Regulation of Cre recombinase by ligand-induced complementation of inactive fragments.
Jullien, Nicolas; Sampieri, François; Enjalbert, Alain; Herman, Jean-Paul
2003-11-01
Cre recombinase is extensively used to engineer the genome of experimental animals. However, its usefulness is still limited by the lack of an efficient temporal control over its activity. To overcome this, we have developed DiCre, a regulatable fragment complementation system for Cre. The enzyme was split into two moieties that were fused to FKBP12 (FK506-binding protein) and FRB (binding domain of the FKBP12-rapamycin-associated protein), respectively. These can be efficiently heterodimerized by rapamycin. Several variants, based on splitting Cre at different sites and using different linker peptides, were tested in an indicator cell line. The fusion proteins, taken separately, had no recombinase activity. Stable transformants, co-expressing complementing fragments based on splitting Cre between Asn59 and Asn60, displayed low background activity affecting 0.05-0.4% of the cells. Rapamycin induced a rapid recombination, reaching 100% by 48-72 h, with an EC50 of 0.02 nM. Thus, ligand-induced dimerization can efficiently regulate Cre, and should be useful to achieve a tight temporal control of its activity, such as in the case of the creation of conditional knock-out animals.
Wehrmann, A; Eggeling, L; Sahm, H
1994-12-01
In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.
Directory of Open Access Journals (Sweden)
Yuichi Ikeda
Full Text Available Identification of cognate ligands for G protein-coupled receptors (GPCRs provides a starting point for understanding novel regulatory mechanisms. Although GPCR ligands have typically been evaluated through the activation of heterotrimeric G proteins, recent studies have shown that GPCRs signal not only through G proteins but also through β-arrestins. As such, monitoring β-arrestin signaling instead of G protein signaling will increase the likelihood of identifying currently unknown ligands, including β-arrestin-biased agonists. Here, we developed a cell-based assay for monitoring ligand-dependent GPCR-β-arrestin interaction via β-lactamase enzyme fragment complementation. Inter alia, β-lactamase is a superior reporter enzyme because of its cell-permeable fluorescent substrate. This substrate makes the assay non-destructive and compatible with fluorescence-activated cell sorting (FACS. In a reporter cell, complementary fragments of β-lactamase (α and ω were fused to β-arrestin 2 and GPCR, respectively. Ligand stimulation initiated the interaction of these chimeric proteins (β-arrestin-α and GPCR-ω, and this inducible interaction was measured through reconstituted β-lactamase activity. Utilizing this system, we screened various mammalian tissue extracts for agonistic activities on human bombesin receptor subtype 3 (hBRS3. We purified peptide E as a low-affinity ligand for hBRS3, which was also found to be an agonist for the other two mammalian bombesin receptors such as gastrin-releasing peptide receptor (GRPR and neuromedin B receptor (NMBR. Successful purification of peptide E has validated the robustness of this assay. We conclude that our newly developed system will facilitate the discovery of GPCR ligands.
Surface complement C3 fragments and cellular binding of microparticles in patients with SLE
DEFF Research Database (Denmark)
Winberg, Line Kjær; Nielsen, Claus Henrik; Jacobsen, Søren
2017-01-01
Objectives: To examine microparticles (MPs) from patients with SLE and healthy controls (HCs) by determining the cellular origin of the MPs, quantifying attached fragments of complement component 3 (C3) and assessing the ability of MPs to bind to circulating phagocytes and erythrocytes. These fea......Objectives: To examine microparticles (MPs) from patients with SLE and healthy controls (HCs) by determining the cellular origin of the MPs, quantifying attached fragments of complement component 3 (C3) and assessing the ability of MPs to bind to circulating phagocytes and erythrocytes...
A new location to split Cre recombinase for protein fragment complementation.
Rajaee, Maryam; Ow, David W
2017-11-01
We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Løbner, Morten; Leslie, Robert G Q; Prodinger, Wolfgang M
2009-01-01
While our previous studies have demonstrated that complement activation induced by complement receptors type 2 (CR2/CD21) and 1 (CR1/CD35) results in C3-fragment deposition and membrane attack complex (MAC) formation in human B cells, the consequences of these events for B-cell functions remain u...
Lee, Linda; Zhang, Ye; Ozar, Brittany; Sensen, Christoph W; Schriemer, David C
2016-09-02
Plants belonging to the genus Nepenthes are carnivorous, using specialized pitfall traps called "pitchers" that attract, capture, and digest insects as a primary source of nutrients. We have used RNA sequencing to generate a cDNA library from the Nepenthes pitchers and applied it to mass spectrometry-based identification of the enzymes secreted into the pitcher fluid using a nonspecific digestion strategy superior to trypsin in this application. This first complete catalog of the pitcher fluid subproteome includes enzymes across a variety of functional classes. The most abundant proteins present in the secreted fluid are proteases, nucleases, peroxidases, chitinases, a phosphatase, and a glucanase. Nitrogen recovery involves a particularly rich complement of proteases. In addition to the two expected aspartic proteases, we discovered three novel nepenthensins, two prolyl endopeptidases that we name neprosins, and a putative serine carboxypeptidase. Additional proteins identified are relevant to pathogen-defense and secretion mechanisms. The full complement of acid-stable enzymes discovered in this study suggests that carnivory in the genus Nepenthes can be sustained by plant-based mechanisms alone and does not absolutely require bacterial symbiosis.
Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis
Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.
2018-04-01
Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).
The CTD2 Center at Emory has developed a new NanoLuc®-based protein-fragment complementation assay (NanoPCA) which allows the detection of novel protein-protein interactions (PPI). NanoPCA allows the study of PPI dynamics with reversible interactions. Read the abstract. Experimental Approaches Read the detailed Experimetnal Approaches.
Sjögren, Jonathan; Andersson, Linda; Mejàre, Malin; Olsson, Fredrik
2017-01-01
Fab fragments are valuable research tools in various areas of science including applications in imaging, binding studies, removal of Fc-mediated effector functions, mass spectrometry, infection biology, and many others. The enzymatic tools for the generation of Fab fragments have been discovered through basic research within the field of molecular bacterial pathogenesis. Today, these enzymes are widely applied as research tools and in this chapter, we describe methodologies based on bacterial enzymes to generate Fab fragments from both human and mouse IgG. For all human IgG subclasses, the IdeS enzyme from Streptococcus pyogenes has been applied to generate F(ab')2 fragments that subsequently can be reduced under mild conditions to generate a homogenous pool of Fab' fragments. The enzyme Kgp from Porphyromonas gingivalis has been applied to generate intact Fab fragments from human IgG1 and the Fab fragments can be purified using a CH1-specific affinity resin. The SpeB protease, also from S. pyogenes, is able to digest mouse IgGs and has been applied to digest antibodies and Fab fragments can be purified on light chain affinity resins. In this chapter, we describe methodologies that can be used to obtain Fab fragments from human and mouse IgG using bacterial proteases.
DEFF Research Database (Denmark)
Nielsen, Claus Henrik; Pedersen, Morten Løbner; Marquart, Hanne Vibeke Hansen
2002-01-01
Normal human B lymphocytes are known to activate the alternative pathway (AP) of complement, leading to C3-fragment deposition and membrane attack complex (MAC) formation. The process is mediated via complement receptor type 2 (CR2, CD21), with complement receptor type 1 (CR1, CD35) playing...... a subsidiary role. In this study, we examine the relative contributions of CR1 and CR2 to the deposition of C3 fragments and MAC on B lymphocytes under circumstances where all complement pathways are operational. C3-fragment deposition and MAC formation were assessed on human peripheral B lymphocytes...... in the presence of 30% autologous serum. Blocking the CR2 ligand-binding site with monoclonal antibody (mAb) FE8 resulted in significant reduction (37.9+/-11.9%) in C3-fragment deposition, whereas MAC formation was only marginally affected (12.1+/-22.2% reduction). Blocking the CR1 binding-site resulted...
Crius: A Novel Fragment-Based Algorithm of De Novo Substrate Prediction for Enzymes.
Yao, Zhiqiang; Jiang, Shuiqin; Zhang, Lujia; Gao, Bei; He, Xiao; Zhang, John Z H; Wei, Dongzhi
2018-05-03
The study of enzyme substrate specificity is vital for developing potential applications of enzymes. However, the routine experimental procedures require lot of resources in the discovery of novel substrates. This article reports an in silico structure-based algorithm called Crius, which predicts substrates for enzyme. The results of this fragment-based algorithm show good agreements between the simulated and experimental substrate specificities, using a lipase from Candida antarctica (CALB), a nitrilase from Cyanobacterium syechocystis sp. PCC6803 (Nit6803), and an aldo-keto reductase from Gluconobacter oxydans (Gox0644). This opens new prospects of developing computer algorithms that can effectively predict substrates for an enzyme. This article is protected by copyright. All rights reserved. © 2018 The Protein Society.
Serum and plasma fibronectin binds to complement reacted immune complexes primarily via Clq
DEFF Research Database (Denmark)
Baatrup, G; Svehag, S E
1986-01-01
The binding of fibronectin to human Clq, C3b, and complement-reacted immune complexes (IC) was investigated by enzyme-linked immunosorbent assays. Microplates were coated with BSA followed by incubation with rabbit-anti-BSA IgG or F(ab')2 fragments of rabbit anti-BSA. Incubation of the solid phase...... with serum at 37 degrees C caused attachment of Clq and C3b. Addition of EDTA to the serum inhibited the binding of C3b, but not Clq, whereas substitution of the anti-BSA IgG on the solid phase with the F(ab')2 fragments abrogated the Clq, but not the C3b binding. Fibronectin binding was observed after...
Akhter, Sundus; Lund, Bjarte Aarmo; Ismael, Aya; Langer, Manuel; Isaksson, Johan; Christopeit, Tony; Leiros, Hanna-Kirsti S; Bayer, Annette
2018-02-10
β-Lactam antibiotics are of utmost importance when treating bacterial infections in the medical community. However, currently their utility is threatened by the emergence and spread of β-lactam resistance. The most prevalent resistance mechanism to β-lactam antibiotics is expression of β-lactamase enzymes. One way to overcome resistance caused by β-lactamases, is the development of β-lactamase inhibitors and today several β-lactamase inhibitors e.g. avibactam, are approved in the clinic. Our focus is the oxacillinase-48 (OXA-48), an enzyme reported to spread rapidly across the world and commonly identified in Escherichia coli and Klebsiella pneumoniae. To guide inhibitor design, we used diversely substituted 3-aryl and 3-heteroaryl benzoic acids to probe the active site of OXA-48 for useful enzyme-inhibitor interactions. In the presented study, a focused fragment library containing 49 3-substituted benzoic acid derivatives were synthesised and biochemically characterized. Based on crystallographic data from 33 fragment-enzyme complexes, the fragments could be classified into R 1 or R 2 binders by their overall binding conformation in relation to the binding of the R 1 and R 2 side groups of imipenem. Moreover, binding interactions attractive for future inhibitor design were found and their usefulness explored by the rational design and evaluation of merged inhibitors from orthogonally binding fragments. The best inhibitors among the resulting 3,5-disubstituted benzoic acids showed inhibitory potential in the low micromolar range (IC 50 = 2.9 μM). For these inhibitors, the complex X-ray structures revealed non-covalent binding to Arg250, Arg214 and Tyr211 in the active site and the interactions observed with the mono-substituted fragments were also identified in the merged structures. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Specificity of EIA immunoassay for complement factor Bb testing.
Pavlov, Igor Y; De Forest, Nikol; Delgado, Julio C
2011-01-01
During the alternative complement pathway activation, factor B is cleaved in two fragments, Ba and Bb. Concentration of those fragments is about 2 logs lower than of factor B present in the blood, which makes fragment detection challenging because of potential cross-reactivity. Lack of information on Bb assay cross-reactivity stimulated the authors to investigate this issue. We ran 109 healthy donor EDTA plasmas and 80 sera samples with both factor B immunodiffusion (The Binding Site) and Quidel Bb EIA assays. During the study it was shown that physiological concentrations of gently purified factor B demonstrated approximately 0.15% cross-reactivity in the Quidel Bb EIA assay. We also observed that Bb concentration in serum is higher than in plasma due to complement activation during clot formation which let us use sera as samples representing complement activated state. Our study demonstrated that despite the potential 0.15% cross-reactivity between endogenous factor B and cleaved Bb molecule, measuring plasma concentrations of factor Bb is adequate to evaluate the activation of the alternative complement pathway.
The C-type lectin of the aggrecan G3 domain activates complement.
Directory of Open Access Journals (Sweden)
Camilla Melin Fürst
Full Text Available Excessive complement activation contributes to joint diseases such as rheumatoid arthritis and osteoarthritis during which cartilage proteins are fragmented and released into the synovial fluid. Some of these proteins and fragments activate complement, which may sustain inflammation. The G3 domain of large cartilage proteoglycan aggrecan interacts with other extracellular matrix proteins, fibulins and tenascins, via its C-type lectin domain (CLD and has important functions in matrix organization. Fragments containing G3 domain are released during normal aggrecan turnover, but increasingly so in disease. We now show that the aggrecan CLD part of the G3 domain activates the classical and to a lesser extent the alternative pathway of complement, via binding of C1q and C3, respectively. The complement control protein (CCP domain adjacent to the CLD showed no effect on complement initiation. The binding of C1q to G3 depended on ionic interactions and was decreased in D2267N mutant G3. However, the observed complement activation was attenuated due to binding of complement inhibitor factor H to CLD and CCP domains. This was most apparent at the level of deposition of terminal complement components. Taken together our observations indicate aggrecan CLD as one factor involved in the sustained inflammation of the joint.
Directory of Open Access Journals (Sweden)
LORENA AGUILAR
2005-01-01
Full Text Available Trypanosoma cruzi calreticulin (TcCRT, described in our laboratory, retains several important functional features from its vertebrate homologues. We have shown that recombinant TcCRT inhibits the human complement system when it binds to the collagenous portion of C1q. The generation of classical pathway convertases and membrane attack complexes is thus strongly inhibited. In most T. cruzi-infected individuals, TcCRT is immunogenic and mediates the generation of specific antibodies. By reverting the C1q / TcCRT interaction, a parasite immune evasion strategy, these antibodies contribute to the host / parasite equilibrium. In an in vitro correlate of this situation, we show that the C1q / TcCRT interaction is inhibited by F(ab'2 polyclonal anti-TcCRT IgG fragments. It is therefore feasible that in infected humans anti-TcCRT antibodies participate in reverting an important parasite strategy aimed at inhibiting the classical complement pathway. Thus, membrane-bound TcCRT interacts with the collagenous portion C1q, and this C1q is recognized by the CD91-bound host cell CRT, thus facilitating parasite internalization. Based on our in vitro results, it could be proposed that the in vivo interaction between TcCRT and vertebrate C1q could be inhibited by F(ab'2 fragments anti-rTcCRT or against its S functional domain, thus interfering with the internalization process
Anti-complement activities of human breast-milk.
Ogundele, M O
1999-08-01
It has long been observed that the human milk possesses significant anti-inflammatory properties, while simultaneously protecting the infant against many intestinal and respiratory pathogens. There is, however, a paucity of information on the degree and extent of this anti-inflammatory activity. In the present study, the inhibitory effects of different fractions of human milk on serum complement activity were analysed. Colostrum and milk samples from healthy voluntary lactating donors at different postpartum ages were obtained and pooled normal human serum was used as source of complement in a modified CH50 assay. Inherent complement activity in human milk was also investigated by measuring the deposition of an activated C3 fragment on a serum-sensitive bacteria, and by haemolytic assays. Most whole- and defatted-milk samples consistently showed a dose-dependent inhibition of the serum complement activity. This inhibition was greater in mature milk compared to transitional milk samples. It was enhanced by inactivation of milk complement, and diminished by centrifugation of milk samples, which partly removed fat and larger protein components including casein micelles. Inherent complement activity in human milk was also demonstrated by haemolysis of sensitised sheep erythrocytes and deposition of C3 fragments on solid-phase bacteria. These activities were highest in the colostrum and gradually decreased as lactation proceeded. Several natural components abundant in the fluid phase of the human breast-milk have been shown to be inhibitors of complement activation in vitro. Their physiological significance probably reside in their ability to prevent inflammatory-induced tissue damage of the delicate immature gastrointestinal tract of the new-born as well as the mammary gland itself, which may arise from ongoing complement activation.
The c-Myc (MYC) transcription factor is a major cancer driver and a well-validated therapeutic target. However, directly targeting MYC has been challenging. Thus, identifying proteins that interact with and regulate MYC may provide alternative strategies to inhibit its oncogenic activity. Here we report the development of a NanoLuc®-based protein-fragment complementation assay (NanoPCA) and mapping of the MYC protein interaction hub in live mammalian cells.
Kozel, T R; Wilson, M A; Pfrommer, G S; Schlageter, A M
1989-07-01
Encapsulated Cryptococcus neoformans yeast cells are potent activators of the complement system. We examined the interaction of the yeast cells with an alternative complement pathway reconstituted from isolated factor D, factor B, factor H, factor I, C3, and properdin. Incubation of encapsulated cryptococci with the reconstituted pathway led to activation and binding of C3 fragments to the yeast cells that was quantitatively and qualitatively identical to that observed with normal human serum. Incubation with either normal serum or a mixture of isolated proteins led to binding of 4 x 10(7) to 5 x 10(7) C3 molecules to the yeast cells. The kinetics for activation and binding of C3 were identical, with maximum binding observed after a 20-min incubation. Immunoglobulin G was not needed for optimal activation kinetics. C3 fragments eluted from the yeast cells by treatment with hydroxylamine and subsequent analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the presence primarily of iC3b on yeast cells incubated with either normal serum or the reconstituted pathway. Ultrastructural examination of the opsonized yeast cells showed that the cryptococcal capsule was the site for binding of C3 activated from normal serum or the reconstituted pathway, with a dense accumulation of C3 at the periphery of the capsule. Thus, incubation of encapsulated cryptococci in the reconstituted pathway led to deposition of opsonic complement fragments at a site that was appropriate for interaction with phagocyte receptors. Cryptococci opsonized with the reconstituted pathway showed a markedly enhanced interaction with cultured human monocytes compared with unopsonized yeast cells, indicating that the alternative pathway alone is opsonic for yeast cells. However, the results indicate that additional serum factors are needed for optimal opsonization of yeast cells because a 35% reduction in the number of cryptococci bound to macrophages was observed with
Hua, Ying; Sun, Qi; Wang, Xiangyu; DU, Yanli; Shao, Na; Zhang, Qiwei; Zhao, Wei; Wan, Chengsong
2015-11-01
To construct enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains with delection espF gene and its nucleotide fragment and with espF gene complementation. A pair of homologous arm primers was designed to amplify the gene fragment of kanamycin resistance, which was transformed into EHEC O157:H7 EDL933w strain via the PKD46 plasmid by electroporation. The replacement of the espF gene by kanamycin resistance gene through the PKD46-mediated red recombination system was confirmed by PCR and sequencing. The entire coding region of espF along with its nucleotide fragment was amplified by PCR and cloned into pBAD33 plasmid, which was transformed into a mutant strain to construct the strain with espF complementation. RT-PCR was used to verify the transcription of espF and its nucleotide fragment in the complemented mutant strain. We established EHEC O157:H7 EDL933w strains with espF gene deletion and with espF gene complementation. Both espF and its nucleotide fragment were transcribed in the complemented mutant strain. The two strains provide a basis for further study of the regulatory mechanism of espF.
Segall-Shapiro, Thomas H; Nguyen, Peter Q; Dos Santos, Edgardo D; Subedi, Saurav; Judd, Justin; Suh, Junghae; Silberg, Jonathan J
2011-02-11
The extent to which thermostability influences the location of protein fragmentation sites that allow retention of function is not known. To evaluate this, we used a novel transposase-based approach to create libraries of vectors that express structurally-related fragments of Bacillus subtilis adenylate kinase (BsAK) and Thermotoga neapolitana adenylate kinase (TnAK) with identical modifications at their termini, and we selected for variants in each library that complement the growth of Escherichia coli with a temperature-sensitive adenylate kinase (AK). Mutants created using the hyperthermophilic TnAK were found to support growth with a higher frequency (44%) than those generated from the mesophilic BsAK (6%), and selected TnAK mutants complemented E. coli growth more strongly than homologous BsAK variants. Sequencing of functional clones from each library also identified a greater dispersion of fragmentation sites within TnAK. Nondisruptive fission sites were observed within the AMP binding and core domains of both AK homologs. However, only TnAK contained sites within the lid domain, which undergoes dynamic fluctuations that are critical for catalysis. These findings implicate the flexible lid domain as having an increased sensitivity to fission events at physiological temperatures. In addition, they provide evidence that comparisons of nondisruptive fission sites in homologous proteins could be useful for finding dynamic regions whose conformational fluctuations are important for function, and they show that the discovery of protein fragments that cooperatively function in mesophiles can be aided by the use of thermophilic enzymes as starting points for protein design. Copyright © 2010 Elsevier Ltd. All rights reserved.
Hepatitis C virus NS3/4A protease inhibits complement activation by cleaving complement component 4.
Directory of Open Access Journals (Sweden)
Seiichi Mawatari
Full Text Available BACKGROUND: It has been hypothesized that persistent hepatitis C virus (HCV infection is mediated in part by viral proteins that abrogate the host immune response, including the complement system, but the precise mechanisms are not well understood. We investigated whether HCV proteins are involved in the fragmentation of complement component 4 (C4, composed of subunits C4α, C4β, and C4γ, and the role of HCV proteins in complement activation. METHODS: Human C4 was incubated with HCV nonstructural (NS 3/4A protease, core, or NS5. Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then subjected to peptide sequencing. The activity of the classical complement pathway was examined using an erythrocyte hemolysis assay. The cleavage pattern of C4 in NS3/4A-expressing and HCV-infected cells, respectively, was also examined. RESULTS: HCV NS3/4A protease cleaved C4γ in a concentration-dependent manner, but viral core and NS5 did not. A specific inhibitor of NS3/4A protease reduced C4γ cleavage. NS3/4A protease-mediated cleavage of C4 inhibited classical pathway activation, which was abrogated by a NS3/4A protease inhibitor. In addition, co-transfection of cells with C4 and wild-type NS3/4A, but not a catalytic-site mutant of NS3/4A, produced cleaved C4γ fragments. Such C4 processing, with a concomitant reduction in levels of full-length C4γ, was also observed in HCV-infected cells expressing C4. CONCLUSIONS: C4 is a novel cellular substrate of the HCV NS3/4A protease. Understanding disturbances in the complement system mediated by NS3/4A protease may provide new insights into the mechanisms underlying persistent HCV infection.
Directory of Open Access Journals (Sweden)
Guido Moll
Full Text Available Infusion of human third-party mesenchymal stromal cells (MSCs appears to be a promising therapy for acute graft-versus-host disease (aGvHD. To date, little is known about how MSCs interact with the body's innate immune system after clinical infusion. This study shows, that exposure of MSCs to blood type ABO-matched human blood activates the complement system, which triggers complement-mediated lymphoid and myeloid effector cell activation in blood. We found deposition of complement component C3-derived fragments iC3b and C3dg on MSCs and fluid-phase generation of the chemotactic anaphylatoxins C3a and C5a. MSCs bound low amounts of immunoglobulins and lacked expression of complement regulatory proteins MCP (CD46 and DAF (CD55, but were protected from complement lysis via expression of protectin (CD59. Cell-surface-opsonization and anaphylatoxin-formation triggered complement receptor 3 (CD11b/CD18-mediated effector cell activation in blood. The complement-activating properties of individual MSCs were furthermore correlated with their potency to inhibit PBMC-proliferation in vitro, and both effector cell activation and the immunosuppressive effect could be blocked either by using complement inhibitor Compstatin or by depletion of CD14/CD11b-high myeloid effector cells from mixed lymphocyte reactions. Our study demonstrates for the first time a major role of the complement system in governing the immunomodulatory activity of MSCs and elucidates how complement activation mediates the interaction with other immune cells.
Directory of Open Access Journals (Sweden)
Patience B Tetteh-Quarcoo
Full Text Available Complement receptor-type 1 (CR1, CD35 is the immune-adherence receptor, a complement regulator, and an erythroid receptor for Plasmodium falciparum during merozoite invasion and subsequent rosette formation involving parasitized and non-infected erythrocytes. The non-uniform geographical distribution of Knops blood group CR1 alleles Sl1/2 and McC(a/b may result from selective pressures exerted by differential exposure to infectious hazards. Here, four variant short recombinant versions of CR1 were produced and analyzed, focusing on complement control protein modules (CCPs 15-25 of its ectodomain. These eleven modules encompass a region (CCPs 15-17 key to rosetting, opsonin recognition and complement regulation, as well as the Knops blood group polymorphisms in CCPs 24-25. All four CR1 15-25 variants were monomeric and had similar axial ratios. Modules 21 and 22, despite their double-length inter-modular linker, did not lie side-by-side so as to stabilize a bent-back architecture that would facilitate cooperation between key functional modules and Knops blood group antigens. Indeed, the four CR1 15-25 variants had virtually indistinguishable affinities for immobilized complement fragments C3b (K(D = 0.8-1.1 µM and C4b (K(D = 5.0-5.3 µM. They were all equally good co-factors for factor I-catalysed cleavage of C3b and C4b, and they bound equally within a narrow affinity range, to immobilized C1q. No differences between the variants were observed in assays for inhibition of erythrocyte invasion by P. falciparum or for rosette disruption. Neither differences in complement-regulatory functionality, nor interactions with P. falciparum proteins tested here, appear to have driven the non-uniform geographic distribution of these alleles.
Complement's participation in acquired immunity
DEFF Research Database (Denmark)
Nielsen, Claus Henrik; Leslie, Robert Graham Quinton
2002-01-01
of the B cell receptor for antigen (BCR), a complex composed of the iC3b/C3d fragment-binding complement type 2 receptor (CR2, CD21) and its signaling element CD19 and the IgG-binding receptor FcgammaRIIb (CD32). The positive or negative outcome of signaling through this triad is determined by the context...
van Vuuren, B Jansen; Bergseth, G; Mollnes, T E; Shaw, A M
2014-01-15
Electroluminescent assays for epitopes on the complement components C3dg, terminal complement complex (TCC) and factor B/Bb (fB/Bb) have been developed with capture and detection antibodies to produce detection limits C3dg=91±9ng/mL, TCC=3±0.1ng/mL and fB=55.7±0.1ng/mL. The assay performance was assessed against a series of zymosan and heat aggregated IgG (HAIgG) in vitro activations of complement using a calibrated activated complement serum (ACS) as calibration standard. The ACS standard was stable within 20% accuracy over a 6-month period with freeze-thaw cycles as required. Differential activation of the complement cascade was observed for TCC showing a pseudo-first order formation half-life of 3.5h after activation with zymosan. The C3dg activation fragment indicates a 10% total activation for both activation agents. The kinetic-epitope analysis for fB indicates that the capture epitope is on the fB/Bb protein fragment which can then become covered by the formation of C3bBb or C3bBbP complexes during the time course of the cascade. Copyright © 2013 Elsevier B.V. All rights reserved.
Structural insight into the recognition of complement C3 activation products by integrin receptors
DEFF Research Database (Denmark)
Bajic, Goran
2015-01-01
fragment C3a called anaphylatoxin. Complement leads to opsonization as the proteolytic fragment C3b becomes covalently linked to the activator surface through a reactive thioester. Self-surfaces are protected by complement regulators, whereas complement activation vividly amplifies on pathogens...... and their clearance by dendritic cells is mediated by αMβ2. The central molecule in my project, αMβ2 integrin, recognizes many diverse ligands including iC3b, but the molecular basis for such recognition was lacking. During my PhD I have obtained a major breakthrough in the dissection of iC3b interaction with αMβ2. I...
Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E
2017-02-01
A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.
Tahtouh, Muriel; Croq, Françoise; Lefebvre, Christophe; Pestel, Joël
2009-09-01
The complement system is well known as an enzyme cascade that helps to defend against infections. Indeed, this ancestral system bridges innate and adaptive immunity. Its implication in diseases of the central nervous system (CNS), has led to an increased number of studies. Complement activation in the CNS has been generally considered to contribute to tissue damage. However, recent studies suggest that complement may be neuroprotective, and can participate in maintenance and repair of the adult brain. Here, we will review this dual role of complement proteins and some of their functional interactions with part of the chemokine and cytokine network associated with the protection of CNS integrity.
Complement, a target for therapy in inflammatory and degenerative diseases.
Morgan, B Paul; Harris, Claire L
2015-12-01
The complement system is a key innate immune defence against infection and an important driver of inflammation; however, these very properties can also cause harm. Inappropriate or uncontrolled activation of complement can cause local and/or systemic inflammation, tissue damage and disease. Complement provides numerous options for drug development as it is a proteolytic cascade that involves nine specific proteases, unique multimolecular activation and lytic complexes, an arsenal of natural inhibitors, and numerous receptors that bind to activation fragments. Drug design is facilitated by the increasingly detailed structural understanding of the molecules involved in the complement system. Only two anti-complement drugs are currently on the market, but many more are being developed for diseases that include infectious, inflammatory, degenerative, traumatic and neoplastic disorders. In this Review, we describe the history, current landscape and future directions for anti-complement therapies.
Complement is activated in progressive multiple sclerosis cortical grey matter lesions.
Watkins, Lewis M; Neal, James W; Loveless, Sam; Michailidou, Iliana; Ramaglia, Valeria; Rees, Mark I; Reynolds, Richard; Robertson, Neil P; Morgan, B Paul; Howell, Owain W
2016-06-22
The symptoms of multiple sclerosis (MS) are caused by damage to myelin and nerve cells in the brain and spinal cord. Inflammation is tightly linked with neurodegeneration, and it is the accumulation of neurodegeneration that underlies increasing neurological disability in progressive MS. Determining pathological mechanisms at play in MS grey matter is therefore a key to our understanding of disease progression. We analysed complement expression and activation by immunocytochemistry and in situ hybridisation in frozen or formalin-fixed paraffin-embedded post-mortem tissue blocks from 22 progressive MS cases and made comparisons to inflammatory central nervous system disease and non-neurological disease controls. Expression of the transcript for C1qA was noted in neurons and the activation fragment and opsonin C3b-labelled neurons and glia in the MS cortical and deep grey matter. The density of immunostained cells positive for the classical complement pathway protein C1q and the alternative complement pathway activation fragment Bb was significantly increased in cortical grey matter lesions in comparison to control grey matter. The number of cells immunostained for the membrane attack complex was elevated in cortical lesions, indicating complement activation to completion. The numbers of classical (C1-inhibitor) and alternative (factor H) pathway regulator-positive cells were unchanged between MS and controls, whilst complement anaphylatoxin receptor-bearing microglia in the MS cortex were found closely apposed to cortical neurons. Complement immunopositive neurons displayed an altered nuclear morphology, indicative of cell stress/damage, supporting our finding of significant neurodegeneration in cortical grey matter lesions. Complement is activated in the MS cortical grey matter lesions in areas of elevated numbers of complement receptor-positive microglia and suggests that complement over-activation may contribute to the worsening pathology that underlies the
DNA fragments assembly based on nicking enzyme system.
Directory of Open Access Journals (Sweden)
Rui-Yan Wang
Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.
Costa, José M.; Loper, Joyce E.
1994-01-01
Erwinia carotovora subsp. betavasculorum Ecb168 produces an antibiotic(s) that suppresses growth of the related bacterium Erwinia carotovora subsp. carotovora in culture and in wounds of potato tubers. Strain Ecb168 also produces and secretes pectolytic enzymes and causes a vascular necrosis and root rot of sugar beet. Genes (out) involved in secretion of pectolytic enzymes by Ecb168 were localized to two HindIII fragments (8.5 and 10.5 kb) of Ecb168 genomic DNA by hybridization to the cloned out region of E. carotovora subsp. carotovora and by complementation of Out- mutants of E. carotovora subsp. carotovora. Out- mutants of Ecb168, which did not secrete pectate lyase into the culture medium, were obtained when deletions internal to either HindIII fragment were introduced into the genome of Ecb168 through marker exchange mutagenesis. Out- mutants of Ecb168 were complemented to the Out+ phenotype by introduction of the corresponding cloned HindIII fragment. Out- mutants of Ecb168 were less virulent than the Out+ parental strain on potato tubers. Strain Ecb168 and Out- derivatives inhibited the growth of E. carotovora subsp. carotovora in culture, indicating that the uncharacterized antibiotic(s) responsible for antagonism was exported through an out-independent mechanism. Strain Ecb168 and Out- derivatives reduced the establishment of large populations of E. carotovora subsp. carotovora in wounds of potato tubers and suppressed tuber soft rot caused by E. carotovora subsp. carotovora. PMID:16349316
Energy Technology Data Exchange (ETDEWEB)
Booth, J C; Hannington, G; Bakir, T M.F.; Stern, H; Kangro, H; Griffiths, P D; Heath, R B [Saint George' s Hospital Medical School, London (UK); Saint Bartholomew' s Hospital, London (UK))
1982-12-01
The radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA) techniques were found to be comparable in sensitivity and specificity for detecting cytomegalovirus IgG antibody, and 10 to 100 times more sensitive than complement-fixation (CF), anticomplement immunofluorescence (ACIF) and passive haemagglutination (PHA). In screening tests for antibody, the frequency of false-positive and -negative results was 0.6% for RIA and ELISA, 1.5% for CF, 1.6% for ACIF and 3.6% for PHA. PHA was the least satisfactory test, largely because of technical problems.
Defining the complement biomarker profile of c3 glomerulopathy
DEFF Research Database (Denmark)
Zhang, Yuzhou; Nester, Carla M; Martin, Bertha
2014-01-01
BACKGROUND AND OBJECTIVES: C3 glomerulopathy (C3G) applies to a group of renal diseases defined by a specific renal biopsy finding: a dominant pattern of C3 fragment deposition on immunofluorescence. The primary pathogenic mechanism involves abnormal control of the alternative complement pathway......, although a full description of the disease spectrum remains to be determined. This study sought to validate and define the association of complement dysregulation with C3G and to determine whether specific complement pathway abnormalities could inform disease definition. DESIGN, SETTING, PARTICIPANTS......, & MEASUREMENTS: This study included 34 patients with C3G (17 with C3 glomerulonephritis [C3GN] and 17 with dense deposit disease [DDD]) diagnosed between 2008 and 2013 selected from the C3G Registry. Control samples (n=100) were recruited from regional blood drives. Nineteen complement biomarkers were assayed...
Barban, P S; Minaeva, V M; Pantiukhina, A N; Startseva, M G
1976-06-01
A comparative study was made of the serological properties and virus-neutralizing activity of antiencephalitis gamma-globulin and Fab-fragments isolated from it by gel-filtration. Horse immunoglobulins against the autumno-summer tick-borne encephalitis virus could be disintegrated with the aid of papaine to monovalent Fab-fragments which (according to the complement fixation reaction, the test of suppression of the complement fixation, and the HAIT) retained the serological activity whose level was compared with that of the serological activity of gamma-globulin. Fab-fragments possessed a marked virus-neutralizing activity. The mean value of a logarithm of the neutralization index was 2.65 +/- 0.2 for Fab-fragments and 3.74 +/- 0.38 for gamma-globulin (P less than 0.01).
Genetic Association of the Porcine C9 Complement Component with Hemolytic Complement Activity
Directory of Open Access Journals (Sweden)
D. V. A. Khoa
2015-09-01
Full Text Available The complement system is a part of the natural immune regulation mechanism against invading pathogens. Complement activation from three different pathways (classical, lectin, and alternative leads to the formation of C5-convertase, an enzyme for cleavage of C5 into C5a and C5b, followed by C6, C7, C8, and C9 in membrane attack complex. The C9 is the last complement component of the terminal lytic pathway, which plays an important role in lysis of the target cells depending on its self-polymerization to form transmembrane channels. To address the association of C9 with traits related to disease resistance, the complete porcine C9 cDNA was comparatively sequenced to detect single nucleotide polymorphisms (SNPs in pigs of the breeds Hampshire (HS, Duroc (DU, Berlin miniature pig (BMP, German Landrace (LR, Pietrain (PIE, and Muong Khuong (Vietnamese potbelly pig. Genotyping was performed in 417 F2 animals of a resource population (DUMI: DU×BMP that were vaccinated with Mycoplasma hyopneumoniae, Aujeszky diseases virus and porcine respiratory and reproductive syndrome virus at 6, 14 and 16 weeks of age, respectively. Two SNPs were detected within the third exon. One of them has an amino acid substitution. The European porcine breeds (LR and PIE show higher allele frequency of these SNPs than Vietnamese porcine breed (MK. Association of the substitution SNP with hemolytic complement activity indicated statistically significant differences between genotypes in the classical pathway but not in the alternative pathway. The interactions between eight time points of measurement of complement activity before and after vaccinations and genotypes were significantly different. The difference in hemolytic complement activity in the both pathways depends on genotype, kind of vaccine, age and the interaction to the other complement components. These results promote the porcine C9 (pC9 as a candidate gene to improve general animal health in the future.
Cao, Wenjing; Pham, Huy P; Williams, Lance A; McDaniel, Jenny; Siniard, Rance C; Lorenz, Robin G; Marques, Marisa B; Zheng, X Long
2016-11-01
Acquired thrombotic thrombocytopenic purpura is primarily caused by the deficiency of plasma ADAMTS13 activity resulting from autoantibodies against ADAMTS13. However, ADAMTS13 deficiency alone is often not sufficient to cause acute thrombotic thrombocytopenic purpura. Infections or systemic inflammation may precede acute bursts of the disease, but the underlying mechanisms are not fully understood. Herein, 52 patients with acquired autoimmune thrombotic thrombocytopenic purpura and 30 blood donor controls were recruited for the study. The plasma levels of human neutrophil peptides 1-3 and complement activation fragments (i.e. Bb, iC3b, C4d, and sC5b-9) were determined by enzyme-linked immunosorbent assays. Univariate analyses were performed to determine the correlation between each biomarker and clinical outcomes. We found that the plasma levels of human neutrophil peptides 1-3 and Bb in patients with acute thrombotic thrombocytopenic purpura were significantly higher than those in the control (Ppurpura patients and the control. We conclude that innate immunity, i.e. neutrophil and complement activation via the alternative pathway, may play a role in the pathogenesis of acute autoimmune thrombotic thrombocytopenic purpura, and a therapy targeted at these pathways may be considered in a subset of these patients. Copyright© Ferrata Storti Foundation.
Arachchillage, D R J; Mackie, I J; Efthymiou, M; Chitolie, A; Hunt, B J; Isenberg, D A; Khamashta, M; Machin, S J; Cohen, H
2016-11-01
Essentials Complement activation has a pathogenic role in thrombotic antiphospholipid syndrome (APS). Coagulation proteases such as factor Xa can activate complement proteins. Complement activation markers were elevated in anticoagulated thrombotic APS patients. Complement activation decreased in APS patients switching from warfarin to rivaroxaban. Background Complement activation may play a major role in the pathogenesis of thrombotic antiphospholipid syndrome (APS). Coagulation proteases such as factor Xa can activate complement proteins. Aims To establish whether rivaroxaban, a direct factor Xa inhibitor, limits complement activation compared with warfarin in APS patients with previous venous thromboembolism (VTE). Methods A total of 111 APS patients with previous VTE, on warfarin target INR 2.5, had blood samples taken at baseline and at day 42 after randomization in the RAPS (Rivaroxaban in Antiphospholipid Syndrome) trial. Fifty-six patients remained on warfarin and 55 switched to rivaroxaban. Fifty-five normal controls (NC) were also studied. Markers of complement activation (C3a, C5a, terminal complement complex [SC5b-9] and Bb fragment) were assessed. Results APS patients had significantly higher complement activation markers compared with NC at both time-points irrespective of the anticoagulant. There were no differences between the two patient groups at baseline, or patients remaining on warfarin at day 42. In 55 patients randomized to rivaroxaban, C3a, C5a and SC5b-9 were lower at day 42 (median (ng mL -1 ) [confidence interval] 64 [29-125] vs. 83 [35-147], 9 [2-15] vs. 12 [4-18] and 171 [56-245] vs. 201 [66-350], respectively) but levels of Bb fragment were unchanged. There were no correlations between rivaroxaban levels and complement activation markers. Conclusions APS patients with previous VTE on warfarin exhibit increased complement activation, which is likely to occur via the classical pathway and is decreased by rivaroxaban administration
DEFF Research Database (Denmark)
Hermanrud, Thorbjørn; Duus, Nicolaj; Bygum, Anette
2016-01-01
Angioedema of the upper airways is a severe and potentially life-threatening condition. The incidence has been increasing in the past two decades, primarily due to pharmaceuticals influencing the generation or degradation of the vasoactive molecule bradykinin. Plasma-derived C1-esterase inhibitor...... concentrate is a well-established treatment option of hereditary and acquired complement C1-esterase inhibitor deficiency, which are also mediated by an increased level of bradykinin resulting in recurrent angioedema. We here present a case of severe angiotensin converting enzyme-inhibitor related angioedema...
Pidde-Queiroz, Giselle; Magnoli, Fábio Carlos; Portaro, Fernanda C. V.; Serrano, Solange M. T.; Lopes, Aline Soriano; Paes Leme, Adriana Franco; van den Berg, Carmen W.; Tambourgi, Denise V.
2013-01-01
Background Snake Venom Metalloproteinases (SVMPs) are amongst the key enzymes that contribute to the high toxicity of snake venom. We have recently shown that snake venoms from the Bothrops genus activate the Complement system (C) by promoting direct cleavage of C-components and generating anaphylatoxins, thereby contributing to the pathology and spread of the venom. The aim of the present study was to isolate and characterize the C-activating protease from Bothrops pirajai venom. Results Using two gel-filtration chromatography steps, a metalloproteinase of 23 kDa that activates Complement was isolated from Bothrops pirajai venom. The mass spectrometric identification of this protein, named here as C-SVMP, revealed peptides that matched sequences from the P-I class of SVMPs. C-SVMP activated the alternative, classical and lectin C-pathways by cleaving the α-chain of C3, C4 and C5, thereby generating anaphylatoxins C3a, C4a and C5a. In vivo, C-SVMP induced consumption of murine complement components, most likely by activation of the pathways and/or by direct cleavage of C3, leading to a reduction of serum lytic activity. Conclusion We show here that a P-I metalloproteinase from Bothrops pirajai snake venom activated the Complement system by direct cleavage of the central C-components, i.e., C3, C4 and C5, thereby generating biologically active fragments, such as anaphylatoxins, and by cleaving the C1-Inhibitor, which may affect Complement activation control. These results suggest that direct complement activation by SVMPs may play a role in the progression of symptoms that follow envenomation. PMID:24205428
[Fragment-based drug discovery: concept and aim].
Tanaka, Daisuke
2010-03-01
Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.
DEFF Research Database (Denmark)
Nielsen, C H; Marquart, H V; Prodinger, W M
2001-01-01
of the CR1 binding site with the monoclonal antibody 3D9 also resulted in a minor reduction in MAC deposition, while FE8 and 3D9, in combination, markedly reduced deposition of both C3 fragments (91 +/- 5%) and C9 (95 +/- 3%). The kinetics of C3-fragment and MAC deposition, as well as the dependence of both......Normal human B lymphocytes activate the alternative pathway of complement via complement receptor type 2 (CR2, CD21), that binds hydrolysed C3 (iC3) and thereby promotes the formation of a membrane-bound C3 convertase. We have investigated whether this might lead to the generation of a C5...... convertase and consequent formation of membrane attack complexes (MAC). Deposition of C3 fragments and MAC was assessed on human peripheral B lymphocytes in the presence of 30% autologous serum containing 4.4 mM MgCl2/20 mM EGTA, which abrogates the classical pathway of complement without affecting...
Maternal and fetal alternative complement pathway activation in early severe preeclampsia.
Hoffman, M Camille; Rumer, Kristen K; Kramer, Anita; Lynch, Anne M; Winn, Virginia D
2014-01-01
We sought to determine whether alternative complement activation fragment Bb (Bb) levels are elevated in the maternal, fetal, and placental blood in cases of severe preeclampsia (PE) compared with normotensive controls. This was a cross-sectional study of women admitted at ≥24 weeks gestation with or without severe PE. Maternal plasma was collected at the time of enrollment. Umbilical venous cord and intervillous space blood were collected at delivery. Plasma Bb levels were assessed using ELISA. Bb levels were compared between cases and controls. Median Bb levels were higher in the maternal plasma of severe PE subjects (n = 24) than in controls (n = 20), 1.45 ± 1.03 versus 0.65 ± 0.23 μg/mL, P < 0.001. In umbilical venous plasma, Bb levels were higher in severe PE subjects (n = 15) compared with controls (n = 15), 2.48 ± 1.40 versus 1.01 ± 0.57 μg/mL, P = 0.01. Activation fragment Bb is increased in the maternal and umbilical venous blood of cases of severe PE when compared with normotensive controls. These data provide support for alternative complement pathway involvement in the pathogenesis of severe PE and demonstrate that alternative complement activation occurs not only in the maternal but also in the fetal compartment. © 2013 John Wiley & Sons Ltd.
Linkage map of the fragments of herpesvirus papio DNA.
Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H
1981-01-01
Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015
Complement drives glucosylceramide accumulation and tissue inflammation in Gaucher disease.
Pandey, Manoj K; Burrow, Thomas A; Rani, Reena; Martin, Lisa J; Witte, David; Setchell, Kenneth D; Mckay, Mary A; Magnusen, Albert F; Zhang, Wujuan; Liou, Benjamin; Köhl, Jörg; Grabowski, Gregory A
2017-03-02
Gaucher disease is caused by mutations in GBA1, which encodes the lysosomal enzyme glucocerebrosidase (GCase). GBA1 mutations drive extensive accumulation of glucosylceramide (GC) in multiple innate and adaptive immune cells in the spleen, liver, lung and bone marrow, often leading to chronic inflammation. The mechanisms that connect excess GC to tissue inflammation remain unknown. Here we show that activation of complement C5a and C5a receptor 1 (C5aR1) controls GC accumulation and the inflammatory response in experimental and clinical Gaucher disease. Marked local and systemic complement activation occurred in GCase-deficient mice or after pharmacological inhibition of GCase and was associated with GC storage, tissue inflammation and proinflammatory cytokine production. Whereas all GCase-inhibited mice died within 4-5 weeks, mice deficient in both GCase and C5aR1, and wild-type mice in which GCase and C5aR were pharmacologically inhibited, were protected from these adverse effects and consequently survived. In mice and humans, GCase deficiency was associated with strong formation of complement-activating GC-specific IgG autoantibodies, leading to complement activation and C5a generation. Subsequent C5aR1 activation controlled UDP-glucose ceramide glucosyltransferase production, thereby tipping the balance between GC formation and degradation. Thus, extensive GC storage induces complement-activating IgG autoantibodies that drive a pathway of C5a generation and C5aR1 activation that fuels a cycle of cellular GC accumulation, innate and adaptive immune cell recruitment and activation in Gaucher disease. As enzyme replacement and substrate reduction therapies are expensive and still associated with inflammation, increased risk of cancer and Parkinson disease, targeting C5aR1 may serve as a treatment option for patients with Gaucher disease and, possibly, other lysosomal storage diseases.
Model for how type I restriction enzymes select cleavage sites in DNA
International Nuclear Information System (INIS)
Studier, F.W.; Bandyopadhyay, P.K.
1988-01-01
Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37 degree C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected
Activation of the classical pathway of complement by tobacco glycoprotein (TGP).
Koethe, S M; Nelson, K E; Becker, C G
1995-07-15
Tobacco glycoprotein (TGP), a polyphenol-rich glycoprotein isolated from tobacco leaves, activates the classical complement pathway through a mechanism that appears to involve direct interaction with C1q. A binding site on C1q for TGP can be localized by competitive inhibition with DNA to a region located in the junction between the collagen-like and globular regions of the molecule. A protein with activity similar to TGP has also been isolated from cigarette smoke condensate (TGP-S); it shares a binding site on C1q with TGP and has similar functional activity, with the exception that complement activation does not proceed to formation of a C3 cleaving enzyme. The ability of TGP and TGP-S to activate complement can be partially duplicated using polyphenols associated with tobacco leaf and smoke, i.e., chlorogenic acid and rutin. These polyphenols also compete with TGP for a binding site on immobilized C1q, suggesting that the polyphenol portion of TGP is critical for activation of complement. These results provide an additional mechanism for complement activation by cigarette products that, in vivo, could result in a localized complement depletion, generation of biologically active complement cleavage products, and initiation of an inflammatory response.
Lessons from hot spot analysis for fragment-based drug discovery
Hall, David R.; Vajda, Sandor
2015-01-01
Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high affinity, druglike ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from protein three-dimensional structure, and how their strength, number and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. PMID:26538314
Patston, P.A.; Roodi, N.; Schifferli, J.A.; Bischoff, Rainer; Courtney, M.; Schapira, M.
1990-01-01
Increased extracellular proteolysis because of unregulated activation of blood coagulation, complement, and fibrinolysis is observed in thrombosis, shock, and inflammation. In the present study, we have examined whether the plasma kallikrein-kinin system, the classical pathway of complement, and the
When fragments link: a bibliometric perspective on the development of fragment-based drug discovery.
Romasanta, Angelo K S; van der Sijde, Peter; Hellsten, Iina; Hubbard, Roderick E; Keseru, Gyorgy M; van Muijlwijk-Koezen, Jacqueline; de Esch, Iwan J P
2018-05-05
Fragment-based drug discovery (FBDD) is a highly interdisciplinary field, rich in ideas integrated from pharmaceutical sciences, chemistry, biology, and physics, among others. To enrich our understanding of the development of the field, we used bibliometric techniques to analyze 3642 publications in FBDD, complementing accounts by key practitioners. Mapping its core papers, we found the transfer of knowledge from academia to industry. Co-authorship analysis showed that university-industry collaboration has grown over time. Moreover, we show how ideas from other scientific disciplines have been integrated into the FBDD paradigm. Keyword analysis showed that the field is organized into four interconnected practices: library design, fragment screening, computational methods, and optimization. This study highlights the importance of interactions among various individuals and institutions from diverse disciplines in newly emerging scientific fields. Copyright © 2018. Published by Elsevier Ltd.
Tatemoto, K; Nozaki, Y; Tsuda, R; Kaneko, S; Tomura, K; Furuno, M; Ogasawara, H; Edamura, K; Takagi, H; Iwamura, H; Noguchi, M; Naito, T
2018-05-01
Mast cells play a central role in inflammatory and allergic reactions by releasing inflammatory mediators through 2 main pathways, immunoglobulin E-dependent and E-independent activation. In the latter pathway, mast cells are activated by a diverse range of basic molecules (collectively known as basic secretagogues) through Mas-related G protein-coupled receptors (MRGPRs). In addition to the known basic secretagogues, here, we discovered several endogenous protein and enzyme fragments (such as chaperonin-10 fragment) that act as bioactive peptides and induce immunoglobulin E-independent mast cell activation via MRGPRX2 (previously known as MrgX2), leading to the degranulation of mast cells. We discuss the possibility that MRGPRX2 responds various as-yet-unidentified endogenous ligands that have specific characteristics, and propose that MRGPRX2 plays an important role in regulating inflammatory responses to endogenous harmful stimuli, such as protein breakdown products released from damaged or dying cells. © 2018 The Foundation for the Scandinavian Journal of Immunology.
Fragment growing and linking lead to novel nanomolar lactate dehydrogenase inhibitors.
