CSIR Research Space (South Africa)
Theron, J
2000-09-01
Full Text Available V. cholerae. The PCR procedure coupled with an enrichment culture detected as few as four V. cholerae organisms in pure culture. Treated sewage, surface, ground and drinking water samples were seeded with V, cholerae and following enrichment, a...
DEFF Research Database (Denmark)
Knutsson, R.; Löfström, Charlotta; Grage, H.
2002-01-01
The performance of a 5' nuclease real-time PCR assay was studied to optimize an automated method of detection of preenriched Salmonella enterica cells in buffered peptone water (BPW). The concentrations and interactions of the PCR reagents were evaluated on the basis of two detection responses, t...
2014-01-01
Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Directory of Open Access Journals (Sweden)
Zhenming Yu
Full Text Available Targeted DNA enrichment coupled with next generation sequencing has been increasingly used for interrogation of select sub-genomic regions at high depth of coverage in a cost effective manner. Specificity measured by on-target efficiency is a key performance metric for target enrichment. Non-specific capture leads to off-target reads, resulting in waste of sequencing throughput on irrelevant regions. Microdroplet-PCR allows simultaneous amplification of up to thousands of regions in the genome and is among the most commonly used strategies for target enrichment. Here we show that carryover of single-stranded template genomic DNA from microdroplet-PCR constitutes a major contributing factor for off-target reads in the resultant libraries. Moreover, treatment of microdroplet-PCR enrichment products with a nuclease specific to single-stranded DNA alleviates off-target load and improves enrichment specificity. We propose that nuclease treatment of enrichment products should be incorporated in the workflow of targeted sequencing using microdroplet-PCR for target capture. These findings may have a broad impact on other PCR based applications for which removal of template DNA is beneficial.
Goodman, Laura B; McDonough, Patrick L; Anderson, Renee R; Franklin-Guild, Rebecca J; Ryan, James R; Perkins, Gillian A; Thachil, Anil J; Glaser, Amy L; Thompson, Belinda S
2017-11-01
Rapid screening for enteric bacterial pathogens in clinical environments is essential for biosecurity. Salmonella found in veterinary hospitals, particularly Salmonella enterica serovar Dublin, can pose unique challenges for culture and testing because of its poor growth. Multiple Salmonella serovars including Dublin are emerging threats to public health given increasing prevalence and antimicrobial resistance. We adapted an automated food testing method to veterinary samples and evaluated the performance of the method in a variety of matrices including environmental samples ( n = 81), tissues ( n = 52), feces ( n = 148), and feed ( n = 29). A commercial kit was chosen as the basis for this approach in view of extensive performance characterizations published by multiple independent organizations. A workflow was established for efficiently and accurately testing veterinary matrices and environmental samples by use of real-time PCR after selective enrichment in Rappaport-Vassiliadis soya (RVS) medium. Using this method, the detection limit for S. Dublin improved by 100-fold over subculture on selective agars (eosin-methylene blue, brilliant green, and xylose-lysine-deoxycholate). Overall, the procedure was effective in detecting Salmonella spp. and provided next-day results.
Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
International Nuclear Information System (INIS)
Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander
2002-01-01
Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment
DEFF Research Database (Denmark)
Liu, Shanlin; Wang, Xin; Xie, Lin
2016-01-01
Biodiversity analyses based on next-generation sequencing (NGS) platforms have developed by leaps and bounds in recent years. A PCR-free strategy, which can alleviate taxonomic bias, was considered as a promising approach to delivering reliable species compositions of targeted environments...... data is highly demanding on computing resources. Here, we present a mitogenome enrichment pipeline via a gene capture chip that was designed by virtue of the mitogenome sequences of the 1000 Insect Transcriptome Evolution project (1KITE, www.1kite.org). A mock sample containing 49 species was used...... in abundance. However, the frequencies of input taxa were largely maintained after capture (R2 = 0.81). We suggest that our mitogenome capture approach coupled with PCR-free shotgun sequencing could provide ecological researchers an efficient NGS method to deliver reliable biodiversity assessment....
Use of enrichment real-time PCR to enumerate salmonella on chicken parts.
Oscar, T P
2014-07-01
Salmonella bacteria that survive cooking or that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. In the present study, enrichment real-time PCR (qPCR) was used to enumerate Salmonella bacteria that contaminate raw chicken parts at retail or that cross-contaminate cooked chicken during simulated meal preparation and serving. Whole raw chickens obtained at retail were partitioned into wings, breasts, thighs, and drumsticks using a sterilized knife and cutting board, which were then used to partition a cooked chicken breast to assess cross-contamination. After enrichment in buffered peptone water (400 ml, 8 h, 40°C, 80 rpm), subsamples were used for qPCR and cultural isolation of Salmonella. In some experiments, chicken parts were spiked with 0 to 3.6 log of Salmonella Typhimurium var. 5- to generate a standard curve for enumeration by qPCR. Of 10 raw chickens examined, 7 (70%) had one or more parts contaminated with Salmonella. Of 80 raw parts examined, 15 (19%) were contaminated with Salmonella. Of 20 cooked chicken parts examined, 2 (10%) were cross-contaminated with Salmonella. Predominant serotypes identified were Typhimurium (71%) and its variants (var. 5-, monophasic, and nonmotile) and Kentucky (18%). The number of Salmonella bacteria on contaminated parts ranged from one to two per part. Results of this study indicated that retail chicken parts examined were contaminated with low levels of Salmonella, which resulted in low levels of cross-contamination during simulated meal preparation and serving. Thus, if consumers properly handle and prepare the chicken, it should pose no or very low risk of consumer exposure to Salmonella.
A Multiscale Enrichment Procedure for Nonlinear Monotone Operators
Efendiev, Yalchin R.
2014-03-11
In this paper, multiscale finite element methods (MsFEMs) and domain decomposition techniques are developed for a class of nonlinear elliptic problems with high-contrast coefficients. In the process, existing work on linear problems [Y. Efendiev, J. Galvis, R. Lazarov, S. Margenov and J. Ren, Robust two-level domain decomposition preconditioners for high-contrast anisotropic flows in multiscale media. Submitted.; Y. Efendiev, J. Galvis and X. Wu, J. Comput. Phys. 230 (2011) 937–955; J. Galvis and Y. Efendiev, SIAM Multiscale Model. Simul. 8 (2010) 1461–1483.] is extended to treat a class of nonlinear elliptic operators. The proposed method requires the solutions of (small dimension and local) nonlinear eigenvalue problems in order to systematically enrich the coarse solution space. Convergence of the method is shown to relate to the dimension of the coarse space (due to the enrichment procedure) as well as the coarse mesh size. In addition, it is shown that the coarse mesh spaces can be effectively used in two-level domain decomposition preconditioners. A number of numerical results are presented to complement the analysis.
Directory of Open Access Journals (Sweden)
Meetha P Gould
Full Text Available Recent advances in sequencing technology allow for accurate detection of mitochondrial sequence variants, even those in low abundance at heteroplasmic sites. Considerable sequencing cost savings can be achieved by enriching samples for mitochondrial (relative to nuclear DNA. Reduction in nuclear DNA (nDNA content can also help to avoid false positive variants resulting from nuclear mitochondrial sequences (numts. We isolate intact mitochondrial organelles from both human cell lines and blood components using two separate methods: a magnetic bead binding protocol and differential centrifugation. DNA is extracted and further enriched for mitochondrial DNA (mtDNA by an enzyme digest. Only 1 ng of the purified DNA is necessary for library preparation and next generation sequence (NGS analysis. Enrichment methods are assessed and compared using mtDNA (versus nDNA content as a metric, measured by using real-time quantitative PCR and NGS read analysis. Among the various strategies examined, the optimal is differential centrifugation isolation followed by exonuclease digest. This strategy yields >35% mtDNA reads in blood and cell lines, which corresponds to hundreds-fold enrichment over baseline. The strategy also avoids false variant calls that, as we show, can be induced by the long-range PCR approaches that are the current standard in enrichment procedures. This optimization procedure allows mtDNA enrichment for efficient and accurate massively parallel sequencing, enabling NGS from samples with small amounts of starting material. This will decrease costs by increasing the number of samples that may be multiplexed, ultimately facilitating efforts to better understand mitochondria-related diseases.
Directory of Open Access Journals (Sweden)
Fábio Mendonça Diniz
2007-03-01
Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...
African Journals Online (AJOL)
Elham
2013-07-03
Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.
Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe
2015-01-01
Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was
Directory of Open Access Journals (Sweden)
Germán eVillamizar-Rodríguez
2015-11-01
Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This
Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe
2015-01-01
Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
PCR amplification of Bartonella koehlerae from human blood and enrichment blood cultures
Directory of Open Access Journals (Sweden)
Breitschwerdt Edward B
2010-08-01
Full Text Available Abstract Background Cats appear to be the primary reservoir host for Bartonella koehlerae, an alpha Proteobacteria that is most likely transmitted among cat populations by fleas (Ctenocephalides felis. Bartonella koehlerae has caused endocarditis in a dog and in one human patient from Israel, but other clinically relevant reports involving this bacterium are lacking. Despite publication of numerous, worldwide epidemiological studies designed to determine the prevalence of Bartonella spp. bacteremia in cats, B. koehlerae has never been isolated using conventional blood agar plates. To date, successful isolation of B. koehlerae from cats and from the one human endocarditis patient has consistently required the use of chocolate agar plates. Results In this study, Bartonella koehlerae bacteremia was documented in eight immunocompetent patients by PCR amplification and DNA sequencing, either prior to or after enrichment blood culture using Bartonella alpha Proteobacteria growth medium. Presenting symptoms most often included fatigue, insomnia, joint pain, headache, memory loss, and muscle pain. Four patients were also infected with Bartonella vinsonii subsp. berkhoffii genotype II. After molecular documentation of B. koehlerae infection in these patients, a serological test was developed and serum samples were tested retrospectively. Bartonella koehlerae antibodies were not detected (titers B. koehlerae antibody titers of 1:64 or greater. Conclusions Although biased by a study population consisting of individuals with extensive arthropod and animal exposure, the results of this study suggest that B. koehlerae bacteremia is more common in immunocompetent people than has been previously suspected. Future studies should more thoroughly define modes of transmission and risk factors for acquiring infection with B. koehlerae. In addition, studies are needed to determine if B. koehlerae is a cause or cofactor in the development of arthritis, peripheral
Directory of Open Access Journals (Sweden)
Shin-Yi Shyu
2013-12-01
Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.
DEFF Research Database (Denmark)
Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas
2014-01-01
, a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...
Aspects of the licensing procedures for enrichment reduction in research reactors
International Nuclear Information System (INIS)
Krull, W.
1983-01-01
The enrichment reduction for research reactors requires a licensing procedure. For this purpose the qualification of the new fuel has to be demonstrated and changes in reactor safety have to be investigated like reactivity values, form-factors, Pu- and fission product inventory, safety margins and accidents. Calculations should be partly experimentally verified. The possible extent of the licensing procedure is discussed. (orig.) [de
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg
2018-05-01
The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.
Energy Technology Data Exchange (ETDEWEB)
NONE
1976-11-05
This publication gives a detailed description of the experimental and calculation procedures for tritium enrichment. Most descriptive sections are divided into 2 parts: Section A describes the procedure in the IAEA laboratory; section B discusses the reasons behind the various procedures, and may indicate alternative acceptable, or in some cases even better, procedures. The description of the equipment focuses on electrolysis cells, cooling system and power supply. Routine procedures are discussed including handling and checking of samples after receipt, 'spike' and blank water, initial sample distillation, preparation of cells and samples for electrolysis, electrolysis and completion of electrolysis (weighing of cells, neutralisation and distillation) and precautions against contaminations (prevention, detection and cure). A list of equipment required for electrolytic enrichment of tritium is provided.
International Nuclear Information System (INIS)
1976-01-01
This publication gives a detailed description of the experimental and calculation procedures for tritium enrichment. Most descriptive sections are divided into 2 parts: Section A describes the procedure in the IAEA laboratory; section B discusses the reasons behind the various procedures, and may indicate alternative acceptable, or in some cases even better, procedures. The description of the equipment focuses on electrolysis cells, cooling system and power supply. Routine procedures are discussed including handling and checking of samples after receipt, 'spike' and blank water, initial sample distillation, preparation of cells and samples for electrolysis, electrolysis and completion of electrolysis (weighing of cells, neutralisation and distillation) and precautions against contaminations (prevention, detection and cure). A list of equipment required for electrolytic enrichment of tritium is provided
A PCR procedure for the detection of Giardia intestinalis cysts and Escherichia coli in lettuce.
Ramirez-Martinez, M L; Olmos-Ortiz, L M; Barajas-Mendiola, M A; Giono Cerezo, S; Avila, E E; Cuellar-Mata, P
2015-06-01
Giardia intestinalis is a pathogen associated with foodborne outbreaks and Escherichia coli is commonly used as a marker of faecal contamination. Implementation of routine identification methods of G. intestinalis is difficult for the analysis of vegetables and the microbiological detection of E. coli requires several days. This study proposes a PCR-based assay for the detection of E. coli and G. intestinalis cysts using crude DNA isolated from artificially contaminated lettuce. The G. intestinalis and E. coli PCR assays targeted the β-giardin and uidA genes, respectively, and were 100% specific. Forty lettuces from local markets were analysed by both PCR and light microscopy and no cysts were detected, the calculated detection limit was 20 cysts per gram of lettuce; however, by PCR, E. coli was detected in eight of ten randomly selected samples of lettuce. These data highlight the need to validate procedures for routine quality assurance. These PCR-based assays can be employed as alternative methods for the detection of G. intestinalis and E. coli and have the potential to allow for the automation and simultaneous detection of protozoa and bacterial pathogens in multiple samples. Significance and impact of the study: There are few studies for Giardia intestinalis detection in food because methods for its identification are difficult for routine implementation. Here, we developed a PCR-based method as an alternative to the direct observation of cysts in lettuce by light microscopy. Additionally, Escherichia coli was detected by PCR and the sanitary quality of lettuce was evaluated using molecular and standard microbiological methods. Using PCR, the detection probability of Giardia cysts inoculated onto samples of lettuce was improved compared to light microscopy, with the advantage of easy automation. These methods may be employed to perform timely and affordable detection of foodborne pathogens. © 2015 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Laura Audrey Hug
2013-11-01
Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.
Directory of Open Access Journals (Sweden)
Tian Ding
2017-05-01
Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.
Directory of Open Access Journals (Sweden)
Valeria Velasco
Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA
Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.
2014-01-01
The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using
Development of ISA procedure for uranium fuel fabrication and enrichment facilities
International Nuclear Information System (INIS)
Yamate, Kazuki; Arakawa, Tomoyuki; Yamashita, Masahiro; Sasaki, Noriaki; Hirano, Mitsumasa
2011-01-01
The integrated safety analysis (ISA) procedure has been developed to apply risk-informed regulation to uranium fuel fabrication and enrichment facilities. The major development efforts are as follows: (a) preparing the risk level matrix as an index for items-relied-on-for-safety (IROFS) identification, (b) defining requirements of IROFS, and (c) determining methods of IROFS importance based on the results of risk- and scenario-based analyses. For the risk level matrix, the consequence and likelihood categories have been defined by taking into account the Japanese regulatory laws, rules, and safety standards. The trial analyses using the developed procedure have been performed for several representative processes of the reference uranium fuel fabrication and enrichment facilities. This paper presents the results of the ISA for the sintering process of the reference fabrication facility. The results of the trial analyses have demonstrated the applicability of the procedure to the risk-informed regulation of these facilities. (author)
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...
Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles
2008-01-01
So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.
Naddaf, S R; Kishdehi, M; Siavashi, Mr
2011-01-01
The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
International Nuclear Information System (INIS)
Yamate, Kazuki; Yamada, Takashi; Takanashi, Mitsuhiro; Sasaki, Noriaki
2013-01-01
Integrated Safety Analysis (ISA) procedure for uranium fuel fabrication and enrichment facilities has been developed for aiming at applying risk-informed regulation to these uranium facilities. The development has carried out referring to the ISA (NUREG-1520) by the Nuclear Regulatory Commission (NRC). The paper presents purpose, principles and activities for the development of the ISA procedure, including Risk Level (RL) matrix and grading evaluation method of IROFS (Items Relied on for Safety), as well as general description and features of the procedure. Also described in the paper is current status in application of risk information from the ISA. Japanese four licensees of the uranium facilities have been conducting ISA for their representative processes using the developed procedure as their voluntary safety activities. They have been accumulating experiences and knowledge on the ISA procedure and risk information through the field activities. NISA (Nuclear and Industrial Safety Agency) and JNES (Japan Nuclear Energy Safety Organization) are studying how to use such risk information for the safety regulation of the uranium facilities, taking into account the licensees' experiences and knowledge. (authors)
Directory of Open Access Journals (Sweden)
Damir Marjanović
2006-05-01
Full Text Available Standard molecular techniques, with only a slight modification, are very useful in obtaining and interpreting the final results in the field of forensic genetic. Data obtained through such analysis are highly reliable and can be used as a very powerful tool that produces valuable results. However, success and swiftness of DNA typing of biological evidence either that found at a crime scene or used in disputed paternity testing, depends on the optimization of numerous factors. One of the most important and critical phases that ensures reliability of the whole procedure is the choice of the most suitable volume for the amplification protocol. Buccal swabs were collected from volunteers. DNA was extracted by Qiagen Dnaeasy Tissue Kit. PowerPlex 16 kit was used to simultaneously amplify 15 STR loci by PCR. Amplification was carried out as described previously. The tested total working reaction volumes were 5, 10 and 25 microl. The PCR amplification was carried out in PE Gene Amp PCR System Thermal Cycler (ABI, Foster City, CA. Amplification products were analyzed on an ABI PRISM 377 instrument (ABI, Foster City, CA in 5% bis-acrilamide gel. Amplification was generally successful for all the tested reaction volumes. Lower partial to complete DNA profiles ratio, the quality of obtained STR profiles, significantly reduced amount of reaction's components give advantage to 5 microl reaction volume over other two tested volumes in this case.
Tellapragada, Chaitanya; Shaw, Tushar; D'Souza, Annet; Eshwara, Vandana Kalwaje; Mukhopadhyay, Chiranjay
2017-07-01
To evaluate the diagnostic utility of enrichment culture and PCR for improved case detection rates of non-bacteraemic form of melioidosis in limited resource settings. Clinical specimens (n = 525) obtained from patients presenting at a tertiary care hospital of South India with clinical symptoms suggestive of community-acquired pneumonia, lower respiratory tract infections, superficial or internal abscesses, chronic skin ulcers and bone or joint infections were tested for the presence of Burkholderia pseudomallei using conventional culture (CC), enrichment culture (EC) and PCR. Sensitivity, specificity, positive and negative predictive values of CC and PCR were initially deduced using EC as the gold standard method. Further, diagnostic accuracies of all the three methods were analysed using Bayesian latent class modelling (BLCM). Detection rates of B. pseudomallei using CC, EC and PCR were 3.8%, 5.3% and 6%, respectively. Diagnostic sensitivities and specificities of CC and PCR were 71.4, 98.4% and 100 and 99.4%, respectively in comparison with EC as the gold standard test. With Bayesian latent class modelling, EC and PCR demonstrated sensitivities of 98.7 and 99.3%, respectively, while CC showed a sensitivity of 70.3% for detection of B. pseudomallei. An increase of 1.6% (95% CI: 1.08-4.32%) in the case detection rate of melioidosis was observed in the study population when EC and/or PCR were used in adjunct to the conventional culture technique. Our study findings underscore the diagnostic superiority of enrichment culture and/or PCR over conventional microbiological culture for improved case detection of melioidosis from non-blood clinical specimens. © 2017 John Wiley & Sons Ltd.
2010-01-01
... mycoplasma reactors by in vivo bio-assay (enrichment). 147.16 Section 147.16 Animals and Animal Products... the evaluation of mycoplasma reactors by in vivo bio-assay (enrichment). This procedure has been shown... publications: (a) Bigland, C. H. and A. J. DaMassa, “A Bio-Assay for Mycoplasma Gallisepticum.” In: United...
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
DEFF Research Database (Denmark)
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas
2017-01-01
, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...
DEFF Research Database (Denmark)
Bruhn, Jesper Bartholin; Vogel, Birte Fonnesbech; Gram, Lone
2005-01-01
compounds in UVM I and II influenced this bias. The results of the present study demonstrate that the selective procedures used for isolation of L. monocytogenes may not allow a true representation of the types present in foods. Our results could have a significant impact on epidemiological studies...
Directory of Open Access Journals (Sweden)
Deborah R Boone
Full Text Available Cognitive deficits in survivors of traumatic brain injury (TBI are associated with irreversible neurodegeneration in brain regions such as the hippocampus. Comparative gene expression analysis of dying and surviving neurons could provide insight into potential therapeutic targets. We used two pathway-specific PCR arrays (RT2 Profiler Apoptosis and Neurotrophins & Receptors PCR arrays to identify and validate TBI-induced gene expression in dying (Fluoro-Jade-positive or surviving (Fluoro-Jade-negative pyramidal neurons obtained by laser capture microdissection (LCM. In the Apoptosis PCR array, dying neurons showed significant increases in expression of genes associated with cell death, inflammation, and endoplasmic reticulum (ER stress compared with adjacent, surviving neurons. Pro-survival genes with pleiotropic functions were also significantly increased in dying neurons compared to surviving neurons, suggesting that even irreversibly injured neurons are able to mount a protective response. In the Neurotrophins & Receptors PCR array, which consists of genes that are normally expected to be expressed in both groups of hippocampal neurons, only a few genes were expressed at significantly different levels between dying and surviving neurons. Immunohistochemical analysis of selected, differentially expressed proteins supported the gene expression data. This is the first demonstration of pathway-focused PCR array profiling of identified populations of dying and surviving neurons in the brain after TBI. Combining precise laser microdissection of identifiable cells with pathway-focused PCR array analysis is a practical, low-cost alternative to microarrays that provided insight into neuroprotective signals that could be therapeutically targeted to ameliorate TBI-induced neurodegeneration.
Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J
2014-06-01
Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Sidney de Almeida; Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mail: vidasnino@yahoo.com.br; antero@cdtn.br; Ituassu, Leonardo Trindade; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)]. E-mail: melo@mono.icb.ufmg.br; ltituassu@yahoo.com.br
2007-07-01
The dogs are the main reservoir of the visceral leishmaniasis etiological agent Leishmania chagasi and these animals have to be systematically monitored. The aim of present work was to standardize a method for canine leishmaniasis diagnosis using DNA samples obtained by a noninvasive ways. Two kind of samples were compared: conjunctival swab and blood. The samples were analyzed by the Polymerase Chain Reaction (PCR) associated with the hybridization of {sup 32}P labeled DNA probes. An in vitro test was carried out using cotton swabs seeded with L. chagasi parasites at different cell numbers. After that, the PCR and hybridization sensitivity was evaluated in two groups of 23 seropositive dogs. Conjunctival swabs and 1,0 mL of blood were collected from each animal. 90 {mu}L of these blood were spotted onto filter paper and the remaining used to prepare the buffy coat. The DNA purification from cotton swabs was carried out through the phenol-chloroform (group 1) or boiling (group 2). The Wizard kit was used to DNA extraction from buffy coat. The filters were treated according to Dialab protocol. The analysis of the seeded samples showed that the PCR was able to identify until ten parasites while the following hybridization of the PCR products allows the detection of until one parasite. The PCR positivity for the conjunctival swabs were 73.9% and 52.2% respectively to the groups 1 and 2. For buffy coat the positivities were 43.5% and 56.5% respectively. The filters presented the lowest positivity. The hybridization step was not accomplished yet for these samples. (author)
Rodgers, J D; Simpkin, E; Lee, R; Clifton-Hadley, F A; Vidal, A B
2017-06-01
Broiler chicken flocks are a significant source of Campylobacter jejuni and Campylobacter coli that result in the major public health problem of campylobacteriosis. Accurate estimates of the prevalence of both C. coli and C. jejuni in flocks would enhance epidemiological understanding, risk assessment and control options. This study combined results from a panel of 10 detection tests (direct culture, enrichment and PCR) on caecal samples from flocks at slaughter. A parallel interpretation approach was used to determine the presence of Campylobacter spp. and for C. jejuni and C. coli individually. The sample was considered positive if at least one method detected the target and this interpretation was taken to represent a 'proxy gold standard' for detection in the absence of a gold standard reference test. The sensitivity of each individual method to detect Campylobacter spp., C. jejuni and C. coli was then estimated relative to the proxy gold standard. Enrichment in adapted Exeter broth (deficient in polymyxin B) with a resuscitation step was 100% sensitive, whilst direct culture on modified charcoal cefoperazone deoxycholate agar (mCCDA) was highly sensitive (97.9%). Enrichment methods using Preston broth and Bolton broth were significantly less sensitive. Enrichment in Exeter broth promoted the recovery of C. jejuni, whilst enrichment in Bolton broth favoured C. coli. A RT-PCR detection test could identify 80% of flocks that were co-colonised with both species. This study found that 76.3% (n = 127) of flocks were colonised with Campylobacter spp. The majority (95.9%) of Campylobacter-positive flocks were colonised with C. jejuni; however, approximately one-third of positive flocks were simultaneously colonised with both C. jejuni and C. coli. The findings highlight the impact of different detection methodologies on the accuracy of the estimated incidence of both C. jejuni and C. coli entering the abattoir within broiler flocks and the associated
A study of the material accountancy procedure at the uranium enrichment facility
International Nuclear Information System (INIS)
Shirahashi, J.; Akiba, M.; Omae, M.
1984-01-01
This paper describes an evaluation of material accountancy based on total uranium (U element MUF) to detect diversions of significant quantity in the uranium enrichment facility operating at a stated maximum enrichment level of 5%. Verification that material production is within the declared enrichment can be achieved by the inspection activities associated with limited - frequency unannounced access (LFUA) to cascade areas as treated extensively in HSP. According to the experience of the material accountancy at our facility, the reduction of the material accountancy capability by changing from U-235 isotope MUF to U element MUF is only about half. However, still the U element MUF approach can meet the current IAEA detection goals for the up to about 1000 tswu/a plant
Procedures for the retention of gaseous tritium released from a tritium enrichment plant
International Nuclear Information System (INIS)
Gutowski, H.; Bracha, M.
1987-01-01
General aim of the study is the comparison of two alternative processes for the retention of gaseous tritium which is released during normal operation and emergency operation in a tritium-enrichment-plant. Two processes for the retention of tritium were compared: 1. Oxidation-process. The hydrogen-gas containing HT will be burnt on an oxidation catalyst to H 2 O and HTO. In a subsequent step the water will be removed from the process by condensation, freezing and adsorption. 2. TROC-process (Tritium Removal by Organic Compounds). The tritium is added to an organic compound (acid) via catalyst. This reaction is irreversible and leads to solid products. (orig./RB) [de
DEFF Research Database (Denmark)
Mahmmod, Yasser; Mweu, Marshal Mutinda; Nielsen, Søren Saxmose
2014-01-01
with Streptococcus agalactiae (S. agalactiae) in dairy herds with conventional milking parlours. Misclassification may result in unnecessary costs for treatment and culling. The objectives of this study were to (1) determine the effect of carryover on PCR-positivity for S. agalactiae at different PCR cycle threshold...... (Ct) cut-offs by estimating the between-cow correlation while accounting for the milking order, and (2) evaluate the effect of aseptic presampling procedures (PSP) on PCR-positivity at the different Ct-value cut-offs. The study was conducted in four herds with conventional milking parlours at routine...
International Nuclear Information System (INIS)
Ansoborlo, E.; Claraz, M.; Henge-Napoli, M.H.; Metivier, H.
1995-01-01
Comprehensive studies of the radiotoxicological risk at new uranium enrichment processing facilities using laser isotopic separation, were particularly motivated by the generation of a uranium oxide aerosol identified as UO 2 + U metal . Taking the new ICRP 66 recommendations into account, the following study on this uranium oxide mixture, was aimed at determining the physico-chemical and biokinetic specific parameters required in order to calculate the effective dose. The activity median aerodynamic diameters (AMAD) ranged between 5.2 and 10 μm with, in some cases, up to 20% of submicron size particles, while concentration values at the workplace ranged from 1.8 to 125 Bq m -3 and biological half-time calculations gave a 48 d period with in vitro dissolution test and a 77 d period with in vivo inhalation experiments. Transfer rates and dissolution rates obtained from both in vitro and vivo experiments intend to emphasize a class W behaviour in term of ICRP 30 and M in term of ICRP 66. (authors). 3 figs., 4 tabs., 22 refs
Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A
2014-12-01
Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.
International Nuclear Information System (INIS)
Hein, H.; Schuette, R.; Steinhaus, H.
1978-09-01
In industrial scale separation nozzle cascades measured data acquisition and process control will be performed by on-line computer systems. To develop the necessary measurement and monitoring techniques, on-line control of the ten stage pilot plant by the WANG 2200 miniature computer system was tested. On-line data processing at the same time has reduced the number of measurements because a large number of operating data which cannot be measured directly can be obtained from a reduced number of measurements by calculation from the material balances in the gas dynamics network of the enrichment cascade. This is performed on-line by means of a cascade monitoring code which produces diagrams of the deviations of major operating parameters from their set values and thus offers to cascade operators an improved picture of the present status of a cascade, thereby facilitating the detection of causes of defects. The graphic representation chosen for this purpose and the performance of the system in practical operation is explained by an example of cascade adjustment and by a few selected examples of cascade fault conditions. Calculation of the quantities derived at all stages from the pressure (po) and concentration (No) readings requires that the individual flow characteristics of the separation nozzles are known. Alos the compressor characteristics have to be determined. Since the monitoring computer in calculating the cascade status utilizes these component characteristics in current enrichment operation, routinely establishing and plotting these two characteristics is also attributed to the computer system (start-up procedures). (orig.) 891 HP [de
Hazeleger, Wilma C; Jacobs-Reitsma, Wilma F; den Besten, Heidy M W
2016-01-01
Campylobacter is well recognized as the leading cause of bacterial foodborne diarrheal disease worldwide, and is routinely found in meat originating from poultry, sheep, pigs, and cattle. Effective monitoring of Campylobacter contamination is dependent on the availability of reliable detection methods. The method of the International Organization for Standardization for the detection of Campylobacter spp. in food (ISO 10272-1:2006) recommends the use of Bolton broth (BB) as selective enrichment medium, including a pre-enrichment step of 4-6 h at 37°C to revive sublethally damaged cells prior to incubation for 2 days at 41.5°C. Recently the presence of abundantly growing extended spectrum β-lactamase producing Enterobacteriaceae (ESBL bacteria) has become one of the most important factors that interfere with the isolation of Campylobacter, resulting in false-negative detection. However, detailed growth dynamics of Campylobacter and its competitors remain unclear, where these would provide a solid base for further improvement of the enrichment procedure for Campylobacter. Other enrichment broths, such as Preston broth (PB) and BB plus clavulanic acid (BBc) have been suggested to inhibit competitive flora. Therefore, these different broths were used as enrichments to measure the growth kinetics of several strains of Campylobacter jejuni and ESBL bacteria separately, in co-culture and of strains in chicken samples. The maximum cell numbers and often the growth rates of Campylobacter in mixed culture with ESBL bacteria were significantly lower than in single cultures, indicating severe suppression of Campylobacter by ESBL bacteria, also in naturally contaminated samples. PB and BBc successfully diminished ESBL bacteria and might therefore be a better choice as enrichment medium in possibly ESBL-bacteria contaminated samples. The efficacy of a pre-enrichment step in the BB ISO-procedure was not supported for cold-stressed and non-stressed cells. Therefore, omission of
Directory of Open Access Journals (Sweden)
Etchells J Peter
2009-10-01
Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.
Directory of Open Access Journals (Sweden)
Ivona Djurkin Kušec
2015-09-01
Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.
Yankson, Kweku K.; Steck, Todd R.
2009-01-01
We present a simple strategy for isolating and accurately enumerating target DNA from high-clay-content soils: desorption with buffers, an optional magnetic capture hybridization step, and quantitation via real-time PCR. With the developed technique, μg quantities of DNA were extracted from mg samples of pure kaolinite and a field clay soil. PMID:19633108
Hassani, Asma; Khan, Gulfaraz
2015-12-01
Long-term formalin fixed brain tissues are potentially an important source of material for molecular studies. Ironically, very few protocols have been published describing DNA extraction from such material for use in PCR analysis. In our attempt to investigate the role of Epstein-Barr virus (EBV) in the pathogenesis of multiple sclerosis (MS), extracting PCR quality DNA from brain samples fixed in formalin for 2-22 years, proved to be very difficult and challenging. As expected, DNA extracted from these samples was not only of poor quality and quantity, but more importantly, it was frequently found to be non-amplifiable due to the presence of PCR inhibitors. Here, we describe a simple and reproducible procedure for extracting DNA using a modified proteinase K and phenol-chloroform methodology. Central to this protocol is the thorough pre-digestion washing of the tissues in PBS, extensive digestion with proteinase K in low SDS containing buffer, and using low NaCl concentration during DNA precipitation. The optimized protocol was used in extracting DNA from meninges of 26 MS and 6 non-MS cases. Although the quality of DNA from these samples was generally poor, small size amplicons (100-200 nucleotides) of the house-keeping gene, β-globin could be reliably amplified from all the cases. PCR for EBV revealed positivity in 35% (9/26) MS cases, but 0/6 non-MS cases. These findings indicate that the method described here is suitable for PCR detection of viral sequences in long-term formalin persevered brain tissues. Our findings also support a possible role for EBV in the pathogenesis of MS. Copyright © 2015 Elsevier Inc. All rights reserved.
Broda, D M; Boerema, J A; Brightwell, G
2009-07-01
To determine possible preslaughter and processing sources of psychrophilic and psychrotolerant clostridia causing spoilage of vacuum-packed chilled meats. Molecular methods based on the polymerase chain reaction (PCR) amplification of specific 16S rDNA fragments were used to detect the presence of Clostridium gasigenes, Clostridium estertheticum, Clostridium algidicarnis and Clostridium putrefaciens in a total of 357 samples collected from ten slaughter stock supply farms, slaughter stock, two lamb-processing plants, their environments, dressed carcasses and final vacuum-packed meat stored at -0.5 degrees C for 5(1/2) weeks. Clostridium gasigenes, C. estertheticum and C. algidicarnis/C. putrefaciens were commonly detected in farm, faeces, fleece and processing environmental samples collected at the slaughter floor operations prior to fleece removal, but all these micro-organisms were detected in only 4 out of 26 cooling floor and chiller environmental samples. One out of 42 boning room environmental samples tested positive for the presence of C. gasigenes and C. estertheticum, but 25 out of 42 of these samples were positive for C. algidicarnis/C. putrefaciens. Nearly all of the 31 faecal samples tested positive for the presence of C. gasigenes and C. estertheticum; however, only two of these samples were positive for C. algidicarnis and/or C. putrefaciens. Clostridial species that were subject to this investigation were frequently detected on chilled dressed carcasses. The major qualitative and quantitative differences between the results of PCR detection obtained with the primers specific for 'blown pack' -causing clostridia (C. gasigenes and C. estertheticum) and those obtained with primers specific for C. algidicarnis and C. putrefaciens suggest that the control of meat spoilage caused by different groups of meat clostridia is best approached individually for each group. This paper provides information significant for controlling meat spoilage-causing clostridia
International Nuclear Information System (INIS)
Guimaraes, Leonam dos Santos; Degrange, Jean Pierre
1998-01-01
The study introduced by this paper compose the first step to the implementation of ALARA (As Low As Reasonable Achievable) for a nuclear fuel assembly factory which one of its two production lines will be designed to work with Enriched Reprocessing Uranium (ERU). This step includes the reference situation analysis is based on previsional dosimetric evaluations for individual and collective exposures of each factory operator (117 in total) working on 7 work stations, considering 6 annual production scenarios (10, 50 75, 100 and 150 ERU tons), which corresponds to an annual production of 600 tons (ERU plus enriched natural uranium ENU). The exposure indicators evolution, expressed in terms of collective dose, annual individual dose and radiological detrimental cost for workers, is also used in a complimentary way to guide the analysis. (author)
Enrichment of Acinetobacter spp. from food samples.
Carvalheira, Ana; Ferreira, Vânia; Silva, Joana; Teixeira, Paula
2016-05-01
Relatively little is known about the role of foods in the chain of transmission of acinetobacters and the occurrence of different Acinetobacter spp. in foods. Currently, there is no standard procedure to recover acinetobacters from food in order to gain insight into the food-related ecology and epidemiology of acinetobacters. This study aimed to assess whether enrichment in Dijkshoorn enrichment medium followed by plating in CHROMagar™ Acinetobacter medium is a useful method for the isolation of Acinetobacter spp. from foods. Recovery of six Acinetobacter species from food spiked with these organisms was compared for two selective enrichment media (Baumann's enrichment and Dijkshoorn's enrichment). Significantly (p enrichment. Next, the Dijkshoorn's enrichment followed by direct plating on CHROMagar™ Acinetobacter was applied to detect Acinetobacter spp. in different foods. Fourteen different presumptive acinetobacters were recovered and assumed to represent nine different strains on the basis of REP-PCR typing. Eight of these strains were identified by rpoB gene analysis as belonging to the species Acinetobacter johnsonii, Acinetobacter calcoaceticus, Acinetobacter guillouiae and Acinetobacter gandensis. It was not possible to identify the species level of one strain which may suggests that it represents a distinct species. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.
1991-01-01
The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs
Uranium enrichment. Enrichment processes
International Nuclear Information System (INIS)
Alexandre, M.; Quaegebeur, J.P.
2009-01-01
Despite the remarkable progresses made in the diversity and the efficiency of the different uranium enrichment processes, only two industrial processes remain today which satisfy all of enriched uranium needs: the gaseous diffusion and the centrifugation. This article describes both processes and some others still at the demonstration or at the laboratory stage of development: 1 - general considerations; 2 - gaseous diffusion: physical principles, implementation, utilisation in the world; 3 - centrifugation: principles, elementary separation factor, flows inside a centrifuge, modeling of separation efficiencies, mechanical design, types of industrial centrifuges, realisation of cascades, main characteristics of the centrifugation process; 4 - aerodynamic processes: vortex process, nozzle process; 5 - chemical exchange separation processes: Japanese ASAHI process, French CHEMEX process; 6 - laser-based processes: SILVA process, SILMO process; 7 - electromagnetic and ionic processes: mass spectrometer and calutron, ion cyclotron resonance, rotating plasmas; 8 - thermal diffusion; 9 - conclusion. (J.S.)
Directory of Open Access Journals (Sweden)
Markus Spiliotis
Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.
Abbasi, Ibrahim; Aramin, Samar; Hailu, Asrat; Shiferaw, Welelta; Kassahun, Aysheshm; Belay, Shewaye; Jaffe, Charles; Warburg, Alon
2013-03-27
Visceral Leishmaniasis (VL) is a disseminated protozoan infection caused by Leishmania donovani parasites which affects almost half a million persons annually. Most of these are from the Indian sub-continent, East Africa and Brazil. Our study was designed to elucidate the role of symptomatic and asymptomatic Leishmania donovani infected persons in the epidemiology of VL in Northern Ethiopia. The efficacy of quantitative real-time kinetoplast DNA/PCR (qRT-kDNA PCR) for detecting Leishmania donovani in dried-blood samples was assessed in volunteers living in an endemic focus. Of 4,757 samples, 680 (14.3%) were found positive for Leishmania k-DNA but most of those (69%) had less than 10 parasites/ml of blood. Samples were re-tested using identical protocols and only 59.3% of the samples with 10 parasite/ml or less were qRT-kDNA PCR positive the second time. Furthermore, 10.8% of the PCR negative samples were positive in the second test. Most samples with higher parasitemias remained positive upon re-examination (55/59 =93%). We also compared three different methods for DNA preparation. Phenol-chloroform was more efficient than sodium hydroxide or potassium acetate. DNA sequencing of ITS1 PCR products showed that 20/22 samples were Leishmania donovani while two had ITS1 sequences homologous to Leishmania major. Although qRT-kDNA PCR is a highly sensitive test, the dependability of low positives remains questionable. It is crucial to correlate between PCR parasitemia and infectivity to sand flies. While optimal sensitivity is achieved by targeting k-DNA, it is important to validate the causative species of VL by DNA sequencing.
Czech Academy of Sciences Publication Activity Database
Smrž, Daniel; Dráber, Petr
2003-01-01
Roč. 283, 1-2 (2003), s. 163-172 ISSN 0022-1759 R&D Projects: GA AV ČR IBS5052201; GA AV ČR IAA5052310; GA ČR GA204/03/0594; GA ČR GA301/03/0596; GA MŠk LN00A026 Institutional research plan: CEZ:AV0Z5052915 Keywords : PCR * DNA labelin * HCMV Subject RIV: EC - Immunology Impact factor: 2.744, year: 2003
Molecular diagnostic PCR handbook
International Nuclear Information System (INIS)
Viljoen, G.J.; Crowther, J.R.; Nel, L.H.
2005-01-01
The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology
Waage, Astrid S.; Vardund, Traute; Lund, Vidar; Kapperud, Georg
1999-01-01
A rapid and sensitive assay was developed for detection of small numbers of Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and food samples. Water and sewage samples were filtered, and the filters were enriched overnight in a nonselective medium. The enrichment cultures were prepared for PCR by a rapid and simple procedure consisting of centrifugation, proteinase K treatment, and boiling. A seminested PCR based on specific amplification of the intergenic sequence between the two Campylobacter flagellin genes, flaA and flaB, was performed, and the PCR products were visualized by agarose gel electrophoresis. The assay allowed us to detect 3 to 15 CFU of C. jejuni per 100 ml in water samples containing a background flora consisting of up to 8,700 heterotrophic organisms per ml and 10,000 CFU of coliform bacteria per 100 ml. Dilution of the enriched cultures 1:10 with sterile broth prior to the PCR was sometimes necessary to obtain positive results. The assay was also conducted with food samples analyzed with or without overnight enrichment. As few as ≤3 CFU per g of food could be detected with samples subjected to overnight enrichment, while variable results were obtained for samples analyzed without prior enrichment. This rapid and sensitive nested PCR assay provides a useful tool for specific detection of C. jejuni or C. coli in drinking water, as well as environmental water, sewage, and food samples containing high levels of background organisms. PMID:10103261
International Nuclear Information System (INIS)
Lydtin, H-J.; Wilden, R.J.; Severin, P.J.W.
1978-01-01
The isotope enrichment method described is based on the recognition that, owing to mass diffusion and thermal diffusion in the conversion of substances at a heated substrate while depositing an element or compound onto the substrate, enrichment of the element, or a compound of the element, with a lighter isotope will occur. The cycle is repeated for as many times as is necessary to obtain the degree of enrichment required
International Nuclear Information System (INIS)
1990-01-01
This report looks at the following issues: How much Soviet uranium ore and enriched uranium are imported into the United States and what is the extent to which utilities flag swap to disguise these purchases? What are the U.S.S.R.'s enriched uranium trading practices? To what extent are utilities required to return used fuel to the Soviet Union as part of the enriched uranium sales agreement? Why have U.S. utilities ended their contracts to buy enrichment services from DOE?
Developments in uranium enrichment
International Nuclear Information System (INIS)
Mohrhauer, H.
1995-01-01
The enrichment services market is still characterized by overcapacities. While consumption worldwide will rise by some 15% to 39,000 t SWU/a over the next ten years, capacities amount to nearly 50,000 t SWU/a. The price for enrichment services probably has reached its all time low. Prices below U.S. $ 100/kg SWU are not likely to cover costs even of the economically most advanced enrichment processes. Urenco has prepared for the difficult enrichment business in the years to come by streamlining and cost cutting measures. The company intends to hold and increase its share of more than 10% in the world market. The uranium enrichment plant of Gronau will be expanded further. Expansion beyond 1000 t is subject to another permit being granted under the Atomic Energy Act, an application for which was filed in December 1994. Centrifuge technology is the superior enrichment technology, i.e., there is still considerable potential for further development. Construction of enrichment plants employing the centrifuge technology in the United States and in France is being pursued in various phases, from feasibility studies to licensing procedures. Before these plants could be implemented, however, considerable problems of organization would have to be solved, and the market would have to change greatly, respectively. The laser process, at the present time, does not seem to be able to develop into a major industrial competitor. (orig.) [de
International Nuclear Information System (INIS)
1989-01-01
GAO was asked to address several questions concerning a number of proposed uranium enrichment bills introduced during the 100th Congress. The bill would have restructured the Department of Energy's uranium enrichment program as a government corporation to allow it to compete more effectively in the domestic and international markets. Some of GAO's findings discussed are: uranium market experts believe and existing market models show that the proposed DOE purchase of a $750 million of uranium from domestic producers may not significantly increase production because of large producer-held inventories; excess uranium enrichment production capacity exists throughout the world; therefore, foreign producers are expected to compete heavily in the United States throughout the 1990s as utilities' contracts with DOE expire; and according to a 1988 agreement between DOE's Offices of Nuclear Energy and Defense Programs, enrichment decommissioning costs, estimated to total $3.6 billion for planning purposes, will be shared by the commercial enrichment program and the government
DEFF Research Database (Denmark)
Mærkedahl, Rasmus Baadsgaard; Frøkiær, Hanne; Lauritzen, Lotte
2015-01-01
Abstract Background: In large clinical trials, where RNA cannot be extracted immediately after sampling, preserving RNA in whole blood is a crucial initial step in obtaining robust qPCR data. The current golden standard for RNA preservation is costly and designed for time-consuming column-based RNA....../binding solution over time and between samples stored and extracted by the two systems. Conclusions: The MagMAX system can be used for storage of human blood for up to 4 months and is equivalent to the PAXgene system for RNA extraction. It furthermore, provides a means for significant cost reduction in large...
International Nuclear Information System (INIS)
Rae, H.K.; Melvin, J.G.
1988-06-01
Canada is the world's largest producer and exporter of uranium, most of which is enriched elsewhere for use as fuel in LWRs. The feasibility of a Canadian uranium-enrichment enterprise is therefore a perennial question. Recent developments in uranium-enrichment technology, and their likely impacts on separative work supply and demand, suggest an opportunity window for Canadian entry into this international market. The Canadian opportunity results from three particular impacts of the new technologies: 1) the bulk of the world's uranium-enrichment capacity is in gaseous diffusion plants which, because of their large requirements for electricity (more than 2000 kW·h per SWU), are vulnerable to competition from the new processes; 2) the decline in enrichment costs increases the economic incentive for the use of slightly-enriched uranium (SEU) fuel in CANDU reactors, thus creating a potential Canadian market; and 3) the new processes allow economic operation on a much smaller scale, which drastically reduces the investment required for market entry and is comparable with the potential Canadian SEU requirement. The opportunity is not open-ended. By the end of the century the enrichment supply industry will have adapted to the new processes and long-term customer/supplier relationships will have been established. In order to seize the opportunity, Canada must become a credible supplier during this century
International Nuclear Information System (INIS)
Mohrhauer, H.
1982-01-01
The separation of uranium isotopes in order to enrich the fuel for light water reactors with the light isotope U-235 is an important part of the nuclear fuel cycle. After the basic principals of isotope separation the gaseous diffusion and the centrifuge process are explained. Both these techniques are employed on an industrial scale. In addition a short review is given on other enrichment techniques which have been demonstrated at least on a laboratory scale. After some remarks on the present situation on the enrichment market the progress in the development and the industrial exploitation of the gas centrifuge process by the trinational Urenco-Centec organisation is presented. (orig.)
International Nuclear Information System (INIS)
Garbuny, M.
1979-01-01
The invention discloses a method for deriving, from a starting material including an element having a plurality of isotopes, derived material enriched in one isotope of the element. The starting material is deposited on a substrate at less than a critical submonatomic surface density, typically less than 10 16 atoms per square centimeter. The deposit is then selectively irradiated by a laser (maser or electronic oscillator) beam with monochromatic coherent radiation resonant with the one isotope causing the material including the one istope to escape from the substrate. The escaping enriched material is then collected. Where the element has two isotopes, one of which is to be collected, the deposit may be irradiated with radiation resonant with the other isotope and the residual material enriched in the one isotope may be evaporated from the substrate and collected
International Nuclear Information System (INIS)
1991-08-01
This paper reports that in 1990 the Department of Energy began a two-year project to illustrate the technical and economic feasibility of a new uranium enrichment technology-the atomic vapor laser isotope separation (AVLIS) process. GAO believes that completing the AVLIS demonstration project will provide valuable information about the technical viability and cost of building an AVLIS plant and will keep future plant construction options open. However, Congress should be aware that DOE still needs to adequately demonstrate AVLIS with full-scale equipment and develop convincing cost projects. Program activities, such as the plant-licensing process, that must be completed before a plant is built, could take many years. Further, an updated and expanded uranium enrichment analysis will be needed before any decision is made about building an AVLIS plant. GAO, which has long supported legislation that would restructure DOE's uranium enrichment program as a government corporation, encourages DOE's goal of transferring AVLIS to the corporation. This could reduce the government's financial risk and help ensure that the decision to build an AVLIS plant is based on commercial concerns. DOE, however, has no alternative plans should the government corporation not be formed. Further, by curtailing a planned public access program, which would have given private firms an opportunity to learn about the technology during the demonstration project, DOE may limit its ability to transfer AVLIS to the private sector
Extraosseus enrichments in bone scintigraphy
International Nuclear Information System (INIS)
Jochens, R.; Schumacher, T.; Amthauer, H.; Wolter, M.; Stock, W.; Stroszczynski, C.; Moersler, J.P.; Eichstaedt, H.
1996-01-01
Extraosseus enrichments are common findings in bone scintigraphy. Main causes are artifacts by skin or cloth contamination, paravenous and subcutaneous injection. Physical examination, removal of cloths, skin cleaning or further images in differing projections lead to the correct diagnosis artefact or extraosseous enrichments. Further on, extraosseous enrichments are seen in physiological variants. In different diseases extraosseous enrichments are common, especially in urinary tract, liver and extremities. Further diagnostics, e.g. conventional radiologic procedures, sonography and CT scans, have to be performed. In individual cases side results in bone scintigraphy lead to formerly unknown diagnosis, further diagnostic procedure is influenced decisively. Own cases show for example a cerebral apoplectic insult, formerly unknown liver metastasis or metastasis in extraosseous Ewings's sarcoma. (orig.) [de
Hemmati, Maryam; Rajabi, Maryam; Asghari, Alireza
2017-11-17
In this research work, two consecutive dispersive solid/liquid phase microextractions based on efficient extraction media were developed for the influential and clean pre-concentration of clonazepam and lorazepam from complicated bio-samples. The magnetism nature of the proposed nanoadsorbent proceeded the clean-up step conveniently and swiftly (∼5min), pursued by a further enrichment via a highly effective and rapid emulsification microextraction process (∼4min) based on a deep eutectic solvent (DES). Finally, the instrumental analysis step was practicable via high performance liquid chromatography-ultraviolet detection. The solid phase used was an adequate magnetic nanocomposite termed as polythiophene-sodium dodecyl benzene sulfonate/iron oxide (PTh-DBSNa/Fe 3 O 4 ), easily and cost-effectively prepared by the impressive co-precipitation method followed by the efficient in situ sonochemical oxidative polymerization approach. The identification techniques viz. FESEM, XRD, and EDX certified the supreme physico-chemical properties of this effective nanosorbent. Also the powerful liquid extraction agent, DES, based on bio-degradable choline chloride, possessed a high efficiency, tolerable safety, low cost, and facile and mild synthesis route. The parameters involved in this versatile hyphenated procedure, efficiently evaluated via the central composite design (CCD), showed that the best extraction conditions consisted of an initial pH value of 7.2, 17mg of the PTh-DBSNa/Fe 3 O 4 nanocomposite, 20 air-agitation cycles (first step), 245μL of methanol, 250μL of DES, 440μL of THF, and 8 air-agitation cycles (second step). Under the optimal conditions, the understudied drugs could be accurately determined in the wide linear dynamic ranges (LDRs) of 4.0-3000ngmL -1 and 2.0-2000ngmL -1 for clonazepam and lorazepam, respectively, with low limits of detection (LODs) ranged from 0.7 to 1.0ngmL -1 . The enrichment factor (EF) and percentage extraction recovery (%ER
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
International Nuclear Information System (INIS)
1991-11-01
This paper analyzes under four different scenarios the adequacy of a $500 million annual deposit into a fund to pay for the cost of cleaning up the Department of Energy's (DOE) three aging uranium enrichment plants. These plants are located in Oak Ridge, Tennessee; Paducah, Kentucky; and Portsmouth, Ohio. In summary the following was found: A fixed annual $500 million deposit made into a cleanup fund would not be adequate to cover total expected cleanup costs, nor would it be adequate to cover expected decontamination and decommissioning (D and D) costs. A $500 million annual deposit indexed to an inflation rate would likely be adequate to pay for all expected cleanup costs, including D and D costs, remedial action, and depleted uranium costs
A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.
Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V
2014-01-01
Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.
Directory of Open Access Journals (Sweden)
Emara Samy
2012-12-01
Full Text Available Abstract Background Analysis of folic acid (FA is not an easy task because of its presence in lower concentrations, its lower stability under acidic conditions, and its sensitiveness against light and high temperature. The present study is concerned with the development and validation of an automated environmentally friendly pre-column derivatization combined by solid-phase enrichment (SPEn to determine low levels of FA. Results Cerium (IV trihydroxyhydroperoxide (CTH as a packed oxidant reactor has been used for oxidative cleavage of FA into highly fluorescent product, 2-amino-4-hydroxypteridine-6-carboxylic acid. FA was injected into a carrier stream of 0.04 M phosphate buffer, pH 3.4 at a flow-rate of 0.25 mL/min. The sample zone containing the analyte was passed through the CTH reactor thermostated at 40°C, and the fluorescent product was trapped and enriched on a head of small ODS column (10 mm x 4.6 mm i.d., 5 μm particle size. The enriched product was then back-flush eluted by column-switching from the small ODS column to the detector with a greener mobile phase consisting of ethanol and phosphate buffer (0.04M, pH 3.4 in the ratio of 5:95 (v/v. The eluent was monitored fluorimetrically at emission and excitation wavelengths of 463 and 367 nm, respectively. The calibration graph was linear over concentrations of FA in the range of 1.25-50 ng/mL, with a detection limit of 0.49 ng/mL. Conclusion A new simple and sensitive green analytical procedure including on-line pre-column derivatization combined by SPEn has been developed for the routine quality control and dosage form assay of FA at very low concentration level. The method was a powerful analytical technique that had excellent sensitivity, sufficient accuracy and required relatively simple and inexpensive instrumentation.
Juvenile psittacine environmental enrichment.
Simone-Freilicher, Elisabeth; Rupley, Agnes E
2015-05-01
Environmental enrichment is of great import to the emotional, intellectual, and physical development of the juvenile psittacine and their success in the human home environment. Five major types of enrichment include social, occupational, physical, sensory, and nutritional. Occupational enrichment includes exercise and psychological enrichment. Physical enrichment includes the cage and accessories and the external home environment. Sensory enrichment may be visual, auditory, tactile, olfactory, or taste oriented. Nutritional enrichment includes variations in appearance, type, and frequency of diet, and treats, novelty, and foraging. Two phases of the preadult period deserve special enrichment considerations: the development of autonomy and puberty. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr
2006-01-01
Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB
International Nuclear Information System (INIS)
Baez, L.A.; Juneja, V.K.; Thayer, D.W.; Sackitey, S.
1997-01-01
The sensitivity of DNA hybridization and polymerase chain reaction (PCR), was evaluated in irradiated cooked and raw beef samples. A membrane-based colony hybridization assay and a PCR protocol, both with specificity for the enterotoxin A gene of Clostridium perfringens, were compared with viable plate counts. The results of the colony hybridization procedure were in agreement with viable plate counts for detection and enumeration of enterotoxigenic C. perfringens. The PCR procedure combined a 4 h enrichment followed by a nucleic acid extraction step and assessed the amplification of 183 and 750 base pair enterotoxin gene targets. Detection of C. perfringens by PCR did not show a reliable correlation with viable plate counts or the colony hybridization assay. C. perfringens killed by irradiation were not detected by the plate count or colony hybridization methods; however, killed cells were detected with the PCR technique. By relying on the growth of viable cells for detection and/or enumeration, the colony hybridization and plate count methods provided a direct correlation with the presence of viable bacteria
Other enrichment related contracts
International Nuclear Information System (INIS)
Hall, J.C.
1978-01-01
In addition to long-term enrichment contracts, DOE has other types of contracts: (1) short-term, fixed-commitment enrichment contract; (2) emergency sales agreement for enriched uranium; (3) feed material lease agreement; (4) enriched uranium storage agreement; and (5) feed material usage agreement
Identification, Selection, and Enrichment of Cardiomyocyte Precursors
Directory of Open Access Journals (Sweden)
Bianca Ferrarini Zanetti
2013-01-01
Full Text Available The large-scale production of cardiomyocytes is a key step in the development of cell therapy and tissue engineering to treat cardiovascular diseases, particularly those caused by ischemia. The main objective of this study was to establish a procedure for the efficient production of cardiomyocytes by reprogramming mesenchymal stem cells from adipose tissue. First, lentiviral vectors expressing neoR and GFP under the control of promoters expressed specifically during cardiomyogenesis were constructed to monitor cell reprogramming into precardiomyocytes and to select cells for amplification and characterization. Cellular reprogramming was performed using 5′-azacytidine followed by electroporation with plasmid pOKS2a, which expressed Oct4, Sox2, and Klf4. Under these conditions, GFP expression began only after transfection with pOKS2a, and less than 0.015% of cells were GFP+. These GFP+ cells were selected for G418 resistance to find molecular markers of cardiomyocytes by RT-PCR and immunocytochemistry. Both genetic and protein markers of cardiomyocytes were present in the selected cells, with some variations among them. Cell doubling time did not change after selection. Together, these results indicate that enrichment with vectors expressing GFP and neoR under cardiomyocyte-specific promoters can produce large numbers of cardiomyocyte precursors (CMPs, which can then be differentiated terminally for cell therapy and tissue engineering.
Report of the Subcommittee on Domestic Uranium Enrichment
International Nuclear Information System (INIS)
1981-01-01
A report by the Subcommittee on Domestic Uranium Enrichment to the Atomic Energy Commission is described; which covers the procedure of the domestic uranium enrichment by centrifugal process up to the commercial production, reviewing the current situation in this field. Domestic uranium enrichment is important in the aspects of securing stable enrichment service, establishing sound fuel cycle, and others. As the future target, the production around the year 2000 is set at 3,000 tons SWU per year at least. The business of uranium enrichment, which is now developed in the Power Reactor and Nuclear Fuel Development Corporation, is to be carried out by private enterprise. The contents are as follows: demand and supply balance of uranium enrichment service, significance of domestic uranium enrichment, evaluation of centrifugal uranium enrichment technology, the target of domestic uranium enrichment, the policy of domestic uranium enrichment promotion. (J.P.N.)
Energy Technology Data Exchange (ETDEWEB)
Heidrich, R. [Muellverwertungsanlage Bonn GmbH, Bonn (Germany)
2007-07-01
MVA Bonn GmbH (Bonn, Federal Republic of Germany) operates a plant for the thermal utilization of settlement wastes. The author of the contribution under consideration reports on measures and attempts according to the reduction of mercury in the waste processing plant Bonn. In particular, three procedures are discussed: (a) The gold amalgam procedure; (b) attempt of precipitation in the scrubber with TMT-15; (c) enrichment of the adsorbent Dioxorb with activated charcoal. The gold amalgam procedure is a reliable procedure for the reduction of the mercury content in exhaust gases. Additionally, it is a very expensive procedure. The filling material containers of all three procedures should be replaced in the next revisions gradually with new containers. The danger of an enrichment of considerable quantities of mercury on the filling material packing is large. A further possibility is the filling of the finished solution over a mist eliminator. Here the danger of the blockage plays a substantial role. A thorough and reliable lowering of the mercury emission can be achieved by means of the active charcoal containing Dioxorb.
International Nuclear Information System (INIS)
Anon.
2012-01-01
The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)
Schauss, Thorsten; Glaeser, Stefanie P.; Gütschow, Alexandra; Dott, Wolfgang; Kämpfer, Peter
2015-01-01
The presence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli was investigated in input (manure from livestock husbandry) and output samples of six German biogas plants in 2012 (one sampling per biogas plant) and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU) per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%), few SHV-type beta lactamase (6%). Sixty-four bla CTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85%) and 9 (13%), and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71%) and B1 (27%), only one to group D (2%). Genomic fingerprinting and multilocus sequence typing (MLST) showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT) genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E. coli in
Directory of Open Access Journals (Sweden)
Thorsten Schauss
Full Text Available The presence of extended-spectrum beta-lactamase (ESBL-producing Escherichia coli was investigated in input (manure from livestock husbandry and output samples of six German biogas plants in 2012 (one sampling per biogas plant and two German biogas plants investigated in an annual cycle four times in 2013/2014. ESBL-producing Escherichia coli were cultured by direct plating on CHROMagar ESBL from input samples in the range of 100 to 104 colony forming units (CFU per g dry weight but not from output sample. This initially indicated a complete elimination of ESBL-producing E. coli by the biogas plant process. Detected non target bacteria were assigned to the genera Acinetobacter, Pseudomonas, Bordetella, Achromobacter, Castellaniella, and Ochrobactrum. A selective pre-enrichment procedure increased the detection efficiency of ESBL-producing E. coli in input samples and enabled the detection in five of eight analyzed output samples. In total 119 ESBL-producing E. coli were isolated from input and 46 from output samples. Most of the E. coli isolates carried CTX-M-type and/or TEM-type beta lactamases (94%, few SHV-type beta lactamase (6%. Sixty-four blaCTX-M genes were characterized more detailed and assigned mainly to CTX-M-groups 1 (85% and 9 (13%, and one to group 2. Phylogenetic grouping of 80 E. coli isolates showed that most were assigned to group A (71% and B1 (27%, only one to group D (2%. Genomic fingerprinting and multilocus sequence typing (MLST showed a high clonal diversity with 41 BOX-types and 19 ST-types. The two most common ST-types were ST410 and ST1210. Antimicrobial susceptibility testing of 46 selected ESBL-producing E. coli revealed that several isolates were additionally resistant to other veterinary relevant antibiotics and some grew on CHROMagar STEC but shiga-like toxine (SLT genes were not detected. Resistance to carbapenems was not detected. In summary the study showed for the first time the presence of ESBL-producing E
Derived enriched uranium market
International Nuclear Information System (INIS)
Rutkowski, E.
1996-01-01
The potential impact on the uranium market of highly enriched uranium from nuclear weapons dismantling in the Russian Federation and the USA is analyzed. Uranium supply, conversion, and enrichment factors are outlined for each country; inventories are also listed. The enrichment component and conversion components are expected to cause little disruption to uranium markets. The uranium component of Russian derived enriched uranium hexafluoride is unresolved; US legislation places constraints on its introduction into the US market
International Nuclear Information System (INIS)
Thomas, D.C.; Gagne, R.W.
1978-01-01
The following topics are covered: the status of the Government's existing uranium enrichment services contracts, natural uranium requirements based on the latest contract information, uncertainty in predicting natural uranium requirements based on uranium enrichment contracts, and domestic and foreign demand assumed in enrichment planning
Uranium Enrichment, an overview
International Nuclear Information System (INIS)
Coates, J.H.
1994-01-01
This general presentation on uranium enrichment will be followed by lectures on more specific topics including descriptions of enrichment processes and assessments of the prevailing commercial and industrial situations. I shall therefore avoid as much as possible duplications with these other lectures, and rather dwell on: some theoretical aspects of enrichment in general, underlying the differences between statistical and selective processes, a review and comparison between enrichment processes, remarks of general order regarding applications, the proliferation potential of enrichment. It is noteworthy that enrichment: may occur twice in the LWR fuel cycle: first by enriching natural uranium, second by reenriching uranium recovered from reprocessing, must meet LWR requirements, and in particular higher assays required by high burn up fuel elements, bears on the structure of the entire front part of the fuel cycle, namely in the conversion/reconversion steps only involving UF 6 for the moment. (author). tabs., figs., 4 refs
DEFF Research Database (Denmark)
Mahmmod, Yasser; Klaas, Ilka Christine; Nielsen, Søren Saxmose
2013-01-01
the farmers' routine premilking preparations, 624 cows of the 1,199 cows were randomly selected for bacterial culture preceded by presampling procedures. These procedures were: cleaning of udder teats, removing the first streams of milk, and 70% alcohol teat disinfection. Data on parity, somatic cell counts...
Smart, Philip D.; Quinn, Jonathan A.; Jones, Christopher B.
The combination of mobile communication technology with location and orientation aware digital cameras has introduced increasing interest in the exploitation of 3D city models for applications such as augmented reality and automated image captioning. The effectiveness of such applications is, at present, severely limited by the often poor quality of semantic annotation of the 3D models. In this paper, we show how freely available sources of georeferenced Web 2.0 information can be used for automated enrichment of 3D city models. Point referenced names of prominent buildings and landmarks mined from Wikipedia articles and from the OpenStreetMaps digital map and Geonames gazetteer have been matched to the 2D ground plan geometry of a 3D city model. In order to address the ambiguities that arise in the associations between these sources and the city model, we present procedures to merge potentially related buildings and implement fuzzy matching between reference points and building polygons. An experimental evaluation demonstrates the effectiveness of the presented methods.
Detection of Mycobacterium Tuberculosis by using PCR
International Nuclear Information System (INIS)
Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.
1996-01-01
Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g
Advanced enrichment techniques
International Nuclear Information System (INIS)
Johnson, A.
1988-01-01
BNFL is in a unique position in that it has commercial experience of diffusion enrichment, and of centrifuge enrichment through its associate company Urenco. In addition BNFL is developing laser enrichment techniques as part of a UK development programme in this area. The paper describes the development programme which led to the introduction of competitive centrifuge enrichment technology by Urenco and discusses the areas where improvements have and will continue to be made in the centrifuge process. It also describes the laser development programme currently being undertaken in the UK. The paper concludes by discussing the relative merits of the various methods of uranium enrichment, with particular reference to the enrichment market likely to obtain over the rest of the century
Advanced enrichment techniques
International Nuclear Information System (INIS)
Johnson, A.
1987-01-01
BNFL is in a unique position in that it has commercial experience of diffusion enrichment, and of centrifuge enrichment through its associate company Urenco. In addition BNFL is developing laser enrichment techniques as part of a UK development programme in this area. The paper describes the development programme which led to the introduction of competitive centrifuge enrichment technology by Urenco and discusses the areas where improvements have and will continue to be made in the centrifuge process. It also describes the laser development programme currently being undertaken in the UK. The paper concludes by discussing the relative merits of the various methods of uranium enrichment, with particular reference to the enrichment market likely to obtain over the rest of the century. (author)
Uranium enrichment: an overview
International Nuclear Information System (INIS)
Cazalet, J.
1995-01-01
This paper is a general presentation of uranium enrichment processes and assessments of the prevailing commercial and industrial situations. It gives first some theoretical aspects of enrichment in general and explains the differences between statistical and selective processes in particular. Then a review of the different processes is made with a comparison between them. Finally, some general remarks concerning applications are given and the risks of proliferation related to enrichment are mentioned. (J.S.). 4 refs., 5 figs., 8 tabs
The enrichment secondary market
International Nuclear Information System (INIS)
Einbund, D.R.
1986-01-01
This paper will addresses two topics: the background to the present status of the enrichment secondary market and the future outlook of the secondary market in enrichment services, and the viability of the nuclear fuel brokerage industry. These two topics are inevitably connected, as most secondary market activity, not only in enrichment but also in natural uranium, has traditionally been conducted with the participation of brokers. Therefore, the author interrelates these topics
International Nuclear Information System (INIS)
Gagne, R.W.; Thomas, D.C.
1977-01-01
The status of existing uranium enrichment contracts in the US is reviewed and expected natural uranium requirements for existing domestic uranium enrichment contracts are evaluated. Uncertainty in natural uranium requirements associated with requirements-type and fixed-commitment type contracts is discussed along with implementation of variable tails assay
Energy Technology Data Exchange (ETDEWEB)
Roser, R. [NRG Technologies, Inc., Reno, NV (United States)
1998-08-01
NRG Technologies, Inc. is attempting to develop hardware and infrastructure that will allow mixtures of hydrogen and conventional fuels to become viable alternatives to conventional fuels alone. This commercialization can be successful if the authors are able to achieve exhaust emission levels of less than 0.03 g/kw-hr NOx and CO; and 0.15 g/kw-hr NMHC at full engine power without the use of exhaust catalysts. The major barriers to achieving these goals are that the lean burn regimes required to meet exhaust emissions goals reduce engine output substantially and tend to exhibit higher-than-normal total hydrocarbon emissions. Also, hydrogen addition to conventional fuels increases fuel cost, and reduces both vehicle range and engine output power. Maintaining low emissions during transient driving cycles has not been demonstrated. A three year test plan has been developed to perform the investigations into the issues described above. During this initial year of funding research has progressed in the following areas: (a) a cost effective single-cylinder research platform was constructed; (b) exhaust gas speciation was performed to characterize the nature of hydrocarbon emissions from hydrogen-enriched natural gas fuels; (c) three H{sub 2}/CH{sub 4} fuel compositions were analyzed using spark timing and equivalence ratio sweeping procedures and finally; (d) a full size pick-up truck platform was converted to run on HCNG fuels. The testing performed in year one of the three year plan represents a baseline from which to assess options for overcoming the stated barriers to success.
Transgene detection by digital droplet PCR.
Directory of Open Access Journals (Sweden)
Dirk A Moser
Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.
International Nuclear Information System (INIS)
Gietzen, A.
1993-01-01
Sixty TRIGA reactors have been sold and the earliest of these are now passing twenty years of operation. All of these reactors use the uranium zirconium hydride fuel (UZrH) which provides certain unique advantages arising out of its large prompt negative temperature coefficient, very low fission product release, and high temperature capability. Eleven of these Sixty reactors are conversions from plate fuel to TRIGA fuel which were made as a result of these advantages. With only a few exceptions, TRIGA reactors have always used low-enriched uranium (LEU) fuel with an enrichment of 19.9%. The exceptions have either been converted from the standard low-enriched fuel to the 70% enriched FLIP fuel in order to achieve extended lifetime, or are higher powered reactors which were designed for long life using 93%-enriched uranium during the time when the use and export of highly enriched uranium (HEU) was not restricted. The advent of international policies focusing attention on nonproliferation and safeguards made the HEU fuels obsolete. General Atomic immediately undertook a development effort (nearly two years ago) in order to be in a position to comply with these policies for all future export sales and also to provide a low-enriched alternative to fully enriched plate-type fuels. This important work was subsequently partially supported by the U.S. Department of Energy. The laboratory and production tests have shown that higher uranium densities can be achieved to compensate for reducing the enrichment to 20%, and that the fuels maintain the characteristics of the very thoroughly proven standard TRIGA fuels. In May of 1978, General Atomic announced that these fuels were available for TRIGA reactors and for plate-type reactors with power levels up to 15 MW with General Atomic's standard commercial warranty
International Nuclear Information System (INIS)
Gietzen, A.
1993-01-01
Sixty TRIGA reactors have been sold and the earliest of these are now passing twenty years of operation. All of these reactors use the uranium-zirconium hydride fuel (UZrH) which provides certain unique advantages arising out of its large prompt negative temperature coefficient, very low fission product release, and high temperature capability. Eleven of these Sixty reactors are conversions from plate fuel to TRIGA fuel which were made as a result of these advantages. With only a few exceptions, TRIGA reactors have always used low-enriched-uranium (LEU) fuel with an enrichment of 19.9%. The exceptions have either been converted from the standard low-enriched fuel to the 70% enriched FLIP fuel in order to achieve extended lifetime, or are higher powered reactors which were designed for long life using 93%-enriched uranium during the time when the use and export of highly enriched uranium (HEU) was not restricted. The advent of international policies focusing attention on nonproliferation and safeguards made the HEU fuels obsolete. General Atomic immediately undertook a development effort (nearly two years ago) in order to be in a position to comply with these policies for all future export sales and also to provide a low-enriched alternative to fully enriched plate-type fuels. This important work was subsequently partially supported by the U.S. Department of Energy. The laboratory and production tests have shown that higher uranium densities can be achieved to compensate for reducing the enrichment to 20%, and that the fuels maintain the characteristics of the very thoroughly proven standard TRIGA fuels. In May of 1978, General Atomic announced that these fuels were available for TRIGA reactors and for plate-type reactors with power levels up to 15 MW with GA's standard commercial warranty
Data analysis for neutron monitoring in an enrichment facility
International Nuclear Information System (INIS)
Markin, J.T.; Stewart, J.E.; Goldman, A.S.
1982-01-01
Area monitoring of neutron radiation to detect high-enriched uranium production is a potential strategy for inspector verification of operations in the cascade area of a centrifuge enrichment facility. This paper discusses the application of statistical filtering and hypothesis testing procedures to experimental data taken in an enrichment facility. The results demonstrate that these data analysis methods can enhance detection of facility misoperation by neutron monitoring
Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario
2017-05-04
Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A survey of tools for the analysis of quantitative PCR (qPCR) data.
Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas
2014-09-01
Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.
DEFF Research Database (Denmark)
Morling, Niels
2009-01-01
Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...... and more advanced, special investigations in cases concerning crime, paternity, relationship, disaster victim identification etc. The present review gives an update on the use of DNA investigations in forensic genetics.......Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...
Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi
Directory of Open Access Journals (Sweden)
Danielle C. Leal
2011-07-01
Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.
The competitive enrichment market
International Nuclear Information System (INIS)
Parks, J.W.; Huffman, F.C.
1984-01-01
With the enactment of the ''Private Ownership of Special Nuclear Materials Act'' in 1964, the U.S. Government made provisions to enter into the uranium enrichment services business. Since nuclear power was in its infancy and the Government was promoting its growth as well as trying to help U.S. industry sell reactors overseas, the initial contracts (Requirements Contracts) for enrichment services placed most of the risks associated with the supplying of the services on the Government. Projections of nuclear power additions continued to grow and in 1972 the Atomic Energy Commission (AEC) stopped contracting under Requirements Contracts in order to study which mode of contracting best suited the commercial development of the industry. In mid-1973, the AEC introduced the Long-Term Fixed Commitment (LTFC) contract which shifted the risk to the customer. By mid-1974, AEC had contracts which completely used the enrichment capacity of its complex and refused to accept requests for additional contracts. This action further convinced European nations that they should continue to develop their own enrichment capacity and resulted in the EURODIF and URENCO projects. Before this time the U.S. supplied 100% of the world market for enriching services
Enrichment: Dealing with overcapacity
International Nuclear Information System (INIS)
Peterson, C.H.
1989-01-01
Today's surplus of enrichment capacity will continue until at least the end of this century. This will challenge the ingenuity of the separative work unit (SWU) suppliers as they attempt to keep market share and remain profitable in a very competitive marketplace. The utilities will be faced with attractive choices, but making the best choice will require careful analysis and increased attention to market factors. Current demand projections will probably prove too high to the extent that more reactors are canceled or delayed. The DOE has the vast majority of the unused capacity, so it will feel the most immediate impact of this large surplus in productive capacity. The DOE has responded to these market challenges by planning another reorganization of its enriching operations. Without a major agreement among the governments affected by the current surplus in enrichment capacity, the future will see lower prices, more competitive terms, and the gradual substitution of centrifuge or laser enrichment for the gaseous diffusion plants. The competition that is forcing the gaseous diffusion prices down to marginal cost will provide the long-term price basis for the enrichment industry
International Nuclear Information System (INIS)
Abd Nasir Ibrahim; Azali Muhammad; Ab Razak Hamzah; Abd Aziz Mohamed; Mohammad Pauzi Ismail
2004-01-01
The following subjects are discussed - Emergency Procedures: emergency equipment, emergency procedures; emergency procedure involving X-Ray equipment; emergency procedure involving radioactive sources
Laser and gas centrifuge enrichment
Energy Technology Data Exchange (ETDEWEB)
Heinonen, Olli [Senior Fellow, Belfer Center for Science and International Affairs, Harvard Kennedy School, Cambridge, Massachusetts (United States)
2014-05-09
Principles of uranium isotope enrichment using various laser and gas centrifuge techniques are briefly discussed. Examples on production of high enriched uranium are given. Concerns regarding the possibility of using low end technologies to produce weapons grade uranium are explained. Based on current assessments commercial enrichment services are able to cover the global needs of enriched uranium in the foreseeable future.
Oxygen enrichment incineration
International Nuclear Information System (INIS)
Kim, Jeong Guk; Yang, Hee Chul; Park, Geun Il; Kim, Joon Hyung
2000-10-01
Oxygen enriched combustion technology has recently been used in waste incineration. To apply the oxygen enrichment on alpha-bearing waste incineration, which is being developed, a state-of-an-art review has been performed. The use of oxygen or oxygen-enriched air instead of air in incineration would result in increase of combustion efficiency and capacity, and reduction of off-gas product. Especially, the off-gas could be reduced below a quarter, which might reduce off-gas treatment facilities, and also increase an efficiency of off-gas treatment. However, the use of oxygen might also lead to local overheating and high nitrogen oxides (NOx) formation. To overcome these problems, an application of low NOx oxy-fuel burner and recycling of a part of off-gas to combustion chamber have been suggested
Oxygen enrichment incineration
Energy Technology Data Exchange (ETDEWEB)
Kim, Jeong Guk; Yang, Hee Chul; Park, Geun Il; Kim, Joon Hyung
2000-10-01
Oxygen enriched combustion technology has recently been used in waste incineration. To apply the oxygen enrichment on alpha-bearing waste incineration, which is being developed, a state-of-an-art review has been performed. The use of oxygen or oxygen-enriched air instead of air in incineration would result in increase of combustion efficiency and capacity, and reduction of off-gas product. Especially, the off-gas could be reduced below a quarter, which might reduce off-gas treatment facilities, and also increase an efficiency of off-gas treatment. However, the use of oxygen might also lead to local overheating and high nitrogen oxides (NOx) formation. To overcome these problems, an application of low NOx oxy-fuel burner and recycling of a part of off-gas to combustion chamber have been suggested.
International Nuclear Information System (INIS)
Astley, E.R.
1976-01-01
Exxon Nuclear has been active in privately funded research and development of centrifuge enrichment technology since 1972. In October of 1975, Exxon Nuclear submitted a proposal to design, construct, and operate a 3000-MT SWU/yr centrifuge enrichment plant, under the provisions of the proposed Nuclear Fuel Assurance Act of 1975. The U.S. Energy Research and Development Administration (ERDA) accepted the proposal as a basis for negotiation. It was proposed to build a 1000-MT SWU/yr demonstration increment to be operational in 1982; and after successful operation for about one year, expand the facilities into a 3000-MT SWU/yr plant. As part of the overall centrifuge enrichment plant, a dedicated centrifuge manufacturing plant would be constructed; sized to support the full 3000-MT SWU/yr plant. The selection of the centrifuge process by Exxon Nuclear was based on an extremely thorough evaluation of current and projected enrichment technology; results show that the technology is mature and the process will be cost effective. The substantial savings in energy (about 93%) from utilization of the centrifuge option rather than gaseous diffusion is a compelling argument. As part of this program, Exxon Nuclear has a large hardware R and D program, plus a prototype centrifuge manufacturing capability in Malta, New York. To provide a full-scale machine and limited cascade test capability, Exxon Nuclear is constructing a $4,000,000 Centrifuge Test Facility in Richland, Washington. This facility was to initiate operations in the Fall of 1976. Exxon Nuclear is convinced that the centrifuge enrichment process is the rational selection for emergence of a commercial enrichment industry
US enrichment reduction studies
International Nuclear Information System (INIS)
1979-06-01
A major national program, the Reduced Enrichment Research and Test Reactor (RERTR) Program, is currently under way in the U.S., centered at the Argonne National Laboratory (ANL), to reduce the potential of research and test reactor fuels for increasing the proliferation of nuclear explosive devices. The main objective of the program is to provide the technical means by which the uranium enrichment to be used in these reactors can be reduced to less than 20% without significant economic and performance penalties. The criteria, basis and goals of the program are consistent with the results of a number of case studies which have been performed as part of the program
Advanced uranium enrichment processes
International Nuclear Information System (INIS)
Clerc, M.; Plurien, P.
1986-01-01
Three advanced Uranium enrichment processes are dealt with in the report: AVLIS (Atomic Vapour LASER Isotope Separation), MLIS (Molecular LASER Isotope Separation) and PSP (Plasma Separation Process). The description of the physical and technical features of the processes constitutes a major part of the report. If further presents comparisons with existing industrially used enrichment technologies, gives information on actual development programmes and budgets and ends with a chapter on perspectives and conclusions. An extensive bibliography of the relevant open literature is added to the different subjects discussed. The report was drawn up by the nuclear research Centre (CEA) Saclay on behalf of the Commission of the European Communities
Uranium Conversion & Enrichment
Energy Technology Data Exchange (ETDEWEB)
Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-02-06
The isotopes of uranium that are found in nature, and hence in ‘fresh’ Yellowcake’, are not in relative proportions that are suitable for power or weapons applications. The goal of conversion then is to transform the U3O8 yellowcake into UF6. Conversion and enrichment of uranium is usually required to obtain material with enough 235U to be usable as fuel in a reactor or weapon. The cost, size, and complexity of practical conversion and enrichment facilities aid in nonproliferation by design.
2004-01-01
The Prevessin Control Room during LEP's start up in 1989. The Prévessin Control Room (PCR) was recently engulfed in a wave of nostalgia. The PCR, scene of some of the greatest moments in CERN's history, is being dismantled to prepare for a complete overhaul. In February 2006, a new combined control centre for all the accelerators will open its doors on the same site, together with a new building currently under construction (see Bulletin issue 27/2004 of 28 June 2004). This marks the end of an important chapter in CERN's history. The Prévessin Control Room saw its first momentous event 28 years ago when the 400 GeV beam for the SPS was commissioned in the presence of Project Leader John Adams. It was also here that the first proton-antiproton collisions were observed, in 1981. Eight years later, in 1989, operators and directors alike jumped for joy at the announcement of the first electron-positron collisions at the start up of LEP, the biggest accelerator in the world. Today the 80 terminals and PCs have b...
Detection of uranium enrichment activities using environmental monitoring techniques
International Nuclear Information System (INIS)
Belew, W.L.; Carter, J.A.; Smith, D.H.; Walker, R.L.
1993-01-01
Uranium enrichment processes have the capability of producing weapons-grade material in the form of highly enriched uranium. Thus, detection of undeclared uranium enrichment activities is an international safeguards concern. The uranium separation technologies currently in use employ UF 6 gas as a separation medium, and trace quantities of enriched uranium are inevitably released to the environment from these facilities. The isotopic content of uranium in the vegetation, soil, and water near the plant site will be altered by these releases and can provide a signature for detecting the presence of enriched uranium activities. This paper discusses environmental sampling and analytical procedures that have been used for the detection of uranium enrichment facilities and possible safeguards applications of these techniques
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
Rapid screening of β-Globin gene mutations by Real-Time PCR in ...
African Journals Online (AJOL)
Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.
Holland, Nancy A.; Burroughs, Jean
2001-01-01
Successful school-community partnerships in Volusia (Florida) Public Schools are the results of marketing creatively, meeting community members' needs, and bringing the right people together. The 3-year old program now offers students of all ages an expanding list of enrichment classes on many subjects for a nominal fee. (MLH)
International Nuclear Information System (INIS)
Hamdoun, N.A.
2007-01-01
This article includes an introduction about the isotopes of natural uranium, their existence and the difficulty of the separation between them. Then it goes to the details of a number of methods used to enrich uranium: Gaseous Diffusion method, Electromagnetic method, Jet method, Centrifugal method, Chemical method, Laser method and Plasma method.
Requirements for enrichment tools
Boer, A.; Winkels, R.; Trompper, M.
2016-01-01
This report gives a high level overview of requirements for Enrichment tools in the Openlaws.eu project. Openlaws.eu aims to initiate a platform and develop a vision for Big Open Legal Data (BOLD): an open framework for legislation, case law, and legal literature from across Europe.
Tennant, Roy
2004-01-01
After decades of costly and time-consuming effort, nearly all libraries have completed the retrospective conversion of their card catalogs to electronic form. However, bibliographic systems still are really not much more than card catalogs on wheels. Enriched content that Amazon.com takes for granted--such as digitized tables of contents, cover…
Availability of enrichment services
International Nuclear Information System (INIS)
Svenke, E.
1977-01-01
The report summarizes major uncertainties which are likely to influence future demands for uranium isotopic enrichment. Since for the next decade the development of nuclear power will be largely concerned with the increment in demand the timely need for enrichment capacity will be particularly sensitive to assumptions about growth rates. Existing worldwide capacity together with capacities under construction will be sufficient well into the 1980's. However, long decision and construction leadtime, uncertainty as to future demand as well as other factors, specifically high capital need, all of which entail financial risks, create hindrances to a timely development of increment. The adequacy of current technology is well demonstrated in plant operation and new technology is under way. Technology is, however, not freely available on a purely commercial basis. Commercial willingness, which anticipates a limited degree of financial risk, is requesting both long term back-up from the utilities that would parallel their firm decisions on the acquisition of nuclear power units, and a protective government umbrella. This situation depends on the symbiotic relationship that exists between the nuclear power generating organizations, the enrichment undertakings and the governments involved. The report accordingly stresses the need for a more cooperative approach and this, moreover, at the multinational level. There is otherwise a risk that proper resources and financing means will not be allocated to the enrichment sector. Export limitations that request the highest degree of industrial processing of nuclear fuel, i.e. the compulsory enrichment of natural uranium, do not serve the interests of overall industrial efficiency
Promotion of uranium enrichment business
International Nuclear Information System (INIS)
Kurushima, Morihiro
1981-01-01
The Committee on Nuclear Power has studied on the basic nuclear power policy, establishing its five subcommittees, entrusted by the Ministry of Nternational Trade and Industry. The results of examination by the subcommittee on uranium enrichment business are given along with a report in this connection by the Committee. In order to establish the nuclear fuel cycle, the aspect of uranium enrichment is essential. The uranium enrichment by centrifugal process has proceeded steadily in Power Reactor and Nuclear Fuel Development Corporation. The following matters are described: the need for domestic uranium enrichment, the outlook for overseas enrichment services and the schedule for establishing domestic enrichment business, the current state of technology development, the position of the prototype enrichment plant, the course to be taken to establish enrichment business the main organization operating the prototype and commercial plants, the system of supplying centrifuges, the domestic conversion of natural uranium the subsidies for uranium enrichment business. (J.P.N.)
United States uranium enrichment policies
International Nuclear Information System (INIS)
Roberts, R.W.
1977-01-01
ERDA's uranium enrichment program policies governing the manner in which ERDA's enrichment complex is being operated and expanded to meet customer requirements for separative work, research and development activities directed at providing technology alternatives for future enrichment capacity, and establishing the framework for additional domestic uranium enrichment capacity to meet the domestic and foreign nuclear industry's growing demand for enrichment services are considered. The ERDA enrichment complex consists of three gaseous diffusion plants located in Oak Ridge, Tennessee; Paducah, Kentucky; and Portsmouth, Ohio. Today, these plants provide uranium enrichment services for commercial nuclear power generation. These enrichment services are provided under contracts between the Government and the utility customers. ERDA's program involves a major pilot plant cascade, and pursues an advanced isotope separation technique for the late 1980's. That the United States must develop additional domestic uranium enrichment capacity is discussed
International Nuclear Information System (INIS)
Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham
2007-01-01
The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)
International Nuclear Information System (INIS)
Denman, S.E.; McSweeney, C.S.
2005-01-01
Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later
Energy Technology Data Exchange (ETDEWEB)
Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com
2009-07-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.
2009-01-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Hosmer, C.
1981-01-01
The increasing amount of separative work being done in government facilities to produce low-enriched uranium fuel for nuclear utilities again raises the question: should this business-type, industrial function be burned over the private industry. The idea is being looked at by the Reagan administration, but faces problems of national security as well as from the unique nature of the business. This article suggests that a joint government-private venture combining enriching, reprocessing, and waste disposal could be the answer. Further, a separate entity using advanced laser technology to deplete existing uranium tails and lease them for fertile blankets in breeder reactors might earn substantial revenues to help reduce the national debt
South Australia, uranium enrichment
International Nuclear Information System (INIS)
1976-02-01
The Report sets out the salient data relating to the establishment of a uranium processing centre at Redcliff in South Australia. It is conceived as a major development project for the Commonwealth, the South Australian Government and Australian Industry comprising the refining and enrichment of uranium produced from Australian mines. Using the data currently available in respect of markets, demand, technology and possible financial return from overseas sales, the project could be initiated immediately with hexafluoride production, followed rapidly in stages by enrichment production using the centrifuge process. A conceptual development plan is presented, involving a growth pattern that would be closely synchronised with the mining and production of yellowcake. The proposed development is presented in the form of an eight-and-half-year programme. Costs in this Report are based on 1975 values, unless otherwise stated. (Author)
One-stop polymerase chain reaction (PCR): An improved PCR ...
African Journals Online (AJOL)
Yomi
2011-12-21
Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.
Beta activity of enriched uranium
International Nuclear Information System (INIS)
Nambiar, P.P.V.J.; Ramachandran, V.
1975-01-01
Use of enriched uranium as reactor fuel necessitates its handling in various forms. For purposes of planning and organising radiation protection measures in enriched uranium handling facilities, it is necessary to have a basic knowledge of the radiation status of enriched uranium systems. The theoretical variations in beta activity and energy with U 235 enrichment are presented. Depletion is considered separately. Beta activity build up is also studied for two specific enrichments, in respect of which experimental values for specific alpha activity are available. (author)
Energy Technology Data Exchange (ETDEWEB)
Perez, L.; Nuñez, F.; Rubio, M.; Nicoli, M. [Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia (Mexico)
2005-01-15
The objective of the present work was to use the PCR technique for the simultaneous detection of Salmonella spp and Vibrio cholerae O1 in frozen shrimp for export. The DNA segments located in the gene A [284 pairs of bases (pb)] from Salmonella spp. locus ial (217 and 320 pb) from Shigella flexneri and Shigella sonnei and the gene ctxA and ctxB (777 pb) from Vibrio cholerae O1 were amplified. The different primers that amplify these segments were assayed in a PCR reaction for the simultaneous detection of DNA from the microorganisms. It was not possible to amplify the gene of Shigella sonnei and Shigella flexneri under the assay’s conditions, whilst those of Salmonella spp. and Vibrio cholerae O1 were successfully amplified. The amplification conditions for the PCR were: 94° C, 58° C and 72° C during 30 cycles, allowing a reduction from 15 days test time with the official microbiological methods to 28 hours (24 for the pre-enrichment and four for the PCR). Samples of raw-frozen-headless shrimps were taken from production plants located in the State of Sinaloa, Mexico. A random sampling procedure was used, according to the guidelines described by the International Commission of Microbiological Specifications for Foods (ICMSF, 1999). Five packages per lot per production plant were obtained. From each individual package (5 pounds 80 OZ ≈ 2.27 kg) three samples were taken for the bacteriological assays to search for Salmonella spp. and Vibrio cholerae O1, respectively. The samples were also analyzed by PCR. Results showed that none of the samples were positive by PCR to any of the studied bacteria. Salmonella spp. and Vibrio cholerae O1 were not detected in these samples by the official methods. However, the latter were able to identify other Vibrio species and enterobacteria like Proteus and Acromobacter. These results confirmed PCR’s rapidity, sensitivity and specificity. (author)
Sefrioui, David; Mauger, Florence; Leclere, Laurence; Beaussire, Ludivine; Di Fiore, Frédéric; Deleuze, Jean-François; Sarafan-Vasseur, Nasrin; Tost, Jörg
2017-02-01
Circulating cell-free DNA (ccfDNA) bears great promise as biomarker for personalized medicine, but ccfDNA is present only at low levels in the plasma or serum of cancer patients. E-ice-COLD-PCR is a recently developed enrichment method to detect and identify mutations present at low-abundance in clinical samples. However, recent studies have shown the importance to accurately quantify low-abundance mutations as clinically important decisions will depend on certain mutation thresholds. The possibility for an enrichment method to accurately quantify the mutation levels remains a point of concern and might limit its clinical applicability. In the present study, we compared the quantification of KRAS mutations in ccfDNA from metastatic colorectal cancer patients by E-ice-COLD-PCR with two digital PCR approaches. For the quantification of mutations by E-ice-COLD-PCR, cell lines with known mutations diluted into WT genomic DNA were used for calibration. E-ice-COLD-PCR and the two digital PCR approaches showed the same range of the mutation level and were concordant for mutation levels below the clinical relevant threshold. E-ice-COLD-PCR can accurately detect and quantify low-abundant mutations in ccfDNA and has a shorter time to results making it compatible with the requirements of analyses in a clinical setting without the loss of quantitative accuracy. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Blueprint for domestic uranium enrichment
International Nuclear Information System (INIS)
1981-01-01
The AEC advisory committee on domestic production of uranium enrichment has studied for more than a year how to achieve the domestic enrichment of uranium by the construction and operation of a commercial enriching plant using centrifugal separation method, and the report was submitted to the Atomic Energy Commission on August 18, 1980. Japan has depended wholly on overseas services for her uranium enrichment needs, but the development of domestic enrichment has been carried on in parallel. The AEC decided to construct a uranium enrichment pilot plant using centrifuges, and it has been forwarded as a national project. The plant is operated by the Power Reactor and Nuclear Fuel Development Corp. since 1979. The capacity of the plant will be raised to approximately 75 ton SWU a year. The centrifuges already operated have provided the first delivery of fuel of about 1 ton for the ATR ''Fugen''. The demand-supply balance of uranium enrichment service, the significance of the domestic enrichment of uranium, the evaluation of uranium enrichment technology, the target for domestic enrichment plan, the measures to promote domestic uranium enrichment, and the promotion of the construction of a demonstration plant are reported. (Kako, I.)
Uranium enrichment by gas centrifuge
International Nuclear Information System (INIS)
Heriot, I.D.
1988-01-01
After recalling the physical principles and the techniques of centrifuge enrichment the report describes the centrifuge enrichment programmes of the various countries concerned and compares this technology with other enrichment technologies like gaseous diffusion, laser, aerodynamic devices and chemical processes. The centrifuge enrichment process is said to be able to replace with advantage the existing enrichment facilities in the short and medium term. Future prospects of the process are also described, like recycled uranium enrichment and economic improvements; research and development needs to achieve the economic prospects are also indicated. Finally the report takes note of the positive aspect of centrifuge enrichment as far as safeguards and nuclear safety are concerned. 27 figs, 113 refs
Radiometric enrichment of nonradioactive ores
International Nuclear Information System (INIS)
Mokrousov, V.A.; Lileev, V.A.
1979-01-01
Considered are the methods of mineral enrichment based on the use of the radioation of various types. The physical essence of enrichment processes is presented, their classification is given. Described are the ore properties influencing the efficiency of radiometric enrichment, methods of the properties study and estimation of ore enrichment. New possibilities opened by radiometric enrichment in the technology of primary processing of mineral raw materials are elucidated. A considerable attention is paid to the main and auxiliary equipment for radiometric enrichment. The foundations of the safety engineering are presented in a brief form. Presented are also results of investigations and practical works in the field of enrichment of ores of non-ferrous, ferrous and non-metallic minerals with the help of radiometric methods
International Nuclear Information System (INIS)
Gunter, L.; McCants, C.; Rutkowski, E.
1991-01-01
The enrichment market can be divided into two periods: the near-term market (1991 to 1995) and the long-term market (1995 and beyond). The near-term market is characterized by limited unfilled requirements of 4% per year, to be supplied by national stockpiles and excess inventories. This low-cost material will be drawn down by about 1993, causing a subsequent price rise. As the price rises, primary supplier activity is expected to increase. In the near-term, two contracting activities are apparent: spot; and intermediate-term. The current spot market is expected to last until available low cost inventories are drawn down. Recently, in attempts to gain market share, suppliers have offered attractively priced intermediate-term (3 year) contracts for 1996 to 1998. While a small spot market will continue after 1995, it is anticipated that utilities will prefer a mix of medium- and long-term (5 to 10 year) contracts from primary suppliers for most of their enrichment requirements. As national stockpiles and utility inventories are consumed, low-cost supply available to the spot market is expected to diminish. Consequently, with little low-cost supply available, the only apparent source of material will be from primary suppliers, and the resulting competition over market share is expected to be intense. (author)
Blatti, Charles; Sinha, Saurabh
2014-07-01
The Motif Enrichment Tool (MET) provides an online interface that enables users to find major transcriptional regulators of their gene sets of interest. MET searches the appropriate regulatory region around each gene and identifies which transcription factor DNA-binding specificities (motifs) are statistically overrepresented. Motif enrichment analysis is currently available for many metazoan species including human, mouse, fruit fly, planaria and flowering plants. MET also leverages high-throughput experimental data such as ChIP-seq and DNase-seq from ENCODE and ModENCODE to identify the regulatory targets of a transcription factor with greater precision. The results from MET are produced in real time and are linked to a genome browser for easy follow-up analysis. Use of the web tool is free and open to all, and there is no login requirement. ADDRESS: http://veda.cs.uiuc.edu/MET/. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C
2006-12-20
Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the
Same-day PCR testing of Salmonella in meat: from research to routine application at slaughterhouses
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Löfström, Charlotta; Josefsen, Mathilde Hartmann
2011-01-01
Development of a rapid PCR technique is described, which enables slaughterhouses to apply same-day testing for Salmonella in carcasses and fresh meat. The technique is based on a shortened pre-enrichment time and 1-h DNA purification using paramagnetic beads (or an easy-to-use boiling method) fol......) followed by Salmonella detection by real-time PCR. Final protocols have been approved for meat testing (fresh meat and carcass swabs) by the Nordval validation organization for Nordic countries....
Morley, Alexander A.
2014-01-01
Digital PCR for quantification of a target of interest has been independently developed several times, being described in 1990 and 1991 using the term “limiting dilution PCR” and in 1999 using the term “digital PCR”. It came into use in the decade following its first development but its use was cut short by the description of real-time PCR in 1996. However digital PCR has now had a renaissance due to the recent development of new instruments and chemistry which have made it a much simpler and...
Uranium enrichment: an activity for the riches
International Nuclear Information System (INIS)
Mundim, S.G.
1985-01-01
The United States in the first place, the European countries next, have begun to maintain strict control of the technology transfer of the methods of enrichment, helped largely by the International Atomic Energy Agency which creates additional obstacles with is so-called 'safeguards'. So that it can possess a complete energy cycle, Brazil needs to have access to the techniques of enrichment. The methods are many and still extremely costly. Committed to signing a risk contract with Germany in the scope of its nuclear treaty with the intention of implementing here the jetcentrofuge method, Brazil should, nevertheless, make an effort to cause to emerge from its laboratories a new procedure which would permit it to become independent in this sector. (Author) [pt
Modular enrichment measurement system for in-situ enrichment assay
International Nuclear Information System (INIS)
Stewart, J.P.
1976-01-01
A modular enrichment measurement system has been designed and is in operation within General Electric's Nuclear Fuel Fabrication Facility for the in-situ enrichment assay of uranium-bearing materials in process containers. This enrichment assay system, which is based on the ''enrichment meter'' concept, is an integral part of the site's enrichment control program and is used in the in-situ assay of the enrichment of uranium dioxide (UO 2 ) powder in process containers (five gallon pails). The assay system utilizes a commercially available modular counting system and a collimnator designed for compatability with process container transport lines and ease of operator access. The system has been upgraded to include a microprocessor-based controller to perform system operation functions and to provide data acquisition and processing functions. Standards have been fabricated and qualified for the enrichment assay of several types of uranium-bearing materials, including UO 2 powders. The assay system has performed in excess of 20,000 enrichment verification measurements annually and has significantly contributed to the facility's enrichment control program
DNA enrichment approaches to identify unauthorized genetically modified organisms (GMOs).
Arulandhu, Alfred J; van Dijk, Jeroen P; Dobnik, David; Holst-Jensen, Arne; Shi, Jianxin; Zel, Jana; Kok, Esther J
2016-07-01
With the increased global production of different genetically modified (GM) plant varieties, chances increase that unauthorized GM organisms (UGMOs) may enter the food chain. At the same time, the detection of UGMOs is a challenging task because of the limited sequence information that will generally be available. PCR-based methods are available to detect and quantify known UGMOs in specific cases. If this approach is not feasible, DNA enrichment of the unknown adjacent sequences of known GMO elements is one way to detect the presence of UGMOs in a food or feed product. These enrichment approaches are also known as chromosome walking or gene walking (GW). In recent years, enrichment approaches have been coupled with next generation sequencing (NGS) analysis and implemented in, amongst others, the medical and microbiological fields. The present review will provide an overview of these approaches and an evaluation of their applicability in the identification of UGMOs in complex food or feed samples.
International Nuclear Information System (INIS)
Coutinho, C.M.M.; Rodrigues Filho, J.S.R.; Umeda, K.; Echternacht, M.V.
1990-01-01
A isotopic separation pilot plant with five ion exchange columns interconnected in series were designed and built in the IEN. The columns are charged with a strong anionic resin in its alkaline form. The boric acid solution is introduced in the separation columns until it reaches a absorbing zone length which is sufficient to obtain the desired boron-10 isotopic concentration. The boric acid absorbing zone movement is provided by the injection of a diluted hydrochloric acid solution, which replace the boric acid throughout the columns. The absorbing zone equilibrium length is proportional to its total length. The enriched boron-10 and the depleted boron are located in the final boundary and in the initial position of the absorbing zones, respectively. (author)
Directory of Open Access Journals (Sweden)
M.V. Resende
2011-06-01
Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.
Thermal breeder fuel enrichment zoning
International Nuclear Information System (INIS)
Capossela, H.J.; Dwyer, J.R.; Luce, R.G.; McCoy, D.F.; Merriman, F.C.
1992-01-01
A method and apparatus for improving the performance of a thermal breeder reactor having regions of higher than average moderator concentration are disclosed. The fuel modules of the reactor core contain at least two different types of fuel elements, a high enrichment fuel element and a low enrichment fuel element. The two types of fuel elements are arranged in the fuel module with the low enrichment fuel elements located between the high moderator regions and the high enrichment fuel elements. Preferably, shim rods made of a fertile material are provided in selective regions for controlling the reactivity of the reactor by movement of the shim rods into and out of the reactor core. The moderation of neutrons adjacent the high enrichment fuel elements is preferably minimized as by reducing the spacing of the high enrichment fuel elements and/or using a moderator having a reduced moderating effect. 1 figure
Advanced Neutron Source enrichment study
International Nuclear Information System (INIS)
Bari, R.A.; Ludewig, H.; Weeks, J.R.
1996-01-01
A study has been performed of the impact on performance of using low-enriched uranium (20% 235 U) or medium-enriched uranium (35% 235 U) as an alternative fuel for the Advanced Neutron Source, which was initially designed to use uranium enriched to 93% 235 U. Higher fuel densities and larger volume cores were evaluated at the lower enrichments in terms of impact on neutron flux, safety, safeguards, technical feasibility, and cost. The feasibility of fabricating uranium silicide fuel at increasing material density was specifically addressed by a panel of international experts on research reactor fuels. The most viable alternative designs for the reactor at lower enrichments were identified and discussed. Several sensitivity analyses were performed to gain an understanding of the performance of the reactor at parametric values of power, fuel density, core volume, and enrichment that were interpolations between the boundary values imposed on the study or extrapolations from known technology
A standard curve based method for relative real time PCR data processing
Directory of Open Access Journals (Sweden)
Krause Andreas
2005-03-01
Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that
A Multiscale Enrichment Procedure for Nonlinear Monotone Operators
Efendiev, Yalchin R.; Galvis, J.; Presho, M.; Zhou, J.
2014-01-01
. Galvis, R. Lazarov, S. Margenov and J. Ren, Robust two-level domain decomposition preconditioners for high-contrast anisotropic flows in multiscale media. Submitted.; Y. Efendiev, J. Galvis and X. Wu, J. Comput. Phys. 230 (2011) 937–955; J. Galvis and Y
Enrichment plants. A survey of major new uranium enriching projects
International Nuclear Information System (INIS)
Kovan, D.
1976-01-01
The work enrichment situation is reported. The development of enrichment in the U.S. and in Europe is outlined. A brief description is given of the technology of separation by diffusion and by centrifugation and the advantages and disadvantages of the two processes are compared. Finally the supply and demand situation is briefly considered. (U.K.)
Schram, E.; Schelvis-Smit, A.A.M.; Heul, van der J.W.; Luten, J.B.
2010-01-01
We wanted to optimize the procedure for the selenium enrichment of farmed African catfish, using garlic as dietary selenium source. In the first experiment we established the relation between the length of the selenium enrichment period and the resulting total selenium level in the fillet of the
Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil
Directory of Open Access Journals (Sweden)
Vlademir Cantarelli
2011-10-01
Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.
Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.
Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R
2001-10-01
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.
Industrial aspects in uranium enrichment
International Nuclear Information System (INIS)
Mezin, M.
1982-05-01
Characteristics of isotope separation processes in operation and under development are discussed. These include the number of stages in series, the number of components, the component unit capacity and enery requirements. The implementation of an enrichment process and the question of an enrichment plant in Australia are also considered
AEC determines uranium enrichment policy
International Nuclear Information System (INIS)
Anon.
1992-01-01
The Advisory Committee on Uranium Enrichment of the Atomic Energy Commission (AEC) has submitted a report to AEC chairman concerning the promotion of the introduction of advanced material, high performance centrifuges to replace conventional metallic drum centrifuges, and the development of next generation advanced centrifuges. The report also called for the postponement until around 1997 of the decision whether the development should be continued or not on atomic vapor laser isotope separation (AVLIS) and molecular laser isotope separation (MLIS) processes, as well as the virtual freezing of the construction of a chemical process demonstration plant. The report was approved by the AEC chairman in August. The uranium enrichment service market in the world will continue to be characterized by oversupply. The domestic situation of uranium enrichment supply-demand trend, progress of the expansion of Rokkasho enrichment plant, the trend in the development of gas centrifuge process and the basic philosophy of commercializing domestic uranium enrichment are reported. (K.I.)
New generation enrichment monitoring technology for gas centrifuge enrichment plants
International Nuclear Information System (INIS)
Ianakiev, Kiril D.; Alexandrov, Boian S.; Boyer, Brian D.; Hill, Thomas R.; Macarthur, Duncan W.; Marks, Thomas; Moss, Calvin E.; Sheppard, Gregory A.; Swinhoe, Martyn T.
2008-01-01
The continuous enrichment monitor, developed and fielded in the 1990s by the International Atomic Energy Agency, provided a go-no-go capability to distinguish between UF 6 containing low enriched (approximately 4% 235 U) and highly enriched (above 20% 235 U) uranium. This instrument used the 22-keV line from a 109 Cd source as a transmission source to achieve a high sensitivity to the UF 6 gas absorption. The 1.27-yr half-life required that the source be periodically replaced and the instrument recalibrated. The instrument's functionality and accuracy were limited by the fact that measured gas density and gas pressure were treated as confidential facility information. The modern safeguarding of a gas centrifuge enrichment plant producing low-enriched UF 6 product aims toward a more quantitative flow and enrichment monitoring concept that sets new standards for accuracy stability, and confidence. An instrument must be accurate enough to detect the diversion of a significant quantity of material, have virtually zero false alarms, and protect the operator's proprietary process information. We discuss a new concept for advanced gas enrichment assay measurement technology. This design concept eliminates the need for the periodic replacement of a radioactive source as well as the need for maintenance by experts. Some initial experimental results will be presented.
PCR assay for the detection of Campylobacter in marinated and non-marinated poultry products
DEFF Research Database (Denmark)
Katzav, Marianne; Isohanni, Pauliina; Lund, Marianne
2008-01-01
and chicken products, respectively. In August, there was a peak with 28.9% positive Campylobacter samples. Campylobacter inoculation tests were carried out to test the detection limit of both methods. The PCR method used is faster than microbiological analyses. However, enrichment of the samples is necessary...
Long, Rachel M; Lappin-Scott, Hilary M; Stevens, Jamie R
2009-07-01
The degradation of polycyclic aromatic compounds (PACs) has been widely studied. Knowledge of the degradation of PACs by microbial populations can be utilized in the remediation of contaminated sites. To isolate and identify PAC-degrading bacteria for potential use in future bioremediation programmes, we established a series of PAC enrichments under the same experimental conditions from a single sediment sample taken from a highly polluted estuarine site. Enrichment cultures were established using the pollutants: anthracene, phenanthrene and dibenzothiophene as a sole carbon source. The shift in microbial community structure on each of these carbon sources was monitored by analysis of a time series of samples from each culture using 16S rRNA polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). Significantly, our findings demonstrate that shifts in the constituent species within each degradative community are directly attributable to enrichment with different PACs. Subsequently, we characterized the microorganisms comprising the degradative communities within each enrichment using 16S rRNA sequence data. Our findings demonstrate that the ability to degrade PACs is present in five divisions of the Proteobacteria and Actinobacteria. By determining the precise identity of the PAC-degrading bacterial species isolated from a single sediment sample, and by comparing our findings with previously published research, we demonstrate how bacteria with similar PAC degrading capabilities and 16S rRNA signatures are found in similarly polluted environments in geographically very distant locations, e.g., China, Italy, Japan and Hawaii. Such a finding suggests that geographical barriers do not limit the distribution of key PAC-degrading bacteria; this finding is in accordance with the Baas-Becking hypothesis "everything is everywhere; the environment selects" and may have significant consequences for the global distribution of PAC-degrading bacteria and
Targeted resequencing and variant validation using pxlence PCR assays
Directory of Open Access Journals (Sweden)
Frauke Coppieters
2016-01-01
Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.
Methylation-Specific PCR Unraveled
Directory of Open Access Journals (Sweden)
Sarah Derks
2004-01-01
Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.
Stams, Alfons J. M.; Grolle, Katja C. F.; Frijters, Carla T. M.; Van Lier, Jules B.
1992-01-01
Thermophilic propionate-oxidizing, proton-reducing bacteria were enriched from the granular methanogenic sludge of a bench-scale upflow anaerobic sludge bed reactor operated at 55°C with a mixture of volatile fatty acids as feed. Thermophilic hydrogenotrophic methanogens had a high decay rate. Therefore, stable, thermophilic propionate-oxidizing cultures could not be obtained by using the usual enrichment procedures. Stable and reproducible cultivation was possible by enrichment in hydrogen-p...
Uranium Enrichment Determination of the InSTEC Sub Critical Ensemble Fuel by Gamma Spectrometry
International Nuclear Information System (INIS)
Borrell Munnoz, Jose L.; LopezPino, Neivy; Diaz Rizo, Oscar; D'Alessandro Rodriguez, Katia; Padilla Cabal, Fatima; Arbelo Penna, Yunieski; Garcia Rios, Aczel R.; Quintas Munn, Ernesto L.; Casanova Diaz, Amaya O.
2009-01-01
Low background gamma spectrometry was applied to analyze the uranium enrichment of the nuclear fuel used in the InSTEC Sub Critical ensemble. The enrichment was calculated by two variants: an absolute method using the Monte Carlo method to simulated detector volumetric efficiency, and an iterative procedure without using standard sources. The results confirm that the nuclear fuel of the ensemble is natural uranium without any additional degree of enrichment. (author)
High enrichment to low enrichment core's conversion. Technical securities
International Nuclear Information System (INIS)
Abbate, P.; Madariaga, M.R.
1990-01-01
This work presents the fulfillment of the technical securities subscribed by INVAP S.E. for the conversion of a high enriched uranium core. The reactor (of 5 thermal Mw), built in the 50's and 60's, is of the 'swimming pool' type, with light water and fuel elements of the curve plates MTR type, enriched at 93.15 %. These are neutronic and thermohydraulic securities. (Author) [es
Safety of uranium enrichment plant
International Nuclear Information System (INIS)
Yonekawa, Shigeru; Morikami, Yoshio; Morita, Minoru; Takahashi, Tsukasa; Tokuyasu, Takashi.
1991-01-01
With respect to safety evaluation of the gas centrifuge enrichment facility, several characteristic problems are described as follows. Criticality safety in the cascade equipments can be obtained to maintain the enrichment of UF 6 below 5 %. External radiation dose equivalent rate of the 30B cylinder is low enough, the shield is not necessary. Penetration ratio of the two-stage HEPA filters for UF 6 aerosol is estimated at 10 -9 . From the experimental investigation, vacuum tightness is not damaged by destruction of gas centrifuge rotor. Carbon steel can be used for uranium enrichment equipments under the condition below 100degC. (author)
Environmental enrichment for aquatic animals.
Corcoran, Mike
2015-05-01
Aquatic animals are the most popular pets in the United States based on the number of owned pets. They are popular display animals and are increasingly used in research settings. Enrichment of captive animals is an important element of zoo and laboratory medicine. The importance of enrichment for aquatic animals has been slower in implementation. For a long time, there was debate over whether or not fish were able to experience pain or form long-term memories. As that debate has reduced and the consciousness of more aquatic animals is accepted, the need to discuss enrichment for these animals has increased. Copyright © 2015 Elsevier Inc. All rights reserved.
World enrichment requirements to 2005
International Nuclear Information System (INIS)
Anon.
1991-01-01
The primary enrichment suppliers-Eurodif, Techsnabexport, Urenco, and the US DOE - are positioning themselves to take advantage of the post - 1995 market. Overall, unfilled requirements represent about 40 percent of world requirements in the year 2000. The USA will be the primary market, as US utilities' unfilled enrichment requirements account for over 60 percent of the world's total unfilled requirements. The enrichment market is moving toward more global competition, as each supplier tries to maintain its current regional market base and then to capture additional market share in other regions
International Nuclear Information System (INIS)
Cabrera, J. A.; Martin, R.
1976-01-01
We present in this work a review of the conventional quantization procedure, the proposed by I.E. Segal and a new quantization procedure similar to this one for use in non linear problems. We apply this quantization procedures to different potentials and we obtain the appropriate equations of motion. It is shown that for the linear case the three procedures exposed are equivalent but for the non linear cases we obtain different equations of motion and different energy spectra. (Author) 16 refs
African Journals Online (AJOL)
DR. AMINU
Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections. INTRODUCTION ... used to amplify a piece of DNA by in-vitro enzymatic replication (David and .... receiving antimicrobial treatment, or when the causative agents are small ...
Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR
Directory of Open Access Journals (Sweden)
Ta-Hsien Lee
2017-08-01
Conclusion: The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic.
DEFF Research Database (Denmark)
D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.
2004-01-01
the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...
Centar's gas centrifuge enrichment project
International Nuclear Information System (INIS)
Abajian, V.V.; Fishman, A.M.
1976-01-01
Plans for the building and operating of Centar Associates gas centrifuge uranium enrichment plant are described. Operating costs and machine manufacture are considered. Commitments with the utilities are summarised. (U.K.)
Uranium enrichment: an evolving market
International Nuclear Information System (INIS)
Longenecker, J.; Witzel, R.
1997-01-01
With over half of the world uranium enrichment market uncommitted to any supplier early in the next century, competition is certain to be fierce. In the meantime the outlood remains unclear, with the market dominated by a number of developments -privatisation of the United States Enrichment Corp (USEC), increasing availability of Russian and US military inventories, the deployment of advanced technology and the closure of nuclear power plants due to deregulation. (author)
Unjust enrichment in business law
Vydrová, Zuzana
2016-01-01
This thesis analyses the concept of unjust enrichment under the business law. First of all the thesis explains the term of business law. Business law is a complex of legal rules concerning the contractual relationships between entrepreneurs arising from their business activities. Business law is a comprehensive field of law which extends into many other fields of law, both private and public law. Equally the regulation of unjust enrichment within the business law expands into many other laws ...
The design of an automated electrolytic enrichment apparatus for tritium
Energy Technology Data Exchange (ETDEWEB)
Myers, J.L.
1994-12-01
The Radiation Analytical Sciences Section at Laboratory at Lawrence Livermore National Laboratory performs analysis of low-level tritium concentrations in various natural water samples from the Tri-Valley Area, DOE Nevada Test Site, Site 300 in Tracy, CA, and other various places around the world. Low levels of tritium, a radioactive isotope of hydrogen, which is pre-concentrated in the RAS laboratory using an electrolytic enrichment apparatus. Later these enriched waters are analyzed by liquid scintillation counting to determine the activity of tritium. The enrichment procedure and the subsequent purification process by vacuum distillation are currently undertaken manually, hence being highly labor-intensive. The whole process typically takes about 2 to 3 weeks to complete a batch of 30 samples, with a dedicated personnel operating the process. The goal is to automate the entire process, specifically having the operation PC-LabVIEW{trademark} controlled with real-time monitoring capability. My involvement was in the design and fabrication of a prototypical automated electrolytic enrichment cell. Work will be done on optimizing the electrolytic process by assessing the different parameters of the enrichment procedure. Hardware and software development have also been an integral component of this project.
An improved cell recovery method for iron oxidizing bacterial (IOB) enrichments
DEFF Research Database (Denmark)
Yu, Ran; Graf, Joerg; Smets, Barth F.
2008-01-01
Two cell recovery methods for IOB enrichments were evaluated for DNA extraction and further PCR-based 16S rRNA gene clone library creation. One was a published method consisting of heating plus oxalic acid treatment and the other one was a new method based on enzymatic agarose digestion (using β...
Hayat Topcu; Nergiz Coban; Keith Woeste; Mehmet Sutyemez; Salih. Kafkas
2015-01-01
We attempted to develop new polymorphic SSR primer pairs in walnut using sequences derived from Juglans nigra L. genomic enriched library with GA repeat. The designed 94 SSR primer pairs were subjected to gradient PCR in 12 walnut cultivars to determine their optimum annealing temperatures and to determine whether they produce bands. Then, the...
PWR fuel of high enrichment with erbia and enriched gadolinia
International Nuclear Information System (INIS)
Bejmer, Klaes-Håkan; Malm, Christian
2011-01-01
Today standard PWR fuel is licensed for operation up to 65-70 MWd/kgU, which in most cases corresponds to an enrichment of more than 5 w/o "2"3"5U. Due to criticality safety reason of storage and transportation, only fuel up to 5 w/o "2"3"5U enrichment is so far used. New fuel storage installations and transportation casks are necessary investments before the reactivity level of the fresh fuel can be significantly increased. These investments and corresponding licensing work takes time, and in the meantime a solution that requires burnable poisons in all pellets of the fresh high-enriched fuel might be used. By using very small amounts of burnable absorber in every pellet the initial reactivity can be reduced to today's levels. This study presents core calculations with fuel assemblies enriched to almost 6 w/o "2"3"5U mixed with a small amount of erbia. Some of the assemblies also contain gadolinia. The results are compared to a reference case containing assemblies with 4.95 w/o "2"3"5U without erbia, utilizing only gadolinia as burnable poison. The comparison shows that the number of fresh fuel assemblies can be reduced by 21% (which increases the batch burnup by 24%) by utilizing the erbia fuel concept. However, increased cost of uranium due to higher enrichment is not fully compensated for by the cost gain due to the reduction of the number assemblies. Hence, the fuel cycle cost becomes slightly higher for the high enrichment erbia case than for the reference case. (author)
Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.
Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin
2017-08-01
Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.
Comparing Multi-Step IMAC and Multi-Step TiO2 Methods for Phosphopeptide Enrichment
Yue, Xiaoshan; Schunter, Alissa; Hummon, Amanda B.
2016-01-01
Phosphopeptide enrichment from complicated peptide mixtures is an essential step for mass spectrometry-based phosphoproteomic studies to reduce sample complexity and ionization suppression effects. Typical methods for enriching phosphopeptides include immobilized metal affinity chromatography (IMAC) or titanium dioxide (TiO2) beads, which have selective affinity and can interact with phosphopeptides. In this study, the IMAC enrichment method was compared with the TiO2 enrichment method, using a multi-step enrichment strategy from whole cell lysate, to evaluate their abilities to enrich for different types of phosphopeptides. The peptide-to-beads ratios were optimized for both IMAC and TiO2 beads. Both IMAC and TiO2 enrichments were performed for three rounds to enable the maximum extraction of phosphopeptides from the whole cell lysates. The phosphopeptides that are unique to IMAC enrichment, unique to TiO2 enrichment, and identified with both IMAC and TiO2 enrichment were analyzed for their characteristics. Both IMAC and TiO2 enriched similar amounts of phosphopeptides with comparable enrichment efficiency. However, phosphopeptides that are unique to IMAC enrichment showed a higher percentage of multi-phosphopeptides, as well as a higher percentage of longer, basic, and hydrophilic phosphopeptides. Also, the IMAC and TiO2 procedures clearly enriched phosphopeptides with different motifs. Finally, further enriching with two rounds of TiO2 from the supernatant after IMAC enrichment, or further enriching with two rounds of IMAC from the supernatant TiO2 enrichment does not fully recover the phosphopeptides that are not identified with the corresponding multi-step enrichment. PMID:26237447
High enrichment to low enrichment core's conversion. Accidents analysis
International Nuclear Information System (INIS)
Abbate, P.; Rubio, R.; Doval, A.; Lovotti, O.
1990-01-01
This work analyzes the different accidents that may occur in the reactor's facility after the 20% high-enriched uranium core's conversion. The reactor (of 5 thermal Mw), built in the 50's and 60's, is of the 'swimming pool' type, with light water and fuel elements of the curve plates MTR type, enriched at 93.15 %. This analysis includes: a) accidents by reactivity insertion; b) accidents by coolant loss; c) analysis by flow loss and d) fission products release. (Author) [es
Directory of Open Access Journals (Sweden)
Ronaldo Pereira Santos
2007-06-01
Full Text Available O Pau-rosa (Aniba rosaeodora Ducke é uma espécie importante economicamente para a Região Amazônica, porque sua madeira é fonte de linalol, insumo utilizado pelas perfumarias. Esta espécie foi explorada durante décadas e, ainda assim, o conhecimento acerca da diversidade genética intra-específica é muito restrito. Foram objetivos deste trabalho: 1 validar um protocolo para coleta de folhas de pau-rosa que permitisse preservar a integridade do DNA até a estocagem em "freezer"; 2 selecionar um protocolo para extração de DNA em quantidade e qualidade adequadas para geração de bandas RAPD e 3 desenvolver um critério para avaliar o grau de reprodutibilidade que pudesse auxiliar a seleção de bandas RAPD úteis para análises de diversidade genética. Imediatamente após a coleta, as folhas foram acondicionadas em tubos de polietileno com sílica gel e aí permaneceram por até 10 dias. Foram testados três protocolos para a extração de ácidos nucléicos destas folhas, condições ideais para as PCR e a reprodutibilidade dos padrões RAPD. Critérios para a eliminação das bandas que mais contribuíram para o afastamento dos resultados do ideal da reprodutibilidade total foram desenvolvidos e a significância estatística das diferenças geradas pela aplicação dos critérios ao conjunto de dados foi testada. DNA com qualidade e em quantidade suficiente para a geração de padrões RAPD, nas condições ideais definidas para as PCRs, foi obtido. A eliminação de bandas com reprodutibilidade menor que 70% não diferiu do controle. A eliminação de bandas com reprodutibilidade menor que 90% diferiu dos demais tratamentos em todos os arranjos testados (P Rosewood (Aniba rosaeodora Ducke is one of the economically valuable species in the Amazon region, because it is the principal source of linalool which is demanded by the perfumery industry. This species was submitted to hard exploitation along the past decades and besides this
Gaseous diffusion -- the enrichment workhorse
International Nuclear Information System (INIS)
Shoemaker, J.E. Jr.
1984-01-01
Construction of the first large-scale gaseous diffusion facility was started as part of the Manhattan Project in Oak Ridge, Tennessee, in 1943. This facility, code named ''K-25,'' began operation in January 1945 and was fully on stream by September 1945. Four additional process buildings were later added in Oak Ridge as the demand for enriched uranium escalated. New gaseous diffusion plants were constructed at Paducah, Kentucky, and Portsmouth, Ohio, during this period. The three gaseous diffusion plants were the ''workhorses'' which provided the entire enriched uranium demand for the United States during the 1950s and 1960s. As the demand for enriched uranium for military purposes decreased during the early 1960s, power to the diffusion plants was curtailed to reduce production. During the 1960s, as plans for the nuclear power industry were formulated, the role of the diffusion plants gradually changed from providing highly-enriched uranium for the military to providing low-enriched uranium for power reactors
Uranium enrichment. Technology, economics, capacity
International Nuclear Information System (INIS)
Voigt, W.R. Jr.; Saire, D.E.; Gestson, D.K.; Peske, S.E.; Vanstrum, P.R.
1983-01-01
Large-scale enrichment of uranium has now been carried out for 40 years. While the gaseous diffusion process was the original choice of several countries and continues today to provide the major component of the world production of separative work, the last two decades have witnessed the development of a number of alternative processes for enrichment. These processes, which are being studied and deployed around the world, offer a wide range of technical and economic characteristics which will be useful in assuring adequate capacity to meet projected reactor fuel market needs through the rest of this century at competitive prices. With present uncertainties in future enriched uranium needs, it is apparent that flexibility in the deployment and operation of any enrichment process will be one of the prime considerations for the future. More economical production of separative work not only can have a beneficial impact on reactor fuel costs, but also tends to conserve natural uranium resources. This paper reviews the world scene in the enrichment component of the fuel cycle, including existing or planned commercial-scale facilities and announced R+D efforts on various processes. (author)
Uranium enrichment: technology, economics, capacity
Energy Technology Data Exchange (ETDEWEB)
Voigt, Jr., W. R.; Vanstrum, P. R.; Saire, D. E.; Gestson, D. K.; Peske, S. E.
1982-08-01
Large-scale enrichment of uranium has now been carried out for 40 years. While the gaseous diffusion process was the original choice of several countries and continues today to provide the major component of the world production of separative work, the last two decades have witnessed the development of a number of alternative processes for enrichment. These processes, which are being studied and deployed around the world, offer a wide range of technical and economic characteristics which will be useful in assuring adequate capacity to meet projected reactor fuel market needs through the rest of this century at competitive prices. With present uncertainties in future enriched uranium needs, it is apparent that flexibility in the deployment and operation of any enrichment process will be one of the prime considerations for the future. More economical production of separative work not only can have a beneficial impact on reactor fuel costs, but also tends to conserve natural uranium resources. This paper reviews the world scene in the enrichment component of the fuel cycle, including existing or planned commercial-scale facilities and announced R and D efforts on various processes.
Uranium enrichment: technology, economics, capacity
International Nuclear Information System (INIS)
Voigt, W.R. Jr.; Vanstrum, P.R.; Saire, D.E.; Gestson, D.K.; Peske, S.E.
1982-01-01
Large-scale enrichment of uranium has now been carried out for 40 years. While the gaseous diffusion process was the original choice of several countries and continues today to provide the major component of the world production of separative work, the last two decades have witnessed the development of a number of alternative processes for enrichment. These processes, which are being studied and deployed around the world, offer a wide range of technical and economic characteristics which will be useful in assuring adequate capacity to meet projected reactor fuel market needs through the rest of this century at competitive prices. With present uncertainties in future enriched uranium needs, it is apparent that flexibility in the deployment and operation of any enrichment process will be one of the prime considerations for the future. More economical production of separative work not only can have a beneficial impact on reactor fuel costs, but also tends to conserve natural uranium resources. This paper reviews the world scene in the enrichment component of the fuel cycle, including existing or planned commercial-scale facilities and announced R and D efforts on various processes
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
DEFF Research Database (Denmark)
Koch, T.; Jacobsen, N.; Fensholdt, J.
2000-01-01
Ligand immobilization on solid surfaces is an essential step in fields such as diagnostics, bio sensor manufacturing, and new material sciences in general. In this paper a photochemical approach based on anthraquinone as the chromophore is presented. Photochemical procedures offer special...... advantages as they are able to generate highly reactive species in an orientation specific manner. As presented here, anthraquinone (AQ) mediated covalent DNA immobilization appears to be superior to currently known procedures. A synthetic procedure providing AQ-phosphoramidites is presented. These reagents...... facilitate AQ conjugation during routine DNA synthesis, thus enabling the AQ-oligonucleotides to be immobilized in a very convenient and efficient manner. AQ-conjugated PCR primers can be used directly in PCR. When the PCR is performed in solution, the amplicons can be immobilized after the PCR. Moreover...
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
A Systematic Approach to Marital Enrichment.
Dinkmeyer, Don; Carlson, Jon
1986-01-01
Presents a systematic approach to enriching marital relationships. The history and current status of marital enrichment is reviewed. An Adlerian approach to marital enrichment is described. Applications of the program in enrichment groups, marriage therapy and couple groups are included. (Author)
Enrichment of light hydrocarbon mixture
Yang,; Dali, [Los Alamos, NM; Devlin, David [Santa Fe, NM; Barbero, Robert S [Santa Cruz, NM; Carrera, Martin E [Naperville, IL; Colling, Craig W [Warrenville, IL
2010-08-10
Light hydrocarbon enrichment is accomplished using a vertically oriented distillation column having a plurality of vertically oriented, nonselective micro/mesoporous hollow fibers. Vapor having, for example, both propylene and propane is sent upward through the distillation column in between the hollow fibers. Vapor exits neat the top of the column and is condensed to form a liquid phase that is directed back downward through the lumen of the hollow fibers. As vapor continues to ascend and liquid continues to countercurrently descend, the liquid at the bottom of the column becomes enriched in a higher boiling point, light hydrocarbon (propane, for example) and the vapor at the top becomes enriched in a lower boiling point light hydrocarbon (propylene, for example). The hollow fiber becomes wetted with liquid during the process.
PC based uranium enrichment analyser
International Nuclear Information System (INIS)
Madan, V.K.; Gopalakrishana, K.R.; Bairi, B.R.
1991-01-01
It is important to measure enrichment of unirradiated nuclear fuel elements during production as a quality control measure. An IBM PC based system has recently been tested for enrichment measurements for Nuclear Fuel Complex (NFC), Hyderabad. As required by NFC, the system has ease of calibration. It is easy to switch the system from measuring enrichment of fuel elements to pellets and also automatically store the data and the results. The system uses an IBM PC plug in card to acquire data. The card incorporates programmable interval timers (8253-5). The counter/timer devices are executed by I/O mapped I/O's. A novel algorithm has been incorporated to make the system more reliable. The application software has been written in BASIC. (author). 9 refs., 1 fig
Two-temperature PCR for Microfluidics
Kodzius, Rimantas
2010-05-01
Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon
Two-temperature PCR for Microfluidics
Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian
2010-01-01
Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon
Enriching Students’ Vocabulary Mastery Using Graphic Organizers
Directory of Open Access Journals (Sweden)
Syaifudin Latif Darmawan
2017-04-01
Full Text Available This action research is carried out to (1 identify whether graphic organizers enrich student’s vocabulary mastery; and (2 to describe the classroom situation when graphic organizers are employed in instructional process of vocabulary. The research is conducted in two cycles from March to May 2016/2017 in the eight years of SMP Muhammadiyah Sekampung, East lampung. The procedure of the research consists of identifying the problem, planning the action, implementing the action, observing the action, and reflecting the result of the research. Qualitative data are collected through interview, observation, questionnaire, and research diary. Quantitative data are collected through test. To analyze qualitative data, the researcher used constant comparative method. It consists of four steps: (1 comparing incidents applicable to each category; (2 Integrating categories and their properties; (3 delimiting the theory; (4 Writing the theory. Meanwhile, to analyze quantitative data, the researcher employed descriptive statistic. The result of the research shows that using graphic organizers can enrich students’ vocabulary mastery and classroom situation. The improvement on students’ vocabulary included; a the students are able to speak English; b the students are able to understand the meaning of the text as they have a lot of vocabularies. The improvement of the classroom situation; (a students come on time in the class (b students are more motivated to join the class (c Students pay more attention in the instructional process (d students’ participation in responding the questions are high.
Advances in uranium enrichment processes
International Nuclear Information System (INIS)
Rae, H.K.; Melvin, J.G.; Slater, J.B.
1986-05-01
Advances in gas centrifuges and development of the atomic vapour laser isotope separation process promise substantial reductions in the cost of enriched uranium. The resulting reduction in LWR fuel costs could seriously erode the economic advantage of CANDU, and in combination with LWR design improvements, shortened construction times and increased operational reliability could allow the LWR to overtake CANDU. CANDU's traditional advantages of neutron economy and high reliability may no longer be sufficient - this is the challenge. The responses include: combining neutron economy and dollar economy by optimizing CANDU for slightly enriched uranium fuel; developing cost-reducing improvements in design, manufacture and construction; and reducing the cost of heavy water. Technology is a renewable resource which must be continually applied to a product for it to remain competitive in the decades to come. Such innovation is a prerequisite to Canada increasing her share of the international market for nuclear power stations. The higher burn-up achievable with enriched fuel in CANDU can reduce the fuel cycle costs by 20 to 40 percent for a likely range of costs for yellowcake and separative work. Alternatively, some of the benefits of a higher fissile content can take the form of a cheaper reactor core containing fewer fuel channels and less heavy water, and needing only a single fuelling machine. An opportunity that is linked to this need to introduce an enriched uranium fuel cycle into CANDU is to build an enrichment business in Canada. This could offer greater value added to our uranium exports, security of supply for enriched CANDUs, technological growth in Canada and new employment opportunities. AECL has a study in progress to define this opportunity
Production of Mo-99 using low-enriched uranium silicide
International Nuclear Information System (INIS)
Hutter, J.C.; Srinivasan, B.; Vicek, M.; Vandegrift, G.F.
1994-01-01
Over the last several years, uranium silicide fuels have been under development as low-enriched uranium (LEU) targets for Mo-99. The use of LEU silicide is aimed at replacing the UAl x alloy in the highly-enriched uranium dissolution process. A process to recover Mo-99 from low-enriched uranium silicide is being developed at Argonne National Laboratory. The uranium silicide is dissolved in alkaline hydrogen peroxide. Experiments performed to determine the optimum dissolution procedure are discussed, and the results of dissolving a portion of a high-burnup (>40%) U 3 Si 2 miniplate are presented. Future work related to Mo-99 separation and waste disposal are also discussed
Pathogen Causing Disease of Diagnosis PCR Tecnology
SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel
2013-01-01
Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...
Uranium enriched granites in Sweden
International Nuclear Information System (INIS)
Wilson, M.R.; Aakerblom, G.
1980-01-01
Granites with uranium contents higher than normal occur in a variety of geological settings in the Swedish Precambrian, and represent a variety of granite types and ages. They may have been generated by (1) the anatexis of continental crust (2) processes occurring at a much greater depth. They commonly show enrichement in F, Sn, W and/or Mo. Only in one case is an important uranium mineralization thought to be directly related to a uranium-enriched granite, while the majority of epigenetic uranium mineralizations with economic potential are related to hydrothermal processes in areas where the bedrock is regionally uranium-enhanced. (Authors)
Uranium enrichment. 1980 annual report
International Nuclear Information System (INIS)
1981-05-01
This report contains data and related information on the production of enriched uranium at the gaseous diffusion plants and an update on the construction and project control center for the gas centrifuge plant. Power usage at the gaseous diffusion plants is illustrated. The report contains several glossy color pictures of the plants and processes described. In addition to gaseous diffusion and the centrifuge process, three advanced isotope separation process are now being developed. The business operation of the enrichment plants is described; charts on revenue, balance sheets, and income statements are included
Economic evaluation of laser enrichment plant
International Nuclear Information System (INIS)
Arisawa, Takashi; Shiba, Koreyuki
1983-08-01
Operational characteristics of Laser Enrichment Plant are described based on the data available at present. And its economy is also discussed from the view point of investment and energy consumption. In the procedure of this estimation, the composition of the plant is firstly considered, secondly each component is designed, and thirdly the production cost of each component is estimated. Then the sensitivity of the component cost on the plant cost is analysed, which leads to the optimization of the product cost and the determination of the economic plant size, etc. The results shows that the power cost of the electric gun occupies the large majority of the total power cost, and that the capital cost of laser devices occupies most of the total capital cost. (author)
Prospects and problems of uranium enrichment
International Nuclear Information System (INIS)
Imai, Ryukichi
1974-01-01
The problem of uranium enrichment now concerns principally peaceful nuclear power generation. With the current oil crisis, energy resources assume unprecedented importance. However, the requirements for enriched uranium vary with the vicissitude of the world situation in nuclear power generation; the enterprise of uranium enrichment is related to economic aspect. The following matters are described: dimension of enrichment problem, political factors, changes in requirements, projects in each country, and strategy of enrichment in Japan. (Mori, K.)
Uranium enrichment in the United States
International Nuclear Information System (INIS)
Hill, J.H.; Parks, J.W.
1975-01-01
History, improvement programs, status of electrical power availability, demands for uranium enrichment, operating plan for the U. S. enriching facilities, working inventory of enriched uranium, possible factors affecting deviations in the operating plan, status of gaseous diffusion technology, status of U. S. gas centrifuge advances, transfer of enrichment technology, gaseous diffusion--gas centrifuge comparison, new enrichment capacity, U. S. separative work pricing, and investment in nuclear energy are discussed. (LK)
Principles and technical aspects of PCR amplification
National Research Council Canada - National Science Library
Pelt-Verkuil, Elizabeth van; Belkum, Alex van; Hays, John P
2008-01-01
... to illustrate any particularly important concepts or comments. Indeed, all commercial PCR biotechnology companies offer information about their products on internet sites and in online technical manuals. These online resources will be invaluable for any readers requiring more detailed PCR protocols. The authors have provided references for many PCR co...
The PCR revolution: basic technologies and applications
National Research Council Canada - National Science Library
Bustin, Stephen A
2010-01-01
... by leading authorities on the many applications of PCR and how this technology has revolutionized their respective areas of interest. This book conveys the ways in which PCR has overcome many obstacles in life science and clinical research and also charts the PCR's development from time-consuming, low throughput, nonquantitative proced...
Inhibitory effect of common microfluidic materials on PCR outcome
Kodzius, Rimantas
2012-02-20
Microfluidic chips have a variety of applications in the biological sciences and medicine. In contrast with traditional experimental approaches, microfluidics entails lower sample and reagent consumption, allows faster reactions and enables efficient separation. Additionally microfluidics offers other advantages accruing from the fluids’ various distinct behaviors, such as energy dissipation, fluidic resistance, laminar flow, and surface tension. Biological molecules suspended in fluid and transported through microfluidics channels interact with the channel-wall material. This interaction is even stronger in high surface-area-to-volume ratio (SAVR) microfluidic channels. Adsorption and inhibition of biomolecules occur when these materials come in contact with biomolecular reaction components. Polymerase chain reaction (PCR) is a thermal cycling procedure for amplifying target DNA. The PCR compatibility of silicon, silicon dioxide (SiO2) and other surfaces have been studied; however the results are inconclusive. Usually for protein-surface interaction measurements, bulky and expensive equipment is used, such as Atomic Force Microscopy (AFM), Scanning or Transmission Electron Microscopy (SEM, TEM), spectrophotometric protein concentration measurement, Fourier transform infrared spectroscopy (FTIR) or X-Ray photoelectron spectroscopy (XPS). \\tThe PCR reaction components include the DNA template, primers, DNA polymerase (the main component), dNTPs, a buffer, divalent ions (MgCl2), and KCl. \\tWe designed a simple, relatively quick measurement that only requires a PCR cycler; thus it mimics actual conditions in PCR cycling. In our study, we evaluated the inhibitory affect of different materials on PCR, which is one of the most frequently used enzymatic reactions in microfluidics. PCR reaction optimization through choice of surface materials is of the upmost importance, as it enables and improves enzymatic reaction in microfluidics. Our assessment of the PCR
A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-05-01
Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.
Enriched uranium recovery flowsheet improvements
International Nuclear Information System (INIS)
Holt, D.L.
1986-01-01
Savannah River uses 7.5% TBP to recover and purify enriched uranium. Adequate decontamination from fission products is necessary to reduce personnel exposure and to ensure that the enriched uranium product meets specifications. Initial decontamination of the enriched uranium from the fission products is carried out in the 1A bank, 16 stages of mixer-settlers. Separation of the enriched uranium from the fission product, 95 Zr, has been adequate, but excessive solvent degradation caused by the long phase contact times in the mixer-settlers has limited the 95 Zr decontamination factor (DF). An experimental program is investigating the replacement of the current 1A bank with either centrifugal contactors or a combination of centrifugal contactors and mixer-settlers. Experimental work completed has compared laboratory-scale centrifugal contactors and mixer-settlers for 95 Zr removal efficiencies. Feed solutions spiked with actual plant solutions were used. The 95 Zr DF was significantly better in the mixer-settlers than in the centrifugal contactors. As a result of this experimental study, a hybrid equipment flowsheet has been proposed for plant use. The hybrid equipment flowsheet combines the advantages of both types of solvent extraction equipment. Centrifugal contactors would be utilized in the extraction and initial scrub sections, followed by additional scrub stages of mixer-settlers
Enrichment plant management and safeguards
International Nuclear Information System (INIS)
Hurt, N.H.
1978-01-01
The next increment of enrichment at Portsmouth will be gas centrifuge. The safeguards program at Portsmouth is discussed, including the DYMCAS system, the computerization, and the detectors. Control of the material access areas is discussed. The licensee material surveillance and verification program is also described
The changing face of enrichment
International Nuclear Information System (INIS)
Dunckel, E.
1981-01-01
The AIS techniques considered are atomic vapour laser isotope separation, molecular laser isotope separation and plasma separation. The future of the AIS technique and their advantages over the gas centrifuge method are discussed in terms of economics, power consideration, and possible enrichment contracts. (U.K.)
Environmental Development Plan: uranium enrichment
International Nuclear Information System (INIS)
1979-09-01
This Environmental Development Plan identifies and examines the environmental, health, safety, and socioeconomic concerns and corresponding requirements associated with the DOE research, development, demonstration, and operation of the Uranium Enrichment program, including the gaseous diffusion process, the centrifuge process, centrifuge rotor fabrication, and related research and development activities
DEFF Research Database (Denmark)
Hjulsager, Charlotte Kristiane; Larsen, Lars Erik
and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M
2005-01-01
We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.
Directory of Open Access Journals (Sweden)
Whyte Paul
2008-09-01
Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.
Hamberger, A; Blomstrand, C; Lehninger, A L
1970-05-01
Fractions enriched in neuronal and glial cells were obtained from dispersions of whole beef brain and rabbit cerebral cortex by large-scale density gradient centrifugation procedures. The fractions were characterized by appropriate microscopic observation. Mitochondria were then isolated from these fractions by differential centrifugation of their homogenates. The two different types of mitochondria were characterized with respect to certain enzyme activities, respiratory rate, rate of protein synthesis, and their buoyant density in sucrose gradients. The mitochondria from the neuron-enriched fraction were distinguished by a higher rate of incorporation of amino acids into protein, higher cytochrome oxidase activity, and a higher buoyant density in sucrose density gradients. Mitochondria from the glia-enriched fraction showed relatively high monoamine oxidase and Na(+)- and K(+)-stimulated ATPase activities. The rates of oxidation of various substrates and the acceptor control ratios did not differ appreciably between the two types of mitochondria. The difference in the buoyant density of mitochondria isolated from the neuron-enriched and glia-enriched cell fractions was utilized in attempts to separate neuronal and glial mitochondria from the mixed mitochondria obtained from whole brain homogenates in shallow sucrose gradients. The appearance of two peaks of cytochrome oxidase, monoamine oxidase, and protein concentration in such gradients shows the potential feasibility of such an approach.
The commercial role for centrifuge enrichment
International Nuclear Information System (INIS)
Readle, P.H.; Wilcox, P.
1987-01-01
The enrichment market is extremely competitive and capacity greatly exceeds demand. BNFL [British Nuclear Fuels Ltd.] is in a unique position in having commercial experience of the two enrichment technologies currently used industrially: diffusion, and centrifuge enrichment through its associate company Urenco. In addition, BNFL is developing laser enrichment techniques as part of a UK development programme. The paper describes the enrichment market, briefly discusses the relative merits of the various methods of uranium enrichment and concludes that the gas centrifuge will be best able to respond to market needs for at least the remainder of the century. (author)
Enrichment into the 21st century
International Nuclear Information System (INIS)
Rutkowski, E.
1995-01-01
This article discusses the future of the enrichment services market into the next century. It is estimated that demand for enrichment services will reach 31 million SWU by the end of the century and remain constant for the following 10 years. The current world enrichment capacity is 44 million SWU, or some 50% ahead of the demand. This oversupply is projected to continue into the next century, but in spite of this, several suppliers are planning new enrichment facilities. HEU as a source of enriched uranium is examined. Overall, long-term prices for enrichment services are expected to decline in the coming decade
Enrichment demand boosts SWU prices
International Nuclear Information System (INIS)
Anon.
1993-01-01
The enrichment market is picking up significantly on very brisk demand. US utilities, which normally purchase material nine months to a year ahead of time, are already hitting the market to fill their 1996 requirements. In June, two non-US utilities, one European entity and a US utility bought SWUs, the entity in an off-market deal. But that doesn't tell the whole story. Three other US utilities entered the market during the month. Meanwhile, we count 13 more utilities getting ready to hit the market for more than 4 million SWUs. Why the surge in demand? Utilities, uncertain of the role to be played by the new US Enrichment Corp. and seeking to take advantage of low interest rates, are implementing buy and hold strategies. As a result, the upper end of NUKEM's SWU price range inched up to $78. The lower end dipped to $67 based on the European deal
A random PCR screening system for the identification of type 1 human herpes simplex virus.
Yu, Xuelian; Shi, Bisheng; Gong, Yan; Zhang, Xiaonan; Shen, Silan; Qian, Fangxing; Gu, Shimin; Hu, Yunwen; Yuan, Zhenghong
2009-10-01
Several viral diseases exhibit measles-like symptoms. Differentiation of suspected cases of measles with molecular epidemiological techniques in the laboratory is useful for measles surveillance. In this study, a random PCR screening system was undertaken for the identification of isolates from patients with measles-like symptoms who exhibited cytopathic effects, but who had negative results for measles virus-specific reverse transcription (RT)-PCR and indirect immunofluorescence assays. Sequence analysis of random amplified PCR products showed that they were highly homologous to type 1 human herpes simplex virus (HSV-1). The results were further confirmed by an HSV-1-specific TaqMan real-time PCR assay. The random PCR screening system described in this study provides an efficient procedure for the identification of unknown viral pathogens. Measles-like symptoms can also be caused by HSV-1, suggesting the need to include HSV-1 in differential diagnoses of measles-like diseases.
Enrichment techniques employed in phosphoproteomics
Czech Academy of Sciences Publication Activity Database
Fíla, Jan; Honys, David
2012-01-01
Roč. 43, č. 3 (2012), s. 1025-1047 ISSN 0939-4451 R&D Projects: GA ČR(CZ) GAP501/11/1462; GA ČR GA522/09/0858; GA ČR GA525/09/0994; GA MŠk OC08011 Institutional research plan: CEZ:AV0Z50380511 Keywords : Phosphoproteomics * Enrichment * IMAC Subject RIV: ED - Physiology Impact factor: 3.914, year: 2012
Uranium enrichment plans and policies
International Nuclear Information System (INIS)
Schwennesen, J.L.
1981-01-01
Significant progress has been made in US efforts to expand its enrichment capacity. The Cascade Improvement Program (CIP) and Cascade Upgrading Program (CUP) are now complete at Oak Ridge and Paducah and almost complete at Portsmouth. Considerable progress has also been made in constructing the Gas Centrifuge Enrichment Plant (GCEP), and physical construction of the first process building is well under way. Current plans are to have two process buildings on-line by 1989 with the remaining six buildings to be added sequentially as needed to meet demand. The status of DOE enrichment services contracts is essentially unchanged from that reported at last year's seminar. The OUEA latest forecast of nuclear power growth, however, is considerably lower than reported last year, although a leveling trend is becoming apparent. The Variable Tails Assay Option (VTAO) of the AFC contract was made available for the third time for FY 1983. The DOE inventories of natural uranium still remain high. The Department of Energy will dispose of this material by using it for Government programs and for enrichment plant operations. It appears that Government inventories of uranium are adequate through at least the mid-1990s. It remains DOE policy not to dispose of its natural uranium stocks through direct sales in the marketplace, except for very small quantities or if an emergency situation would exist and all reasonable attempts had been made, without success, to obtain natural uranium from commercial sources. Finally, with regard to DOE plans on future transaction tails assays, it still appears likely that the current 0.20 percent uranium-235 reference tails assay will be maintained until well into the 1990s, at which time it might be increased up to 0.25 percent uranium-235
Gomes, Newton C M; Flocco, Cecilia G; Costa, Rodrigo; Junca, Howard; Vilchez, Ramiro; Pieper, Dietmar H; Krögerrecklenfort, Ellen; Paranhos, Rodolfo; Mendonça-Hagler, Leda C S; Smalla, Kornelia
2010-11-01
In this study, the combination of culture enrichments and molecular tools was used to identify bacterial guilds, plasmids and functional genes potentially important in the process of petroleum hydrocarbon (PH) decontamination in mangrove microniches (rhizospheres and bulk sediment). In addition, we aimed to recover PH-degrading consortia (PHDC) for future use in remediation strategies. The PHDC were enriched with petroleum from rhizosphere and bulk sediment samples taken from a mangrove chronically polluted with oil hydrocarbons. Southern blot hybridization (SBH) assays of PCR amplicons from environmental DNA before enrichments resulted in weak positive signals for the functional gene types targeted, suggesting that PH-degrading genotypes and plasmids were in low abundance in the rhizosphere and bulk sediments. However, after enrichment, these genes were detected and strong microniche-dependent differences in the abundance and composition of hydrocarbonoclastic bacterial populations, plasmids (IncP-1α, IncP-1β, IncP-7 and IncP-9) and functional genes (naphthalene, extradiol and intradiol dioxygenases) were revealed by in-depth molecular analyses [PCR-denaturing gradient gel electrophoresis and hybridization (SBH and microarray)]. Our results suggest that, despite the low abundance of PH-degrading genes and plasmids in the environmental samples, the original bacterial composition of the mangrove microniches determined the structural and functional diversity of the PHDC enriched. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Phylogenetic analysis of TCE-dechlorinating consortia enriched on a variety of electron donors.
Freeborn, Ryan A; West, Kimberlee A; Bhupathiraju, Vishvesh K; Chauhan, Sadhana; Rahm, Brian G; Richardson, Ruth E; Alvarez-Cohen, Lisa
2005-11-01
Two rapidly fermented electron donors, lactate and methanol, and two slowly fermented electron donors, propionate and butyrate, were selected for enrichment studies to evaluate the characteristics of anaerobic microbial consortia that reductively dechlorinate TCE to ethene. Each electron donor enrichment subculture demonstrated the ability to dechlorinate TCE to ethene through several serial transfers. Microbial community analyses based upon 16S rDNA, including terminal restriction fragment length polymorphism (T-RFLP) and clone library/sequencing, were performed to assess major changes in microbial community structure associated with electron donors capable of stimulating reductive dechlorination. Results demonstrated that five phylogenic subgroups or genera of bacteria were present in all consortia, including Dehalococcoides sp., low G+C Gram-positives (mostly Clostridium and Eubacterium sp.), Bacteroides sp., Citrobacter sp., and delta Proteobacteria (mostly Desulfovibrio sp.). Phylogenetic association indicates that only minor shifts in the microbial community structure occurred between the four alternate electron donor enrichments and the parent consortium. Inconsistent detection of Dehalococcoides spp. in clone libraries and T-RFLP of enrichment subcultures was resolved using quantitative polymerase chain reaction (Q-PCR). Q-PCR with primers specific to Dehalococcoides 16S rDNA resulted in positive detection of this species in all enrichments. Our results suggest that TCE-dechlorinating consortia can be stably maintained on a variety of electron donors and that quantities of Dehalococcoides cells detected with Dehalococcoides specific 16S rDNA primer/probe sets do not necessarily correlate well with solvent degradation rates.
Selenium Enrichment of Horticultural Crops.
Puccinelli, Martina; Malorgio, Fernando; Pezzarossa, Beatrice
2017-06-04
The ability of some crops to accumulate selenium (Se) is crucial for human nutrition and health. Selenium has been identified as a cofactor of the enzyme glutathione peroxidase, which is a catalyzer in the reduction of peroxides that can damage cells and tissues, and can act as an antioxidant. Plants are the first link in the food chain, which ends with humans. Increasing the Se quantity in plant products, including leafy and fruity vegetables, and fruit crops, without exceeding the toxic threshold, is thus a good way to increase animal and human Se intake, with positive effects on long-term health. In many Se-enriched plants, most Se is in its major organic form. Given that this form is more available to humans and more efficient in increasing the selenium content than inorganic forms, the consumption of Se-enriched plants appears to be beneficial. An antioxidant effect of Se has been detected in Se-enriched vegetables and fruit crops due to an improved antioxidative status and to a reduced biosynthesis of ethylene, which is the hormone with a primary role in plant senescence and fruit ripening. This thus highlights the possible positive effect of Se in preserving a longer shelf-life and longer-lasting quality.
Selenium Enrichment of Horticultural Crops
Directory of Open Access Journals (Sweden)
Martina Puccinelli
2017-06-01
Full Text Available The ability of some crops to accumulate selenium (Se is crucial for human nutrition and health. Selenium has been identified as a cofactor of the enzyme glutathione peroxidase, which is a catalyzer in the reduction of peroxides that can damage cells and tissues, and can act as an antioxidant. Plants are the first link in the food chain, which ends with humans. Increasing the Se quantity in plant products, including leafy and fruity vegetables, and fruit crops, without exceeding the toxic threshold, is thus a good way to increase animal and human Se intake, with positive effects on long-term health. In many Se-enriched plants, most Se is in its major organic form. Given that this form is more available to humans and more efficient in increasing the selenium content than inorganic forms, the consumption of Se-enriched plants appears to be beneficial. An antioxidant effect of Se has been detected in Se-enriched vegetables and fruit crops due to an improved antioxidative status and to a reduced biosynthesis of ethylene, which is the hormone with a primary role in plant senescence and fruit ripening. This thus highlights the possible positive effect of Se in preserving a longer shelf-life and longer-lasting quality.
International Nuclear Information System (INIS)
1992-01-01
The European Bank has pledged in its Agreement to place environmental management at the forefront of its operations to promote sustainable economic development in central and eastern Europe. The Bank's environmental policy is set out in the document titled, Environmental Management: The Bank's Policy Approach. This document, Environmental Procedures, presents the procedures which the European Bank has adopted to implement this policy approach with respect to its operations. The environmental procedures aim to: ensure that throughout the project approval process, those in positions of responsibility for approving projects are aware of the environmental implications of the project, and can take these into account when making decisions; avoid potential liabilities that could undermine the success of a project for its sponsors and the Bank; ensure that environmental costs are estimated along with other costs and liabilities; and identify opportunities for environmental enhancement associated with projects. The review of environmental aspects of projects is conducted by many Bank staff members throughout the project's life. This document defines the responsibilities of the people and groups involved in implementing the environmental procedures. Annexes contain Environmental Management: The Bank's Policy Approach, examples of environmental documentation for the project file and other ancillary information
The isotopic enrichment of uranium in 1979
International Nuclear Information System (INIS)
Baron, M.
1979-01-01
The Eurodif uranium enrichment plant built on the Tricastin site is described. The uranium isotope separation plants in service abroad are presented. The main characteristics of the international enrichment market are defined [fr
Uranium enrichment (a strategy analysis overview)
International Nuclear Information System (INIS)
Blahnik, C.
1979-08-01
An analysis of available information on enrichment technology, separative work supply and demand, and SWU cost is presented. Estimates of present and future enrichment costs are provided for use in strategy analyses of alternate nuclear fuel cycles and systems. (auth)
Curriculum enrichment through indigenous Zulu games | Roux ...
African Journals Online (AJOL)
Curriculum enrichment through indigenous Zulu games. ... 1997). The aim of the study was to document and analyze indigenous Zulu games for possible curriculum enrichment of physical ... AJOL African Journals Online. HOW TO USE AJOL.
Li, Ki Angel; Lund, Emilie Torp; Voigt, Jörg-Peter W
2016-01-01
The early postnatal period is a sensitive period in rodents as behavioural systems are developing and maturing during this time. However, relatively little information is available about the impact of environmental enrichment on offspring behaviour if enrichment is implemented only during this period. Here, environmental enrichment was provided from postnatal day 1 until weaning. On post-natal day 9, maternal behaviour and nonmaternal behaviour of the dam was observed. Nursing time in the enriched group was reduced but dams showed more non-maternal appetitive behaviours. Offspring were exposed to either the open field or the elevated plus maze (EPM) after weaning. In the open field, rats from the enriched group approached the more aversive inner zone of the open field later than control rats. Offspring from the enriched group made fewer entries into the inner zone and spent less time in this part of the arena. Enrichment had no impact on behaviour in the EPM. The present study provides evidence that postnatal enrichment can interfere with maternal behaviour in rats and can possibly lead to increased anxiety in the offspring. The findings suggest that enrichment procedures can have potentially unintended effects, interfering with the development of emotional behaviours in rats. Copyright © 2015 Elsevier B.V. All rights reserved.
Network-based functional enrichment
Directory of Open Access Journals (Sweden)
Poirel Christopher L
2011-11-01
Full Text Available Abstract Background Many methods have been developed to infer and reason about molecular interaction networks. These approaches often yield networks with hundreds or thousands of nodes and up to an order of magnitude more edges. It is often desirable to summarize the biological information in such networks. A very common approach is to use gene function enrichment analysis for this task. A major drawback of this method is that it ignores information about the edges in the network being analyzed, i.e., it treats the network simply as a set of genes. In this paper, we introduce a novel method for functional enrichment that explicitly takes network interactions into account. Results Our approach naturally generalizes Fisher’s exact test, a gene set-based technique. Given a function of interest, we compute the subgraph of the network induced by genes annotated to this function. We use the sequence of sizes of the connected components of this sub-network to estimate its connectivity. We estimate the statistical significance of the connectivity empirically by a permutation test. We present three applications of our method: i determine which functions are enriched in a given network, ii given a network and an interesting sub-network of genes within that network, determine which functions are enriched in the sub-network, and iii given two networks, determine the functions for which the connectivity improves when we merge the second network into the first. Through these applications, we show that our approach is a natural alternative to network clustering algorithms. Conclusions We presented a novel approach to functional enrichment that takes into account the pairwise relationships among genes annotated by a particular function. Each of the three applications discovers highly relevant functions. We used our methods to study biological data from three different organisms. Our results demonstrate the wide applicability of our methods. Our algorithms are
Enriched uranium sales: effect on supply industry
International Nuclear Information System (INIS)
Andersen, R.K.
1985-01-01
The subject is covered in sections: introduction (combined effect of low-enriched uranium (LEU) inventory sales and utility services enrichment contract terms); enrichment market overview; enrichment market dynamics; the reaction of the US Department of Energy; elimination of artificial demand; draw down of inventories; purchase and sale of LEU inventories; tails assay option; unfulfilled requirements for U 3 O 8 ; conclusions. (U.K.)
Diagnostic PCR tests for Microsporum audouinii, M. canis and Trichophyton infections
DEFF Research Database (Denmark)
Brillowska-Dabrowska, Anna; Swierkowska, Aleksandra; Lindhardt Saunte, Ditte Marie
2010-01-01
; 25 routine specimens from patients suspected of having dermatophytosis; 10 hair specimens from guinea pigs experimentally infected with M. canis; and two samples from un-infected control animals. DNA was prepared by a 10-min procedure from pure cultures as previously described. The 302 bp PCR product....... Finally, the Microsporum PCR was positive for 10/10 guinea pig specimens from infected animals but for 0/2 of the control animal samples. The evaluation of the two PCR tests indicated excellent sensitivity and specificity....
31 CFR 540.316 - Uranium enrichment.
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Uranium enrichment. 540.316 Section 540.316 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 540.316 Uranium enrichment. The term uranium enrichment means the process of...
Pitfalls in PCR troubleshooting: Expect the unexpected?
Directory of Open Access Journals (Sweden)
Livia Schrick
2016-01-01
Full Text Available PCR is a well-understood and established laboratory technique often used in molecular diagnostics. Huge experience has been accumulated over the last years regarding the design of PCR assays and their set-up, including in-depth troubleshooting to obtain the optimal PCR assay for each purpose. Here we report a PCR troubleshooting that came up with a surprising result never observed before. With this report we hope to sensitize the reader to this peculiar problem and to save troubleshooting efforts in similar situations, especially in time-critical and ambitious diagnostic settings.
Absolute quantification by droplet digital PCR versus analog real-time PCR
Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh
2014-01-01
Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387
Su, Zhangli
2016-01-01
Combinatorial patterns of histone modifications are key indicators of different chromatin states. Most of the current approaches rely on the usage of antibodies to analyze combinatorial histone modifications. Here we detail an antibody-free method named MARCC (Matrix-Assisted Reader Chromatin Capture) to enrich combinatorial histone modifications. The combinatorial patterns are enriched on native nucleosomes extracted from cultured mammalian cells and prepared by micrococcal nuclease digestion. Such enrichment is achieved by recombinant chromatin-interacting protein modules, or so-called reader domains, which can bind in a combinatorial modification-dependent manner. The enriched chromatin can be quantified by western blotting or mass spectrometry for the co-existence of histone modifications, while the associated DNA content can be analyzed by qPCR or next-generation sequencing. Altogether, MARCC provides a reproducible, efficient and customizable solution to enrich and analyze combinatorial histone modifications. PMID:26131849
ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data.
Directory of Open Access Journals (Sweden)
Yuttachon Promworn
Full Text Available Biochemical methods are available for enriching 5' ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5' ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance.We present Transformation of Nucleotide Enrichment Ratios (ToNER, a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5' ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5' ends than TSSAR. In general, the transcript 5' ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR.ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5'ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a
ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data.
Promworn, Yuttachon; Kaewprommal, Pavita; Shaw, Philip J; Intarapanich, Apichart; Tongsima, Sissades; Piriyapongsa, Jittima
2017-01-01
Biochemical methods are available for enriching 5' ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq) and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5' ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance. We present Transformation of Nucleotide Enrichment Ratios (ToNER), a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5' ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5' ends than TSSAR. In general, the transcript 5' ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR. ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5'ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a.biotec.or.th/GI/tools/toner) and Git
International Nuclear Information System (INIS)
Lyon, W.S.
1982-01-01
The modern counting instrumentation has largely obviated the need for separation processes in the radiochemical analysis but problems in low-level radioactivity measurement, environmental-type analyses, and special situations caused in the last years a renaissance of the need for separation techniques. Most of the radiochemical procedures, based on the classic works of the Manhattan Project chemists of the 1940's, were published in the National Nuclear Energy Series (NNES). Improvements such as new solvent extraction and ion exchange separations have been added to these methods throughout the years. Recently the Los Alamos Group have reissued their collected Radiochemical Procedures containing a short summary and review of basic inorganic chemistry - 'Chemistry of the Elements on the Basis of Electronic Configuration'. (A.L.)
Zhang, Li; Yang, Huiyi; Zhao, Yanwei; Liu, Wenchao; Wu, Shiyang; He, Jiaying; Luo, Xiaodi; Zhu, Zeyao; Xu, Jiasen; Zhou, Qinghua; Ren-Heidenreich, Lifen
2012-09-01
We have developed and standardized a novel technology, mutant-enriched liquidchip (MEL), for clinical detection of EGFR mutations. The MEL integrates a mutant-enriched PCR procedure with liquidchip technology for detections of EGFR exon 19 deletions and L858R mutation on both formalin-fixed and paraffin-embedded (FFPE) slides and plasma samples from patients with non-small cell lung cancer (NSCLC). The detection sensitivity was 0.1% of mutant DNA in the presence of its wild-type DNA. The cross-reaction rate was lower than 5%. To evaluate the MEL platform, the EGFR mutation status of 59 patients with advanced NSCLC treated with EGFRTKIs (Tyrosine Kinase Inhibitors) were tested on their FFPE samples. EGFR exon 19 deletions and L858R were detected in 21 patients (21/59) and 76.2% (16/21) of them had partial response to the EGFR-TKIs, while by sequencing method, only 4 (4/59) mutations were detected. Plasma samples from 627 patients with various stages of NSCLC were examined with the MEL and 22% of EGFR exon 19 deletions and L858R were detected. Furthermore, in patients with advanced disease there are more mutations detected in plasma samples than in patients with less advanced disease. In conclusion, the MEL is a sensitive, stable, and robust technology for detecting EGFR DNA mutations from both FFPE and plasma samples from patients with NSCLC and is now routinely used for clinical diagnosis.
Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.
Smith, Cindy J; Osborn, A Mark
2009-01-01
Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.
Population diversity of ammonium oxidizers investigated by specific PCR amplification
Ward, B.B.; Voytek, M.A.; Witzel, K.-P.
1997-01-01
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.
Gas-phase UF6 enrichment monitor for enrichment plant safeguards
International Nuclear Information System (INIS)
Strittmatter, R.B.; Tape, J.W.
1980-03-01
An in-line enrichment monitor is being developed to provide real-time enrichment data for the gas-phase UF 6 feed stream of an enrichment plant. The nondestructive gamma-ray assay method can be used to determine the enrichment of natural UF 6 with a relative precision of better than 1% for a wide range of pressures
2011-03-02
... and Licensing Board; AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility); Notice of... Governmental Entities Regarding Environmental Portion of Enrichment Facility Licensing Proceeding February 24.... White. In this 10 CFR part 70 proceeding regarding the request of applicant AREVA Enrichment Services...
Directory of Open Access Journals (Sweden)
Nurulwahida Hj Azid
2016-01-01
Full Text Available Orphans are considered a minority and they should be given a greater emphasis so that they do not feel left out and can build their own lives without a sense of humility. This does not mean that the orphans should be pampered instead they should be given the confidence and motivation to strive for success in later life. Humility among orphans can be associated with interpersonal and intrapersonal intelligences. This study aims to evaluate the impact of problem-solving activity treatment based on the interpersonal and intrapersonal intelligences. 46 students from two orphanages were involved as the treatment group. The research design used was a one-group pretest-posttest design applied through a combination of quantitative and qualitative approaches. Enrichment activities that provided interpersonal and intrapersonal skills as evidenced in this study should be carried out regularly at orphanages. Our study has proven that orphans‟ rights to learn cannot be neglected and „no child left behind „policy needs to be carried through by everybody involved with orphans‟ well-being. Teachers and carers need to be trained to use these enrichment activities at their orphanages to help maximize the orphans‟ potentials.
Study the Three Extraction Methods for HBV DNA to Use in PCR
Directory of Open Access Journals (Sweden)
N. Sheikh
2004-07-01
Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.
The reduced enrichment program for JRR-4
International Nuclear Information System (INIS)
Takayanagi, M.
1992-01-01
Japan Research Reactor No. 4(JRR-4) with the rated power of 3.5 MW, swimming pool type research reactor, 93 % enriched uranium ETR-type fuel used, light water moderated and cooled. The first criticality reached on 28th January, 1965. The reactor has operated for about 26 years. However, it was planed to the reduced enrichment of the fuels to low enrichment according to the International Reduced Enrichment for Research and Test Reactors (RERTR) program. This paper describes the program for conversion of the enrichment of fuel from 93 % to less than 20 %. (author)
Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR
Energy Technology Data Exchange (ETDEWEB)
Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)
1994-09-01
Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.
Enrichment planting without soil treatment
Energy Technology Data Exchange (ETDEWEB)
Hagner, Mats
1998-12-31
Where enrichment planting had been carried out with either of the two species Picea abies and Pinus contorta, the survival of the planted seedlings was at least as good as after planting in a normal clear cut area treated with soil scarification. This was in spite of the fact that the seedlings were placed shallow in the humus layer without any soil treatment. However, they were sheltered from insects by treatment before planting. Where enrichment planting was carried out with Pinus sylvestris the survival in dense forest was poor, but in open forest the survival was good. The growth of planted seedlings was enhanced by traditional clearing and soil treatment. However, this was for Pinus sylvestris not enough to compensate for the loss of time, 1-2 years, caused by arrangement of soil scarification. The growth of seedlings planted under crown cover was directly related to basal area of retained trees. However, the variation in height growth among individual seedlings was very big, which meant that some seedlings grow well also under a fairly dense forest cover. The pioneer species Pinus sylvestris reacted more strongly to basal area of retained trees than did the shade tolerant species Picea abies. Enrichment planting seems to be a necessary tool for preserving volume productivity, at places where fairly intensive harvest of mature trees has been carried out in stands of ordinary forest type in central Sweden. If double seedlings, with one Picea abies and one Pinus sylvestris, are used, the probability for long term establishment is enhanced 13 refs, 20 figs, 4 tabs
Miranda, A; Saldaña, A; González, K; Paz, H; Santamaría, G; Samudio, F; Calzada, J E
2012-09-01
Cutaneous leishmaniasis (CL) is a major vectorborne disease in Panama. In this study, the diagnostic performance and usefulness of two DNA extraction procedures from skin scraping samples collected on FTA filter paper for subsequent PCR diagnosis of CL was evaluated. A positive CL laboratory diagnosis was based on a positive parasitological test (Giemsa-stained smears or in vitro culture) and/or positive PCR test performed from skin scrapings collected in TE buffer (PCR-TE). Of 100 patients with skin lesions suggestive of CL, 82 (82%) were confirmed as CL positive. The sensitivity was calculated for each of the PCR approaches from samples collected on filter paper. The highest sensitivity was achieved by PCR-FTA processed by Chelex 100 (PCR-Chelex) (0.94). PCR-FTA extracted using the FTA purification reagent presented a lower sensitivity (0.60). Good concordance between routine PCR-TE and PCR-Chelex was observed (percent agreement=0.88, κ index=0.65). In conclusion, use of FTA filter paper for skin scraping collection combined with PCR is a reliable and convenient method for CL diagnosis in Panama, with comparable performance to the routine PCR method and with improved sensitivity compared with those of conventional parasitological methods. Copyright © 2012 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.
[Hydroxylamine conversion by anammox enrichment].
Hu, Anhui; Zheng, Ping; Lu, Huifeng; Ding, Shuang; Wang, Caihua
2010-04-01
Hydroxylamine is an important intermediate product of anammox. This study was focused on the characteristics of hydroxylamine and nitrite conversions by anammox enrichment. The changes of nitrogenous substrates and related products with time were measured using batch tests with anammox enrichment as inoculum. Since hydroxylamine didn't react with nitrite in uninoculated control culture, these two compounds were chemically stable. Both of them decreased with time in anammox enrichment inoculated cultures, in which ammonia as intermediate product would be produced and converted with the maximum concentration being 0.338 mg/L. The total nitrogen concentration decreased from 4.694 mmol/L to 0.812 mmol/L with conversion rate 82.7% in the end. When hydroxylamine and nitrite concentrations were about 2.5 mmol/L respectively, the maximum specific sludge conversion rates of hydroxylamine was 0.535 mmol/(gVSS.h), which was 1.81 times bigger than that of ammonia in ammonia reaction system; the maximum specific sludge rate of total nitrogen was slightly higher than that in ammonia reaction system. When hydroxylamine concentration increased to 5.0 mmol/L, the hydroxylamine and nitrite conversion rates promoted by 26.7% and 120.7% respectively; and the maximum ammonia accumulated was 1.810 mmol/L. When nitrite concentration increased to 5.0 mmol/L, the hydroxylamine and nitrite conversion rates promoted by 6.9% and 9.0% respectively; and the maximum ammonia accumulated was 0.795 mmol/L. Anammox enrichment was capable of converting hydroxylamine and nitrite simultaneously and had the higher conversion rate of hydroxylamine than ammonia conversion rate. Hydroxylamine and nitrite conversion rates were less affected by increase in nitrite concentration, but more significantly influenced by increase in hydroxylamine. The maximum ammonia concentration accumulated would rise as the result of increasing both hydroxylamine and nitrite. The result of experiment was consistent with pathway
Boron enrichment in martian clay.
Directory of Open Access Journals (Sweden)
James D Stephenson
Full Text Available We have detected a concentration of boron in martian clay far in excess of that in any previously reported extra-terrestrial object. This enrichment indicates that the chemistry necessary for the formation of ribose, a key component of RNA, could have existed on Mars since the formation of early clay deposits, contemporary to the emergence of life on Earth. Given the greater similarity of Earth and Mars early in their geological history, and the extensive disruption of Earth's earliest mineralogy by plate tectonics, we suggest that the conditions for prebiotic ribose synthesis may be better understood by further Mars exploration.
Producing deuterium-enriched products
International Nuclear Information System (INIS)
1980-01-01
A method of producing an enriched deuterium product from a gaseous feed stream of mixed hydrogen and deuterium, comprises: (a) combining the feed stream with gaseous bromine to form a mixture of the feed stream and bromine and exposing the mixture to an electrical discharge effective to form deuterium bromide and hydrogen bromide with a ratio of D/H greater than the ratio of D/H in the feed stream; and (b) separating at least a portion of the hydrogen bromide and deuterium bromide from the mixture. (author)
Directory of Open Access Journals (Sweden)
F.M. Munari
2012-03-01
Full Text Available Group B Streptococcus (GBS is the most common cause of life-threatening infection in neonates. Guidelines from CDC recommend universal screening of pregnant women for rectovaginal GBS colonization. The objective of this study was to compare the performance of a combined enrichment/PCR based method targeting the atr gene in relation to culture using enrichment with selective broth medium (standard method to identify the presence of GBS in pregnant women. Rectovaginal GBS samples from women at ≥36 weeks of pregnancy were obtained with a swab and analyzed by the two methods. A total of 89 samples were evaluated. The prevalence of positive results for GBS detection was considerable higher when assessed by the combined enrichment/PCR method than with the standard method (35.9% versus 22.5%, respectively. The results demonstrated that the use of selective enrichment broth followed by PCR targeting the atr gene is a highly sensitive, specific and accurate test for GBS screening in pregnant women, allowing the detection of the bacteria even in lightly colonized patients. This PCR methodology may provide a useful diagnostic tool for GBS detection and contributes for a more accurate and effective intrapartum antibiotic and lower newborn mortality and morbidity.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
Muino Acuna, J.M.
2011-01-01
WARNING: This library was yield low amount of material and it was over-amplified by PCR. This libraries are used study the robustness of several statitical methods against PCR artifacts. ChIP experiments were performed on Arabidopsis wildtype inflorescences using an antibody raised against a
Digital PCR for detection of citrus pathogens
Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...
Testing for Genetically Modified Foods Using PCR
Taylor, Ann; Sajan, Samin
2005-01-01
The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…
Validation of RNAi by real time PCR
DEFF Research Database (Denmark)
Josefsen, Knud; Lee, Ying Chiu
2011-01-01
Real time PCR is the analytic tool of choice for quantification of gene expression, while RNAi is concerned with downregulation of gene expression. Together, they constitute a powerful approach in any loss of function studies of selective genes. We illustrate here the use of real time PCR to verify...
PCR specific for Actinobacillus pleuropneumoniae serotype 3
DEFF Research Database (Denmark)
Zhou, L.; Jones, S.C.P.; Angen, Øystein
2008-01-01
, but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Mathematical analysis of the real time array PCR (RTA PCR) process
Dijksman, Johan Frederik; Pierik, A.
2012-01-01
Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the
Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas
2002-03-15
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.
Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.
Pavšič, Jernej; Žel, Jana; Milavec, Mojca
2016-01-01
Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.
Present state of development of uranium enrichment
International Nuclear Information System (INIS)
1979-01-01
The pilot plant for uranium enrichment started the operation on September 12, 1979. The pilot plant has been constructed by the Power Reactor and Nuclear Fuel Development Corp. in Ningyo Pass, Okayama Prefecture. 7000 centrifugal separators will be installed by mid 1981, and yearly production of 70 t SWU is expected. The Uranium Enrichment Committee of Japan Atomic Industrial Forum has made the proposal on the method of forwarding the development of uranium enrichment in Japan to Atomic Energy Commission and related government offices in December, 1978. This survey summarized the trends of uranium enrichment in Japan and foreign countries and the problems about nuclear non-proliferation, and provides with the reference materials. The demand and supply of uranium enrichment in the world, the present states and plans in USA, Europe, USSR and others, the demand and supply of uranium enrichment and the measures for securing it in Japan, the present state and future plan of uranium enrichment project in Japan, the international regulation of uranium enrichment, the recent policy of USA and INFCE, and the trend of the regulation of utilizing enriched uranium are described. Moreover, the concept of separation works in uranium enrichment and the various technologies of separation are explained. (Kako, I.)
Reduced enrichment fuel and its reactivity effects in the University Training Reactor Moata
International Nuclear Information System (INIS)
Wilson, D.J.
1983-08-01
Concern for nuclear proliferation is likely to preclude future supply of highly enriched uranium fuel for research reactors such as the University Training Reactor Moata. This study calculates the fuel densities necessary to maintain the reactivity per plate of the present high enrichment (90 per cent 235 U) fuel for a range of lower enrichments assuming that no geometry changes are allowed. The maximum uranium density for commercially available aluminium-type research reactor fuels is generally considered to be about 1.7 g cm -3 . With this density limitation, the minimum enrichment to maintain present reactivity per plate is about 35 per cent 235 U. For low enrichment (max. 20 per cent 235 U) fuel, the required U density is about 2.9 g cm -3 , which is beyond the expected range for UAl/sub x/-Al but within that projected for the longer term development and full qualification for U 3 O 8 -Al. Medium enrichment (nominally 45 per cent 235 U) Al/sub x/-Al would be entirely satisfactory as an immediate replacement fuel, requiring no modifications to the reactor and operating procedures, and minimal reappraisal of safety issues. Included in this study are calculations of the fuel coefficients at various enrichments, the effect of replacing standard fuel plates or complete elements with 45 per cent enriched fuel, and the reactivity to be gained by replacing 12-plate with 13-plate elements
Two-stage electrolysis to enrich tritium in environmental water
International Nuclear Information System (INIS)
Shima, Nagayoshi; Muranaka, Takeshi
2007-01-01
We present a two-stage electrolyzing procedure to enrich tritium in environmental waters. Tritium is first enriched rapidly through a commercially-available electrolyser with a large 50A current, and then through a newly-designed electrolyser that avoids the memory effect, with a 6A current. Tritium recovery factor obtained by such a two-stage electrolysis was greater than that obtained when using the commercially-available device solely. Water samples collected in 2006 in lakes and along the Pacific coast of Aomori prefecture, Japan, were electrolyzed using the two-stage method. Tritium concentrations in these samples ranged from 0.2 to 0.9 Bq/L and were half or less, that in samples collected at the same sites in 1992. (author)
Enrichment and Determination of radionuclides by ion chromatography
International Nuclear Information System (INIS)
ZAFIMANJATO, J.L.R.
1996-01-01
The fundamentals of Ion Chromatography (IC) and Liquid Scintillation Counting (LSC) are reviewed. Ion Chromatography as separation method for cations is coupled with Liquid Scintillation Counting for the determination of Radionuclides in water samples. An experimental arrangement for investigations on the applicability of guard columns for cationic radionuclide enrichment is shown. The saturation behaviour of single and bivalentic cations and their combination is presented. Our results show that radioactive bivalentic cations like strontium-90 and radium-226 are enriched on a Ion Pac CG 12 Dionex guard column from 100 to 300ml natural water in one single step. The procedure is suitable for their determination in concentrations down to 10 -2 Bq.l -1 [fr
Preparation of isotopically enriched mercury sulphide targets
Energy Technology Data Exchange (ETDEWEB)
Szerypo, J.; Friebel, H.U.; Frischke, D.; Grossman, R.; Maier, H.J. [Dept. fuer Physik, Univ. Muenchen (LMU) (Germany); Maier-Leibnitz-Lab. (MLL), Garching (Germany)
2007-07-01
The primary difficulty in performing nuclear reactions on mercury is to obtain a suitable target. The primary difficulty in performing nuclear reactions on mercury is to obtain a suitable target. The utilization of amalgam targets has been reported in early publications. These targets, however, were lacking homogeneity and in-beam stability. A thorough investigation of literature shows, that HgS, because of its comparatively high chemical and mechanical stability, is one of the more adequate Hg compounds for accelerator target applications. In this presentation we describe the production of HgS targets consisting of an enriched Hg isotope and S of natural isotopic abundance, starting up from HgO. Following the outline given in [3], in this special case HgS can be prepared by dissolving HgO in diluted HNO{sub 3} and subsequent precipitation of the black HgS modification with gaseous H{sub 2}S. Last step of the target production procedure is evaporation-condensation of HgS in vacuum. In the present case, HgS layers of 500 {mu}g/cm{sup 2} on a backing carbon foil of 26 {mu}g/cm{sup 2} with a protective carbon layer of about 20 {mu}g/cm{sup 2} thickness on top of the HgS layer were produced. (orig.)
Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.
Directory of Open Access Journals (Sweden)
Xiangdong Kong
Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.
Direct-to-PCR tissue preservation for DNA profiling.
Sorensen, Amy; Berry, Clare; Bruce, David; Gahan, Michelle Elizabeth; Hughes-Stamm, Sheree; McNevin, Dennis
2016-05-01
Disaster victim identification (DVI) often occurs in remote locations with extremes of temperatures and humidities. Access to mortuary facilities and refrigeration are not always available. An effective and robust DNA sampling and preservation procedure would increase the probability of successful DNA profiling and allow faster repatriation of bodies and body parts. If the act of tissue preservation also released DNA into solution, ready for polymerase chain reaction (PCR), the DVI process could be further streamlined. In this study, we explored the possibility of obtaining DNA profiles without DNA extraction, by adding aliquots of preservative solutions surrounding fresh human muscle and decomposing human muscle and skin tissue samples directly to PCR. The preservatives consisted of two custom preparations and two proprietary solutions. The custom preparations were a salt-saturated solution of dimethyl sulfoxide (DMSO) with ethylenediaminetetraacetic (EDTA) and TENT buffer (Tris, EDTA, NaCl, Tween 20). The proprietary preservatives were DNAgard (Biomatrica(®)) and Tissue Stabilising Kit (DNA Genotek). We obtained full PowerPlex(®) 21 (Promega) and GlobalFiler(®) (Life Technologies) DNA profiles from fresh and decomposed tissue preserved at 35 °C for up to 28 days for all four preservatives. The preservative aliquots removed from the fresh muscle tissue samples had been stored at -80 °C for 4 years, indicating that long-term archival does not diminish the probability of successful DNA typing. Rather, storage at -80 °C seems to reduce PCR inhibition.
Material Biocompatibility for PCR Microfluidic Chips
Kodzius, Rimantas; Chang, Donald Choy; Gong, Xiuqing; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yi, Xin
2010-01-01
As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.
Material Biocompatibility for PCR Microfluidic Chips
Kodzius, Rimantas
2010-04-23
As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.
Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.
Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei
2018-02-02
As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.
A 2000-2010 years outlook of isotopic uranium enrichment
International Nuclear Information System (INIS)
Vasaru, G.
1998-01-01
The increase of the installed power in nuclear plants implies the following steps to be achieved: - developing a parallel industry for the nuclear fuel cycle able to ensure a rhythmic supply of natural uranium, possibly an isotopic enrichment of 235 U of around 1.2 - 3.2%, depending on the reactor system; - manufacturing the fuel elements and the operation of cycle back-end, which may, possibly, include a temporary storage of the irradiated fuel; - reprocessing the spend fuel; - radioactive waste processing in view of final disposal, as well as the recovery of un-spent uranium and of plutonium formed. The heavy water reactors of CANDU-PHW does not imply any isotopic enrichment but provides a lower burnup of only 7,000 MW day/tone. An enrichment to 1.2% in 235 U for this type of reactors could increase the burnup up to 20,000 MW day/tone. An advanced method of enriching 235 U is based on the Atomic Vapor Laser Isotop Separation (AVLIS). This procedure called AVLIS has several advantages which are pointed out in this paper, among which: a very high selectivity; high separation factors; a low energy consumption due to the fact that in the conditions of a selective photo ionization, the energy necessary to the process is only 6.2 eV for the separated 235 U atom vs 0.3 MeV in case of inertial separators or 3 MeV in case of gaseous diffusion procedure. With the current laser yields an energy consumption of 100 kWh/SWU is estimated for AVLIS procedures as compared with 2,400 kWh/SWU in case of gaseous diffusion; an almost entire extraction of 235 U, what ensures a more efficient utilisation of nuclear fuel. Due to its modular character and to potential improvement in the equipment which could be achieved, this procedure will ensure a reduction in the investment costs in the construction stage what will make AVLIS a substitute of the classical separation procedures
Chicken microsatellite markers isolated from libraries enriched for simple tandem repeats.
Gibbs, M; Dawson, D A; McCamley, C; Wardle, A F; Armour, J A; Burke, T
1997-12-01
The total number of microsatellite loci is considered to be at least 10-fold lower in avian species than in mammalian species. Therefore, efficient large-scale cloning of chicken microsatellites, as required for the construction of a high-resolution linkage map, is facilitated by the construction of libraries using an enrichment strategy. In this study, a plasmid library enriched for tandem repeats was constructed from chicken genomic DNA by hybridization selection. Using this technique the proportion of recombinant clones that cross-hybridized to probes containing simple tandem repeats was raised to 16%, compared with < 0.1% in a non-enriched library. Primers were designed from 121 different sequences. Polymerase chain reaction (PCR) analysis of two chicken reference pedigrees enabled 72 loci to be localized within the collaborative chicken genetic map, and at least 30 of the remaining loci have been shown to be informative in these or other crosses.
DEFF Research Database (Denmark)
Jensen, Annette Nygaard; Andersen, M. T.; Dalsgaard, Anders
2005-01-01
species-specific detection of Campylobacter spp. in naturally infected pig faecal samples after an enrichment step, whereas the hybridization approach enhanced the specific isolation of C. jejuni (present in minority to C. coli) from pigs. Conclusions: The rt-PCR was specific for Campylobacter jejuni, C...... by phenotypic methods and the developed rt-PCR provides an easy and fast method for such differentiation. Detection of C. jejuni by colony hybridization may increase the isolation rate of this species from pig faeces....
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas
2002-01-01
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...
Gasket for uranium enrichment plant
Energy Technology Data Exchange (ETDEWEB)
Kishi, S; Aiyoshi, H
1977-02-08
A gasket to be inserted between flange joints in the equipments and pipe lines of an uranium enrichment plant having neither permeability nor adsorptivity to water while maintaining mechanical, physical and chemical properties of an elastomer gasket is described. A gasket made of an elastomeric material such as a polymer is integratedly formed at its surface with anti-slip projections. The gasket is further surrounded at its upper and lower peripheral sides, as well as outer circumferential portion with a U-sectioned cover (enclosure) made of fluoro-plastics. In this arrangement, the gasket main body shows a gas-tightness for uranium hexafluoride gas and the cover exhibits a gas-tightness for other component gases such as moisture to thereby prevent degradation of the gasket due to absorption and permeation of the moisture.
Uranium enrichment in South Africa
International Nuclear Information System (INIS)
Roux, A.J.A.; Grant, W.L.
1976-01-01
It is stated that the South African process is of an aerodynamic type, the separating element being in effect a high performance stationary-walled centrifuge using UF 6 in hydrogen as process fluid. Some details of the very low uranium inventory and high separation factor achievable are given. A new cascade technique is described, based on the principle that an axial flow compressor can simultaneously transmit several streams of different isotopic composition without there being significant mixing between them. The research and development programme is discussed. It is expected that an enrichment plant of 5000 t/a SW capacity, with provision for expansion up to 10,000 t/a SW capacity, will come into operation by 1984. (U.K.)
Huang, Chao-June; Lin, Hsin-I; Shiesh, Shu-Chu; Lee, Gwo-Bin
2010-03-15
The systematic evolution of ligands by exponential enrichment (SELEX) is an experimental procedure that allows screening of given molecular targets by desired binding affinities from an initial random pool of oligonucleotides and oligomers. The final products of SELEX are usually referred as aptamers, which are recognized as promising molecules for a variety of biomedical applications. However, SELEX is an iterative process requiring multiple rounds of extraction and amplification that demands significant time and labor. Therefore, this study presents a novel, automatic, miniature SELEX platform. As a demonstration, the rapid screening of C-reactive protein (CRP) aptamers was performed. By utilizing microfluidic technologies and magnetic beads conjugated with CRP, aptamers with a high affinity to CRP were extracted from a random single-strand deoxyribonucleic acid (ssDNA) pool. These aptamers were further amplified by an on-chip polymerase chain reaction (PCR) process. After five consecutive extraction and amplification cycles, a specific aptamer with the highest affinity was screened automatically. The screened aptamers were used as a recognition molecule for the detection of CRP. The developed microsystem demonstrated fast screening of CRP aptamers and can be used as a powerful tool to select analyte-specific aptamers for biomedical applications. (c) 2009 Elsevier B.V. All rights reserved.
Stable isotope enrichment: Current and future potential
International Nuclear Information System (INIS)
Tracy, J.G.; Aaron, W.S.
1992-01-01
Oak Ridge National Laboratory (ORNL) operates the Isotope Enrichment Facility for the purpose of providing enriched stable isotopes, selected radioactive isotopes (including the actinides), and isotope-related materials and services for use in various research applications. ORNL is responsible for isotope enrichment and the distribution of approximately 225 nongaseous stable isotopes from 50 multi-isotopic elements. Many enriched isotope products are of prime importance in the fabrication of nuclear targets and the subsequent production of special radionuclides. State-of-the-art techniques to achieve special isotopic, chemical, and physical requirements are performed at ORNL This report describes the status and capabilities of the Isotope Enrichment Facility and the Isotope Research Materials Laboratory as well as emphasizing potential advancements in enrichment capabilities
Considering the post-1995 enrichment market
International Nuclear Information System (INIS)
Gunter, L.
1994-01-01
World demand for uranium enrichment services is likely to grow only a little over the next decade, from the current 28 million separative work units (SWU) per year to 33 MSWU per year. Much of the growth will come from Asia where nuclear generating capacity is still increasing. The current situation of the primary enrichment companies is summarized. The primary Western suppliers, Cogema, United States Enrichment Corporation and Urenco, are competing for increased market share in the USA, Europe and Asia as utilities purchase their post-1995 requirements. Entry of the Russian enrichment company, Tenex, into Western markets has been limited by trade restrictions. As a consequence of disarmament, blended weapons material has resulted in a surplus of low-enriched uranium. Together with over-capacity amongst the primary enrichers this has led to an expectation that reduced prices will be negotiable in the medium term. (3 figures). (UK)
Noble gas enrichment studies at JET
International Nuclear Information System (INIS)
Groth, M.; Andrew, P.; Fundamenski, W.; Guo, H.Y.; Hillis, D.L.; Hogan, J.T.; Horton, L.D.; Matthews, G.F.; Meigs, A.G.; Morgan, P.M.; Stamp, M.F.; Hellermann, M. von
2001-01-01
Adequate helium exhaust has been achieved in reactor-relevant ELMy H-mode plasmas in JET performed in the MKII AP and MKII GB divertor geometry. The divertor-characteristic quantities of noble gas compression and enrichment have been experimentally inferred from Charge Exchange Recombination Spectroscopy measurements in the core plasma, and from spectroscopic analysis of a Penning gauge discharge in the exhaust gas. The retention of helium was found to be satisfactory for a next-step device, with enrichment factors exceeding 0.1. The helium enrichment decreases with increasing core plasma density, while the neon enrichment has the opposite behaviour. Analytic and numerical analyses of these plasmas using the divertor impurity code package DIVIMP/NIMBUS support the explanation that the enrichment of noble gases depends significantly on the penetration depth of the impurity neutrals with respect to the fuel atoms. Changes of the divertor plasma configuration and divertor geometry have no effect on the enrichment
Stable isotope enrichment - current and future potential
International Nuclear Information System (INIS)
Tracy, J.G.; Aaron, W.S.
1993-01-01
Oak Ridge National Laboratory (ORNL) operates the Isotope Enrichment Facility for the purpose of providing enriched stable isotopes, selected radioactive isotopes (including the actinides), and isotope-related materials and services for use in various research applications. ORNL is responsible for isotope enrichment and the distribution of approximately 225 nongaseous stable isotopes from 50 multi-isotopic elements. Many enriched isotope products are of prime importance in the fabrication of nuclear targets and the subsequent production of special radionuclides. State-of-the-art techniques to achieve special isotopic, chemical, and physical requirements are performed at ORNL. This report describes the status and capabilities of the Isotope Enrichment Facility and the Isotope Research Materials Laboratory as well as emphasizing potential advancements in enrichment capabilities. (orig.)
International Nuclear Information System (INIS)
1977-09-01
The objective of this paper is to examine critically the diversion potential at uranium enrichment facilities and to outline a basic safeguards strategy which counters all identified hazards as completely as possible yet with a minimum of non-essential redundancy. Where existing technology does not appear to be adequate for effective safeguards, the limitations are examined, and suggestions for further R and D effort are made. Parts of this report are generally applicable to all currently known enrichment processes, while other parts are specifically directed toward facilities based on the gas centrifuge process. It is hoped that additional sections discussing a safeguards strategy for gas diffusion facilities can be added later. It should be emphasized that this is a technical report, and does not reflect any legal positions. The safeguards strategy and subsequent inspection procedures are intended as guidelines, not as negotiating positions
Turkey's regulatory plans for high enriched to low enriched conversion of TR-2 reactor core
International Nuclear Information System (INIS)
Guelol Oezdere, Oya
2003-01-01
Turkey is a developing country and has three nuclear facilities two of which are research reactors and one pilot fuel production plant. One of the two research reactors is TR-2 which is located in Cekmece site in Istanbul. TR-2 Reactor's core is composed of both high enriched and low enriched fuel and from high enriched to low enriched core conversion project will take place in year 2005. This paper presents the plans for drafting regulations on the safety analysis report updates for high enriched to low enriched core conversion of TR-2 reactor, the present regulatory structure of Turkey and licensing activities of nuclear facilities. (author)
EURODIF: the uranium enrichment by gaseous diffusion
International Nuclear Information System (INIS)
Rougeau, J.P.
1981-01-01
During the seventies the nuclear power programme had an extremely rapid growth rate which entailed to increase the world uranium enrichment capacity. EURODIF is the largest undertaking in this field. This multinational joint venture built and now operates and enrichment plant using the gaseous diffusion process at Tricastin (France). This plant is delivering low enriched uranium since two years and has contracted about 110 million SWU's till 1990. Description, current activity and prospects are given in the paper. (Author) [pt
The future cost of uranium enrichment
International Nuclear Information System (INIS)
Pouris, A.
1986-01-01
The cost of uranium enrichment is the most important factor determining the fuel cost of nuclear energy. This paper attempts to forecast the future direction of the price of separative work by examining the forces that determine it. It is argued that the interplay among the characteristics of enrichment technologies, the structure of the international market, and the balance of supply and demand determine the enrichment price. The analysis indicates that all forces point towards a price much lower than the current one. It is predicted that, depending on the technological advances, the price of separative work unit for uranium enrichment will range between $40 and $90 by the year 2000. (author)
Real-Time PCR Quantification of Chloroplast DNA Supports DNA Barcoding of Plant Species.
Kikkawa, Hitomi S; Tsuge, Kouichiro; Sugita, Ritsuko
2016-03-01
Species identification from extracted DNA is sometimes needed for botanical samples. DNA quantification is required for an accurate and effective examination. If a quantitative assay provides unreliable estimates, a higher quantity of DNA than the estimated amount may be used in additional analyses to avoid failure to analyze samples from which extracting DNA is difficult. Compared with conventional methods, real-time quantitative PCR (qPCR) requires a low amount of DNA and enables quantification of dilute DNA solutions accurately. The aim of this study was to develop a qPCR assay for quantification of chloroplast DNA from taxonomically diverse plant species. An absolute quantification method was developed using primers targeting the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene using SYBR Green I-based qPCR. The calibration curve was generated using the PCR amplicon as the template. DNA extracts from representatives of 13 plant families common in Japan. This demonstrates that qPCR analysis is an effective method for quantification of DNA from plant samples. The results of qPCR assist in the decision-making will determine the success or failure of DNA analysis, indicating the possibility of optimization of the procedure for downstream reactions.
High-throughput STR analysis for DNA database using direct PCR.
Sim, Jeong Eun; Park, Su Jeong; Lee, Han Chul; Kim, Se-Yong; Kim, Jong Yeol; Lee, Seung Hwan
2013-07-01
Since the Korean criminal DNA database was launched in 2010, we have focused on establishing an automated DNA database profiling system that analyzes short tandem repeat loci in a high-throughput and cost-effective manner. We established a DNA database profiling system without DNA purification using a direct PCR buffer system. The quality of direct PCR procedures was compared with that of conventional PCR system under their respective optimized conditions. The results revealed not only perfect concordance but also an excellent PCR success rate, good electropherogram quality, and an optimal intra/inter-loci peak height ratio. In particular, the proportion of DNA extraction required due to direct PCR failure could be minimized to <3%. In conclusion, the newly developed direct PCR system can be adopted for automated DNA database profiling systems to replace or supplement conventional PCR system in a time- and cost-saving manner. © 2013 American Academy of Forensic Sciences Published 2013. This article is a U.S. Government work and is in the public domain in the U.S.A.
PCR methodology as a valuable tool for identification of endodontic pathogens.
Siqueira, José F; Rôças, Isabela N
2003-07-01
This paper reviews the principles of polymerase chain reaction (PCR) methodology, its application in identification of endodontic pathogens and the perspectives regarding the knowledge to be reached with the use of this highly sensitive, specific and accurate methodology as a microbial identification test. Studies published in the medical, dental and biological literature. Evaluation of published epidemiological studies examining the endodontic microbiota through PCR methodology. PCR technology has enabled the detection of bacterial species that are difficult or even impossible to culture as well as cultivable bacterial strains showing a phenotypically divergent or convergent behaviour. Moreover, PCR is more rapid, much more sensitive, and more accurate when compared with culture. Its use in endodontics to investigate the microbiota associated with infected root canals has expanded the knowledge on the bacteria involved in the pathogenesis of periradicular diseases. For instance, Tannerella forsythensis (formerly Bacteroides forsythus), Treponema denticola, other Treponema species, Dialister pneumosintes, and Prevotella tannerae were detected in infected root canals for the first time and in high prevalence when using PCR analysis. The diversity of endodontic microbiota has been demonstrated by studies using PCR amplification, cloning and sequencing of the PCR products. Moreover, other fastidious bacterial species, such as Porphyromonas endodontalis, Porphyromonas gingivalis and some Eubacterium spp., have been reported in endodontic infections at a higher prevalence than those reported by culture procedures.
Dezsi, Gabi; Ozturk, Ezgi; Salzberg, Michael R; Morris, Margaret; O'Brien, Terence J; Jones, Nigel C
2016-09-01
The absence epilepsies are presumed to be caused by genetic factors, but the influence of environmental exposures on epilepsy development and severity, and whether this influence is transmitted to subsequent generations, is not well known. We assessed the effects of environmental enrichment on epilepsy and anxiety outcomes in multiple generations of GAERS - a genetic rat model of absence epilepsy that manifests comorbid elevated anxiety-like behaviour. GAERS were exposed to environmental enrichment or standard housing beginning either prior to, or after epilepsy onset, and underwent EEG recordings and anxiety testing. Then, we exposed male GAERS to early enrichment or standard housing and generated F1 progeny, which also underwent EEG recordings. Hippocampal CRH mRNA expression and DNA methylation were assessed using RT-PCR and pyrosequencing, respectively. Early environmental enrichment delayed the onset of epilepsy in GAERS, and resulted in fewer seizures in adulthood, compared with standard housed GAERS. Enrichment also reduced the frequency of seizures when initiated in adulthood. Anxiety levels were reduced by enrichment, and these anti-epileptogenic and anxiolytic effects were heritable into the next generation. We also found reduced expression of CRH mRNA in GAERS exposed to enrichment, but this was not due to changes in DNA methylation. Environmental enrichment produces disease-modifying effects on genetically determined absence epilepsy and anxiety, and these beneficial effects are transferable to the subsequent generation. Reduced CRH expression was associated with these phenotypic improvements. Environmental stimulation holds promise as a naturalistic therapy for genetically determined epilepsy which may benefit subsequent generations. Copyright © 2016 Elsevier Inc. All rights reserved.
Calibrated user-friendly reverse transcriptase-PCR assay
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Rammer, P
1998-01-01
We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...
International Nuclear Information System (INIS)
Anon.
1989-01-01
It is frequently in the patient's best interest that radiation treatments are initiated soon after the decision to treat is made. However, it is essential to good radiation therapy that the patient's treatment course be planned and beam-modifying devices be fabricated with utmost care prior to treatment. The objectives of the treatment, along with the treatment parameters and techniques necessary to achieve these objectives, must be discussed prior to initiating planning procedures. Determination of the target volume is made by the radiation oncologist; this is based on knowledge of the history of the tumor, the patterns of spread of the disease, and on diagnostic findings during the work-up of each patient. It is then necessary to obtain several measurements of the patient and also to identify the position of the target volume and of adjacent normal organs with respect to known external skin marks before the actual treatment planning is begun. Such localization can be done through several methods. The two most commonly used methods are radiographic and computed tomography (CT), both of which are discussed in this chapter. The measurements often include contours of the patient's external surface, usually in the axial plane of the central axis of the beam, and often in multiple levels within the region to be treated. Three dimensional localization and treatment planning requires thorough understanding of geometry as well as of patient positioning and immobilization. This chapter attempts to clarify some of these complicated but essential preparations for treatment
Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S
2012-08-01
Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.
Diagnosis of trichomonas vaginalis infection by PCR
International Nuclear Information System (INIS)
Issa, R.M.; Shalaby, M.A.
2007-01-01
To compare the sensitivity of PCR, wet preparation and culture in detecting Trichomonas vaginalis in urine and vaginal fluid. A PCR targeting the beta-tubulin genes of T. vaginalis was used for the detection of the organism in both vaginal swab and urine specimens from infected patients. Random urine samples were collected from 30 patients (23 females and 7 males), and tested for T. vaginalis by wet preparation and the Inpouch T. vaginalis culture systeme. Two vaginal swabs were collected by each woman. PCR detection. was carried out on samples negative by first methods. The positive result was found in 28.57% in male urine and 39.13% in female urine samples, 65.21% in 1st swab and 78.26 % in 2nd swab by wet preparation. By culture, the male urine samples showed 42.85% positive, female urine 69.56% while 1st swab showed 86.95% positive and 2nd swab 91.30% positive. All negative cases by culture in urine and vaginal samples were tested by PCR, which showed 2 cases to be positive in male urine samples and 5 cases positive in female urine sample. PCR assay was as good as or more sensitive than wet preparation and culture and resulted in practical advantage of providing results in shorter time. However, PCR test is still very expensive. (author)
Stable isotopes. Enriched wheat: a new chance for nutrition research
International Nuclear Information System (INIS)
Chagvardieff, P.
1996-01-01
The Department of Plant Eco-physiology (DEV) from the CEA/Life Sciences Department of Cadarache (France) has artificially produced two kg of carbon 13 labelled wheat for nutrition research. It is the first successful stable isotope labelling of complex nutriments with a 10% enrichment in carbon 13. This wheat has been used for the manufacturing of pastas to follow the assimilation of nutrients by the organism. This short paper gives some details about the experimental procedure of labelled wheat cultivation. (J.S.)
Spectrographic determination of impurities in enriched uranium solutions
International Nuclear Information System (INIS)
Capdevila, C.; Roca, M.
1980-01-01
A spectrographic procedure for the determination of trace amounts of Al, B, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Fe, K, L i , Hg, Mn, Mo, Na, Nb, Ni, P, Pb, Ru, Sb, Sn, Sr, Ti, V, Zn, and Zr in enriched uranyl nitrate solutions from the reprocessing of spent nuclear fuels is described. After removal of uranium by either TBP or TNOA solvent extraction, the aqueous phase Is analysed by the graphite spark technique. TBP is adequate for all impurities, excepting boron and phosphorus; both of these elements can sat is factory be determined by using TNOA after the addition of mannitol to avoid boron losses. (Author) 4 refs
Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann
2014-10-01
Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.
2011-01-04
... and Licensing Board; AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility) December 17, 2010... construction and operation of a gas centrifuge uranium enrichment facility--denoted as the Eagle Rock... site at http://www.nrc.gov/materials/fuel-cycle-fac/arevanc.html . These and other documents relating...
Study on the radiotoxicology of enriched uranium
International Nuclear Information System (INIS)
Zhu Shoupeng; Zheng Siying; Wang Guolin; Wang Chongdao; Cao Genfa
1987-12-01
A study on the retentive peculiarity of soluble enriched uranium UO 2 F 2 were observed after iv once or consecutive ip qd x 3d to Wistar male rats. The dynamic retention of radioactivity in the body showed that the enriched uranium UO 2 F 2 was chiefly localized in kidney, and then in skeleton and liver. The radioactivity of the enriched uranium UO 2 F 2 in skeleton rose steadily while the concentratoin in kidney and liver droped. When enriched uranium UO 2 F 2 was accumulated in organism, it caused chromosome aberrations on bone marrow cells. Results indicated that the chromosome aberration rates were elevated when the dose of the enriched uranium UO 2 F 2 was increased, at the same time, the cell division was depressed. Accumulation of insoluble enriched uranium U 3 O 8 in gastrointestinal tract was well described by a two exponential expression. Values of retention estimate for fast component, T 1 = 0.34 d, and for relatively long term component, T 2 = 4.05 d. The deposition of UO 2 F 2 in the intact skin was only 0.16 to 0.18% of the total contaminated UO 2 F 2 . Penetration of the enriched uranium UO 2 F 2 was dominantly increased in abraded skin. This value is about 25 to 32 times as compaired with that in intact skin. Retention of the enriched uranium UO 2 F 2 through abraded skins was dominantly localized in kidney and skeleton
Uranium enrichment: a vital new industry
International Nuclear Information System (INIS)
1975-10-01
The energy problem facing the nation and the need for nuclear power are pointed out. Uranium enrichment and the demand for it are discussed. Reasons for, and obstacles to, private enrichment are outlined. The President's plan (including the Nuclear Fuel Assurance Act) is summarized
Inoculation stress hypothesis of environmental enrichment.
Crofton, Elizabeth J; Zhang, Yafang; Green, Thomas A
2015-02-01
One hallmark of psychiatric conditions is the vast continuum of individual differences in susceptibility vs. resilience resulting from the interaction of genetic and environmental factors. The environmental enrichment paradigm is an animal model that is useful for studying a range of psychiatric conditions, including protective phenotypes in addiction and depression models. The major question is how environmental enrichment, a non-drug and non-surgical manipulation, can produce such robust individual differences in such a wide range of behaviors. This paper draws from a variety of published sources to outline a coherent hypothesis of inoculation stress as a factor producing the protective enrichment phenotypes. The basic tenet suggests that chronic mild stress from living in a complex environment and interacting non-aggressively with conspecifics can inoculate enriched rats against subsequent stressors and/or drugs of abuse. This paper reviews the enrichment phenotypes, mulls the fundamental nature of environmental enrichment vs. isolation, discusses the most appropriate control for environmental enrichment, and challenges the idea that cortisol/corticosterone equals stress. The intent of the inoculation stress hypothesis of environmental enrichment is to provide a scaffold with which to build testable hypotheses for the elucidation of the molecular mechanisms underlying these protective phenotypes and thus provide new therapeutic targets to treat psychiatric/neurological conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Perspectives for the uranium enrichment in Brazil
International Nuclear Information System (INIS)
Senna, J.G.S.M.
1991-01-01
Through an analysis of the electrical energy future in Brazil, the needs for enriched uranium are discussed, and therefore the importance of developing local capability for self-production. A description of the production processes that are well established is given first, then the analysis itself is performed and finally a visualization of the International Market for enriched uranium is shown. (author)
Uranium enrichment : global view and Brazilian perspectives
International Nuclear Information System (INIS)
Zouain, D.M.; Sakamoto, L.H.
1981-12-01
A global view of isotope enrichment involving a general description of process (technical-economical aspects and policy) and status in developing countries is done. An enrichment demand in function of the Brazilian Nuclear Program is evaluated, analyzing a probable market and a low market. The perspectives to attend this demand, are studied. (E.G.) [pt
21 CFR 137.350 - Enriched rice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Enriched rice. 137.350 Section 137.350 Food and... Related Products § 137.350 Enriched rice. (a) The foods for which definitions and standards of identity are prescribed by this section are forms of milled rice (except rice coated with talc and glucose and...
Providing incentives to buy US enrichment
International Nuclear Information System (INIS)
Steyn, J.
1985-01-01
The U.S. Department of Energy is making a series of commercial and technological decisions crucial to its future as an enriching enterprise. The state of US enrichment, as revealed in this years AIF Fuel Cycle conference, is reported. (U.K.)
Enrichment technology. Dependable vendor of gas centrifuges
International Nuclear Information System (INIS)
Anon.
2011-01-01
Enrichment Technology is an innovative, high-tech company that develops, manufactures and installs gas centrifuges for enriching uranium. In addition, Enrichment Technology designs enrichment plants that use gas centrifuge technology. This technology offers the most efficient and cost-effective method for enriching uranium yet: high-performance, safe technology that dominates the market with a global share of 45 percent. A determining factor in Enrichment Technology's success is its mission: supplying its customers with safe, reliable technology. Production of the centrifuges requires versatile know-how and collaboration between different departments as well as interdisciplinary teams at the various sites. More than 2000 operators at 8 sites in 5 countries contribute their individual knowledge and personal skills in order to produce this exceptional technology. The head office is in Beaconsfield near London and the operational headquarters are in Almelo in the Netherlands. There are other sites in Germany (Juelich und Gronau), Great Britain (Capenhurst) as well as project sites in the USA and France. Capenhurst is where experienced engineers design new enrichment plants and organise their construction. Centrifuge components are manufactured in Almelo and Juelich, while the pipework needed to connect up the centrifuges is produced at the site in Gronau. In Juelich, highly qualified scientists in interdisciplinary teams are continuously researching ways of improving the current centrifuges. Communication between specialists in the fields of chemistry, physics and engineering forms the basis for the company's success and the key to extending this leading position in the global enrichment market. (orig.)
Student science enrichment training program
Energy Technology Data Exchange (ETDEWEB)
Sandhu, S.S.
1994-08-01
This is a report on the Student Science Enrichment Training Program, with special emphasis on chemical and computer science fields. The residential summer session was held at the campus of Claflin College, Orangeburg, SC, for six weeks during 1993 summer, to run concomitantly with the college`s summer school. Fifty participants selected for this program, included high school sophomores, juniors and seniors. The students came from rural South Carolina and adjoining states which, presently, have limited science and computer science facilities. The program focused on high ability minority students, with high potential for science engineering and mathematical careers. The major objective was to increase the pool of well qualified college entering minority students who would elect to go into science, engineering and mathematical careers. The Division of Natural Sciences and Mathematics and engineering at Claflin College received major benefits from this program as it helped them to expand the Departments of Chemistry, Engineering, Mathematics and Computer Science as a result of additional enrollment. It also established an expanded pool of well qualified minority science and mathematics graduates, which were recruited by the federal agencies and private corporations, visiting Claflin College Campus. Department of Energy`s relationship with Claflin College increased the public awareness of energy related job opportunities in the public and private sectors.
Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P
2001-07-01
Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
International Nuclear Information System (INIS)
Miyasaka, Yasuhiko
1979-01-01
The fuel used for the research reactors of Japan Atomic Energy Research Institute (JAERI) is presently highly enriched uranium of 93%. However, the U.S. government (the supplier of fuel) is claiming to utilize low or medium enriched uranium from the viewpoint of resistivity to nuclear proliferation, and the availability of highly enriched uranium is becoming hard owing to the required procedure. This report is described on the results of nuclear calculation which is the basis of fuel design in the countermeasures to the reduction of enrichment. The basic conception in the reduction of enrichment is three-fold: to lower the latent potential of nuclear proliferation as far as possible, to hold the present reactor performance as far as possible, and to limit the reduction in the range which is not accompanied by the modification of reactor core construction and cooling system. This time, the increase of the density and thickness of fuel plates and the effect of enrichment change to 45% on reactivity and neutron flux were investigated. The fuel of UAl sub(x) - Al system was assumed, which was produced by powder metallurgical method. The results of investigations on JRR-2 and JMTR reactors revealed that 45% enriched fuel does not affect the performances much. However, deterioration of the performances is not neglegible if further reduction is needed. In future, the influence of the burn-up effect of fuel on the life of reactor cores must be investigated. (Wakatsuki, Y.)
Determination of enrichment of recycle uranium fuels for different burnup values
International Nuclear Information System (INIS)
Zabunoglu, Okan H.
2008-01-01
Uranium (U) recovered from spent LWR fuels by reprocessing, which contains small amounts of U-236, is to be enriched before being re-irradiated as the recycle U. During the enrichment of recovered U in U-235, the mass fraction of U-236 also increases. Since the existence of U-236 in the recycle U has a negative effect on neutron economy, a greater enrichment of U-235 in the recycle U is required for reaching the same burnup as can be reached by the fresh U fuel. Two burnup values play the most important role in determining the enrichment of recycle U: (1) discharge burnup of spent fuel from which the recycle U is obtained and (2) desired discharge burnup of the recycle U fuel. A step-by-step procedure for calculating the enrichment of the recycle U as a function of these two burnup values is introduced. The computer codes MONTEBURNS and ORIGEN-S are made use of and a three-component (U-235, U-236, U-238) enrichment scheme is applied for calculating the amount of U-236 in producing the recycle U from the recovered U. As was aimed, the resulting expression is simple enough for quick/hand calculations of the enrichment of the recycle U for any given discharge burnup of spent fuel and for any desired discharge burnup of the recycle U fuel, most accurately within the range of 33,000-50,000 MWd/tonU
Uranium enrichment capacity: public versus private ownership
International Nuclear Information System (INIS)
Fraser, J.T.
1977-01-01
Continual growth of conventional nuclear capacity requires an assured supply of enriched uranium and, hence, potential expansion of domestic uranium enrichment capacity. The question of ownership of new enrichment capacity, i.e., public or private, entails not only the social-opportunity costs of alternative investments but also technical parameters of uranium utilization and advanced reactor development. Inclusion of risk preferences in both the public and private sectors produces interesting results in terms of optimal investment strategies with respect to choice of technology and scale of investment. Utilization of a nuclear fuel cycle requirements process model allows explicit specification of production technology. Integration of process model output with a least-cost investment model permits flexibility in parametric analysis. Results indicate minimum incentive for Government subsidy of a private enrichment sector through 2000 given moderate to low nuclear growth assumptions. The long-run scenario, to 2020, exhibits potentially greater incentives for private enrichment investment
Enriching an effect calculus with linear types
DEFF Research Database (Denmark)
Egger, Jeff; Møgelberg, Rasmus Ejlers; Simpson, Alex
2009-01-01
We define an ``enriched effect calculus'' by conservatively extending a type theory for computational effects with primitives from linear logic. By doing so, we obtain a generalisation of linear type theory, intended as a formalism for expressing linear aspects of effects. As a worked example, we...... formulate linearly-used continuations in the enriched effect calculus. These are captured by a fundamental translation of the enriched effect calculus into itself, which extends existing call-by-value and call-by-name linearly-used CPS translations. We show that our translation is involutive. Full...... completeness results for the various linearly-used CPS translations follow. Our main results, the conservativity of enriching the effect calculus with linear primitives, and the involution property of the fundamental translation, are proved using a category-theoretic semantics for the enriched effect calculus...
Review of environmental enrichment for broiler chickens
DEFF Research Database (Denmark)
Riber, Anja Brinch; Van de Weerd, H.A.; de Jong, I.C.
2018-01-01
to improvements of the biological function. This definition has been broadened to include practical and economic aspects, as any enrichment strategy that adversely affects the health of animals or that has too many economic or practical constraints will never be implemented on commercial farms and thus never...... benefit animals. Environmental enrichment for broilers often has the purpose of satisfying behavioral needs and/or stimulating the broilers to an increased level of activity, which among others will reduce the occurrence of leg problems. Potentially successful environmental enrichments for broiler...... chickens are elevated resting-places, panels, barriers, and bales of straw (“point-source enrichment”), as well as covered verandas and outdoor ranges (“complex enriched environments”). Many of the ideas for environmental enrichment for broilers need to be further developed and studied, preferably...
Current perspective of the uranium enrichment market
International Nuclear Information System (INIS)
Laughon, K.O.
1986-01-01
Over the past several years, developments in the uranium enrichment market have required the Department of Energy (DOE) to make a number of changes in the U.S. enrichment enterprise. These changes have been made to allow DOE to conduct our enrichment business so as to be more responsive to changing market forces. Needless to say, some of these changes have been difficult, but they have been necessary if they are to conduct a healthy and competitive uranium enrichment business in the United States. This paper discusses several topics, including: The Uranium Enrichment Market, Utility Services (US) Contracts, Reduced Prices, Incentive Pricing, Better Customer Services, and Advanced Technology. In addition to these topics, information is provided on the recent court action regarding the US Contracts and the viability finding on the uranium mining industry
Silver surface enrichment controlled by simultaneous RBS for reliable PIXE analysis of ancient coins
International Nuclear Information System (INIS)
Beck, L.; Alloin, E.; Berthier, C.; Reveillon, S.; Costa, V.
2008-01-01
Evidence of silver surface enrichment of ancient silver-copper coins has been pointed out in the past years. Surface enrichment can be fortuitous or intentional. In this paper, we have investigated the cleaning procedures usually performed after excavation or in museums. We have shown that chemicals or commercial products routinely used dissolve preferentially the copper phase and consequently contribute to the silver surface enrichment. As a result, surface analyses such as PIXE or XRF can be strongly affected by this effect. By using simultaneously RBS and PIXE, it is possible to check through the silver surface enrichment and then select the reliable measurements, characteristic of the bulk composition. Results on coins recently discovered and mechanically or chemically cleaned are presented
Laser-induced photochemical enrichment of boron isotopes
International Nuclear Information System (INIS)
Freund, S.M.; Ritter, J.J.
1976-01-01
A boron trichloride starting material containing both boron-10 isotopes and boron-11 isotopes is selectively enriched in one or the other of these isotopes by a laser-induced photochemical method involving the reaction of laser-excited boron trichloride with either H 2 S or D 2 S. The method is carried out by subjecting a low pressure gaseous mixture of boron trichloride starting material and the sulfide to infrared radiation from a carbon dioxide TE laser. The wave length of the radiation is selected so as to selectively excite one or the other of boron-10 BCl 3 molecules or boron-11 BCl 3 molecules, thereby making them preferentially more reactive with the sulfide. The laser-induced reaction produces both a boron-containing solid phase reaction product and a gaseous phase containing mostly unreacted BCl 3 and small amounts of sulfhydroboranes. Pure boron trichloride selectively enriched in one of the isotopes is recovered as the primary product of the method from the gaseous phase by a multi-step recovery procedure. Pure boron trichloride enriched in the other isotope is recovered as a secondary product of the method by the subsequent chlorination of the solid phase reaction product followed by separation of BCl 3 from the mixture of gaseous products resulting from the chlorination
The low-enrichment fuel development program
International Nuclear Information System (INIS)
Stahl, D.
1993-01-01
In the 1950s and 1960s, low-power research reactors were built around the world utilized MTR-type fuel elements containing 20% enriched uranium. However, the demand for higher specific power created a need for greater uranium-235 concentrations. Early difficulties in increasing uranium content led to the substitution of highly enriched uranium in place of the 20% enriched fuel previously utilized. The highly enriched material also yielded other benefits including longer core residence time, higher specific reactivity, and somewhat lower cost. Highly enriched material then became readily available and was used for high-power reactors as well as in low-power reactors where 20% enriched material would have sufficed. The trend toward higher and higher specific power also led to the development of the dispersion-type fuels which utilized highly enriched uranium at a concentration of about 40 wt%. In the 1970's, however, concerns were raised about the proliferation resistance of fuels and fuel cycles. As a consequence, the U.S. Department of State has recently prohibited the foreign shipment of highly enriched material, except where prior contractual obligation or special merit exists. This will impact on the availability and utilization of highly enriched uranium for research and test reactor fuel. It has also stimulated development programs on fuels with higher uranium content which would allow the use of uranium of lower enrichment. The purpose of this report is to briefly describe the overall fuel-development program which is coordinated by Argonne National Laboratory for the Department of Energy, and to indicate the current and potential uranium loadings. Other reports will address the individual fuel-development activities in greater detail
Van Damme, Inge; Habib, Ihab; De Zutter, Lieven
2010-02-01
Tonsil samples from 139 slaughter pigs were examined for the presence of pathogenic Yersinia enterocolitica by enrichment procedures based on the standard method ISO 10273:2003. In addition, samples were tested by direct plating method to evaluate its efficiency compared to the enrichment culture methods and to quantify the level of contamination in porcine tonsils. In total, 52 samples (37.4%) were positive for pathogenic Y. enterocolitica, all belonging to bioserotype 4/O:3. Fifty out of the 52 positive samples (96.2%) were detected by direct plating. Enumeration showed an average concentration of 4.5 log(10) CFU g(-1) and 4.4 log(10) CFU g(-1) tonsil on Salmonella-Shigella-desoxycholate-calcium chloride (SSDC) and cefsulodin-irgasan-novobiocin (CIN) agar plates, respectively. The enrichment procedures recommended by the ISO 10273:2003 method were not optimal for the isolation of pathogenic Y. enterocolitica from pig tonsils: two days enrichment in irgasan-ticarcillin-potassium chlorate (ITC) broth resulted in an isolation rate of 84.6%, while 5 days enrichment in peptone-sorbitol-bile (PSB) broth recovered only 59.6% of positive samples. Reducing the enrichment time in PSB from 5 to 2 days resulted in a significantly higher recovery rate (94.2%) and might serve as an appropriate enrichment protocol for the isolation of pathogenic Y. enterocolitica from pig tonsils. Compared to enrichment culture methods, results based on direct plating can be obtained in a shorter time course and provide quantitative data that might be needed for further risk assessment studies.
Emad, Ahmed; Drouin, Régen
2014-09-01
Physical separation by density gradient centrifugation (DGC) is usually used as an initial step of multistep enrichment protocols for purification of fetal cells (FCs) from maternal blood. Many protocols were designed but no single approach was efficient enough to provide noninvasive prenatal diagnosis. Procedures and methods were difficult to compare because of the nonuniformity of protocols among different groups. Recovery of FCs is jeopardized by their loss during the process of enrichment. Any loss of FCs must be minimized because of the multiplicative effect of each step of the enrichment process. The main objective of this study was to evaluate FC loss caused by DGC. Fetal cells were quantified in peripheral blood samples obtained from both euploid and aneuploid pregnancies before and after enrichment by buoyant DGC using Histopaque 1.119 g/mL. Density gradient centrifugation results in major loss of 60% to 80% of rare FCs, which may further complicate subsequent enrichment procedures. Eliminating aggressive manipulations can significantly minimize FC loss. Data obtained raise questions about the appropriateness of the DGC step for the enrichment of rare FCs and argues for the use of the alternative nonaggressive version of the procedure presented here or prioritizing other methods of enrichments. © 2014 John Wiley & Sons, Ltd.
PCR+ In Diesel Fuels and Emissions Research
Energy Technology Data Exchange (ETDEWEB)
McAdams, H.T.
2002-04-15
In past work for the U.S. Department of Energy (DOE) and Oak Ridge National Laboratory (ORNL), PCR+ was developed as an alternative methodology for building statistical models. PCR+ is an extension of Principal Components Regression (PCR), in which the eigenvectors resulting from Principal Components Analysis (PCA) are used as predictor variables in regression analysis. The work was motivated by the observation that most heavy-duty diesel (HDD) engine research was conducted with test fuels that had been ''concocted'' in the laboratory to vary selected fuel properties in isolation from each other. This approach departs markedly from the real world, where the reformulation of diesel fuels for almost any purpose leads to changes in a number of interrelated properties. In this work, we present new information regarding the problems encountered in the conventional approach to model-building and how the PCR+ method can be used to improve research on the relationship between fuel characteristics and engine emissions. We also discuss how PCR+ can be applied to a variety of other research problems related to diesel fuels.
Comments on applications of reduced enrichment fuels
International Nuclear Information System (INIS)
Winkler, M.H.
1983-01-01
Full text: I will briefly describe the experience gained using different fuels in the SAPHIR reactor in Switzerland. The SAPHIR has been operating since 1957 and was the first swimming pool reactor built outside of the United States, which was originally known as the Geneva Conference Reactor. The first core was loaded with 20 percent enriched high density UO 2 fuel with a density of about 2.5 grams per cc, fabricated in 1955 by Oak Ridge National Laboratory. After a few years of operation at a power level of one MW, more than one batch of the elements released small amounts of fission products mainly Xe and Kr. When these releases were discovered, high enriched fuel was becoming available so that the fuel fabricators began to produce the lower density high enriched fuels. During this transition from fabrication of low to high enriched fuels no one could foresee that the stone age of nuclear fuel fabrication would come back again. Therefore, we did not investigate the reasons for the fission product release from the high density low enriched UO 2 fuel. The second fuel type used in the SAPHIR was the 90 percent enriched low density U 3 O 8 fuel fabricated by NUKEM. This high enriched fuel has performed satisfactorily over the years. Since 1968, the core has been using improved 23 plate fuel elements with a loading of 280 grams of uranium. The reactor power has been recently increased to five MW. An additional increase in the power level to 10 MW is planned at the end of next year so that heavier loaded elements will be needed. In order to follow the recommendations of the INFCE working group 8C and in cooperation with the reduced enrichment program, we intend to initially reduce the fuel enrichment to 45 percent. Last year we ordered five fuel elements with a loading of 320 grams 235 U/element and 45 percent enrichment for full power tests. Unfortunately, the delivery of the necessary enriched fuel uranium has been delayed and it is not available at this time. If
Licensing procedures and safety criteria for core conversion in Japan
International Nuclear Information System (INIS)
Kanda, K.; Nakagome, Y.; Hayashi, M.
1983-01-01
Procedures relating to the construction and operation of reactor facilities are discussed. Specifically, the Safety Analysis Report on the Kyoto University Critical Assembly (KUCA) core conversion (93% to 45% enrichment) is noted. The results of critical experiments in the KUCA and of burnup tests in the Oak Ridge Research (ORR) Reactor will be used in the final determination of the feasibility of the conversion of the Kyoto University High Flux Reactor (KUHFR) to the use of 45% enrichment
Prevalence of Bartonella spp. by culture, PCR and serology, in veterinary personnel from Spain
Directory of Open Access Journals (Sweden)
José A. Oteo
2017-11-01
Full Text Available Abstract Background The genus Bartonella includes fastidious, facultative intracellular bacteria mainly transmitted by arthropods and distributed among mammalian reservoirs. Bartonella spp. implicated as etiological agents of zoonoses are increasing. Apart from the classical Bartonella henselae, B. bacilliformis or B. quintana, other species (B. elizabethae, B. rochalimae, B. vinsonii arupensis and B. v. berkhoffii, B. tamiae or B. koehlerae, among others have also been associated with human and/or animal diseases. Laboratory techniques for diagnosis (culture, PCR assays and serology usually show lack of sensitivity. Since 2005, a method based on a liquid enrichment Bartonella alphaproteobacteria growth medium (BAPGM followed by PCRs for the amplification of Bartonella spp. has been developed. We aimed to assess culture, molecular and serological prevalence of Bartonella infections in companion animal veterinary personnel from Spain. Methods Each of 89 participants completed a questionnaire. Immunofluorescence assays (IFA using B. vinsonii berkhoffii (genotypes I, II and III, B. henselae, B. quintana and B. koehlerae as antigens were performed. A cut-off of 1:64 was selected as a seroreactivity titer. Blood samples were inoculated into BAPGM and subcultured onto blood agar plates. Bartonella spp. was detected using conventional and quantitative real-time PCR assays and DNA sequencing. Results Among antigens corresponding to six Bartonella spp. or genotypes, the lowest seroreactivity was found against B. quintana (11.2% and the highest, against B. v. berkhoffii genotype III (56%. A total of 27% of 89 individuals were not seroreactive to any test antigen. Bartonella spp. IFA seroreactivity was not associated with any clinical sign or symptom. DNA from Bartonella spp., including B. henselae (n = 2, B. v. berkhoffii genotypes I (n = 1 and III (n = 2, and B. quintana (n = 2 was detected in 7/89 veterinary personnel. PCR and DNA sequencing
Powell, Daniel J; Brennan, Andrea L; Zheng, Zhaohui; Huynh, Hong; Cotte, Julio; Levine, Bruce L
2009-01-01
Clinical-scale lymphocyte enrichment from a leukapheresis product has been performed most routinely using costly magnetic bead separation systems that deplete monocytes, but this procedure may leave behind residual beads or antibodies in the enriched cell product. Counterflow centrifugal elutriation has been demonstrated previously to enrich monocytes efficiently for generation of dendritic cells. This study describes a modified elutriation procedure for efficient bead-free economical enrichment of lymphocytes from leukapheresis products from healthy donors and study subjects with human immunodeficiency virus (HIV) infection or malignancy. Modified program settings and conditions for the CaridianBCT Elutra device were investigated to optimize lymphocyte enrichment and recovery. Lymphocyte enrichment was measured using a novel approach utilizing cell sizing analysis on a Beckman Coulter Multisizer and confirmed by flow cytometry phenotypic analysis. Efficient enrichment and recovery of lymphocytes from leukapheresis cell products was achieved using modified elutriation settings for flow rate and fraction volume. Elutriation allowed for enrichment of larger numbers of lymphocytes compared with depletion of monocytes by bead adherence, with a trend toward increased lymphocyte purity and yield via elutriation, resulting in a substantial reduction in the cost of enrichment per cell. Importantly, significant lymphocyte enrichment could be accomplished using leukapheresis samples from healthy donors (n=12) or from study subjects with HIV infection (n=15) or malignancy (n=12). Clinical-scale closed-system elutriation can be performed efficiently for the selective enrichment of lymphocytes for immunotherapy protocols. This represents an improvement in cost, yield and purity over current methods that require the addition of monocyte-depleting beads.
Han, R.; Zhang, L.; Fu, B.; Liu, H.
2014-12-01
Synthetic gases are usually generated from either cellulosic agricultural waste combustion or industrial release and could be subsequently transformed into acetate, ethanol, and/or butyrate by homoacetogenic bacteria, which commonly possess reductive acetyl-CoA synthesis pathway. Homoacetogen-based syngas fermentation technology provides an alternative solution to link greenhouse gas emission control and cellulosic solid waste treatment with biofuels production. The objective of our current project is to hunt for homoacetogens with capabilities of highly efficiently converting syngases to chemical solvents. In this study, we evaluated homoacetogens population dynamics during enrichments and pinpointed dominant homoacetogens representing diverse ecosystems enriched by different substrates. We enriched homoacetogens from four different samples including waste activate sludge, freshwater sediment, anaerobic methanogenic sludge, and cow manure using H2/CO2 (4:1) or formate as substrate for homoacetogen enrichment. Along with the formyltetrahydrofolate synthetase (FTHFS) gene (fhs gene)-specific real time qPCR assay and Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis, 16S rRNA based 454 high-throughput pyrosequencing was applied to reveal the population dynamic and community structure during enrichment from different origins. Enrichment of homoacetogenic populations coincided with accumulations of short chain fatty acids such as acetate and butyrate. 454 high-throughput pyrosequencing revealed Firmicutes and Spirochaetes populations became dominant while the overall microbial diversity decreased after enrichment. The most abundant sequences among the four origins belonged to the following phyla: Firmicutes, Spirochaetes, Proteobacteria, and Bacteroidetes, accounting for 62.1%-99.1% of the total reads. The major putative homoacetogenic species enriched on H2/CO2 or formate belonged to Clostridium spp., Acetobacterium spp., Acetoanaerobium spp
Determination of D2O - 2% enriched uranium lattice parameters by means of a critical system
International Nuclear Information System (INIS)
Raisic, N.; Takac, S.; Markovic, H.; Bosevski, T.
1963-01-01
In order to specify experimental procedures for few standard measurements sufficient to provide consistent set of lattice parameters, a series of experiments were performed at the RB reactor using 2% enriched tubular fuel elements. Obtained results were compared to standard two-group diffusion calculation indicating high degree of accuracy for a broad variety of reactor lattice configurations
Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.
1988-01-01
In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure
From the 'PCR' function to the 'PCR' profession; de la fonction 'PCR' au metier 'PCR'
Energy Technology Data Exchange (ETDEWEB)
Perrin, L. [CERAP, 91 - Gif sur Yvette (France)
2008-07-01
After having recalled the legal context concerning the appointment and training of a radiation protection expert (PCR for 'personne competente en radioprotection'), the author outlines that the PCR's role has notably evolved: his function is now of primary importance in the company and his activity does not correspond to the legal framework any longer. Moreover, with the application of a European directive, some small establishments possessing ionizing radiation sources are disadvantaged, and the PCR is now facing an increasing number of missions and tasks. The author gives a list of them and assesses a needed time of 146 days per year: this means PCRs cannot have an other activity within their company
Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production
Directory of Open Access Journals (Sweden)
Junji Tominaga4
2012-04-01
Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.
DOE enrichment plants-safeguards means business
International Nuclear Information System (INIS)
Donnelly, R.
1987-01-01
The Portsmouth Gaseous Diffusion Plant, owned by the US Department of Energy (DOE) and operated by Martin Marietta Energy Systems, Inc., is a full service enrichment plant. Its long enriching cascade can process uranium hexafluoride (UF 6 ) feeds at almost any 235 U level and can produce UF 6 over the complete spectrum from depleted to very highly enriched uranium. The DOE uranium enrichment program is a government-owned enterprise operating as a business. The operating concerns of the DOE uranium enrichment plants and their safeguards programs have evolved together over the past three decades, and that evolution will likely continue. As the risk associated with possession, processing, and shipment of strategic nuclear material increased, the protection and control of it increased; as the value of the product grew with time, better ways were found to measure and conserve it. In each of these areas, safeguards objectives and the business requirements of the plant are complementary, and the progress made in one area has been reflected by progress in the other. The plant's material control and accountability program has become crucial to such business requirements as quantifying the enriched uranium (separative work units) produced in each monthly period and convincing financial auditors that the multibillion dollar enriched uranium assets located at the Portsmouth plant are properly stated
Multinational uranium enrichment in the Middle East
International Nuclear Information System (INIS)
Ahmad, Ali; Salahieh, Sidra; Snyder, Ryan
2017-01-01
The Joint Comprehensive Plan of Action (JCPOA) agreed to by Iran and the P5+1 in July 2015 placed restrictions on Iran’s nuclear program while other Middle Eastern countries– Egypt, Jordan, Saudi Arabia, Turkey, and the United Arab Emirates–are planning to build their own nuclear power plants to meet increasing electricity demands. Although the JCPOA restricts Iran's uranium enrichment program for 10–15 years, Iran's neighbors may choose to develop their own national enrichment programs giving them a potential nuclear weapons capability. This paper argues that converting Iran's national enrichment program to a more proliferation-resistant multinational arrangement could offer significant economic benefits–reduced capital and operational costs–due to economies of scale and the utilization of more efficient enrichment technologies. In addition, the paper examines policy aspects related to financing, governance, and how multinational enrichment could fit into the political and security context of the Middle East. A multinational enrichment facility managed by regional and international partners would provide more assurance that it remains peaceful and could help build confidence between Iran and its neighbors to cooperate in managing other regional security challenges. - Highlights: • Freezing Iran's nuclear program is an opportunity to launch joint initiatives in ME. • A joint uranium enrichment program in the Middle East offers economic benefits. • Other benefits include improved nuclear security and transparency in the region.
Uranium enrichment: heading for a cliff
International Nuclear Information System (INIS)
Norman, C.
1987-01-01
Thanks to drastic cost cutting in the past 2 years, US enrichment plants now have the lowest cost production in the world, but US prices are still higher than those of overseas competitors because the business is paying for past mistakes. The most serious difficulty is that the Department of Energy (DOE), which owns and operates the US enrichment enterprise, is paying more than $500 million a year to the Tennessee Valley Authority (TVA) for electricity it once thought it would need but no longer requires. Another is that billions of dollars were spent in the 1970s and early 1980s to build new capacity that is now not needed. As a result, the enrichment enterprise has accumulated a debt to the US Treasury that the General Accounting Office (GAO) estimates at $8.8 billion. This paper presents the background and current debate in Congress about the difficulties facing the enrichment industry. In the midst of this debate over the future of the enterprise, the development of the next generation of enrichment technology is being placed in jeopardy. Known as atomic vapor laser isotope separation, or AVLIS, the process was viewed as the key to the long-term competitiveness of US enrichment. As the federal deficit mounted, however, funding for the AVLIS program was cut back and the timetable was stretched out. The US enrichment program has reached the point at which Congress will be forced to make some politically difficult decisions
PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains
Directory of Open Access Journals (Sweden)
Nowak Magdalena
2009-11-01
Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.
Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...
de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena
2013-04-01
Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.
Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR
Directory of Open Access Journals (Sweden)
M Heiat
2010-07-01
Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.
Gilardoni, Liliana Rosa; Fernández, Bárbara; Morsella, Claudia; Mendez, Laura; Jar, Ana María; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor
2016-01-01
The aim of this study was to standardize a diagnosis procedure to detect Mycobacterium avium subsp. paratuberculosis (Map) DNA in raw cow milk samples under field conditions. A procedure that combines both immunomagnetic separation and IS900-PCR detection (IMS-IS1 PCR) was employed on milk samples from 265 lactating Holstein cows from Map infected and uninfected herds in Argentina. IMS-IS1 PCR results were analyzed and compared with those obtained from milk and fecal culture and serum ELISA. The extent of agreement between both tests was determined by the Kappa test. IMS-IS1 PCR showed a detection limit of 10(1) CFU of Map/mL of milk, when 50:50 mix of monoclonal and polyclonal antibodies were used to coat magnetic beads. All of the 118 samples from the Map uninfected herds were negative for the set of the tests. In Map infected herds, 80 out of 147 cows tested positive by milk IMS-IS1 PCR (55%), of which 2 (1.4%) were also positive by milk culture, 15 (10%) by fecal culture, and 20 (14%) by serum ELISA. Kappa statistics (95% CI) showed a slight agreement between the different tests (<0.20), and the proportions of agreement were ≤0.55. The IMS-IS1 PCR method detected Map in milk of the cows that were not positive in other techniques. This is the first report dealing with the application of IMS-IS1 PCR in the detection of Map in raw milk samples under field conditions in Argentina. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Microbial Community Dynamics of Lactate Enriched Hanford Groundwaters
International Nuclear Information System (INIS)
Mosher, Jennifer J.; Drake, Meghan M.; Carroll, Susan L.; Yang, Zamin K.; Schadt, Christopher W.; Brown, Stephen D.; Podar, Mircea; Hazen, Terry C.; Arkin, Adam P.; Phelps, Tommy J.; Palumbo, Anthony V.; Faybishenko, Boris A.; Elias, Dwayne A.
2010-01-01
The Department of Energy site at Hanford, WA, has been historically impacted by U and Cr from the nuclear weapons industry. In an attempt to stimulate microbial remediation of these metals, in-situ lactate enrichment experiments are ongoing. In order to bridge the gap from the laboratory to the field, we inoculated triplicate anaerobic, continuous-flow glass reactors with groundwater collected from well Hanford 100-H in order to obtain a stable, enriched community while selecting for metal-reducing bacteria. Each reactor was fed from a single carboy containing defined media with 30 mM lactate at a rate of 0.223 ml/min under continuous nitrogen flow at 9 ml/min. Cell counts, organic acids, gDNA (for qPCR and pyrosequencing) and gases were sampled during the experiment. Cell counts remained low (less than 1x107 cells/ml) during the first two weeks of the experiment, but by day 20, had reached a density greater than 1x108 cells/ml. Metabolite analysis showed a decrease in the lactate concentrations over time. Pyruvate concentrations ranged from 20-40 uM the first week of the experiment then was undetectable after day 10. Likewise, formate appeared in the reactors during the first week with concentrations of 1.48-1.65 mM at day 7 then the concentrations decreased to 0.69-0.95 on day 10 and were undetectable on day 15. Acetate was present in low amounts on day 3 (0.15-0.33 mM) and steadily increased to 3.35-5.22 mM over time. Similarly, carbon dioxide was present in low concentrations early on and increased to 0.28-0.35 mM as the experiment progressed. We also were able to detect low amounts of methane (10-20 uM) during the first week of the experiment, but by day 10 the methane was undetectable. From these results and pyrosequencing analysis, we conclude that a shift in the microbial community dynamics occurred over time to eventually form a stable and enriched microbial community. Comprehensive investigations such as these allow for the examination of not only which
Review of environmental enrichment for broiler chickens.
Riber, A B; van de Weerd, H A; de Jong, I C; Steenfeldt, S
2018-02-01
Welfare problems are commonly found in both conventional and organic production of broiler chickens. In order to reduce the extent of welfare problems, it has been suggested to provide stimulating, enriched environments. The aim of the present paper is to provide a review of the effect on behavior and welfare of the different kinds of environmental enrichments in the production of broilers that have been described in the scientific literature. Environmental enrichment is defined as an improvement of the environment of captive animals, which increases the behavioral opportunities of the animal and leads to improvements of the biological function. This definition has been broadened to include practical and economic aspects, as any enrichment strategy that adversely affects the health of animals or that has too many economic or practical constraints will never be implemented on commercial farms and thus never benefit animals. Environmental enrichment for broilers often has the purpose of satisfying behavioral needs and/or stimulating the broilers to an increased level of activity, which among others will reduce the occurrence of leg problems. Potentially successful environmental enrichments for broiler chickens are elevated resting-places, panels, barriers, and bales of straw ("point-source enrichment"), as well as covered verandas and outdoor ranges ("complex enriched environments"). Many of the ideas for environmental enrichment for broilers need to be further developed and studied, preferably in commercial trials, with respect to the use, the effect on behavior and on other welfare aspects such as leg health, and the interaction with genotype, production system, stocking density, light, and flock size. In addition, information on the practical application and the economics of the production system is often lacking, although it is important for application in practice. © 2017 Poultry Science Association Inc.
Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M
2010-03-01
Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.
Payne, Matthew S; Tabone, Tania; Kemp, Matthew W; Keelan, Jeffrey A; Spiller, O Brad; Newnham, John P
2014-02-01
Ureaplasma sp. infection in neonates and adults underlies a variety of disease pathologies. Of the two human Ureaplasma spp., Ureaplasma parvum is clinically the most common. We have developed a high-resolution melt (HRM) PCR assay for the differentiation of the four serovars of U. parvum in a single step. Currently U. parvum strains are separated into four serovars by sequencing the promoter and coding region of the multiple-banded antigen (MBA) gene. We designed primers to conserved sequences within this region for PCR amplification and HRM analysis to generate reproducible and distinct melt profiles that distinguish clonal representatives of serovars 1, 3, 6, and 14. Furthermore, our HRM PCR assay could classify DNA extracted from 74 known (MBA-sequenced) test strains with 100% accuracy. Importantly, HRM PCR was also able to identify U. parvum serovars directly from 16 clinical swabs. HRM PCR performed with DNA consisting of mixtures of combined known serovars yielded profiles that were easily distinguished from those for single-serovar controls. These profiles mirrored clinical samples that contained mixed serovars. Unfortunately, melt curve analysis software is not yet robust enough to identify the composition of mixed serovar samples, only that more than one serovar is present. HRM PCR provides a single-step, rapid, cost-effective means to differentiate the four serovars of U. parvum that did not amplify any of the known 10 serovars of Ureaplasma urealyticum tested in parallel. Choice of reaction reagents was found to be crucial to allow sufficient sensitivity to differentiate U. parvum serovars directly from clinical swabs rather than requiring cell enrichment using microbial culture techniques.
Fongaro, Gislaine; Hernández, Marta; García-González, María Cruz; Barardi, Célia Regina Monte; Rodríguez-Lázaro, David
2016-03-01
The use of propidium monoazide (PMA) coupled with real-time PCR (RT-qPCR or qPCR for RNA or DNA viruses, respectively) was assessed to discriminate infectious enteric viruses in swine raw manure, swine effluent from anaerobic biodigester (AB) and biofertilized soils. Those samples were spiked either with infectious and heat-inactivated human adenovirus-2 (HAdV-2) or mengovirus (vMC0), and PMA-qPCR/RT-qPCR allowed discriminating inactivated viruses from the infective particles, with significant reductions (>99.9%). Then, the procedure was further assayed to evaluate the presence and stability of two non-cultivable viruses (porcine adenovirus and rotavirus A) in natural samples (swine raw manure, swine effluent from AB and biofertilized soils); it demonstrated viral inactivation during the storage period at 23 °C. As a result, the combination of PMA coupled to real-time PCR can be a promising alternative for prediction of viral infectivity in comparison to more labour-intensive and costly techniques such as animal or tissue-culture infectivity methods, and for those viruses that do not have currently available cell culture techniques.
Reduction of heteroduplex formation in PCR amplification
Czech Academy of Sciences Publication Activity Database
Michu, Elleni; Mráčková, Martina; Vyskot, Boris; Žlůvová, Jitka
2010-01-01
Roč. 54, č. 1 (2010), s. 173-176 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) KJB600040801; GA ČR(CZ) GD204/09/H002; GA AV ČR(CZ) IAA600040801; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polymerase chain reaction * reconditioning PCR * mixed-template PCR Subject RIV: BO - Biophysics Impact factor: 1.582, year: 2010
A naked-eye colorimetric "PCR developer"
Valentini, Paola; Pompa, Pier Paolo
2016-04-01
Despite several advances in molecular biology and diagnostics, Polymerase Chain Reaction (PCR) is currently the gold standard for nucleic acids amplification and detection, due to its versatility, low-cost and universality, with estimated genetically modified organisms, and pathogens). The PCR developer proved to be highly specific and ultra-sensitive, discriminating down to few copies of HIV viral DNA, diluted in an excess of interfering human genomic DNA, which is a clinically relevant viral load. Hence, it could be a valuable tool for both academic research and clinical applications.
PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.
Prevost, S; Andre, S; Remize, F
2010-12-01
Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.
European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.
Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Dybkær, Karen; Munch, Mette; Handberg, Kurt J.
2004-01-01
Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...
Directed PCR-free engineering of highly repetitive DNA sequences
Directory of Open Access Journals (Sweden)
Preissler Steffen
2011-09-01
Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.
Profile of World Uranium Enrichment Programs - 2007
International Nuclear Information System (INIS)
Laughter, Mark D.
2007-01-01
It is generally agreed that the most difficult step in building a nuclear weapon is acquiring weapons grade fissile material, either plutonium or highly enriched uranium (HEU). Plutonium is produced in a nuclear reactor, while HEU is produced using a uranium enrichment process. Enrichment is also an important step in the civil nuclear fuel cycle, in producing low enriched uranium (LEU) for use in fuel for nuclear reactors. However, the same equipment used to produce LEU for nuclear fuel can also be used to produce HEU for weapons. Safeguards at an enrichment plant are the array of assurances and verification techniques that ensure uranium is only enriched to LEU, no undeclared LEU is produced, and no uranium is enriched to HEU or secretly diverted. There are several techniques for enriching uranium. The two most prevalent are gaseous diffusion, which uses older technology and requires a lot of energy, and gas centrifuge separation, which uses more advanced technology and is more energy efficient. Gaseous diffusion plants (GDPs) provide about 40% of current world enrichment capacity, but are being phased out as newer gas centrifuge enrichment plants (GCEPs) are constructed. Estimates of current and future enrichment capacity are always approximate, due to the constant upgrades, expansions, and shutdowns occurring at enrichment plants, largely determined by economic interests. Currently, the world enrichment capacity is approximately 53 million kg-separative work units (SWU) per year, with 22 million in gaseous diffusion and 31 million in gas centrifuge plants. Another 23 million SWU/year of capacity are under construction or planned for the near future, almost entirely using gas centrifuge separation. Other less-efficient techniques have also been used in the past, including electromagnetic and aerodynamic separations, but these are considered obsolete, at least from a commercial perspective. Laser isotope separation shows promise as a possible enrichment technique
2011-06-10
.... 10-899-02-ML-BD01] In the Matter of Areva Enrichment Services, LLC (Eagle Rock Enrichment Facility...'' portion of this proceeding regarding the December 2008 application by AREVA Enrichment Services, LLC (AES... gas centrifuge uranium enrichment facility--denoted as the Eagle Rock Enrichment Facility (EREF)--in...
Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A
2016-05-01
The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.
Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.
Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou
2018-02-15
Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.
Lehmann, P; Ehrenstein, B; Hartung, W; Dragonas, C; Reischl, U; Fleck, M
2017-03-01
The diagnosis of Whipple's disease (WD) is commonly confirmed by histology demonstrating Periodic Acid Schiff (PAS)-positive macrophages in the duodenal mucosa. Analysis of intestinal tissue or other specimens using polymerase chain reaction (PCR) is a more sensitive method. However, the relevance of positive PCR findings is still controversial. Therefore, we evaluated the relevance of histology and PCR findings to establishing the diagnosis of WD in a series of WD patients initially presenting with suspected rheumatic diseases. Between 2006 and 2014, 20 patients with seronegative rheumatic diseases tested positive for Tropheryma whipplei (Tw) by PCR and/or histology and were enrolled in a retrospective analysis of the diagnostic value of both procedures. Seven of the 20 cases (35%) were diagnosed with 'classic' WD as indicated by PAS-positive macrophages. In the remaining 13 patients, the presence of Tw was detected by intestinal (n = 10) or synovial PCR analysis (n = 3). Two of the 20 patients (10%) with evidence of Tw did not respond to antibiotic therapy. They were not considered to suffer from WD. Therefore, relying only on histological findings of intestinal biopsies would have missed 11 (61%) of the 18 patients with WD in our cohort. In comparison, PCR of intestinal biopsies detected Tw-DNA in 14 (93%) of the 15 WD patients evaluated. Patients with a positive histology did not differ from PCR-positive patients with regard to sex, age, or duration of disease, but more often presented with gastrointestinal symptoms. A substantial number of WD patients present without typical intestinal histology findings. Additional PCR analysis of intestinal tissue or synovial fluid increased the sensitivity of the diagnostic evaluation and should be considered particularly in patients presenting with atypical seronegative rheumatic diseases and a high-risk profile for WD.
Pavšič, Jernej; Devonshire, Alison; Blejec, Andrej; Foy, Carole A; Van Heuverswyn, Fran; Jones, Gerwyn M; Schimmel, Heinz; Žel, Jana; Huggett, Jim F; Redshaw, Nicholas; Karczmarczyk, Maria; Mozioğlu, Erkan; Akyürek, Sema; Akgöz, Müslüm; Milavec, Mojca
2017-04-01
Quantitative PCR (qPCR) is an important tool in pathogen detection. However, the use of different qPCR components, calibration materials and DNA extraction methods reduces comparability between laboratories, which can result in false diagnosis and discrepancies in patient care. The wider establishment of a metrological framework for nucleic acid tests could improve the degree of standardisation of pathogen detection and the quantification methods applied in the clinical context. To achieve this, accurate methods need to be developed and implemented as reference measurement procedures, and to facilitate characterisation of suitable certified reference materials. Digital PCR (dPCR) has already been used for pathogen quantification by analysing nucleic acids. Although dPCR has the potential to provide robust and accurate quantification of nucleic acids, further assessment of its actual performance characteristics is needed before it can be implemented in a metrological framework, and to allow adequate estimation of measurement uncertainties. Here, four laboratories demonstrated reproducibility (expanded measurement uncertainties below 15%) of dPCR for quantification of DNA from human cytomegalovirus, with no calibration to a common reference material. Using whole-virus material and extracted DNA, an intermediate precision (coefficients of variation below 25%) between three consecutive experiments was noted. Furthermore, discrepancies in estimated mean DNA copy number concentrations between laboratories were less than twofold, with DNA extraction as the main source of variability. These data demonstrate that dPCR offers a repeatable and reproducible method for quantification of viral DNA, and due to its satisfactory performance should be considered as candidate for reference methods for implementation in a metrological framework.
Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay
Directory of Open Access Journals (Sweden)
Farzaneh Lotfipour
2015-06-01
Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.
A procedure for preparing alkali metal hydrides
International Nuclear Information System (INIS)
Lemieux, R.U.; Sanford, C.E.; Prescott, J.F.
1976-01-01
A plain low cost, procedure for the continuous, low temperature preparation of sodium or potassium hydrides using cheap reagents is presented. Said invention is especially concerned with a process of purifying of a catalytic exchange liquid used for deuterium enrichment, in which an alkali metal hydride is produced as intermediate product. The procedure for producing the sodium and potassium hydrides consists in causing high pressure hydrogen to be absorbed by a mixture of at least a lower monoalkylamine and an alkylamide of an alkali metal from at least one of said amines [fr
Internal quality control of PCR-based genotyping methods
DEFF Research Database (Denmark)
Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen
2002-01-01
Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...
A Guide to Job Enrichment and Redesign.
Cunningham, J. Barton; Eberle, Ted
1990-01-01
Describes job design alternatives--job enrichment, the job characteristics model, Japanese style management, and quality-of-worklife approaches. Focuses on the problems that human resources professionals may encounter when attempting to implement these approaches. (Author/JOW)
Mercury enrichment in sediments of Amba estuary
Digital Repository Service at National Institute of Oceanography (India)
Ram, A.; Rokade, M.A.; Zingde, M.D.
of anthropogenic metal to the estuary. Geoaccumulation index and enrichment factor support Hg contamination of the estuarine sediment to a varying degree. Hg is not significantly correlated with TOC, Al, Fe and Mn in these sediments...
Safety criteria of uranium enrichment plants
International Nuclear Information System (INIS)
Nardocci, A.C.; Oliveira Neto, J.M. de
1994-01-01
The applicability of nuclear reactor safety criteria applied to uranium enrichment plants is discussed, and a new criterion based on the soluble uranium compounds and hexafluoride chemical toxicities is presented. (L.C.J.A.). 21 refs, 4 tabs
Management's Ecstasy and Disparity Over Job Enrichment
King, Albert S.
1976-01-01
A case study analyzing job enrichment schemes and manager expectations of increased productivity is presented. It was found that it was the managers' expectations of increased productivity, not the reorganization of work, that led to higher productivity. (EC)
Safety aspects of gas centrifuge enrichment plants
International Nuclear Information System (INIS)
Hansen, A.H.
1987-01-01
Uranium enrichment by gas centrifuge is a commercially proven, viable technology. Gas centrifuge enrichment plant operations pose hazards that are also found in other industries as well as unique hazards as a result of processing and handling uranium hexafluoride and the handling of enriched uranium. Hazards also found in other industries included those posed by the use of high-speed rotating equipment and equipment handling by use of heavy-duty cranes. Hazards from high-speed rotating equipment are associated with the operation of the gas centrifuges themselves and with the operation of the uranium hexafluoride compressors in the tail withdrawal system. These and related hazards are discussed. It is included that commercial gas centrifuge enrichment plants have been designed to operate safely
(+)- 10-camphorsulfonic acid and enrichment of enantiomeric
Indian Academy of Sciences (India)
WINTEC
. The partially resolved enriched sample of (S,S)-(–)-2,3-diphenylpiperazine with 73% ee was purified to obtain samples of 97% ee using different achiral acids via the preparation of either homochiral or heterochiral hydrogen bonded.
Boron isotopic enrichment by displacement chromatography
International Nuclear Information System (INIS)
Mohapatra, K.K.; Bose, Arun
2014-01-01
10 B enriched boron is used in applications requiring high volumetric neutron absorption (absorption cross section- 3837 barn for thermal and 1 barn for 1 MeV fast neutron). It is used in fast breeder reactor (as control rod material), in neutron counter, in Boron Neutron Capture Therapy etc. Owing to very small separation factor, boron isotopic enrichment is a complex process requiring large number of separation stages. Heavy Water Board has ventured in industrial scale production of 10 B enriched boron using Exchange Distillation Process as well as Ion Displacement Chromatography Process. Ion Displacement Chromatography process is used in Boron Enrichment Plant at HWP, Manuguru. It is based on isotopic exchange between borate ions (B(OH) 4 - ) on anion exchange resin and boric acid passing through resin. The isotopic exchange takes place due to difference in zero point energy of 10 B and 11 B
Process for recovering water enriched with deuterium
International Nuclear Information System (INIS)
Mandel, H.
1975-01-01
By the process proposed herewith, enrichment of deuterium in water by cooling water recirculation through series-connection of several cooling ciruits in the form of columns is obtained. With this method, conventional, open-type cooling towers without special installations can be applied, which is an important advantage as compared with a formerly proposed single-stage process with specially designed, complicated cooling towers. Series-connection of the cooling towers is carried out in such a way that the circulating water of a certain cooling circuit, which has a corresponding output value of deuterium enrichment, is conveyed to a succeeding circuit where further enrichment is achieved. The water enriched with deuterium is removed from the last cooling circuit of the series while an amount of fresch water equivalent to the water removed or evaporated altogether is fed to the first circuit of the series. (RB) [de
PCR detection of potato cyst nematode.
Reid, Alex
2009-01-01
Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.
Real-time PCR gene expression profiling
Czech Academy of Sciences Publication Activity Database
Kubista, Mikael; Sjögreen, B.; Forootan, A.; Šindelka, Radek; Jonák, Jiří; Andrade, J.M.
2007-01-01
Roč. 1, - (2007), s. 56-60 ISSN 1360-8606 R&D Projects: GA AV ČR KJB500520601 Institutional research plan: CEZ:AV0Z50520514 Keywords : real - time PCR, * expression profiling * statistical analysis Subject RIV: EB - Genetics ; Molecular Biology
U.S. forms uranium enrichment corporation
International Nuclear Information System (INIS)
Seltzer, R.
1993-01-01
After almost 40 years of operation, the federal government is withdrawing from the uranium enrichment business. On July 1, the Department of Energy turned over to a new government-owned entity--the US Enrichment Corp. (USEC)--both the DOE enrichment plants at Paducah, Ky., and Portsmouth, Ohio, and domestic and international marketing of enriched uranium from them. Pushed by the inability of DOE's enrichment operations to meet foreign competition, Congress established USEC under the National Energy Policy Act of 1992, envisioning the new corporation as the first step to full privatization. With gross revenues of $1.5 billion in fiscal 1992, USEC would rank 275th on the Fortune 500 list of top US companies. USEC will lease from DOE the Paducah and Portsmouth facilities, built in the early 1950s, which use the gaseous diffusion process for uranium enrichment. USEC's stock is held by the US Treasury, to which it will pay annual dividends. Martin Marietta Energy Systems, which has operated Paducah since 1984 and Portsmouth since 1986 for DOE, will continue to operate both plants for USEC. Closing one of the two facilities will be studied, especially in light of a 40% world surplus of capacity over demand. USEC also will consider other nuclear-fuel-related ventures. USEC will produce only low-enriched uranium, not weapons-grade material. Indeed, USEC will implement a contract now being completed under which the US will purchase weapons-grade uranium from dismantled Russian nuclear weapons and convert it into low-enriched uranium for power reactor fuel
Comparative proteomic assessment of matrisome enrichment methodologies
Krasny, Lukas; Paul, Angela; Wai, Patty; Howard, Beatrice A.; Natrajan, Rachael C.; Huang, Paul H.
2016-01-01
The matrisome is a complex and heterogeneous collection of extracellular matrix (ECM) and ECM-associated proteins that play important roles in tissue development and homeostasis. While several strategies for matrisome enrichment have been developed, it is currently unknown how the performance of these different methodologies compares in the proteomic identification of matrisome components across multiple tissue types. In the present study, we perform a comparative proteomic assessment of two widely used decellularisation protocols and two extraction methods to characterise the matrisome in four murine organs (heart, mammary gland, lung and liver). We undertook a systematic evaluation of the performance of the individual methods on protein yield, matrisome enrichment capability and the ability to isolate core matrisome and matrisome-associated components. Our data find that sodium dodecyl sulphate (SDS) decellularisation leads to the highest matrisome enrichment efficiency, while the extraction protocol that comprises chemical and trypsin digestion of the ECM fraction consistently identifies the highest number of matrisomal proteins across all types of tissue examined. Matrisome enrichment had a clear benefit over non-enriched tissue for the comprehensive identification of matrisomal components in murine liver and heart. Strikingly, we find that all four matrisome enrichment methods led to significant losses in the soluble matrisome-associated proteins across all organs. Our findings highlight the multiple factors (including tissue type, matrisome class of interest and desired enrichment purity) that influence the choice of enrichment methodology, and we anticipate that these data will serve as a useful guide for the design of future proteomic studies of the matrisome. PMID:27589945
Modeling of Transients in an Enrichment Circuit
International Nuclear Information System (INIS)
Fernandino, Maria; Delmastro, Dario; Brasnarof, Daniel
2003-01-01
In the present work a mathematical model is presented in order to describe the dynamic behavior inside a closed enrichment loop, the latter representing a single stage of an uranium gaseous diffusion enrichment cascade.The analytical model is turned into a numerical model, and implemented through a computational code.Transients of two species separation were numerically analyzed, including setting times of each magnitude, behavior of each one of them during different transients, and redistribution of concentrations along the closed loop
NRC licensing of uranium enrichment plants
International Nuclear Information System (INIS)
Moran, B.W.
1991-01-01
The US Nuclear Regulatory Commission (NRC) is preparing a rule making that establishes the licensing requirements for low-enriched uranium enrichment plants. Although implementation of this rule making is timed to correspond with receipt of a license application for the Louisiana Energy Services centrifuge enrichment plant, the rule making is applicable to all uranium enrichment technologies. If ownership of the US gaseous diffusion plants and/or atomic vapor laser isotope separation is transferred to a private or government corporation, these plants also would be licensable under the new rule making. The Safeguards Studies Department was tasked by the NRC to provide technical assistance in support of the rule making and guidance preparation process. The initial and primary effort of this task involved the characterization of the potential safeguards concerns associated with a commercial enrichment plant, and the licensing issues associated with these concerns. The primary safeguards considerations were identified as detection of the loss of special nuclear material, detection of unauthorized production of material of low strategic significance, and detection of production of uranium enriched to >10% 235 U. The primary safeguards concerns identified were (1) large absolute limit of error associated with the material balance closing, (2) the inability to shutdown some technologies to perform a cleanout inventory of the process system, and (3) the flexibility of some technologies to produce higher enrichments. Unauthorized production scenarios were identified for some technologies that could prevent conventional material control and accounting programs from detecting the production and removal of 5 kg 235 U as highly enriched uranium. Safeguards techniques were identified to mitigate these concerns
Principles and techniques of uranium enrichment
International Nuclear Information System (INIS)
Frejacques, Claude; Mezin, Michel
1975-01-01
The main separation processes already used industrially or likely to be used before the end of century (gas diffusion, ultracentrifugation, laser, the nozzle process, a process developed in South Africa) are presented. Some data on the costs of the enrichment are clarified. The main characteristics of the enrichment market in which the Eurodif plant is called upon, on the expiration of five years, to take a foremost place are reported [fr
A Resolution of the Paradox of Enrichment
Feng, Z. C.; Li, Y. Charles
2011-01-01
The paradox of enrichment was observed by M. Rosenzweig in a class of predator-prey models. Two of the parameters in the models are crucial for the paradox. These two parameters are the prey's carrying capacity and prey's half-saturation for predation. Intuitively, increasing the carrying capacity due to enrichment of the prey's environment should lead to a more stable predator-prey system. Analytically, it turns out that increasing the carrying capacity always leads to an unstable predator-p...
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.
Doyle, Laura; Vogel, Sherilynn; Procop, Gary W
2017-01-01
The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Monocyte enrichment from leukapheresis products by using the Elutra cell separator.
Kim, Sinyoung; Kim, Hyun Ok; Baek, Eun-Jung; Choi, Youjeong; Kim, Han-Soo; Lee, Min-Geul
2007-12-01
Dendritic cells (DCs), used in clinical trials for cancer immunotherapy, require processing on an expanded scale to conform to current good manufacturing practice guidelines. This study evaluated a large-scale monocyte enrichment procedure with a commercially available cell separator (Elutra, Gambro BCT) and analyzed the capacity of enriched monocytes to differentiate into DCs. Mononuclear cells were collected in two patients with malignant melanoma and seven healthy donors by leukapheresis. Continuous-counterflow elutriation with the Elutra was performed to enrich and purify monocytes from leukapheresis products. Purity and recovery of enriched monocytes were analyzed by flow cytometry. DCs were generated from the elutriated monocytes and characterized by phenotypic surface marker and stimulatory capacity in an allogeneic mixed lymphocyte reaction. In the leukapheresis products, the total MNC count was 7.3 x 10(9) +/- 0.7 x 10(9) and the mean percentage of CD14+ monocytes was 16.5 +/- 3.8 percent, which increased to 68.9 +/- 7.4 percent after elutriation with the Elutra. The mean monocyte recovery was 94.3 percent. Elutriated monocytes were successfully cultured into phenotypically and functionally mature DCs. These results indicate that the Elutra cell separator allows for fast and easy enrichment of monocytes within a closed system. Furthermore, these monocytes can be differentiated into functionally mature DCs. Compared to plastic adherence and immunomagnetic selection methods, the elutriation procedure is inexpensive, efficient, and very effective.
Xu, Yan; Liu, Biao; Ding, Fengan; Zhou, Xiaodie; Tu, Pin; Yu, Bo; He, Yan; Huang, Peilin
2017-06-01
Circulating tumor cells (CTCs), isolated as a 'liquid biopsy', may provide important diagnostic and prognostic information. Therefore, rapid, reliable and unbiased detection of CTCs are required for routine clinical analyses. It was demonstrated that negative enrichment, an epithelial marker-independent technique for isolating CTCs, exhibits a better efficiency in the detection of CTCs compared with positive enrichment techniques that only use specific anti-epithelial cell adhesion molecules. However, negative enrichment techniques incur significant cell loss during the isolation procedure, and as it is a method that uses only one type of antibody, it is inherently biased. The detection procedure and identification of cell types also relies on skilled and experienced technicians. In the present study, the detection sensitivity of using negative enrichment and a previously described unbiased detection method was compared. The results revealed that unbiased detection methods may efficiently detect >90% of cancer cells in blood samples containing CTCs. By contrast, only 40-60% of CTCs were detected by negative enrichment. Additionally, CTCs were identified in >65% of patients with stage I/II lung cancer. This simple yet efficient approach may achieve a high level of sensitivity. It demonstrates a potential for the large-scale clinical implementation of CTC-based diagnostic and prognostic strategies.
Reducing enrichment of fuel for research reactors
International Nuclear Information System (INIS)
Kanda, Keiji; Matsuura, