic activities to investigate the inhibitory properties of test samples using a continuous spectrophotometric assay. The inhibitory capacity of test samples was presented at half maximal inhibitory concentration (IC50. Results The results showed that aqueous extract of the rhizome was found to have greater inhibitory effects than the others on both of antioxidant and skin diseases-related enzymes. Furthermore, 5,6-dehydrokawain (DK, dihydro-5,6-dehydrokawain (DDK and 8(17,12-labdadiene-15,16-dial (labdadiene, isolated from rhizome, were tested for antioxidant and enzyme inhibitions. We found that DK showed higher inhibitory activities on DPPH, ABTS and PMS-NADH scavenging (IC50 = 122.14 ± 1.40, 110.08 ± 3.34 and 127.78 ± 4.75 μg/ml, respectively. It also had stronger inhibitory activities against collagenase, elastase, hyaluronidase and tyrosinase (IC50 = 24.93 ± 0.97, 19.41 ± 0.61, 19.48 ± 0.24 and 76.67 ± 0.50 μg/ml, respectively than DDK and labdadiene. Conclusion Our results indicate that the rhizome aqueous extract proved to be the source of bioactive compounds against enzymes responsible for
DEEPre: sequence-based enzyme EC number prediction by deep learning
Li, Yu
2017-10-20
Annotation of enzyme function has a broad range of applications, such as metagenomics, industrial biotechnology, and diagnosis of enzyme deficiency-caused diseases. However, the time and resource required make it prohibitively expensive to experimentally determine the function of every enzyme. Therefore, computational enzyme function prediction has become increasingly important. In this paper, we develop such an approach, determining the enzyme function by predicting the Enzyme Commission number.We propose an end-to-end feature selection and classification model training approach, as well as an automatic and robust feature dimensionality uniformization method, DEEPre, in the field of enzyme function prediction. Instead of extracting manuallycrafted features from enzyme sequences, our model takes the raw sequence encoding as inputs, extracting convolutional and sequential features from the raw encoding based on the classification result to directly improve the prediction performance. The thorough cross-fold validation experiments conducted on two large-scale datasets show that DEEPre improves the prediction performance over the previous state-of-the-art methods. In addition, our server outperforms five other servers in determining the main class of enzymes on a separate low-homology dataset. Two case studies demonstrate DEEPre\\'s ability to capture the functional difference of enzyme isoforms.The server could be accessed freely at http://www.cbrc.kaust.edu.sa/DEEPre.
DEEPre: sequence-based enzyme EC number prediction by deep learning
Li, Yu; Wang, Sheng; Umarov, Ramzan; Xie, Bingqing; Fan, Ming; Li, Lihua; Gao, Xin
2017-01-01
Annotation of enzyme function has a broad range of applications, such as metagenomics, industrial biotechnology, and diagnosis of enzyme deficiency-caused diseases. However, the time and resource required make it prohibitively expensive to experimentally determine the function of every enzyme. Therefore, computational enzyme function prediction has become increasingly important. In this paper, we develop such an approach, determining the enzyme function by predicting the Enzyme Commission number.We propose an end-to-end feature selection and classification model training approach, as well as an automatic and robust feature dimensionality uniformization method, DEEPre, in the field of enzyme function prediction. Instead of extracting manuallycrafted features from enzyme sequences, our model takes the raw sequence encoding as inputs, extracting convolutional and sequential features from the raw encoding based on the classification result to directly improve the prediction performance. The thorough cross-fold validation experiments conducted on two large-scale datasets show that DEEPre improves the prediction performance over the previous state-of-the-art methods. In addition, our server outperforms five other servers in determining the main class of enzymes on a separate low-homology dataset. Two case studies demonstrate DEEPre's ability to capture the functional difference of enzyme isoforms.The server could be accessed freely at http://www.cbrc.kaust.edu.sa/DEEPre.
Enzyme loading dependence of cellulose hydrolysis of sugarcane bagasse
Directory of Open Access Journals (Sweden)
Carlos Martín
2012-01-01
Full Text Available The enzymatic hydrolysis of steam-pretreated sugarcane bagasse, either delignified or non-delignified, was studied as a function of enzyme loading. Hydrolysis experiments were carried out using five enzyme loadings (2.5 to 20 FPU/g cellulose and the concentration of solids was 2% for both materials. Alkaline delignification improved cellulose hydrolysis by increasing surface area. For both materials, glucose concentrations increased with enzyme loading. On the other hand, enzyme loadings higher than 15 FPU/g did not result in any increase in the initial rate, since the excess of enzyme adsorbed onto the substrate restricted the diffusion process through the structure.
Enzymic hydrolysis of cellulosic wastes to glucose
Energy Technology Data Exchange (ETDEWEB)
Spano, L A; Medeiros, J; Mandels, M
1976-01-01
An enzymic process for the conversion of cellulose to glucose is based on the use of a specific enzyme derived from mutant strains of the fungus trichoderma viride which is capable of reacting with the crystalline fraction of the cellulose molecule. The production and mode of action of the cellulase complex produced during the growth of trichoderma viride is discussed as well as the application of such enzymes for the conversion of cellulosic wastes to crude glucose syrup for use in production of chemical feedstocks, single-cell proteins, fuels, solvents, etc.
Immobilized enzyme studies in a microscale bioreactor.
Jones, Francis; Forrest, Scott; Palmer, Jim; Lu, Zonghuan; Elmore, John; Elmore, Bill B
2004-01-01
Novel microreactors with immobilized enzymes were fabricated using both silicon and polymer-based microfabrication techniques. The effectiveness of these reactors was examined along with their behavior over time. Urease enzyme was successfully incorporated into microchannels of a polymeric matrix of polydimethylsiloxane and through layer-bylayer self-assembly techniques onto silicon. The fabricated microchannels had cross-sectional dimensions ranging from tens to hundreds of micrometers in width and height. The experimental results for continuous-flow microreactors are reported for the conversion of urea to ammonia by urease enzyme. Urea conversions of >90% were observed.
Dibromine radical anion reactions with heme enzymes
International Nuclear Information System (INIS)
Gebicka, L.; Gebicki, J.L.
1996-01-01
Reactions of Br 2 radical anion with heme enzymes, catalase horseradish peroxidase, have been studied by pulse radiolysis. It has been found that Br 2 - does not react with the heme centre of investigated enzymes. Dibromine radical anion reacts with tryptophan residues of catalase without any influence on the activity of catalase. It is suggested that in pulse radiolysis studies, where horseradish peroxidase is at about tenfold excess toward Br 2 - , the enzyme is modified rather by Br 2 , than by Br 2 - . (author). 26 refs., 3 figs
Multi-enzyme catalyzed processes: Next generation biocatalysis
DEFF Research Database (Denmark)
Andrade Santacoloma, Paloma de Gracia; Sin, Gürkan; Gernaey, Krist
2011-01-01
Biocatalysis has been attracting increasing interest in recent years. Nevertheless, most studies concerning biocatalysis have been carried out using single enzymes (soluble or immobilized). Currently, multiple enzyme mixtures are attractive for the production of many compounds at an industrial...
Substrate mediated enzyme prodrug therapy
DEFF Research Database (Denmark)
Fejerskov, Betina; Jarlstad Olesen, Morten T; Zelikin, Alexander N
2017-01-01
Substrate mediated enzyme prodrug therapy (SMEPT) is a biomedical platform developed to perform a localized synthesis of drugs mediated by implantable biomaterials. This approach combines the benefits and at the same time offers to overcome the drawbacks for traditional pill-based drug administra......Substrate mediated enzyme prodrug therapy (SMEPT) is a biomedical platform developed to perform a localized synthesis of drugs mediated by implantable biomaterials. This approach combines the benefits and at the same time offers to overcome the drawbacks for traditional pill-based drug...
[Potentialization of antibiotics by lytic enzymes].
Brisou, J; Babin, P; Babin, R
1975-01-01
Few lytic enzymes, specially papaine and lysozyme, acting on the membrane and cell wall structures facilitate effects of bacitracine, streptomycine and other antibiotics. Streptomycino resistant strains became sensibles to this antibiotic after contact with papaine and lysozyme. The results of tests in physiological suspensions concern only the lytic activity of enzymes. The results on nutrient medium concern together lytic, and antibiotic activities.
Enzyme Characterization in Microreactors by UV-Vis Spectroscopy
DEFF Research Database (Denmark)
Ringborg, Rolf Hoffmeyer; Krühne, Ulrich; Woodley, John
for selection can at this point be improved by characterization of the enzyme performance where also inhibition and toxicity effects are taken into account. Enzyme characterization is here defined as the effect on initial rate of reaction with respect to pH, enzyme, substrate, co-substrate, product and co......-product concentration [2]. From this investigation, it will be possible to determine whether the enzyme meets the criteria for process requirements or not. The development of the process will determine the requirements and this can also reach a state of maturity that resolves obstacles, lowers criteria and paves......, as the enzyme resource is scarce at this point of development. In the case where the reaction operates with UV active components, UV can be used to detect compounds with high sensitivity supplemented by multivariate data analysis. The spectra are here decorrelated and regressed to yield concentrations...
Applications of Enzymes in Oil and Oilseed Processing
DEFF Research Database (Denmark)
Xu, Xuebing
Enzymes, through the last 20-30 years research and development, have been widely explored for the uses in oil and oilseed processing. Following the conventional processing technology from oilseeds, the oil can be produced through pressing or solvent extraction. The crude oil is then refined to meet...... edible requirements. The oil can be also modified to meet functional or even nutritional needs. In each of those steps, enzymes have been used in industry successfully. For the oil processing stage, enzymes have been used to destroy the cell structure so that makes the oil release easier, where...... conventionally high temperature conditioning or cooking is necessary. The good story in industry is the fish oil and olive oil processing. Good quality and higher oil yield have been achieved through the use of enzymes in the processing stages. For the refining stage, the use of enzymes for degumming has...
Size determination of an equilibrium enzymic system by radiation inactivation
International Nuclear Information System (INIS)
Simon, P.; Swillens, S.; Dumont, J.E.