Kohlmann, Anna; Zech, Stephan G; Li, Feng; Zhou, Tianjun; Squillace, Rachel M; Commodore, Lois; Greenfield, Matthew T; Lu, Xiaohui; Miller, David P; Huang, Wei-Sheng; Qi, Jiwei; Thomas, R Mathew; Wang, Yihan; Zhang, Sen; Dodd, Rory; Liu, Shuangying; Xu, Rongsong; Xu, Yongjin; Miret, Juan J; Rivera, Victor; Clackson, Tim; Shakespeare, William C; Zhu, Xiaotian; Dalgarno, David C
2013-02-14
Lactate dehydrogenase A (LDH-A) catalyzes the interconversion of lactate and pyruvate in the glycolysis pathway. Cancer cells rely heavily on glycolysis instead of oxidative phosphorylation to generate ATP, a phenomenon known as the Warburg effect. The inhibition of LDH-A by small molecules is therefore of interest for potential cancer treatments. We describe the identification and optimization of LDH-A inhibitors by fragment-based drug discovery. We applied ligand based NMR screening to identify low affinity fragments binding to LDH-A. The dissociation constants (K(d)) and enzyme inhibition (IC(50)) of fragment hits were measured by surface plasmon resonance (SPR) and enzyme assays, respectively. The binding modes of selected fragments were investigated by X-ray crystallography. Fragment growing and linking, followed by chemical optimization, resulted in nanomolar LDH-A inhibitors that demonstrated stoichiometric binding to LDH-A. Selected molecules inhibited lactate production in cells, suggesting target-specific inhibition in cancer cell lines.
Lessons from Hot Spot Analysis for Fragment-Based Drug Discovery.
Hall, David R; Kozakov, Dima; Whitty, Adrian; Vajda, Sandor
2015-11-01
Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high-affinity, drug-like ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from a protein 3D structure, and how their strength, number, and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. Copyright © 2015 Elsevier Ltd. All rights reserved.
Liszewski, M. Kathryn; Kolev, Martin; Le Friec, Gaelle; Leung, Marilyn; Bertram, Paula G.; Fara, Antonella F.; Subias, Marta; Pickering, Matthew C.; Drouet, Christian; Meri, Seppo; Arstila, T. Petteri; Pekkarinen, Pirkka T.; Ma, Margaret; Cope, Andrew; Reinheckel, Thomas; Rodriguez de Cordoba, Santiago; Afzali, Behdad; Atkinson, John P.; Kemper, Claudia
2013-01-01
Summary Complement is viewed as a critical serum-operative component of innate immunity, with processing of its key component, C3, into activation fragments C3a and C3b confined to the extracellular space. We report here that C3 activation also occurred intracellularly. We found that the T cell-expressed protease cathepsin L (CTSL) processed C3 into biologically active C3a and C3b. Resting T cells contained stores of endosomal and lysosomal C3 and CTSL and substantial amounts of CTSL-generated C3a. While “tonic” intracellular C3a generation was required for homeostatic T cell survival, shuttling of this intracellular C3-activation-system to the cell surface upon T cell stimulation induced autocrine proinflammatory cytokine production. Furthermore, T cells from patients with autoimmune arthritis demonstrated hyperactive intracellular complement activation and interferon-γ production and CTSL inhibition corrected this deregulated phenotype. Importantly, intracellular C3a was observed in all examined cell populations, suggesting that intracellular complement activation might be of broad physiological significance. PMID:24315997
Advances in fragment-based drug discovery platforms.
Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya
2009-11-01
Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.
Complement activation in Ghanaian children with severe Plasmodium falciparum malaria
Directory of Open Access Journals (Sweden)
Ofori Michael F
2007-12-01
Full Text Available Abstract Background Severe anaemia (SA, intravascular haemolysis (IVH and respiratory distress (RD are severe forms of Plasmodium falciparum malaria, with RD reported to be of prognostic importance in African children with malarial anaemia. Complement factors have been implicated in the mechanism leading to excess anaemia in acute P. falciparum infection. Methods The direct Coombs test (DCT and flow cytometry were used to investigate the mean levels of RBC-bound complement fragments (C3d and C3bαβ and the regulatory proteins [complement receptor 1 (CD35 and decay accelerating factor (CD55] in children with discrete clinical forms of P. falciparum malaria. The relationship between the findings and clinical parameters including coma, haemoglobin (Hb levels and RD were investigated. Results Of the 484 samples tested, 131(27% were positive in DCT, out of which 115/131 (87.8% were positive for C3d alone while 16/131 (12.2% were positive for either IgG alone or both. 67.4% of the study population were below 5 years of age and DCT positivity was more common in this age group relative to children who were 5 years or older (Odds ratio, OR = 3.8; 95%CI, 2.2–6.7, p Conclusion These results suggest that complement activation contributed to anaemia in acute childhood P. falciparum malaria, possibly through induction of erythrophagocytosis and haemolysis. In contrast to other studies, this study did not find association between levels of the complement regulatory proteins, CD35 and CD55 and malarial anaemia. These findings suggest that complement activation could also be involved in the pathogenesis of RD but larger studies are needed to confirm this finding.
Directory of Open Access Journals (Sweden)
Adriana Balbina Paoliello-Paschoalato
2015-01-01
Full Text Available Rheumatoid arthritis (RA is a highly disabling disease that affects all structures of the joint and significantly impacts on morbidity and mortality in RA patients. RA is characterized by persistent inflammation of the synovial membrane lining the joint associated with infiltration of immune cells. Eighty to 90% of the leukocytes infiltrating the synovia are neutrophils. The specific role that neutrophils play in the onset of RA is not clear, but recent studies have evidenced that they have an important participation in joint damage and disease progression through the release of proteolytic enzymes, reactive oxygen species (ROS, cytokines, and neutrophil extracellular traps, in particular during frustrated phagocytosis of immune complexes (ICs. In addition, the local and systemic activation of the complement system contributes to the pathogenesis of RA and other IC-mediated diseases. This review discusses (i the participation of Fcγ and complement receptors in mediating the effector functions of neutrophils in RA; (ii the contribution of the complement system and ROS-dependent and ROS-independent mechanisms to joint damage in RA; and (iii the use of plant extracts, dietary compounds, and isolated natural compounds in the treatment of RA, focusing on modulation of the effector functions of neutrophils and the complement system activity and/or activation.
Energy Technology Data Exchange (ETDEWEB)
Kim, Ji-sun; Choi, Dong-Ki; Park, Seong-wook; Shin, Seung-Min; Bae, Jeomil [Department of Molecular Science and Technology, Ajou University, Suwon 443-749 (Korea, Republic of); Kim, Dong-Myung [Department of Chemical Engineering and Applied Chemistry, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Yoo, Tae Hyeon [Department of Molecular Science and Technology, Ajou University, Suwon 443-749 (Korea, Republic of); Kim, Yong-Sung, E-mail: kimys@ajou.ac.kr [Department of Molecular Science and Technology, Ajou University, Suwon 443-749 (Korea, Republic of)
2015-11-27
Considering the number of cytosolic proteins associated with many diseases, development of cytosol-penetrating molecules from outside of living cells is highly in demand. To gain access to the cytosol after cellular uptake, cell-penetrating molecules should be released from intermediate endosomes prior to the lysosomal degradation. However, it is very challenging to distinguish the pool of cytosolic-released molecules from those trapped in the endocytic vesicles. Here we describe a method to directly demonstrate the cytosolic localization and quantification of cytosolic amount of a cytosol-penetrating IgG antibody, TMab4, based on enhanced split GFP complementation system. We generated TMab4 genetically fused with one GFP fragment and separately established HeLa cells expressing the other GFP fragment in the cytosol such that the complemented GFP fluorescence is observed only when extracellular-treated TMab4 reaches the cytosol after cellular internalization. The high affinity interactions between streptavidin-binding peptide 2 and streptavidin was employed as respective fusion partners of GFP fragments to enhance the sensitivity of GFP complementation. With this method, cytosolic concentration of TMab4 was estimated to be about 170 nM after extracellular treatment of HeLa cells with 1 μM TMab4 for 6 h. We also found that after cellular internalization into living cells, nearly 1.3–4.3% of the internalized TMab4 molecules escaped into the cytosol from the endocytic vesicles. Our enhanced split GFP complementation assay provides a useful tool to directly quantify cytosolic amount of cytosol-penetrating agents and allows cell-based high-throughput screening for cytosol-penetrating agents with increased endosomal-escaping activity.
Eriksson, Charlotta E; Studahl, Marie; Bergström, Tomas
2016-06-15
Herpes simplex encephalitis (HSE) is characterized by a pronounced inflammatory activity in the central nervous system (CNS). Here, we investigated the acute and prolonged complement system activity in HSE patients, by using enzyme-linked immunosorbent assays (ELISAs) for numerous complement components (C). We found increased cerebrospinal fluid concentrations of C3a, C3b, C5 and C5a in HSE patients compared with healthy controls. C3a and C5a concentrations remained increased also compared with patient controls. Our results conclude that the complement system is activated in CNS during HSE in the acute phase, and interestingly also in later stages supporting previous reports of prolonged inflammation. Copyright © 2016 Elsevier B.V. All rights reserved.
Research Applications of Proteolytic Enzymes in Molecular Biology
Directory of Open Access Journals (Sweden)
József Tőzsér
2013-11-01
Full Text Available Proteolytic enzymes (also termed peptidases, proteases and proteinases are capable of hydrolyzing peptide bonds in proteins. They can be found in all living organisms, from viruses to animals and humans. Proteolytic enzymes have great medical and pharmaceutical importance due to their key role in biological processes and in the life-cycle of many pathogens. Proteases are extensively applied enzymes in several sectors of industry and biotechnology, furthermore, numerous research applications require their use, including production of Klenow fragments, peptide synthesis, digestion of unwanted proteins during nucleic acid purification, cell culturing and tissue dissociation, preparation of recombinant antibody fragments for research, diagnostics and therapy, exploration of the structure-function relationships by structural studies, removal of affinity tags from fusion proteins in recombinant protein techniques, peptide sequencing and proteolytic digestion of proteins in proteomics. The aim of this paper is to review the molecular biological aspects of proteolytic enzymes and summarize their applications in the life sciences.
The Murine Factor H-Related Protein FHR-B Promotes Complement Activation
Directory of Open Access Journals (Sweden)
Marcell Cserhalmi
2017-09-01
Full Text Available Factor H-related (FHR proteins consist of varying number of complement control protein domains that display various degrees of sequence identity to respective domains of the alternative pathway complement inhibitor factor H (FH. While such FHR proteins are described in several species, only human FHRs were functionally investigated. Their biological role is still poorly understood and in part controversial. Recent studies on some of the human FHRs strongly suggest a role for FHRs in enhancing complement activation via competing with FH for binding to certain ligands and surfaces. The aim of the current study was the functional characterization of a murine FHR, FHR-B. To this end, FHR-B was expressed in recombinant form. Recombinant FHR-B bound to human C3b and was able to compete with human FH for C3b binding. FHR-B supported the assembly of functionally active C3bBb alternative pathway C3 convertase via its interaction with C3b. This activity was confirmed by demonstrating C3 activation in murine serum. In addition, FHR-B bound to murine pentraxin 3 (PTX3, and this interaction resulted in murine C3 fragment deposition due to enhanced complement activation in mouse serum. FHR-B also induced C3 deposition on C-reactive protein, the extracellular matrix (ECM extract Matrigel, and endothelial cell-derived ECM when exposed to mouse serum. Moreover, mouse C3 deposition was strongly enhanced on necrotic Jurkat T cells and the mouse B cell line A20 by FHR-B. FHR-B also induced lysis of sheep erythrocytes when incubated in mouse serum with FHR-B added in excess. Altogether, these data demonstrate that, similar to human FHR-1 and FHR-5, mouse FHR-B modulates complement activity by promoting complement activation via interaction with C3b and via competition with murine FH.
Granja, Luiz Fernando Zmetek; Pinto, Lysianne; Almeida, Cátia Amancio; Alviano, Daniela Sales; Da Silva, Maria Helena; Ejzemberg, Regina; Alviano, Celuta Sales
2010-03-01
Complement activation by spores of Mucor ramosissimus, Mucor plumbeus and Mucor circinelloides was studied using absorbed human serum in the presence or absence of chelators (EGTA or EDTA). We found that the spore caused full complement activation when incubated with EGTA-Mg2+ or without chelators, indicating that the alternative pathway is mainly responsible for this response. In order to compare activation profiles from each species, ELISAs for C3 and C4 fragments, mannan binding lectin (MBL), C-reactive protein (CRP) and IgG studies were carried out. All proteins were present on the species tested. Immunofluorescence tests demonstrated the presence of C3 fragments on the surface of all samples, which were confluent throughout fungal surfaces. The same profile of C3, C4, MBL, CRP and IgG deposition, observed in all species, suggests a similar activation behavior for these species.
Developments in SPR Fragment Screening.
Chavanieu, Alain; Pugnière, Martine
2016-01-01
Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.
Directory of Open Access Journals (Sweden)
Changshui Liu
Full Text Available The formation of fusion protein in biosynthetic pathways usually improves metabolic efficiency either channeling intermediates and/or colocalizing enzymes. In the metabolic engineering of biochemical pathways, generating unnatural protein fusions between sequential biosynthetic enzymes is a useful method to increase system efficiency and product yield. Here, we reported a special case. The malonyl-CoA reductase (MCR of Chloroflexus aurantiacus catalyzes the conversion of malonyl-CoA to 3-hydroxypropionate (3HP, and is a key enzyme in microbial production of 3HP, an important platform chemical. Functional domain analysis revealed that the N-terminal region of MCR (MCR-N; amino acids 1-549 and the C-terminal region of MCR (MCR-C; amino acids 550-1219 were functionally distinct. The malonyl-CoA was reduced into free intermediate malonate semialdehyde with NADPH by MCR-C fragment, and further reduced to 3HP by MCR-N fragment. In this process, the initial reduction of malonyl-CoA was rate limiting. Site-directed mutagenesis demonstrated that the TGXXXG(AX(1-2G and YXXXK motifs were important for enzyme activities of both MCR-N and MCR-C fragments. Moreover, the enzyme activity increased when MCR was separated into two individual fragments. Kinetic analysis showed that MCR-C fragment had higher affinity for malonyl-CoA and 4-time higher K cat/K m value than MCR. Dissecting MCR into MCR-N and MCR-C fragments also had a positive effect on the 3HP production in a recombinant Escherichia coli strain. Our study showed the feasibility of protein dissection as a new strategy in biosynthetic systems.
Zhang, Yingjie; Wu, Minhao; Hang, Tianrong; Wang, Chengliang; Yang, Ye; Pan, Weimin; Zang, Jianye; Zhang, Min; Zhang, Xuan
2017-05-04
Complement factor H (CFH) is a soluble complement regulatory protein essential for the down-regulation of the alternative pathway on interaction with specific markers on the host cell surface. It recognizes the complement component 3b (C3b) and 3d (C3d) fragments in addition to self cell markers (i.e. glycosaminoglycans, sialic acid) to distinguish host cells that deserve protection from pathogens that should be eliminated. The Staphylococcus aureus surface protein serine-aspartate repeat protein E (SdrE) was previously reported to bind human CFH as an immune-evasion tactic. However, the molecular mechanism underlying SdrE-CFH-mediated immune evasion remains unknown. In the present study, we identified a novel region at CFH's C-terminus (CFH 1206-1226 ), which binds SdrE N2 and N3 domains (SdrE N2N3 ) with high affinity, and determined the crystal structures of apo-SdrE N2N3 and the SdrE N2N3 -CFH 1206-1226 complex. Comparison of the structure of the CFH-SdrE complex with other CFH structures reveals that CFH's C-terminal tail flips from the main body to insert into the ligand-binding groove of SdrE. In addition, SdrE N2N3 adopts a 'close' state in the absence of CFH, which undergoes a large conformational change on CFH binding, suggesting a novel 'close, dock, lock and latch' (CDLL) mechanism for SdrE to recognize its ligand. Our findings imply that SdrE functions as a 'clamp' to capture CFH's C-terminal tail via a unique CDLL mechanism and sequesters CFH on the surface of S. aureus for complement evasion. © 2017 The Author(s).
Khandhadia, Samir; Hakobyan, Svetlana; Heng, Ling Z; Gibson, Jane; Adams, David H; Alexander, Graeme J; Gibson, Jonathan M; Martin, Keith R; Menon, Geeta; Nash, Kathryn; Sivaprasad, Sobha; Ennis, Sarah; Cree, Angela J; Morgan, B Paul; Lotery, Andrew J
2013-08-01
To investigate whether modification of liver complement factor H (CFH) production, by alteration of liver CFH Y402H genotype through liver transplantation (LT), influences the development of age-related macular degeneration (AMD). Multicenter, cross-sectional study. We recruited 223 Western European patients ≥ 55 years old who had undergone LT ≥ 5 years previously. We determined AMD status using a standard grading system. Recipient CFH Y402H genotype was obtained from DNA extracted from recipient blood samples. Donor CFH Y402H genotype was inferred from recipient plasma CFH Y402H protein allotype, measured using enzyme-linked immunosorbent assays. This approach was verified by genotyping donor tissue from a subgroup of patients. Systemic complement activity was ascertained by measuring levels of plasma complement proteins using an enzyme-linked immunosorbent assay, including substrates (C3, C4), activation products (C3a, C4a, and terminal complement complex), and regulators (total CFH, C1 inhibitor). We evaluated AMD status and recipient and donor CFH Y402H genotype. In LT patients, AMD was associated with recipient CFH Y402H genotype (P = 0.036; odds ratio [OR], 1.6; 95% confidence interval [CI], 1.0-2.4) but not with donor CFH Y402H genotype (P = 0.626), after controlling for age, sex, smoking status, and body mass index. Recipient plasma CFH Y402H protein allotype predicted donor CFH Y402H genotype with 100% accuracy (n = 49). Plasma complement protein or activation product levels were similar in LT patients with and without AMD. Compared with previously reported prevalence figures (Rotterdam Study), LT patients demonstrated a high prevalence of both AMD (64.6% vs 37.1%; OR, 3.09; Pproduction. In addition, AMD is not associated with systemic complement activity in LT patients. These findings suggest that local intraocular complement activity is of greater importance in AMD pathogenesis. The high AMD prevalence observed in LT patients may be associated with
Zhang, Yingjie; Wu, Minhao; Hang, Tianrong; Wang, Chengliang; Yang, Ye; Pan, Weimin; Zang, Jianye
2017-01-01
Complement factor H (CFH) is a soluble complement regulatory protein essential for the down-regulation of the alternative pathway on interaction with specific markers on the host cell surface. It recognizes the complement component 3b (C3b) and 3d (C3d) fragments in addition to self cell markers (i.e. glycosaminoglycans, sialic acid) to distinguish host cells that deserve protection from pathogens that should be eliminated. The Staphylococcus aureus surface protein serine–aspartate repeat protein E (SdrE) was previously reported to bind human CFH as an immune-evasion tactic. However, the molecular mechanism underlying SdrE–CFH-mediated immune evasion remains unknown. In the present study, we identified a novel region at CFH's C-terminus (CFH1206–1226), which binds SdrE N2 and N3 domains (SdrEN2N3) with high affinity, and determined the crystal structures of apo-SdrEN2N3 and the SdrEN2N3–CFH1206–1226 complex. Comparison of the structure of the CFH–SdrE complex with other CFH structures reveals that CFH's C-terminal tail flips from the main body to insert into the ligand-binding groove of SdrE. In addition, SdrEN2N3 adopts a ‘close’ state in the absence of CFH, which undergoes a large conformational change on CFH binding, suggesting a novel ‘close, dock, lock and latch' (CDLL) mechanism for SdrE to recognize its ligand. Our findings imply that SdrE functions as a ‘clamp' to capture CFH's C-terminal tail via a unique CDLL mechanism and sequesters CFH on the surface of S. aureus for complement evasion. PMID:28258151
Baculovirus display of functional antibody Fab fragments.
Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki
2015-08-01
The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.
Identification of Multiple Druggable Secondary Sites by Fragment Screening against DC-SIGN.
Aretz, Jonas; Baukmann, Hannes; Shanina, Elena; Hanske, Jonas; Wawrzinek, Robert; Zapol'skii, Viktor A; Seeberger, Peter H; Kaufmann, Dieter E; Rademacher, Christoph
2017-06-12
DC-SIGN is a cell-surface receptor for several pathogenic threats, such as HIV, Ebola virus, or Mycobacterium tuberculosis. Multiple attempts to develop inhibitors of the underlying carbohydrate-protein interactions have been undertaken in the past fifteen years. Still, drug-like DC-SIGN ligands are sparse, which is most likely due to its hydrophilic, solvent-exposed carbohydrate-binding site. Herein, we report on a parallel fragment screening against DC-SIGN applying SPR and a reporter displacement assay, which complements previous screenings using 19 F NMR spectroscopy and chemical fragment microarrays. Hit validation by SPR and 1 H- 15 N HSQC NMR spectroscopy revealed that although no fragment bound in the primary carbohydrate site, five secondary sites are available to harbor drug-like molecules. Building on key interactions of the reported fragment hits, these pockets will be targeted in future approaches to accelerate the development of DC-SIGN inhibitors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Incorporation of rapid thermodynamic data in fragment-based drug discovery.
Kobe, Akihiro; Caaveiro, Jose M M; Tashiro, Shinya; Kajihara, Daisuke; Kikkawa, Masato; Mitani, Tomoya; Tsumoto, Kouhei
2013-03-14
Fragment-based drug discovery (FBDD) has enjoyed increasing popularity in recent years. We introduce SITE (single-injection thermal extinction), a novel thermodynamic methodology that selects high-quality hits early in FBDD. SITE is a fast calorimetric competitive assay suitable for automation that captures the essence of isothermal titration calorimetry but using significantly fewer resources. We describe the principles of SITE and identify a novel family of fragment inhibitors of the enzyme ketosteroid isomerase displaying high values of enthalpic efficiency.
Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong
2012-06-01
A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.
The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation
Energy Technology Data Exchange (ETDEWEB)
Krishnan, Vengadesan [Center for Biophysical Sciences and Engineering, School of Optometry, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Xu, Yuanyuan [Division of Clinical Immunology and Rheumatology, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Macon, Kevin [Center for Biophysical Sciences and Engineering, School of Optometry, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Volanakis, John E. [Department of Medicine, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Narayana, Sthanam V. L., E-mail: narayana@uab.edu [Center for Biophysical Sciences and Engineering, School of Optometry, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)
2009-03-01
The crystal structure of C2b has been determined at 1.8 Å resolution, which reveals the arrangement of its three complement control protein (CCP) modules. A model for complement component C2 is presented and its conformational changes during the C3-convertase formation are also discussed. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. The formation of these convertases requires the Mg{sup 2+}-dependent binding of C2 to C4b and the subsequent cleavage of C2 by C1s or MASP2, respectively. The crystal structure of full-length C2 is not yet available, although the structure of its C-terminal catalytic segment C2a has been determined. The crystal structure of the N-terminal segment C2b of C2 determined to 1.8 Å resolution presented here reveals the arrangement of its three CCP domains. The domains are arranged differently compared with most other CCP-domain assemblies, but their arrangement is similar to that found in the Ba part of the full-length factor B structure. The crystal structures of C2a, C2b and full-length factor B are used to generate a model for C2 and a discussion of the domain association and possible interactions with C4b during formation of the C4b–C2 complex is presented. The results of this study also suggest that upon cleavage by C1s, C2a domains undergo conformational rotation while bound to C4b and the released C2b domains may remain folded together similar to as observed in the intact protein.
The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation
International Nuclear Information System (INIS)
Krishnan, Vengadesan; Xu, Yuanyuan; Macon, Kevin; Volanakis, John E.; Narayana, Sthanam V. L.
2009-01-01
The crystal structure of C2b has been determined at 1.8 Å resolution, which reveals the arrangement of its three complement control protein (CCP) modules. A model for complement component C2 is presented and its conformational changes during the C3-convertase formation are also discussed. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. The formation of these convertases requires the Mg 2+ -dependent binding of C2 to C4b and the subsequent cleavage of C2 by C1s or MASP2, respectively. The crystal structure of full-length C2 is not yet available, although the structure of its C-terminal catalytic segment C2a has been determined. The crystal structure of the N-terminal segment C2b of C2 determined to 1.8 Å resolution presented here reveals the arrangement of its three CCP domains. The domains are arranged differently compared with most other CCP-domain assemblies, but their arrangement is similar to that found in the Ba part of the full-length factor B structure. The crystal structures of C2a, C2b and full-length factor B are used to generate a model for C2 and a discussion of the domain association and possible interactions with C4b during formation of the C4b–C2 complex is presented. The results of this study also suggest that upon cleavage by C1s, C2a domains undergo conformational rotation while bound to C4b and the released C2b domains may remain folded together similar to as observed in the intact protein
Mizukami, Makoto; Onishi, Hiromasa; Hanagata, Hiroshi; Miyauchi, Akira; Ito, Yuji; Tokunaga, Hiroko; Ishibashi, Matsujiro; Arakawa, Tsutomu; Tokunaga, Masao
2018-10-01
The Brevibacillus expression system has been successfully employed for the efficient productions of a variety of recombinant proteins, including enzymes, cytokines, antigens and antibody fragments. Here, we succeeded in secretory expression of Trastuzumab Fab antibody fragments using B. choshinensis/BIC (Brevibacillus in vivocloning) expression system. In the fed-batch high-density cell culture, recombinant Trastuzumab Fab with amino-terminal His-tag (His-BcFab) was secreted at high level, 1.25 g/liter, and Fab without His-tag (BcFab) at ∼145 mg/L of culture supernatant. His-BcFab and BcFab were purified to homogeneity using combination of conventional column chromatographies with a yield of 10-13%. This BcFab preparation exhibited native structure and functions evaluated by enzyme-linked immunosorbent assay, surface plasmon resonance, circular dichroism measurements and size exclusion chromatography. To our knowledge, this is the highest production of Fab antibody fragments in gram-positive bacterial expression/secretion systems. Copyright © 2018 Elsevier Inc. All rights reserved.
Engelberts, Patrick J.; Voorhorst, Marleen; Schuurman, Janine; van Meerten, Tom; Bakker, Joost M.; Vink, Tom; Mackus, Wendy J. M.; Breij, Esther C. W.; Derer, Stefanie; Valerius, Thomas; van de Winkel, Jan G. J.; Parren, Paul W. H. I.; Beurskens, Frank J.
2016-01-01
Human IgG1 type I CD20 Abs, such as rituximab and ofatumumab (OFA), efficiently induce complement-dependent cytotoxicity (CDC) of CD20(+) B cells by binding of C1 to hexamerized Fc domains. Unexpectedly, we found that type I CD20 Ab F(ab ')2 fragments, as well as C1q-binding-deficient IgG mutants,
Khattab, Ayman; Barroso, Marta; Miettinen, Tiera; Meri, Seppo
2015-01-01
Hematophagous vectors strictly require ingesting blood from their hosts to complete their life cycles. Exposure of the alimentary canal of these vectors to the host immune effectors necessitates efficient counteractive measures by hematophagous vectors. The Anopheles mosquito transmitting the malaria parasite is an example of hematophagous vectors that within seconds can ingest human blood double its weight. The innate immune defense mechanisms, like the complement system, in the human blood should thereby immediately react against foreign cells in the mosquito midgut. A prerequisite for complement activation is that the target cells lack complement regulators on their surfaces. In this work, we analyzed whether human complement is active in the mosquito midgut, and how the mosquito midgut cells protect themselves against complement attack. We found that complement remained active for a considerable time and was able to kill microbes within the mosquito midgut. However, the Anopheles mosquito midgut cells were not injured. These cells were found to protect themselves by capturing factor H, the main soluble inhibitor of the alternative complement pathway. Factor H inhibited complement on the midgut cells by promoting inactivation of C3b to iC3b and preventing the activity of the alternative pathway amplification C3 convertase enzyme. An interference of the FH regulatory activity by monoclonal antibodies, carried to the midgut via blood, resulted in increased mosquito mortality and reduced fecundity. By using a ligand blotting assay, a putative mosquito midgut FH receptor could be detected. Thereby, we have identified a novel mechanism whereby mosquitoes can tolerate human blood. PMID:25679788
Directory of Open Access Journals (Sweden)
Ayman Khattab
2015-02-01
Full Text Available Hematophagous vectors strictly require ingesting blood from their hosts to complete their life cycles. Exposure of the alimentary canal of these vectors to the host immune effectors necessitates efficient counteractive measures by hematophagous vectors. The Anopheles mosquito transmitting the malaria parasite is an example of hematophagous vectors that within seconds can ingest human blood double its weight. The innate immune defense mechanisms, like the complement system, in the human blood should thereby immediately react against foreign cells in the mosquito midgut. A prerequisite for complement activation is that the target cells lack complement regulators on their surfaces. In this work, we analyzed whether human complement is active in the mosquito midgut, and how the mosquito midgut cells protect themselves against complement attack. We found that complement remained active for a considerable time and was able to kill microbes within the mosquito midgut. However, the Anopheles mosquito midgut cells were not injured. These cells were found to protect themselves by capturing factor H, the main soluble inhibitor of the alternative complement pathway. Factor H inhibited complement on the midgut cells by promoting inactivation of C3b to iC3b and preventing the activity of the alternative pathway amplification C3 convertase enzyme. An interference of the FH regulatory activity by monoclonal antibodies, carried to the midgut via blood, resulted in increased mosquito mortality and reduced fecundity. By using a ligand blotting assay, a putative mosquito midgut FH receptor could be detected. Thereby, we have identified a novel mechanism whereby mosquitoes can tolerate human blood.
Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments
International Nuclear Information System (INIS)
Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.
1979-01-01
Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)
Mohammed, Akram; Guda, Chittibabu
2015-01-01
Enzymes are known as the molecular machines that drive the metabolism of an organism; hence identification of the full enzyme complement of an organism is essential to build the metabolic blueprint of that species as well as to understand the interplay of multiple species in an ecosystem. Experimental characterization of the enzymatic reactions of all enzymes in a genome is a tedious and expensive task. The problem is more pronounced in the metagenomic samples where even the species are not adequately cultured or characterized. Enzymes encoded by the gut microbiota play an essential role in the host metabolism; thus, warranting the need to accurately identify and annotate the full enzyme complements of species in the genomic and metagenomic projects. To fulfill this need, we develop and apply a method called ECemble, an ensemble approach to identify enzymes and enzyme classes and study the human gut metabolic pathways. ECemble method uses an ensemble of machine-learning methods to accurately model and predict enzymes from protein sequences and also identifies the enzyme classes and subclasses at the finest resolution. A tenfold cross-validation result shows accuracy between 97 and 99% at different levels in the hierarchy of enzyme classification, which is superior to comparable methods. We applied ECemble to predict the entire complements of enzymes from ten sequenced proteomes including the human proteome. We also applied this method to predict enzymes encoded by the human gut microbiome from gut metagenomic samples, and to study the role played by the microbe-derived enzymes in the human metabolism. After mapping the known and predicted enzymes to canonical human pathways, we identified 48 pathways that have at least one bacteria-encoded enzyme, which demonstrates the complementary role of gut microbiome in human gut metabolism. These pathways are primarily involved in metabolizing dietary nutrients such as carbohydrates, amino acids, lipids, cofactors and
2015-01-01
Background Enzymes are known as the molecular machines that drive the metabolism of an organism; hence identification of the full enzyme complement of an organism is essential to build the metabolic blueprint of that species as well as to understand the interplay of multiple species in an ecosystem. Experimental characterization of the enzymatic reactions of all enzymes in a genome is a tedious and expensive task. The problem is more pronounced in the metagenomic samples where even the species are not adequately cultured or characterized. Enzymes encoded by the gut microbiota play an essential role in the host metabolism; thus, warranting the need to accurately identify and annotate the full enzyme complements of species in the genomic and metagenomic projects. To fulfill this need, we develop and apply a method called ECemble, an ensemble approach to identify enzymes and enzyme classes and study the human gut metabolic pathways. Results ECemble method uses an ensemble of machine-learning methods to accurately model and predict enzymes from protein sequences and also identifies the enzyme classes and subclasses at the finest resolution. A tenfold cross-validation result shows accuracy between 97 and 99% at different levels in the hierarchy of enzyme classification, which is superior to comparable methods. We applied ECemble to predict the entire complements of enzymes from ten sequenced proteomes including the human proteome. We also applied this method to predict enzymes encoded by the human gut microbiome from gut metagenomic samples, and to study the role played by the microbe-derived enzymes in the human metabolism. After mapping the known and predicted enzymes to canonical human pathways, we identified 48 pathways that have at least one bacteria-encoded enzyme, which demonstrates the complementary role of gut microbiome in human gut metabolism. These pathways are primarily involved in metabolizing dietary nutrients such as carbohydrates, amino acids, lipids
Inhibition of ligand exchange kinetics via active-site trapping with an antibody fragment.
Oyen, David; Steyaert, Jan; Barlow, John N
2014-04-01
We describe the first example of an inhibitory antibody fragment (nanobody ca1697) that binds simultaneously to an enzyme (the enzyme dihydrofolate reductase from Escherichia coli) and its bound substrate (folate). Binding of the antibody to the substrate causes a 20-fold reduction in the rate of folate exchange kinetics. This work opens up the prospect of designing new types of antibody-based inhibitors of enzymes and receptors through suitable design of immunogens.
Binding-site assessment by virtual fragment screening.
Directory of Open Access Journals (Sweden)
Niu Huang
2010-04-01
Full Text Available The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock approximately 11,000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors.
In silico fragment-based drug design.
Konteatis, Zenon D
2010-11-01
In silico fragment-based drug design (FBDD) is a relatively new approach inspired by the success of the biophysical fragment-based drug discovery field. Here, we review the progress made by this approach in the last decade and showcase how it complements and expands the capabilities of biophysical FBDD and structure-based drug design to generate diverse, efficient drug candidates. Advancements in several areas of research that have enabled the development of in silico FBDD and some applications in drug discovery projects are reviewed. The reader is introduced to various computational methods that are used for in silico FBDD, the fragment library composition for this technique, special applications used to identify binding sites on the surface of proteins and how to assess the druggability of these sites. In addition, the reader will gain insight into the proper application of this approach from examples of successful programs. In silico FBDD captures a much larger chemical space than high-throughput screening and biophysical FBDD increasing the probability of developing more diverse, patentable and efficient molecules that can become oral drugs. The application of in silico FBDD holds great promise for historically challenging targets such as protein-protein interactions. Future advances in force fields, scoring functions and automated methods for determining synthetic accessibility will all aid in delivering more successes with in silico FBDD.
In silico design of fragment-based drug targeting host processing α-glucosidase i for dengue fever
Toepak, E. P.; Tambunan, U. S. F.
2017-02-01
Dengue is a major health problem in the tropical and sub-tropical regions. The development of antiviral that targeting dengue’s host enzyme can be more effective and efficient treatment than the viral enzyme. Host enzyme processing α-glucosidase I has an important role in the maturation process of dengue virus envelope glycoprotein. The inhibition of processing α-glucosidase I can become a promising target for dengue fever treatment. The antiviral approach using in silico fragment-based drug design can generate drug candidates with high binding affinity. In this research, 198.621 compounds were obtained from ZINC15 Biogenic Database. These compounds were screened to find the favorable fragments according to Rules of Three and pharmacological properties. The screening fragments were docked into the active site of processing α-glucosidase I. The potential fragment candidates from the molecular docking simulation were linked with castanospermine (CAST) to generate ligands with a better binding affinity. The Analysis of ligand - enzyme interaction showed ligands with code LRS 22, 28, and 47 have the better binding free energy than the standard ligand. Ligand LRS 28 (N-2-4-methyl-5-((1S,3S,6S,7R,8R,8aR)-1,6,7,8-tetrahydroxyoctahydroindolizin-3-yl) pentyl) indolin-1-yl) propionamide) itself among the other ligands has the lowest binding free energy. Pharmacological properties prediction also showed the ligands LRS 22, 28, and 47 can be promising as the dengue fever drug candidates.
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1989-01-01
The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...
Complementing the sugar code: role of GAGs and sialic acid in complement regulation
Directory of Open Access Journals (Sweden)
Alex eLangford-Smith
2015-02-01
Full Text Available Sugar molecules play a vital role on both microbial and mammalian cells, where they are involved in cellular communication, govern microbial virulence and modulate host immunity and inflammatory responses. The complement cascade, as part of a host’s innate immune system, is a potent weapon against invading bacteria but has to be tightly regulated to prevent inappropriate attack and damage to host tissues. A number of complement regulators, such as factor H and properdin, interact with sugar molecules, such as glycosaminoglycans and sialic acid, on host and pathogen membranes and direct the appropriate complement response by either promoting the binding of complement activators or inhibitors. The binding of these complement regulators to sugar molecules can vary from location to location, due to their different specificities and because distinct structural and functional subpopulations of sugars are found in different human organs, such as the brain, kidney and eye. This review will cover recent studies that have provided important new insights into the role of glycosaminoglycans and sialic acid in complement regulation and how sugar recognition may be compromised in disease
Complement Activation in Inflammatory Skin Diseases
Directory of Open Access Journals (Sweden)
Jenny Giang
2018-04-01
Full Text Available The complement system is a fundamental part of the innate immune system, playing a crucial role in host defense against various pathogens, such as bacteria, viruses, and fungi. Activation of complement results in production of several molecules mediating chemotaxis, opsonization, and mast cell degranulation, which can contribute to the elimination of pathogenic organisms and inflammation. Furthermore, the complement system also has regulating properties in inflammatory and immune responses. Complement activity in diseases is rather complex and may involve both aberrant expression of complement and genetic deficiencies of complement components or regulators. The skin represents an active immune organ with complex interactions between cellular components and various mediators. Complement involvement has been associated with several skin diseases, such as psoriasis, lupus erythematosus, cutaneous vasculitis, urticaria, and bullous dermatoses. Several triggers including auto-antibodies and micro-organisms can activate complement, while on the other hand complement deficiencies can contribute to impaired immune complex clearance, leading to disease. This review provides an overview of the role of complement in inflammatory skin diseases and discusses complement factors as potential new targets for therapeutic intervention.
Cross-species complementation of bacterial- and eukaryotic-type cardiolipin synthases
Directory of Open Access Journals (Sweden)
Petra Gottier
2017-11-01
Full Text Available The glycerophospholipid cardiolipin is a unique constituent of bacterial and mitochondrial membranes. It is involved in forming and stabilizing high molecular mass membrane protein complexes and in maintaining membrane architecture. Absence of cardiolipin leads to reduced efficiency of the electron transport chain, decreased membrane potential, and, ultimately, impaired respiratory metabolism. For the protozoan parasite Trypanosoma brucei cardiolipin synthesis is essential for survival, indicating that the enzymes involved in cardiolipin production represent potential drug targets. T. brucei cardiolipin synthase (TbCLS is unique as it belongs to the family of phospholipases D (PLD, harboring a prokaryotic-type cardiolipin synthase (CLS active site domain. In contrast, most other eukaryotic CLS, including the yeast ortholog ScCrd1, are members of the CDP-alcohol phosphatidyl transferase family. To study if these mechanistically distinct CLS enzymes are able to catalyze cardiolipin production in a cell that normally expresses a different type of CLS, we expressed TbCLS and ScCrd1 in CLS-deficient yeast and trypanosome strains, respectively. Our results show that TbCLS complemented cardiolipin production in CRD1 knockout yeast and partly restored wild-type colony forming capability under stress conditions. Remarkably, CL remodeling appeared to be impaired in the transgenic construct, suggesting that CL production and remodeling are tightly coupled processes that may require a clustering of the involved proteins into specific CL-synthesizing domains. In contrast, no complementation was observed by heterologous expression of ScCrd1 in conditional TbCLS knockout trypanosomes, despite proper mitochondrial targeting of the protein.
Population structure of Salmonella investigated by amplified fragment length polymorphism
DEFF Research Database (Denmark)
Torpdahl, M.; Ahrens, Peter
2004-01-01
Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...
Tamás Fülöp; Tamás Mészáros; Gergely Tibor Kozma; János Szebeni; Mihály Józsi
2018-01-01
Human application of monoclonal antibodies (mAbs), enzymes, as well as contrast media and many other particulate drugs and agents referred to as “nanomedicines”, can initiate pseudoallergic hypersensitivity reactions, also known as infusion reactions. These may in part be mediated by the activation of the complement system, a major humoral defense system of innate immunity. In this review, we provide a brief outline of complement activation-related pseudoallergy (CARPA) in general, and then f...
Directory of Open Access Journals (Sweden)
Benedikt eLeis
2015-04-01
Full Text Available Functional metagenomic screening strategies, which are independent of known sequence information, can lead to the identification of truly novel genes and enzymes. Since E. coli has been used exhaustively for this purpose as a host, it is important to establish alternative expression hosts and to use them for functional metagenomic screening for new enzymes. In this study we show that Thermus thermophilus HB27 is an excellent screening host and can be used as an alternative provider of truly novel biocatalysts. In a previous study we constructed the mutant strain BL03 that was no longer able to grow on defined minimal medium supplemented with tributyrin as the sole carbon source and could be used as a host to screen for metagenomic DNA fragments that could complement growth on tributyrin. Several thousand single fosmid clones from thermophilic metagenomic libraries from heated compost and hot spring water samples were subjected to a comparative screening for esterase activity in both T. thermophilus strain BL03 and E. coli EPI300. We scored a greater number of active clones in the thermophilic bacterium than in the mesophilic E. coli. From all clones functionally screened in E. coli, only two thermostable α/β-fold hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes were identifiable. In contrast, five further fosmids were found that conferred lipolytic activities in T. thermophilus. Four open reading frames (ORFs were found which did not share significant similarity to known esterase enzymes. Two of the genes were expressed in both hosts and the novel thermophilic esterases, which based on their primary structures could not be assigned to known esterase or lipase families, were purified and preliminarily characterized. Our work underscores the benefit of using additional screening hosts other than E. coli for the identification of novel biocatalysts with industrial relevance.
Shelke, Rupesh U; Degani, Mariam S; Raju, Archana; Ray, Mukti Kanta; Rajan, Mysore G R
2016-08-01
Fragment-based drug design was used to identify Mycobacterium tuberculosis (Mtb) dihydrofolate reductase (DHFR) inhibitors. Screening of ligands against the Mtb DHFR enzyme resulted in the identification of multiple fragment hits with IC50 values in the range of 38-90 μM versus Mtb DHFR and minimum inhibitory concentration (MIC) values in the range of 31.5-125 μg/mL. These fragment scaffolds would be useful for anti-tubercular drug design. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Daniel Ajona
Full Text Available Molecular markers in bronchial fluids may contribute to the diagnosis of lung cancer. We previously observed a significant increase of C4d-containing complement degradation fragments in bronchoalveolar lavage (BAL supernatants from lung cancer patients in a cohort of 50 cases and 22 controls (CUN cohort. The present study was designed to determine the diagnostic performance of these complement fragments (hereinafter jointly referred as C4d in bronchial fluids. C4d levels were determined in BAL supernatants from two independent cohorts: the CU cohort (25 cases and 26 controls and the HUVR cohort (60 cases and 98 controls. A series of spontaneous sputum samples from 68 patients with lung cancer and 10 controls was also used (LCCCIO cohort. Total protein content, complement C4, complement C5a, and CYFRA 21-1 were also measured in all cohorts. C4d levels were significantly increased in BAL samples from lung cancer patients. The area under the ROC curve was 0.82 (95%CI = 0.71-0.94 and 0.67 (95%CI = 0.58-0.76 for the CU and HUVR cohorts, respectively. In addition, unlike the other markers, C4d levels in BAL samples were highly consistent across the CUN, CU and HUVR cohorts. Interestingly, C4d test markedly increased the sensitivity of bronchoscopy in the two cohorts in which cytological data were available (CUN and HUVR cohorts. Finally, in the LCCCIO cohort, C4d levels were higher in sputum supernatants from patients with lung cancer (area under the ROC curve: 0.7; 95%CI = 0.56-0.83. In conclusion, C4d is consistently elevated in bronchial fluids from lung cancer patients and may be used to improve the diagnosis of the disease.
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
CSF coccidioides complement fixation
... this page: //medlineplus.gov/ency/article/003526.htm CSF coccidioides complement fixation test To use the sharing features on this page, please enable JavaScript. CSF coccidioides complement fixation is a test that checks ...
International Nuclear Information System (INIS)
Calderon, I.L.; Contopoulou, C.R.; Mortimer, R.K.
1982-01-01
Plasmids that complement the rad50-1, rad51-1, rad54-3 and rad55-3 mutations in yeast, have been isolated. They were obtained by transforming strains, carrying the leu2-112 leu2-3 alleles and the particular rad mutation, with YEp13 plasmids containing near random yeast DNA inserts. Rad + clones were identified among the Leu + transformants. Integration by targeting into the RAD55 locus showed that the rad55-3 complementing plasmid contained the actual RAD55 gene. BamHI fragments from each of the plasmids that complement rad50-1, rad51-1 and rad54-3, all of which lacked Rad + activity, were subcloned into the integrating plasmid YIp5 and the hybrid plasmids were used to transform a Rad + Ura - strain to Ura + . By genetic mapping, the rad51 and rad54 subclones were shown to integrate at their respective loci. However, the rad50 subclones integrated at a site unlinked to the RAD50 locus. This suggests that no homology exists between this BamHI fragment and the RAD50 gene. Integration at the RAD54 locus of the rad54 subclone made the host cell Ura + but Rad - ; excision of the plasmid was shown to be x-ray inducible and to restore the Ura - Rad + phenotype. These results indicate that the BamHI fragment of the RAD54 plasmid is internal to the RAD54 gene. We can conclude also that the RAD54 gene is not essential as cells bearing a disrupted copy of this gene are able to survive. Additionally, a plasmid carrying an amber suppressor has been isolated and characterized
Complement anaphylatoxin C3a is a potent inducer of embryonic chick retina regeneration
Haynes, Tracy; Luz-Madrigal, Agustin; Reis, Edimara S.; Echeverri Ruiz, Nancy P.; Grajales-Esquivel, Erika; Tzekou, Apostolia; Tsonis, Panagiotis A.; Lambris, John D.; Del Rio-Tsonis, Katia
2013-01-01
Identifying the initiation signals for tissue regeneration in vertebrates is one of the major challenges in regenerative biology. Much of the research thus far has indicated that certain growth factors have key roles. Here we show that complement fragment C3a is sufficient to induce complete regeneration of the embryonic chick retina from stem/progenitor cells present in the eye, independent of fibroblast growth factor receptor signaling. Instead, C3a induces retina regeneration via STAT3 activation, which in turn activates the injury- and inflammation-responsive factors, IL-6, IL-8 and TNF-α. This activation sets forth regulation of Wnt2b, Six3 and Sox2, genes associated with retina stem and progenitor cells. Thus, our results establish a mechanism for retina regeneration based on injury and inflammation signals. Furthermore, our results indicate a unique function for complement anaphylatoxins that implicate these molecules in the induction and complete regeneration of the retina, opening new avenues of experimentation in the field. PMID:23942241
Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W
1991-01-01
Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.
Controlling the complement system in inflammation.
Kirschfink, M
1997-12-01
Inappropriate or excessive activation of the complement system can lead to harmful, potentially life-threatening consequences due to severe inflammatory tissue destruction. These consequences are clinically manifested in various disorders, including septic shock, multiple organ failure and hyperacute graft rejection. Genetic complement deficiencies or complement depletion have been proven to be beneficial in reducing tissue injury in a number of animal models of severe complement-dependent inflammation. It is therefore believed that therapeutic inhibition of complement is likely to arrest the process of certain diseases. Attempts to efficiently inhibit complement include the application of endogenous soluble complement inhibitors (C1-inhibitor, recombinant soluble complement receptor 1- rsCR1), the administration of antibodies, either blocking key proteins of the cascade reaction (e.g. C3, C5), neutralizing the action of the complement-derived anaphylatoxin C5a, or interfering with complement receptor 3 (CR3, CD18/11b)-mediated adhesion of inflammatory cells to the vascular endothelium. In addition, incorporation of membrane-bound complement regulators (DAF-CD55, MCP-CD46, CD59) has become possible by transfection of the correspondent cDNA into xenogeneic cells. Thereby, protection against complement-mediated inflammatory tissue damage could be achieved in various animal models of sepsis, myocardial as well as intestinal ischemia/reperfusion injury, adult respiratory distress syndrome, nephritis and graft rejection. Supported by results from first clinical trials, complement inhibition appears to be a suitable therapeutic approach to control inflammation. Current strategies to specifically inhibit complement in inflammation have been discussed at a recent meeting on the 'Immune Consequences of Trauma, Shock and Sepsis', held from March 4-8, 1997, in Munich, Germany. The Congress (chairman: E. Faist, Munich, Germany), which was held in close cooperation with various
Thangavelu, Bharani; Bhansali, Pravin; Viola, Ronald E
2015-10-15
Aspartate-β-semialdehyde dehydrogenase (ASADH) lies at the first branch point in the aspartate metabolic pathway which leads to the biosynthesis of several essential amino acids and some important metabolites. This pathway is crucial for many metabolic processes in plants and microbes like bacteria and fungi, but is absent in mammals. Therefore, the key microbial enzymes involved in this pathway are attractive potential targets for development of new antibiotics with novel modes of action. The ASADH enzyme family shares the same substrate binding and active site catalytic groups; however, the enzymes from representative bacterial and fungal species show different inhibition patterns when previously screened against low molecular weight inhibitors identified from fragment library screening. In the present study several approaches, including fragment based drug discovery (FBDD), inhibitor docking, kinetic, and structure-activity relationship (SAR) studies have been used to guide ASADH inhibitor development. Elaboration of a core structure identified by FBDD has led to the synthesis of low micromolar inhibitors of the target enzyme, with high selectivity introduced between the Gram-negative and Gram-positive orthologs of ASADH. This new set of structures open a novel direction for the development of inhibitors against this validated drug-target enzyme. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nanomedicine and the complement paradigm.
Moghimi, S Moein; Farhangrazi, Z Shadi
2013-05-01
The role of complement in idiosyncratic reactions to nanopharmaceutical infusion is receiving increasing attention. We discuss this in relation to nanopharmaceutical development and the possible use of complement inhibitors to prevent related adverse reactions. We further call on initiation of genetic association studies to unravel the genetic basis of nanomedicine infusion-related adverse responses, since most of the polymorphic genes in the genome belong to the immune system. In this paper, idiosyncratic reactions based on complement activation are discussed in the context of newly available complement inhibitors. Copyright © 2013 Elsevier Inc. All rights reserved.
Complement Evasion by Pathogenic Leptospira.
Fraga, Tatiana Rodrigues; Isaac, Lourdes; Barbosa, Angela Silva
2016-01-01
Leptospirosis is a neglected infectious disease caused by spirochetes from the genus Leptospira . Pathogenic microorganisms, notably those which reach the blood circulation such as Leptospira , have evolved multiple strategies to escape the host complement system, which is important for innate and acquired immunity. Leptospira avoid complement-mediated killing through: (i) recruitment of host complement regulators; (ii) acquisition of host proteases that cleave complement proteins on the bacterial surface; and, (iii) secretion of proteases that inactivate complement proteins in the Leptospira surroundings. The recruitment of host soluble complement regulatory proteins includes the acquisition of Factor H (FH) and FH-like-1 (alternative pathway), C4b-binding protein (C4BP) (classical and lectin pathways), and vitronectin (Vn) (terminal pathway). Once bound to the leptospiral surface, FH and C4BP retain cofactor activity of Factor I in the cleavage of C3b and C4b, respectively. Vn acquisition by leptospires may result in terminal pathway inhibition by blocking C9 polymerization. The second evasion mechanism lies in plasminogen (PLG) binding to the leptospiral surface. In the presence of host activators, PLG is converted to enzymatically active plasmin, which is able to degrade C3b, C4b, and C5 at the surface of the pathogen. A third strategy used by leptospires to escape from complement system is the active secretion of proteases. Pathogenic, but not saprophytic leptospires, are able to secrete metalloproteases that cleave C3 (central complement molecule), Factor B (alternative pathway), and C4 and C2 (classical and lectin pathways). The purpose of this review is to fully explore these complement evasion mechanisms, which act together to favor Leptospira survival and multiplication in the host.
Gündemir-Durmaz, Tülay; Schmid, Fabian; El Baz, Yana; Häusser, Annette; Schneider, Carmen; Bilitewski, Ursula; Rauhut, Guntram; Garnier, Delphine; Baro, Angelika; Laschat, Sabine
2016-09-21
The construction of novel borrelidin analogues is reported in which the northern fragment is truncated to a simple hydroxyundecanecarboxylate and the original cyclopentanecarboxylic acid in the southern fragment is replaced with different six-membered rings. The required precursors were prepared by cross metathesis of the appropriate carbocycle-based homoallylic alcohol with crotonaldehyde followed by HWE olefination of the resulting enal with bromocyanophosphonate. The key aldehyde for intramolecular cross coupling was accessible by oxidation of the hydroxy group of the linked undecanecarboxylate unit. Grignard mediated macrocyclization finally yielded the borrelidin related products. The investigation is complemented by SAR studies and quantum-chemical calculations.
Boyko, Alex; Kovalchuk, Igor
2010-01-01
Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.
DEFF Research Database (Denmark)
Nielsen, C H; Marquart, H V; Prodinger, W M
2001-01-01
the alternative pathway. Blockade of the CR2 ligand-binding site with the monoclonal antibody FE8 resulted in 56 +/- 13% and 71 +/- 9% inhibition of the C3-fragment and MAC deposition, respectively, whereas the monoclonal antibody HB135, directed against an irrelevant CR2 epitope, had no effect. Blockade......Normal human B lymphocytes activate the alternative pathway of complement via complement receptor type 2 (CR2, CD21), that binds hydrolysed C3 (iC3) and thereby promotes the formation of a membrane-bound C3 convertase. We have investigated whether this might lead to the generation of a C5...... processes on CR2, indicate that MAC formation is a consequence of alternative pathway activation....
Bythell, Benjamin J; Csonka, István P; Suhai, Sándor; Barofsky, Douglas F; Paizs, Béla
2010-11-25
The gas-phase structures and fragmentation pathways of the singly protonated peptide arginylglycylaspartic acid (RGD) are investigated by means of collision-induced-dissociation (CID) and detailed molecular mechanics and density functional theory (DFT) calculations. It is demonstrated that despite the ionizing proton being strongly sequestered at the guanidine group, protonated RGD can easily be fragmented on charge directed fragmentation pathways. This is due to facile mobilization of the C-terminal or aspartic acid COOH protons thereby generating salt-bridge (SB) stabilized structures. These SB intermediates can directly fragment to generate b(2) ions or facilely rearrange to form anhydrides from which both b(2) and b(2)+H(2)O fragments can be formed. The salt-bridge stabilized and anhydride transition structures (TSs) necessary to form b(2) and b(2)+H(2)O are much lower in energy than their traditional charge solvated counterparts. These mechanisms provide compelling evidence of the role of SB and anhydride structures in protonated peptide fragmentation which complements and supports our recent findings for tryptic systems (Bythell, B. J.; Suhai, S.; Somogyi, A.; Paizs, B. J. Am. Chem. Soc. 2009, 131, 14057-14065.). In addition to these findings we also report on the mechanisms for the formation of the b(1) ion, neutral loss (H(2)O, NH(3), guanidine) fragment ions, and the d(3) ion.
Complement fixation test to C burnetii
... complement fixation test; Coxiella burnetii - complement fixation test; C burnetii - complement fixation test ... a specific foreign substance ( antigen ), in this case, C burnetii . Antibodies defend the body against bacteria, viruses, ...
Subversion of complement by hematophagous parasites.
Schroeder, Hélène; Skelly, Patrick J; Zipfel, Peter F; Losson, Bertrand; Vanderplasschen, Alain
2009-01-01
The complement system is a crucial part of innate and adaptive immunity which exerts a significant evolutionary pressure on pathogens. It has selected for those pathogens, mainly microorganisms but also parasites, that have evolved countermeasures. The characterization of how pathogens evade complement attack is a rapidly developing field of current research. In recent years, multiple complement evasion strategies have been characterized. In this review, we focus on complement escape mechanisms expressed by hematophagous parasites, a heterogeneous group of metazoan parasites that share the property of ingesting the whole blood of their host. Complement inhibition is crucial for parasite survival within the host tissue or to facilitate blood feeding. Finally, complement inhibition by hematophagous parasites may also contribute to their success as pathogen vectors.
Grosso, Giorgia; Vikerfors, Anna; Woodhams, Barry; Adam, Mariette; Bremme, Katarina; Holmström, Margareta; Ågren, Anna; Eelde, Anna; Bruzelius, Maria; Svenungsson, Elisabet; Antovic, Aleksandra
2017-10-01
Thrombosis and complement activation are pathogenic features of antiphospholipid syndrome (APS). Their molecular link is Plasma carboxypeptidase-B, also known as thrombin activatable fibrinolysis inhibitor (TAFIa), which plays a dual role: anti-fibrinolytic, by cleaving carboxyl-terminal lysine residues from partially degraded fibrin, and anti-inflammatory, by downregulating complement anaphylatoxins C3a and C5a. To investigate the levels of TAFI (proenzyme) and TAFIa (active enzyme) in relation to complement activation, fibrin clot permeability and fibrinolytic function in clinical and immunological subsets of 52 APS patients and 15 controls. TAFI (pAPS patients compared to controls. Furthermore, TAFIa was increased (pAPS patients affected by arterial thrombosis compared to other APS-phenotypes. Positive associations were found between TAFI and age, fibrinogen and C5a, and between TAFIa and age, fibrinogen and thrombomodulin. TAFI and TAFIa levels were increased in patients with APS as a potential response to complement activation. Interestingly, TAFI activation was associated with arterial thrombotic APS manifestations. Thus, TAFIa may be considered a novel biomarker for arterial thrombosis in APS. Copyright © 2017 Elsevier Ltd. All rights reserved.
Osthoff, Michael; Brown, Karl D; Kong, David C M; Daniell, Mark; Eisen, Damon P
2014-01-01
Pseudomonas aeruginosa (P. aeruginosa) microbial keratitis (MK) is a sight-threatening disease. Previous animal studies have identified an important contribution of the complement system to the clearance of P. aeruginosa infection of the cornea. Mannose-binding lectin (MBL), a pattern recognition receptor of the lectin pathway of complement, has been implicated in the host defense against P. aeruginosa. However, studies addressing the role of the lectin pathway in P. aeruginosa MK are lacking. Hence, we sought to determine the activity of the lectin pathway in human MK caused by P. aeruginosa. Primary human corneal epithelial cells (HCECs) from cadaveric donors were exposed to two different P. aeruginosa strains. Gene expression of interleukin (IL)-6, IL-8, MBL, and other complement proteins was determined by reverse transcription-polymerase chain reaction (RT-PCR) and MBL synthesis by enzyme-linked immunosorbent assay and intracellular flow cytometry. MBL gene expression was not detected in unchallenged HCECs. Exposure of HCECs to P. aeruginosa resulted in rapid induction of the transcriptional expression of MBL, IL-6, and IL-8. In addition, expression of several complement proteins of the classical and lectin pathways, but not the alternative pathway, were upregulated after 5 h of challenge, including MBL-associated serine protease 1. However, MBL protein secretion was not detectable 18 h after challenge with P. aeruginosa. MK due to P. aeruginosa triggers activation of MBL and the lectin pathway of complement. However, the physiologic relevance of this finding is unclear, as corresponding MBL oligomer production was not observed.
Noun complement clauses as referential modifiers
Directory of Open Access Journals (Sweden)
Carlos de Cuba
2017-01-01
Full Text Available A number of recent analyses propose that so-called noun complement clauses should be analyzed as a type of relative clause. In this paper, I present a number of complications for any analysis that equates noun complement clauses to relative clauses, and conclude that this type of analysis is on the wrong track. I present cross-linguistic evidence showing that the syntactic behavior of noun complement clauses does not pattern with relative clauses. Patterns of complementizer choice and complementizer drop as well as patterns involving main clause phenomena and extraction differ in the two constructions, which I argue is unexpected under a relative clause analysis that involves operator movement. Instead I present an alternative analysis in which I propose that the referentiality of a noun complement clause is linked to its syntactic behavior. Following recent work, I claim that referential clauses have a syntactically truncated left-periphery, and this truncation can account for the lack of main clause phenomena in noun complement clauses. I argue that the truncation analysis is also able to accommodate complementizer data patterns more easily than relative clause analyses that appeal to operator movement.
DEFF Research Database (Denmark)
Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar
2014-01-01
The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...
Subversion of complement by hematophagous parasites
Schroeder, Hélène; Skelly, Patrick; Zipfel, Peter F.; Losson, Bertrand; Vanderplasschen, Alain
2009-01-01
The complement system is a crucial part of innate and adaptive immunity which exerts a significant evolutionary pressure on pathogens. It has selected for those pathogens, mainly micro-organisms but also parasites, that have evolved countermeasures. The characterization of how pathogens evade complement attack is a rapidly developing field of current research. In recent years, multiple complement evasion strategies have been characterized. In this review, we focus on complement escape mechani...
Musi, Valeria; Spolaore, Barbara; Picotti, Paola; Zambonin, Marcello; De Filippis, Vincenzo; Fontana, Angelo
2004-05-25
Limited proteolysis of the 153-residue chain of horse apomyoglobin (apoMb) by thermolysin results in the selective cleavage of the peptide bond Pro88-Leu89. The N-terminal (residues 1-88) and C-terminal (residues 89-153) fragments of apoMb were isolated to homogeneity and their conformational and association properties investigated in detail. Far-UV circular dichroism (CD) measurements revealed that both fragments in isolation acquire a high content of helical secondary structure, while near-UV CD indicated the absence of tertiary structure. A 1:1 mixture of the fragments leads to a tight noncovalent protein complex (1-88/89-153, nicked apoMb), characterized by secondary and tertiary structures similar to those of intact apoMb. The apoMb complex binds heme in a nativelike manner, as given by CD measurements in the Soret region. Second-derivative absorption spectra in the 250-300 nm region provided evidence that the degree of exposure of Tyr residues in the nicked species is similar to that of the intact protein at neutral pH. Also, the microenvironment of Trp residues, located in positions 7 and 14 of the 153-residue chain of the protein, is similar in both protein species, as given by fluorescence emission data. Moreover, in analogy to intact apoMb, the nicked protein binds the hydrophobic dye 1-anilinonaphthalene-8-sulfonate (ANS). Taken together, our results indicate that the two proteolytic fragments 1-88 and 89-153 of apoMb adopt partly folded states characterized by sufficiently nativelike conformational features that promote their specific association and mutual stabilization into a nicked protein species much resembling in its structural features intact apoMb. It is suggested that the formation of a noncovalent complex upon fragment complementation can mimic the protein folding process of the entire protein chain, with the difference that the folding of the complementary fragments is an intermolecular process. In particular, this study emphasizes the
Janssen, George; Christis, Chantal; Kooy-Winkelaar, Yvonne; Edens, Luppo; Smith, Drew
2015-01-01
Background Due to the high proline content of gluten molecules, gastrointestinal proteases are unable to fully degrade them leaving large proline-rich gluten fragments intact, including an immunogenic 33-mer from α-gliadin and a 26-mer from γ-gliadin. These latter peptides can trigger pro-inflammatory T cell responses resulting in tissue remodeling, malnutrition and a variety of other complications. A strict lifelong gluten-free diet is currently the only available treatment to cope with gluten intolerance. Post-proline cutting enzymes have been shown to effectively degrade the immunogenic gluten peptides and have been proposed as oral supplements. Several existing digestive enzyme supplements also claim to aid in gluten degradation. Here we investigate the effectiveness of such existing enzyme supplements in comparison with a well characterized post-proline cutting enzyme, Prolyl EndoPeptidase from Aspergillus niger (AN-PEP). Methods Five commercially available digestive enzyme supplements along with purified digestive enzymes were subjected to 1) enzyme assays and 2) mass spectrometric identification. Gluten epitope degradation was monitored by 1) R5 ELISA, 2) mass spectrometric analysis of the degradation products and 3) T cell proliferation assays. Findings The digestive enzyme supplements showed comparable proteolytic activities with near neutral pH optima and modest gluten detoxification properties as determined by ELISA. Mass spectrometric analysis revealed the presence of many different enzymes including amylases and a variety of different proteases with aminopeptidase and carboxypeptidase activity. The enzyme supplements leave the nine immunogenic epitopes of the 26-mer and 33-mer gliadin fragments largely intact. In contrast, the pure enzyme AN-PEP effectively degraded all nine epitopes in the pH range of the stomach at much lower dose. T cell proliferation assays confirmed the mass spectrometric data. Conclusion Currently available digestive enzyme
Directory of Open Access Journals (Sweden)
George Janssen
Full Text Available Due to the high proline content of gluten molecules, gastrointestinal proteases are unable to fully degrade them leaving large proline-rich gluten fragments intact, including an immunogenic 33-mer from α-gliadin and a 26-mer from γ-gliadin. These latter peptides can trigger pro-inflammatory T cell responses resulting in tissue remodeling, malnutrition and a variety of other complications. A strict lifelong gluten-free diet is currently the only available treatment to cope with gluten intolerance. Post-proline cutting enzymes have been shown to effectively degrade the immunogenic gluten peptides and have been proposed as oral supplements. Several existing digestive enzyme supplements also claim to aid in gluten degradation. Here we investigate the effectiveness of such existing enzyme supplements in comparison with a well characterized post-proline cutting enzyme, Prolyl EndoPeptidase from Aspergillus niger (AN-PEP.Five commercially available digestive enzyme supplements along with purified digestive enzymes were subjected to 1 enzyme assays and 2 mass spectrometric identification. Gluten epitope degradation was monitored by 1 R5 ELISA, 2 mass spectrometric analysis of the degradation products and 3 T cell proliferation assays.The digestive enzyme supplements showed comparable proteolytic activities with near neutral pH optima and modest gluten detoxification properties as determined by ELISA. Mass spectrometric analysis revealed the presence of many different enzymes including amylases and a variety of different proteases with aminopeptidase and carboxypeptidase activity. The enzyme supplements leave the nine immunogenic epitopes of the 26-mer and 33-mer gliadin fragments largely intact. In contrast, the pure enzyme AN-PEP effectively degraded all nine epitopes in the pH range of the stomach at much lower dose. T cell proliferation assays confirmed the mass spectrometric data.Currently available digestive enzyme supplements are ineffective in
Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua
2012-03-01
The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.
Ionization and fragmentation of DNA-RNA bases: a density functional theory study
International Nuclear Information System (INIS)
Sadr-Arani, Leila
2014-01-01
Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)
Woehrl, Bianca; Brouwer, Matthijs C.; Murr, Carmen; Heckenberg, Sebastiaan G.B.; Baas, Frank; Pfister, Hans W.; Zwinderman, Aeilko H.; Morgan, B. Paul; Barnum, Scott R.; van der Ende, Arie; Koedel, Uwe; van de Beek, Diederik
2011-01-01
Pneumococcal meningitis is the most common and severe form of bacterial meningitis. Fatality rates are substantial, and long-term sequelae develop in about half of survivors. Disease outcome has been related to the severity of the proinflammatory response in the subarachnoid space. The complement system, which mediates key inflammatory processes, has been implicated as a modulator of pneumococcal meningitis disease severity in animal studies. Additionally, SNPs in genes encoding complement pathway proteins have been linked to susceptibility to pneumococcal infection, although no associations with disease severity or outcome have been established. Here, we have performed a robust prospective nationwide genetic association study in patients with bacterial meningitis and found that a common nonsynonymous complement component 5 (C5) SNP (rs17611) is associated with unfavorable disease outcome. C5 fragment levels in cerebrospinal fluid (CSF) of patients with bacterial meningitis correlated with several clinical indicators of poor prognosis. Consistent with these human data, C5a receptor–deficient mice with pneumococcal meningitis had lower CSF wbc counts and decreased brain damage compared with WT mice. Adjuvant treatment with C5-specific monoclonal antibodies prevented death in all mice with pneumococcal meningitis. Thus, our results suggest C5-specific monoclonal antibodies could be a promising new antiinflammatory adjuvant therapy for pneumococcal meningitis. PMID:21926466
Fragmentation, labeling and biodistribution studies of KS1/4, a monoclonal antibody
International Nuclear Information System (INIS)
Mohd, S.B.
1987-01-01
In this study, an IgG2a (KS1/4), a monoclonal antibody (MoAb) specific against a human lung adenocarcinoma (UCLA P-3) was successfully fragmented enzymatically to yield F(ab') 2 and Fab by using pepsin and papain, respectively. The kinetic of fragmentation of the MoAb was compared to that of human immunoglobulin G (IgG). A similar pattern of fragmentation was observed with both antibodies with a higher percentage yield of the F(ab') 2 and Fab obtained upon the fragmentation of the IgG by the enzymes. The KS1/4 and the two fragments were labeled with three different radionuclides, namely iodine-131, indium-111 and selenium-75. The radioiodination of the MoAb and the fragments was carried out by using a modified chloramine-T method. Radiometal labeling of the MoAb and the fragments with indium-111 was performed by using DTPA as a bifunctional chelating agent, while intrinsic labeling of the MoAb was done by culturing the hybridoma in the presence of 75 Se-methionine. The biodistribution of the radiolabeled MoAb, F(ab') 2 and Fab fragments were performed by injecting the preparations intravenously into nude mice bearing human lung adenocarcinoma
High-throughput selection for cellulase catalysts using chemical complementation.
Peralta-Yahya, Pamela; Carter, Brian T; Lin, Hening; Tao, Haiyan; Cornish, Virginia W
2008-12-24
Efficient enzymatic hydrolysis of lignocellulosic material remains one of the major bottlenecks to cost-effective conversion of biomass to ethanol. Improvement of glycosylhydrolases, however, is limited by existing medium-throughput screening technologies. Here, we report the first high-throughput selection for cellulase catalysts. This selection was developed by adapting chemical complementation to provide a growth assay for bond cleavage reactions. First, a URA3 counter selection was adapted to link chemical dimerizer activated gene transcription to cell death. Next, the URA3 counter selection was shown to detect cellulase activity based on cleavage of a tetrasaccharide chemical dimerizer substrate and decrease in expression of the toxic URA3 reporter. Finally, the utility of the cellulase selection was assessed by isolating cellulases with improved activity from a cellulase library created by family DNA shuffling. This application provides further evidence that chemical complementation can be readily adapted to detect different enzymatic activities for important chemical transformations for which no natural selection exists. Because of the large number of enzyme variants that selections can now test as compared to existing medium-throughput screens for cellulases, this assay has the potential to impact the discovery of improved cellulases and other glycosylhydrolases for biomass conversion from libraries of cellulases created by mutagenesis or obtained from natural biodiversity.
Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin
2014-01-01
The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.
International Nuclear Information System (INIS)
Fritz, E.
1994-06-01
In this Ph.D.-thesis, phenotypic complementation of AT-cells (AT5BIVA) by transfection of cDNA-expression-libraries was adressed: After stable transfection of cDNA-expression-libraries G418 resistant clones were selected for enhanced radioresistance by a fractionated X-ray selection. One surviving transfectant clone (clone 514) exhibited enhanced radiation resistance in dose-response experiments and further X-ray selections. Cell cycle analysis revealed complementation of untreated and irradiated 514-cells in cell cycle progression. The rate of DNA synthesis, however, is not diminished after irradiation but shows the reverse effect. A transfected cDNA-fragment (AT500-cDNA) was isolated from the genomic DNA of 514-cells and proved to be an unknown DNA sequence. A homologous sequence could be detected in genomic DNA from human cell lines, but not in DNA from other species. The cDNA-sequence could be localized to human chromosome 11. In human cells the cDNA sequence is part of two large mRNAs. 4 different cosmid clones containing high molecular genomic DNA from normal human cells could be isolated from a library, each hybridizing to the AT500-cDNA. After stable transfection into AT-cells, one cosmid-clone was able to confer enhanced radiation resistance both in X-ray selections and dose-response experiments. The results indicate that the cloned cDNA-fragment is based on an unknown gene from human chromosome 11 which partially complements the radiosensitivity and the defective cell cycle progression in AT5BIVA cells. (orig.) [de
Persistence of bacterial proteolytic enzymes in lake ecosystems.
Kiersztyn, Bartosz; Siuda, Waldemar; Chróst, Ryszard J
2012-04-01
This study analyzes proteolytic enzyme persistence and the role of dead (or metabolically inactive) aquatic bacteria in organic matter cycling. Samples from four lakes of different trophic status were used. Irrespective of the trophic status of the examined lakes, bacterial aminopeptidases remained active even 72 h after the death of the bacteria that produced them. The total pool of proteolytic enzymes in natural lake water samples was also stable. We found that the rates of amino acid enzymatic release from proteinaceous matter added to preserved lake water sample were constant for at least 96 h (r(2) = 0.99, n = 17, P ≤ 0.0001, V(max) = 84.6 nM h(-1) ). We also observed that proteases built into bacterial cell debris fragments remained active for a long time, even after the total destruction of cells. Moreover, during 24 h of incubation time, about 20% of these enzymatically active fragments adsorbed onto natural seston particles, becoming a part of the 'attached enzymes system' that is regarded as the 'hot-spot' of protein degradation in aquatic ecosystems. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hany Ibrahim Kenawy
2015-05-01
Full Text Available The complement system is a major constituent of the innate immune system. It not only bridges innate and adaptive arms of the immune system but also links the immune system with the coagulation system. Current understanding of the role of complement has extended far beyond fighting of infections, and now encompasses maintenance of homeostasis, tissue regeneration and pathophysiology of multiple diseases. It has been known for many years that complement activation is strongly pH sensitive, but only relatively recently has the physiological significance of this been appreciated. Most complement assays are carried out at the physiological pH 7.4. However, pH in some extracellular compartments, for example renal tubular fluid in parts of the tubule, and extracellular fluid at inflammation loci, is sufficiently acidic to activate complement. The exact molecular mechanism of this activation is still unclear, but possible cross talk between the contact system and complement may exist at low pH with subsequent complement activation. The current article reviews the published data on the effect of pH on the contact system and complement activity, the nature of the pH sensor molecules, and the clinical implications of these effects. Of particular interest is chronic kidney disease (CKD accompanied by metabolic acidosis, in which therapeutic alkalinisation of urine has been shown significantly to reduce tubular complement activation products, an effect which may have important implications for slowing progression of CKD.
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
Directory of Open Access Journals (Sweden)
Reza Rezvani
2014-01-01
Full Text Available Objective. Obesity is associated with metabolic dysfunction with sex differences and chronic, low-grade inflammation. We proposed that hepatic expression of immune complement C3 related receptors (C3aR, C5aR, and C5L2 would be associated with pre- or postmenopausal status and metabolic profile in severely obese women. We hypothesized that C5L2/C5aR ratio, potentially influencing the ASP/C5L2 metabolic versus C5a/C5aR immune response, would predict metabolic profiles after weight loss surgery. Materials and Methods. Fasting plasma (hormone, lipid, and enzyme analysis and liver biopsies (RT-PCR gene expression were obtained from 91 women during surgery. Results. Hepatic C5L2 mRNA expression was elevated in pre- versus postmenopausal women (P<0.01 and correlated positively with circulating estradiol, estrone, ApoB, ApoA1, ApoA1/B, waist circumference, age, and LDL-C (all P<0.05. While plasma ASP was lower in pre- versus postmenopausal women (P<0.01, the hepatic C5L2/C5aR mRNA ratio was increased (P<0.001 and correlated positively with estrone (P<0.01 and estradiol (P<0.001 and negatively with circulating ApoB and liver enzymes ALT, AST, and GGT (all P<0.05. Over 12 months postoperatively, liver enzymes in low C5L2/C5aR mRNA ratio group remained higher (ALP and ALT, P<0.05, AST and GGT, P<0.001 2-way-ANOVA. Conclusion. C5L2-C5aR association with other mediators including estrogens may contribute to hepatic metabolic and inflammatory function.
Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats
DEFF Research Database (Denmark)
Kastern, W.; Dyrberg, T.; Scholler, J.
1984-01-01
DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
In vivo and in vitro olefin cyclopropanation catalyzed by heme enzymes
Coelho, Pedro S; Brustad, Eric M; Arnold, Frances H; Wang, Zhan; Lewis, Jared C
2015-03-31
The present invention provides methods for catalyzing the conversion of an olefin to any compound containing one or more cyclopropane functional groups using heme enzymes. In certain aspects, the present invention provides a method for producing a cyclopropanation product comprising providing an olefinic substrate, a diazo reagent, and a heme enzyme; and admixing the components in a reaction for a time sufficient to produce a cyclopropanation product. In other aspects, the present invention provides heme enzymes including variants and fragments thereof that are capable of carrying out in vivo and in vitro olefin cyclopropanation reactions. Expression vectors and host cells expressing the heme enzymes are also provided by the present invention.
GLUCOCORTICOSTEROIDS' EFFECT UPON THE COMPLEMENT LEVEL
Directory of Open Access Journals (Sweden)
Voja Pavlovic
2001-03-01
Full Text Available The effect of high doses of cortisol upon the level of the overall complements'hemolytic activity and particular complements' components is studies. The experimentsinvolved guinea pigs of male sex of the body mass from 300 to 400 g, namelythose that have not been treated by anything so far. The doses of hydrocortisone(Hemofarm DD were also used for the experiment. The overall complements'activity was determined by testing the capabilities of a series of various solutions ofthe guinea pigs' serum to separate sheep erythrocytes that were made sensitive byrabbit anti-erythrocyte antibodies. The determination of the C1, C2, C3 and C4complements' components was done by the method of the quantitative diffusion ofthe radial type by using the Partigen blocks Behringwerke AG. The series comprised25 guinea pigs of male sex. The low cortisol level rapidly increase the overallhemolytic activity of the complements of the C1 est erase concentration. Along withthe cortisol dose increase the overall hemolytic complements' activity is dropping aswell as that of the C1, C2, C3 and C4 complements' components.
A new fission-fragment detector to complement the CACTUS-SiRi setup at the Oslo Cyclotron Laboratory
Energy Technology Data Exchange (ETDEWEB)
Tornyi, T.G., E-mail: tornyitom@atomki.hu [Department of Physics, University of Oslo (Norway); Institute of Nuclear Research of the Hungarian Academy of Sciences (MTA Atomki), Debrecen (Hungary); Görgen, A.; Guttormsen, M.; Larsen, A.C.; Siem, S. [Department of Physics, University of Oslo (Norway); Krasznahorkay, A. [Institute of Nuclear Research of the Hungarian Academy of Sciences (MTA Atomki), Debrecen (Hungary); Csige, L. [Institute of Nuclear Research of the Hungarian Academy of Sciences (MTA Atomki), Debrecen (Hungary); Max-Planck-Institute for Quantum Optics, D-85748 Garching (Germany)
2014-02-21
An array of Parallel Plate Avalanche Counters (PPAC) for the detection of heavy ions has been developed. The new device, NIFF (Nuclear Instrument for Fission Fragments), consists of four individual detectors and covers 60% of 2π. It was designed to be used in conjunction with the SiRi array of ΔE−E silicon telescopes for light charged particles and fits into the CACTUS array of 28 large-volume NaI scintillation detectors at the Oslo Cyclotron Laboratory. The low-pressure gas-filled PPACs are sensitive for the detection of fission fragments, but are insensitive to scattered beam particles of light ions or light-ion ejectiles. The PPAC detectors of NIFF have good time resolution and can be used either to select or to veto fission events in in-beam experiments with light-ion beams and actinide targets. The powerful combination of SiRi, CACTUS, and NIFF provides new research opportunities for the study of nuclear structure and nuclear reactions in the actinide region. The new setup is particularly well suited to study the competition of fission and γ decay as a function of excitation energy.
A Bioinorganic Approach to Fragment-Based Drug Discovery Targeting Metalloenzymes.
Cohen, Seth M
2017-08-15
Metal-dependent enzymes (i.e., metalloenzymes) make up a large fraction of all enzymes and are critically important in a wide range of biological processes, including DNA modification, protein homeostasis, antibiotic resistance, and many others. Consequently, metalloenzymes represent a vast and largely untapped space for drug development. The discovery of effective therapeutics that target metalloenzymes lies squarely at the interface of bioinorganic and medicinal chemistry and requires expertise, methods, and strategies from both fields to mount an effective campaign. In this Account, our research program that brings together the principles and methods of bioinorganic and medicinal chemistry are described, in an effort to bridge the gap between these fields and address an important class of medicinal targets. Fragment-based drug discovery (FBDD) is an important drug discovery approach that is particularly well suited for metalloenzyme inhibitor development. FBDD uses relatively small but diverse chemical structures that allow for the assembly of privileged molecular collections that focus on a specific feature of the target enzyme. For metalloenzyme inhibition, the specific feature is rather obvious, namely, a metal-dependent active site. Surprisingly, prior to our work, the exploration of diverse molecular fragments for binding the metal active sites of metalloenzymes was largely unexplored. By assembling a modest library of metal-binding pharmacophores (MBPs), we have been able to find lead hits for many metalloenzymes and, from these hits, develop inhibitors that act via novel mechanisms of action. A specific case study on the use of this strategy to identify a first-in-class inhibitor of zinc-dependent Rpn11 (a component of the proteasome) is highlighted. The application of FBDD for the development of metalloenzyme inhibitors has raised several other compelling questions, such as how the metalloenzyme active site influences the coordination chemistry of bound
Directory of Open Access Journals (Sweden)
Teresia Hallström
Full Text Available Pathogenicity of many microbes relies on their capacity to resist innate immunity, and to survive and persist in an immunocompetent human host microbes have developed highly efficient and sophisticated complement evasion strategies. Here we show that different human pathogens including Gram-negative and Gram-positive bacteria, as well as the fungal pathogen Candida albicans, acquire the human terminal complement regulator vitronectin to their surface. By using truncated vitronectin fragments we found that all analyzed microbial pathogens (n = 13 bound human vitronectin via the same C-terminal heparin-binding domain (amino acids 352-374. This specific interaction leaves the terminal complement complex (TCC regulatory region of vitronectin accessible, allowing inhibition of C5b-7 membrane insertion and C9 polymerization. Vitronectin complexed with the various microbes and corresponding proteins was thus functionally active and inhibited complement-mediated C5b-9 deposition. Taken together, diverse microbial pathogens expressing different structurally unrelated vitronectin-binding molecules interact with host vitronectin via the same conserved region to allow versatile control of the host innate immune response.
Comparison of complement fixation and ELISA for diagnosis of foot-and-mouth disease
International Nuclear Information System (INIS)
Caballero, P.H.; Gonzalez, S.; Orue, P.M.; Vergara, N.N.
1998-01-01
Foot-and-mouth disease (FMD) virus is characterised by its rapid transmission and its great antigenic variability which require a requires a rapid and accurate diagnosis in the laboratory, in order to initiate an immediate response for control. From these studies it is clear that Enzyme linked immunosorbent assay (ELISA) has the advantage over the Complement fixation test (CFT) of being a test of high sensitivity and specificity. Therefore, this technique is now used in our laboratory for diagnosis to detect FMD virus (O-A-C) in epithelia from animals affected by the disease. (author)
Fujita, Mitsugu; Ohnishi, Katsunori; Takaoka, Shinsaku; Ogasawara, Kazuya; Fukuyama, Ryo; Nakamuta, Hiromichi
2011-01-01
To determine whether the antihypertensive effect of nattokinase is associated with the protease activity of this enzyme, we compared nattokinase with the fragments derived from nattokinase, which possessed no protease activity, in terms of the effect on hypertension in spontaneously hypertensive rats (SHR). In the continuous oral administration test, the groups were given a basic diet alone (control), the basic diet containing nattokinase (0.2, 2.6 mg/g diet) or the basic diet containing the fragments derived from nattokinase (0.2, 0.6 mg/g diet). The group fed the basic diet containing high-dosage nattokinase (2.6 mg/g diet) showed significant reductions in systolic blood pressure (SBP), diastolic blood pressure (DBP) and plasma fibrinogen level, compared with control group and no influence on activities of renin and angiotensin-converting enzyme (ACE, EC 3.4.15.1), and plasma angiotensin II level in the renin-angiotensin system. The treatment of the basic diet containing high-dosage fragments (0.6 mg/g diet) significantly decreased SBP, DBP and plasma angiotensin II level in plasma but the treatment did not influence on plasma fibrinogen level. These results suggest that nattokinase and its fragments are different from each other in the mechanism to reduce hypertension. Nattokinase, retained its protease activity after absorbance across the intestines, may decrease blood pressure through cleavage of fibrinogen in plasma. The fragments, which absorbed as nattokinase-degradation products, prevents the elevation of plasma angiotensin II level to suppress hypertension.
Complement activation by Pseudomonas aeruginosa biofilms
DEFF Research Database (Denmark)
Jensen, E T; Kharazmi, A; Garred, P
1993-01-01
In chronic infections, such as the bronchopulmonary Pseudomonas aeruginosa infection in cystic fibrosis (CF) patients, bacteria persist despite an intact host immune defense and frequent antibiotic treatment. An important reason for the persistence of the bacteria is their capacity for the biofilm...... mode of growth. In this study we investigated the role of biofilms in activation of complement, a major contributor to the inflammatory process. Complement activation by P. aeruginosa was examined in a complement consumption assay, production of C3 and factor B conversion products assessed by crossed...... immuno-electrophoresis, C5a generation tested by a PMN chemotactic assay, and terminal complement complex formation measured by ELISA. Two of the four assays showed that P. aeruginosa grown in biofilm activated complement less than planktonic bacteria, and all assays showed that activation by intact...
Material properties in complement activation
DEFF Research Database (Denmark)
Moghimi, S. Moein; Andersen, Alina Joukainen; Ahmadvand, Davoud
2011-01-01
activation differently and through different sensing molecules and initiation pathways. The importance of material properties in triggering complement is considered and mechanistic aspects discussed. Mechanistic understanding of complement events could provide rational approaches for improved material design...
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Directory of Open Access Journals (Sweden)
Julia A Sharp
Full Text Available The complement system has been increasingly recognized to play a pivotal role in a variety of inflammatory and autoimmune diseases. Consequently, therapeutic modulators of the classical, lectin and alternative pathways of the complement system are currently in pre-clinical and clinical development. Our laboratory has identified a peptide that specifically inhibits the classical and lectin pathways of complement and is referred to as Peptide Inhibitor of Complement C1 (PIC1. In this study, we determined that the lead PIC1 variant demonstrates a salt-dependent binding to C1q, the initiator molecule of the classical pathway. Additionally, this peptide bound to the lectin pathway initiator molecule MBL as well as the ficolins H, M and L, suggesting a common mechanism of PIC1 inhibitory activity occurs via binding to the collagen-like tails of these collectin molecules. We further analyzed the effect of arginine and glutamic acid residue substitution on the complement inhibitory activity of our lead derivative in a hemolytic assay and found that the original sequence demonstrated superior inhibitory activity. To improve upon the solubility of the lead derivative, a pegylated, water soluble variant was developed, structurally characterized and demonstrated to inhibit complement activation in mouse plasma, as well as rat, non-human primate and human serum in vitro. After intravenous injection in rats, the pegylated derivative inhibited complement activation in the blood by 90% after 30 seconds, demonstrating extremely rapid function. Additionally, no adverse toxicological effects were observed in limited testing. Together these results show that PIC1 rapidly inhibits classical complement activation in vitro and in vivo and is functional for a variety of animal species, suggesting its utility in animal models of classical complement-mediated diseases.
Pathogens' toolbox to manipulate human complement.
Fernández, Francisco J; Gómez, Sara; Vega, M Cristina
2017-12-14
The surveillance and pathogen fighting functions of the complement system have evolved to protect mammals from life-threatening infections. In turn, pathogens have developed complex molecular mechanisms to subvert, divert and evade the effector functions of the complement. The study of complement immunoevasion by pathogens sheds light on their infection drivers, knowledge that is essential to implement therapies. At the same time, complement evasion also acts as a discovery ground that reveals important aspects of how complement works under physiological conditions. In recent years, complex interrelationships between infection insults and the onset of autoimmune and complement dysregulation diseases have led to propose that encounters with pathogens can act as triggering factors for disease. The correct management of these diseases involves the recognition of their triggering factors and the development and administration of complement-associated molecular therapies. Even more recently, unsuspected proteins from pathogens have been shown to possess moonlighting functions as virulence factors, raising the possibility that behind the first line of virulence factors there be many more pathogen proteins playing secondary, helping and supporting roles for the pathogen to successfully establish infections. In an era where antibiotics have a progressively reduced effect on the management and control of infectious diseases worldwide, knowledge on the mechanisms of pathogenic invasion and evasion look more necessary and pressing than ever. Copyright © 2017 Elsevier Ltd. All rights reserved.
Complement System Part II: Role in Immunity
Merle, Nicolas S.; Noe, Remi; Halbwachs-Mecarelli, Lise; Fremeaux-Bacchi, Veronique; Roumenina, Lubka T.
2015-01-01
The complement system has been considered for a long time as a simple lytic cascade, aimed to kill bacteria infecting the host organism. Nowadays, this vision has changed and it is well accepted that complement is a complex innate immune surveillance system, playing a key role in host homeostasis, inflammation, and in the defense against pathogens. This review discusses recent advances in the understanding of the role of complement in physiology and pathology. It starts with a description of complement contribution to the normal physiology (homeostasis) of a healthy organism, including the silent clearance of apoptotic cells and maintenance of cell survival. In pathology, complement can be a friend or a foe. It acts as a friend in the defense against pathogens, by inducing opsonization and a direct killing by C5b–9 membrane attack complex and by triggering inflammatory responses with the anaphylatoxins C3a and C5a. Opsonization plays also a major role in the mounting of an adaptive immune response, involving antigen presenting cells, T-, and B-lymphocytes. Nevertheless, it can be also an enemy, when pathogens hijack complement regulators to protect themselves from the immune system. Inadequate complement activation becomes a disease cause, as in atypical hemolytic uremic syndrome, C3 glomerulopathies, and systemic lupus erythematosus. Age-related macular degeneration and cancer will be described as examples showing that complement contributes to a large variety of conditions, far exceeding the classical examples of diseases associated with complement deficiencies. Finally, we discuss complement as a therapeutic target. PMID:26074922
A High-throughput Selection for Cellulase Catalysts Using Chemical Complementation
Peralta-Yahya, Pamela; Carter, Brian T.; Lin, Hening; Tao, Haiyan; Cornish, Virginia W.
2010-01-01
Efficient enzymatic hydrolysis of lignocellulosic material remains one of the major bottlenecks to cost-effective conversion of biomass to ethanol. Improvement of glycosylhydrolases however is limited by existing medium-throughput screening technologies. Here, we report the first high-throughput selection for cellulase catalysts. This selection was developed by adapting chemical complementation to provide a growth assay for bond cleavage reactions. First, a URA3 counter selection was adapted to link chemical dimerizer activated gene transcription to cell death. Next, the URA3 counter selection was shown to detect cellulase activity based on cleavage of a tetrasaccharide chemical dimerizer substrate and decrease in expression of the toxic URA3 reporter. Finally, the utility of the cellulase selection was assessed by isolating cellulases with improved activity from a cellulase library created by family DNA shuffling. This application provides further evidence that chemical complementation can be readily adapted to detect different enzymatic activities for important chemical transformations for which no natural selection exists. Due to the large number of enzyme variants selections can test compared to existing medium-throughput screens for cellulases, this assay has the potential to impact the discovery of improved cellulases and other glycosylhydrolases for biomass conversion from libraries of cellulases created by mutagenesis or obtained from natural biodiversity. PMID:19053460
Current perspectives in fragment-based lead discovery (FBLD)
Lamoree, Bas; Hubbard, Roderick E.
2017-01-01
It is over 20 years since the first fragment-based discovery projects were disclosed. The methods are now mature for most ‘conventional’ targets in drug discovery such as enzymes (kinases and proteases) but there has also been growing success on more challenging targets, such as disruption of protein–protein interactions. The main application is to identify tractable chemical startpoints that non-covalently modulate the activity of a biological molecule. In this essay, we overview current practice in the methods and discuss how they have had an impact in lead discovery – generating a large number of fragment-derived compounds that are in clinical trials and two medicines treating patients. In addition, we discuss some of the more recent applications of the methods in chemical biology – providing chemical tools to investigate biological molecules, mechanisms and systems. PMID:29118093
Targeting lysine specific demethylase 4A (KDM4A) tandem TUDOR domain - A fragment based approach.
Upadhyay, Anup K; Judge, Russell A; Li, Leiming; Pithawalla, Ron; Simanis, Justin; Bodelle, Pierre M; Marin, Violeta L; Henry, Rodger F; Petros, Andrew M; Sun, Chaohong
2018-06-01
The tandem TUDOR domains present in the non-catalytic C-terminal half of the KDM4A, 4B and 4C enzymes play important roles in regulating their chromatin localizations and substrate specificities. They achieve this regulatory role by binding to different tri-methylated lysine residues on histone H3 (H3-K4me3, H3-K23me3) and histone H4 (H4-K20me3) depending upon the specific chromatin environment. In this work, we have used a 2D-NMR based fragment screening approach to identify a novel fragment (1a), which binds to the KDM4A-TUDOR domain and shows modest competition with H3-K4me3 binding in biochemical as well as in vitro cell based assays. A co-crystal structure of KDM4A TUDOR domain in complex with 1a shows that the fragment binds stereo-specifically to the methyl lysine binding pocket forming a network of strong hydrogen bonds and hydrophobic interactions. We anticipate that the fragment 1a can be further developed into a novel allosteric inhibitor of the KDM4 family of enzymes through targeting their C-terminal tandem TUDOR domain. Copyright © 2018 Elsevier Ltd. All rights reserved.
PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products
Directory of Open Access Journals (Sweden)
Y. Erwanto
2011-04-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 % was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication.
International Nuclear Information System (INIS)
Amneus, H.
1976-01-01
The distribution of in vitro induced 60 Co-γ (structural heterogeneity of mouse chymotrypsin has been studied in terms of molecular weight, catalytic activity and net charge distribution. It was found that the enzyme stucture, with retained molecular weight, could partly accumulate structural changes subsequently not leading to modification of catalytic properties. Loss of petide fragments (0 < Mw (lt 6000) the enzyme showed native function but also modified as well as total loss of function. Further loss of peptide fragments results in modified function and total loss of function. These results indicate the capability of the enzyme to accumulate in vitro changes partly without a total loss of function. (author)
Increased complement C1q level marks active disease in human tuberculosis.
Directory of Open Access Journals (Sweden)
Yi Cai
Full Text Available BACKGROUND: Complement functions as an important host defense system and complement C5 and C7 have been implicated in immunopathology of tuberculosis. However, little is known about the role of other complement components in tuberculosis. METHODS: Complement gene expression in peripheral blood mononuclear cells of tuberculosis patients and controls were determined using whole genome transcriptional microarray assays. The mRNA and protein levels of three C1q components, C1qA, C1qB, and C1qC, were further validated by qRT-PCR and enzyme-linked immunosorbent assay, respectively. The percentages of C1q expression in CD14 positive cells were determined by flow cytometry. Finally, C1qC protein level was quantified in the pleural fluid of tuberculosis and non-tuberculosis pleurisy. RESULTS: C1q expression increases significantly in the peripheral blood of patients with active tuberculosis compared to healthy controls and individuals with latent TB infection. The percentage of C1q-expressing CD14 positive cells is significantly increased in active TB patients. C1q expression in the peripheral blood correlates with sputum smear positivity in tuberculosis patients and is reduced after anti-tuberculosis chemotherapy. Notably, receiver operating characteristic analysis showed that C1qC mRNA levels in peripheral blood efficiently discriminate active from latent tuberculosis infection and healthy controls. Additionally, C1qC protein level in pleural effusion shows improved power in discriminating tuberculosis from non-tuberculosis pleurisy when compared to other inflammatory markers, such as IL-6 and TNF-α. CONCLUSIONS: C1q expression correlates with active disease in human tuberculosis. C1q could be a potential diagnostic marker to discriminate active tuberculosis from latent tuberculosis infection as well as tuberculosis pleurisy from non-tuberculosis pleurisy.
DEFF Research Database (Denmark)
Baatrup, Gunnar; Petersen, Ivan; Kappelgaard, E
1984-01-01
Thirty-two of 36 serum samples from 19 SLE patients showed reduced capacity to mediate complement-dependent solubilization of immune complexes (IC). SLE patients with nephritis exerted the lowest complement-mediated solubilization capacity (CMSC) whereas sera from patients with inactive disease g...
Complement anaphylatoxins as immune regulators in cancer.
Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T
2014-08-01
The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
... Salicylates Semen Analysis Serotonin Serum Free Light Chains Sex Hormone Binding Globulin (SHBG) Shiga toxin-producing Escherichia ... and forming complexes that respond to infections, non-self tissues (transplants), dead cells ... KJ. Complement determinations in human disease. Ann Allergy Asthma Immunol . 2004; ...
Fragment Screening of Human Kynurenine Aminotransferase-II.
Jayawickrama, Gayan S; Nematollahi, Alireza; Sun, Guanchen; Church, W Bret
2018-03-01
Kynurenine aminotransferase-II (KAT-II) is a pyridoxal 5'-phosphate (PLP)-dependent enzyme that acts in the tryptophan metabolic pathway by catalyzing the transamination of kynurenine into kynurenic acid (KYNA). It is one of four isoforms in the KAT family, of which it is the primary homologue responsible for KYNA production in the mammalian brain. KAT-II is targeted for inhibition as KYNA is implicated in diseases such as schizophrenia, where it is found in elevated concentrations. Previously, many different approaches have been taken to develop KAT-II inhibitors, and herein fragment-based drug design (FBDD) approaches have been exploited to provide further lead compounds that can be designed into novel inhibitors. Surface plasmon resonance (SPR) was used to screen a fragment library containing 1000 compounds, of which 41 hits were identified. These hits were further evaluated with SPR, and 18 were selected for inhibition studies. From these hits, two fragments, F6037-0164 and F0037-7280, were pursued and determined to have an IC 50 of 524.5 (± 25.6) μM and 115.2 (± 4.5) μM, respectively. This strategy shows the viability of using FBDD in gleaning knowledge about KAT-II inhibition and generating leads for the production of KAT-II inhibitors.
Zonulin as prehaptoglobin2 regulates lung permeability and activates the complement system.
Rittirsch, Daniel; Flierl, Michael A; Nadeau, Brian A; Day, Danielle E; Huber-Lang, Markus S; Grailer, Jamison J; Zetoune, Firas S; Andjelkovic, Anuska V; Fasano, Alessio; Ward, Peter A
2013-06-15
Zonulin is a protein involved in the regulation of tight junctions (TJ) in epithelial or endothelial cells. Zonulin is known to affect TJ in gut epithelial cells, but little is known about its influences in other organs. Prehaptoglobin2 has been identified as zonulin and is related to serine proteases (MASPs, C1qrs) that activate the complement system. The current study focused on the role of zonulin in development of acute lung injury (ALI) in C57BL/6 male mice following intrapulmonary deposition of IgG immune complexes. A zonulin antagonist (AT-1001) and a related peptide with permeability agonist activities (AT-1002) were employed and given intratracheally or intravenously. Also, zonulin was blocked in lung with a neutralizing antibody. In a dose-dependent manner, AT-1001 or zonulin neutralizing antibody attenuated the intensity of ALI (as quantitated by albumin leak, neutrophil accumulation, and proinflammatory cytokines). A similar pattern was found using the bacterial lipopolysaccharide model of ALI. Using confocal microscopy on sections of injured lungs, staining patterns for TJ proteins were discontinuous, reduced, and fragmented. As expected, the leak of blood products into the alveolar space confirmed the passage of 3 and 20 kDa dextran, and albumin. In contrast to AT-1001, application of the zonulin agonist AT-1002 intensified ALI. Zonulin both in vitro and in vivo induced generation of complement C3a and C5a. Collectively, these data suggest that zonulin facilitates development of ALI both by enhancing albumin leak and complement activation as well as increased buildup of neutrophils and cytokines during development of ALI.
Restricted fragmentation of poliovirus type 1, 2, and 3 RNAs by ribonuclease III
Energy Technology Data Exchange (ETDEWEB)
Nomoto, A. (State Univ. of New York, Stony Brook); Lee, Y.F.; Babich, A.; Jacobson, A.; Dunn, J.J.; Wimmer, E.
1979-01-01
Cleavage of the genome RNAs of poliovirus type 1, 2, and 3 with the ribonuclease III of Escherichia coli has been investigated with the following results: (1) at or above physiological salt concentration, the RNAs are completely resistant to the action of the enzyme, an observation suggesting that the RNAs lack primary cleavage sites; (2) lowering the salt concentration to 0.1 M or below allows RNase III to cleave the RNAs at secondary sites. Both large and small fragments can be obtained in a reproducible manner depending on salt conditions chosen for cleavage. Fingerprints of three large fragments of poliovirus type 2 RNA show that they originate from unique segments and represent most if not all sequences of the genome. Based upon binding to poly(U) filters of poly(A)-linked fragments, a physical map of the large fragments of poliovirus type 2 RNA was constructed. The data suggest that RNase III cleavage of single-stranded RNA provides a useful method to fragment the RNA for further studies.
Directory of Open Access Journals (Sweden)
M.G. Mithra
2017-08-01
Full Text Available Two strategies leading to enzyme saving during saccharification of pretreated lignocellulo-starch biomass (LCSB was investigated which included reducing enzyme dosage by varying their levels in enzyme cocktails and enhancing the fermentable sugar yield in enzyme-reduced systems using detoxification chemicals. Time course release of reducing sugars (RS during 24–120 h was significantly higher when an enzyme cocktail containing full dose of cellulase (16 FPU/g cellulose along with half dose each of xylanase (1.5 mg protein/g hemicelluloses and Stargen (12.5 μl/g biomass was used to saccharify conventional dilute sulphuric acid (DSA pretreated biomass compared to a parallel system where only one-fourth the dose of the latter two enzymes was used. The reduction in RS content in the 120 h saccharified mash to the extent of 3–4 g/L compared to the system saccharified with full complement of the three enzymes could be overcome considerably by supplementing the system (half dose of two enzymes with detoxification chemical mix incorporating Tween 20, PEG 4000 and sodium borohydride. Microwave (MW-assisted DSA pretreated biomass on saccharification with enzyme cocktail having full dose of cellulase and half dose of Stargen along with detoxification chemicals gave significantly higher RS yield than DSA pretreated system saccharified using three enzymes. The study showed that xylanase could be eliminated during saccharification of MW-assisted DSA pretreated biomass without affecting RS yield when detoxification chemicals were also supplemented. The Saccharification Efficiency and Overall Conversion Efficiency were also high for the MW-assisted DSA pretreated biomass. Since whole slurry saccharifcation of pretreated biomass is essential to conserve fermentable sugars in LCSB saccharification, detoxification of soluble inhibitors is equally important as channelling out of insoluble lignin remaining in the residue. As one of the major factors contributing
Li, Jialiang; Todaro, Louis; Mootoo, David R
2011-11-01
We describe a synthetic strategy for the angelimicin family of anthraquinoid natural products that involves converting a central highly oxygenated decalin intermediate to the AB and A'B' subunits. Herein, we report the synthesis of the bicyclic A'B' subunit that complements our earlier route to the tricyclic AB framework. The differentiating tact in the two syntheses focused on controlling the Suárez radical fragmentation of lactol precursors by modulating the substrate's structural rigidity. A more flexible lactol gave the tricyclic AB framework, whereas a more rigid substrate led to the bicyclic A'B' precursor, presumably through divergent pathways from the radical produced in the initial fragmentation step. These results establish a versatile advanced synthetic precursor for the angelimicins, and on a more general note, illustrate strategies for applying the Suárez fragmentation to diverse and complex molecular frameworks.
Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.
Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse
2016-01-01
The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.
Virtual fragment preparation for computational fragment-based drug design.
Ludington, Jennifer L
2015-01-01
Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.
Bilbao, Aivett; Zhang, Ying; Varesio, Emmanuel; Luban, Jeremy; Strambio-De-Castillia, Caterina; Lisacek, Frédérique; Hopfgartner, Gérard
2016-01-01
Data-independent acquisition LC-MS/MS techniques complement supervised methods for peptide quantification. However, due to the wide precursor isolation windows, these techniques are prone to interference at the fragment ion level, which in turn is detrimental for accurate quantification. The “non-outlier fragment ion” (NOFI) ranking algorithm has been developed to assign low priority to fragment ions affected by interference. By using the optimal subset of high priority fragment ions these interfered fragment ions are effectively excluded from quantification. NOFI represents each fragment ion as a vector of four dimensions related to chromatographic and MS fragmentation attributes and applies multivariate outlier detection techniques. Benchmarking conducted on a well-defined quantitative dataset (i.e. the SWATH Gold Standard), indicates that NOFI on average is able to accurately quantify 11-25% more peptides than the commonly used Top-N library intensity ranking method. The sum of the area of the Top3-5 NOFIs produces similar coefficients of variation as compared to the library intensity method but with more accurate quantification results. On a biologically relevant human dendritic cell digest dataset, NOFI properly assigns low priority ranks to 85% of annotated interferences, resulting in sensitivity values between 0.92 and 0.80 against 0.76 for the Spectronaut interference detection algorithm. PMID:26412574
International Nuclear Information System (INIS)
Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.
1987-01-01
Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls
International Nuclear Information System (INIS)
Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.
1990-01-01
A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map
Yamanaka, Atsushi; Konishi, Eiji
2017-09-25
Dengue is the most important arboviral disease worldwide. We previously reported that most inhabitants of dengue-endemic countries who are naturally immune to the disease have infection-enhancing antibodies whose in vitro activity does not decrease in the presence of complement (complement-independent enhancing antibodies, or CiEAb). Here, we compared levels of CiEAb and complement-dependent neutralizing antibodies (CdNAb) in dengue-immune humans. A typical antibody dose-response pattern obtained in our assay system to measure the balance between neutralizing and enhancing antibodies showed both neutralizing and enhancing activities depending on serum dilution factor. The addition of complement to the assay system increased the activity of neutralizing antibodies at lower dilutions, indicating the presence of CdNAb. In contrast, similar dose-response curves were obtained with and without complement at higher dilutions, indicating higher levels of CiEAb than CdNAb. For experimental support for the higher CiEAb levels, a cocktail of mouse monoclonal antibodies against dengue virus type 1 was prepared. The antibody dose-response curves obtained in this assay, with or without complement, were similar to those obtained with human serum samples when a high proportion of D1-V-3H12 (an antibody exhibiting only enhancing activity and thus a model for CiEAb) was used in the cocktail. This study revealed higher-level induction of CiEAb than CdNAb in humans naturally infected with dengue viruses.
Graham, Matthew; Shin, Dong-Ho; Smith, Sylvia L
2009-07-01
We present the complete cDNA sequence of shark (Ginglymostoma cirratum) pro-C5 and its molecular characterization with a descriptive analysis of the structural elements necessary for its potential functional role as a potent mediator of inflammation (fragment C5a) and initiator molecule (fragment C5b) for the assembly of the membrane attack complex (MAC) upon activation by C5 convertase. In mammals the three complement activation cascades, the classical, alternative and lectin pathways, converge at the activation of C3, a pivotal complement protein. It is, however, the subsequent activation of the next complement component, C5, which is the focal point at which the initiation of the terminal lytic pathway takes place and involves the stepwise assembly of the MAC. The effector cytolytic function of complement occurs with the insertion of MAC into target membranes causing dough-nut like holes and cell leakage. The lytic activity of shark complement results in structurally similar holes in target membranes suggesting the assembly of a shark MAC that likely involves a functional analogue of C5. The composition of shark MAC remains unresolved and to date conclusive evidence has been lacking for shark C5. The gene has not been cloned nor has the serum protein been characterized for any elasmobranch species. This report is the first to confirm the presence of C5 homologue in the shark. GcC5 is remarkably similar to human C5 in overall structure and domain arrangement. The GcC5 cDNA measured 5160-bp with 5' and 3' UTRs of 35 bp and 79 bp, respectively. Structural analysis of the derived protein sequence predicts a molecule that is a two-chain structure which lacks a thiolester bond and contains a C5 convertase cleavage site indicating that activation will generate two peptides, akin to C5b and C5a. The putative GcC5 molecule also contains the C-terminal C345C/Netrin module that characterizes C3, C4 and C5. Multiple alignment of deduced amino acid sequences shows that GcC5
Complement anaphylatoxins as immune regulators in cancer
Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T
2014-01-01
The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediat...
Molecular basis for genetic deficiency of the second component of human complement
International Nuclear Information System (INIS)
Cole, F.S.; Whitehead, A.S.; Auerbach, H.S.; Lint, T.; Zeitz, H.J.; Kilbridge, P.; Colten, H.R.
1985-01-01
Genetic deficiency of the second component of complement (C2) is the most common complement-deficiency state among Western Europeans and is frequently associated with autoimmune diseases. To examine the molecular basis of this deficiency, the authors established cultures of blood monocytes from four families with C2-deficient members. Using a hemolytic-plaque assay, [ 35 S]methionine metabolic labeling of proteins in tissue culture and immunoprecipitation, RNA extraction and Northern blot analysis, and DNA restriction-enzyme digestion and Southern blot analysis, the authors found that C2 deficiency is not due to a major gene deletion or rearrangement but is the result of a specific and selective pretranslational regulatory defect in C2 gene expression. This leads to a lack of detectable C2 mRNA and a lack of synthesis of C2 protein. The approach used in this study should prove useful in examination of other plasma protein deficiencies, especially those in which the deficient gene is normally expressed in peripheral-blood monocytes or tissue macrophages and in which ethical considerations preclude the use of liver or other tissue for study
Complement activation and inhibition: a delicate balance
DEFF Research Database (Denmark)
Sjöberg, A P; Trouw, L A; Blom, A M
2009-01-01
proteins, pentraxins, amyloid deposits, prions and DNA, all bind the complement activator C1q, but also interact with complement inhibitors C4b-binding protein and factor H. This contrasts to the interaction between C1q and immune complexes, in which case no inhibitors bind, resulting in full complement...
conformational complexity of complement component C3
Janssen, B.J.C.
2007-01-01
The complement system is an important part of the immune system and critical for the elimination of pathogens. In mammals the complement system consists of an intricate set of about 35 soluble and cell-surface plasma proteins. Central to complement is component C3, a large protein of 1,641 residues.
Probing conformational states of glutaryl-CoA dehydrogenase by fragment screening
Energy Technology Data Exchange (ETDEWEB)
Begley, Darren W.; Davies, Douglas R.; Hartley, Robert C.; Hewitt, Stephen N.; Rychel, Amanda L.; Myler, Peter J.; Van Voorhis, Wesley C.; Staker, Bart L.; Stewart, Lance J. (Emerald)
2014-10-02
Glutaric acidemia type 1 is an inherited metabolic disorder which can cause macrocephaly, muscular rigidity, spastic paralysis and other progressive movement disorders in humans. The defects in glutaryl-CoA dehydrogenase (GCDH) associated with this disease are thought to increase holoenzyme instability and reduce cofactor binding. Here, the first structural analysis of a GCDH enzyme in the absence of the cofactor flavin adenine dinucleotide (FAD) is reported. The apo structure of GCDH from Burkholderia pseudomallei reveals a loss of secondary structure and increased disorder in the FAD-binding pocket relative to the ternary complex of the highly homologous human GCDH. After conducting a fragment-based screen, four small molecules were identified which bind to GCDH from B. pseudomallei. Complex structures were determined for these fragments, which cause backbone and side-chain perturbations to key active-site residues. Structural insights from this investigation highlight differences from apo GCDH and the utility of small-molecular fragments as chemical probes for capturing alternative conformational states of preformed protein crystals.
Harmsen, M.M.; Fijten, H.P.D.
2012-01-01
We studied the effect of different fusion domains on the functional immobilization of three llama single-domain antibody fragments (VHHs) after passive adsorption to polystyrene in enzyme-linked immunosorbent assays (ELISA). Three VHHs produced without any fusion domain were efficiently adsorbed to
Energy Technology Data Exchange (ETDEWEB)
Begley, Darren W.; Hartley, Robert C.; Davies, Douglas R.; Edwards, Thomas E.; Leonard, Jess T.; Abendroth, Jan; Burris, Courtney A.; Bhandari, Janhavi; Myler, Peter J.; Staker, Bart L.; Stewart, Lance J. (UWASH); (Emerald)
2011-09-28
As part of the Seattle Structural Genomics Center for Infectious Disease, we seek to enhance structural genomics with ligand-bound structure data which can serve as a blueprint for structure-based drug design. We have adapted fragment-based screening methods to our structural genomics pipeline to generate multiple ligand-bound structures of high priority drug targets from pathogenic organisms. In this study, we report fragment screening methods and structure determination results for 2C-methyl-D-erythritol-2,4-cyclo-diphosphate (MECP) synthase from Burkholderia pseudomallei, the gram-negative bacterium which causes melioidosis. Screening by nuclear magnetic resonance spectroscopy as well as crystal soaking followed by X-ray diffraction led to the identification of several small molecules which bind this enzyme in a critical metabolic pathway. A series of complex structures obtained with screening hits reveal distinct binding pockets and a range of small molecules which form complexes with the target. Additional soaks with these compounds further demonstrate a subset of fragments to only bind the protein when present in specific combinations. This ensemble of fragment-bound complexes illuminates several characteristics of MECP synthase, including a previously unknown binding surface external to the catalytic active site. These ligand-bound structures now serve to guide medicinal chemists and structural biologists in rational design of novel inhibitors for this enzyme.
Medicinal chemistry inspired fragment-based drug discovery.
Lanter, James; Zhang, Xuqing; Sui, Zhihua
2011-01-01
Lead generation can be a very challenging phase of the drug discovery process. The two principal methods for this stage of research are blind screening and rational design. Among the rational or semirational design approaches, fragment-based drug discovery (FBDD) has emerged as a useful tool for the generation of lead structures. It is particularly powerful as a complement to high-throughput screening approaches when the latter failed to yield viable hits for further development. Engagement of medicinal chemists early in the process can accelerate the progression of FBDD efforts by incorporating drug-friendly properties in the earliest stages of the design process. Medium-chain acyl-CoA synthetase 2b and ketohexokinase are chosen as examples to illustrate the importance of close collaboration of medicinal chemists, crystallography, and modeling. Copyright © 2011 Elsevier Inc. All rights reserved.
Production and characterization of anti-human IgG F(ab')2 antibody fragment.
Valedkarimi, Zahra; Nasiri, Hadi; Aghebati-Maleki, Leili; Abdolalizadeh, Jalal; Esparvarinha, Mojghan; Majidi, Jafar
2018-04-10
In present study an optimized protocol for the separation of antibodies into antigen-binding fragments F(ab')2 using pepsin digestion was investigated. The production of these fragments is a consequential step in the development of medical research, treatment and diagnosis. For production of polyclonal antibody rabbit received antigen in four steps. The rabbit serum at 1/128000 dilution showed high absorbance in reaction with human IgG at the designed ELISA method. Rabbit IgG was purified by Ion-Exchange Chromatography (IEC) method. Purity was assessed by SDS-PAGE method. In non-reduced condition only one band was seen in about 150 kDa MW position and in reduced form, two bands were seen in 50 and 25 kDa MW positions. Rabbit IgG was digested by pepsin enzyme. The antibody fragments solution was applied to Gel filtration column to isolate the F(ab')2. Non-reduced SDS-PAGE for determining the purity of F(ab')2 fragment resulted in one band in 100 kDa corresponds to F(ab')2 fragment and a band in 150 kDa MW position corresponds to undigested IgG antibodies. The activities of FITC conjugated F(ab')2 fragment and commercial ones were compared using flowcytometry method. The activity results implied that the FITC conjugated- anti human F(ab')2 fragment worked as efficiently as the commercial one.
2017-01-01
Purpose Inflammatory rheumatic diseases (IRD) are associated with accelerated coronary artery disease (CAD), which may result from both systemic and vascular wall inflammation. There are indications that complement may be involved in the pathogenesis of CAD in Systemic Lupus Erythematosus (SLE) and Rheumatoid Arthritis (RA). This study aimed to evaluate the associations between circulating complement and complement activation products with mononuclear cell infiltrates (MCI, surrogate marker of vascular inflammation) in the aortic media and adventitia in IRDCAD and non-IRDCAD patients undergoing coronary artery bypass grafting (CABG). Furthermore, we compared complement activation product deposition patterns in rare aorta adventitial and medial biopsies from SLE, RA and non-IRD patients. Methods We examined plasma C3 (p-C3) and terminal complement complexes (p-TCC) in 28 IRDCAD (SLE = 3; RA = 25), 52 non-IRDCAD patients, and 32 IRDNo CAD (RA = 32) from the Feiring Heart Biopsy Study. Aortic biopsies taken from the CAD only patients during CABG were previously evaluated for adventitial MCIs. The rare aortic biopsies from 3 SLE, 3 RA and 3 non-IRDCAD were assessed for the presence of C3 and C3d using immunohistochemistry. Results IRDCAD patients had higher p-TCC than non-IRDCAD or IRDNo CAD patients (prheumatic disease, and, in particular, SLE with the complement system. Exaggerated systemic and vascular complement activation may accelerate CVD, serve as a CVD biomarker, and represent a target for new therapies. PMID:28362874
Peón, Antonio; Robles, Adrián; Blanco, Beatriz; Convertino, Marino; Thompson, Paul; Hawkins, Alastair R; Caflisch, Amedeo; González-Bello, Concepción
2017-09-21
A multidisciplinary approach was used to identify and optimize a quinazolinedione-based ligand that would decrease the flexibility of the substrate-covering loop (catalytic loop) of the type II dehydroquinase from Helicobacter pylori. This enzyme, which is essential for the survival of this bacterium, is involved in the biosynthesis of aromatic amino acids. A computer-aided fragment-based protocol (ALTA) was first used to identify the aromatic fragments able to block the interface pocket that separates two neighboring enzyme subunits and is located at the active site entrance. Chemical modification of its non-aromatic moiety through an olefin cross-metathesis and Seebach's self-reproduction of chirality synthetic principle allowed the development of a quinazolinedione derivative that disables the catalytic loop plasticity, which is essential for the enzyme's catalytic cycle. Molecular dynamics simulations revealed that the ligand would force the catalytic loop into an inappropriate arrangement for catalysis by strong interactions with the catalytic tyrosine and by expelling the essential arginine out of the active site. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Inactivation of complement by Loxosceles reclusa spider venom.
Gebel, H M; Finke, J H; Elgert, K D; Cambell, B J; Barrett, J T
1979-07-01
Zymosan depletion of serum complement in guinea pigs rendered them highly resistant to lesion by Loxosceles reclusa spider venom. Guinea pigs deficient in C4 of the complement system are as sensitive to the venom as normal guinea pigs. The injection of 35 micrograms of whole recluse venom intradermally into guinea pigs lowered their complement level by 35.7%. Brown recluse spider venom in concentrations as slight as 0.02 micrograms protein/ml can totally inactivate one CH50 of guinea pig complement in vitro. Bee, scorpion, and other spider venoms had no influence on the hemolytic titer of complement. Fractionation of recluse spider venom by Sephadex G-200 filtration separated the complement-inactivating property of the venom into three major regions which could be distinguished on the basis of heat stability as well as size. None was neutralized by antivenom. Polyacrylamide gel electrophoresis of venom resolved the complement inactivators into five fractions. Complement inactivated by whole venom or the Sephadex fractions could be restored to hemolytic activity by supplements of fresh serum but not by heat-inactivated serum, pure C3, pure C5, or C3 and C5 in combination.
Francisella tularensis Confronts the Complement System
Directory of Open Access Journals (Sweden)
Susan R. Brock
2017-12-01
Full Text Available Francisella tularensis has developed a number of effective evasion strategies to counteract host immune defenses, not the least of which is its ability to interact with the complement system to its own advantage. Following exposure of the bacterium to fresh human serum, complement is activated and C3b and iC3b can be found covalently attached to the bacterial surface. However, the lipopolysaccharide and capsule of the F. tularensis cell wall prevent complement-mediated lysis and endow the bacterium with serum resistance. Opsonization of F. tularensis with C3 greatly increases its uptake by human neutrophils, dendritic cells and macrophages. Uptake occurs by an unusual looping morphology in human macrophages. Complement receptor 3 is thought to play an important role in opsonophagocytosis by human macrophages, and signaling through this receptor can antagonize Toll-like receptor 2-initiated macrophage activation. Complement C3 also determines the survival of infected human macrophages and perhaps other cell types. C3-opsonization of F. tularensis subsp. tularensis strain SCHU S4 results in greatly increased death of infected human macrophages, which requires more than complement receptor engagement and is independent of the intracellular replication by the pathogen. Given its entry into the cytosol of host cells, F. tularensis has the potential for a number of other complement-mediated interactions. Studies on the uptake C3-opsonized adenovirus have suggested the existence of a C3 sensing system that initiates cellular responses to cytosolic C3b present on invading microbes. Here we propose that C3 peptides enter the cytosol of human macrophages following phagosome escape of F. tularensis and are recognized as intruding molecular patterns that signal host cell death. With the discovery of new roles for intracellular C3, a better understanding of tularemia pathogenesis is likely to emerge.
Telomere Restriction Fragment (TRF) Analysis.
Mender, Ilgen; Shay, Jerry W
2015-11-20
While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of
Energy Technology Data Exchange (ETDEWEB)
Holmes, Amie L. [Wise Laboratory of Environmental and Genetic Toxicology, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Maine Center for Toxicology and Environmental Health, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Department of Applied Medical Science, University of Southern Maine, 96 Falmouth Street, P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Joyce, Kellie [Wise Laboratory of Environmental and Genetic Toxicology, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Maine Center for Toxicology and Environmental Health, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Xie, Hong [Wise Laboratory of Environmental and Genetic Toxicology, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Maine Center for Toxicology and Environmental Health, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Department of Applied Medical Science, University of Southern Maine, 96 Falmouth Street, P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Falank, Carolyne [Wise Laboratory of Environmental and Genetic Toxicology, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); Maine Center for Toxicology and Environmental Health, University of Southern Maine, 96 Falmouth St., P.O. Box 9300, Portland, ME 04104-9300, United States of America (United States); and others
2014-04-15
Highlights: • The role of homologous recombination repair in DU-induced toxicity was examined. • Loss of RAD51D did not affect DU-induced cytotoxicity or genotoxicity. • XRCC3 protects cell from DU-induced chromosome breaks and fusions. • XRCC3 plays a role in DU-induced chromosome fragmentation of the X chromosome. - Abstract: Depleted uranium (DU) is extensively used in both industry and military applications. The potential for civilian and military personnel exposure to DU is rising, but there are limited data on the potential health hazards of DU exposure. Previous laboratory research indicates DU is a potential carcinogen, but epidemiological studies remain inconclusive. DU is genotoxic, inducing DNA double strand breaks, chromosome damage and mutations, but the mechanisms of genotoxicity or repair pathways involved in protecting cells against DU-induced damage remain unknown. The purpose of this study was to investigate the effects of homologous recombination repair deficiency on DU-induced genotoxicity using RAD51D and XRCC3-deficient Chinese hamster ovary (CHO) cell lines. Cells deficient in XRCC3 (irs1SF) exhibited similar cytotoxicity after DU exposure compared to wild-type (AA8) and XRCC3-complemented (1SFwt8) cells, but DU induced more break-type and fusion-type lesions in XRCC3-deficient cells compared to wild-type and XRCC3-complemented cells. Surprisingly, loss of RAD51D did not affect DU-induced cytotoxicity or genotoxicity. DU induced selective X-chromosome fragmentation irrespective of RAD51D status, but loss of XRCC3 nearly eliminated fragmentation observed after DU exposure in wild-type and XRCC3-complemented cells. Thus, XRCC3, but not RAD51D, protects cells from DU-induced breaks and fusions and also plays a role in DU-induced chromosome fragmentation.
International Nuclear Information System (INIS)
Holmes, Amie L.; Joyce, Kellie; Xie, Hong; Falank, Carolyne
2014-01-01
Highlights: • The role of homologous recombination repair in DU-induced toxicity was examined. • Loss of RAD51D did not affect DU-induced cytotoxicity or genotoxicity. • XRCC3 protects cell from DU-induced chromosome breaks and fusions. • XRCC3 plays a role in DU-induced chromosome fragmentation of the X chromosome. - Abstract: Depleted uranium (DU) is extensively used in both industry and military applications. The potential for civilian and military personnel exposure to DU is rising, but there are limited data on the potential health hazards of DU exposure. Previous laboratory research indicates DU is a potential carcinogen, but epidemiological studies remain inconclusive. DU is genotoxic, inducing DNA double strand breaks, chromosome damage and mutations, but the mechanisms of genotoxicity or repair pathways involved in protecting cells against DU-induced damage remain unknown. The purpose of this study was to investigate the effects of homologous recombination repair deficiency on DU-induced genotoxicity using RAD51D and XRCC3-deficient Chinese hamster ovary (CHO) cell lines. Cells deficient in XRCC3 (irs1SF) exhibited similar cytotoxicity after DU exposure compared to wild-type (AA8) and XRCC3-complemented (1SFwt8) cells, but DU induced more break-type and fusion-type lesions in XRCC3-deficient cells compared to wild-type and XRCC3-complemented cells. Surprisingly, loss of RAD51D did not affect DU-induced cytotoxicity or genotoxicity. DU induced selective X-chromosome fragmentation irrespective of RAD51D status, but loss of XRCC3 nearly eliminated fragmentation observed after DU exposure in wild-type and XRCC3-complemented cells. Thus, XRCC3, but not RAD51D, protects cells from DU-induced breaks and fusions and also plays a role in DU-induced chromosome fragmentation
Autocrine Effects of Tumor-Derived Complement
Directory of Open Access Journals (Sweden)
Min Soon Cho
2014-03-01
Full Text Available We describe a role for the complement system in enhancing cancer growth. Cancer cells secrete complement proteins that stimulate tumor growth upon activation. Complement promotes tumor growth via a direct autocrine effect that is partially independent of tumor-infiltrating cytotoxic T cells. Activated C5aR and C3aR signal through the PI3K/AKT pathway in cancer cells, and silencing the PI3K or AKT gene in cancer cells eliminates the progrowth effects of C5aR and C3aR stimulation. In patients with ovarian or lung cancer, higher tumoral C3 or C5aR mRNA levels were associated with decreased overall survival. These data identify a role for tumor-derived complement proteins in promoting tumor growth, and they therefore have substantial clinical and therapeutic implications.
complement C3, Complement C4 and C-reactive protein
African Journals Online (AJOL)
ajl yemi
2011-12-19
Dec 19, 2011 ... (IL-6), E-selectin and P-selectin (Perlstein and Lee,. 2006). Studies have ... of cigarette smoke causes complement activation which is in turn ..... are decreased by long term smoking cessation in male smokers. Prevent. Med.
Dynamics of Pellet Fragmentation and Aggregation in Liquid-Grown Cultures of Streptomyces lividans
Directory of Open Access Journals (Sweden)
Boris Zacchetti
2018-05-01
Full Text Available Streptomycetes are extensively used for the production of valuable products, including various antibiotics and industrial enzymes. The preferred way to grow these bacteria in industrial settings is in large-scale fermenters. Growth of streptomycetes under these conditions is characterized by the formation of complex mycelial particles, called pellets. While the process of pellet formation is well characterized, little is known about their disintegration. Here, we use a qualitative and quantitative approach to show that pellet fragmentation in Streptomyces lividans is initiated when cultures enter the stationary phase, which coincides with a remarkable change in pellet architecture. Unlike young pellets, aging pellets have a less dense appearance and are characterized by the appearance of filaments protruding from their outer edges. These morphological changes are accompanied by a dramatic increase in the number of mycelial fragments in the culture broth. In the presence of fresh nutrients, these fragments are able to aggregate with other small fragments, but not with disintegrating pellets, to form new mycelial particles. Altogether, our work indicates that fragmentation might represent an escape mechanism from the environmental stress caused by nutrient scarcity, with striking similarities to the disassembly of bacterial biofilms.
Detection of titin fragments in urine in response to exercise-induced muscle damage.
Directory of Open Access Journals (Sweden)
Kazue Kanda
Full Text Available Many studies have attempted to determine the associations between blood biomarkers and exercise-induced muscle damage. However, poor correlations between the changes in biomarker levels and the magnitude of muscle symptoms have been reported. Recent advances in proteomic tools offer a strategy for the comprehensive analysis of protein expression, which can be used to identify biomarkers. Here, we used a proteomic analysis to identify urinary proteins that appear in response to a calf-raise exercise, including repetitive eccentric muscle contractions, and found that a titin (also known as connectin N-terminal fragment molecule appears in the urine after eccentric exercise. We measured the titin fragment in urine samples from nine individuals before and after eccentric exercise using a newly-established enzyme-linked immunosorbent assay and found that the titin fragment excretion rate increased 96 h after the exercise (5.1 to 77.6 pg/min, p <0.01. The changes in the titin fragment excretion rate were correlated strongly with blood markers of muscle damage and with muscle symptoms. These findings suggest that the urinary titin fragment is potentially a noninvasive biomarker of muscle damage.
Light fragment production at CERN Super Proton Synchrotron
Energy Technology Data Exchange (ETDEWEB)
Ivanov, Yu.B. [National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow (Russian Federation); Bogoliubov Laboratory of Theoretical Physics, JINR, Dubna (Russian Federation); Soldatov, A.A. [National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation)
2017-11-15
Recent data on the deuteron and {sup 3}He production in central Pb+Pb collisions at the CERN Super Proton Synchrotron (SPS) energies measured by the NA49 Collaboration are analyzed within the model of the three-fluid dynamics (3FD) complemented by the coalescence model for the light-fragment production. The simulations are performed with different equations of state - with and without deconfinement transition. It is found that scenarios with the deconfinement transition are preferable for reproduction rapidity distributions of deuterons and {sup 3}He, the corresponding results well agree with the experimental data. At the same time the calculated transverse-mass spectra at midrapidity do not agree that nicely with the experimental data. The latter apparently indicate that coalescence coefficients should be temperature and/or momentum dependent. (orig.)
Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J
2015-05-15
Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.
DEFF Research Database (Denmark)
Zimmermann-Nielsen, Erik; Iversen, Lene H; Svehag, Sven-Erik
2002-01-01
surgery. The samples were analyzed with an enzyme-linked immunosorbent assay that measured C3 activation capacity by the alternative and classic complement pathways. Cancer patients were compared according to Dukes stage, type of surgery performed, transfusion of blood, development of infection, venous....... Significant differences in C3 activation capacities were observed between cancer patients that were related to Dukes stage and in patients with and without buffy coat-depleted red cells suspended in saline, adenine, glucose, and mannitol transfusion, infectious events, and deep venous thromboembolism...
DEFF Research Database (Denmark)
Carlsson, A.S.; LaBrie, S.T.; Kinney, A.J.
2002-01-01
The fab1 mutant of Arabidopsis is partially deficient in activity of ß-ketoacyl-[acyl carrier protein] synthase II (KAS II). This defect results in increased levels of 16 : 0 fatty acid and is associated with damage and death of the mutants at low temperature. Transformation of fab1 plants with a c......DNA from Brassica napus encoding a KAS II enzyme resulted in complementation of both mutant phenotypes. The dual complementation by expression of the single gene proves that low-temperature damage is a consequence of altered membrane unsaturation. The fab1 mutation is a single nucleotide change...... chain to bend. For functional analysis the equivalent Leu207Phe mutation was introduced into the fabB gene encoding the E. coli KAS I enzyme. Compared to wild-type, the Leu207Phe protein showed a 10-fold decrease in binding affinity for the fatty acid substrate, exhibited a modified behavior during size...
Complement Attack against Aspergillus and Corresponding Evasion Mechanisms
Directory of Open Access Journals (Sweden)
Cornelia Speth
2012-01-01
Full Text Available Invasive aspergillosis shows a high mortality rate particularly in immunocompromised patients. Perpetually increasing numbers of affected patients highlight the importance of a clearer understanding of interactions between innate immunity and fungi. Innate immunity is considered to be the most significant host defence against invasive fungal infections. Complement represents a crucial part of this first line defence and comprises direct effects against invading pathogens as well as bridging functions to other parts of the immune network. However, despite the potency of complement to attack foreign pathogens, the prevalence of invasive fungal infections is increasing. Two possible reasons may explain that phenomenon: First, complement activation might be insufficient for an effective antifungal defence in risk patients (due to, e.g., low complement levels, poor recognition of fungal surface, or missing interplay with other immune elements in immunocompromised patients. On the other hand, fungi may have developed evasion strategies to avoid recognition and/or eradication by complement. In this review, we summarize the most important interactions between Aspergillus and the complement system. We describe the various ways of complement activation by Aspergillus and the antifungal effects of the system, and also show proven and probable mechanisms of Aspergillus for complement evasion.
International Nuclear Information System (INIS)
Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.
1987-01-01
The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens
Does Host Complement Kill Borrelia burgdorferi within Ticks?
Rathinavelu, Sivaprakash; Broadwater, Anne; de Silva, Aravinda M.
2003-01-01
The Lyme disease spirochete, Borrelia burgdorferi, inhabits the gut lumen of the tick vector. At this location the spirochete is exposed to host blood when a tick feeds. We report here on studies that were done with normal and complement-deficient (C3-knockout) mice to determine if the host complement system killed spirochetes within the vector. We found that spirochete numbers within feeding nymphs were not influenced by complement, most likely because host complement was inactivated within ...
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Systemic complement activation in age-related macular degeneration.
Directory of Open Access Journals (Sweden)
Hendrik P N Scholl
Full Text Available Dysregulation of the alternative pathway (AP of complement cascade has been implicated in the pathogenesis of age-related macular degeneration (AMD, the leading cause of blindness in the elderly. To further test the hypothesis that defective control of complement activation underlies AMD, parameters of complement activation in blood plasma were determined together with disease-associated genetic markers in AMD patients. Plasma concentrations of activation products C3d, Ba, C3a, C5a, SC5b-9, substrate proteins C3, C4, factor B and regulators factor H and factor D were quantified in patients (n = 112 and controls (n = 67. Subjects were analyzed for single nucleotide polymorphisms in factor H (CFH, factor B-C2 (BF-C2 and complement C3 (C3 genes which were previously found to be associated with AMD. All activation products, especially markers of chronic complement activation Ba and C3d (p<0.001, were significantly elevated in AMD patients compared to controls. Similar alterations were observed in factor D, but not in C3, C4 or factor H. Logistic regression analysis revealed better discriminative accuracy of a model that is based only on complement activation markers Ba, C3d and factor D compared to a model based on genetic markers of the complement system within our study population. In both the controls' and AMD patients' group, the protein markers of complement activation were correlated with CFH haplotypes.This study is the first to show systemic complement activation in AMD patients. This suggests that AMD is a systemic disease with local disease manifestation at the ageing macula. Furthermore, the data provide evidence for an association of systemic activation of the alternative complement pathway with genetic variants of CFH that were previously linked to AMD susceptibility.
Complement and thrombosis in the antiphospholipid syndrome.
Oku, Kenji; Nakamura, Hiroyuki; Kono, Michihiro; Ohmura, Kazumasa; Kato, Masaru; Bohgaki, Toshiyuki; Horita, Tetsuya; Yasuda, Shinsuke; Amengual, Olga; Atsumi, Tatsuya
2016-10-01
The involvement of complement activation in the pathophysiology of antiphospholipid syndrome (APS) was first reported in murine models of antiphospholipid antibody (aPL)-related pregnancy morbidities. We previously reported that complement activation is prevalent and may function as a source of procoagulant cell activation in the sera of APS patients. Recently, autoantibodies against C1q, a component of complement 1, were reported to be correlated with complement activation in systemic lupus erythematosus. These antibodies target neoepitopes of deformed C1q bound to various molecules (i.e., anionic phospholipids) and induce accelerated complement activation. We found that anti-C1q antibodies are more frequently detected in primary APS patients than in control patients and in refractory APS patients with repeated thrombotic events. The titer of anti-C1q antibodies was significantly higher in refractory APS patients than in APS patients without flare. The binding of C1q to anionic phospholipids may be associated with the surge in complement activation in patients with anti-C1q antibodies when triggered by 'second-hit' biological stressors such as infection. Such stressors will induce overexpression of anionic phospholipids, with subsequent increases in deformed C1q that is targeted by anti-C1q antibodies. Copyright © 2016. Published by Elsevier B.V.
Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.
Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh
2016-04-01
Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.
Radioassays for quantitation of intact complement proteins C2 and B in human serum
Energy Technology Data Exchange (ETDEWEB)
Oglesby, T J; Ueda, A; Volanakis, J E
1988-05-25
Availability of polyclonal and monoclonal antibodies recognizing determinants on the major cleavage fragments of complement proteins C2 and B enabled development of sensitive radioassays which can be used to quantitate the intact proteins in human sera. Changes in C2 and B concentrations indicative of classical or alternative pathway activation, or both, were seen in normal serum after incubation with complement activators. The authors determined the normal range of C2 concentration to be 11-35 ..mu..g/ml in 32 healthy individuals, and that of protein B to be 74-286 ..mu..g/ml. Sera from patients with systemic lupus erythematosus (SLE), septic shock, infections, and following orthopedic surgery were then assayed. Mean protein B concentration was significantly higher in SLE sera and in the infected and post-operative sera, and the mean C2 concentration in the septic shock group was significantly lower than the mean of healthy individuals. Intact C2 was not detected in known C2-deficient individuals. These assays allow parallel quantitation of the structurally and functionally homologous proteins of the classical (C2) and alternative (B) pathways, which is of interest in patients with genetic and acquired hypocomplementemia. 22 refs.; 3 figs.
International Nuclear Information System (INIS)
Vojtsitskij, V.M.; Fedorov, A.N.; Lugovskoj, Eh.B.; Derzskaya, S.G.; Khizhnyak, S.V.; Kurskij, M.D.; Kucherenko, N.E.
1990-01-01
Early (1 and 24 h) after X-irradiation with a dose of 0.21 C/kg changes occurred in the acceptibility of the polypeptide chain parts of sarcoplasmic reticulum Ca-ATPase for the effect of trypsin. The analysis of the results of studying the structural and functional properties of a hydrophobic fragment of this enzyme in the control and after irradiation permitted to define the part of the Ca-ATPase polypeptide chain that provided ion selectivity of the fragment
Does host complement kill Borrelia burgdorferi within ticks?
Rathinavelu, Sivaprakash; Broadwater, Anne; de Silva, Aravinda M
2003-02-01
The Lyme disease spirochete, Borrelia burgdorferi, inhabits the gut lumen of the tick vector. At this location the spirochete is exposed to host blood when a tick feeds. We report here on studies that were done with normal and complement-deficient (C3-knockout) mice to determine if the host complement system killed spirochetes within the vector. We found that spirochete numbers within feeding nymphs were not influenced by complement, most likely because host complement was inactivated within the vector. The Lyme disease outer surface protein A (OspA) vaccine is a transmission-blocking vaccine that targets spirochetes in the vector. In experiments with mice hyperimmunized with OspA, complement was not required to kill spirochetes within nymphs and to block transmission from nymphs to the vaccinated host. However, host complement did enhance the ability of OspA antibody to block larvae from acquiring spirochetes. Thus, the effects of OspA antibody on nymphal transmission and larval acquisition appear to be based on different mechanisms.
Hepatic macrophage complement receptor clearance function following injury.
Cuddy, B G; Loegering, D J; Blumenstock, F A; Shah, D M
1986-03-01
Previous work has demonstrated that in vivo hepatic macrophage complement receptor clearance function is depressed following thermal injury. The present study was carried out to determine if complement receptor function depression is associated with other states of depressed host defense. Hepatic complement receptor clearance function was determined from the hepatic uptake of rat erythrocytes coated with antierythrocyte IgM (EIgM) in rats. Receptor function was determined following cannulation of a carotid artery, laparotomy plus enterotomy, hemorrhagic shock, trauma, thermal injury, acute bacteremia, acute endotoxemia, and injection of erythrocyte stroma, gelatinized lipid emulsion, or colloidal carbon. Hepatic uptake of EIgM was depressed following each of these experimental interventions except arterial cannulation. This effect was shown not to be due to a decrease in hepatic blood flow or depletion of complement and was therefore due to a depression in hepatic macrophage complement receptor clearance function. Thus, impairment of hepatic macrophage complement receptor function is associated with several states of depressed host defense.
International Nuclear Information System (INIS)
Saxon, D.H.
1985-10-01
The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2014-10-01
Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul
2014-10-01
This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.
Viral mimicry of the complement system
Indian Academy of Sciences (India)
The complement system is a potent innate immune mechanism consisting of cascades of proteins which are designed to fight against and annul intrusion of all the foreign pathogens. Although viruses are smaller in size and have relatively simple structure, they are not immune to complement attack. Thus, activation of the ...
[Renal risks of dietary complements: a forgotten cause].
Dori, Olympia; Humbert, Antoine; Burnier, Michel; Teta, Daniel
2014-02-26
The use of dietary complements like vitamins, minerals, trace elements, proteins, aminoacids and plant-derived agents is prevalent in the general population, in order to promote health and treat diseases. Dietary complements are considered as safe natural products and are easily available without prescription. However, these can lead to severe renal toxicity, especially in cases of unknown pre-existing chronic kidney disease (CKD). In particular, Chinese herbs including aristolochic acid, high doses of vitamine C, creatine and protein complements may lead to acute and chronic renal failure, sometimes irreversible. Dietary complement toxicity should be suspected in any case of unexplained renal impairement. In the case of pre-existing CKD, the use of potentially nephrotoxic dietary complements should be screened for.
Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design
2012-01-01
The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472
Enzyme organization in the proline biosynthetic pathway of Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Gamper, H; Moses, V
1974-01-01
The conversion of glutamic acid to proline by an Escherichia coli extract was studied. The activity was dependent upon the presence of ATP and NADPH and was largely unaffected by the presence of NH/sub 3/ or imidazole. The first two pathway enzymes appear to exist as a complex which stabilizes a labile intermediate postulated as ..gamma..-glutamyl phosphate. Attempted synthesis of this compound was unsuccessful due to its spontaneous cyclization to 2-pyrrolidone 5-carboxylate. Dissociation of the enzyme complex upon dilution of the extract is presumed responsible for an experimentally observed dilution effect. E. coli pro/sub A//sup -/ and pro/sub B//sup -/ auxotroph extracts failed to complement one another in the biosynthesis of proline. This is attributed to the lack of a dynamic equilibrium between the complex and its constituent enzymes. In vivo studies with E. coli showed no evidence for metabolic channeling in the final reaction of proline synthesis, the reduction of ..delta../sup 1/-pyrroline 5-carboxylate.
Directory of Open Access Journals (Sweden)
David Sadílek
2013-10-01
Full Text Available Variation in the number of chromosomes was revealed in 61 samples of Cimex lectularius Linnaeus, 1758 from the Czech Republic and other European countries, hosted on Myotis Kaup, 1829 (4 and Homo sapiens Linnaeus, 1758 (57. The karyotype of all the specimens of C. lectularius analysed contained 26 autosomes and a varying number of the sex chromosomes. The number of sex chromosomes showed extensive variation, and up to 20 fragments were recorded. Altogether, 12 distinct karyotypes were distinguished. The male karyotypes consisted of 29, 30, 31, 32, 33, 34, 35, 36, 37, 40, 42 and 47 chromosomes. The females usually exhibited the number of chromosomes which was complementary to the number established in the males from the same sample. However, 11 polymorphic samples were revealed in which the karyotypes of females and males were not complementary each other. The complement with 2n = 26+X1X2Y was found in 44% of the specimens and 57,4% samples of bed bugs studied. The karyotypes with higher chromosome numbers as well as individuals with chromosomal mosaics were usually found within the samples exhibiting particularly extensive variation between individuals, and such complements were not found within samples contaning a few or single specimen. The occurrence of chromosomal mosaics with the karyotype constitution varying between cells of single individual was observed in five specimens (4.3% from five samples. We assume that polymorphism caused by fragmentation of the X chromosome may result in meiotic problems and non-disjunction can produce unbalanced gametes and result in lowered fitness of individuals carrying higher numbers of the X chromosome fragments. This effect should be apparently enhanced with the increasing number of the fragments and this may be the reason for the observed distribution pattern of individual karyotypes in the studied samples and the rarity of individuals with extremely high chromosome numbers. The assumed lowering of the
Shimozawa, N.; Suzuki, Y.; Zhang, Z.; Imamura, A.; Tsukamoto, T.; Osumi, T.; Tateishi, K.; Okumoto, K.; Fujiki, Y.; Orii, T.; Barth, P. G.; Wanders, R. J.; Kondo, N.
1998-01-01
Ten complementation groups of generalized peroxisome biogenesis disorders (PBD), (excluding rhizomelic chondrodysplasia punctata) have been identified using complementation analysis. Four of the genes involved have been identified using two different methods of (1) genetic functional complementation
Force Dynamics of Verb Complementation
Directory of Open Access Journals (Sweden)
Jacek Woźny
2015-12-01
Full Text Available Force Dynamics of Verb Complementation The concepts of motion and force are both extensively discussed in cognitive linguistics literature. But they are discussed separately. The first usually in the context of ‘motion situations’ (Talmy, Slobin, Zlatev, the other as part of the Force Dynamics framework, which was developed by Talmy. The aim of this paper is twofold: first, to argue that the concepts of force and motion should not be isolated but considered as two inseparable parts of force-motion events. The second goal is to prove that the modified Force Dynamics (force-motion framework can be used for precise characterization of the verb complementation patterns. To this end, a random sample of 50 sentences containing the verb ‘went’ is analyzed, demonstrating the differences between the categories of intensive and intransitive complementation with respect to the linguistically coded parameters of force and motion.
Kieslich, Chris A; Morikis, Dimitrios
2012-01-01
The interaction between complement fragment C3d and complement receptor 2 (CR2) is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of -1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic "hot-spots". Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic "hot-spots" at the two functional sites of C3d, while the surface of CR2 lacks electrostatic "hot-spots" despite its excessively positive nature. We propose that the electrostatic "hot-spots" of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2), which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3d, after the
Directory of Open Access Journals (Sweden)
Chris A Kieslich
Full Text Available The interaction between complement fragment C3d and complement receptor 2 (CR2 is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of -1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic "hot-spots". Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic "hot-spots" at the two functional sites of C3d, while the surface of CR2 lacks electrostatic "hot-spots" despite its excessively positive nature. We propose that the electrostatic "hot-spots" of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2, which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3
Coughlin, Jane M; Kundu, Rituparna; Cooper, Julian C; Ball, Zachary T
2014-11-15
A small molecule containing a rhodium(II) tetracarboxylate fragment is shown to be a potent inhibitor of the prolyl isomerase FKBP12. The use of small molecules conjugates of rhodium(II) is presented as a general strategy for developing new protein inhibitors based on distinct structural and sequence features of the enzyme active site. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ingrid Evans-Osses
2013-01-01
Full Text Available The innate immune system is evolutionary and ancient and is the pivotal line of the host defense system to protect against invading pathogens and abnormal self-derived components. Cellular and molecular components are involved in recognition and effector mechanisms for a successful innate immune response. The complement lectin pathway (CLP was discovered in 1990. These new components at the complement world are very efficient. Mannan-binding lectin (MBL and ficolin not only recognize many molecular patterns of pathogens rapidly to activate complement but also display several strategies to evade innate immunity. Many studies have shown a relation between the deficit of complement factors and susceptibility to infection. The recently discovered CLP was shown to be important in host defense against protozoan microbes. Although the recognition of pathogen-associated molecular patterns by MBL and Ficolins reveal efficient complement activations, an increase in deficiency of complement factors and diversity of parasite strategies of immune evasion demonstrate the unsuccessful effort to control the infection. In the present paper, we will discuss basic aspects of complement activation, the structure of the lectin pathway components, genetic deficiency of complement factors, and new therapeutic opportunities to target the complement system to control infection.
Complement C5a receptor antagonism by protamine and poly-L-Arg on human leukocytes.
Olsen, U B; Selmer, J; Kahl, J U
1988-01-01
It is shown that protamine selectively and dose-dependently inhibits complement C5a-induced leukocyte responses such as histamine release from basophils, chemiluminescence and beta-glucuronidase release from neutrophils. Protamine produces parallel rightward displacements of the C5a dose-response curves. The inhibitory capacity of the polypeptide is reversible and disappears following repeated washing of exposed cells. In neutrophils poly-L-Arg similarly and specifically antagonizes C5a-induced chemiluminescence and enzyme release. This polymer alone, however, degranulates basophils and neutrophils, leading to histamine and enzyme release, respectively. It is concluded that on human neutrophils the arginine-rich polycations protamine and poly-L-Arg exhibit a competitive C5a receptor antagonism. In addition, protamine inhibits the C5a receptors on basophils. It is hypothesized that molecular conformations of the arginine-rich polycations might bind reversibly to, and block negatively charged groups at the C5a-receptor sites.
Fragment-Based Discovery of Pyrimido[1,2-b]indazole PDE10A Inhibitors.
Chino, Ayaka; Seo, Ryushi; Amano, Yasushi; Namatame, Ichiji; Hamaguchi, Wataru; Honbou, Kazuya; Mihara, Takuma; Yamazaki, Mayako; Tomishima, Masaki; Masuda, Naoyuki
2018-01-01
In this study, we report the identification of potent pyrimidoindazoles as phosphodiesterase10A (PDE10A) inhibitors by using the method of fragment-based drug discovery (FBDD). The pyrazolopyridine derivative 2 was found to be a fragment hit compound which could occupy a part of the binding site of PDE10A enzyme by using the method of the X-ray co-crystal structure analysis. On the basis of the crystal structure of compound 2 and PDE10A protein, a number of compounds were synthesized and evaluated, by means of structure-activity relationship (SAR) studies, which culminated in the discovery of a novel pyrimidoindazole derivative 13 having good physicochemical properties.
Complement: Alive and Kicking Nanomedicines
DEFF Research Database (Denmark)
Andersen, Alina Joukainen; Hashemi, S.H.; Andresen, Thomas Lars
2009-01-01
Administration of liposome- and polymer-based clinical nanomedicines, as well as many other proposed multifunctional nanoparticles, often triggers hypersensitivity reactions without the involvement of IgE. These anaphylactic reactions are believed to be secondary to activation of the complement...... their procoagulant activity, and has the capacity to elicit non-lytic stimulatory responses from vascular endothelial cells. Here we discuss the molecular basis of complement activation by liposomes, including poly(ethylene glycol) coated vesicles, and other related lipid-based and phospholipid-poly(ethylene glycol...
Complement elevation in spinal cord injury.
Rebhun, J; Botvin, J
1980-05-01
Laboratory studies revealed an elevated complement in 66% of patients with spinal cord injury. It is postulated that the activated complement may be a component of self-feeding immunological mechanism responsible for the failure of regeneration of a mature mammalian spinal cord. There was no evidence that such an injury had any effect on pre-existing atopy.
Directory of Open Access Journals (Sweden)
Tharusha Jayasena
Full Text Available Alzheimer's disease (AD is a neurodegenerative disorder associated with increased oxidative stress and neuroinflammation. Markers of increased protein, lipid and nucleic acid oxidation and reduced activities of antioxidant enzymes have been reported in AD plasma. Amyloid plaques in the AD brain elicit a range of reactive inflammatory responses including complement activation and acute phase reactions, which may also be reflected in plasma. Previous studies have shown that human AD plasma may be cytotoxic to cultured cells. We investigated the effect of pooled plasma (n = 20 each from healthy controls, individuals with amnestic mild cognitive impairment (aMCI and Alzheimer's disease (AD on cultured microglial cells. AD plasma and was found to significantly decrease cell viability and increase glycolytic flux in microglia compared to plasma from healthy controls. This effect was prevented by the heat inactivation of complement. Proteomic methods and isobaric tags (iTRAQ found the expression level of complement and other acute phase proteins to be altered in MCI and AD plasma and an upregulation of key enzymes involved in the glycolysis pathway in cells exposed to AD plasma. Altered expression levels of acute phase reactants in AD plasma may alter the energy metabolism of glia.
Directory of Open Access Journals (Sweden)
Katarzyna Smykał-Jankowiak
2009-09-01
Full Text Available Complement plays an important role in the immune system. Three different pathways of complement activation are known: the classical, alternative, and lectin dependent. They involve more than 30 serum peptides. C1q is the first subcomponent of the classical pathway of complement activation. It is composed of three types of chains, A, B, and C, which form a molecule containing 18 peptides. Each of the chains has a short amino-terminal region followed by a collagen-like region (playing a role in the activation of C1r2C1s2 and a carboxy-terminal head, which binds to immune complexes. Recent studies have shown a great number of ligands for C1q, including aggregated IgG, IgM, human T-cell lymphotropic virus-I (HTLV-I, gp21 peptide, human immunodeficiency virus-1 (HIV-1 gp21 peptide, β-amyloid, fragments of bacterial walls, apoptotic cells, and many others. However, the role of C1q is not only associated with complement activation. It also helps in the removal of immune complexes and necrotic cells, stimulates the production of some cytokines, and modulates the function of lymphocytes. Complete C1q deficiency is a rare genetic disorder. The C1q gene is located on the short arm of chromosome 1. So far, only a few mutations in C1q gene have been reported. The presence of these mutations is strongly associated with recurrent bacterial infections and the development of systemic lupus erythematosus (SLE. Recent clinical studies point to the significance of anti-C1q antibodies in the diagnosis and assessment of lupus nephritis activity.
Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe
2016-05-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.
Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe
2016-01-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825
Restriction fragment length polymorphism of the major histocompatibility complex of the dog.
Sarmiento, U M; Storb, R F
1988-01-01
Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.
Directory of Open Access Journals (Sweden)
Yujia Li
2018-04-01
Full Text Available The complement system is a part of the innate immune system that viruses need to face during infections. Many viruses incorporate cellular regulators of complement activation (RCA to block complement pathways and our prior work has shown that Parainfluenza virus 5 (PIV5 incorporates CD55 and CD46 to delay complement-mediated neutralization. In this paper, we tested the role of a third individual RCA inhibitor CD59 in PIV5 interactions with complement pathways. Using a cell line engineered to express CD59, we show that small levels of functional CD59 are associated with progeny PIV5, which is capable of blocking assembly of the C5b-C9 membrane attack complex (MAC. PIV5 containing CD59 (PIV5-CD59 showed increased resistance to complement-mediated neutralization in vitro comparing to PIV5 lacking regulators. Infection of A549 cells with PIV5 and RSV upregulated CD59 expression. TGF-beta treatment of PIV5-infected cells also increased cell surface CD59 expression and progeny virions were more resistant to complement-mediated neutralization. A comparison of individual viruses containing only CD55, CD46, or CD59 showed a potency of inhibiting complement-mediated neutralization, which followed a pattern of CD55 > CD46 > CD59.
Using enzyme folding to explore the mechanism of therapeutic touch: a feasibility study.
Strickland, Mallory L; Boylan, Helen M
2010-07-01
The goal of this research is to design a novel model using protein folding to study Therapeutic Touch, a noncontact form of energy manipulation healing. Presented is a feasibility study suggesting that the denaturation path of ribonuclease A may be a useful model to study the energy exchange underlying therapeutic touch. The folding of ribonuclease A serves as a controlled energy-requiring system in which energy manipulation can be measured by the degree of folding achieved. A kinetic assay and fluorescence spectroscopy are used to assess the enzyme-folding state. The data suggest that the kinetic assay is a useful means of assessing the degree of refolding, and specifically, the enzyme function. However, fluorescence spectroscopy was not shown to be an effective measurement of enzyme structure for the purposes of this work. More research is needed to assess the underlying mechanism of therapeutic touch to complement the existing studies. An enzyme-folding model may provide a useful means of studying the energy exchange in therapeutic touch.
Homology of yeast photoreactivating gene fragment with human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1984-01-01
Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes
Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.
2018-03-01
It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.
Kupffer cell complement receptor clearance function and host defense.
Loegering, D J
1986-01-01
Kupffer cells are well known to be important for normal host defense function. The development of methods to evaluate the in vivo function of specific receptors on Kupffer cells has made it possible to assess the role of these receptors in host defense. The rationale for studying complement receptors is based on the proposed important role of these receptors in host defense and on the observation that the hereditary deficiency of a complement receptor is associated with recurrent severe bacterial infections. The studies reviewed here demonstrate that forms of injury that are associated with depressed host defense including thermal injury, hemorrhagic shock, trauma, and surgery also cause a decrease in complement receptor clearance function. This decrease in Kupffer cell receptor clearance function was shown not to be the result of depressed hepatic blood flow or depletion of complement components. Complement receptor function was also depressed following the phagocytosis of particulates that are known to depress Kupffer cell host defense function. Endotoxemia and bacteremia also were associated with a depression of complement receptor function. Complement receptor function was experimentally depressed in uninjured animals by the phagocytosis of IgG-coated erythrocytes. There was a close association between the depression of complement receptor clearance function and increased susceptibility to the lethal effects of endotoxin and bacterial infection. These studies support the hypotheses that complement receptors on Kupffer cells are important for normal host defense and that depression of the function of these receptors impairs host defense.
Complement pathways and meningococcal disease : diagnostic aspects
DEFF Research Database (Denmark)
Sjöholm, A G; Truedsson, L; Jensenius, Jens Christian
2001-01-01
Complement is an immunological effector system that bridges innate and acquired immunity in several ways. There is a striking association between susceptibility to meningococcal disease and various forms of complement deficiency (1,2). In defense against bacterial infection, the most important fu...
Universal elements of fragmentation
International Nuclear Information System (INIS)
Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.
2010-01-01
A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.
Directory of Open Access Journals (Sweden)
R Mirnejad
2011-01-01
Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.
Surviving mousepox infection requires the complement system.
Directory of Open Access Journals (Sweden)
Elizabeth A Moulton
2008-12-01
Full Text Available Poxviruses subvert the host immune response by producing immunomodulatory proteins, including a complement regulatory protein. Ectromelia virus provides a mouse model for smallpox where the virus and the host's immune response have co-evolved. Using this model, our study investigated the role of the complement system during a poxvirus infection. By multiple inoculation routes, ectromelia virus caused increased mortality by 7 to 10 days post-infection in C57BL/6 mice that lack C3, the central component of the complement cascade. In C3(-/- mice, ectromelia virus disseminated earlier to target organs and generated higher peak titers compared to the congenic controls. Also, increased hepatic inflammation and necrosis correlated with these higher tissue titers and likely contributed to the morbidity in the C3(-/- mice. In vitro, the complement system in naïve C57BL/6 mouse sera neutralized ectromelia virus, primarily through the recognition of the virion by natural antibody and activation of the classical and alternative pathways. Sera deficient in classical or alternative pathway components or antibody had reduced ability to neutralize viral particles, which likely contributed to increased viral dissemination and disease severity in vivo. The increased mortality of C4(-/- or Factor B(-/- mice also indicates that these two pathways of complement activation are required for survival. In summary, the complement system acts in the first few minutes, hours, and days to control this poxviral infection until the adaptive immune response can react, and loss of this system results in lethal infection.
Novel Evasion Mechanisms of the Classical Complement Pathway.
Garcia, Brandon L; Zwarthoff, Seline A; Rooijakkers, Suzan H M; Geisbrecht, Brian V
2016-09-15
Complement is a network of soluble and cell surface-associated proteins that gives rise to a self-amplifying, yet tightly regulated system with fundamental roles in immune surveillance and clearance. Complement becomes activated on the surface of nonself cells by one of three initiating mechanisms known as the classical, lectin, and alternative pathways. Evasion of complement function is a hallmark of invasive pathogens and hematophagous organisms. Although many complement-inhibition strategies hinge on hijacking activities of endogenous complement regulatory proteins, an increasing number of uniquely evolved evasion molecules have been discovered over the past decade. In this review, we focus on several recent investigations that revealed mechanistically distinct inhibitors of the classical pathway. Because the classical pathway is an important and specific mediator of various autoimmune and inflammatory disorders, in-depth knowledge of novel evasion mechanisms could direct future development of therapeutic anti-inflammatory molecules. Copyright © 2016 by The American Association of Immunologists, Inc.
Bahia El Idrissi, Nawal; Das, Pranab K; Fluiter, Kees; Rosa, Patricia S; Vreijling, Jeroen; Troost, Dirk; Morgan, B Paul; Baas, Frank; Ramaglia, Valeria
2015-05-01
Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is unclear. We previously identified the membrane attack complex (MAC) of the complement system as a key determinant of post-traumatic nerve damage and demonstrated that its inhibition is neuroprotective. Here, we determined the contribution of the MAC to nerve damage caused by Mycobacterium leprae and its components in mouse. Furthermore, we studied the association between MAC and the key M. leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients. Intraneural injections of M. leprae sonicate induced MAC deposition and pathological changes in the mouse nerve, whereas MAC inhibition preserved myelin and axons. Complement activation occurred mainly via the lectin pathway and the principal activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity was robust and significantly higher in multibacillary compared to paucibacillary donors (p = 0.01 and p = 0.001, respectively), with a highly significant association between LAM and MAC in the diseased samples (r = 0.9601, p = 0.0001). Further, MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in complement activation and nerve damage in leprosy. Our findings demonstrate that MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and its inhibition is neuroprotective. In addition, our data identified LAM as the key pathogen associated molecule that activates complement and causes nerve damage. Taken together our data imply an important role of complement in nerve damage in leprosy and may inform the development of novel therapeutics for patients.
Directory of Open Access Journals (Sweden)
Michal Potempa
2009-02-01
Full Text Available Periodontitis is an inflammatory disease of the supporting structures of the teeth caused by, among other pathogens, Prevotella intermedia. Many strains of P. intermedia are resistant to killing by the human complement system, which is present at up to 70% of serum concentration in gingival crevicular fluid. Incubation of human serum with recombinant cysteine protease of P. intermedia (interpain A resulted in a drastic decrease in bactericidal activity of the serum. Furthermore, a clinical strain 59 expressing interpain A was more serum-resistant than another clinical strain 57, which did not express interpain A, as determined by Western blotting. Moreover, in the presence of the cysteine protease inhibitor E64, the killing of strain 59 by human serum was enhanced. Importantly, we found that the majority of P. intermedia strains isolated from chronic and aggressive periodontitis carry and express the interpain A gene. The protective effect of interpain A against serum bactericidal activity was found to be attributable to its ability to inhibit all three complement pathways through the efficient degradation of the alpha-chain of C3 -- the major complement factor common to all three pathways. P. intermedia has been known to co-aggregate with P. gingivalis, which produce gingipains to efficiently degrade complement factors. Here, interpain A was found to have a synergistic effect with gingipains on complement degradation. In addition, interpain A was able to activate the C1 complex in serum, causing deposition of C1q on inert and bacterial surfaces, which may be important at initial stages of infection when local inflammatory reaction may be beneficial for a pathogen. Taken together, the newly characterized interpain A proteinase appears to be an important virulence factor of P. intermedia.
Complement evasion by Bordetella pertussis: implications for improving current vaccines.
Jongerius, Ilse; Schuijt, Tim J; Mooi, Frits R; Pinelli, Elena
2015-04-01
Bordetella pertussis causes whooping cough or pertussis, a highly contagious disease of the respiratory tract. Despite high vaccination coverage, reported cases of pertussis are rising worldwide and it has become clear that the current vaccines must be improved. In addition to the well-known protective role of antibodies and T cells during B. pertussis infection, innate immune responses such as the complement system play an essential role in B. pertussis killing. In order to evade this complement activation and colonize the human host, B. pertussis expresses several molecules that inhibit complement activation. Interestingly, one of the known complement evasion proteins, autotransporter Vag8, is highly expressed in the recently emerged B. pertussis isolates. Here, we describe the current knowledge on how B. pertussis evades complement-mediated killing. In addition, we compare this to complement evasion strategies used by other bacterial species. Finally, we discuss the consequences of complement evasion by B. pertussis on adaptive immunity and how identification of the bacterial molecules and the mechanisms involved in complement evasion might help improve pertussis vaccines.
DEFF Research Database (Denmark)
Marquart, H V; Svendsen, A; Rasmussen, J M
1995-01-01
It has previously been reported that the expression of the complement receptors, CR1 on erythrocytes and blood leucocytes and CR2 on B cells, is reduced in patients with SLE, and that the reduced expression of CR1 on erythrocytes is related to disease activity. We have earlier demonstrated...... that normal B cells are capable of activating the alternative pathway (AP) of complement in a CR2-dependent fashion. In this study we have investigated whether disturbances in this activity may be related to the altered phenotype of SLE B cells. Flow cytometry was used to measure expression of complement...
Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli
2015-04-30
Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.
Valenzuela, Nicole M.; Thomas, Kimberly A.; Mulder, Arend; Parry, Graham C.; Panicker, Sandip; Reed, Elaine F.
2017-01-01
Background Antibody-mediated rejection (AMR) of most solid organs is characterized by evidence of complement activation and/or intragraft macrophages (C4d + and CD68+ biopsies). We previously demonstrated that crosslinking of HLA I by antibodies triggered endothelial activation and monocyte adhesion. We hypothesized that activation of the classical complement pathway at the endothelial cell surface by HLA antibodies would enhance monocyte adhesion through soluble split product generation, in parallel with direct endothelial activation downstream of HLA signaling. Methods Primary human aortic endothelial cells (HAEC) were stimulated with HLA class I antibodies in the presence of intact human serum complement. C3a and C5a generation, endothelial P-selectin expression, and adhesion of human primary and immortalized monocytes (Mono Mac 6) were measured. Alternatively, HAEC or monocytes were directly stimulated with purified C3a or C5a. Classical complement activation was inhibited by pretreatment of complement with an anti-C1s antibody (TNT003). Results Treatment of HAEC with HLA antibody and human complement increased the formation of C3a and C5a. Monocyte recruitment by human HLA antibodies was enhanced in the presence of intact human serum complement or purified C3a or C5a. Specific inhibition of the classical complement pathway using TNT003 or C1q-depleted serum significantly reduced adhesion of monocytes in the presence of human complement. Conclusions Despite persistent endothelial viability in the presence of HLA antibodies and complement, upstream complement anaphylatoxin production exacerbates endothelial exocytosis and leukocyte recruitment. Upstream inhibition of classical complement may be therapeutic to dampen mononuclear cell recruitment and endothelial activation characteristic of microvascular inflammation during AMR. PMID:28640789
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Zhu, Li; Zhai, Ya-Ling; Wang, Feng-Mei; Hou, Ping; Lv, Ji-Cheng; Xu, Da-Min; Shi, Su-Fang; Liu, Li-Jun; Yu, Feng; Zhao, Ming-Hui; Novak, Jan; Gharavi, Ali G; Zhang, Hong
2015-05-01
Complement activation is common in patients with IgA nephropathy (IgAN) and associated with disease severity. Our recent genome-wide association study of IgAN identified susceptibility loci on 1q32 containing the complement regulatory protein-encoding genes CFH and CFHR1-5, with rs6677604 in CFH as the top single-nucleotide polymorphism and CFHR3-1 deletion (CFHR3-1∆) as the top signal for copy number variation. In this study, to explore the clinical effects of variation in CFH, CFHR3, and CFHR1 on IgAN susceptibility and progression, we enrolled two populations. Group 1 included 1178 subjects with IgAN and available genome-wide association study data. Group 2 included 365 subjects with IgAN and available clinical follow-up data. In group 1, rs6677604 was associated with mesangial C3 deposition by genotype-phenotype correlation analysis. In group 2, we detected a linkage between the rs6677604-A allele and CFHR3-1∆ and found that the rs6677604-A allele was associated with higher serum levels of CFH and lower levels of the complement activation split product C3a. Furthermore, CFH levels were positively associated with circulating C3 levels and negatively associated with mesangial C3 deposition. Moreover, serum levels of the pathogenic galactose-deficient glycoform of IgA1 were also associated with the degree of mesangial C3 deposition in patients with IgAN. Our findings suggest that genetic variants in CFH, CFHR3, and CFHR1 affect complement activation and thereby, predispose patients to develop IgAN. Copyright © 2015 by the American Society of Nephrology.
Directory of Open Access Journals (Sweden)
Caldeira Roberta Lima
1998-01-01
Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.
Murakami, Keiko; Yamanaka, Naoki; Ohnishi, Katsunori; Fukayama, Minoru; Yoshino, Masataka
2012-06-01
Angiotensin I converting enzyme (ACE) was inhibited by the culture medium of Bacillus subtilis subsp. natto, which ferments boiled soy beans to natto, a Japanese traditional food. Subtilisin NAT (nattokinase) produced by B. subtilis also inhibited ACE, and the inhibition was markedly stimulated by heat treatment of subtilisin at 120 °C for 15 min. Inhibition of ACE by subtilisin was of a mixed type: the decrease in V(max) and the increase in K(m) value. SDS-polyacrylamide gel electrophoresis showed that heat treatment of subtilisin caused inactivation with fragmentation of the enzyme protein into small peptides. The inhibitory action of subtilisin was not due to an enzymatic action of protease, but may be ascribed to the potent ACE-inhibitory peptides such as LY and FY, amino acid sequences in subtilisin. HPLC-MS analysis of heat-inactivated subtilisin confirmed that LY and FY were liberated by fragmentation of the enzyme. Inhibition of ACE by subtilisin and its degradation peptides such as LY and FY may participate in the suppression of blood pressure by ingestion of natto.
Development of a classification scheme for disease-related enzyme information
Directory of Open Access Journals (Sweden)
Söhngen Carola
2011-08-01
Full Text Available Abstract Background BRENDA (BRaunschweig ENzyme DAtabase, http://www.brenda-enzymes.org is a major resource for enzyme related information. First and foremost, it provides data which are manually curated from the primary literature. DRENDA (Disease RElated ENzyme information DAtabase complements BRENDA with a focus on the automatic search and categorization of enzyme and disease related information from title and abstracts of primary publications. In a two-step procedure DRENDA makes use of text mining and machine learning methods. Results Currently enzyme and disease related references are biannually updated as part of the standard BRENDA update. 910,897 relations of EC-numbers and diseases were extracted from titles or abstracts and are included in the second release in 2010. The enzyme and disease entity recognition has been successfully enhanced by a further relation classification via machine learning. The classification step has been evaluated by a 5-fold cross validation and achieves an F1 score between 0.802 ± 0.032 and 0.738 ± 0.033 depending on the categories and pre-processing procedures. In the eventual DRENDA content every category reaches a classification specificity of at least 96.7% and a precision that ranges from 86-98% in the highest confidence level, and 64-83% for the smallest confidence level associated with higher recall. Conclusions The DRENDA processing chain analyses PubMed, locates references with disease-related information on enzymes and categorises their focus according to the categories causal interaction, therapeutic application, diagnostic usage and ongoing research. The categorisation gives an impression on the focus of the located references. Thus, the relation categorisation can facilitate orientation within the rapidly growing number of references with impact on diseases and enzymes. The DRENDA information is available as additional information in BRENDA.
Tyrosine hydroxylase regulatory domain as indicator of enzyme sensitivity to irradiation
International Nuclear Information System (INIS)
Mustafayeva, N.N.; Alieva, I.N.; Aliev, Ds.I.
2002-01-01
Full text: At the present time contra dictionary and variously kind opinions concern to effect of different level of irradiation on the structure and functional activity of the tyrosine hydroxylase (TH), the key a rate-limiting enzyme in the biosynthesis of catecholamines are discussed in this study. To date, the effect of the irradiation on the both catalytic and N-terminal regulatory domains of TH localized in the different parts of the brain has been established. Th is responsible for dopamine, noradrenaline and adrenaline catecholamines neuro mediators biosynthesis, so a number of pathological changes in an organism has been induced by the structural reorganization different parts of the TH domains under pathological effect of environment. The available conformational states of the human TH type 1 (hTH1) regulatory domain, the activity of which is regulated by the feedback inhibition of the catecholamine products including dopamine has been established by the method of molecular mechanics. It is shown that N-terminal sequence Met30-Ser40 of hTH1 located between the two a-helices (residues 16-29 and residues 41-59) has a number of low-energy conformational states. The most available structures consists of b-turn type II on the pentapeptide fragment of hTH1. This fragment distortion under pathological factors effect, i.e. irradiation may lead to global reorganization in enzyme structure as well as at the enzyme catalytic and regulatory functions
Fragmentation cross sections outside the limiting-fragmentation regime
Sümmerer, K
2003-01-01
The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.
Identifying pathogenicity of human variants via paralog-based yeast complementation.
Directory of Open Access Journals (Sweden)
Fan Yang
2017-05-01
Full Text Available To better understand the health implications of personal genomes, we now face a largely unmet challenge to identify functional variants within disease-associated genes. Functional variants can be identified by trans-species complementation, e.g., by failure to rescue a yeast strain bearing a mutation in an orthologous human gene. Although orthologous complementation assays are powerful predictors of pathogenic variation, they are available for only a few percent of human disease genes. Here we systematically examine the question of whether complementation assays based on paralogy relationships can expand the number of human disease genes with functional variant detection assays. We tested over 1,000 paralogous human-yeast gene pairs for complementation, yielding 34 complementation relationships, of which 33 (97% were novel. We found that paralog-based assays identified disease variants with success on par with that of orthology-based assays. Combining all homology-based assay results, we found that complementation can often identify pathogenic variants outside the homologous sequence region, presumably because of global effects on protein folding or stability. Within our search space, paralogy-based complementation more than doubled the number of human disease genes with a yeast-based complementation assay for disease variation.
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Universality of fragment shapes.
Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea
2015-03-16
The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.
Hot spot analysis for driving the development of hits into leads in fragment based drug discovery
Hall, David R.; Ngan, Chi Ho; Zerbe, Brandon S.; Kozakov, Dima; Vajda, Sandor
2011-01-01
Fragment based drug design (FBDD) starts with finding fragment-sized compounds that are highly ligand efficient and can serve as a core moiety for developing high affinity leads. Although the core-bound structure of a protein facilitates the construction of leads, effective design is far from straightforward. We show that protein mapping, a computational method developed to find binding hot spots and implemented as the FTMap server, provides information that complements the fragment screening results and can drive the evolution of core fragments into larger leads with a minimal loss or, in some cases, even a gain in ligand efficiency. The method places small molecular probes, the size of organic solvents, on a dense grid around the protein, and identifies the hot spots as consensus clusters formed by clusters of several probes. The hot spots are ranked based on the number of probe clusters, which predicts the binding propensity of the subsites and hence their importance for drug design. Accordingly, with a single exception the main hot spot identified by FTMap binds the core compound found by fragment screening. The most useful information is provided by the neighboring secondary hot spots, indicating the regions where the core can be extended to increase its affinity. To quantify this information, we calculate the density of probes from mapping, which describes the binding propensity at each point, and show that the change in the correlation between a ligand position and the probe density upon extending or repositioning the core moiety predicts the expected change in ligand efficiency. PMID:22145575
International Nuclear Information System (INIS)
Karmanov, V.A.
1983-01-01
Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative
Tortajada, Agustín; Gutiérrez, Eduardo; Goicoechea de Jorge, Elena; Anter, Jaouad; Segarra, Alfons; Espinosa, Mario; Blasco, Miquel; Roman, Elena; Marco, Helena; Quintana, Luis F; Gutiérrez, Josué; Pinto, Sheila; Lopez-Trascasa, Margarita; Praga, Manuel; Rodriguez de Córdoba, Santiago
2017-10-01
IgA nephropathy (IgAN), a frequent cause of chronic kidney disease worldwide, is characterized by mesangial deposition of galactose-deficient IgA1-containing immune complexes. Complement involvement in IgAN pathogenesis is suggested by the glomerular deposition of complement components and the strong protection from IgAN development conferred by the deletion of the CFHR3 and CFHR1 genes (Δ CFHR3-CFHR1 ). Here we searched for correlations between clinical progression and levels of factor H (FH) and FH-related protein 1 (FHR-1) using well-characterized patient cohorts consisting of 112 patients with IgAN, 46 with non-complement-related autosomal dominant polycystic kidney disease (ADPKD), and 76 control individuals. Patients with either IgAN or ADPKD presented normal FH but abnormally elevated FHR-1 levels and FHR-1/FH ratios compared to control individuals. Highest FHR-1 levels and FHR-1/FH ratios are found in patients with IgAN with disease progression and in patients with ADPKD who have reached chronic kidney disease, suggesting that renal function impairment elevates the FHR-1/FH ratio, which may increase FHR-1/FH competition for activated C3 fragments. Interestingly, Δ CFHR3-CFHR1 homozygotes are protected from IgAN, but not from ADPKD, and we found five IgAN patients with low FH carrying CFH or CFI pathogenic variants. These data support a decreased FH activity in IgAN due to increased FHR-1/FH competition or pathogenic CFH variants. They also suggest that alternative pathway complement activation in patients with IgAN, initially triggered by galactose-deficient IgA1-containing immune complexes, may exacerbate in a vicious circle as renal function deterioration increase FHR-1 levels. Thus, a role of FHR-1 in IgAN pathogenesis is to compete with complement regulation by FH. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
The role of complement in the acquired immune response
DEFF Research Database (Denmark)
Nielsen, C H; Fischer, E M; Leslie, R G
2000-01-01
Studies over the past three decades have clearly established a central role for complement in the promotion of a humoral immune response. The primary function of complement, in this regard, is to opsonize antigen or immune complexes for uptake by complement receptor type 2 (CR2, CD21) expressed...... on B cells, follicular dendritic cells (FDC) and some T cells. A variety of mechanisms appear to be involved in complement-mediated promotion of the humoral response. These include: enhancement of antigen (Ag) uptake and processing by both Ag-specific and non-specific B cells for presentation...
Directory of Open Access Journals (Sweden)
Nancy A Turner
Full Text Available Vascular endothelial cells (ECs express and release protein components of the complement pathways, as well as secreting and anchoring ultra-large von Willebrand factor (ULVWF multimers in long string-like structures that initiate platelet adhesion during hemostasis and thrombosis. The alternative complement pathway (AP is an important non-antibody-requiring host defense system. Thrombotic microangiopathies can be associated with defective regulation of the AP (atypical hemolytic-uremic syndrome or with inadequate cleavage by ADAMTS-13 of ULVWF multimeric strings secreted by/anchored to ECs (thrombotic thrombocytopenic purpura. Our goal was to determine if EC-anchored ULVWF strings caused the assembly and activation of AP components, thereby linking two essential defense mechanisms.We quantified gene expression of these complement components in cultured human umbilical vein endothelial cells (HUVECs by real-time PCR: C3 and C5; complement factor (CF B, CFD, CFP, CFH and CFI of the AP; and C4 of the classical and lectin (but not alternative complement pathways. We used fluorescent microscopy, monospecific antibodies against complement components, fluorescent secondary antibodies, and the analysis of >150 images to quantify the attachment of HUVEC-released complement proteins to ULVWF strings secreted by, and anchored to, the HUVECs (under conditions of ADAMTS-13 inhibition. We found that HUVEC-released C4 did not attach to ULVWF strings, ruling out activation of the classical and lectin pathways by the strings. In contrast, C3, FB, FD, FP and C5, FH and FI attached to ULVWF strings in quantitative patterns consistent with assembly of the AP components into active complexes. This was verified when non-functional FB blocked the formation of AP C3 convertase complexes (C3bBb on ULVWF strings.AP components are assembled and activated on EC-secreted/anchored ULVWF multimeric strings. Our findings provide one possible molecular mechanism for clinical
Cyclosporine Induces Endothelial Cell Release of Complement-Activating Microparticles
Renner, Brandon; Klawitter, Jelena; Goldberg, Ryan; McCullough, James W.; Ferreira, Viviana P.; Cooper, James E.; Christians, Uwe
2013-01-01
Defective control of the alternative pathway of complement is an important risk factor for several renal diseases, including atypical hemolytic uremic syndrome. Infections, drugs, pregnancy, and hemodynamic insults can trigger episodes of atypical hemolytic uremic syndrome in susceptible patients. Although the mechanisms linking these clinical events with disease flares are unknown, recent work has revealed that each of these clinical conditions causes cells to release microparticles. We hypothesized that microparticles released from injured endothelial cells promote intrarenal complement activation. Calcineurin inhibitors cause vascular and renal injury and can trigger hemolytic uremic syndrome. Here, we show that endothelial cells exposed to cyclosporine in vitro and in vivo release microparticles that activate the alternative pathway of complement. Cyclosporine-induced microparticles caused injury to bystander endothelial cells and are associated with complement-mediated injury of the kidneys and vasculature in cyclosporine-treated mice. Cyclosporine-induced microparticles did not bind factor H, an alternative pathway regulatory protein present in plasma, explaining their complement-activating phenotype. Finally, we found that in renal transplant patients, the number of endothelial microparticles in plasma increases 2 weeks after starting tacrolimus, and treatment with tacrolimus associated with increased C3 deposition on endothelial microparticles in the plasma of some patients. These results suggest that injury-associated release of endothelial microparticles is an important mechanism by which systemic insults trigger intravascular complement activation and complement-dependent renal diseases. PMID:24092930
International Nuclear Information System (INIS)
Montarou, G.; Marroncle, J.; Alard, J.P.; Augerat, J.; Bastid, N.; Charmensat, P.; Dupieux, P.; Fraysse, L.; Parizet, M.J.; Rahmani, A.; Brochard, F.; Gorodetzky, P.; Racca, C.; Cugnon, J.
1992-01-01
The results of intranuclear cascade calculations (ideal gas with two body collisions and no mean-field), complemented by a simple percolation procedure, are compared with experimental data on protons and light nuclear fragments (d, t, 3 He and 4 He) measured in 400 and 800 MeV/nucleon Ne+Nb collisions using the large solid angle detector DIOGENE. The model reproduces quite well global experimental observables like nuclear fragment multiplicity distributions or production cross-sections, and nuclear fragment to proton ratios. For rapidity distributions the best agreement occurs for peripheral reactions. Transverse momentum analysis confirms once again that the cascade, although being a microscopic approach, gives too small a collective flow. For heavier nuclear fragments conclusions are not so clear. Since the cross-sections are the main ingredients of the detailed treatment of the first stage of the reaction by the intranuclear cascade, such an approach can be very fruitful in order to infer informations on effective nucleon-nucleon cross-sections. (authors). 31 refs., 23 figs., 6 tabs
DEFF Research Database (Denmark)
Eriksson, H; Nissen, Mogens Holst
1990-01-01
weights of the fragments are in agreement with the cleavage located in the area between the disulphide loops of the alpha 2-and alpha 3-domains of the heavy chain. In addition human C1s complement is able to cleave H-2 antigens from mouse in a similar fashion but not rat MHC class I antigen or mouse MHC...... class II antigen (I-Ad). Mouse MHC class I antigen-specific determinants could also be detected in supernatant from mouse spleen cells incubated with C1r and C1s. These results indicate the presence in the body fluids of a non-membrane-bound soluble form of the alpha 1-and alpha 2-domains which...
DEFF Research Database (Denmark)
Eriksson, H; Nissen, Mogens Holst
1992-01-01
Apart from cleaving C1s, we demonstrate for the first time that: 1) at concentrations found in serum, the activated forms of the complement components C1r in addition to C1s can cleave the heavy chain of MHC class I antigens, 2) the cleavage by C1r and C1s is seemingly dependent upon a native con......-chain of MHC class I was shown to take place between the alpha 2- and alpha 3- domains as estimated by the Con A-Sepharose precipitation pattern on SDS-PAGE. The alpha 1/alpha 2 fragment was still shown to interact with beta 2-microglobulin as shown by immunoprecipitation....
A novel antihuman C3d monoclonal antibody with specificity to the C3d complement split product
DEFF Research Database (Denmark)
Rasmussen, Karina Juhl; Skjødt, Mikkel-Ole; Vitved, Lars
2017-01-01
The complement component C3 and the cleavage products of C3b/iC3b, C3c and C3d are used as biomarkers in clinical diagnostics. Currently, no specific antibodies are able to differentiate C3d from other fragments, although such a distinction could be very valuable considering that they may reflect...... different pathophysiological mechanisms. We have developed a rat antihuman C3d monoclonal antibody with specificity to the end sequence of the N-terminal region of C3d. The antibody can therefore only bind to C3d when it manifests itself as the final end product of cleaved C3. We believe...
Directory of Open Access Journals (Sweden)
Horikoshi Satoshi
2010-12-01
Full Text Available Abstract Background The complement system is vital for innate immunity and is implicated in the pathogenesis of inflammatory diseases and the mechanism of host defense. Complement deficiencies occasionally cause life-threatening diseases. In hemodialysis (HD patients, profiles on complement functional activity and deficiency are still obscure. The objectives of the present study were to measure the functional complement activities of the classical pathway (CP, lectin pathway (LP and alternative pathway (AP using a novel method and consequently to elucidate the rates of deficiencies among HD patients. Methods In the present study, 244 HD patients at one dialysis center and 204 healthy controls were enrolled. Functional complement activities were measured simultaneously using the Wielisa®-kit. The combination of the results of these three pathway activities allows us to speculate which candidate complement is deficient; subsequently, the deficient complement was determined. Results All three functional complement activities were significantly higher in the HD patients than in the control group (P ®-kit, 16 sera (8.8% with mannose-binding lectin (MBL deficiency, 1 serum (0.4% with C4 deficiency, 1 serum (0.4% with C9 deficiency, and 1 serum (0.4% with B deficiency were observed in the HD group, and 18 sera (8.8% with MBL deficiency and 1 serum (0.5% with B deficiency were observed in the control group. There were no significant differences in the 5-year mortality rate between each complement-deficient group and the complement-sufficient group among the HD patients. Conclusion This is the first report that profiles complement deficiencies by simultaneous measurement of functional activities of the three complement pathways in HD patients. Hemodialysis patients frequently suffer from infections or malignancies, but functional complement deficiencies do not confer additional risk of mortality.
The complement inhibitor eculizumab in paroxysmal nocturnal hemoglobinuria.
Hillmen, P.; Young, N.S.; Schubert, J.; Brodsky, R.A.; Socie, G.; Muus, P.; Roth, A.; Szer, J.; Elebute, M.O.; Nakamura, R.; Browne, P.; Risitano, A.M.; Hill, A.; Schrezenmeier, H.; Fu, C.L.; Maciejewski, J; Rollins, S.A.; Mojcik, C.F.; Rother, R.P.; Luzzatto, L.
2006-01-01
BACKGROUND: We tested the safety and efficacy of eculizumab, a humanized monoclonal antibody against terminal complement protein C5 that inhibits terminal complement activation, in patients with paroxysmal nocturnal hemoglobinuria (PNH). METHODS: We conducted a double-blind, randomized,
Directory of Open Access Journals (Sweden)
Przemysław Krzysztof Wirstlein
2012-10-01
Full Text Available Factors controlling complement activation appear to exert a protective effect on pregnancy. This is
particularly important in women with thrombophilia. The aim of this study was to determine the transcript and
protein levels of complement decay-accelerating factor (DAF and membrane cofactor protein (MCP in the
placentas of women with acquired and inherited thrombophilia. Also, we assessed immunohistochemistry staining
of inhibitors of the complement cascade, DAF and MCP proteins, in the placentas of thrombophilic women.
Placentas were collected from eight women with inherited thrombophilia and ten with acquired thrombophilia.
The levels of DAF and MCP transcripts were evaluated by qPCR, the protein level was evaluated by Western
blot. We observed a higher transcript (p < 0.05 and protein (p < 0.001 levels of DAF and MCP in the placentas
of thrombophilic women than in the control group. DAF and MCP were localized on villous syncytiotrophoblast
membranes, but the assessment of staining in all groups did not differ. The observed higher expression level of
proteins that control activation of complement control proteins is only seemingly contradictory to the changes
observed for example in the antiphospholipid syndrome. However, given the hitherto known biochemical changes
associated with thrombophilia, a mechanism in which increased expression of DAF and MCP in the placentas is
an effect of proinflammatory cytokines, which accompanies thrombophilia, is probable.Factors controlling complement activation appear to exert a protective effect on pregnancy. This is
particularly important in women with thrombophilia. The aim of this study was to determine the transcript and
protein levels of complement decay-accelerating factor (DAF and membrane cofactor protein (MCP in the
placentas of women with acquired and inherited thrombophilia. Also, we assessed immunohistochemistry
Strategies for protection and experiments on repair of irradiated sulfhydryl enzymes
International Nuclear Information System (INIS)
Durchschlag, H.; Zipper, P.
1991-01-01
The investigation of sulfur-containing biomolecules, especially of sulfhydryl proteins, is of particular interest in radiation biology. Sulfhydryl enzymes are useful objects for studying both structural and functional changes caused by radiation. In this context oxidation of enzyme sulfhydryl, inactivation (continuing in the post-irradiation phase), subunit cross-linking, enzyme aggregation, fragmentation, unfolding etc. may be mentioned. For their studies the authors used primarily malate synthase (MS), an enzyme with essential sulfhydryl, which was X-irradiated in aqueous solution in the absence or presence of a variety of additives (thiols, antioxienzymes, typical radical scavengers, inorganic salts, buffer components, substrates, products, substrate and product analogues). Radiation-induced effects were registered during irradiation, after stop of irradiation, and in the post-radiation (p.r.) phase 30 or 60 h p.r. using, e.g., small-angle X-ray scattering (SAXS), polyacrylamide gel electrophoreses (PAGEs), and activity measurements. Repair experiments were initiated by p.r. addition of dithiothreitol (DTT). For comparison, some of the experiments were also carried out with two additional sulfhydryl enzymes (glyceraldehyde-3-phosphate dehydrogenase (GAPDH), lactate dehydrogenase (LDH)) and two disulfide containing proteins (ribonuclease A, serum albumin). 9 refs., 6 figs
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))
1994-08-01
The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.
International Nuclear Information System (INIS)
Chung, K.C.
1989-01-01
An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)
Cui, Xiping; Vasylieva, Natalia; Wu, Panpan; Barnych, Bogdan; Yang, Jun; Shen, Ding; He, Qiyi; Gee, Shirley J; Zhao, Suqing; Hammock, Bruce D
2017-10-17
Glycocholic acid (GCA) is an important metabolite of bile acids, whose urine levels are expected to be a specific diagnostic biomarker for hepatocellular carcinoma (HCC). A high-throughput immunoassay for determination of GCA would be of significant advantage and useful for primary diagnosis, surveillance, and early detection of HCC. Single-chain variable fragment (scFv) antibodies have several desirable characteristics and are an attractive alternative to traditional antibodies for the immunoassay. Because chicken antibodies possess single heavy and light variable functional domains, they are an ideal framework for simplified generation of recombinant antibodies for GCA detection. However, chicken scFvs have rarely been used to detect GCA. In this study, a scFv library was generated from chickens immunized with a GCA hapten coupled to bovine serum albumin (BSA), and anti-GCA scFvs were isolated by a phage-displayed method. Compared to the homologous coating antigen, use of a heterologous coating antigen resulted in about an 85-fold improvement in sensitivity of the immunoassay. This assay, under optimized conditions, had a linear range of 0.02-0.18 μg/mL, with an IC 50 of 0.06 μg/mL. The assay showed negligible cross-reactivity with various related bile acids, except for taurocholic acid. The detection of GCA from spiked human urine samples ranged from 86.7% to 123.3%. These results, combined with the advantages of scFv antibodies, indicated that a chicken scFv-based enzyme-linked immunosorbent assay is a suitable method for high-throughput screening of GCA in human urine.
Proteomic Profiling of Mitochondrial Enzymes during Skeletal Muscle Aging
Directory of Open Access Journals (Sweden)
Lisa Staunton
2011-01-01
Full Text Available Mitochondria are of central importance for energy generation in skeletal muscles. Expression changes or functional alterations in mitochondrial enzymes play a key role during myogenesis, fibre maturation, and various neuromuscular pathologies, as well as natural fibre aging. Mass spectrometry-based proteomics suggests itself as a convenient large-scale and high-throughput approach to catalogue the mitochondrial protein complement and determine global changes during health and disease. This paper gives a brief overview of the relatively new field of mitochondrial proteomics and discusses the findings from recent proteomic surveys of mitochondrial elements in aged skeletal muscles. Changes in the abundance, biochemical activity, subcellular localization, and/or posttranslational modifications in key mitochondrial enzymes might be useful as novel biomarkers of aging. In the long term, this may advance diagnostic procedures, improve the monitoring of disease progression, help in the testing of side effects due to new drug regimes, and enhance our molecular understanding of age-related muscle degeneration.
The Complement System: A Prey of Trypanosoma cruzi
Directory of Open Access Journals (Sweden)
Kárita C. F. Lidani
2017-04-01
Full Text Available Trypanosoma cruzi is a protozoan parasite known to cause Chagas disease (CD, a neglected sickness that affects around 6–8 million people worldwide. Originally, CD was mainly found in Latin America but more recently, it has been spread to countries in North America, Asia, and Europe due the international migration from endemic areas. Thus, at present CD represents an important concern of global public health. Most of individuals that are infected by T. cruzi may remain in asymptomatic form all lifelong, but up to 40% of them will develop cardiomyopathy, digestive mega syndromes, or both. The interaction between the T. cruzi infective forms and host-related immune factors represents a key point for a better understanding of the physiopathology of CD. In this context, the complement, as one of the first line of host defense against infection was shown to play an important role in recognizing T. cruzi metacyclic trypomastigotes and in controlling parasite invasion. The complement consists of at least 35 or more plasma proteins and cell surface receptors/regulators, which can be activated by three pathways: classical (CP, lectin (LP, and alternative (AP. The CP and LP are mainly initiated by immune complexes or pathogen-associated molecular patterns (PAMPs, respectively, whereas AP is spontaneously activated by hydrolysis of C3. Once activated, several relevant complement functions are generated which include opsonization and phagocytosis of particles or microorganisms and cell lysis. An important step during T. cruzi infection is when intracellular trypomastigotes are release to bloodstream where they may be target by complement. Nevertheless, the parasite uses a sequence of events in order to escape from complement-mediated lysis. In fact, several T. cruzi molecules are known to interfere in the initiation of all three pathways and in the assembly of C3 convertase, a key step in the activation of complement. Moreover, T. cruzi promotes secretion
Cheng, Xin; Ivessa, Andreas S
2012-10-01
Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.
DEFF Research Database (Denmark)
Palarasah, Y; Nielsen, C; Sprogøe, U
2011-01-01
is therefore of great importance. In this study, we present novel improved enzyme-linked immunosorbent assays for the functional assessment of the three individual pathways of the complement system. The method is applicable at high serum concentrations and we demonstrate that it minimizes both false negative...... as well as false positive results. In particular, for the functional mannose-binding lectin activity it represents an improvement on the existing assays. In this respect, the present assays represent novel improved diagnostic protocols for patients with suspected immunodeficiencies related...
Directory of Open Access Journals (Sweden)
N. Roshani Pour
2017-09-01
Full Text Available Aims: Age-related macular degeneration (AMD is the most prevalent cause of irreversible blindness and debilitating in old stages, in developed and developing countries that engage the central part of the retina or macula. The aim of this study was to evaluate the relationship of the rs4151667 position of the complement factor B gene polymorphism with AMD (dry type with geographic atrophy phenotype in the North East of Iran population. Materials & Methods: In this descriptive cross-sectional study in 2015-2016, 44 AMD patients (dry type with geographic atrophy phenotype were randomly selected from Gonabad City, Iran, health centers as the patient group. 50 healthy individuals from the same society that have no relative relations with each other or the patients, but were adapted by age and sex to the patient group, were selected as the control group. The polymorphism of rs4151667 (c.26T>A position of the complement factor B gene was determined for all samples by Restriction Fragment Length Polymorphism (RFLP. Data was analyzed the Chi-square test in 2x2.Contingency software. Findings: The frequency of TT genotype in AMD patients (95.5% was significantly (p=0.048 more than the control group (88.0%, but the frequency of AT genotype in AMD patients (4.5% was significantly (p=0.025 less than the control group (12.0%. Conclusion: The polymorphism of rs4151667 (c.26T>A position of complement factor B is effective on the development of AMD in North East of Iran population.
Fast conversion of scFv to Fab antibodies using type IIs restriction enzymes.
Sanmark, Hanna; Huovinen, Tuomas; Matikka, Tero; Pettersson, Tiina; Lahti, Maria; Lamminmäki, Urpo
2015-11-01
Single chain variable fragment (scFv) antibody libraries are widely used for developing novel bioaffinity reagents, although Fab or IgG molecules are the preferred antibody formats in many final applications. Therefore, rapid conversion methods for combining multiple DNA fragments are needed to attach constant domains to the scFv derived variable domains. In this study we describe a fast and easy cloning method for the conversion of single framework scFv fragments to Fab fragments using type IIS restriction enzymes. All cloning steps excluding plating of the Fab transformants can be done in 96 well plates and the procedure can be completed in one working day. The concept was tested by converting 69 scFv clones into Fab format on 96 well plates, which resulted in 93% success rate. The method is particularly useful as a high-throughput tool for the conversion of the chosen scFv clones into Fab molecules in order to analyze them as early as possible, as the conversion can significantly affect the binding properties of the chosen clones. Copyright © 2015 Elsevier B.V. All rights reserved.
Goetz, Lindsey; Laskowski, Jennifer; Renner, Brandon; Pickering, Matthew C; Kulik, Liudmila; Klawitter, Jelena; Stites, Erik; Christians, Uwe; van der Vlag, Johan; Ravichandran, Kameswaran; Holers, V Michael; Thurman, Joshua M
2018-05-01
Natural IgM binds to glomerular epitopes in several progressive kidney diseases. Previous work has shown that IgM also binds within the glomerulus after ischemia/reperfusion (I/R) but does not fully activate the complement system. Factor H is a circulating complement regulatory protein, and congenital or acquired deficiency of factor H is a strong risk factor for several types of kidney disease. We hypothesized that factor H controls complement activation by IgM in the kidney after I/R, and that heterozygous factor H deficiency would permit IgM-mediated complement activation and injury at this location. We found that mice with targeted heterozygous deletion of the gene for factor H developed more severe kidney injury after I/R than wild-type controls, as expected, but that complement activation within the glomeruli remained well controlled. Furthermore, mice that are unable to generate soluble IgM were not protected from renal I/R, even in the setting of heterozygous factor H deficiency. These results demonstrate that factor H is important for limiting injury in the kidney after I/R, but it is not critical for controlling complement activation by immunoglobulin within the glomerulus in this setting. IgM binds to glomerular epitopes after I/R, but it is not a significant source of injury. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Randi H. Gottfredsen
2013-01-01
Full Text Available Superoxide dismutase (EC-SOD controls the level of superoxide in the extracellular space by catalyzing the dismutation of superoxide into hydrogen peroxide and molecular oxygen. In addition, the enzyme reacts with hydrogen peroxide in a peroxidase reaction which is known to disrupt enzymatic activity. Here, we show that the peroxidase reaction supports a site-specific bond cleavage. Analyses by peptide mapping and mass spectrometry shows that oxidation of Pro112 supports the cleavage of the Pro112–His113 peptide bond. Substitution of Ala for Pro112 did not inhibit fragmentation, indicating that the oxidative fragmentation at this position is dictated by spatial organization and not by side-chain specificity. The major part of EC-SOD inhibited by the peroxidase reaction was not fragmented but found to encompass oxidations of histidine residues involved in the coordination of copper (His98 and His163. These oxidations are likely to support the dissociation of copper from the active site and thus loss of enzymatic activity. Homologous modifications have also been described for the intracellular isozyme, Cu/Zn-SOD, reflecting the almost identical structures of the active site within these enzymes. We speculate that the inactivation of EC-SOD by peroxidase activity plays a role in regulating SOD activity in vivo, as even low levels of superoxide will allow for the peroxidase reaction to occur.
A vital role for complement in heart disease
DEFF Research Database (Denmark)
Lappegård, Knut T; Garred, Peter; Jonasson, Lena
2014-01-01
fibrillation often share risk factors both with coronary heart disease and heart failure, and there is some evidence implicating complement activation in atrial fibrillation. Moreover, Chagas heart disease, a protozoal infection, is an important cause of heart failure in Latin America, and the complement...
Demand Heterogeneity and the Adoption of Platform Complements
G.J. Rietveld (Joost); J.P. Eggers
2016-01-01
textabstractThis paper offers a demand-based theory of how platform maturity affects the adoption of platform complements. We argue that differences between early and late adopters of the platform include willingness to pay for the platform-and-complement bundle, risk preferences, preference for
Novel roles of complement in renal diseases and their therapeutic consequences.
Wada, Takehiko; Nangaku, Masaomi
2013-09-01
The complement system functions as a part of the innate immune system. Inappropriate activation of the complement pathways has a deleterious effect on kidneys. Recent advances in complement research have provided new insights into the pathogenesis of glomerular and tubulointerstitial injury associated with complement activation. A new disease entity termed 'C3 glomerulopathy' has recently been proposed and is characterized by isolated C3 deposition in glomeruli without positive staining for immunoglobulins. Genetic and functional studies have demonstrated that several different mutations and disease variants, as well as the generation of autoantibodies, are potentially associated with its pathogenesis. The data from comprehensive analyses suggest that complement dysregulation can also be associated with hemolytic uremic syndrome and more common glomerular diseases, such as IgA nephropathy and diabetic kidney disease. In addition, animal studies utilizing genetically modified mice have begun to elucidate the molecular pathomechanisms associated with the complement system. From a diagnostic point of view, a noninvasive, MRI-based method for detecting C3 has recently been developed to serve as a novel tool for diagnosing complement-mediated kidney diseases. While novel therapeutic tools related to complement regulation are emerging, studies evaluating the precise roles of the complement system in kidney diseases will still be useful for developing new therapeutic approaches.
String fragmentation; La fragmentation des cordes
Energy Technology Data Exchange (ETDEWEB)
Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)
1997-10-01
The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.
Functional analysis of Ficolin-3 mediated complement activation
DEFF Research Database (Denmark)
Hein, Estrid; Honoré, Christian; Skjoedt, Mikkel-Ole
2010-01-01
Ficolin-3 mediated complement activation that could be applicable for research and clinical use. Bovine serum albumin (BSA) was acetylated (acBSA) and chosen as a solid phase ligand for Ficolins in microtiter wells. Binding of Ficolins on acBSA was evaluated, as was functional complement activation...... was applied to the samples that inhibited interference from the classical pathway due to the presence of anti-BSA antibodies in some sera. We describe a novel functional method for measuring complement activation mediated by Ficolin-3 in human serum up to the formation of TCC. The assay provides...
Complement propriety and conspiracy in nanomedicine
DEFF Research Database (Denmark)
Moghimi, Seyed Moein
2016-01-01
The complement system is the first line of body's defense against intruders and it acts as a functional bridge between innate and adaptive arms of the immune system. This commentary examines the key roles of complement activation in response to nanomedicine administration, including nucleic acid...... complexes. These comprise beneficial (eg, adjuvanticity) as well as adverse effects (eg, infusion-related reactions). Pigs (and sheep) are often used as predictive models of nanomedicine-mediated infusion-related reactions in humans. The validity of these models in relation to human responses is questioned...
Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E
2016-02-15
The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.
Novel enzymic hydrolytic dehalogenation of a chlorinated aromatic
International Nuclear Information System (INIS)
Scholten, J.D.; Chang, Kaihsuan; Dunaway-Mariano, D.; Babbitt, P.C.; Charest, H.; Sylvestre, M.
1991-01-01
Microbial enzyme systems may be used in the biodegradation of persistent environmental pollutants. The three polypeptide components of one such system, the 4-chlorobenzoate dehalogenase system, have been isolated, and the chemical steps of the 4-hydroxybenzoate-forming reaction that they catalyze have been identified. The genes contained within a 4.5-filobase Pseudomonas sp. strain CBS3 chromosomal DNA fragment that encode dehalogenase activity were selectively expressed in transformed Escherichia coli. Oligonucleotide sequencing revealed a stretch of homology between the 57-kilodalton (kD) polypeptide and several magnesium adenosine triphosphate (MgATP)-cleaving enzymes that allowed MgATP and coenzyme A (CoA) to be identified as the dehalogenase cosubstrate and cofactor, respectively. The dehalogenase activity arises from two components, a 4-chlorobenzoate:CoA ligase-dehalogenase (an αβ dimer of the 57- and 30-kD polypeptides) and a thioesterase (the 16-kD polypeptide)
DEFF Research Database (Denmark)
Petersen, Ivan; Baatrup, Gunnar; Jepsen, H H
1985-01-01
Some of the molecular events in the complement (C)-mediated solubilization of immune complexes (IC) have been clarified in recent years. The solubilization is primarily mediated by alternative C pathway proteins whereas factors in the classical pathway accelerate the process. Components of the me......Some of the molecular events in the complement (C)-mediated solubilization of immune complexes (IC) have been clarified in recent years. The solubilization is primarily mediated by alternative C pathway proteins whereas factors in the classical pathway accelerate the process. Components...... of the cellular localization, expression and structure of the C3 receptors, especially the C3b (CR1) receptor, has been considerably extended in the last few years, whereas our understanding of the physiological role of these receptors is still fragmentary. However, it is becoming increasingly evident...
Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Carciofi, Massimiliano; Blennow, Per Gunnar Andreas; Jensen, Susanne Langgård
2012-01-01
is preferentially derived from amylose, which can be increased by suppressing amylopectin synthesis by silencing of starch branching enzymes (SBEs). However all the previous works attempting the production of high RS crops resulted in only partly increased amylose-content and/or significant yield loss. Results...... In this study we invented a new method for silencing of multiple genes. Using a chimeric RNAi hairpin we simultaneously suppressed all genes coding for starch branching enzymes (SBE I, SBE IIa, SBE IIb) in barley (Hordeum vulgare L.), resulting in production of amylose-only starch granules in the endosperm...... yield in a living organism. This was achieved by a new method of simultaneous suppression of the entire complement of genes encoding starch branching enzymes. We demonstrate that amylopectin is not essential for starch granule crystallinity and integrity. However the slower initial growth of shoots from...
DEFF Research Database (Denmark)
Palarasah, Yaseelan; Skjodt, Karsten; Brandt, Jette
2010-01-01
complex (C5b-C9) and quantification of complement split products by precipitation-in-gel techniques (e.g. C3d). We have developed a mouse monoclonal antibody (mAb) that is able to detect fluid phase C3c without interference from other products generated from the complement component C3. The C3c specific m....... The C3c mAb was confirmed to be C3c specific, as it showed no cross-reactivity with native (un-cleaved) C3, with C3b, iC3b, or with C3d. Also, no significant reaction was observed with C3 fragments in factor I deficient sera or plasma. This antibody forms the basis for the generation of a robust ELISA...... that allows for a quick and reliable evaluation of complement activation and consumption as a marker for inflammatory processes. We established the C3c plasma range in 100 healthy Danish blood donors with a mean of 3.47 μg/ml and a range of 2.12-4.92 μg/ml. We believe that such an antibody might...
Schur complements of matrices with acyclic bipartite graphs
DEFF Research Database (Denmark)
Britz, Thomas Johann; Olesky, D.D.; van den Driessche, P.
2005-01-01
Bipartite graphs are used to describe the generalized Schur complements of real matrices having nos quare submatrix with two or more nonzero diagonals. For any matrix A with this property, including any nearly reducible matrix, the sign pattern of each generalized Schur complement is shown to be ...
Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa
2010-01-01
Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.
Banner, David W; Gsell, Bernard; Benz, Jörg; Bertschinger, Julian; Burger, Dominique; Brack, Simon; Cuppuleri, Simon; Debulpaep, Maja; Gast, Alain; Grabulovski, Dragan; Hennig, Michael; Hilpert, Hans; Huber, Walter; Kuglstatter, Andreas; Kusznir, Eric; Laeremans, Toon; Matile, Hugues; Miscenic, Christian; Rufer, Arne C; Schlatter, Daniel; Steyaert, Jan; Stihle, Martine; Thoma, Ralf; Weber, Martin; Ruf, Armin
2013-06-01
The aspartic protease BACE2 is responsible for the shedding of the transmembrane protein Tmem27 from the surface of pancreatic β-cells, which leads to inactivation of the β-cell proliferating activity of Tmem27. This role of BACE2 in the control of β-cell maintenance suggests BACE2 as a drug target for diabetes. Inhibition of BACE2 has recently been shown to lead to improved control of glucose homeostasis and to increased insulin levels in insulin-resistant mice. BACE2 has 52% sequence identity to the well studied Alzheimer's disease target enzyme β-secretase (BACE1). High-resolution BACE2 structures would contribute significantly to the investigation of this enzyme as either a drug target or anti-target. Surface mutagenesis, BACE2-binding antibody Fab fragments, single-domain camelid antibody VHH fragments (Xaperones) and Fyn-kinase-derived SH3 domains (Fynomers) were used as crystallization helpers to obtain the first high-resolution structures of BACE2. Eight crystal structures in six different packing environments define an ensemble of low-energy conformations available to the enzyme. Here, the different strategies used for raising and selecting BACE2 binders for cocrystallization are described and the crystallization success, crystal quality and the time and resources needed to obtain suitable crystals are compared.
Fission fragment angular momentum
International Nuclear Information System (INIS)
Frenne, D. De
1991-01-01
Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs
Assaying Oxidative Coupling Activity of CYP450 Enzymes.
Agarwal, Vinayak
2018-01-01
Cytochrome P450 (CYP450) enzymes are ubiquitous catalysts in natural product biosynthetic schemes where they catalyze numerous different transformations using radical intermediates. In this protocol, we describe procedures to assay the activity of a marine bacterial CYP450 enzyme Bmp7 which catalyzes the oxidative radical coupling of polyhalogenated aromatic substrates. The broad substrate tolerance of Bmp7, together with rearrangements of the aryl radical intermediates leads to a large number of products to be generated by the enzymatic action of Bmp7. The complexity of the product pool generated by Bmp7 thus presents an analytical challenge for structural elucidation. To address this challenge, we describe mass spectrometry-based procedures to provide structural insights into aryl crosslinked products generated by Bmp7, which can complement subsequent spectroscopic experiments. Using the procedures described here, for the first time, we show that Bmp7 can efficiently accept polychlorinated aryl substrates, in addition to the physiological polybrominated substrates for the biosynthesis of polyhalogenated marine natural products. © 2018 Elsevier Inc. All rights reserved.
More than just immune evasion: Hijacking complement by Plasmodium falciparum.
Schmidt, Christoph Q; Kennedy, Alexander T; Tham, Wai-Hong
2015-09-01
Malaria remains one of the world's deadliest diseases. Plasmodium falciparum is responsible for the most severe and lethal form of human malaria. P. falciparum's life cycle involves two obligate hosts: human and mosquito. From initial entry into these hosts, malaria parasites face the onslaught of the first line of host defence, the complement system. In this review, we discuss the complex interaction between complement and malaria infection in terms of hosts immune responses, parasite survival and pathogenesis of severe forms of malaria. We will focus on the role of complement receptor 1 and its associated polymorphisms in malaria immune complex clearance, as a mediator of parasite rosetting and as an entry receptor for P. falciparum invasion. Complement evasion strategies of P. falciparum parasites will also be highlighted. The sexual forms of the malaria parasites recruit the soluble human complement regulator Factor H to evade complement-mediated killing within the mosquito host. A novel evasion strategy is the deployment of parasite organelles to divert complement attack from infective blood stage parasites. Finally we outline the future challenge to understand the implications of these exploitation mechanisms in the interplay between successful infection of the host and pathogenesis observed in severe malaria. Copyright © 2015 Elsevier Ltd. All rights reserved.
Complement and the control of HIV infection: an evolving story.
Frank, Michael M; Hester, Christopher; Jiang, Haixiang
2014-05-01
Thirty years ago, investigators isolated and later determined the structure of HIV-1 and its envelope proteins. Using techniques that were effective with other viruses, they prepared vaccines designed to generate antibody or T-cell responses, but they were ineffective in clinical trials. In this article, we consider the role of complement in host defense against enveloped viruses, the role it might play in the antibody response and why complement has not controlled HIV-1 infection. Complement consists of a large group of cell-bound and plasma proteins that are an integral part of the innate immune system. They provide a first line of defense against microbes and also play a role in the immune response. Here we review the studies of complement-mediated HIV destruction and the role of complement in the HIV antibody response. HIV-1 has evolved a complex defense to prevent complement-mediated killing reviewed here. As part of these studies, we have discovered that HIV-1 envelope, on administration into animals, is rapidly broken down into small peptides that may prove to be very inefficient at provident the type of antigenic stimulation that leads to an effective immune response. Improving complement binding and stabilizing envelope may improve the vaccine response.
Complementation analysis of ataxia-telangiectasia
International Nuclear Information System (INIS)
Jaspers, N.G.; Painter, R.B.; Paterson, M.C.; Kidson, C.; Inoue, T.
1985-01-01
In a number of laboratories genetic analysis of ataxia-telangiectasia (AT) has been performed by studying the expression of the AT phenotype in fused somatic cells or mixtures of cell-free extracts from different patients. Complementation of the defective response to ionizing radiation was observed frequently, considering four different parameters for radiosensitivity in AT. The combined results from studies on cultured fibroblasts or lymphoblastoid cells from 17 unrelated families revealed the presence of at least four and possibly nine complementation groups. These findings suggest that there is an extensive genetic heterogeneity in AT. More extensive studies are needed for an integration of these data and to provide a set of genetically characterized cell strains for future research of the AT genetic defect
The lectin pathway of complement
DEFF Research Database (Denmark)
Ballegaard, Vibe Cecilie Diederich; Haugaard, Anna Karen; Garred, P
2014-01-01
The pattern recognition molecules of the lectin complement pathway are important components of the innate immune system with known functions in host-virus interactions. This paper summarizes current knowledge of how these intriguing molecules, including mannose-binding lectin (MBL), Ficolin-1, -2......-1, -2 and -3 and CL-11 could have similar functions in HIV infection as the ficolins have been shown to play a role in other viral infections, and CL-11 resembles MBL and the ficolins in structure and binding capacity.......The pattern recognition molecules of the lectin complement pathway are important components of the innate immune system with known functions in host-virus interactions. This paper summarizes current knowledge of how these intriguing molecules, including mannose-binding lectin (MBL), Ficolin-1, -2...
Complement: a key system for immune surveillance and homeostasis.
Ricklin, Daniel; Hajishengallis, George; Yang, Kun; Lambris, John D
2010-09-01
Nearly a century after the significance of the human complement system was recognized, we have come to realize that its functions extend far beyond the elimination of microbes. Complement acts as a rapid and efficient immune surveillance system that has distinct effects on healthy and altered host cells and foreign intruders. By eliminating cellular debris and infectious microbes, orchestrating immune responses and sending 'danger' signals, complement contributes substantially to homeostasis, but it can also take action against healthy cells if not properly controlled. This review describes our updated view of the function, structure and dynamics of the complement network, highlights its interconnection with immunity at large and with other endogenous pathways, and illustrates its multiple roles in homeostasis and disease.
Wyss, Daniel F; Wang, Yu-Sen; Eaton, Hugh L; Strickland, Corey; Voigt, Johannes H; Zhu, Zhaoning; Stamford, Andrew W
2012-01-01
Fragment-based drug discovery (FBDD) has become increasingly popular over the last decade. We review here how we have used highly structure-driven fragment-based approaches to complement more traditional lead discovery to tackle high priority targets and those struggling for leads. Combining biomolecular nuclear magnetic resonance (NMR), X-ray crystallography, and molecular modeling with structure-assisted chemistry and innovative biology as an integrated approach for FBDD can solve very difficult problems, as illustrated in this chapter. Here, a successful FBDD campaign is described that has allowed the development of a clinical candidate for BACE-1, a challenging CNS drug target. Crucial to this achievement were the initial identification of a ligand-efficient isothiourea fragment through target-based NMR screening and the determination of its X-ray crystal structure in complex with BACE-1, which revealed an extensive H-bond network with the two active site aspartate residues. This detailed 3D structural information then enabled the design and validation of novel, chemically stable and accessible heterocyclic acylguanidines as aspartic acid protease inhibitor cores. Structure-assisted fragment hit-to-lead optimization yielded iminoheterocyclic BACE-1 inhibitors that possess desirable molecular properties as potential therapeutic agents to test the amyloid hypothesis of Alzheimer's disease in a clinical setting.
Nguyen, Nam-Ninh; Srihari, Sriganesh; Leong, Hon Wai; Chong, Ket-Fah
2015-10-01
Determining the entire complement of enzymes and their enzymatic functions is a fundamental step for reconstructing the metabolic network of cells. High quality enzyme annotation helps in enhancing metabolic networks reconstructed from the genome, especially by reducing gaps and increasing the enzyme coverage. Currently, structure-based and network-based approaches can only cover a limited number of enzyme families, and the accuracy of homology-based approaches can be further improved. Bottom-up homology-based approach improves the coverage by rebuilding Hidden Markov Model (HMM) profiles for all known enzymes. However, its clustering procedure relies firmly on BLAST similarity score, ignoring protein domains/patterns, and is sensitive to changes in cut-off thresholds. Here, we use functional domain architecture to score the association between domain families and enzyme families (Domain-Enzyme Association Scoring, DEAS). The DEAS score is used to calculate the similarity between proteins, which is then used in clustering procedure, instead of using sequence similarity score. We improve the enzyme annotation protocol using a stringent classification procedure, and by choosing optimal threshold settings and checking for active sites. Our analysis shows that our stringent protocol EnzDP can cover up to 90% of enzyme families available in Swiss-Prot. It achieves a high accuracy of 94.5% based on five-fold cross-validation. EnzDP outperforms existing methods across several testing scenarios. Thus, EnzDP serves as a reliable automated tool for enzyme annotation and metabolic network reconstruction. Available at: www.comp.nus.edu.sg/~nguyennn/EnzDP .
Azimuthal Anisotropies in Nuclear Fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.
2002-01-01
The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)
International Nuclear Information System (INIS)
Caesar, Joseph J. E.; Wallich, Reinhard; Kraiczy, Peter; Zipfel, Peter F.; Lea, Susan M.
2013-01-01
B. burgdorferi binds complement factor H using a dimeric surface protein, CspA (BbCRASP-1). Presented here is a new structure of CspA that suggests that there is a degree of flexibility between subunits which may have implications for complement regulator binding. Borrelia burgdorferi has evolved many mechanisms of evading the different immune systems across its range of reservoir hosts, including the capture and presentation of host complement regulators factor H and factor H-like protein-1 (FHL-1). Acquisition is mediated by a family of complement regulator-acquiring surface proteins (CRASPs), of which the atomic structure of CspA (BbCRASP-1) is known and shows the formation of a homodimeric species which is required for binding. Mutagenesis studies have mapped a putative factor H binding site to a cleft between the two subunits. Presented here is a new atomic structure of CspA which shows a degree of flexibility between the subunits which may be critical for factor H scavenging by increasing access to the binding interface and allows the possibility that the assembly can clamp around the bound complement regulators
Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory
Energy Technology Data Exchange (ETDEWEB)
Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)
2016-11-15
The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)
Directory of Open Access Journals (Sweden)
Pontón José
2007-04-01
Full Text Available Abstract Background The diagnosis of invasive candidiasis is difficult because there are no specific clinical manifestations of the disease and colonization and infection are difficult to distinguish. In the last decade, much effort has been made to develop reliable tests for rapid diagnosis of invasive candidiasis, but none of them have found widespread clinical use. Results Antibodies against a recombinant N-terminal fragment of the Candida albicans germ tube-specific antigen hyphal wall protein 1 (Hwp1 generated in Escherichia coli were detected by both immunoblotting and ELISA tests in a group of 36 hematological or Intensive Care Unit patients with invasive candidiasis and in a group of 45 control patients at high risk for the mycosis who did not have clinical or microbiological data to document invasive candidiasis. Results were compared with an immunofluorescence test to detect antibodies to C. albicans germ tubes (CAGT. The sensitivity, specificity, positive and negative predictive values of a diagnostic test based on the detection of antibodies against the N-terminal fragment of Hwp1 by immunoblotting were 27.8 %, 95.6 %, 83.3 % and 62.3 %, respectively. Detection of antibodies to the N-terminal fragment of Hwp1 by ELISA increased the sensitivity (88.9 % and the negative predictive value (90.2 % but slightly decreased the specificity (82.6 % and positive predictive values (80 %. The kinetics of antibody response to the N-terminal fragment of Hwp1 by ELISA was very similar to that observed by detecting antibodies to CAGT. Conclusion An ELISA test to detect antibodies against a recombinant N-terminal fragment of the C. albicans germ tube cell wall antigen Hwp1 allows the diagnosis of invasive candidiasis with similar results to those obtained by detecting antibodies to CAGT but without the need of treating the sera to adsorb the antibodies against the cell wall surface of the blastospore.
Directory of Open Access Journals (Sweden)
Jesús A. Rosales-Castillo
2017-12-01
Full Text Available Litter fungal communities and their ligninolytic enzyme activities (laccase, Mn-peroxidase, and lignin-peroxidase play a vital role in forest biogeochemical cycles by breaking down plant cell wall polymers, including recalcitrant lignin. However, litter fungal communities and ligninolytic enzyme activities have rarely been studied in Neotropical, non-coniferous forests. Here, we found no significant differences in litter ligninolytic enzyme activities from well preserved, moderately disturbed, and heavily disturbed Quercus deserticola Trel. forests in central Mexico. However, we did find seasonal effects on enzyme activities: during the dry season, we observed lower laccase, and increased Mn-peroxidase and lignin-peroxidase activities, and in the rainy season, Mn-peroxidase and lignin-peroxidase activities were lower, while laccase activity peaked. Fungal diversity (Shannon-Weaver and Simpson indices based on ITS-rDNA analyses decreased with increased disturbance, and principal component analysis showed that litter fungal communities are structured differently between forest types. White-rot Polyporales and Auriculariales only occurred in the well preserved forest, and a high number of Ascomycota were shared between forests. While the degree of forest disturbance significantly affected the litter fungal community structure, the ligninolytic enzyme activities remained unaffected, suggesting functional redundancy and a possible role of generalist Ascomycota taxa in litter delignification. Forest conservation and restoration strategies must account for leaf litter and its associated fungal community.
Tachibana, Mayumi; Wu, Yimin; Iriko, Hideyuki; Muratova, Olga; MacDonald, Nicholas J.; Sattabongkot, Jetsumon; Takeo, Satoru; Otsuki, Hitoshi; Torii, Motomi; Tsuboi, Takafumi
2011-01-01
The aim of a malaria transmission-blocking vaccine is to block the development of malaria parasites in the mosquito and thus prevent subsequent infection of the human host. Previous studies have demonstrated that the gametocyte/gamete surface protein Pfs230 can induce transmission-blocking immunity and have evaluated Escherichia coli-produced Pfs230 as a transmission-blocking vaccine candidate. In this study, we used the wheat germ cell-free expression system to produce N-terminal fragments of Pfs230 and evaluated the transmission-blocking activity of antisera raised against the recombinant Pfs230 protein. The rabbit antisera reacted to the surface of cultured gametocytes and gametes of the Plasmodium falciparum NF54 line, recognized the 360-kDa form of parasite-produced Pfs230 by Western blot assay, and reduced the infectivity of NF54 parasites to Anopheles stefensi mosquitoes in the presence of complement in a standard membrane feeding assay. Thus, our data demonstrate that the N-terminal pro domain of Pfs230 is sufficient to induce complement-dependent transmission-blocking activity against P. falciparum. PMID:21715579
Tachibana, Mayumi; Wu, Yimin; Iriko, Hideyuki; Muratova, Olga; MacDonald, Nicholas J; Sattabongkot, Jetsumon; Takeo, Satoru; Otsuki, Hitoshi; Torii, Motomi; Tsuboi, Takafumi
2011-08-01
The aim of a malaria transmission-blocking vaccine is to block the development of malaria parasites in the mosquito and thus prevent subsequent infection of the human host. Previous studies have demonstrated that the gametocyte/gamete surface protein Pfs230 can induce transmission-blocking immunity and have evaluated Escherichia coli-produced Pfs230 as a transmission-blocking vaccine candidate. In this study, we used the wheat germ cell-free expression system to produce N-terminal fragments of Pfs230 and evaluated the transmission-blocking activity of antisera raised against the recombinant Pfs230 protein. The rabbit antisera reacted to the surface of cultured gametocytes and gametes of the Plasmodium falciparum NF54 line, recognized the 360-kDa form of parasite-produced Pfs230 by Western blot assay, and reduced the infectivity of NF54 parasites to Anopheles stefensi mosquitoes in the presence of complement in a standard membrane feeding assay. Thus, our data demonstrate that the N-terminal pro domain of Pfs230 is sufficient to induce complement-dependent transmission-blocking activity against P. falciparum.
Designer genes. Recombinant antibody fragments for biological imaging
Energy Technology Data Exchange (ETDEWEB)
Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology
2000-09-01
Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering
Designer genes. Recombinant antibody fragments for biological imaging
International Nuclear Information System (INIS)
Wu, A.M.; Yazaki, P.J.
2000-01-01
Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and
Gouge, Michael F.
2011-01-01
Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.
Directory of Open Access Journals (Sweden)
Alfredo Sahagún-Ruiz
Full Text Available Pasteurella pneumotropica is an opportunist Gram negative bacterium responsible for rodent pasteurellosis that affects upper respiratory, reproductive and digestive tracts of mammals. In animal care facilities the presence of P. pneumotropica causes severe to lethal infection in immunodeficient mice, being also a potential source for human contamination. Indeed, occupational exposure is one of the main causes of human infection by P. pneumotropica. The clinical presentation of the disease includes subcutaneous abscesses, respiratory tract colonization and systemic infections. Given the ability of P. pneumotropica to fully disseminate in the organism, it is quite relevant to study the role of the complement system to control the infection as well as the possible evasion mechanisms involved in bacterial survival. Here, we show for the first time that P. pneumotropica is able to survive the bactericidal activity of the human complement system. We observed that host regulatory complement C4BP and Factor H bind to the surface of P. pneumotropica, controlling the activation pathways regulating the formation and maintenance of C3-convertases. These results show that P. pneumotropica has evolved mechanisms to evade the human complement system that may increase the efficiency by which this pathogen is able to gain access to and colonize inner tissues where it may cause severe infections.
Hakobyan, Svetlana; Luppe, Sebastian; Evans, David Rs; Harding, Katharine; Loveless, Samantha; Robertson, Neil P; Morgan, B Paul
2017-06-01
Multiple sclerosis (MS) and neuromyelitis optica spectrum disorder (NMOSD) are autoimmune inflammatory demyelinating diseases of the central nervous system. Although distinguished by clinicoradiological and demographic features, early manifestations can be similar complicating management. Antibodies against aquaporin-4 support the diagnosis of NMOSD but are negative in some patients. Therefore, there is unmet need for biomarkers that enable early diagnosis and disease-specific intervention. We investigated whether plasma complement proteins are altered in MS and NMOSD and provide biomarkers that distinguish these diseases. Plasma from 54 NMOSD, 40 MS and 69 control donors was tested in multiplex assays measuring complement activation products and proteins. Using logistic regression, we tested whether combinations of complement analytes distinguished NMOSD from controls and MS. All activation products were elevated in NMOSD compared to either control or MS. Four complement proteins (C1inh, C1s, C5 and FH) were higher in NMOSD compared to MS or controls. A model comprising C1inh and terminal complement complex (TCC) distinguished NMOSD from MS (area under the curve (AUC): 0.98), while C1inh and C5 distinguished NMOSD from controls (AUC: 0.94). NMOSD is distinguished from MS by plasma complement biomarkers. Selected complement analytes enable differential diagnosis. Findings support trials of anti-complement therapies in NMOSD.
Protective function of complement against alcohol-induced rat liver damage.
Bykov, Igor L; Väkevä, Antti; Järveläinen, Harri A; Meri, Seppo; Lindros, Kai O
2004-11-01
The complement system can promote tissue damage or play a homeostatic role in the clearance and disposal of damaged tissue. We assessed the role of the terminal complement pathway in alcohol-induced liver damage in complement C6 (C6-/-) genetically deficient rats. C6-/- and corresponding C6+/+ rats were continuously exposed to ethanol by feeding ethanol-supplemented liquid diet for six weeks. Liver samples were analyzed for histopathology and complement component deposition by immunofluorescence microscopy. Prostaglandin E receptors and cytokine mRNA levels were analyzed by RT-PCR and plasma cytokines by ELISA. Deposition of complement components C1, C3, C8 and C9 was observed in C6+/+ rats, but not in C6-/- animals. The histopathological changes, the liver weight increase and the elevation of the plasma pro-/anti-inflammatory TNF-alpha/IL-10 ratio were, on the other hand, more marked in C6-/- rats. Furthermore, ethanol enhanced the hepatic mRNA expression of the prostaglandin E receptors EP2R and EP4R exclusively in the C6-/- rats. Our results indicate that a deficient terminal complement pathway predisposes to tissue injury and promotes a pro-inflammatory cytokine response. This suggests that an intact complement system has a protective function in the development of alcoholic liver damage.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Payne, Lloyd R.; Cole, David L.
2010-03-30
A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.
CYP4F18-Deficient Neutrophils Exhibit Increased Chemotaxis to Complement Component C5a
Directory of Open Access Journals (Sweden)
Rachel Vaivoda
2015-01-01
Full Text Available CYP4Fs were first identified as enzymes that catalyze hydroxylation of leukotriene B4 (LTB4. CYP4F18 has an unusual expression in neutrophils and was predicted to play a role in regulating LTB4-dependent inflammation. We compared chemotaxis of wild-type and Cyp4f18 knockout neutrophils using an in vitro assay. There was no significant difference in the chemotactic response to LTB4, but the response to complement component C5a increased 1.9–2.25-fold in knockout cells compared to wild-type (P < 0.01. This increase was still observed when neutrophils were treated with inhibitors of eicosanoid synthesis. There were no changes in expression of other CYP4 enzymes in knockout neutrophils that might compensate for loss of CYP4F18 or lead to differences in activity. A mouse model of dextran sodium sulfate colitis was used to investigate the consequences of increased C5a-dependent chemotaxis in vivo, but there was no significant difference in weight loss, disease activity, or colonic tissue myeloperoxidase between wild-type and Cyp4f18 knockout mice. This study demonstrates the limitations of inferring CYP4F function based on an ability to use LTB4 as a substrate, points to expanding roles for CYP4F enzymes in immune regulation, and underscores the in vivo challenges of CYP knockout studies.
Directory of Open Access Journals (Sweden)
S. C. Oukouomi Noutchie
2014-01-01
Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.
Land fragmentation and production diversification
Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.
2018-01-01
We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver
Assessing reprogramming by chimera formation and tetraploid complementation.
Li, Xin; Xia, Bao-long; Li, Wei; Zhou, Qi
2015-01-01
Pluripotent stem cells can be evaluated by pluripotent markers expression, embryoid body aggregation, teratoma formation, chimera contribution and even more, tetraploid complementation. Whether iPS cells in general are functionally equivalent to normal ESCs is difficult to establish. Here, we present the detailed procedure for chimera formation and tetraploid complementation, the most stringent criterion, to assessing pluripotency.
Fragmentation processes in nuclear reactions
International Nuclear Information System (INIS)
Legrain, R.
1984-08-01
Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed
Rich, Megan C; Keene, Chesleigh N; Neher, Miriam D; Johnson, Krista; Yu, Zhao-Xue; Ganivet, Antoine; Holers, V Michael; Stahel, Philip F
2016-03-23
Intracerebral complement activation after severe traumatic brain injury (TBI) leads to a cascade of neuroinflammatory pathological sequelae that propagate host-mediated secondary brain injury and adverse outcomes. There are currently no specific pharmacological agents on the market to prevent or mitigate the development of secondary cerebral insults after TBI. A novel chimeric CR2-fH compound (mTT30) provides targeted inhibition of the alternative complement pathway at the site of tissue injury. This experimental study was designed to test the neuroprotective effects of mTT30 in a mouse model of closed head injury. The administration of 500 μg mTT30 i.v. at 1 h, 4 h and 24 h after head injury attenuated complement C3 deposition in injured brains, reduced the extent of neuronal cell death, and decreased post-injury microglial activation, compared to vehicle-injected placebo controls. These data imply that site-targeted alternative pathway complement inhibition may represent a new promising therapeutic avenue for the future management of severe TBI. Copyright © 2016. Published by Elsevier Ireland Ltd.
The role of the complement system in diabetic nephropathy
DEFF Research Database (Denmark)
Flyvbjerg, Allan
2017-01-01
-threatening disease. An increasing body of evidence points toward a role of the complement system in the pathogenesis of diabetic nephropathy. For example, circulating levels of mannose-binding lectin (MBL), a pattern recognition molecule of the innate immune system, have emerged as a robust biomarker...... for the development and progression of this disease, and evidence suggests that MBL, H-ficolin, complement component C3 and the membrane attack complex might contribute to renal injury in the hyperglycaemic mileu. New approaches to modulate the complement system might lead to the development of new agents to prevent...
Complement modulation of T cell immune responses during homeostasis and disease.
Clarke, Elizabeth V; Tenner, Andrea J
2014-11-01
The complement system is an ancient and critical effector mechanism of the innate immune system as it senses, kills, and clears infectious and/or dangerous particles and alerts the immune system to the presence of the infection and/or danger. Interestingly, an increasing number of reports have demonstrated a clear role for complement in the adaptive immune system as well. Of note, a number of recent studies have identified previously unknown roles for complement proteins, receptors, and regulators in T cell function. Here, we will review recent data demonstrating the influence of complement proteins C1q, C3b/iC3b, C3a (and C3aR), and C5a (and C5aR) and complement regulators DAF (CD55) and CD46 (MCP) on T cell function during homeostasis and disease. Although new concepts are beginning to emerge in the field of complement regulation of T cell function, future experiments should focus on whether complement is interacting directly with the T cell or is having an indirect effect on T cell function via APCs, the cytokine milieu, or downstream complement activation products. Importantly, the identification of the pivotal molecular pathways in the human systems will be beneficial in the translation of concepts derived from model systems to therapeutic targeting for treatment of human disorders. © 2014 Society for Leukocyte Biology.
ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R
Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia
Effects of Habitat Fragmentation on Genetic Diversity in Cycas Balansae (Cycadaceae
Directory of Open Access Journals (Sweden)
Nguyen Minh Tam
2017-11-01
Full Text Available Habitat fragmentation is a serious threat to species survival. In Vietnam, Cycas balansae has been considered as threatened species because of the reduction and fragmentation of its habitats and over-exploitation. We assessed genetic variability and the pattern of population structure among six populations sampled in four provinces: Hoa Binh, Ha Nam, Ninh Binh and Quang Ninh. Polyacrylamide gel electrophoresis was performed on leaf tissues from 152 individuals representing 6 populations of C. balansae. Six of twelve enzyme systems were used to estimate genetic diversity at population and species levels. Eleven loci were examined. The allozyme data showed high levels of genetic diversity within all populations, ranging from 0.538 in Ba Sao to 0.628 in Tan Dan (average 0.576. The maintenance of high levels of expected heterozygosity (average 0.571 and low in observed heterozygosity (average 0.347 might be related to great heterozygote deficiency and increased frequencies of rare alleles. Genetic differentiation among populations was low (Dst = 0.036 and Gst = 0.064, indicating high level of gene flow (Nm = 3.22. Isolation by geographical distance was observed, however, no significant relationship between genetic distances and geographical distances was recorded. Our studies suggest small population sizes of cycads brought about by fragmentation of its habitats, over-exploitation, and increasing number of inbred individuals within populations.
Detection of secondary binding sites in proteins using fragment screening.
Ludlow, R Frederick; Verdonk, Marcel L; Saini, Harpreet K; Tickle, Ian J; Jhoti, Harren
2015-12-29
Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets.
Directory of Open Access Journals (Sweden)
Caldeira Roberta L
2000-01-01
Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.
Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir
2015-06-01
A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.
Schroeder, Hélène; Daix, Virginie; Gillet, Laurent; Renauld, Jean-Christophe; Vanderplasschen, Alain
2007-02-01
Several observations suggest that inhibition of the host complement alternative pathway by Ixodes tick saliva is crucial to achieve blood feeding. We recently described two paralogous anti-complement proteins called Ixodes ricinus anti-complement (IRAC) proteins I and II co-expressed in I. ricinus salivary glands. Phylogenetic analyses suggested that these sequences were diversifying by a process of positive Darwinian selection, possibly leading to molecules with different biological properties. In the present study, we tested the hypothesis that each paralogue may have different inhibitory activities against the complement of different natural host species, thereby contributing to broaden the host range of I. ricinus ticks. IRAC I and IRAC II were tested against the complement of eight I. ricinus natural host species (six mammals and two birds). The results demonstrate that IRAC I and IRAC II have broad and complementary inhibition activities against the complement of different host species. This report is the first description of paralogous anti-complement molecules encoded by a pathogen with broad and complementary inhibitory activities against the complement of different host species.
Implication of urinary complement factor H in the progression of immunoglobulin A nephropathy.
Directory of Open Access Journals (Sweden)
Maojing Liu
Full Text Available After activation, the complement system is involved in the pathogenesis of Immunoglobulin A nephropathy (IgAN. Complement factor H (CFH is a crucial inhibitory factor of the alternative pathway of the complement system. The study investigated the effects of urinary CFH levels on IgAN progression.A total of 351 patients with IgAN participated in this study. They were followed up for an average of 51.8 ± 26.6 months. Renal outcome was defined as a composite endpoint, that included instances of end-stage renal disease (ESRD, ≥ 50% decline in estimated glomerular filtration rate (eGFR or doubling of plasma creatinine levels. Urinary CFH levels were measured by enzyme-linked immunosorbent assay and calculated as the ratio of urinary CFH over creatinine (uCFH/uCr.In the whole cohort, uCFH/uCr values were associated with disease progression either as continuous [log(uCFH/uCr] or categorical traits (dichotomous and quartile variables after adjusting for eGFR, proteinuria, mean arterial blood pressure, histological grading and immunosuppressive therapy in the Cox proportional hazard model. Kaplan-Meier analysis showed that higher uCFH/uCr values at baseline predicted worse renal outcome during follow-up (log-rank, P < 0.001. Receiver operating characteristic curve (ROC analysis showed that log(uCFH/uCr had predictive value for renal outcome (area under curve [AUC] = 0.745, and the AUC increased to 0.805 after being incorporated into baseline eGFR and proteinuria. In subgroup analysis with eGFR ≥ 60 mL/min/1.73 m2, log(uCFH/uCr had better predictive value (AUC = 0.724, P = 0.002 for renal outcome compared to eGFR (AUC = 0.582, P = 0.259 and proteinuria (AUC = 0.615, P = 0.114.Urinary CFH levels are associated with renal function decline and increased urinary CFH levels are a risk factor for progression of IgA nephropathy.
Role of complement in porphyrin-induced photosensitivity
International Nuclear Information System (INIS)
Lim, H.W.; Gigli, I.
1981-01-01
Addition of porphyrins to sera of guinea pigs in vitro, followed by irradiation with 405 nm light, resulted in dose-dependent inhibitions of hemolytic activity of complement. With guinea pig as an animal model, we also found that systemically administered porphyrins, followed by irradiation with 405 nm light, resulted in dose-dependent inhibition of CH50 in vivo. The erythrocytes from porphyrin-treated guinea pigs showed an increased susceptibility to hemolysis induced by 405 nm irradiation in vitro. Clinical changes in these animals were limited to light-exposed areas and consisted of erythema, crusting, and delayed growth of hair. Histologically, dermal edema, dilation of blood vessels, and infiltration of mononuclear and polymorphonuclear cells were observed. Guinea pigs irradiated with ultraviolet-B developed erythema, but had no alteration of their complement profiles. It is suggested that complement products may play a specific role in the pathogenesis of the cutaneous lesions of some porphyrias
Gladysz, Rafaela; Cleenewerck, Matthias; Joossens, Jurgen; Lambeir, Anne-Marie; Augustyns, Koen; Van der Veken, Pieter
2014-10-13
Fragment-based drug discovery (FBDD) has evolved into an established approach for "hit" identification. Typically, most applications of FBDD depend on specialised cost- and time-intensive biophysical techniques. The substrate activity screening (SAS) approach has been proposed as a relatively cheap and straightforward alternative for identification of fragments for enzyme inhibitors. We have investigated SAS for the discovery of inhibitors of oncology target urokinase (uPA). Although our results support the key hypotheses of SAS, we also encountered a number of unreported limitations. In response, we propose an efficient modified methodology: "MSAS" (modified substrate activity screening). MSAS circumvents the limitations of SAS and broadens its scope by providing additional fragments and more coherent SAR data. As well as presenting and validating MSAS, this study expands existing SAR knowledge for the S1 pocket of uPA and reports new reversible and irreversible uPA inhibitor scaffolds. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A simple and robust approach to immobilization of antibody fragments.
Ikonomova, Svetlana P; He, Ziming; Karlsson, Amy J
2016-08-01
Antibody fragments, such as the single-chain variable fragment (scFv), have much potential in research and diagnostics because of their antigen-binding ability similar to a full-sized antibody and their ease of production in microorganisms. Some applications of antibody fragments require immobilization on a surface, and we have established a simple immobilization method that is based on the biotin-streptavidin interaction and does not require a separate purification step. We genetically fused two biotinylation tags-the biotin carboxyl carrier protein (BCCP) or the AviTag minimal sequence-to six different scFvs (scFv13R4, scFvD10, scFv26-10, scFv3, scFv5, and scFv12) for site-specific biotinylation in vivo by endogenous biotin ligases produced by Escherichia coli. The biotinylated scFvs were immobilized onto streptavidin-coated plates directly from cell lysates, and immobilization was detected through enzyme-linked immunosorbent assays. All scFvs fusions were successfully immobilized, and scFvs biotinylated via the BCCP tag tended to immobilize better than those biotinylated via the AviTag, even when biotinylation efficiency was improved with the biotin ligase BirA. The ability of immobilized scFvs to bind antigens was confirmed using scFv13R4 and scFvD10 with their respective targets β-galactosidase and bacteriophage lambda head protein D (gpD). The immobilized scFv13R4 bound to β-galactosidase at the same level for both biotinylation tags when the surface was saturated with the scFv, and immobilized scFvs retained their functionality for at least 100days after immobilization. The simplicity and robustness of our method make it a promising approach for future applications that require antibody fragment immobilization. Copyright © 2016 Elsevier B.V. All rights reserved.
Aubin, P; Le Brun, G; Moldovan, F; Villette, J M; Créminon, C; Dumas, J; Homyrda, L; Soliman, H; Azizi, M; Fiet, J
1997-01-01
A sandwich-type enzyme immunoassay has been developed for measuring human big endothelin-1 (big ET-1) in human plasma and supernatant fluids from human cell cultures. Big ET-1 is the precursor of endothelin 1 (ET-1), the most potent vasoconstrictor known. A rabbit antibody raised against the big ET-1 COOH-terminus fragment was used as an immobilized antibody (anti-P16). The Fab' fragment of a monoclonal antibody (1B3) raised against the ET-1 loop fragment was used as the enzyme-labeled antibody, after being coupled to acetylcholinesterase. The lowest detectable value in the assay was 1.2 pg/mL (0.12 pg/well). The assay was highly specific for big ET-1, demonstrating no cross-reactivity with ET-1, big endothelin-2 (big ET-2), and big endothelin-3 (big ET-3). We used this assay to evaluate the effect of two different postural positions (supine and standing) on plasma big ET-1 concentrations in 11 male and 11 female healthy subjects. Data analysis revealed that neither sex nor body position influenced plasma big ET-1 concentrations. This assay should thus permit the detection of possible variations in plasma concentrations of big ET-1 in certain pathologies and, in association with ET-1 assay, make possible in vitro study of endothelin-converting enzyme activity in cell models. Such studies could clarify the physiological and clinical roles of this family of peptides.
Vujičić-Žagar, Andreja; Pijning, Tjaard; Kralj, Slavko; López, Cesar A.; Eeuwema, Wieger; Dijkhuizen, Lubbert; Dijkstra, Bauke W.
2010-01-01
Glucansucrases are large enzymes belonging to glycoside hydrolase family 70, which catalyze the cleavage of sucrose into fructose and glucose, with the concomitant transfer of the glucose residue to a growing α-glucan polymer. Among others, plaque-forming oral bacteria secrete these enzymes to
Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H
2011-01-01
Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.
Fragment informatics and computational fragment-based drug design: an overview and update.
Sheng, Chunquan; Zhang, Wannian
2013-05-01
Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.
Fragmentation modeling of a resin bonded sand
Hilth, William; Ryckelynck, David
2017-06-01
Cemented sands exhibit a complex mechanical behavior that can lead to sophisticated models, with numerous parameters without real physical meaning. However, using a rather simple generalized critical state bonded soil model has proven to be a relevant compromise between an easy calibration and good results. The constitutive model formulation considers a non-associated elasto-plastic formulation within the critical state framework. The calibration procedure, using standard laboratory tests, is complemented by the study of an uniaxial compression test observed by tomography. Using finite elements simulations, this test is simulated considering a non-homogeneous 3D media. The tomography of compression sample gives access to 3D displacement fields by using image correlation techniques. Unfortunately these fields have missing experimental data because of the low resolution of correlations for low displacement magnitudes. We propose a recovery method that reconstructs 3D full displacement fields and 2D boundary displacement fields. These fields are mandatory for the calibration of the constitutive parameters by using 3D finite element simulations. The proposed recovery technique is based on a singular value decomposition of available experimental data. This calibration protocol enables an accurate prediction of the fragmentation of the specimen.
Jensen, Rasmus K; Pihl, Rasmus; Gadeberg, Trine A F; Jensen, Jan K; Andersen, Kasper R; Thiel, Steffen; Laursen, Nick S; Andersen, Gregers Rom
2018-03-01
The complement system is a complex, carefully regulated proteolytic cascade for which suppression of aberrant activation is of increasing clinical relevance and inhibition of the complement alternative pathway is a subject of intense research. Here, we describe the nanobody hC3Nb1 that binds to multiple functional states of C3 with sub-nanomolar affinity. The nanobody causes a complete shutdown of alternative pathway activity in human and murine serum when present in concentrations comparable to C3, and hC3Nb1 is shown to prevent both proconvertase assembly as well as binding of the C3 substrate to C3 convertases. Our crystal structure of the C3b-hC3Nb1 complex and functional experiments demonstrate that proconvertase formation is blocked by steric hindrance between the nanobody and an Asn-linked glycan on complement factor B. In addition, hC3Nb1 is shown to prevent factor H binding to C3b rationalizing its inhibition of factor I activity. Our results identify hC3Nb1 as a versatile, inexpensive, and powerful inhibitor of the alternative pathway in both human and murine in vitro model systems of complement activation. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Complement in the Initiation and Evolution of Rheumatoid Arthritis
Holers, V. Michael; Banda, Nirmal K.
2018-01-01
The complement system is a major component of the immune system and plays a central role in many protective immune processes, including circulating immune complex processing and clearance, recognition of foreign antigens, modulation of humoral and cellular immunity, removal of apoptotic and dead cells, and engagement of injury resolving and tissue regeneration processes. In stark contrast to these beneficial roles, however, inadequately controlled complement activation underlies the pathogenesis of human inflammatory and autoimmune diseases, including rheumatoid arthritis (RA) where the cartilage, bone, and synovium are targeted. Recent studies of this disease have demonstrated that the autoimmune response evolves over time in an asymptomatic preclinical phase that is associated with mucosal inflammation. Notably, experimental models of this disease have demonstrated that each of the three major complement activation pathways plays an important role in recognition of injured joint tissue, although the lectin and amplification pathways exhibit particularly impactful roles in the initiation and amplification of damage. Herein, we review the complement system and focus on its multi-factorial role in human patients with RA and experimental murine models. This understanding will be important to the successful integration of the emerging complement therapeutics pipeline into clinical care for patients with RA. PMID:29892280
Abdelbaset-Ismail, A; Borkowska-Rzeszotek, S; Kubis, E; Bujko, K; Brzeźniakiewicz-Janus, K; Bolkun, L; Kloczko, J; Moniuszko, M; Basak, G W; Wiktor-Jedrzejczak, W; Ratajczak, M Z
2017-02-01
As a crucial arm of innate immunity, the complement cascade (ComC) is involved both in mobilization of normal hematopoietic stem/progenitor cells (HSPCs) from bone marrow (BM) into peripheral blood and in their homing to BM. Despite the fact that ComC cleavage fragments alone do not chemoattract normal HSPCs, we found that leukemia cell lines as well as clonogenic blasts from chronic myeloid leukemia and acute myeloid leukemia patients respond robustly to C3 and C5 cleavage fragments by chemotaxis and increased adhesion. This finding was supported by the detection of C3a and C5a receptors in cells from human malignant hematopoietic cell lines and patient blasts at the mRNA (reverse transcriptase-polymerase chain reaction) and protein level (fluorescence-activated cell sorting), and by the demonstration that these receptors respond to stimulation by C3a and C5a by phosphorylation of p42/44 and p38 mitogen-activated protein kinases (MAPK), and protein kinase B (PKB/AKT). We also found that inducible heme oxygenase 1 (HO-1) is a negative regulator of ComC-mediated trafficking of leukemic cells, and that stimulation of leukemic cells by C3 or C5 cleavage fragments activates p38 MAPK, which downregulates HO-1 expression, rendering cells more mobile. We conclude that activation of the ComC in leukemia/lymphoma patients (for example, as a result of accompanying infections) enhances the motility of malignant cells and contributes to their spread in a p38 MAPK-HO-1-dependent manner. Therefore, inhibition of p38 MAPK or upregulation of HO-1 by small-molecule modulators would have a beneficial effect on ameliorating cell migration-mediated expansion of leukemia/lymphoma cells when the ComC becomes activated.
Abdelbaset-Ismail, A; Borkowska-Rzeszotek, S; Kubis, E; Bujko, K; Brzeźniakiewicz-Janus, K; Bolkun, L; Kloczko, J; Moniuszko, M; Basak, G W; Wiktor-Jedrzejczak, W; Ratajczak, M Z
2017-01-01
As a crucial arm of innate immunity, the complement cascade (ComC) is involved both in mobilization of normal hematopoietic stem/progenitor cells (HSPCs) from bone marrow (BM) into peripheral blood and in their homing to BM. Despite the fact that ComC cleavage fragments alone do not chemoattract normal HSPCs, we found that leukemia cell lines as well as clonogenic blasts from chronic myeloid leukemia and acute myeloid leukemia patients respond robustly to C3 and C5 cleavage fragments by chemotaxis and increased adhesion. This finding was supported by the detection of C3a and C5a receptors in cells from human malignant hematopoietic cell lines and patient blasts at the mRNA (reverse transcriptase-polymerase chain reaction) and protein level (fluorescence-activated cell sorting), and by the demonstration that these receptors respond to stimulation by C3a and C5a by phosphorylation of p42/44 and p38 mitogen-activated protein kinases (MAPK), and protein kinase B (PKB/AKT). We also found that inducible heme oxygenase 1 (HO-1) is a negative regulator of ComC-mediated trafficking of leukemic cells, and that stimulation of leukemic cells by C3 or C5 cleavage fragments activates p38 MAPK, which downregulates HO-1 expression, rendering cells more mobile. We conclude that activation of the ComC in leukemia/lymphoma patients (for example, as a result of accompanying infections) enhances the motility of malignant cells and contributes to their spread in a p38 MAPK–HO-1-dependent manner. Therefore, inhibition of p38 MAPK or upregulation of HO-1 by small-molecule modulators would have a beneficial effect on ameliorating cell migration-mediated expansion of leukemia/lymphoma cells when the ComC becomes activated. PMID:27451975
Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio
2014-08-30
The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.
Knowledge-based Fragment Binding Prediction
Tang, Grace W.; Altman, Russ B.
2014-01-01
Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971
Evasion Mechanisms Used by Pathogens to Escape the Lectin Complement Pathway
DEFF Research Database (Denmark)
Rosbjerg, Anne; Genster, Ninette; Pilely, Katrine
2017-01-01
The complement system is a crucial defensive network that protects the host against invading pathogens. It is part of the innate immune system and can be initiated via three pathways: the lectin, classical and alternative activation pathway. Overall the network compiles a group of recognition...... the level of activity. The result is a pro-inflammatory response meant to combat foreign microbes. Microbial elimination is, however, not a straight forward procedure; pathogens have adapted to their environment by evolving a collection of evasion mechanisms that circumvent the human complement system....... Complement evasion strategies features different ways of exploiting human complement proteins and moreover features different pathogen-derived proteins that interfere with the normal processes. Accumulated, these mechanisms target all three complement activation pathways as well as the final common part...
Czech Academy of Sciences Publication Activity Database
Korecká, L.; Bílková, Z.; Holčapek, M.; Královský, J.; Beneš, Milan J.; Lenfeld, Jiří; Minc, N.; Cecal, R.; Viovy, J.-L.; Przybylski, M.
2004-01-01
Roč. 808, č. 1 (2004), s. 15-24 ISSN 1570-0232. [International Symposium on Polymer Design for BioSeparation and Nanobiotechnology /8./. Compiegne, 27.11.2003-29.11.2003] Grant - others:GA ČR(CZ) GA203/02/0023 Program:GA Institutional research plan: CEZ:AV0Z4050913 Keywords : immobilized enzyme reactors * immunoglobulin G Subject RIV: CE - Biochemistry Impact factor: 2.176, year: 2004
Lirman
2000-08-23
Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.
Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.
Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N
2016-01-01
Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.
Fractal statistics of brittle fragmentation
Directory of Open Access Journals (Sweden)
M. Davydova
2013-04-01
Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.
High-throughput assay of 9 lysosomal enzymes for newborn screening.
Spacil, Zdenek; Tatipaka, Haribabu; Barcenas, Mariana; Scott, C Ronald; Turecek, Frantisek; Gelb, Michael H
2013-03-01
There is interest in newborn screening of lysosomal storage diseases (LSDs) because of the availability of treatments. Pilot studies have used tandem mass spectrometry with flow injection of samples to achieve multiplex detection of enzyme products. We report a multiplexing method of 9 enzymatic assays that uses HPLC-tandem mass spectrometry (MS/MS). The assay of 9 enzymes was carried out in 1 or 2 buffers with a cassette of substrates and internal standards and 1 or 2 punches of a dried blood spot (DBS) from a newborn screening card as the source of enzymes. The pre-HPLC-MS/MS sample preparation required only 4 liquid transfers before injection into a dual-column HPLC equipped with switching valves to direct the flow to separation and column equilibration. Product-specific and internal standard-specific ion fragmentations were used for MS/MS quantification in the selected reaction monitoring mode. Analysis of blood spots from 58 random newborns and lysosomal storage disease-affected patients showed that the assay readily distinguished affected from nonaffected individuals. The time per 9-plex analysis (1.8 min) was sufficiently short to be compatible with the workflow of newborn screening laboratories. HPLC-MS/MS provides a viable alternative to flow-injection MS/MS for the quantification of lysosomal enzyme activities. It is possible to assay 9 lysosomal enzymes using 1 or 2 reaction buffers, thus minimizing the number of separate incubations necessary.
Influence of complement on neutrophil extracellular trap release induced by bacteria
DEFF Research Database (Denmark)
Palmer, Lisa Joanne; Damgaard, Christian; Holmstrup, Palle
2016-01-01
by Staphylococcus aureus and three oral bacteria: Actinomyces viscosus, Aggregatibacter actinomycetemcomitans and Fusobacterium nucleatum subsp. vincettii. Material and Methods Bacteria-stimulated NET release from the neutrophils of healthy donors was measured fluorometrically. Various complement containing...... In conclusion, complement opsonization promotes NET release induced by a variety of bacteria, including A. actinomycetemcomitans, and CR1 plays a dominant role in the process. Complement consumption or deficiency may compromise NETosis induced by some bacterial species, including A. actinomycetemcomitans....... Within biofilms, the complement-inactivating abilities of some bacteria may protect other species against NETosis, while these are more vulnerable when adopting a planktonic lifestyle....
The complement system and its role in the pathogenesis of periodontitis
DEFF Research Database (Denmark)
Damgaard, Christian; Holmstrup, Palle; Van Dyke, Thomas E.
2015-01-01
Periodontitis is a highly prevalent inflammatory disease in tooth supporting tissues, induced by bacteria growing in a biofilm on tooth surfaces. Components of the complement system are present in the periodontal tissue and the system is activated in periodontitis. Continuous complement activation...... and modulation by bacteria within the biofilm in periodontal pockets, however, may enhance local tissue destruction, providing the biofilm with both essential nutrients and space to grow. A more profound understanding of the mechanisms involved in complement-derived tissue degradation may facilitate...... with an emphasis on interaction of complement with bacteria from periodontitis-associated biofilm....
Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel
2011-01-01
A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014
Complement Involvement in Periodontitis: Molecular Mechanisms and Rational Therapeutic Approaches.
Hajishengallis, George; Maekawa, Tomoki; Abe, Toshiharu; Hajishengallis, Evlambia; Lambris, John D
2015-01-01
The complement system is a network of interacting fluid-phase and cell surface-associated molecules that trigger, amplify, and regulate immune and inflammatory signaling pathways. Dysregulation of this finely balanced network can destabilize host-microbe homeostasis and cause inflammatory tissue damage. Evidence from clinical and animal model-based studies suggests that complement is implicated in the pathogenesis of periodontitis, a polymicrobial community-induced chronic inflammatory disease that destroys the tooth-supporting tissues. This review discusses molecular mechanisms of complement involvement in the dysbiotic transformation of the periodontal microbiome and the resulting destructive inflammation, culminating in loss of periodontal bone support. These mechanistic studies have additionally identified potential therapeutic targets. In this regard, interventional studies in preclinical models have provided proof-of-concept for using complement inhibitors for the treatment of human periodontitis.
Energy Technology Data Exchange (ETDEWEB)
Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)
2014-02-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.
International Nuclear Information System (INIS)
Brax, Philippe; Upadhye, Amol
2014-01-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments
Böhnke, Stefanie; Perner, Mirjam
2015-03-01
Ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) is a key enzyme of the Calvin cycle, which is responsible for most of Earth's primary production. Although research on RubisCO genes and enzymes in plants, cyanobacteria and bacteria has been ongoing for years, still little is understood about its regulation and activation in bacteria. Even more so, hardly any information exists about the function of metagenomic RubisCOs and the role of the enzymes encoded on the flanking DNA owing to the lack of available function-based screens for seeking active RubisCOs from the environment. Here we present the first solely activity-based approach for identifying RubisCO active fosmid clones from a metagenomic library. We constructed a metagenomic library from hydrothermal vent fluids and screened 1056 fosmid clones. Twelve clones exhibited RubisCO activity and the metagenomic fragments resembled genes from Thiomicrospira crunogena. One of these clones was further analyzed. It contained a 35.2 kb metagenomic insert carrying the RubisCO gene cluster and flanking DNA regions. Knockouts of twelve genes and two intergenic regions on this metagenomic fragment demonstrated that the RubisCO activity was significantly impaired and was attributed to deletions in genes encoding putative transcriptional regulators and those believed to be vital for RubisCO activation. Our new technique revealed a novel link between a poorly characterized gene and RubisCO activity. This screen opens the door to directly investigating RubisCO genes and respective enzymes from environmental samples.
The Role of Complement Inhibition in Thrombotic Angiopathies and Antiphospholipid Syndrome
Erkan, Doruk; Salmon, Jane E.
2016-01-01
Antiphospholipid syndrome (APS) is characterized by thrombosis (arterial, venous, small vessel) and/or pregnancy morbidity occurring in patients with persistently positive antiphospholipid antibodies (aPL). Catastrophic APS is the most severe form of the disease, characterized by multiple organ thromboses occurring in a short period and commonly associated with thrombotic microangiopathy (TMA). Similar to patients with complement regulatory gene mutations developing TMA, increased complement activation on endothelial cells plays a role in hypercoagulability in aPL-positive patients. In mouse models of APS, activation of the complement is required and interaction of complement (C) 5a with its receptor C5aR leads to aPL-induced inflammation, placental insufficiency, and thrombosis. Anti-C5 antibody and C5aR antagonist peptides prevent aPL-mediated pregnancy loss and thrombosis in these experimental models. Clinical studies of anti-C5 monoclonal antibody in aPL-positive patients are limited to a small number of case reports. Ongoing and future clinical studies of complement inhibitors will help determine the role of complement inhibition in the management of aPL-positive patients. PMID:27020721
Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L
2015-01-01
Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.
Inhibition of RecBCD enzyme by antineoplastic DNA alkylating agents.
Dziegielewska, Barbara; Beerman, Terry A; Bianco, Piero R
2006-09-01
To understand how bulky adducts might perturb DNA helicase function, three distinct DNA-binding agents were used to determine the effects of DNA alkylation on a DNA helicase. Adozelesin, ecteinascidin 743 (Et743) and hedamycin each possess unique structures and sequence selectivity. They bind to double-stranded DNA and alkylate one strand of the duplex in cis, adding adducts that alter the structure of DNA significantly. The results show that Et743 was the most potent inhibitor of DNA unwinding, followed by adozelesin and hedamycin. Et743 significantly inhibited unwinding, enhanced degradation of DNA, and completely eliminated the ability of the translocating RecBCD enzyme to recognize and respond to the recombination hotspot chi. Unwinding of adozelesin-modified DNA was accompanied by the appearance of unwinding intermediates, consistent with enzyme entrapment or stalling. Further, adozelesin also induced "apparent" chi fragment formation. The combination of enzyme sequestering and pseudo-chi modification of RecBCD, results in biphasic time-courses of DNA unwinding. Hedamycin also reduced RecBCD activity, albeit at increased concentrations of drug relative to either adozelesin or Et743. Remarkably, the hedamycin modification resulted in constitutive activation of the bottom-strand nuclease activity of the enzyme, while leaving the ability of the translocating enzyme to recognize and respond to chi largely intact. Finally, the results show that DNA alkylation does not significantly perturb the allosteric interaction that activates the enzyme for ATP hydrolysis, as the efficiency of ATP utilization for DNA unwinding is affected only marginally. These results taken together present a unique response of RecBCD enzyme to bulky DNA adducts. We correlate these effects with the recently determined crystal structure of the RecBCD holoenzyme bound to DNA.
Guilty as charged: all available evidence implicates complement's role in fetal demise.
Girardi, Guillermina
2008-03-01
Appropriate complement inhibition is an absolute requirement for normal pregancy. Uncontrolled complement activation in the maternal-fetal interface leads to fetal death. Here we show that complement activation is a crucial and early mediator of pregnancy loss in two different mouse models of pregnancy loss. Using a mouse model of fetal loss and growth restriction (IUGR) induced by antiphospholipid antibodies (aPL), we examined the role of complement activation in fetal loss and IUGR. We found that C5a-C5aR interaction and neutrophils are key mediators of fetal injury. Treatment with heparin, the standard therapy for pregnant patients with aPL, prevents complement activation and protects mice from pregnancy complications induced by aPL, and anticoagulants that do not inhibit complement do not protect pregnancies. In an antibody-independent mouse model of spontaneous miscarriage and IUGR (CBA/JxDBA/2) we also identified C5a as an essential mediator. Complement activation caused dysregulation of the angiogenic factors required for normal placental development. In CBA/JxDBA/2 mice, we observed inflammatory infiltrates in placentas, functional deficiency of free vascular endothelial growth factor (VEGF), elevated levels of soluble VEGF receptor-1 (sVEGFR-1, also known as sFlt-1; a potent anti-angiogenic molecule), and defective placental development. Inhibition of complement activation blocked the increase in sVEGFR-1 and rescued pregnancies. Our studies in antibody-dependent and antibody-independent models of pregnancy complications identified complement activation as the key mediator of damage and will allow development of new interventions to prevent pregnancy loss and IUGR.
Cloning, characterization, and expression of the dapE gene of Escherichia coli.
Bouvier, J; Richaud, C; Higgins, W; Bögler, O; Stragier, P
1992-01-01
The dapE gene of Escherichia coli encodes N-succinyl-L-diaminopimelic acid desuccinylase, an enzyme that catalyzes the synthesis of LL-diaminopimelic acid, one of the last steps in the diaminopimelic acid-lysine pathway. The dapE gene region was previously purified from a lambda bacteriophage transducing the neighboring purC gene (J. Parker, J. Bacteriol. 157:712-717, 1984). Various subcloning steps led to the identification of a 2.3-kb fragment that complemented several dapE mutants and allo...
Complementing xeroderma pigmentosum fibroblasts restore biological activity to UV-damaged DNA
International Nuclear Information System (INIS)
Day, R.S. III; Kraemer, K.H.; Robbins, J.H.
1975-01-01
UV survival curves of adenovirus 2 using fused complementing xeroderma pigmentosum fibroblast strains as virus hosts showed a component with an inactivation slope identical to that given by normal cells. This component was not observed when the fibroblasts were not fused or when fusions involved strains in the same complementing group. Extrapolation to zero dose indicated that three percent of the viral plaque-forming units had infected cells capable of normal repair; this suggested that three percent of the cells were complementing heterokaryons. Thus, heterokaryons formed from xeroderma pigmentosum fibroblasts belonging to different complementation groups are as capable of restoring biological activity to UV-damaged adenovirus 2 as are normal cells
DEFF Research Database (Denmark)
Jensen, Rasmus K; Pihl, Rasmus; Gadeberg, Trine A F
2018-01-01
The complement system is a complex, carefully regulated proteolytic cascade for which suppression of aberrant activation is of increasing clinical relevance and inhibition of the complement alternative pathway is a subject of intense research. Here, we describe the nanobody hC3Nb1 that binds...... to multiple functional states of C3 with sub-nanomolar affinity. The nanobody causes a complete shutdown of alternative pathway activity in human and murine serum when present in concentrations comparable to C3, and hC3Nb1 is shown to prevent both proconvertase assembly as well as binding of the C3 substrate...... to C3 convertases. Our crystal structure of the C3b-hC3Nb1 complex and functional experiments demonstrate that proconvertase formation is blocked by steric hindrance between the nanobody and an Asn-linked glycan on complement factor B. In addition, hC3Nb1 is shown to prevent factor H binding to C3b...
Universality of projectile fragmentation model
International Nuclear Information System (INIS)
Chaudhuri, G.; Mallik, S.; Das Gupta, S.
2012-01-01
Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation
Complement inhibitors for age-related macular degeneration.
Williams, Michael A; McKay, Gareth J; Chakravarthy, Usha
2014-01-15
Given the relatively high prevalence of age-related macular degeneration (AMD) and the increased incidence of AMD as populations age, the results of trials of novel treatments are awaited with much anticipation. The complement cascade describes a series of proteolytic reactions occurring throughout the body that generate proteins with a variety of roles including the initiation and promotion of immune reactions against foreign materials or micro-organisms. The complement cascade is normally tightly regulated, but much evidence implicates complement overactivity in AMD and so it is a logical therapeutic target in the treatment of AMD. To assess the effects and safety of complement inhibitors in the prevention or treatment of advanced AMD. We searched CENTRAL (which contains the Cochrane Eyes and Vision Group Trials Register) (The Cochrane Library 2013, Issue 11), Ovid MEDLINE, Ovid MEDLINE In-Process and Other Non-Indexed Citations, Ovid MEDLINE Daily, Ovid OLDMEDLINE (January 1946 to November 2013), EMBASE (January 1980 to November 2013), Allied and Complementary Medicine Database (AMED) (January 1985 to November 2013), Latin American and Caribbean Literature on Health Sciences (LILACS) (January 1982 to November 2013), OpenGrey (System for Information on Grey Literature in Europe) (www.opengrey.eu/), Web of Science Conference Proceedings Citation Index - Science (CPCI-S) (January 1990 to November 2013), the metaRegister of Controlled Trials (mRCT) (www.controlled-trials.com), ClinicalTrials.gov (www.clinicaltrials.gov) and the WHO International Clinical Trials Registry Platform (ICTRP) (www.who.int/ictrp/search/en). We did not use any date or language restrictions in the electronic searches for trials. We last searched the electronic databases on 21 November 2013. We also performed handsearching of proceedings, from 2012 onwards, of meetings and conferences of specific professional organisations. We planned to include randomised controlled trials (RCTs) with
DEFF Research Database (Denmark)
Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter
2014-01-01
Background: The use of cold-active enzymes has many advantages, including reduced energy consumption and easy inactivation. The ikaite columns of SW Greenland are permanently cold (4-6°C) and alkaline (above pH 10), and the microorganisms living there and their enzymes are adapted to these condit......Background: The use of cold-active enzymes has many advantages, including reduced energy consumption and easy inactivation. The ikaite columns of SW Greenland are permanently cold (4-6°C) and alkaline (above pH 10), and the microorganisms living there and their enzymes are adapted...... to these conditions. Since only a small fraction of the total microbial diversity can be cultured in the laboratory, a combined approach involving functional screening of a strain collection and a metagenomic library was undertaken for discovery of novel enzymes from the ikaite columns.Results: A strain collection...... complemented each other by targeting different microbial communities, highlighting the usefulness of combining methods for bioprospecting. Finally, we document here that ikaite columns constitute an important source of cold- and/or alkaline-active enzymes with industrial application potential....
Effects of radiographic contrast media on the serum complement system
International Nuclear Information System (INIS)
Tirone, P.; Boldrini, E.
1983-01-01
The authors explored the activation of the complement system produced by a nonionic organic iodine compound, namely iopamidol, which is proposed as a contrast medium for radiographic examination by intravenous and intra-arterial injection. The study was conducted in vitro versus established ionic contrasts (diatrizoate, iothalamate, acetrizoate) and a nonionic compound (metrizamide). The adopted experimental model was the immunohemolytic detector system, in which the immune complex consisted of goat erythrocytes sensitized with the corresponding antibody (hemolysin), and complement (C') was supplied by guinea pig serum. All the products caused complement activation. The results show that nonionic contrast media produce less activation of the complement system than the traditional ionic contrast. Thus the use of nonionic contrast for radiological procedures necessitating the introduction of contrast material into the blood compartment would imply a reduced risk of anaphylactoid reactions. (orig.)
Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.
Dubinets, Nikita; Slipchenko, Lyudmila V
2017-07-20
Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.
Genetic, molecular and functional analyses of complement factor I deficiency
DEFF Research Database (Denmark)
Nilsson, S.C.; Trouw, L.A.; Renault, N.
2009-01-01
Complete deficiency of complement inhibitor factor I (FI) results in secondary complement deficiency due to uncontrolled spontaneous alternative pathway activation leading to susceptibility to infections. Current genetic examination of two patients with near complete FI deficiency and three patie...
Kim, Kyoung Whun; Jeong, Soyoung; Ahn, Ki Bum; Yang, Jae Seung; Yun, Cheol-Heui; Han, Seung Hyun
2017-12-01
The vibriocidal assay using guinea pig complement is widely used for the evaluation of immune responses to cholera vaccines in human clinical trials. However, it is unclear why guinea pig complement has been used over human complement in the measurement of vibriocidal activity of human sera and there have not been comparison studies for the use of guinea pig complement over those from other species. Therefore, we comparatively investigated the effects of complements derived from human, guinea pig, rabbit, and sheep on vibriocidal activity. Complements from guinea pig, rabbit, and human showed concentration-dependent vibriocidal activity in the presence of quality control serum antibodies. Of these complements, guinea pig complement was the most sensitive and effective over a wide concentration range. When the vibriocidal activity of complements was measured in the absence of serum antibodies, human, sheep, and guinea pig complements showed vibriocidal activity up to 40-fold, 20-fold, and 1-fold dilution, respectively. For human pre- and post-vaccination sera, the most potent vibriocidal activity was observed when guinea pig complement was used. In addition, the highest fold-increases between pre- and post- vaccinated sera were obtained with guinea pig complement. Furthermore, human complement contained a higher amount of V. cholerae- and its lipopolysaccharide-specific antibodies than guinea pig complement. Collectively, these results suggest that guinea pig complements are suitable for vibriocidal assays due to their high sensitivity and effectiveness to human sera.
Robust Object Tracking Using Valid Fragments Selection.
Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang
Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.
Directory of Open Access Journals (Sweden)
Raymond Morales
Full Text Available Topoisomerases play a fundamental role in genome stability, DNA replication and repair. As a result, topoisomerases have served as therapeutic targets of interest in Eukarya and Bacteria, two of the three domains of life. Since members of Archaea, the third domain of life, have not been implicated in any diseased state to-date, there is a paucity of data on archaeal topoisomerases. Here we report Methanosarcina acetivorans TopoIIIα (MacTopoIIIα as the first biochemically characterized mesophilic archaeal topoisomerase. Maximal activity for MacTopoIIIα was elicited at 30-35°C and 100 mM NaCl. As little as 10 fmol of the enzyme initiated DNA relaxation, and NaCl concentrations above 250 mM inhibited this activity. The present study also provides the first evidence that a type IA Topoisomerase has activity in the presence of all divalent cations tested (Mg(2+, Ca(2+, Sr(2+, Ba(2+, Mn(2+, Fe(2+, Co(2+, Ni(2+, Cu(2+, Zn(2+ and Cd(2+. Activity profiles were, however, specific to each metal. Known type I (ssDNA and camptothecin and type II (etoposide, novobiocin and nalidixic acid inhibitors with different mechanisms of action were used to demonstrate that MacTopoIIIα is a type IA topoisomerase. Alignment of MacTopoIIIα with characterized topoisomerases identified Y317 as the putative catalytic residue, and a Y317F mutation ablated DNA relaxation activity, demonstrating that Y317 is essential for catalysis. As the role of Domain V (C-terminal domain is unclear, MacTopoIIIα was aligned with the canonical E. coli TopoI 67 kDa fragment in order to construct an N-terminal (1-586 and a C-terminal (587-752 fragment for analysis. Activity could neither be elicited from the fragments individually nor reconstituted from a mixture of the fragments, suggesting that native folding is impaired when the two fragments are expressed separately. Evidence that each of the split domains plays a role in Zn(2+ binding of the enzyme is also provided.
Niessen, W M A
2011-01-01
The identification of drugs and related compounds by LC-MS-MS is an important analytical challenge in several application areas, including clinical and forensic toxicology, doping control analysis, and environmental analysis. Although target-compound based analytical strategies are most frequently applied, at some point the information content of the MS-MS spectra becomes relevant. In this article, the positive-ion MS-MS spectra of a wide variety of drugs and related substances are discussed. Starting point was an MS-MS mass spectral library of toxicologically relevant compounds, available on the internet. The positive-ion MS-MS spectra of ∼570 compounds were interpreted by chemical and therapeutic class, thus involving a wide variety of drug compound classes, such benzodiazepines, beta-blockers, angiotensin-converting enzyme inhibitors, phenothiazines, dihydropyridine calcium channel blockers, diuretics, local anesthetics, vasodilators, as well as various subclasses of anti-diabetic, antidepressant, analgesic, and antihistaminic drugs. In addition, the scientific literature was searched for available MS-MS data of these compound classes and the interpretation thereof. The results of this elaborate study are presented in this article. For each individual compound class, the emphasis is on class-specific fragmentation, as discussing fragmentation of all individual compounds would take far too much space. The recognition of class-specific fragmentation may be quite informative in determining the compound class of a specific unknown, which may further help in the identification. In addition, knowledge on (class-specific) fragmentation may further help in the optimization of the selectivity in targeted analytical approaches of compounds of one particular class. Copyright © 2011 Wiley Periodicals, Inc.
Virulence of Group A Streptococci Is Enhanced by Human Complement Inhibitors
DEFF Research Database (Denmark)
Ermert, David; Shaughnessy, Jutamas; Joeris, Thorsten
2015-01-01
Streptococcus pyogenes, also known as Group A Streptococcus (GAS), is an important human bacterial pathogen that can cause invasive infections. Once it colonizes its exclusively human host, GAS needs to surmount numerous innate immune defense mechanisms, including opsonization by complement and c...... in studies of GAS pathogenesis and for developing vaccines and therapeutics that rely on human complement activation for efficacy.......Streptococcus pyogenes, also known as Group A Streptococcus (GAS), is an important human bacterial pathogen that can cause invasive infections. Once it colonizes its exclusively human host, GAS needs to surmount numerous innate immune defense mechanisms, including opsonization by complement...... and consequent phagocytosis. Several strains of GAS bind to human-specific complement inhibitors, C4b-binding protein (C4BP) and/or Factor H (FH), to curtail complement C3 (a critical opsonin) deposition. This results in diminished activation of phagocytes and clearance of GAS that may lead to the host being...
Directory of Open Access Journals (Sweden)
Kubra F Naqvi
2016-03-01
Full Text Available The enzymes involved in synthesizing the bacterial cell wall are attractive targets for the design of antibacterial compounds, since this pathway is essential for bacteria and is absent in animals, particularly humans. A survey of the genome of a bacterium that belongs to the phylum Verrucomicrobia, the closest free-living relative to bacteria from the Chlamydiales phylum, shows genetic evidence that Verrucomicrobium spinosum possesses a novel fusion open reading frame (ORF annotated by the locus tag (VspiD_010100018130. The ORF, which is predicted to encode the enzymes UDP-N-acetylenolpyruvoylglucosamine reductase (MurB and UDP-N-acetylmuramate:L-alanine ligase (MurC that are involved in the cytoplasmic steps of peptidoglycan biosynthesis, was cloned. In vivo analyses using functional complementation showed that the fusion gene was able to complement E. coli murB and murC temperature sensitive mutants. The purified recombinant fusion enzyme (MurB/CVs was shown to be endowed with UDP-N-acetylmuramate:L-alanine ligase activity. In vitro analyses demonstrated that the latter enzyme had a pH optimum of 9.0, a magnesium optimum of 10 mM and a temperature optimum of 44-46 oC. Its apparent Km values for ATP, UDP-MurNAc and L-alanine were 470, 90 and 25 µM, respectively. However, all attempts to demonstrate an in vitro UDP-N-acetylenolpyruvoylglucosamine reductase (MurB activity were unsuccessful. Lastly, Hidden Markov Model-based similarity search and phylogenetic analysis revealed that this fusion enzyme could only be identified in specific lineages within the Verrucomicrobia phylum.
Naqvi, Kubra F; Patin, Delphine; Wheatley, Matthew S; Savka, Michael A; Dobson, Renwick C J; Gan, Han Ming; Barreteau, Hélène; Blanot, Didier; Mengin-Lecreulx, Dominique; Hudson, André O
2016-01-01
The enzymes involved in synthesizing the bacterial cell wall are attractive targets for the design of antibacterial compounds, since this pathway is essential for bacteria and is absent in animals, particularly humans. A survey of the genome of a bacterium that belongs to the phylum Verrucomicrobia, the closest free-living relative to bacteria from the Chlamydiales phylum, shows genetic evidence that Verrucomicrobium spinosum possesses a novel fusion open reading frame (ORF) annotated by the locus tag (VspiD_010100018130). The ORF, which is predicted to encode the enzymes UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) and UDP-N-acetylmuramate:l-alanine ligase (MurC) that are involved in the cytoplasmic steps of peptidoglycan biosynthesis, was cloned. In vivo analyses using functional complementation showed that the fusion gene was able to complement Escherichia coli murB and murC temperature sensitive mutants. The purified recombinant fusion enzyme (MurB/C Vs ) was shown to be endowed with UDP-N-acetylmuramate:l-alanine ligase activity. In vitro analyses demonstrated that the latter enzyme had a pH optimum of 9.0, a magnesium optimum of 10 mM and a temperature optimum of 44-46°C. Its apparent K m values for ATP, UDP-MurNAc, and l-alanine were 470, 90, and 25 μM, respectively. However, all attempts to demonstrate an in vitro UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) activity were unsuccessful. Lastly, Hidden Markov Model-based similarity search and phylogenetic analysis revealed that this fusion enzyme could only be identified in specific lineages within the Verrucomicrobia phylum.
Naqvi, Kubra F.; Patin, Delphine; Wheatley, Matthew S.; Savka, Michael A.; Dobson, Renwick C. J.; Gan, Han Ming; Barreteau, Hélène; Blanot, Didier; Mengin-Lecreulx, Dominique; Hudson, André O.
2016-01-01
The enzymes involved in synthesizing the bacterial cell wall are attractive targets for the design of antibacterial compounds, since this pathway is essential for bacteria and is absent in animals, particularly humans. A survey of the genome of a bacterium that belongs to the phylum Verrucomicrobia, the closest free-living relative to bacteria from the Chlamydiales phylum, shows genetic evidence that Verrucomicrobium spinosum possesses a novel fusion open reading frame (ORF) annotated by the locus tag (VspiD_010100018130). The ORF, which is predicted to encode the enzymes UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) and UDP-N-acetylmuramate:l-alanine ligase (MurC) that are involved in the cytoplasmic steps of peptidoglycan biosynthesis, was cloned. In vivo analyses using functional complementation showed that the fusion gene was able to complement Escherichia coli murB and murC temperature sensitive mutants. The purified recombinant fusion enzyme (MurB/CVs) was shown to be endowed with UDP-N-acetylmuramate:l-alanine ligase activity. In vitro analyses demonstrated that the latter enzyme had a pH optimum of 9.0, a magnesium optimum of 10 mM and a temperature optimum of 44–46°C. Its apparent Km values for ATP, UDP-MurNAc, and l-alanine were 470, 90, and 25 μM, respectively. However, all attempts to demonstrate an in vitro UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) activity were unsuccessful. Lastly, Hidden Markov Model-based similarity search and phylogenetic analysis revealed that this fusion enzyme could only be identified in specific lineages within the Verrucomicrobia phylum. PMID:27047475
Classical Complement Pathway Activation in the Kidneys of Women With Preeclampsia.
Penning, Marlies; Chua, Jamie S; van Kooten, Cees; Zandbergen, Malu; Buurma, Aletta; Schutte, Joke; Bruijn, Jan Anthonie; Khankin, Eliyahu V; Bloemenkamp, Kitty; Karumanchi, S Ananth; Baelde, Hans
2015-07-01
A growing body of evidence suggests that complement dysregulation plays a role in the pathogenesis of preeclampsia. The kidney is one of the major organs affected in preeclampsia. Because the kidney is highly susceptible to complement activation, we hypothesized that preeclampsia is associated with renal complement activation. We performed a nationwide search for renal autopsy material in the Netherlands using a computerized database (PALGA). Renal tissue was obtained from 11 women with preeclampsia, 25 pregnant controls, and 14 nonpregnant controls with hypertension. The samples were immunostained for C4d, C1q, mannose-binding lectin, properdin, C3d, C5b-9, IgA, IgG, and IgM. Preeclampsia was significantly associated with renal C4d-a stable marker of complement activation-and the classical pathway marker C1q. In addition, the prevalence of IgM was significantly higher in the kidneys of the preeclamptic women. No other complement markers studied differed between the groups. Our findings in human samples were validated using a soluble fms-like tyrosine kinase 1 mouse model of preeclampsia. The kidneys in the soluble fms-like tyrosine kinase 1-injected mice had significantly more C4 deposits than the control mice. The association between preeclampsia and renal C4d, C1q, and IgM levels suggests that the classical complement pathway is involved in the renal injury in preeclampsia. Moreover, our finding that soluble fms-like tyrosine kinase 1-injected mice develop excess C4 deposits indicates that angiogenic dysregulation may play a role in complement activation within the kidney. We suggest that inhibiting complement activation may be beneficial for preventing the renal manifestations of preeclampsia. © 2015 American Heart Association, Inc.
Self-organized criticality in fragmenting
DEFF Research Database (Denmark)
Oddershede, L.; Dimon, P.; Bohr, J.
1993-01-01
The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...
Hobbs, Joanne K; Prentice, Erica J; Groussin, Mathieu; Arcus, Vickery L
2015-10-01
Ancestral sequence reconstruction has been widely used to study historical enzyme evolution, both from biochemical and cellular perspectives. Two properties of reconstructed ancestral proteins/enzymes are commonly reported--high thermostability and high catalytic activity--compared with their contemporaries. Increased protein stability is associated with lower aggregation rates, higher soluble protein abundance and a greater capacity to evolve, and therefore, these proteins could be considered "superior" to their contemporary counterparts. In this study, we investigate the relationship between the favourable in vitro biochemical properties of reconstructed ancestral enzymes and the organismal fitness they confer in vivo. We have previously reconstructed several ancestors of the enzyme LeuB, which is essential for leucine biosynthesis. Our initial fitness experiments revealed that overexpression of ANC4, a reconstructed LeuB that exhibits high stability and activity, was only able to partially rescue the growth of a ΔleuB strain, and that a strain complemented with this enzyme was outcompeted by strains carrying one of its descendants. When we expanded our study to include five reconstructed LeuBs and one contemporary, we found that neither in vitro protein stability nor the catalytic rate was correlated with fitness. Instead, fitness showed a strong, negative correlation with estimated evolutionary age (based on phylogenetic relationships). Our findings suggest that, for reconstructed ancestral enzymes, superior in vitro properties do not translate into organismal fitness in vivo. The molecular basis of the relationship between fitness and the inferred age of ancestral LeuB enzymes is unknown, but may be related to the reconstruction process. We also hypothesise that the ancestral enzymes may be incompatible with the other, contemporary enzymes of the metabolic network.
Evasion Mechanisms Used by Pathogens to Escape the Lectin Complement Pathway
DEFF Research Database (Denmark)
Rosbjerg, Anne; Genster, Ninette; Pilely, Katrine
2017-01-01
the level of activity. The result is a pro-inflammatory response meant to combat foreign microbes. Microbial elimination is, however, not a straight forward procedure; pathogens have adapted to their environment by evolving a collection of evasion mechanisms that circumvent the human complement system....... Complement evasion strategies features different ways of exploiting human complement proteins and moreover features different pathogen-derived proteins that interfere with the normal processes. Accumulated, these mechanisms target all three complement activation pathways as well as the final common part...... of the cascade. This review will cover the currently known lectin pathway evasion mechanisms and give examples of pathogens that operate these to increase their chance of invasion, survival and dissemination....
Energy production using fission fragment rockets
International Nuclear Information System (INIS)
Chapline, G.; Matsuda, Y.
1991-08-01
Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs
A RALDH-like enzyme involved in Fusarium verticillioides development
Dí az-Sá nchez, Violeta; Carmen Limó n, M.; Schaub, Patrick; Al-Babili, Salim; Avalos, Javier
2015-01-01
Retinaldehyde dehydrogenases (RALDHs) convert retinal to retinoic acid, an important chordate morphogen. Retinal also occurs in some fungi, such as Fusarium and Ustilago spp., evidenced by the presence of rhodopsins and β–carotene cleaving, retinal-forming dioxygenases. Based on the assumption that retinoic acid may also be formed in fungi, we searched the Fusarium protein databases for RALDHs homologs, focusing on Fusarium verticillioides. Using crude lysates of Escherichia coli cells expressing the corresponding cDNAs, we checked the capability of best matches to convert retinal into retinoic acid in vitro. Thereby, we identified an aldehyde dehydrogenase, termed CarY, as a retinoic acid-forming enzyme, an activity that was also exerted by purified CarY. Targeted mutation of the carY gene in F. verticillioides resulted in alterations of mycelia development and conidia morphology in agar cultures, and reduced capacity to produce perithecia as a female in sexual crosses. Complementation of the mutant with a wild-type carY allele demonstrated that these alterations are caused by the lack of CarY. However, retinoic acid could not be detected by LC-MS analysis either in the wild type or the complemented carY strain in vivo, making elusive the connection between CarY enzymatic activity and retinoic acid formation in the fungus.
A RALDH-like enzyme involved in Fusarium verticillioides development
Díaz-Sánchez, Violeta
2015-12-11
Retinaldehyde dehydrogenases (RALDHs) convert retinal to retinoic acid, an important chordate morphogen. Retinal also occurs in some fungi, such as Fusarium and Ustilago spp., evidenced by the presence of rhodopsins and β–carotene cleaving, retinal-forming dioxygenases. Based on the assumption that retinoic acid may also be formed in fungi, we searched the Fusarium protein databases for RALDHs homologs, focusing on Fusarium verticillioides. Using crude lysates of Escherichia coli cells expressing the corresponding cDNAs, we checked the capability of best matches to convert retinal into retinoic acid in vitro. Thereby, we identified an aldehyde dehydrogenase, termed CarY, as a retinoic acid-forming enzyme, an activity that was also exerted by purified CarY. Targeted mutation of the carY gene in F. verticillioides resulted in alterations of mycelia development and conidia morphology in agar cultures, and reduced capacity to produce perithecia as a female in sexual crosses. Complementation of the mutant with a wild-type carY allele demonstrated that these alterations are caused by the lack of CarY. However, retinoic acid could not be detected by LC-MS analysis either in the wild type or the complemented carY strain in vivo, making elusive the connection between CarY enzymatic activity and retinoic acid formation in the fungus.
Directory of Open Access Journals (Sweden)
McClendon Shara D
2012-07-01
Full Text Available Abstract Background Thermophilic fungi have attracted increased interest for their ability to secrete enzymes that deconstruct biomass at high temperatures. However, development of thermophilic fungi as enzyme producers for biomass deconstruction has not been thoroughly investigated. Comparing the enzymatic activities of thermophilic fungal strains that grow on targeted biomass feedstocks has the potential to identify promising candidates for strain development. Thielavia terrestris and Thermoascus aurantiacus were chosen for characterization based on literature precedents. Results Thermoascus aurantiacus and Thielavia terrestris were cultivated on various biomass substrates and culture supernatants assayed for glycoside hydrolase activities. Supernatants from both cultures possessed comparable glycoside hydrolase activities when incubated with artificial biomass substrates. In contrast, saccharifications of ionic liquid pretreated switchgrass (Panicum virgatum revealed that T. aurantiacus enzymes released more glucose than T. terrestris enzymes over a range of protein mass loadings and temperatures. Temperature-dependent saccharifications demonstrated that the T. aurantiacus proteins retained higher levels of activity compared to a commercial enzyme mixture sold by Novozymes, Cellic CTec2, at elevated temperatures. Enzymes secreted by T. aurantiacus released glucose at similar protein loadings to CTec2 on dilute acid, ammonia fiber expansion, or ionic liquid pretreated switchgrass. Proteomic analysis of the T. aurantiacus culture supernatant revealed dominant glycoside hydrolases from families 5, 7, 10, and 61, proteins that are key enzymes in commercial cocktails. Conclusions T. aurantiacus produces a complement of secreted proteins capable of higher levels of saccharification of pretreated switchgrass than T. terrestris enzymes. The T. aurantiacus enzymatic cocktail performs at the same level as commercially available enzymatic cocktail for
McClendon, Shara D; Batth, Tanveer; Petzold, Christopher J; Adams, Paul D; Simmons, Blake A; Singer, Steven W
2012-07-28
Thermophilic fungi have attracted increased interest for their ability to secrete enzymes that deconstruct biomass at high temperatures. However, development of thermophilic fungi as enzyme producers for biomass deconstruction has not been thoroughly investigated. Comparing the enzymatic activities of thermophilic fungal strains that grow on targeted biomass feedstocks has the potential to identify promising candidates for strain development. Thielavia terrestris and Thermoascus aurantiacus were chosen for characterization based on literature precedents. Thermoascus aurantiacus and Thielavia terrestris were cultivated on various biomass substrates and culture supernatants assayed for glycoside hydrolase activities. Supernatants from both cultures possessed comparable glycoside hydrolase activities when incubated with artificial biomass substrates. In contrast, saccharifications of ionic liquid pretreated switchgrass (Panicum virgatum) revealed that T. aurantiacus enzymes released more glucose than T. terrestris enzymes over a range of protein mass loadings and temperatures. Temperature-dependent saccharifications demonstrated that the T. aurantiacus proteins retained higher levels of activity compared to a commercial enzyme mixture sold by Novozymes, Cellic CTec2, at elevated temperatures. Enzymes secreted by T. aurantiacus released glucose at similar protein loadings to CTec2 on dilute acid, ammonia fiber expansion, or ionic liquid pretreated switchgrass. Proteomic analysis of the T. aurantiacus culture supernatant revealed dominant glycoside hydrolases from families 5, 7, 10, and 61, proteins that are key enzymes in commercial cocktails. T. aurantiacus produces a complement of secreted proteins capable of higher levels of saccharification of pretreated switchgrass than T. terrestris enzymes. The T. aurantiacus enzymatic cocktail performs at the same level as commercially available enzymatic cocktail for biomass deconstruction, without strain development or
Laarman, Alexander J; Bardoel, Bart W; Ruyken, Maartje; Fernie, Job; Milder, Fin J; van Strijp, Jos A G; Rooijakkers, Suzan H M
2012-01-01
The complement system rapidly detects and kills Gram-negative bacteria and supports bacterial killing by phagocytes. However, bacterial pathogens exploit several strategies to evade detection by the complement system. The alkaline protease (AprA) of Pseudomonas aeruginosa has been associated with bacterial virulence and is known to interfere with complement-mediated lysis of erythrocytes, but its exact role in bacterial complement escape is unknown. In this study, we analyzed how AprA interferes with complement activation and whether it could block complement-dependent neutrophil functions. We found that AprA potently blocked phagocytosis and killing of Pseudomonas by human neutrophils. Furthermore, AprA inhibited opsonization of bacteria with C3b and the formation of the chemotactic agent C5a. AprA specifically blocked C3b deposition via the classical and lectin pathways, whereas the alternative pathway was not affected. Serum degradation assays revealed that AprA degrades both human C1s and C2. However, repletion assays demonstrated that the mechanism of action for complement inhibition is cleavage of C2. In summary, we showed that P. aeruginosa AprA interferes with classical and lectin pathway-mediated complement activation via cleavage of C2.
Complement-mediated tumour growth: implications for cancer nanotechnology and nanomedicines
DEFF Research Database (Denmark)
Moghimi, S. M.; Andresen, Thomas Lars
2009-01-01
The recent unexpected observation that complement activation helps turnout growth and progression has an important bearing on the future development of cancer nanomedicines for site-specific tumour targeting as these entities are capable of triggering complement. These issues are discussed and su...
Fragmentation of relativistic nuclei
International Nuclear Information System (INIS)
Cork, B.
1975-06-01
Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)
Evasion Mechanisms Used by Pathogens to Escape the Lectin Complement Pathway.
Rosbjerg, Anne; Genster, Ninette; Pilely, Katrine; Garred, Peter
2017-01-01
The complement system is a crucial defensive network that protects the host against invading pathogens. It is part of the innate immune system and can be initiated via three pathways: the lectin, classical and alternative activation pathway. Overall the network compiles a group of recognition molecules that bind specific patterns on microbial surfaces, a group of associated proteases that initiates the complement cascade, and a group of proteins that interact in proteolytic complexes or the terminal pore-forming complex. In addition, various regulatory proteins are important for controlling the level of activity. The result is a pro-inflammatory response meant to combat foreign microbes. Microbial elimination is, however, not a straight forward procedure; pathogens have adapted to their environment by evolving a collection of evasion mechanisms that circumvent the human complement system. Complement evasion strategies features different ways of exploiting human complement proteins and moreover features different pathogen-derived proteins that interfere with the normal processes. Accumulated, these mechanisms target all three complement activation pathways as well as the final common part of the cascade. This review will cover the currently known lectin pathway evasion mechanisms and give examples of pathogens that operate these to increase their chance of invasion, survival and dissemination.
The complement system at the embryo implantation site: friend or foe?
Directory of Open Access Journals (Sweden)
Roberta eBulla
2012-03-01
Full Text Available An inflammatory-like process and vascular remodeling represent the main changes that occur in decidua in the early phase of pregnancy. These changes are partly induced by trophoblast cells that colonize the decidua and are also contributed by the complement system. C1q is one of the component components produced at feto-maternal interface that serves an important function in placental development. Decidual endothelial cells synthesize and express C1q on the cell surface where it acts as a molecular bridge between endovascular trophoblast and endothelial cells. C1q is also produced by extravillous trophoblast and is used to favor trophoblast migration through the decidua. C7 is another component produced and expressed on the membrane of endothelial cells and is involved in the control of the proinflammatory effect of the terminal complement complex. Defective expression of C1q by trophoblast is associated with impaired trophoblast invasion of decidua and may have important implications in pregnancy disorders such as preeclampsia characterized by reduced vascular remodeling. Local control of complement activation by several complement regulators including cell-bound C7 is critical to prevent complement-mediated tissue damage as suggested by recent data showing an association of preeclampsia with mutations in the genes encoding for some complement regulators.
Acute Systolic Heart Failure Associated with Complement-Mediated Hemolytic Uremic Syndrome
Directory of Open Access Journals (Sweden)
John L. Vaughn
2015-01-01
Full Text Available Complement-mediated hemolytic uremic syndrome (otherwise known as atypical HUS is a rare disorder of uncontrolled complement activation that may be associated with heart failure. We report the case of a 49-year-old female with no history of heart disease who presented with microangiopathic hemolytic anemia, thrombocytopenia, and acute kidney injury. Given her normal ADAMSTS13 activity, evidence of increased complement activation, and renal biopsy showing evidence of thrombotic microangiopathy, she was diagnosed with complement-mediated HUS. She subsequently developed acute hypoxemic respiratory failure secondary to pulmonary edema requiring intubation and mechanical ventilation. A transthoracic echocardiogram showed evidence of a Takotsubo cardiomyopathy with an estimated left ventricular ejection fraction of 20%, though ischemic cardiomyopathy could not be ruled out. Treatment was initiated with eculizumab. After several failed attempts at extubation, she eventually underwent tracheotomy. She also required hemodialysis to improve her uremia and hypervolemia. After seven weeks of hospitalization and five doses of eculizumab, her renal function and respiratory status improved, and she was discharged in stable condition on room air and independent of hemodialysis. Our case illustrates a rare association between acute systolic heart failure and complement-mediated HUS and highlights the potential of eculizumab in stabilizing even the most critically-ill patients with complement-mediated disease.
Energy Technology Data Exchange (ETDEWEB)
Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1965-07-01
This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de
Thermodynamics of the fuel fragmentation gas
International Nuclear Information System (INIS)
Perez, R.B.; Alsmiller, R.G. Jr.
1977-01-01
In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented
Von Neumann algebras as complemented subspaces of B(H)
DEFF Research Database (Denmark)
Christensen, Erik; Wang, Liguang
2014-01-01
Let M be a von Neumann algebra of type II1 which is also a complemented subspace of B( H). We establish an algebraic criterion, which ensures that M is an injective von Neumann algebra. As a corollary we show that if M is a complemented factor of type II1 on a Hilbert space H, then M is injective...
Directory of Open Access Journals (Sweden)
Hannah M W Salim
2009-10-01
Full Text Available The methionine salvage pathway is responsible for regenerating methionine from its derivative, methylthioadenosine. The complete set of enzymes of the methionine pathway has been previously described in bacteria. Despite its importance, the pathway has only been fully described in one eukaryotic organism, yeast. Here we use a computational approach to identify the enzymes of the methionine salvage pathway in another eukaryote, Tetrahymena thermophila. In this organism, the pathway has two fused genes, MTNAK and MTNBD. Each of these fusions involves two different genes whose products catalyze two different single steps of the pathway in other organisms. One of the fusion proteins, mtnBD, is formed by enzymes that catalyze non-consecutive steps in the pathway, mtnB and mtnD. Interestingly the gene that codes for the intervening enzyme in the pathway, mtnC, is missing from the genome of Tetrahymena. We used complementation tests in yeast to show that the fusion of mtnB and mtnD from Tetrahymena is able to do in one step what yeast does in three, since it can rescue yeast knockouts of mtnB, mtnC, or mtnD. Fusion genes have proved to be very useful in aiding phylogenetic reconstructions and in the functional characterization of genes. Our results highlight another characteristic of fusion proteins, namely that these proteins can serve as biochemical shortcuts, allowing organisms to completely bypass steps in biochemical pathways.
Breaking down the complement system: a review and update on novel therapies.
Reddy, Yuvaram N V; Siedlecki, Andrew M; Francis, Jean M
2017-03-01
The complement system represents one of the more primitive forms of innate immunity. It has increasingly been found to contribute to pathologies in the native and transplanted kidney. We provide a concise review of the physiology of the complement cascade, and discuss current and upcoming complement-based therapies. Current agents in clinical use either bind to complement components directly or prevent complement from binding to antibodies affixed to the endothelial surface. These include C1 esterase inhibitors, anti-C5 mAbs, anti-CD20 mAbs, and proteasome inhibitors. Treatment continues to show efficacy in the atypical hemolytic uremic syndrome and antibody-mediated rejection. Promising agents not currently available include CCX168, TP10, AMY-101, factor D inhibitors, coversin, and compstatin. Several new trials are targeting complement inhibition to treat antineutrophilic cystoplasmic antibody (ANCA)-associated vasculitis, C3 glomerulopathy, thrombotic microangiopathy, and IgA nephropathy. New agents for the treatment of the atypical hemolytic uremic syndrome are also in development. Complement-based therapies are being considered for targeted therapy in the atypical hemolytic uremic syndrome and antibody-mediated rejection, C3 glomerulopathy, and ANCA-associated vasculitis. A few agents are currently in use as orphan drugs. A number of other drugs are in clinical trials and, overall, are showing promising preliminary results.
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
Models of fragmentation with composite power laws
Tavassoli, Z.; Rodgers, G. J.
1999-06-01
Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.
Kinetics of fragmentation-annihilation processes
Filipe, JAN; Rodgers, GJ
1996-01-01
We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...
Fission fragment spins and spectroscopy
International Nuclear Information System (INIS)
Durell, J.L.
1988-01-01
Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission
How regional non-proliferation arrangements complement international verification
International Nuclear Information System (INIS)
Carlson, J.
1999-01-01
This presentation focuses on international verification in the form of IAEA Safeguards, and discusses the relationship between IAEA safeguards and the relevant regional arrangements, both the existing and the future. For most States the political commitment against acquisition of nuclear weapons has been carefully reached and strongly held. Their observance of treaty commitments does not depend on the deterrent effect of verification activities. Safeguards serve to assist States who recognise it is in their own interest to demonstrate their compliance to others. Thus safeguards are a vital confidence building measure in their own right, as well as being a major complement to the broader range of international confidence building measures. Safeguards can both complement other confidence building measures and in turn be complemented by them. Within consideration of how it could work it is useful to consider briefly current developments of IAEA safeguards, i.e. existing regional arrangements and nuclear weapon free zones
Manning, Michael L; Williams, Simon A; Jelinek, Christine A; Kostova, Maya B; Denmeade, Samuel R
2013-03-15
Prostate-specific Ag (PSA) is a serine protease that is expressed exclusively by normal and malignant prostate epithelial cells. The continued high-level expression of PSA by the majority of men with both high- and low-grade prostate cancer throughout the course of disease progression, even in the androgen-ablated state, suggests that PSA has a role in the pathogenesis of disease. Current experimental and clinical evidence suggests that chronic inflammation, regardless of the cause, may predispose men to prostate cancer. The responsibility of the immune system in immune surveillance and eventually tumor progression is well appreciated but not completely understood. In this study, we used a mass spectrometry-based evaluation of prostatic fluid obtained from diseased prostates after removal by radical prostatectomy to identify potential immunoregulatory proteins. This analysis revealed the presence of Igs and the complement system proteins C3, factor B, and clusterin. Verification of these findings by Western blot confirmed the high-level expression of C3 in the prostatic fluid and the presence of a previously uncharacterized C-terminal C3 cleavage product. Biochemical analysis of this C3 cleavage fragment revealed a putative PSA cleavage site after tyrosine-1348. Purified PSA was able to cleave iC3b and the related complement protein C5. These results suggest a previously uncharacterized function of PSA as an immunoregulatory protease that could help to create an environment hospitable to malignancy through proteolysis of the complement system.
A novel method for direct measurement of complement convertases activity in human serum
Blom, A.M.; Volokhina, E.B.; Fransson, V.; Stromberg, P.; Berghard, L.; Viktorelius, M.; Mollnes, T.E.; Lopez-Trascasa, M.; Heuvel, B. van den; Goodship, T.H.; Marchbank, K.J.; Okroj, M.
2014-01-01
Complement convertases are enzymatic complexes that play a central role in sustaining and amplification of the complement cascade. Impairment of complement function leads directly or indirectly to pathological conditions, including higher infection rate, kidney diseases, autoimmune- or
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-02-10
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-01-01
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614
Fragmentation of atomic clusters: A theoretical study
International Nuclear Information System (INIS)
Lopez, M.J.; Jellinek, J.
1994-01-01
Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time
Wang, Wenya; Zhang, Chao; Sun, Xinxiao; Su, Sisi; Li, Qiang; Linhardt, Robert J
2017-06-01
Lignin is the second most abundant bio-resource in nature. It is increasingly important to convert lignin into high value-added chemicals to accelerate the development of the lignocellulose biorefinery. Over the past several decades, physical and chemical methods have been widely explored to degrade lignin and convert it into valuable chemicals. Unfortunately, these developments have lagged because of several difficulties, of which high energy consumption and non-specific cleavage of chemical bonds in lignin remain the greatest challenges. A large number of enzymes have been discovered for lignin degradation and these are classified as radical lignolytic enzymes and non-radical lignolytic enzymes. Radical lignolytic enzymes, including laccases, lignin peroxidases, manganese peroxidases and versatile peroxidases, are radical-based bio-catalysts, which degrade lignins through non-specific cleavage of chemical bonds but can also catalyze the radical-based re-polymerization of lignin fragments. In contrast, non-radical lignolytic enzymes selectively cleave chemical bonds in lignin and lignin model compounds and, thus, show promise for use in the preparation of high value-added chemicals. In this mini-review, recent developments on non-radical lignolytic enzymes are discussed. These include recently discovered non-radical lignolytic enzymes, their metabolic pathways for lignin conversion, their recent application in the lignin biorefinery, and the combination of bio-catalysts with physical/chemical methods for industrial development of the lignin refinery.
DUOX enzyme activity promotes AKT signalling in prostate cancer cells.
Pettigrew, Christopher A; Clerkin, John S; Cotter, Thomas G
2012-12-01
Reactive oxygen species (ROS) and oxidative stress are related to tumour progression, and high levels of ROS have been observed in prostate tumours compared to normal prostate. ROS can positively influence AKT signalling and thereby promote cell survival. The aim of this project was to establish whether the ROS generated in prostate cancer cells positively regulate AKT signalling and enable resistance to apoptotic stimuli. In PC3 cells, dual oxidase (DUOX) enzymes actively generate ROS, which inactivate phosphatases, thereby maintaining AKT phosphorylation. Inhibition of DUOX by diphenylene iodium (DPI), intracellular calcium chelation and small-interfering RNA (siRNA) resulted in lower ROS levels, lower AKT and glycogen synthase kinase 3β (GSK3β) phosphorylation, as well as reduced cell viability and increased susceptibility to apoptosis stimulating fragment (FAS) induced apoptosis. This report shows that ROS levels in PC3 cells are constitutively maintained by DUOX enzymes, and these ROS positively regulate AKT signalling through inactivating phosphatases, leading to increased resistance to apoptosis.
The Role of Properdin in Zymosan- and Escherichia coli-Induced Complement Activation
DEFF Research Database (Denmark)
Harboe, Morten; Garred, Peter; Lindstad, Julie K
2012-01-01
Properdin is well known as an enhancer of the alternative complement amplification loop when C3 is activated, whereas its role as a recognition molecule of exogenous pathogen-associated molecular patterns and initiator of complement activation is less understood. We therefore studied the role...... of properdin in activation of complement in normal human serum by zymosan and various Escherichia coli strains. In ELISA, microtiter plates coated with zymosan induced efficient complement activation with deposition of C4b and terminal complement complex on the solid phase. Virtually no deposition of C4b...... cytometry was used to further explore whether properdin acts as an initial recognition molecule reacting directly with zymosan and three E. coli strains. Experiments reported by other authors were made with EGTA Mg(2+) buffer, permitting autoactivation of C3. We found inhibition by compstatin...
Distant homology between yeast photoreactivating gene fragment and human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1985-01-01
Hybridization of DNA coding for the yeast DNA photolyase to human genomic DNA appears to allow one to determine whether a conserved enzyme is coded for in human cells. Under stringent conditions (68 0 C), hybridization is not found between the cloned yeast fragment (YEp13-phr1) and human or chick genomic digests. At less stringent conditions (60 0 C), hybridization is observed with chick digests, indicating evolutionary divergence even among organisms capable of photo-reactivation. At 50 0 C, weak hybridization with human digests was observed, indicating further divergence from the cloned gene. Data concerning the precise extent of homology and methods to clone the chick gene for use as another probe are discussed
Lattices with unique complements
Saliĭ, V N
1988-01-01
The class of uniquely complemented lattices properly contains all Boolean lattices. However, no explicit example of a non-Boolean lattice of this class has been found. In addition, the question of whether this class contains any complete non-Boolean lattices remains unanswered. This book focuses on these classical problems of lattice theory and the various attempts to solve them. Requiring no specialized knowledge, the book is directed at researchers and students interested in general algebra and mathematical logic.
DNA fragmentation in spermatozoa
DEFF Research Database (Denmark)
Rex, A S; Aagaard, J.; Fedder, J
2017-01-01
Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...
Expression of spoT in Borrelia burgdorferi during Serum Starvation
Concepcion, Marc B.; Nelson, David R.
2003-01-01
Borrelia burgdorferi, the causative agent of Lyme disease, is transmitted by the tick Ixodes scapularis. A 2.9-kb fragment containing a putative spoT gene was isolated from B. burgdorferi genomic DNA by PCR amplification and cloned into a pBAD24 vector. The cloned gene complemented Escherichia coli mutant strain CF1693, which contains deletions of both the relA and spoT genes. The spoT gene in E. coli encodes a bifunctional enzyme capable of synthesizing and degrading (p)ppGpp, which mediates...
Bioinformatic analysis reveals high diversity of bacterial genes for laccase-like enzymes.
Directory of Open Access Journals (Sweden)
Luka Ausec
Full Text Available Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three-domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications.
Photon-hadron fragmentation: theoretical situation
International Nuclear Information System (INIS)
Peschanski, R.
1983-07-01
Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory
Invisible anti-cloak with elliptic cross section using phase complement
International Nuclear Information System (INIS)
Yang Yu-Qi; Zhang Min; Yue Jian-Xiang
2011-01-01
Based on the theory of phase complement, an anti-cloak with circular cross section can be made invisible to an object outside its domain. As the cloak with elliptic cross section is more effective to make objects invisible than that with circular cross section, a scaled coordinate system is proposed to design equivalent materials of invisible anti-cloak with elliptic cross section using phase complement. The cloaks with conventional dielectric and double negative parameters are both simulated with the geometrical transformations. The results show that the cloak with elliptic cross section through phase complement can effectively hide the outside objects. (classical areas of phenomenology)
koganova, Z I; Ingel', F I; Antipanova, N A; Legostoeva, T B; Poliakova, O V
2010-01-01
The paper provides the first fragment of a multiparameter study analyzing the influence of environmental pollution, the social and psychological features of a family, and some endogenous factors on genome stability and sensitivity in a developed ferrous metallurgy town. It also gives data on the urine and serum activity of the lysosomal enzyme N-acetyl-b-D-glucosaminidase (NAG) and the serum activity of catalase in an organized contingent of apparently healthy children (n = 178; 6 kindergartens) aged 5-7 years, who live permanently in Magnitogorsk at different distances from the metallurgical works. More than 70% of children selected for examination were found to have average normal levels of activity of the enzymes studied. According to the average levels of enzyme activity, there were only 2 kindergartens (both from the left-bank region). In the children from the left-bank area, enzyme activities varied more greatly, which suggests the higher prevalence of tense adaptation. Correlation analysis revealed association between the children's serum activity of enzymes and some components of snow pollution. It is anticipated that the found changes in serum activities of N-acetyl-beta-D-glucosaminidase and catalase may be determined by individual differences in a child's response to ambient air pollutants.
Recent progress on perturbative QCD fragmentation functions
International Nuclear Information System (INIS)
Cheung, K.
1995-05-01
The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons
Fragmentation and flow in central collisions
International Nuclear Information System (INIS)
Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.
1987-01-01
Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs
David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda
2010-01-01
Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...
Mass spectrometry for fragment screening.
Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris
2017-11-08
Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
2015-01-01
AMSH, a conserved zinc metallo deubiquitinase, controls downregulation and degradation of cell-surface receptors mediated by the endosomal sorting complexes required for transport (ESCRT) machinery. It displays high specificity toward the Lys63-linked polyubiquitin chain, which is used as a signal for ESCRT-mediated endosomal–lysosomal sorting of receptors. Herein, we report the crystal structures of the catalytic domain of AMSH orthologue Sst2 from fission yeast, its ubiquitin (product)-bound form, and its Lys63-linked diubiquitin (substrate)-bound form at 1.45, 1.7, and 2.3 Å, respectively. The structures reveal that the P-side product fragment maintains nearly all the contacts with the enzyme as seen with the P portion (distal ubiquitin) of the Lys63-linked diubiquitin substrate, with additional coordination of the Gly76 carboxylate group of the product with the active-site Zn2+. One of the product-bound structures described herein is the result of an attempt to cocrystallize the diubiquitin substrate bound to an active site mutant presumed to render the enzyme inactive, instead yielding a cocrystal structure of the enzyme bound to the P-side ubiquitin fragment of the substrate (distal ubiquitin). This fragment was generated in situ from the residual activity of the mutant enzyme. In this structure, the catalytic water is seen placed between the active-site Zn2+ and the carboxylate group of Gly76 of ubiquitin, providing what appears to be a snapshot of the active site when the product is about to depart. Comparison of this structure with that of the substrate-bound form suggests the importance of dynamics of a flexible flap near the active site in catalysis. The crystal structure of the Thr319Ile mutant of the catalytic domain of Sst2 provides insight into structural basis of microcephaly capillary malformation syndrome. Isothermal titration calorimetry yields a dissociation constant (KD) of 10.2 ± 0.6 μM for the binding of ubiquitin to the enzyme, a value
Mei, B.; Tu, X. L.; Wang, M.
2018-04-01
An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.
Yeast redoxyendonuclease, a DNA repair enzyme similar to Escherichia coli endonuclease III
International Nuclear Information System (INIS)
Gossett, J.; Lee, K.; Cunningham, R.P.; Doetsch, P.W.
1988-01-01
A DNA repair endonuclease (redoxyendonuclease) was isolated from bakers' yeast (Saccharomyces cerevisiae). The enzyme has been purified by a series of column chromatography steps and cleaves OsO 4 -damaged, double-stranded DNA at sites of thymine glycol and heavily UV-irradiated DNA at sites of cytosine, thymine, and guanine photoproducts. The base specificity and mechanism of phosphodiester bond cleavage for the yeast redoxyendonuclease appear to be identical with those of Escherichia coli endonuclease III when thymine glycol containing, end-labeled DNA fragments of defined sequence are employed as substrates. Yeast redoxyendonuclease has an apparent molecular size of 38,000-42,000 daltons and is active in the absence of divalent metal cations. The identification of such an enzyme in yeast may be of value in the elucidation of the biochemical basis for radiation sensitivity in certain yeast mutants
Computer systems for annotation of single molecule fragments
Schwartz, David Charles; Severin, Jessica
2016-07-19
There are provided computer systems for visualizing and annotating single molecule images. Annotation systems in accordance with this disclosure allow a user to mark and annotate single molecules of interest and their restriction enzyme cut sites thereby determining the restriction fragments of single nucleic acid molecules. The markings and annotations may be automatically generated by the system in certain embodiments and they may be overlaid translucently onto the single molecule images. An image caching system may be implemented in the computer annotation systems to reduce image processing time. The annotation systems include one or more connectors connecting to one or more databases capable of storing single molecule data as well as other biomedical data. Such diverse array of data can be retrieved and used to validate the markings and annotations. The annotation systems may be implemented and deployed over a computer network. They may be ergonomically optimized to facilitate user interactions.
Sano, Rie; Takahashi, Yoichiro; Hayakawa, Akira; Murayama, Masayuki; Kubo, Rieko; Hirasawa, Satoshi; Tokue, Hiroyuki; Shimada, Takehiro; Awata, Sachiko; Takei, Hiroyuki; Yuasa, Masahiro; Uetake, Shinji; Akuzawa, Hisashi; Kominato, Yoshihiko
2018-05-01
Postmortem computed tomography (PMCT) is becoming a commonly used modality in routine forensic investigation. Mechanical injuries including lacerations, incisions, stab wounds and gunshot wounds frequently contain foreign bodies that may have significant value as clues in criminal investigations. CT is a sensitive modality for detection of metal foreign bodies that may be associated with injuries to the victim in cases of homicide or traffic accidents. Here we report two cases in which PMCT was able to act as a guide to forensic pathologists for retrieval of metal fragments in the corpses of the victims, the retrieved fragments then being used to validate the confessions of the assailants through comparison with the knife and the crowbar, respectively, that had been used in the crimes. In these cases, the small metal fragments retrieved from the corpses of the victims with the aid of PMCT were decisive pieces of evidence confirming the circumstances of the crimes. These cases illustrate how PMCT can be used to complement the findings of classical autopsy for integrative investigation of corpses with injury. Copyright © 2018 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Moghimi, S.M.; Hamad, I.; Bunger, R.
2006-01-01
level of S-protein-bound form of the terminal complex (SC5b-9). However, liposome-induced rise of SC5b-9 was significantly suppressed when serum HDL cholesterol levels increased by 30%. Increase of serum LDL to levels similar to that observed in heterozygous familial hypercholesterolemia also suppressed......Intravenously infused liposomes may induce cardiopulmonary distress in some human subjects, which is a manifestation of "complement activation-related pseudoallergy." We have now examined liposome-mediated complement activation in human sera with elevated lipoprotein (LDL and HDL) levels, since...... abnormal or racial differences in serum lipid profiles seem to modulate the extent of complement activation and associated adverse responses. In accordance with our earlier observations, cholesterol-rich (45 mol% cholesterol) liposomes activated human complement, as reflected by a significant rise in serum...
Physics of projectile fragments
International Nuclear Information System (INIS)
Minamisono, Tadanori
1982-01-01
This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)
Dynamics of human complement-mediated killing of Klebsiella pneumoniae.
Nypaver, Christina M; Thornton, Margaret M; Yin, Suellen M; Bracho, David O; Nelson, Patrick W; Jones, Alan E; Bortz, David M; Younger, John G
2010-11-01
With an in vitro system that used a luminescent strain of Klebsiella pneumoniae to assess bacterial metabolic activity in near-real-time, we investigated the dynamics of complement-mediated attack in healthy individuals and in patients presenting to the emergency department with community-acquired severe sepsis. A novel mathematical/statistical model was developed to simplify light output trajectories over time into two fitted parameters, the rate of complement activation and the delay from activation to the onset of killing. Using Factor B-depleted serum, the alternative pathway was found to be the primary bactericidal effector: In the absence of B, C3 opsonization as measured by flow cytometry did not progress and bacteria proliferated near exponentially. Defects in bacterial killing were easily demonstrable in patients with severe sepsis compared with healthy volunteers. In most patients with sepsis, the rate of activation was higher than in normal subjects but was associated with a prolonged delay between activation and bacterial killing (P < 0.05 for both). Theoretical modeling suggested that this combination of accentuated but delayed function should allow successful bacterial killing but with significantly greater complement activation. The use of luminescent bacteria allowed for the development of a novel and powerful tool for assessing complement immunology for the purposes of mechanistic study and patient evaluation.
Sridevi, N. V.; Shukra, A. M.; Neelakantam, B.; Anilkumar, J.; Madhanmohan, M.; Rajan, S.; Dev Chandran
2014-01-01
Recombinant antibody fragments like single chain variable fragments (scFvs) represent an attractive yet powerful alternative to immunoglobulins and hold great potential in the development of clinical diagnostic/therapeutic reagents. Structurally, scFvs are the smallest antibody fragments capable of retaining the antigen-binding capacity of whole antibodies and are composed of an immunoglobulin (Ig) variable light (VL) and variable heavy (VH) chain joined by a flexible polypeptide linker. In the present study, we constructed a scFv against bovine IgA from a hybridoma cell line IL-A71 that secretes a monoclonal antibody against bovine IgA using recombinant DNA technology. The scFv was expressed in Escherichia coli and purified using immobilized metal affinity chromatography (IMAC). The binding activity and specificity of the scFv was established by its non-reactivity toward other classes of immunoglobulins as determined by enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis. Kinetic measurement of the scFv indicated that the recombinant antibody fragment had an affinity in picomolar range toward purified IgA. Furthermore, the scFv was used to develop a sensitive ELISA for the detection of foot and mouth disease virus (FMDV) carrier animals. PMID:24678404
DEFF Research Database (Denmark)
Palarasah, Yaseelan; Skjoedt, Mikkel-Ole; Vitved, Lars
2010-01-01
complement activation pathways: the classical, alternative, and lectin pathways, respectively. Inhibition of complement activity by SPS is caused by a blocking of complement activation and is not a result of complement consumption. The classical pathway is inhibited at SPS concentrations greater than 0.1 mg...... findings also open up the possibility of a new assay for the assessment of the functional capacity of the lectin complement pathway....
Biziulevicius, Gediminas A
2006-01-01
Enteric-coated proteolytic enzyme preparations like Wobenzym and Phlogenzym are widely used for the so-called 'systemic enzyme therapy' both in humans and animals. Numerous publications reveal that oral proteolytic enzymes are able to stimulate directly the activity of immune competent cells as well as to increase efficiency of some of their products. But origins of the immunostimulatory effects of oral proteolytic enzymes are still unclear. The hypothesis described here suggests that it may be proteolysis of intestinal microorganisms that makes the immune competent cells to work in the immunostimulatory manner. The hypothesis was largely formed by several scientific observations: First, microbial lysis products (lipopolysaccharides, muropeptides and other peptidoglycan fragments, beta-glucans, etc.) are well known for their immunostimulatory action. Second, a normal human being hosts a mass of intestinal microorganisms equivalent to about 1 kg. The biomass (mainly due to naturally occurring autolysis) continuously supplies the host's organism with immunostimulatory microbial cell components. Third, the immunostimulatory effects resulting from the oral application of exogenously acting antimicrobial (lytic) enzyme preparations, such as lysozyme and lysosubtilin, are likely to be a result of the action of microbial lysis products. Fourth, cell walls of most microorganisms contain a considerable amount of proteins/peptides, a possible target for exogenous proteolytic enzymes. In fact, several authors have already shown that a number of proteases possess an ability to lyse the microbial cells in vitro. Fifth, the pretreatment of microbial cells (at least of some species) in vitro with proteolytic enzymes makes them more sensitive to the lytic action of lysozyme and, otherwise, pretreatment with lysozyme makes them more susceptible to proteolytic degradation. Sixth, exogenous proteases, when in the intestines, may participate in final steps of food-protein digestion
DEFF Research Database (Denmark)
Lappegård, Knut Tore; Christiansen, Dorte; Pharo, Anne
2009-01-01
on CD14 and inversely regulated by complement, that is, complement deficiency and complement inhibition enhanced their release. Granulocyte responses were mainly complement-dependent, whereas monocyte responses were more dependent on CD14. Notably, all responses were abolished by combined neutralization...
The stability of complement-mediated bactericidal activity in human serum against Salmonella.
Directory of Open Access Journals (Sweden)
Colette M O'Shaughnessy
Full Text Available The complement cascade includes heat-labile proteins and care is required when handling serum in order to preserve its functional integrity. We have previously used a whole human serum bactericidal assay to show that antibody and an intact complement system are required in blood for killing of invasive isolates of Salmonella. The aim of the present study was to evaluate the conditions under which human serum can be stored and manipulated while maintaining complement integrity. Serum bactericidal activity against Salmonella was maintained for a minimum of 35 days when stored at 4°C, eight days at 22°C and 54 hours at 37°C. Up to three freeze-thaw cycles had no effect on the persistence of bactericidal activity and hemolytic complement assays confirmed no effect on complement function. Delay in the separation of serum for up to four days from clotted blood stored at 22°C did not affect bactericidal activity. Dilution of serum resulted in an increased rate of loss of bactericidal activity and so serum should be stored undiluted. These findings indicate that the current guidelines concerning manipulation and storage of human serum to preserve complement integrity and function leave a large margin for safety with regards to bactericidal activity against Salmonella. The study provides a scheme for determining the requirements for serum handling in relation to functional activity of complement in other systems.
MRI of displaced meniscal fragments
International Nuclear Information System (INIS)
Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal
2012-01-01
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
MRI of displaced meniscal fragments
Energy Technology Data Exchange (ETDEWEB)
Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)
2012-01-15
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
Dimensional crossover in fragmentation
Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.
2000-11-01
Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.
Intragenic complementation by the nifJ-coded protein of Klebsiella pneumoniae.
Stacey, G; Zhu, J; Shah, V K; Shen, S C; Brill, W J
1982-01-01
A single mutation, nifC1005 (Jin et al. Sci. Sin. 23:108-118, 1980), located between nifH and nifJ in the nif cluster of Klebsiella pneumoniae, genetically complemented mutations in each of the 17 known nif genes. This suggested that the mutation is located in a new nif gene. We showed by complementation analyses that only 3 of 12 nifJ mutations tested were complemented by nifC1005. Nitrogenase activity in cell extracts of the mutant with nifC1005 as well as NifJ- mutants was stimulated by th...
Complement Activation by Ceramide Transporter Proteins
Bode, G.H.; Losen, M.; Buurman, W.A.; Veerhuis, R.; Molenaar, P.C.; Steinbusch, H.W.M.; De Baets, M.H.; Daha, MR; Martinez-Martinez, P.
2014-01-01
C1q is the initiator of the classical complement pathway and, as such, is essential for efficient opsonization and clearance of pathogens, altered self-structures, and apoptotic cells. The ceramide transporter protein (CERT) and its longer splicing isoform CERTL are known to interact with
Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...
DMPD: Complement-mediated phagocytosis--the role of Syk. [Dynamic Macrophage Pathway CSML Database
Lifescience Database Archive (English)
Full Text Available 16754322 Complement-mediated phagocytosis--the role of Syk. Tohyama Y, Yamamura H. ...IUBMB Life. 2006 May-Jun;58(5-6):304-8. (.png) (.svg) (.html) (.csml) Show Complement-mediated phagocytosis-...-the role of Syk. PubmedID 16754322 Title Complement-mediated phagocytosis--the role of Syk. Authors Tohyama
Energy Technology Data Exchange (ETDEWEB)
Dong Jiexian; Li Zhenfeng; Lei Hongtao; Sun Yuanming [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Ducancel, Frederic [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Xu Zhenlin [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Boulain, Jean-Claude [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Yang Jinyi; Shen Yudong [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Wang Hong, E-mail: gzwhongd@63.com [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China)
2012-07-29
Graphical abstract: Detection model of dc-CLEIA based on anti-RAC scFv-AP fusion protein. Highlights: Black-Right-Pointing-Pointer The scFv-AP fusion protein against ractopamine (RAC) was produced. Black-Right-Pointing-Pointer A dc-CLEIA for RAC was developed based on the purified scFv-AP fusion protein. Black-Right-Pointing-Pointer The sensitivity of dc-CLEIA was 10 times as sensitive as dc-ELISA for RAC. Black-Right-Pointing-Pointer Recovery tests from pork samples were studied. Black-Right-Pointing-Pointer Good accuracy was obtained. - Abstract: A rapid, sensitive chemiluminescent enzyme immunoassay (CLEIA) for ractopamine (RAC) based on a single-chain variable fragment (scFv)-alkaline phosphatase (AP) fusion protein was developed. The scFv gene was prepared by cloning the heavy- and light-chain variable region genes (V{sub H} and V{sub L}) from hybridoma cell line AC2, which secretes antibodies against RAC, and assembling V{sub H} and V{sub L} genes with a linker by means of splicing overlap extension polymerase chain reaction. The resulting scFv gene was inserted into the expression vector pLIP6/GN containing AP to produce the fusion protein in Escherichia coli strain BL21. The purified scFv-AP fusion protein was used to develop a direct competitive CLEIA (dcCLEIA) protocol for detection of RAC. The average concentration required for 50% inhibition of binding and the limit of detection of the assay were 0.25 {+-} 0.03 and 0.02 {+-} 0.004 ng mL{sup -1}, respectively, and the linear response range extended from 0.05 to 1.45 ng mL{sup -1}. The assay was 10 times as sensitive as the corresponding enzyme-linked immunosorbent assay based on the same fusion protein. Cross-reactivity studies showed that the fusion protein did not cross react with RAC analogs. DcCLEIA was used to analyze RAC spiked pork samples, and the validation was confirmed by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS). The results showed a good correlation between
Maye, Susan; Stanton, Catherine; Fitzgerald, Gerald F; Kelly, Philip M
2015-08-01
While the Complement protein system in human milk is well characterised, there is little information on its presence and activity in bovine milk. Complement forms part of the innate immune system, hence the importance of its contribution during milk ingestion to the overall defences of the neonate. A bactericidal sequestration assay, featuring a Complement sensitive strain, Escherichia coli 0111, originally used to characterise Complement activity in human milk was successfully applied to freshly drawn bovine milk samples, thus, providing an opportunity to compare Complement activities in both human and bovine milks. Although not identical in response, the levels of Complement activity in bovine milk were found to be closely comparable with that of human milk. Differential counts of Esch. coli 0111 after 2 h incubation were 6.20 and 6.06 log CFU/ml, for raw bovine and human milks, respectively - the lower value representing a stronger Complement response. Exposing bovine milk to a range of thermal treatments e.g. 42, 45, 65, 72, 85 or 95 °C for 10 min, progressively inhibited Complement activity by increasing temperature, thus confirming the heat labile nature of this immune protein system. Low level Complement activity was found, however, in 65 and 72 °C heat treated samples and in retailed pasteurised milk which highlights the outer limit to which high temperature, short time (HTST) industrial thermal processes should be applied if retention of activity is a priority. Concentration of Complement in the fat phase was evident following cream separation, and this was also reflected in the further loss of activity recorded in low fat variants of retailed pasteurised milk. Laboratory-based churning of the cream during simulated buttermaking generated an aqueous (buttermilk) phase with higher levels of Complement activity than the fat phase, thus pointing to a likely association with the milk fat globule membrane (MFGM) layer.
Energy Technology Data Exchange (ETDEWEB)
Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)
2013-09-21
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.
International Nuclear Information System (INIS)
Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.
2013-01-01
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections
Schmidt, Radomir; Battaglia, Vince; Scow, Kate; Kane, Staci; Hristova, Krassimira R
2008-11-01
Methylibium petroleiphilum PM1 is a well-characterized environmental strain capable of complete metabolism of the fuel oxygenate methyl tert-butyl ether (MTBE). Using a molecular genetic system which we established to study MTBE metabolism by PM1, we demonstrated that the enzyme MdpA is involved in MTBE removal, based on insertional inactivation and complementation studies. MdpA is constitutively expressed at low levels but is strongly induced by MTBE. MdpA is also involved in the regulation of tert-butyl alcohol (TBA) removal under certain conditions but is not directly responsible for TBA degradation. Phylogenetic comparison of MdpA to related enzymes indicates close homology to the short-chain hydrolyzing alkane hydroxylases (AH1), a group that appears to be a distinct subfamily of the AHs. The unique, substrate-size-determining residue Thr(59) distinguishes MdpA from the AH1 subfamily as well as from AlkB enzymes linked to MTBE degradation in Mycobacterium austroafricanum.
Reincarnation of ancient links between coagulation and complement.
Conway, E M
2015-06-01
Throughout evolution, organisms have developed means to contain wounds by simultaneously limiting bleeding and eliminating pathogens and damaged host cells via the recruitment of innate defense mechanisms. Disease emerges when there is unchecked activation of innate immune and/or coagulation responses. A key component of innate immunity is the complement system. Concurrent excess activation of coagulation and complement - two major blood-borne proteolytic pathways - is evident in numerous diseases, including atherosclerosis, diabetes, venous thromboembolic disease, thrombotic microangiopathies, arthritis, cancer, and infectious diseases. Delineating the cross-talk between these two cascades will uncover novel therapeutic insights. © 2015 International Society on Thrombosis and Haemostasis.
Dasgupta, Tathagata; Croll, David H; Owen, Jeremy A; Vander Heiden, Matthew G; Locasale, Jason W; Alon, Uri; Cantley, Lewis C; Gunawardena, Jeremy
2014-05-09
Covalent modification provides a mechanism for modulating molecular state and regulating physiology. A cycle of competing enzymes that add and remove a single modification can act as a molecular switch between "on" and "off" and has been widely studied as a core motif in systems biology. Here, we exploit the recently developed "linear framework" for time scale separation to determine the general principles of such switches. These methods are not limited to Michaelis-Menten assumptions, and our conclusions hold for enzymes whose mechanisms may be arbitrarily complicated. We show that switching efficiency improves with increasing irreversibility of the enzymes and that the on/off transition occurs when the ratio of enzyme levels reaches a value that depends only on the rate constants. Fluctuations in enzyme levels, which habitually occur due to cellular heterogeneity, can cause flipping back and forth between on and off, leading to incoherent mosaic behavior in tissues, that worsens as switching becomes sharper. This trade-off can be circumvented if enzyme levels are correlated. In particular, if the competing catalytic domains are on the same protein but do not influence each other, the resulting bifunctional enzyme can switch sharply while remaining coherent. In the mammalian liver, the switch between glycolysis and gluconeogenesis is regulated by the bifunctional 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFK-2/FBPase-2). We suggest that bifunctionality of PFK-2/FBPase-2 complements the metabolic zonation of the liver by ensuring coherent switching in response to insulin and glucagon.
The role of complement in CD4⁺ T cell homeostasis and effector functions.
Kolev, Martin; Le Friec, Gaëlle; Kemper, Claudia
2013-02-01
The complement system is among the evolutionary oldest 'players' of the immune system. It was discovered in 1896 by Jules Bordet as a heat-labile fraction of the serum responsible for the opsonisation and subsequent killing of bacteria. The decades between the 1920s and 1990s then marked the discovery and biochemical characterization of the proteins comprising the complement system. Today, complement is defined as a complex system consisting of more than 30 membrane-bound and soluble plasma proteins, which are activated in a cascade-like manner, very similarly to the caspase proteases and blood coagulation systems. Complement is engrained in the immunologist's mind as a serum-effective, quintessential part of innate immunity, vitally required for the detection and removal of pathogens or other dangerous entities. Three decades ago, this rather confined definition was challenged and then refined when it was shown that complement participates vitally in the induction and regulation of B cell responses, thus adaptive immunity. Similarly, research work published in more recent years supports an equally important role for the complement system in shaping T cell responses. Today, we are again facing paradigm shifts in the field: complement is actively involved in the negative control of T cell effector immune responses, and thus, by definition in immune homeostasis. Further, while serum complement activity is without doubt fundamental in the defence against invading pathogens, local immune cell-derived production of complement emerges as key mediator of complement's impact on adaptive immune responses. And finally, the impact of complement on metabolic pathways and the crosstalk between complement and other immune effector systems is likely more extensive than previously anticipated and is fertile ground for future discoveries. In this review, we will discuss these emerging new roles of complement, with a focus on Th1 cell biology. Copyright © 2013 Elsevier Ltd. All
Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen
2009-01-30
In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.
The intestinal complement system in inflammatory bowel disease: Shaping intestinal barrier function.
Sina, Christian; Kemper, Claudia; Derer, Stefanie
2018-06-01
The complement system is part of innate sensor and effector systems such as the Toll-like receptors (TLRs). It recognizes and quickly systemically and/or locally respond to microbial-associated molecular patterns (MAMPs) with a tailored defense reaction. MAMP recognition by intestinal epithelial cells (IECs) and appropriate immune responses are of major importance for the maintenance of intestinal barrier function. Enterocytes highly express various complement components that are suggested to be pivotal for proper IEC function. Appropriate activation of the intestinal complement system seems to play an important role in the resolution of chronic intestinal inflammation, while over-activation and/or dysregulation may worsen intestinal inflammation. Mice deficient for single complement components suffer from enhanced intestinal inflammation mimicking the phenotype of patients with chronic inflammatory bowel disease (IBD) such as Crohn's disease (CD) or ulcerative colitis (UC). However, the mechanisms leading to complement expression in IECs seem to differ markedly between UC and CD patients. Hence, how IECs, intestinal bacteria and epithelial cell expressed complement components interact in the course of IBD still remains to be mostly elucidated to define potential unique patterns contributing to the distinct subtypes of intestinal inflammation observed in CD and UC. Copyright © 2018 Elsevier Ltd. All rights reserved.
Complement activation in the Parkinson's disease substantia nigra: an immunocytochemical study
Directory of Open Access Journals (Sweden)
Conant Stephanie B
2006-10-01
Full Text Available Abstract Background Inflammatory processes are increased in the Parkinson's disease (PD brain. The long-term use of nonsteroidal anti-inflammatory drugs has been associated, in retrospective studies, with decreased risk for PD, suggesting that inflammation may contribute to development of this disorder. The objective of this study was to determine the extent of complement activation, a major inflammatory mechanism, in PD. Methods Substantia nigra specimens from young normal subjects (n = 11–13, aged normal subjects (n = 24–28, and subjects with PD (n = 19–20, Alzheimer's disease (AD; n = 12–13, and dementia with Lewy bodies (DLB; n = 9 were stained for iC3b and C9, representing early- and late-stage complement activation, respectively. Numbers of iC3b+, C9+, and total melanized neurons in each section were counted in a blinded fashion. Nonparametric analyses were used to evaluate differences between groups and to evaluate correlations between complement staining, numbers of melanized neurons, and the duration of PD. Results Lewy bodies in both PD and DLB specimens stained for iC3b and C9. Staining was also prominent on melanized neurons. The percentage of iC3b+ neurons was significantly increased in PD vs. aged normal and AD specimens, and in young normal vs. aged normal specimens. C9 immunoreactivity was significantly increased in PD vs. AD specimens, but unlike iC3b, the increased C9 staining in PD and young normal specimens did not achieve statistical significance vs. aged normal specimens. iC3b and C9 staining in PD specimens was not correlated with the numbers of remaining melanized neurons, nor with the duration of PD. Conclusion Complement activation occurs on Lewy bodies and melanized neurons in the PD substantia nigra. Early complement activation (iC3b is increased on melanized neurons in PD vs. aged normal specimens, and late-stage complement activation (C9 also tends to increase. This latter finding suggests that complement
Complement Mutations in Diacylglycerol Kinase-ε–Associated Atypical Hemolytic Uremic Syndrome
Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago
2014-01-01
Background and objectives Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Design, setting, participants, & measurements Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Results Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol
Complement mutations in diacylglycerol kinase-ε-associated atypical hemolytic uremic syndrome.
Sánchez Chinchilla, Daniel; Pinto, Sheila; Hoppe, Bernd; Adragna, Marta; Lopez, Laura; Justa Roldan, Maria Luisa; Peña, Antonia; Lopez Trascasa, Margarita; Sánchez-Corral, Pilar; Rodríguez de Córdoba, Santiago
2014-09-05
Atypical hemolytic uremic syndrome is characterized by vascular endothelial damage caused by complement dysregulation. Consistently, complement inhibition therapies are highly effective in most patients with atypical hemolytic uremic syndrome. Recently, it was shown that a significant percentage of patients with early-onset atypical hemolytic uremic syndrome carry mutations in diacylglycerol kinase-ε, an intracellular protein with no obvious role in complement. These data support an alternative, complement-independent mechanism leading to thrombotic microangiopathy that has implications for treatment of early-onset atypical hemolytic uremic syndrome. To get additional insights into this new form of atypical hemolytic uremic syndrome, the diacylglycerol kinase-ε gene in a cohort with atypical hemolytic uremic syndrome was analyzed. Eighty-three patients with early-onset atypical hemolytic uremic syndrome (<2 years) enrolled in the Spanish atypical hemolytic uremic syndrome registry between 1999 and 2013 were screened for mutations in diacylglycerol kinase-ε. These patients were also fully characterized for mutations in the genes encoding factor H, membrane cofactor protein, factor I, C3, factor B, and thrombomodulin CFHRs copy number variations and rearrangements, and antifactor H antibodies. Four patients carried mutations in diacylglycerol kinase-ε, one p.H536Qfs*16 homozygote and three compound heterozygotes (p.W322*/p.P498R, two patients; p.Q248H/p.G484Gfs*10, one patient). Three patients also carried heterozygous mutations in thrombomodulin or C3. Extensive plasma infusions controlled atypical hemolytic uremic syndrome recurrences and prevented renal failure in the two patients with diacylglycerol kinase-ε and thrombomodulin mutations. A positive response to plasma infusions and complement inhibition treatment was also observed in the patient with concurrent diacylglycerol kinase-ε and C3 mutations. Data suggest that complement dysregulation influences
Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration
Ramaglia, Valeria; King, Rosalind Helen Mary; Morgan, Bryan Paul; Baas, Frank
2009-01-01
The complement system is implicated in Wallerian degeneration (WD). We have previously shown that the membrane attack complex (MAC) the terminal activation product of the complement cascade, mediates rapid axonal degradation and myelin clearance during WD after peripheral nerve injury. In this study
Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair
International Nuclear Information System (INIS)
Thomas, S.M.; Sedgwick, S.G.
1989-01-01
Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli
Complement activation by ceramide transporter proteins.
Bode, Gerard H; Losen, Mario; Buurman, Wim A; Veerhuis, Robert; Molenaar, Peter C; Steinbusch, Harry W M; De Baets, Marc H; Daha, Mohamed R; Martinez-Martinez, Pilar
2014-02-01
C1q is the initiator of the classical complement pathway and, as such, is essential for efficient opsonization and clearance of pathogens, altered self-structures, and apoptotic cells. The ceramide transporter protein (CERT) and its longer splicing isoform CERTL are known to interact with extracellular matrix components, such as type IV collagen, and with the innate immune protein serum amyloid P. In this article, we report a novel function of CERT in the innate immune response. Both CERT isoforms, when immobilized, were found to bind the globular head region of C1q and to initiate the classical complement pathway, leading to activation of C4 and C3, as well as generation of the membrane attack complex C5b-9. In addition, C1q was shown to bind to endogenous CERTL on the surface of apoptotic cells. These results demonstrate the role of CERTs in innate immunity, especially in the clearance of apoptotic cells.
Clark, S J; Templeton, M D; Sullivan, P A
1997-04-01
A secreted aspartic proteinase from Glomerella cingulata (GcSAP) was purified to homogeneity by ion exchange chromatography. The enzyme has an M, of 36000 as estimated by SDS-PAGE, optimal activity from pH 3.5 to pH 4.0 and is inhibited by pepstatin. The N-terminal sequence, 23 residues long, was used to design a gene-specific primer. This was used in 3' RACE (rapid amplification of cDNA ends) PCR to amplify a 1.2 kb fragment of the gcsap cDNA. A second gene-specific primer was designed and used in 5' RACE PCR to clone the 5' region. This yielded a 600 bp DNA fragment and completed the open reading frame. The gcsap open reading frame encodes a protein with a 78 residue prepro-sequence typical of other fungal secreted aspartic proteinases. Based on the deduced sequence, the mature enzyme contains 329 amino acids and shows approximately 40% identity to other fungal aspartic proteinases. Subsequent cloning and sequencing of gcsap fragments obtained from PCR with genomic DNA revealed a 73 bp intron beginning at nt 728. Southern analyses at medium and high stringency indicated that G. cingulata possesses one gene for the secreted aspartic proteinase, and Northern blots indicated that gene expression was induced by exogenous protein and repressed by ammonium salts. GcSAP is a putative pathogenicity factor of G. cingulata, and it will now be possible to create SAP-mutants and assess the role GcSAP plays in pathogenicity.
Reframing landscape fragmentation's effects on ecosystem services.
Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R
2015-04-01
Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fragment Size Distribution of Blasted Rock Mass
Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris
2017-12-01
Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.
Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George
2003-05-01
Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.
International Nuclear Information System (INIS)
Pas, H.H.; Robillard, G.T.
1988-01-01
The cysteine of the membrane-bound mannitol-specific enzyme II (EII/sup Mtl/) of the Escherichia coli phosphoenolpyruvate-dependent phosphotransferase system have been labeled with 4-vinylpyridine. After proteolytic breakdown and reversed-phase HPLC, the peptides containing cysteines 110, 384, and 571 could be identified. N-Ethylmaleimide (NEM) treatment of the native unphosphorylated enzyme results in incorporation of one NEM label per molecule and loss of enzymatic activity. NEM treatment and inactivation prevented 4-vinylpyridine incorporation into the Cys-384-containing peptide, identifying this residue as the activity-linked cysteine. Both oxidation and phosphorylation of the native enzyme protected the enzyme against NEM labeling of Cys-384. Positive identification of the activity-linked cysteine was accomplished by inactivation with [ 14 C]iodoacetamide, proteolytic fragmentation, isolation of the peptide, and amino acid sequencing
Medium-scale melt-sodium fragmentation experiments
International Nuclear Information System (INIS)
Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.
1979-01-01
The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments
Bahia El Idrissi, N; Hakobyan, S; Ramaglia, V; Geluk, A; Morgan, B Paul; Das, P Kumar; Baas, F
2016-06-01
Mycobacterium leprae infection gives rise to the immunologically and histopathologically classified spectrum of leprosy. At present, several tools for the stratification of patients are based on acquired immunity markers. However, the role of innate immunity, particularly the complement system, is largely unexplored. The present retrospective study was undertaken to explore whether the systemic levels of complement activation components and regulators can stratify leprosy patients, particularly in reference to the reactional state of the disease. Serum samples from two cohorts were analysed. The cohort from Bangladesh included multi-bacillary (MB) patients with (n = 12) or without (n = 46) reaction (R) at intake and endemic controls (n = 20). The cohort from Ethiopia included pauci-bacillary (PB) (n = 7) and MB (n = 23) patients without reaction and MB (n = 15) patients with reaction. The results showed that the activation products terminal complement complex (TCC) (P ≤ 0·01), C4d (P ≤ 0·05) and iC3b (P ≤ 0·05) were specifically elevated in Bangladeshi patients with reaction at intake compared to endemic controls. In addition, levels of the regulator clusterin (P ≤ 0·001 without R; P < 0·05 with R) were also elevated in MB patients, irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed that, irrespective of a reaction, serum TCC levels were increased significantly in patients with reactions compared to patients without reactions (P ≤ 0·05). Our findings suggests that serum TCC levels may prove to be a valuable tool in diagnosing patients at risk of developing reactions. © 2016 British Society for Immunology.
Dual Fragment Impact of PBX Charges
Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team
2017-06-01
Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.
International Nuclear Information System (INIS)
Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James
2014-01-01
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Energy Technology Data Exchange (ETDEWEB)
Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)
2014-04-10
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Gallstone fragmentation by control electrohydraulic lithotripsy
International Nuclear Information System (INIS)
Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.
1989-01-01
The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy
Fragmentation functions approach in pQCD fragmentation phenomena
International Nuclear Information System (INIS)
Rolli, S.
1996-07-01
Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines
Fragmentation of neck-like structures
International Nuclear Information System (INIS)
Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI
1994-01-01
Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)
Directory of Open Access Journals (Sweden)
Paula Eveline Ribeiro D’Anunciação
2013-01-01
Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.
A novel method for direct measurement of complement convertases activity in human serum.
Blom, A M; Volokhina, E B; Fransson, V; Strömberg, P; Berghard, L; Viktorelius, M; Mollnes, T E; López-Trascasa, M; van den Heuvel, L P; Goodship, T H; Marchbank, K J; Okroj, M
2014-10-01
Complement convertases are enzymatic complexes that play a central role in sustaining and amplification of the complement cascade. Impairment of complement function leads directly or indirectly to pathological conditions, including higher infection rate, kidney diseases, autoimmune- or neurodegenerative diseases and ischaemia-reperfusion injury. An assay for direct measurement of activity of the convertases in patient sera is not available. Existing assays testing convertase function are based on purified complement components and, thus, convertase formation occurs under non-physiological conditions. We designed a new assay, in which C5 blocking compounds enabled separation of the complement cascade into two phases: the first ending at the stage of C5 convertases and the second ending with membrane attack complex formation. The use of rabbit erythrocytes or antibody-sensitized sheep erythrocytes as the platforms for convertase formation enabled easy readout based on measurement of haemolysis. Thus, properties of patient sera could be studied directly regarding convertase activity and membrane attack complex formation. Another advantage of this assay was the possibility to screen for host factors such as C3 nephritic factor and other anti-complement autoantibodies, or gain-of-function mutations, which prolong the half-life of complement convertases. Herein, we present proof of concept, detailed description and validation of this novel assay. © 2014 British Society for Immunology.
Fragmentation of Ceramics in Rapid Expansion Mode
Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan
The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.
Determinism and Contingency Shape Metabolic Complementation in an Endosymbiotic Consortium.
Ponce-de-Leon, Miguel; Tamarit, Daniel; Calle-Espinosa, Jorge; Mori, Matteo; Latorre, Amparo; Montero, Francisco; Pereto, Juli
2017-01-01
Bacterial endosymbionts and their insect hosts establish an intimate metabolic relationship. Bacteria offer a variety of essential nutrients to their hosts, whereas insect cells provide the necessary sources of matter and energy to their tiny metabolic allies. These nutritional complementations sustain themselves on a diversity of metabolite exchanges between the cell host and the reduced yet highly specialized bacterial metabolism-which, for instance, overproduces a small set of essential amino acids and vitamins. A well-known case of metabolic complementation is provided by the cedar aphid Cinara cedri that harbors two co-primary endosymbionts, Buchnera aphidicola BCc and Ca . Serratia symbiotica SCc, and in which some metabolic pathways are partitioned between different partners. Here we present a genome-scale metabolic network (GEM) for the bacterial consortium from the cedar aphid i BSCc. The analysis of this GEM allows us the confirmation of cases of metabolic complementation previously described by genome analysis (i.e., tryptophan and biotin biosynthesis) and the redefinition of an event of metabolic pathway sharing between the two endosymbionts, namely the biosynthesis of tetrahydrofolate. In silico knock-out experiments with i BSCc showed that the consortium metabolism is a highly integrated yet fragile network. We also have explored the evolutionary pathways leading to the emergence of metabolic complementation between reduced metabolisms starting from individual, complete networks. Our results suggest that, during the establishment of metabolic complementation in endosymbionts, adaptive evolution is significant in the case of tryptophan biosynthesis, whereas vitamin production pathways seem to adopt suboptimal solutions.
Micrurus snake venoms activate human complement system and generate anaphylatoxins
Directory of Open Access Journals (Sweden)
Tanaka Gabriela D
2012-01-01
Full Text Available Abstract Background The genus Micrurus, coral snakes (Serpentes, Elapidae, comprises more than 120 species and subspecies distributed from the south United States to the south of South America. Micrurus snake bites can cause death by muscle paralysis and further respiratory arrest within a few hours after envenomation. Clinical observations show mainly neurotoxic symptoms, although other biological activities have also been experimentally observed, including cardiotoxicity, hemolysis, edema and myotoxicity. Results In the present study we have investigated the action of venoms from seven species of snakes from the genus Micrurus on the complement system in in vitro studies. Several of the Micrurus species could consume the classical and/or the lectin pathways, but not the alternative pathway, and C3a, C4a and C5a were generated in sera treated with the venoms as result of this complement activation. Micrurus venoms were also able to directly cleave the α chain of the component C3, but not of the C4, which was inhibited by 1,10 Phenanthroline, suggesting the presence of a C3α chain specific metalloprotease in Micrurus spp venoms. Furthermore, complement activation was in part associated with the cleavage of C1-Inhibitor by protease(s present in the venoms, which disrupts complement activation control. Conclusion Micrurus venoms can activate the complement system, generating a significant amount of anaphylatoxins, which may assist due to their vasodilatory effects, to enhance the spreading of other venom components during the envenomation process.
Functional analysis of Ficolin-3 mediated complement activation
DEFF Research Database (Denmark)
Hein, Estrid; Honoré, Christian Le Fèvre; Skjoedt, Mikkel-Ole
2010-01-01
assessed by C4, C3 and terminal complement complex (TCC) deposition. Serum Ficolin-3 bound to acBSA in a calcium dependent manner, while only minimal binding of Ficolin-2 and no binding of Ficolin-1 were observed. No binding to normal BSA was seen for any of the Ficolins. Serum C4, C3 and TCC deposition...... was applied to the samples that inhibited interference from the classical pathway due to the presence of anti-BSA antibodies in some sera. We describe a novel functional method for measuring complement activation mediated by Ficolin-3 in human serum up to the formation of TCC. The assay provides...
International Nuclear Information System (INIS)
Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin
1990-01-01
The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)
The complement system: a gateway to gene-environment interactions in schizophrenia pathogenesis.
Nimgaonkar, V L; Prasad, K M; Chowdari, K V; Severance, E G; Yolken, R H
2017-11-01
The pathogenesis of schizophrenia is considered to be multi-factorial, with likely gene-environment interactions (GEI). Genetic and environmental risk factors are being identified with increasing frequency, yet their very number vastly increases the scope of possible GEI, making it difficult to identify them with certainty. Accumulating evidence suggests a dysregulated complement pathway among the pathogenic processes of schizophrenia. The complement pathway mediates innate and acquired immunity, and its activation drives the removal of damaged cells, autoantigens and environmentally derived antigens. Abnormalities in complement functions occur in many infectious and autoimmune disorders that have been linked to schizophrenia. Many older reports indicate altered serum complement activity in schizophrenia, though the data are inconclusive. Compellingly, recent genome-wide association studies suggest repeat polymorphisms incorporating the complement 4A (C4A) and 4B (C4B) genes as risk factors for schizophrenia. The C4A/C4B genetic associations have re-ignited interest not only in inflammation-related models for schizophrenia pathogenesis, but also in neurodevelopmental theories, because rodent models indicate a role for complement proteins in synaptic pruning and neurodevelopment. Thus, the complement system could be used as one of the 'staging posts' for a variety of focused studies of schizophrenia pathogenesis. They include GEI studies of the C4A/C4B repeat polymorphisms in relation to inflammation-related or infectious processes, animal model studies and tests of hypotheses linked to autoimmune diseases that can co-segregate with schizophrenia. If they can be replicated, such studies would vastly improve our understanding of pathogenic processes in schizophrenia through GEI analyses and open new avenues for therapy.
Coty, Jean-Baptiste; Eleamen Oliveira, Elquio; Vauthier, Christine
2017-11-05
The understanding of complement activation by nanomaterials is a key to a rational design of safe and efficient nanomedicines. This work proposed a systematic study investigating how molecular design of nanoparticle coronas made of dextran impacts on mechanisms that trigger complement activation. The nanoparticles used for this work consisted of dextran-coated poly(isobutylcyanoacrylate) (PIBCA) nanoparticles have already been thoroughly characterized. Their different capacity to trigger complement activation established on the cleavage of the protein C3 was also already described making these nanoparticles good models to investigate the relation between the molecular feature of their corona and the mechanism by which they triggered complement activation. Results of this new study show that complement activation pathways can be selected by distinct architectures formed by dextran chains composing the nanoparticle corona. Assumptions that explain the relation between complement activation mechanisms triggered by the nanoparticles and the nanoparticle corona molecular feature were proposed. These results are of interest to better understand how the design of dextran-coated nanomaterials will impact interactions with the complement system. It can open perspectives with regard to the selection of a preferential complement activation pathway or prevent the nanoparticles to activate the complement system, based on a rational choice of the corona configuration. Copyright © 2017 Elsevier B.V. All rights reserved.
The formation of planets by disc fragmentation
Directory of Open Access Journals (Sweden)
Stamatellos Dimitris
2013-04-01
Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.
Extraction of 16th Century Calender Fragments
DEFF Research Database (Denmark)
Holck, Jakob Povl; Etheridge, Christian
at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....
Schmidt, Radomir; Battaglia, Vince; Scow, Kate; Kane, Staci; Hristova, Krassimira R.
2008-01-01
Methylibium petroleiphilum PM1 is a well-characterized environmental strain capable of complete metabolism of the fuel oxygenate methyl tert-butyl ether (MTBE). Using a molecular genetic system which we established to study MTBE metabolism by PM1, we demonstrated that the enzyme MdpA is involved in MTBE removal, based on insertional inactivation and complementation studies. MdpA is constitutively expressed at low levels but is strongly induced by MTBE. MdpA is also involved in the regulation of tert-butyl alcohol (TBA) removal under certain conditions but is not directly responsible for TBA degradation. Phylogenetic comparison of MdpA to related enzymes indicates close homology to the short-chain hydrolyzing alkane hydroxylases (AH1), a group that appears to be a distinct subfamily of the AHs. The unique, substrate-size-determining residue Thr59 distinguishes MdpA from the AH1 subfamily as well as from AlkB enzymes linked to MTBE degradation in Mycobacterium austroafricanum. PMID:18791002
Keedy, Daniel A; Hill, Zachary B; Biel, Justin T; Kang, Emily; Rettenmaier, T Justin; Brandao-Neto, Jose; Pearce, Nicholas M; von Delft, Frank; Wells, James A; Fraser, James S
2018-06-07
Allostery is an inherent feature of proteins, but it remains challenging to reveal the mechanisms by which allosteric signals propagate. A clearer understanding of this intrinsic circuitry would afford new opportunities to modulate protein function. Here we have identified allosteric sites in protein tyrosine phosphatase 1B (PTP1B) by combining multiple-temperature X-ray crystallography experiments and structure determination from hundreds of individual small-molecule fragment soaks. New modeling approaches reveal 'hidden' low-occupancy conformational states for protein and ligands. Our results converge on allosteric sites that are conformationally coupled to the active-site WPD loop and are hotspots for fragment binding. Targeting one of these sites with covalently tethered molecules or mutations allosterically inhibits enzyme activity. Overall, this work demonstrates how the ensemble nature of macromolecular structure, revealed here by multitemperature crystallography, can elucidate allosteric mechanisms and open new doors for long-range control of protein function. © 2018, Keedy et al.
Fluctuations in the fragmentation process
International Nuclear Information System (INIS)
Botet, R.; Ploszajczak, M.
1993-01-01
Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs
The spectroscopy of fission fragments
International Nuclear Information System (INIS)
Phillips, W.R.
1998-01-01
High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)
Velocity distribution of fragments of catastrophic impacts
Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi
1992-01-01
Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
DEFF Research Database (Denmark)
Baatrup, G; Qvist, N; Junker, A
1994-01-01
OBJECTIVE: To find out if there was any local activation of complement in the vicinity of a colonic cancer, and any fluctuation in the function of the complement system during operation. DESIGN: Prospective study. SETTING: One university and two district hospitals in Denmark. SUBJECTS: 29 selected...... patients undergoing emergency and elective operations for colonic cancer. INTERVENTIONS: Measurements of systemic and local complement fixation capacity and complement activation in samples of serum or plasma taken before, during, and after operation. MAIN OUTCOME MEASURES: Changes in complement fixation...... capacity and complement activation during operation. RESULTS: Haemodilution during operation caused a significant reduction in the complement fixation capacity of serum and in the activation of the complement system as measured by generation of C3c. We were unable to confirm the presence of complement...
Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator
Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.
2018-04-01
The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.
Current fragmentation in deep inelastic scattering
International Nuclear Information System (INIS)
Hamer, C.J.
1975-04-01
It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)
Versatile de novo enzyme activity in capsid proteins from an engineered M13 bacteriophage library.
Casey, John P; Barbero, Roberto J; Heldman, Nimrod; Belcher, Angela M
2014-11-26
Biocatalysis has grown rapidly in recent decades as a solution to the evolving demands of industrial chemical processes. Mounting environmental pressures and shifting supply chains underscore the need for novel chemical activities, while rapid biotechnological progress has greatly increased the utility of enzymatic methods. Enzymes, though capable of high catalytic efficiency and remarkable reaction selectivity, still suffer from relative instability, high costs of scaling, and functional inflexibility. Herein, we developed a biochemical platform for engineering de novo semisynthetic enzymes, functionally modular and widely stable, based on the M13 bacteriophage. The hydrolytic bacteriophage described in this paper catalyzes a range of carboxylic esters, is active from 25 to 80 °C, and demonstrates greater efficiency in DMSO than in water. The platform complements biocatalysts with characteristics of heterogeneous catalysis, yielding high-surface area, thermostable biochemical structures readily adaptable to reactions in myriad solvents. As the viral structure ensures semisynthetic enzymes remain linked to the genetic sequences responsible for catalysis, future work will tailor the biocatalysts to high-demand synthetic processes by evolving new activities, utilizing high-throughput screening technology and harnessing M13's multifunctionality.
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1990-01-01
The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...
Fragment emission from modestly excited nuclear systems
Energy Technology Data Exchange (ETDEWEB)
Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.
1996-07-08
Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).
Complement to the 1999-2000 progress report; Complement au rapport d'activite 1999-2000
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-07-01
Among a lot of achievements relevant to INIS we can note: -) the status of the work on GLAST (gamma-ray large area space telescope) and on the Celeste telescope; -) the study of the energy and angular distributions of the fast outgoing electron beam produced in the interaction of a laser beam with a thin plastic foil and a gas jet; -) the investigation of the excitation of the 76 eV energy level of U{sup 235} by a YAG laser radiation; -) the feasibility study of a dating method of wines based on the gamma spectroscopy of specific rays of K{sup 40} and Cs{sup 137}; -) the study of nuclei beyond the proton drip line by determining the missing mass spectrum from complete kinematics measurements of the reaction products; -) the beta decay half-lives of proton-rich Kr{sup 78} fragments have been determined for all nuclei between Z = 27 and 36; -) a beta decay scheme is proposed for P{sup 26} and S{sup 27} including beta delayed one and two proton emission and gamma ray spectroscopy; -) the observation of the 2-proton emission decay of the Fe{sup 45} fundamental state; -) the measurement of the radiative capture cross-section of I{sup 129}; -) the measurement of the fission cross-section of U{sup 233} induced by fast neutrons; -) the investigation of intermediate mass fragments observed in coincidence with 2 correlated fission fragments following incomplete fusion in C{sup 12} + Th{sup 232} at E/A = 16 and 22 MeV; and -) the status of the single ion irradiation system used for the irradiation of biological samples. (A.C.)
The spectroscopy of fission fragments
Energy Technology Data Exchange (ETDEWEB)
Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)
1998-12-31
High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.
Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T
2018-06-01
To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically
Complement factor H deficiency results in decreased neuroretinal expression of Cd59a in aged mice
DEFF Research Database (Denmark)
Faber, Carsten; Williams, Jennifer; Juel, Helene Bæk
2012-01-01
Purpose. The complement system is closely linked to the pathogenesis of AMD. Several complement genes are expressed in RPE, and complement proteins accumulate in drusen. Further, a common variant of complement factor H (CFH) confers increased risk of developing AMD. Because the mechanisms by which...
New perspectives on mannan-binding lectin-mediated complement activation
DEFF Research Database (Denmark)
Degn, Søren Egedal; Thiel, Steffen; Jensenius, Jens Christian
2007-01-01
The complement system is an important part of the innate immune system, mediating several major effector functions and modulating adaptive immune responses. Three complement activation pathways exist: the classical pathway (CP), the alternative pathway (AP), and the lectin pathway (LP). The LP......, allowing C3 activation in the absence of components otherwise believed critical. The classical bypass pathways are dependent on C1 and components of the AP. A recent study has shown the existence also of a lectin bypass pathway dependent on mannan-binding lectin (MBL) and AP components. The emerging...
McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.