1982-01-01
Radiation inactivation of complex enzymic systems is currently used to determine the enzyme size and the molecular organization of the components in the system. An equilibrium model was simulated describing the regulation of enzyme activity by association of the enzyme with a regulatory unit. It is assumed that, after irradiation, the system equilibrates before the enzyme activity is assayed. The theoretical results show that the target-size analysis of these numerical data leads to a bad estimate of the enzyme size. Moreover, some implicit assumptions such as the transfer of radiation energy between non-covalently bound molecules should be verified before interpretation of target-size analysis. It is demonstrated that the apparent target size depends on the parameters of the system, namely the size and the concentration of the components, the equilibrium constant, the relative activities of free enzyme and enzymic complex, the existence of energy transfer, and the distribution of the components between free and bound forms during the irradiation. (author)
Wang, Zhi-Jiang; Zheng, Li; Yang, Jun-Mo; Kang, Yani; Park, Yong-Doo
2018-06-01
Fucoidans are complex sulfated polysaccharides that have a wide range of biological activities. Previously, we reported the various effects of Fucus vesiculosus fucoidan on tyrosinase and B16 melanoma cells. In this study, to identify fucoidan-targeted proteins in B16 melanoma cells, we performed a proteomics study and integrated enzyme kinetics. We detected 19 candidate proteins dysregulated by fucoidan treatment. Among the probed proteins, the enzyme kinetics of two candidate enzymes, namely lactate dehydrogenase (LDH) as an upregulated protein and superoxide dismutase (SOD) as a downregulated enzyme, were determined. The enzyme kinetics results showed that Fucus vesiculosus fucoidan significantly inhibited LDH catalytic function while it did not affect SOD activity even at a high dose, while only slightly decreased activity (up to 10%) at a low dose. Based on our previous and present observations, fucoidan could inhibit B16 melanoma cells growth via regulating proteins/enzymes expression levels such as LDH and SOD known as cell survival biomarkers. Interestingly, both expression level and enzyme catalytic activity of LDH were regulated by fucoidan, which could directly induce the apoptotic effect on B16 melanoma cells along with SOD downregulation. This study highlights how combining proteomics with enzyme kinetics can yield valuable insights into fucoidan targets. Copyright © 2018 Elsevier B.V. All rights reserved.
Khan, Abdur Rahim; Park, Gun-Seok; Asaf, Sajjad; Hong, Sung-Jun; Jung, Byung Kwon
2017-01-01
Serratia marcescens RSC-14 is a Gram-negative bacterium that was previously isolated from the surface-sterilized roots of the Cd-hyperaccumulator Solanum nigrum. The strain stimulates plant growth and alleviates Cd stress in host plants. To investigate the genetic basis for these traits, the complete genome of RSC-14 was obtained by single-molecule real-time sequencing. The genome of S. marcescens RSC-14 comprised a 5.12-Mbp-long circular chromosome containing 4,593 predicted protein-coding genes, 22 rRNA genes, 88 tRNA genes, and 41 pseudogenes. It contained genes with potential functions in plant growth promotion, including genes involved in indole-3-acetic acid (IAA) biosynthesis, acetoin synthesis, and phosphate solubilization. Moreover, annotation using NCBI and Rapid Annotation using Subsystem Technology identified several genes that encode antioxidant enzymes as well as genes involved in antioxidant production, supporting the observed resistance towards heavy metals, such as Cd. The presence of IAA pathway-related genes and oxidative stress-responsive enzyme genes may explain the plant growth-promoting potential and Cd tolerance, respectively. This is the first report of a complete genome sequence of Cd-tolerant S. marcescens and its plant growth promotion pathway. The whole-genome analysis of this strain clarified the genetic basis underlying its phenotypic and biochemical characteristics, underpinning the beneficial interactions between RSC-14 and plants. PMID:28187139
Ulusu, Nuriye Nuray
2015-07-01
Life as we know it heavily relies on biological catalysis, in fact, in a very nonromantic version of it, life could be considered as a series of chemical reactions, regulated by the guarding principles of thermodynamics. In ancient times, a beating heart was a good sign of vitality, however, to me, it is actually the presence of active enzymes that counts… Though we do not usually pay attention, the history of enzymology is as old as humanity itself, and dates back to the ancient times. This paper is dedicated to these early moments of this remarkable science that touched our lives in the past and will make life a lot more efficient for humanity in the future. There was almost always a delicate, fundamentally essential relationship between mankind and the enzymes. Challenged by a very alien and hostile Nature full of predators, prehistoric men soon discovered the medicinal properties of the plants, through trial and error. In fact, they accidently discovered the enzyme inhibitors and thus, in crude terms, kindled a sparkling area of research. These plant-derivatives that acted as enzyme inhibitors helped prehistoric men in their pursuit of survival and protection from predators; in hunting and fishing… Later in history, while the underlying purposes of survival and increasing the quality of life stayed intact, the ways and means of enzymology experienced a massive transformation, as the 'trial and error' methodology of the ancients is now replaced with rational scientific theories.
Preparation of immobilized enzyme membrane by radiation-cast-polymerization
International Nuclear Information System (INIS)
Kumakura, M.; Kaetsu, I.
1989-01-01
The preparation of immobilized enzyme membranes was studied by radiation cast-polymerization at low temperatures using cellulase enzyme, hydrophilic and hydrophobic monomers. The enzyme activity of the membranes was affected by monomer concentration, membrane thickness, and hydrophilicity of monomer, in which the membranes with 100 μm thickness from high monomer concentration (80%) had high enzyme activity, which was similar to that of the membranes with 1.0 mm thickness from low monomer concentration (20%). (author)
Thematic review series: glycerolipids. DGAT enzymes and triacylglycerol biosynthesis.
Yen, Chi-Liang Eric; Stone, Scot J; Koliwad, Suneil; Harris, Charles; Farese, Robert V
2008-11-01
Triacylglycerols (triglycerides) (TGs) are the major storage molecules of metabolic energy and FAs in most living organisms. Excessive accumulation of TGs, however, is associated with human diseases, such as obesity, diabetes mellitus, and steatohepatitis. The final and the only committed step in the biosynthesis of TGs is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes. The genes encoding two DGAT enzymes, DGAT1 and DGAT2, were identified in the past decade, and the use of molecular tools, including mice deficient in either enzyme, has shed light on their functions. Although DGAT enzymes are involved in TG synthesis, they have distinct protein sequences and differ in their biochemical, cellular, and physiological functions. Both enzymes may be useful as therapeutic targets for diseases. Here we review the current knowledge of DGAT enzymes, focusing on new advances since the cloning of their genes, including possible roles in human health and diseases.
Hfq stimulates the activity of the CCA-adding enzyme
Directory of Open Access Journals (Sweden)
Betat Heike
2007-10-01
Full Text Available Abstract Background The bacterial Sm-like protein Hfq is known as an important regulator involved in many reactions of RNA metabolism. A prominent function of Hfq is the stimulation of RNA polyadenylation catalyzed by E. coli poly(A polymerase I (PAP. As a member of the nucleotidyltransferase superfamily, this enzyme shares a high sequence similarity with an other representative of this family, the tRNA nucleotidyltransferase that synthesizes the 3'-terminal sequence C-C-A to all tRNAs (CCA-adding enzyme. Therefore, it was assumed that Hfq might not only influence the poly(A polymerase in its specific activity, but also other, similar enzymes like the CCA-adding enzyme. Results Based on the close evolutionary relation of these two nucleotidyltransferases, it was tested whether Hfq is a specific modulator acting exclusively on PAP or whether it also influences the activity of the CCA-adding enzyme. The obtained data indicate that the reaction catalyzed by this enzyme is substantially accelerated in the presence of Hfq. Furthermore, Hfq binds specifically to tRNA transcripts, which seems to be the prerequisite for the observed effect on CCA-addition. Conclusion The increase of the CCA-addition in the presence of Hfq suggests that this protein acts as a stimulating factor not only for PAP, but also for the CCA-adding enzyme. In both cases, Hfq interacts with RNA substrates, while a direct binding to the corresponding enzymes was not demonstrated up to now (although experimental data indicate a possible interaction of PAP and Hfq. So far, the basic principle of these stimulatory effects is not clear yet. In case of the CCA-adding enzyme, however, the presented data indicate that the complex between Hfq and tRNA substrate might enhance the product release from the enzyme.
Lignocellulose biotechnology: issues of bioconversion and enzyme ...
African Journals Online (AJOL)
Lignocellulose biotechnology: issues of bioconversion and enzyme production. ... and secondly to highlight some of the modern approaches which potentially could be used to tackle one of the major impediments, namely high enzyme cost, to speed-up the extensive commercialisation of the lignocellulose bioprocessing.
21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Mixed carbohydrase and protease enzyme product. 184... RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1027 Mixed carbohydrase and protease enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes...
Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.
2016-12-01
A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene
Effects of de-icing salt on soil enzyme activity
Energy Technology Data Exchange (ETDEWEB)
Guentner, M; Wilke, B M
1983-01-01
Effects of de-icing salt on dehydrogenase, urease, alkalinephosphatase and arylsulfatase activity of O/sub L/- and A/sub h/-horizons of a moder and a mull soil were investigated using a field experiment. Additions of 2.5 kg m/sup -2/ and 5.0 kg m/sup -2/ of de-icing salt reduced activities of most enzymes within four weeks. Eleven months after salt addition there was nearly no reduction of enzyme activity to be measured on salt treated soils. The percentage of reduced enzyme activity was generally higher in the moder soil. It was concluded that reductions of enzyme activity were due to decreases of microbial activity and not to inactivation of enzymes.
Chung, Chia-Min; Wang, Ruey-Yun; Fann, Cathy S. J.; Chen, Jaw-Wen; Jong, Yuh-Shiun; Jou, Yuh-Shan; Yang, Hsin-Chou; Kang, Chih-Sen; Chen, Chien-Chung; Chang, Huan-Cheng; Pan, Wen-Harn
2013-01-01
Angiotensin-converting enzyme (ACE) has been implicated in multiple biological system, particularly cardiovascular diseases. However, findings associating ACE insertion/deletion polymorphism with hypertension or other related traits are inconsistent. Therefore, in a two-stage approach, we aimed to fine-map ACE in order to narrow-down the function-specific locations. We genotyped 31 single nucleotide polymorphisms (SNPs) of ACE from 1168 individuals from 305 young-onset (age ≤40) hypertension pedigrees, and found four linkage disequilibrium (LD) blocks. A tag-SNP, rs1800764 on LD block 2, upstream of and near the ACE promoter, was significantly associated with young-onset hypertension (p = 0.04). Tag-SNPs on all LD blocks were significantly associated with ACE activity (p-value: 10–16 to ACE activity were found between exon13 and intron18 and between intron 20 and 3′UTR, as revealed by measured haplotype analysis. These two major QTLs of ACE activity and the moderate effect variant upstream of ACE promoter for young-onset hypertension were replicated by another independent association study with 842 subjects. PMID:23469169
Ceramic membrane microfilter as an immobilized enzyme reactor.
Harrington, T J; Gainer, J L; Kirwan, D J
1992-10-01
This study investigated the use of a ceramic microfilter as an immobilized enzyme reactor. In this type of reactor, the substrate solution permeates the ceramic membrane and reacts with an enzyme that has been immobilized within its porous interior. The objective of this study was to examine the effect of permeation rate on the observed kinetic parameters for the immobilized enzyme in order to assess possible mass transfer influences or shear effects. Kinetic parameters were found to be independent of flow rate for immobilized penicillinase and lactate dehydrogenase. Therefore, neither mass transfer nor shear effects were observed for enzymes immobilized within the ceramic membrane. Both the residence time and the conversion in the microfilter reactor could be controlled simply by regulating the transmembrane pressure drop. This study suggests that a ceramic microfilter reactor can be a desirable alternative to a packed bed of porous particles, especially when an immobilized enzyme has high activity and a low Michaelis constant.
Independent Evolution of Six Families of Halogenating Enzymes.
Xu, Gangming; Wang, Bin-Gui
2016-01-01
Halogenated natural products are widespread in the environment, and the halogen atoms are typically vital to their bioactivities. Thus far, six families of halogenating enzymes have been identified: cofactor-free haloperoxidases (HPO), vanadium-dependent haloperoxidases (V-HPO), heme iron-dependent haloperoxidases (HI-HPO), non-heme iron-dependent halogenases (NI-HG), flavin-dependent halogenases (F-HG), and S-adenosyl-L-methionine (SAM)-dependent halogenases (S-HG). However, these halogenating enzymes with similar biological functions but distinct structures might have evolved independently. Phylogenetic and structural analyses suggest that the HPO, V-HPO, HI-HPO, NI-HG, F-HG, and S-HG enzyme families may have evolutionary relationships to the α/β hydrolases, acid phosphatases, peroxidases, chemotaxis phosphatases, oxidoreductases, and SAM hydroxide adenosyltransferases, respectively. These halogenating enzymes have established sequence homology, structural conservation, and mechanistic features within each family. Understanding the distinct evolutionary history of these halogenating enzymes will provide further insights into the study of their catalytic mechanisms and halogenation specificity.
Research Applications of Proteolytic Enzymes in Molecular Biology
Mótyán, János András; Tóth, Ferenc; Tőzsér, József
2013-01-01
Proteolytic enzymes (also termed peptidases, proteases and proteinases) are capable of hydrolyzing peptide bonds in proteins. They can be found in all living organisms, from viruses to animals and humans. Proteolytic enzymes have great medical and pharmaceutical importance due to their key role in biological processes and in the life-cycle of many pathogens. Proteases are extensively applied enzymes in several sectors of industry and biotechnology, furthermore, numerous research applications ...
Influence of high temperature and ethanol on thermostable lignocellulolytic enzymes
DEFF Research Database (Denmark)
Skovgaard, Pernille Anastasia; Jørgensen, Henning
2013-01-01
the influence of temperature and ethanol on enzyme activity and stability in the distillation step, where most enzymes are inactivated due to high temperatures. Two enzyme mixtures, a mesophilic and a thermostable mixture, were exposed to typical process conditions [temperatures from 55 to 65 °C and up to 5...... % ethanol (w/v)] followed by specific enzyme activity analyses and SDS-PAGE. The thermostable and mesophilic mixture remained active at up to 65 and 55 °C, respectively. When the enzyme mixtures reached their maximum temperature limit, ethanol had a remarkable influence on enzyme activity, e.g., the more...... ethanol, the faster the inactivation. The reason could be the hydrophobic interaction of ethanol on the tertiary structure of the enzyme protein. The thermostable mixture was more tolerant to temperature and ethanol and could therefore be a potential candidate for recycling after distillation....
21 CFR 184.1287 - Enzyme-modified fats.
2010-04-01
... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD... that are generally recognized as safe (GRAS). Enzyme-modified milk powder may be prepared with GRAS enzymes from reconstituted milk powder, whole milk, condensed or concentrated whole milk, evaporated milk...
International Nuclear Information System (INIS)
Alpert, C.A.; Frank, R.; Stueber, K.D.; Deutscher, J.; Hengstenberg, W.
1985-01-01
Enzyme I, the phosphoenolpyruvate:protein phosphotransferase (EC 2.7.3.9), which is part of the bacterial phosphoenolpyruvate-(PEP) dependent phosphotransferase system, has been purified from Streptococcus faecalis by using a large-scale preparation. Size exclusion chromatography revealed a molecular weight of 140,000. On sodium dodecyl sulfate gels, enzyme I gave one band with a molecular weight of 70,000, indicating that enzyme I consists of two identical subunits. The first 59 amino acids of the amino-terminal part of the protein have been sequenced. It showed some similarities with enzyme I of Salmonella typhimurium. The active center of enzyme I has also been determined. After phosphorylation with [ 32 P]PEP, the enzyme was cleaved by using different proteases. Labeled peptides were isolated by high-performance liquid chromatography on a reversed-phase column. The amino acid composition or amino acid sequence of the peptides has been determined. The largest labeled peptide was obtained with Lys-C protease and had the following sequence: -Ala-Phe-Val-Thr-Asp-Ile-Gly- Gly-Arg-Thr-Ser-His*-Ser-Ala-Ile-Met-Ala-Arg-Ser-Leu-Glu-Ile-Pro-Ala- Ile-Val-Gly-Thr-Lys-. It has previously been shown that the phosphoryl group is bound to the N-3 position of a histidyl residue in phosphorylated enzyme I. The single His in position 12 of the above peptide must therefore carry the phosphoryl group
Dimeric assembly of enterocyte brush border enzymes
DEFF Research Database (Denmark)
Danielsen, E M
1994-01-01
The noncovalent, dimeric assembly of small intestinal brush border enzymes was studied by sedimentation analysis in density gradients of extracts of pulse-labeled pig jejunal mucosal explants. Like aminopeptidase N (EC 3.4.11.2), sucrase-isomaltase (EC 3.2.1.48-10), aminopeptidase A (EC 3...... appearance of the liposome-reconstituted enzyme [Norén et al. (1986) J. Biol. Chem. 261, 12306-12309], showing only the inner, membrane-anchored domains of the monomers to be in close contact with one another while the outer domains are far apart. In contrast to the other brush border enzymes studied...
Thermophilic archaeal enzymes and applications in biocatalysis.
Littlechild, Jennifer A
2011-01-01
Thermophilic enzymes have advantages for their use in commercial applications and particularly for the production of chiral compounds to produce optically pure pharmaceuticals. They can be used as biocatalysts in the application of 'green chemistry'. The thermophilic archaea contain enzymes that have already been used in commercial applications such as the L-aminoacylase from Thermococcus litoralis for the resolution of amino acids and amino acid analogues. This enzyme differs from bacterial L-aminoacylases and has similarities to carboxypeptidases from other archaeal species. An amidase/γ-lactamase from Sulfolobus solfataricus has been used for the production of optically pure γ-lactam, the building block for antiviral carbocyclic nucleotides. This enzyme has similarities to the bacterial signature amidase family. An alcohol dehydrogenase from Aeropyrum pernix has been used for the production of optically pure alcohols and is related to the zinc-containing eukaryotic alcohol dehydrogenases. A transaminase and a dehalogenase from Sulfolobus species have also been studied. The archaeal transaminase is found in a pathway for serine synthesis which is found only in eukaryotes and not in bacteria. It can be used for the asymmetric synthesis of homochiral amines of high enantioselective purity. The L-2-haloacid dehalogenase has applications both in biocatalysis and in bioremediation. All of these enzymes have increased thermostability over their mesophilic counterparts.
21 CFR 862.3360 - Drug metabolizing enzyme genotyping system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Drug metabolizing enzyme genotyping system. 862... Test Systems § 862.3360 Drug metabolizing enzyme genotyping system. (a) Identification. A drug metabolizing enzyme genotyping system is a device intended for use in testing deoxyribonucleic acid (DNA...
Ultrasound in Enzyme Activation and Inactivation
Mawson, Raymond; Gamage, Mala; Terefe, Netsanet Shiferaw; Knoerzer, Kai
As discussed in previous chapters, most effects due to ultrasound arise from cavitation events, in particular, collapsing cavitation bubbles. These collapsing bubbles generate very high localized temperatures and pressure shockwaves along with micro-streaming that is associated with high shear forces. These effects can be used to accelerate the transport of substrates and reaction products to and from enzymes, and to enhance mass transfer in enzyme reactor systems, and thus improve efficiency. However, the high velocity streaming, together with the formation of hydroxy radicals and heat generation during collapsing of bubbles, may also potentially affect the biocatalyst stability, and this can be a limiting factor in combined ultrasound/enzymatic applications. Typically, enzymes can be readily denatured by slight changes in environmental conditions, including temperature, pressure, shear stress, pH and ionic strength.
Functional Sites Induce Long-Range Evolutionary Constraints in Enzymes.
Directory of Open Access Journals (Sweden)
Benjamin R Jack
2016-05-01
Full Text Available Functional residues in proteins tend to be highly conserved over evolutionary time. However, to what extent functional sites impose evolutionary constraints on nearby or even more distant residues is not known. Here, we report pervasive conservation gradients toward catalytic residues in a dataset of 524 distinct enzymes: evolutionary conservation decreases approximately linearly with increasing distance to the nearest catalytic residue in the protein structure. This trend encompasses, on average, 80% of the residues in any enzyme, and it is independent of known structural constraints on protein evolution such as residue packing or solvent accessibility. Further, the trend exists in both monomeric and multimeric enzymes and irrespective of enzyme size and/or location of the active site in the enzyme structure. By contrast, sites in protein-protein interfaces, unlike catalytic residues, are only weakly conserved and induce only minor rate gradients. In aggregate, these observations show that functional sites, and in particular catalytic residues, induce long-range evolutionary constraints in enzymes.
Energy Technology Data Exchange (ETDEWEB)
Klyachko, N. L.; Dmitrieva, N. F.; Eshchina, A. S.; Ignatenko, O. V.; Filatova, L. Y.; Rainina, Evguenia I.; Kazarov, A. K.; Levashov, A. V.
2008-06-01
Recombinant, phage associated lytic enzyme Ply C capable to lyse streptococci of groups A and C was stabilized in the variety of the micelles containing compositions to improve the stability of the enzyme for further application in medicine. It was shown that, in the micellar polyelectrolyte composition M16, the enzyme retained its activity for 2 months; while in a buffer solution under the same conditions ((pH 6.3, room temperature), it completely lost its activity in 2 days
Jung, Young Hoon; Kim, Hyun Kyung; Song, Du-Sup; Choi, In-Geol; Yang, Taek Ho; Lee, Hee Jong; Seung, Doyoung; Kim, Kyoung Heon
2014-04-01
In the conversion of lignocellulose into high-value products, including fuels and chemicals, the production of cellulase and the enzymatic hydrolysis for producing fermentable sugar are the largest contributors to the cost of production of the final products. The marine bacterium Saccharophagus degradans 2-40(T) can degrade more than ten different complex polysaccharides found in the ocean, including cellulose and xylan. Accordingly, S. degradans has been actively considered as a practical source of crude enzymes needed for the saccharification of lignocellulose to produce ethanol by others including a leading commercial company. However, the overall enzyme system of S. degradans for hydrolyzing cellulose and hemicellulose has not been quantitatively evaluated yet in comparison with commercial enzymes. In this study, the inductions and activities of cellulase and xylanase of cell-free lysate of S. degradans were investigated. The growth of S. degradans cells and the activities of cellulase and xylanase were promoted by adding 2 % of cellulose and xylan mixture (cellulose:xylan = 4:3 in mass ratio) to the aquarium salt medium supplemented with 0.2 % glucose. The specific cellulase activity of the cell-free lysate of S. degradans, as determined by the filter paper activity assay, was approximately 70 times lower than those of commercial cellulases, including Celluclast 1.5 L and Accellerase 1000. These results imply that significant improvement in the cellulase activity of S. degradans is needed for the industrial uses of S. degradans as the enzyme source.
Progress of Mimetic Enzymes and Their Applications in Chemical Sensors.
Yang, Bin; Li, Jianping; Deng, Huan; Zhang, Lianming
2016-11-01
The need to develop innovative and reformative approaches to synthesize chemical sensors has increased in recent years because of demands for selectivity, stability, and reproducibility. Mimetic enzymes provide an efficient and convenient method for chemical sensors. This review summarizes the application of mimetic enzymes in chemical sensors. Mimetic enzymes can be classified into five categories: hydrolases, oxidoreductases, transferases, isomerases, and induced enzymes. Potential and recent applications of mimetic enzymes in chemical sensors are reviewed in detail, and the outlook of profound development has been illustrated.
Simmons, Graham; Zmora, Pawel; Gierer, Stefanie; Heurich, Adeline; Pöhlmann, Stefan
2013-12-01
The severe acute respiratory syndrome (SARS) pandemic revealed that zoonotic transmission of animal coronaviruses (CoV) to humans poses a significant threat to public health and warrants surveillance and the development of countermeasures. The activity of host cell proteases, which cleave and activate the SARS-CoV spike (S) protein, is essential for viral infectivity and constitutes a target for intervention. However, the identities of the proteases involved have been unclear. Pioneer studies identified cathepsins and type II transmembrane serine proteases as cellular activators of SARS-CoV and demonstrated that several emerging viruses might exploit these enzymes to promote their spread. Here, we will review the proteolytic systems hijacked by SARS-CoV for S protein activation, we will discuss their contribution to viral spread in the host and we will outline antiviral strategies targeting these enzymes. This paper forms part of a series of invited articles in Antiviral Research on "From SARS to MERS: 10years of research on highly pathogenic human coronaviruses.'' Copyright © 2013 Elsevier B.V. All rights reserved.
Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism in Migraine Patients
Directory of Open Access Journals (Sweden)
Belgin Alaşehirli
2009-12-01
Full Text Available OBJECTIVE: The beneficial effects of angiotensin converting enzyme inhibitor drugs on migraine attack frequency have been shown. We aimed to study the relationship between the angiotensin converting enzyme gene and migraine pathophysiology. METHODS: In the present study, to assess whether the angiotensin converting enzyme insertion/deletion (I/D gene polymorphisms have an effect on migraine attacks, we studied the angiotensin converting enzyme genotypes of 102 migraine patients (35 cases of migraine with aura and 67 of migraine without aura and 75 age-and sex-matched normal volunteers. Frequency and age of onset of migraine attacks were also assessed according to angiotensin converting enzyme genotypes. RESULTS: Patients with migraine with and without aura were comparable with each other and the control group with respect to angiotensin converting enzyme genotypes (respectively; p= 0.88 and p= 0.76, p= 0.624. We could not determine a relationship between angiotensin converting enzyme genotypes and attack frequency (p= 0.125, but cases with angiotensin converting enzyme-II genotype showed a significantly younger age for onset of migraine attacks in comparison with the I/D genotype patients (p= 0.021. CONCLUSION: We believe that further angiotensin converting enzyme gene studies are warranted in younger age groups of patients with migraine and also in different populations
Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells
Directory of Open Access Journals (Sweden)
Hsu Anna
2011-10-01
Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.
Plant growth and resistance promoted by Streptomyces spp. in tomato.
Dias, Maila P; Bastos, Matheus S; Xavier, Vanessa B; Cassel, Eduardo; Astarita, Leandro V; Santarém, Eliane R
2017-09-01
Plant Growth Promoting Rhizobacteria (PGPR) represent an alternative to improve plant growth and yield as well as to act as agents of biocontrol. This study characterized isolates of Streptomyces spp. (Stm) as PGPR, determined the antagonism of these isolates against Pectobacterium carotovorum subsp. brasiliensis (Pcb), evaluated the ability of Stm on promoting growth and modulating the defense-related metabolism of tomato plants, and the potential of Stm isolates on reducing soft rot disease in this species. The VOC profile of Stm was also verified. Promotion of plant growth was assessed indirectly through VOC emission and by direct interaction with Stm isolates in the roots. Evaluation of soft rot disease was performed in vitro on plants treated with Stm and challenged with Pcb. Enzymes related to plant defense were then analyzed in plants treated with three selected isolates of Stm, and PM1 was chosen for further Pcb-challenging experiment. Streptomyces spp. isolates displayed characteristics of PGPR. PM3 was the isolate with efficient antagonism against Pcb by dual-culture. Most of the isolates promoted growth of root and shoot of tomato plants by VOC, and PM5 was the isolate that most promoted growth by direct interaction with Stm. Soft rot disease and mortality of plants were significantly reduced when plants were treated with StmPM1. Modulation of secondary metabolism was observed with Stm treatment, and fast response of polyphenoloxidases was detected in plants pretreated with StmPM1 and challenged with Pcb. Peroxidase was significantly activated three days after infection with Pcb in plants pretreated with StmPM1. Results suggest that Streptomyces sp. PM1 and PM5 have the potential to act as PGPR. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Molecular Imaging of Hydrolytic Enzymes Using PET and SPECT.
Rempel, Brian P; Price, Eric W; Phenix, Christopher P
2017-01-01
Hydrolytic enzymes are a large class of biological catalysts that play a vital role in a plethora of critical biochemical processes required to maintain human health. However, the expression and/or activity of these important enzymes can change in many different diseases and therefore represent exciting targets for the development of positron emission tomography (PET) and single-photon emission computed tomography (SPECT) radiotracers. This review focuses on recently reported radiolabeled substrates, reversible inhibitors, and irreversible inhibitors investigated as PET and SPECT tracers for imaging hydrolytic enzymes. By learning from the most successful examples of tracer development for hydrolytic enzymes, it appears that an early focus on careful enzyme kinetics and cell-based studies are key factors for identifying potentially useful new molecular imaging agents.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Optimum concrete compression strength using bio-enzyme
Directory of Open Access Journals (Sweden)
Bagio Tony Hartono
2017-01-01
Full Text Available To make concrete with high compressive strength and has a certain concrete specifications other than the main concrete materials are also needed concrete mix quality control and other added material is also in line with the current technology of concrete mix that produces concrete with specific characteristics. Addition of bio enzyme on five concrete mixture that will be compared with normal concrete in order to know the optimum level bio-enzyme in concrete to increase the strength of the concrete. Concrete with bio-enzyme 200 ml/m3, 400 ml/m3, 600 ml/m3, 800 ml/m3, 1000 ml/m3 and normal concrete. Refer to the crushing test result, its tends to the mathematical model using 4th degree polynomial regression (least quartic, as represent on the attached data series, which is for the design mix fc′ = 25 MPa generate optimum value for 33,98 MPa, on the bio-additive dosage of 509 ml bio enzymes.
Design of novel nano-carriers for multi-enzyme co-localization
Energy Technology Data Exchange (ETDEWEB)
Jia, Feng [Iowa State Univ., Ames, IA (United States)
2013-01-01
The main objective of this project is to design novel nano-structured carriers and strategies to co-localize multiple enzymes to mimic the functionalities of MECs. In order to achieve this goal, distinct approaches for enzyme co-localization were developed and evaluated. Specifically, we investigated different polymeric nano-carriers, both flexible and rigid, as platforms for co-localization, as well as distinct enzyme attachment techniques using model enzyme systems using glucose oxidase and horseradish peroxidase to control the spatial arrangement of the multiple enzymes on the nanocarriers. This platform technology can be potentially used to co-localize various enzyme systems and its broad applicability will be tested using the sclareol biosynthesis process to control the formation of products through the formation of MECs with multiple enzymes NgCPS and sSsSS to regulate the pathway of reactive intermediate to enhance the final product conversion rate.
Microbial Enzyme Activity and Carbon Cycling in Grassland Soil Fractions
Allison, S. D.; Jastrow, J. D.
2004-12-01
Extracellular enzymes are necessary to degrade complex organic compounds present in soils. Using physical fractionation procedures, we tested whether old soil carbon is spatially isolated from degradative enzymes across a prairie restoration chronosequence in Illinois, USA. We found that carbon-degrading enzymes were abundant in all soil fractions, including macroaggregates, microaggregates, and the clay fraction, which contains carbon with a mean residence time of ~200 years. The activities of two cellulose-degrading enzymes and a chitin-degrading enzyme were 2-10 times greater in organic matter fractions than in bulk soil, consistent with the rapid turnover of these fractions. Polyphenol oxidase activity was 3 times greater in the clay fraction than in the bulk soil, despite very slow carbon turnover in this fraction. Changes in enzyme activity across the restoration chronosequence were small once adjusted for increases in soil carbon concentration, although polyphenol oxidase activity per unit carbon declined by 50% in native prairie versus cultivated soil. These results are consistent with a `two-pool' model of enzyme and carbon turnover in grassland soils. In light organic matter fractions, enzyme production and carbon turnover both occur rapidly. However, in mineral-dominated fractions, both enzymes and their carbon substrates are immobilized on mineral surfaces, leading to slow turnover. Soil carbon accumulation in the clay fraction and across the prairie restoration chronosequence probably reflects increasing physical isolation of enzymes and substrates on the molecular scale, rather than the micron to millimeter scale.
The helicase domain of Polθ counteracts RPA to promote alt-NHEJ.
Mateos-Gomez, Pedro A; Kent, Tatiana; Deng, Sarah K; McDevitt, Shane; Kashkina, Ekaterina; Hoang, Trung M; Pomerantz, Richard T; Sfeir, Agnel
2017-12-01
Mammalian polymerase theta (Polθ) is a multifunctional enzyme that promotes error-prone DNA repair by alternative nonhomologous end joining (alt-NHEJ). Here we present structure-function analyses that reveal that, in addition to the polymerase domain, Polθ-helicase activity plays a central role during double-strand break (DSB) repair. Our results show that the helicase domain promotes chromosomal translocations by alt-NHEJ in mouse embryonic stem cells and also suppresses CRISPR-Cas9- mediated gene targeting by homologous recombination (HR). In vitro assays demonstrate that Polθ-helicase activity facilitates the removal of RPA from resected DSBs to allow their annealing and subsequent joining by alt-NHEJ. Consistent with an antagonistic role for RPA during alt-NHEJ, inhibition of RPA1 enhances end joining and suppresses recombination. Taken together, our results reveal that the balance between HR and alt-NHEJ is controlled by opposing activities of Polθ and RPA, providing further insight into the regulation of repair-pathway choice in mammalian cells.
Studies on a photoreactivating enzyme from Drosophila melanogaster cultured cells
International Nuclear Information System (INIS)
Beck, L.A.
1982-01-01
A photoreactivating enzyme was purified from Schneider's Line No. 2 Drosophila melanogaster cultured cells. DEAE cellulose chromatography with high potassium phosphate buffer conditions was used to separate nucleic acids from the protein component of the crude cell extract. The protein pass-through fraction from DEAE cellulose was chromatographed on phosphocellulose followed by hydroxylapatite, using linear potassium phosphate gradients to elute the enzyme. Gel filtration chromatography on Sephacryl S-200 resulted in a 4500-fold purification of the enzyme with a final recovery of 4%. The enzyme has an apparent gel filtration molecular weight of 32,900 (+/- 1350 daltons) and an isoelectric pH of 4.9. Optimum ionic strength for activity is 0.17 at pH 6.5 in potassium phosphate buffer. The action spectrum for photoreactivation in Drosophila has an optimum at 365 nm with a response to wavelengths in the range of 313 to 465 nm. Drosophila photoreactivating enzyme contains an essential RNA that is necessary for activity in vitro. The ability of the enzyme to photoreactivate dimers in vitro is abolished by treatment of the enzyme with ribonucleases, or by disruption of the enzyme-RNA complex by electrophoresis or adsorption to DEAE cellulose. The essential RNA is heterogeneous in size but contains a 10-12 base region that may interact with the active site of the enzyme, and thus is protected from degradation by contaminating RNase activities during purification. The RNA is thought to stabilize the photoreactivating enzyme by maintaining the enzyme in the proper configuration for binding to dimer-containing DNA. It is not known whether this RNA is essential for in vivo photoreactivation
Detection of enzyme activity in decontaminated spices of industrial use
International Nuclear Information System (INIS)
Müller, R.; Theobald, R.
1995-01-01
A range of decontaminated spices of industrial use have been examinated for their enzymes (catalase, peroxidase, amylase, lipase activity). The genuine enzymes remain fully active in irradiated spices, whereas the microbial load is clearly reduced. In contrast steam treated spices no longer demonstrate enzyme activities. Steam treatment offers e.g. black pepper without lipase activity, which can no longer cause fat deterioration. Low microbial load in combination with clearly detectable enzyme activity in spices is an indication for irradiation, whereas, reduced microbial contamination combined with enzyme inactivation indicate steam treatment of raw material [de
Linking Hydrolysis Performance to Trichoderma reesei Cellulolytic Enzyme Profile
DEFF Research Database (Denmark)
Lehmann, Linda Olkjær; Petersen, Nanna; I. Jørgensen, Christian
2016-01-01
Trichoderma reesei expresses a large number of enzymes involved in lignocellulose hydrolysis and the mechanism of how these enzymes work together is too complex to study by traditional methods, e.g. by spiking with single enzymes and monitoring hydrolysis performance. In this study a multivariate...... approach, partial least squares regression, was used to see if it could help explain the correlation between enzyme profile and hydrolysis performance. Diverse enzyme mixtures were produced by Trichoderma reesei Rut-C30 by exploiting various fermentation conditions and used for hydrolysis of washed...
UK-18,892: resistance to modification by aminoglycoside-inactivating enzymes.
Andrews, R J; Brammer, K W; Cheeseman, H E; Jevons, S
1978-12-01
UK-18,892, a new semisynthetic aminoglycoside, was active against bacteria possessing aminoglycoside-inactivating enzymes, with the exception of some known to possess AAC(6') or AAD(4') enzymes. This activity has been rationalized by using cell-free extracts of bacteria containing known inactivating enzymes, where it was shown that UK-18,892 was not a substrate for the APH(3'), AAD(2''), AAC(3), and AAC(2') enzymes. It was also demonstrated that UK-18,892 protected mice against lethal infections caused by organisms possessing aminoglycoside-inactivating enzymes.
Soluble inhibitors/deactivators of cellulase enzymes from lignocellulosic biomass.
Kim, Youngmi; Ximenes, Eduardo; Mosier, Nathan S; Ladisch, Michael R
2011-04-07
Liquid hot water, steam explosion, and dilute acid pretreatments of lignocellulose generate soluble inhibitors which hamper enzymatic hydrolysis as well as fermentation of sugars to ethanol. Toxic and inhibitory compounds will vary with pretreatment and include soluble sugars, furan derivatives (hydroxymethyl fulfural, furfural), organic acids (acetic, formic and, levulinic acid), and phenolic compounds. Their effect is seen when an increase in the concentration of pretreated biomass in a hydrolysis slurry results in decreased cellulose conversion, even though the ratio of enzyme to cellulose is kept constant. We used lignin-free cellulose, Solka Floc, combined with mixtures of soluble components released during pretreatment of wood, to prove that the decrease in the rate and extent of cellulose hydrolysis is due to a combination of enzyme inhibition and deactivation. The causative agents were extracted from wood pretreatment liquid using PEG surfactant, activated charcoal or ethyl acetate and then desorbed, recovered, and added back to a mixture of enzyme and cellulose. At enzyme loadings of either 1 or 25mg protein/g glucan, the most inhibitory components, later identified as phenolics, decreased the rate and extent of cellulose hydrolysis by half due to both inhibition and precipitation of the enzymes. Full enzyme activity occurred when the phenols were removed. Hence detoxification of pretreated woods through phenol removal is expected to reduce enzyme loadings, and therefore reduce enzyme costs, for a given level of cellulose conversion. Copyright © 2011 Elsevier Inc. All rights reserved.
Enzyme Activity Experiments Using a Simple Spectrophotometer
Hurlbut, Jeffrey A.; And Others
1977-01-01
Experimental procedures for studying enzyme activity using a Spectronic 20 spectrophotometer are described. The experiments demonstrate the effect of pH, temperature, and inhibitors on enzyme activity and allow the determination of Km, Vmax, and Kcat. These procedures are designed for teaching large lower-level biochemistry classes. (MR)
The use of enzymes for beer brewing
Donkelaar, van Laura H.G.; Mostert, Joost; Zisopoulos, Filippos K.; Boom, Remko M.; Goot, van der Atze Jan
2016-01-01
The exergetic performance of beer produced by the conventional malting and brewing process is compared with that of beer produced using an enzyme-assisted process. The aim is to estimate if the use of an exogenous enzyme formulation reduces the environmental impact of the overall brewing process.
Directory of Open Access Journals (Sweden)
Feng eChen
2013-07-01
Full Text Available The endothelial production of nitric oxide (NO mediates endothelium-dependent vasorelaxation and restrains vascular inflammation, smooth muscle proliferation and platelet aggregation. Impaired production of NO is a hallmark of endothelial dysfunction and promotes the development of cardiovascular disease. In endothelial cells, NO is generated by endothelial nitric oxide synthase (eNOS through the conversion of its substrate, L-arginine to L-citrulline. Reduced access to L-arginine has been proposed as a major mechanism underlying reduced eNOS activity and NO production in cardiovascular disease. The arginases (Arg1 and Arg2 metabolize L-arginine to generate L-ornithine and urea and increased expression of arginase has been proposed as a mechanism of reduced eNOS activity secondary to the depletion of L-arginine. Indeed, supplemental L-arginine and suppression of arginase activity has been shown to improve endothelium-dependent relaxation and ameliorate cardiovascular disease. However, L-arginine concentrations in endothelial cells remain sufficiently high to support NO synthesis suggesting additional mechanisms. The compartmentalization of intracellular L-arginine into poorly interchangeable pools has been proposed to allow for the local depletion of L-arginine. Indeed the subcellular location of L-arginine metabolizing enzymes plays important functional roles. In endothelial cells, eNOS is found in discrete intracellular locations and the capacity to generate NO is heavily influenced by its localtion. Arg1 and Arg2 also reside in different subcellular environments and are thought to differentially influence endothelial function. The plasma membrane solute transporter, CAT-1 and the arginine recycling enzyme, ASL, co-localize with eNOS and facilitate NO release. This review highlights the importance of the subcellular location of eNOS and arginine transporting and metabolizing enzymes to NO release and cardiovascular disease.
Modification of polymer surfaces to enhance enzyme activity and stability
DEFF Research Database (Denmark)
Hoffmann, Christian
Enzyme immobilization is an important concept for the development of improved biocatalytic processes, primarily through facilitated separation procedures. However, enzyme immobilization usually comes at a price of reduced biocatalytic activity. For this reason, different immobilization methods have...... already been developed, combining the same goal to improve enzyme activity, stability and selectivity. Polymer materials have shown, due to their easy processibility and versatile properties, high potential as enzyme support. However, in order to achieve improved enzyme performance, the combination...... on their tailored surface modification in order to obtain improved enzyme-support systems. Firstly, an off-stoichiometric thiol-ene (OSTE) thermosetting material was used for the development of a screening platform allowing the investigation of micro-environmental effects and their impact on the activity...
USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy
Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.
2014-01-01
Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308
Microbial production of raw starch digesting enzymes | Sun | African ...
African Journals Online (AJOL)
Raw starch digesting enzymes refer to enzymes that can act directly on raw starch granules below the gelatinization temperature of starch. With the view of energy-saving, a worldwide interest has been focused on raw starch digesting enzymes in recent years, especially since the oil crisis of 1973. Raw starch digesting ...
Directory of Open Access Journals (Sweden)
Mehrnoush Amid
2014-01-01
Full Text Available The thermoalkaline protease enzyme from pitaya (Hylocereus polyrhizus waste was purified by a factor of 221.2 with 71.3% recovery using ammonium sulphate precipitation, gel filtration, and cation exchange chromatography. Gel filtration chromatography together with sodium dodecyl sulphate gel electrophoresis (SDS-PAGE revealed that the enzyme is monomeric with a molecular weight of 26.7 kDa. The apparent Km and Vmax of the protease were 2.8 mg/mL and 31.20 u/min, respectively. The optimum pH and temperature were 8.0 and 70°C. The enzyme was highly active and stable over a wide pH range (from pH 3.0 to pH 11.0 with the optimum activity at pH 8.0. The protease has broad specificity toward azocasein, casein, hemoglobin, and gelatine. Activity of the enzyme was inhibited by Fe2+ and Zn2+, while protease activity was increased in the presence of Ca2+ and Mg2+ and Cu2+ by factors of 125%, 110%, and 105%, respectively. The alkaline protease showed extreme stability toward surfactants and oxidizing agent. The purified protease exhibited extreme stability in the presence of organic solvents and inhibitors. In addition, the enzyme was relativity stable toward organic solvents and chelating agents, such as ethylenediaminetetraacetic acid (EDTA. The enzyme, derived from pitaya peel, possesses unique characteristics and could be used in various industrial and biotechnological applications.
Coproduction of detergent compatible bacterial enzymes and stain removal evaluation.
Niyonzima, Francois N; More, Sunil S
2015-10-01
Most of the detergents that are presently produced contain the detergent compatible enzymes to improve and accelerate the washing performance by removing tough stains. The process is environment friendly as the use of enzymes in the detergent formulation reduces the utilization of toxic detergent constituents. The current trend is to use the detergent compatible enzymes that are active at low and ambient temperature in order to save energy and maintain fabric quality. As the detergent compatible bacterial enzymes are used together in the detergent formulation, it is important to co-produce the detergent enzymes in a single fermentation medium as the enzyme stability is assured, and production cost gets reduced enormously. The review reports on the production, purification, characterization and application of detergent compatible amylases, lipases, and proteases are available. However, there is no specific review or minireview on the concomitant production of detergent compatible amylases, lipases, and proteases. In this minireview, the coproduction of detergent compatible enzymes by bacterial species, enzyme stability towards detergents and detergent components, and stain release analysis were discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Ronning, Donald R; Iacopelli, Natalie M; Mishra, Vidhi [Toledo
2012-03-15
The bacterial enzyme 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase (MTAN) plays a central role in three essential metabolic pathways in bacteria: methionine salvage, purine salvage, and polyamine biosynthesis. Recently, its role in the pathway that leads to the production of autoinducer II, an important component in quorum-sensing, has garnered much interest. Because of this variety of roles, MTAN is an attractive target for developing new classes of inhibitors that influence bacterial virulence and biofilm formation. To gain insight toward the development of new classes of MTAN inhibitors, the interactions between the Helicobacter pylori-encoded MTAN and its substrates and substrate analogs were probed using X-ray crystallography. The structures of MTAN, an MTAN-Formycin A complex, and an adenine bound form were solved by molecular replacement and refined to 1.7, 1.8, and 1.6 Å, respectively. The ribose-binding site in the MTAN and MTAN-adenine cocrystal structures contain a tris[hydroxymethyl]aminomethane molecule that stabilizes the closed form of the enzyme and displaces a nucleophilic water molecule necessary for catalysis. This research gives insight to the interactions between MTAN and bound ligands that promote closing of the enzyme active site and highlights the potential for designing new classes of MTAN inhibitors using a link/grow or ligand assembly development strategy based on the described H. pylori MTAN crystal structures.
Novel Enzymes for Targeted Hydrolysis of Algal Cell Walls
DEFF Research Database (Denmark)
Schultz-Johansen, Mikkel
Seaweeds, also known as macroalgae, constitute a rich source of valuable biomolecules which have a potential industrial application in food and pharma products. The use of enzymes can optimize the extraction and separation of these molecules from the seaweed biomass, but most commercial enzymes...... are incapable of breaking the complex polysaccharides found in seaweed cell walls. Therefore, new enzymes are needed for degradation of seaweed biomass. Bacteria that colonize the surfaces of seaweed secrete enzymes that allow them to degrade and utilize seaweed polysaccharides as energy. In addition, sea...... degradation. In addition, three carrageenases were characterised; one as a GH16 κ-carrageenase whereas the other two belong to a new GH16 subfamily of enzymes that degrade furcellaran (κ/β-carrageenan). From metagenome sequence data three putative GH107 fucanases were identified and characterized...
Angiotensin-Converting Enzymes Play a Dominant Role in Fertility
Directory of Open Access Journals (Sweden)
Fan Jin
2013-10-01
Full Text Available According to the World Health Organization, infertility, associated with metabolic syndrome, has become a global issue with a 10%–20% incidence worldwide. An accumulating body of evidence has shown that the renin–angiotensin system is involved in the fertility problems observed in some populations. Moreover, alterations in the expression of angiotensin-converting enzyme-1, angiotensin-converting enzyme-2, and angiotensin-converting enzyme-3 might be one of the most important mechanisms underlying both female and male infertility. However, as a pseudogene in humans, further studies are needed to explore whether the abnormal angiotensin-converting enzyme-3 gene could result in the problems of human reproduction. In this review, the relationship between angiotensin-converting enzymes and fertile ability is summarized, and a new procedure for the treatment of infertility is discussed.
EVOLUTIONARY TRANSITIONS IN ENZYME ACTIVITY OF ANT FUNGUS GARDENS
DEFF Research Database (Denmark)
De Fine Licht, Henrik H; Schiøtt, Morten; Mueller, Ulrich G
2010-01-01
an association with a monophyletic clade of specialized symbionts. In conjunction with the transition to specialized symbionts, the ants advanced in colony size and social complexity. Here we provide a comparative study of the functional specialization in extracellular enzyme activities in fungus gardens across...... the attine phylogeny. We show that, relative to sister clades, gardens of higher-attine ants have enhanced activity of protein-digesting enzymes, whereas gardens of leaf-cutting ants also have increased activity of starch-digesting enzymes. However, the enzyme activities of lower-attine fungus gardens...... are targeted primarily towards partial degradation of plant cell walls, reflecting a plesiomorphic state of non-domesticated fungi. The enzyme profiles of the higher-attine and leaf-cutting gardens appear particularly suited to digest fresh plant materials and to access nutrients from live cells without major...
Illustrating Enzyme Inhibition Using Gibbs Energy Profiles
Bearne, Stephen L.
2012-01-01
Gibbs energy profiles have great utility as teaching and learning tools because they present students with a visual representation of the energy changes that occur during enzyme catalysis. Unfortunately, most textbooks divorce discussions of traditional kinetic topics, such as enzyme inhibition, from discussions of these same topics in terms of…
Prevalence of sensitization to 'improver' enzymes in UK supermarket bakers.
Jones, M; Welch, J; Turvey, J; Cannon, J; Clark, P; Szram, J; Cullinan, P
2016-07-01
Supermarket bakers are exposed not only to flour and alpha-amylase but also to other 'improver' enzymes, the nature of which is usually shrouded by commercial sensitivity. We aimed to determine the prevalence of sensitization to 'improver' enzymes in UK supermarket bakers. We examined the prevalence of sensitization to enzymes in 300 bakers, employed by one of two large supermarket bakeries, who had declared work-related respiratory symptoms during routine health surveillance. Sensitization was determined using radioallergosorbent assay to eight individual enzymes contained in the specific 'improver' mix used by each supermarket. The prevalence of sensitization to 'improver' enzymes ranged from 5% to 15%. Sensitization was far more likely if the baker was sensitized also to either flour or alpha-amylase. The prevalence of sensitization to an 'improver' enzyme did not appear to be related to the concentration of that enzyme in the mix. We report substantial rates of sensitization to enzymes other than alpha-amylase in UK supermarket bakers; in only a small proportion of bakers was there evidence of sensitization to 'improver mix' enzymes without sensitization to either alpha-amylase or flour. The clinical significance of these findings needs further investigation, but our findings indicate that specific sensitization in symptomatic bakers may not be identified without consideration of a wide range of workplace antigens. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A stochastic model of enzyme kinetics
Stefanini, Marianne; Newman, Timothy; McKane, Alan
2003-10-01
Enzyme kinetics is generally modeled by deterministic rate equations, and in the simplest case leads to the well-known Michaelis-Menten equation. It is plausible that stochastic effects will play an important role at low enzyme concentrations. We have addressed this by constructing a simple stochastic model which can be exactly solved in the steady-state. Throughout a wide range of parameter values Michaelis-Menten dynamics is replaced by a new and simple theoretical result.
Industrial Applications of Enzymes: Recent Advances, Techniques, and Outlooks
Directory of Open Access Journals (Sweden)
Jordan Chapman
2018-06-01
Full Text Available Enzymes as industrial biocatalysts offer numerous advantages over traditional chemical processes with respect to sustainability and process efficiency. Enzyme catalysis has been scaled up for commercial processes in the pharmaceutical, food and beverage industries, although further enhancements in stability and biocatalyst functionality are required for optimal biocatalytic processes in the energy sector for biofuel production and in natural gas conversion. The technical barriers associated with the implementation of immobilized enzymes suggest that a multidisciplinary approach is necessary for the development of immobilized biocatalysts applicable in such industrial-scale processes. Specifically, the overlap of technical expertise in enzyme immobilization, protein and process engineering will define the next generation of immobilized biocatalysts and the successful scale-up of their induced processes. This review discusses how biocatalysis has been successfully deployed, how enzyme immobilization can improve industrial processes, as well as focuses on the analysis tools critical for the multi-scale implementation of enzyme immobilization for increased product yield at maximum market profitability and minimum logistical burden on the environment and user.
Heme-containing enzymes and inhibitors for tryptophan metabolism.
Yan, Daojing; Lin, Ying-Wu; Tan, Xiangshi
2017-09-20
Iron-containing enzymes such as heme enzymes play crucial roles in biological systems. Three distinct heme-containing dioxygenase enzymes, tryptophan 2,3-dioxygenase (TDO), indoleamine 2,3-dioxygenase 1 (IDO1) and indoleamine 2,3-dioxygenase 2 (IDO2) catalyze the initial and rate-limiting step of l-tryptophan catabolism through the kynurenine pathway in mammals. Overexpression of these enzymes causes depletion of tryptophan and the accumulation of metabolic products, which contributes to tumor immune tolerance and immune dysregulation in a variety of disease pathologies. In the past few decades, IDO1 has garnered the most attention as a therapeutic target with great potential in cancer immunotherapy. Many potential inhibitors of IDO1 have been designed, synthesized and evaluated, among which indoximod (d-1-MT), INCB024360, GDC-0919 (formerly NLG-919), and an IDO1 peptide-based vaccine have advanced to the clinical trial stage. However, recently, the roles of TDO and IDO2 have been elucidated in immune suppression. In this review, the current drug discovery landscape for targeting TDO, IDO1 and IDO2 is highlighted, with particular attention to the recent use of drugs in clinical trials. Moreover, the crystal structures of these enzymes, in complex with inhibitors, and the mechanisms of Trp catabolism in the first step, are summarized to provide information for facilitating the discovery of new enzyme inhibitors.
Plant growth promotion and Penicillium citrinum
Directory of Open Access Journals (Sweden)
Choo Yeon-Sik
2008-12-01
Full Text Available Abstract Background Endophytic fungi are known plant symbionts. They produce a variety of beneficial metabolites for plant growth and survival, as well as defend their hosts from attack of certain pathogens. Coastal dunes are nutrient deficient and offer harsh, saline environment for the existing flora and fauna. Endophytic fungi may play an important role in plant survival by enhancing nutrient uptake and producing growth-promoting metabolites such as gibberellins and auxins. We screened roots of Ixeris repenes (L. A. Gray, a common dune plant, for the isolation of gibberellin secreting endophytic fungi. Results We isolated 15 endophytic fungi from the roots of Ixeris repenes and screened them for growth promoting secondary metabolites. The fungal isolate IR-3-3 gave maximum plant growth when applied to waito-c rice and Atriplex gemelinii seedlings. Analysis of the culture filtrate of IR-3-3 showed the presence of physiologically active gibberellins, GA1, GA3, GA4 and GA7 (1.95 ng/ml, 3.83 ng/ml, 6.03 ng/ml and 2.35 ng/ml, respectively along with other physiologically inactive GA5, GA9, GA12, GA15, GA19, GA20 and, GA24. The plant growth promotion and gibberellin producing capacity of IR-3-3 was much higher than the wild type Gibberella fujikuroi, which was taken as control during present study. GA5, a precursor of bioactive GA3 was reported for the first time in fungi. The fungal isolate IR-3-3 was identified as a new strain of Penicillium citrinum (named as P. citrinum KACC43900 through phylogenetic analysis of 18S rDNA sequence. Conclusion Isolation of new strain of Penicillium citrinum from the sand dune flora is interesting as information on the presence of Pencillium species in coastal sand dunes is limited. The plant growth promoting ability of this fungal strain may help in conservation and revegetation of the rapidly eroding sand dune flora. Penicillium citrinum is already known for producing mycotoxin citrinin and cellulose digesting
Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A
2012-09-21
Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Wilko H. AHLRICHS
2009-08-01
Full Text Available The rotifer Brachionus calyciflorus was examined by scanning electron microscopy (SEM for surface-attached, i.e. epizootic, bacteria to ascertain their specific localization and thus find out if we could discern between rotifer and bacterial enzyme activity. The lorica of B. calyciflorus was colonized by one distinct type of bacteria, which originated from the algal culture used for rotifer feeding. The corona, posterior epidermis and foot of all inspected individuals were always without attached bacteria. The density of the attached bacteria was higher with the increasing age of B. calyciflorus: while young individuals were colonized by ~ tens of bacterial cells, older ones had on average hundreds to thousands of attached bacteria. We hypothesize that epizooic bacteria may produce the ectoenzymes phosphatases and β-N-acetylhexosaminidases on the lorica, but not on the corona of B. calyciflorus. Since enzyme activities of epizooic bacteria may influence the values and interpretation of bulk rotifer enzyme activities, we should take the bacterial contribution into account.
ExplorEnz: the primary source of the IUBMB enzyme list
McDonald, Andrew G.; Boyce, Sinéad; Tipton, Keith F.
2009-01-01
ExplorEnz is the MySQL database that is used for the curation and dissemination of the International Union of Biochemistry and Molecular Biology (IUBMB) Enzyme Nomenclature. A simple web-based query interface is provided, along with an advanced search engine for more complex Boolean queries. The WWW front-end is accessible at http://www.enzyme-database.org, from where downloads of the database as SQL and XML are also available. An associated form-based curatorial application has been developed to facilitate the curation of enzyme data as well as the internal and public review processes that occur before an enzyme entry is made official. Suggestions for new enzyme entries, or modifications to existing ones, can be made using the forms provided at http://www.enzyme-database.org/forms.php. PMID:18776214
Experimental Strategy to Discover Microbes with Gluten-degrading Enzyme Activities.
Helmerhorst, Eva J; Wei, Guoxian
2014-05-05
Gluten proteins contained in the cereals barley, rye and wheat cause an inflammatory disorder called celiac disease in genetically predisposed individuals. Certain immunogenic gluten domains are resistant to degradation by mammalian digestive enzymes. Enzymes with the ability to target such domains are potentially of clinical use. Of particular interest are gluten-degrading enzymes that would be naturally present in the human body, e.g. associated with resident microbial species. This manuscript describes a selective gluten agar approach and four enzyme activity assays, including a gliadin zymogram assay, designed for the selection and discovery of novel gluten-degrading microorganisms from human biological samples. Resident and harmless bacteria and/or their derived enzymes could potentially find novel applications in the treatment of celiac disease, in the form of a probiotic agent or as a dietary enzyme supplement.
DEFF Research Database (Denmark)
Parving, H H; Jacobsen, P; Tarnow, L
1996-01-01
OBJECTIVE: To evaluate the concept that an insertion/deletion polymorphism of the angiotensin converting enzyme gene predicts the therapeutic efficacy of inhibition of angiotensin converting enzyme on progression of diabetic nephropathy. DESIGN: Observational follow up study of patients with insu...
Biocatalytic material comprising multilayer enzyme coated fiber
Kim, Jungbae [Richland, WA; Kwak, Ja Hun [Richland, WA; Grate, Jay W [West Richland, WA
2009-11-03
The present invention relates generally to high stability, high activity biocatalytic materials and processes for using the same. The materials comprise enzyme aggregate coatings having high biocatalytic activity and stability useful in heterogeneous environment. These new materials provide a new biocatalytic immobilized enzyme system with applications in bioconversion, bioremediation, biosensors, and biofuel cells.
Enzyme Vs. Extremozyme -32 ...
Indian Academy of Sciences (India)
Enzymes are biocatalytic protein molecules that enhance the rates of ... to physical forces (hydrogen bonds, hydrophobic 1, electrostatic and Van der ... conformation. In 1995 ... surface against 14.7% in Klenow poll (some of the hydrophobic.
Amid, Mehrnoush; Murshid, Fara Syazana; Manap, Mohd Yazid; Islam Sarker, Zaidul
2016-01-01
This study aimed to investigate the effects of the ultrasound-assisted extraction conditions on the yield, specific activity, temperature, and storage stability of the pectinase enzyme from guava peel. The ultrasound variables studied were sonication time (10-30 min), ultrasound temperature (30-50 °C), pH (2.0-8.0), and solvent-to-sample ratio (2:1 mL/g to 6:1 mL/g). The main goal was to optimize the ultrasound-assisted extraction conditions to maximize the recovery of pectinase from guava peel with the most desirable enzyme-specific activity and stability. Under the optimum conditions, a high yield (96.2%), good specific activity (18.2 U/mg), temperature stability (88.3%), and storage stability (90.3%) of the extracted enzyme were achieved. The optimal conditions were 20 min sonication time, 40 °C temperature, at pH 5.0, using a 4:1 mL/g solvent-to-sample ratio. The study demonstrated that optimization of ultrasound-assisted process conditions for the enzyme extraction could improve the enzymatic characteristics and yield of the enzyme.
Production of saccharifying enzyme using the wastewater of a shochu distillery
Energy Technology Data Exchange (ETDEWEB)
Morimura, S.; Kida, K.; Yakita, Y.; Sonoda, Y. (Kumamoto University, Kumamoto (Japan). Faculty of Engineering); Myoga, H. (Organo Co. LTd., Tokyo (Japan))
1991-05-25
A saccharifying enzyme was produced using wastewater from a shochu distillery. Since the wastewater contained highly concentrated volatile fatty acids and those severely inhibited cell growth at low pH as converted to their free forms, the initial pH ranging from 4.5 to 6.0 was optimum. It was suggested that cell autolysis facilitated the release of the saccharifying enzyme, however, a released protease digested the enzyme with a subsequent decrease in activity. The enzyme was purified easily, and the purified enzyme was homogeneous as analyzed by disc electrophoresis. The enzyme was characterized by a molecular weight of 54,000 Da, an isoelectric point of pH 3.6, and the optimum reaction temperature and pH of 50-55{degree}C and 4.5-5.5, respectively. The enzyme could digest no raw starch, and the hydrolyzate of soluble starch by the enzyme was composed of two to four oligosaccharides. Based on above results and the amino acid sequence in a N-terminal, the enzyme produced was concluded to be {alpha}-amylase. 11 refs., 8 figs., 6 tabs.
Operating considerations of ultrafiltration in enzyme enhanced carbon capture
DEFF Research Database (Denmark)
Deslauriers, Maria Gundersen; Gladis, Arne; Fosbøl, Philip Loldrup
2017-01-01
capture capacity of 1 MTonn CO2/year, and is here operated for one year continuously. This publication compares soluble enzymes dissolved in a capture solvent with and without the use of ultrafiltration membranes. The membranes used here have an enzyme retention of 90%, 99% and 99.9%. Enzyme retention......Today, enzyme enhanced carbon capture and storage (CCS) is gaining interest, since it can enable the use of energy efficient solvents, and thus potentially reduce the carbon footprint of CCS. However, a limitation of this technology is the high temperatures encountered in the stripper column, which...
Tsume, Yasuhiro; Amidon, Gordon L
2012-03-26
The improvement of therapeutic efficacy for cancer agents has been a big challenge which includes the increase of tumor selectivity and the reduction of adverse effects at non-tumor sites. In order to achieve those goals, prodrug approaches have been extensively investigated. In this report, the potential activation enzymes for 5'-amino acid/dipeptide monoester floxuridine prodrugs in pancreatic cancer cells were selected and the feasibility of enzyme specific activation of prodrugs was evaluated. All prodrugs exhibited the range of 3.0-105.7 min of half life in Capan-2 cell homogenate with the presence and the absence of selective enzyme inhibitors. 5'-O-L-Phenylalanyl-L-tyrosyl-floxuridine exhibited longer half life only with the presence of pepstatin A. Human cathepsin B and D selectively hydrolized 5'-O-L-phenylalanyl-L-tyrosylfloxuridine and 5'-O-L-phenylalanyl-L-glycylfloxuridine compared to the other tested prodrugs. The wide range of growth inhibitory effect by floxuridine prodrugs in Capan-2 cells was observed due to the different affinities of prodrug promoieties to enzymes. In conclusion, it is feasible to design prodrugs which are activated by specific enzymes. Cathepsin D might be a good candidate as a target enzyme for prodrug activation and 5'-O-L-phenylalanyl-L-tyrosylfloxuridine may be the best candidate among the tested floxuridine prodrugs.
Enzyme activity and kinetics in substrate-amended river sediments
Energy Technology Data Exchange (ETDEWEB)
Duddridge, J E; Wainwright, M
1982-01-01
In determining the effects of heavy metals in microbial activity and litter degradation in river sediments, one approach is to determine the effects of these pollutants on sediment enzyme activity and synthesis. Methods to assay amylase, cellulase and urease activity in diverse river sediments are reported. Enzyme activity was low in non-amended sediments, but increased markedly when the appropriate substrate was added, paralleling both athropogenic and natural amendment. Linear relationships between enzyme activity, length of incubation, sample size and substrate concentration were established. Sediment enzyme activity generally obeyed Michaelis-Menton kinetics, but of the three enzymes, urease gave least significant correlation coefficients when the data for substrate concentration versus activity was applied to the Eadie-Hofstee transformation of the Michaelis-Menten equation. K/sub m/ and V/sub max/ for amylase, cellulase and urease in sediments are reported. (JMT)
Structural analysis of enzymes used for bioindustry and bioremediation.
Tanokura, Masaru; Miyakawa, Takuya; Guan, Lijun; Hou, Feng
2015-01-01
Microbial enzymes have been widely applied in the large-scale, bioindustrial manufacture of food products and pharmaceuticals due to their high substrate specificity and stereoselectivity, and their effectiveness under mild conditions with low environmental burden. At the same time, bioremedial techniques using microbial enzymes have been developed to solve the problem of industrial waste, particularly with respect to persistent chemicals and toxic substances. And finally, structural studies of these enzymes have revealed the mechanistic basis of enzymatic reactions, including the stereoselectivity and binding specificity of substrates and cofactors. The obtained structural insights are useful not only to deepen our understanding of enzymes with potential bioindustrial and/or bioremedial application, but also for the functional improvement of enzymes through rational protein engineering. This review shows the structural bases for various types of enzymatic reactions, including the substrate specificity accompanying cofactor-controlled and kinetic mechanisms.
Utilization of enzyme supplemented Telfairia occidentalis stalk ...
African Journals Online (AJOL)
An eight (8) week feeding trial was carried out to assess the use of enzyme natuzyme supplemented Telfairia occidentalis stalk extract as growth inducer in the practical diet for Oreochromis niloticus fingerlings. Five isonitrogenous (35% crude protein) diets at 0 ml of stalk extract and enzyme (TRT 1), 15 ml (TRT 2) and 30 ...
Application of radiopolymerization for immobilization of enzymes
International Nuclear Information System (INIS)
Higa, O.Z.; Mastro, N.L. del; Castagnet, A.C.G.
1986-01-01
Hydrophilic glass-forming monomers were used in an application of irradiation technology for the immobilization of cellulase and cellobiase. Experiments to observe the effect of additives such as silicates and polyethylene glycol in the enzyme entrapment are reported on. In all cases, enzymatic activity was maintained for more than fifteen batch enzyme reactions. (Author) [pt
Energy Technology Data Exchange (ETDEWEB)
Knox, W.E.
1978-09-01
Low grade tumors of various origins are chemically very different. High grade tumors, whatever their origin, are chemically very similar to one another and to embryonic tissues. Analyses of human tumor tissues and sera from cancer patients were conducted for two new groups of enzymes expected to be informative about the physiological state of the tissue. The enzymes measured in tumors and sera were chosen because they were characteristic of fetal tissues and high grade neoplasms in rats, and could, therefore, be expected to exist in human cancers (and fetuses) and to predominate more in those of higher grade malignancies. Results indicated that the classification of enzymes (or isozymes) as fetal or adult types in the rat could be extended to man. Human cancers do contain most of the enzymes expected, and lack others, as expected. Analyses of the same enzymes in sera gave less clear results. It was recognized at the outset that no simple proportionality existed between tissue and serum levels. The tendency existed in cancer patients to have in serum elevated amounts of those enzymes characteristic of undifferentiated tissues. The abnormalities in a specific patient are conditioned by his physiological state, by the grade of his tumor, and by the mass of tumor present. The tumor mass had a very significant effect, so that monitoring this tumor burden by chemical means should be quite possible. The latest work focused on particular enzymes that have not previously been measured in cancer patients. These studies concentrated on pyrroline-5-carboxylate (P-5-C) reductase and its inhibition and on lysosomal glucosidases and phosphatases. Both groups are relatively high in fetal and neoplastic tissues.
International Nuclear Information System (INIS)
Kasumi, T.; Tsumuraya, Y.; Brewer, C.F.; Kersters-Hilderson, H.; Claeyssens, M.; Hehre, E.J.
1987-01-01
Bacillus pumilus β-xylosidase, an enzyme considered restricted to hydrolyzing a narrow range of β-D-xylosidic substrates with inversion of configuration, was found to catalyze different stereochemical, essentially irreversible, glycosylation reactions with α- and β-D-xylopyranosyl fluoride. The enzyme promoted the hydrolysis of β-D-xylopyranosyl fluoride at a high rate, V = 6.25 μmol min -1 mg -1 at 0 0 C, in a reaction that obeyed Michaelis-Menten kinetics. In contrast, its action upon α-D-xylopyranosyl fluoride was slow and characterized by an unusual relation between the rate of fluoride release and the substrate concentration, suggesting the possible need for two substrate molecules to be bound at the active center in order for reaction to occur. Moreover, 1 H NMR spectra of a digest of α-D-xylosyl fluoride showed the substrate to be specifically converted to α-D-xylose by the enzyme. The observed retention of configuration is not consistent with direct hydrolysis by this inverting enzyme but is strongly indicative of the occurrence of two successive inverting reactions: xylosyl transfer from α-D-xylosyl fluoride to form a β-D-xylosidic product, followed by hydrolysis of the latter to produce α-D-xylose. The transient intermediate product formed enzymically from α-D-xylosyl fluoride in the presence of [ 14 C]xylose was isolated and shown by its specific radioactivity and 1 H NMR spectrum as well as by methylatino and enzymic analyses to be 4-O-β-D-xylopyranosyl-D-xylopyranose containing one [ 14 C]xylose residue
An appraisal of the enzyme stability-activity trade-off.
Miller, Scott R
2017-07-01
A longstanding idea in evolutionary physiology is that an enzyme cannot jointly optimize performance at both high and low temperatures due to a trade-off between stability and activity. Although a stability-activity trade-off has been observed for well-characterized examples, such a trade-off is not imposed by any physical chemical constraint. To better understand the pervasiveness of this trade-off, I investigated the stability-activity relationship for comparative biochemical studies of purified orthologous enzymes identified by a literature search. The nature of this relationship varied greatly among studies. Notably, studies of enzymes with low mean synonymous nucleotide sequence divergence were less likely to exhibit the predicted negative correlation between stability and activity. Similarly, a survey of directed evolution investigations of the stability-activity relationship indicated that these traits are often uncoupled among nearly identical yet phenotypically divergent enzymes. This suggests that the presumptive trade-off often reported for investigations of enzymes with high mean sequence divergence may in some cases instead be a consequence of the degeneration over time of enzyme function in unselected environments, rather than a direct effect of thermal adaptation. The results caution against the general assertion of a stability-activity trade-off during enzyme adaptation. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
Parasite enzymes as a tool to investigate immune responses
Directory of Open Access Journals (Sweden)
Italo M. Cesari
1992-01-01
Full Text Available Previous evidences reported by us and by other authors revealed the presence of IgG in sera of Schistosoma mansoni-infected patients to immunodominant antigens which are enzymes. Besides their immunological interest as possible inductors of protection, several of these enzume antigens might be also intersting markers of infection in antibody-detecting immunocapture assays which use the intrinsic catalytic property of these antigens. It was thus thought important to define some enzymatic and immunological characteristics of these molecules to better exploit their use as antigens. Four different enzymes from adult worms were partially characterized in their biochemical properties and susceptibility to react with antibodies of infected patients, namely alkaline phosphatase (AKP, Mg*+, pH 9.5, type I phosphodiesterase (PDE, pH 9.5, cysteine proteinase (CP, dithiothreitol, pH 5.5 and N-acetyl-ß-D-glucosaminidase (NAG, pH 5.5. The AKP and PDE are distinct tegumental membrane-bound enzymes whereas CP and NAG are soluble acid enzymes. Antibodies in infected human sera differed in their capacity to react with and to inhibit these enzyme antigens. Possibly, the specificity of the antibodies related to the extent of homology between the parasite and the host enzyme might be in part responsible for the above differences. The results are also discussed in view of the possible functional importance of these enzymes.
Enzyme Technology for Shipboard Waste Management
1976-12-01
sucrose to the sweeter invert sugar by the enzyme invertase is a well established process, as is the conversion of starch to glucose by the enzyme...aspects of our health and daily lives. Recent advances in fundamental and applied enzymology indicate that we have already started in that direction. At a...Chemtech, p. 677 (Nov 1973) 11 - Bungay, H. P., "Applied Enzymology ," Worthington, Biochemical Corp., Notes for an AIChE Lecture, Washington, D. C. (Dec
Balajthy, Z; Kedei, N; Nagy, L; Davies, P J; Fésüs, L
1997-07-18
The intracellular activity and expression of tissue transglutaminase, which crosslinks proteins through epsilon(gamma-glutamyl)lysine isodipeptide bond, was investigated in CHO cells and those stably transfected with either inducible c-Myc (which leads to apoptosis) or with c-myc and the apoptosis inhibitor Bcl-2. Protein-bound cross-link content was significantly higher when apoptosis was induced by c-Myc while the concomitant presence of Bcl-2 markedly reduced both apoptosis and enzymatic protein cross-linking. The expression of tissue transglutaminase did not change following the initiation of apoptosis by c-Myc or when it was blocked by Bcl-2. Studying transiently co-transfected elements of the mouse tissue transglutaminase promoter linked to a reporter enzyme revealed their overall repression in cells expressing c-Myc. This repression was partially suspended in cells also carrying Bcl-2. Our data suggest that tissue transglutaminase is not induced when c-Myc initiates apoptosis but the pre-existing endogenous enzyme is activated.
Directory of Open Access Journals (Sweden)
T. XUE
2008-12-01
Full Text Available Selenium (Se is able to defend human and animal cells against UV(B stress. Higher plants are generally considered not to require Se but to have a low tolerance to it. However, recently it has been demonstrated that Se is able to protect also plants against UV-induced oxidative stress and even to promote the growth of plants subjected to high-energy light. In the present study the effects of Se on antioxidative enzymes possibly associated with this synergistic effect were investigated. Ryegrass and lettuce were grown in soil supplemented with Se at 0, 0.1 or 1.0 mg kg-1 under normal light or subjected to UV episodes. Lipid peroxidation and the changes of antioxidative enzymes were measured at two growing stages. The positive synergistic effect of the lower Se dosage and UV was found to be at least partly associated with the antioxidative role of Se through increased glutathione peroxidase (GSH-Px and catalase (CAT activity, whereas ascorbate peroxidase (APX responded negatively to both factors. The contribution of the other enzymes studied seemed to be plant-specific: glutathione S-transferase (GST increased in both ryegrass assays and superoxide dismutase (SOD in the first lettuce assay. At the higher addition level Se acted as a pro-oxidant and diminished fresh weight yields. UV irradiation alleviated the toxicity coincidently with increase of CAT in ryegrass and SOD in lettuce.;
Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes
Directory of Open Access Journals (Sweden)
José Maria Rodrigues da Luz
2012-12-01
Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.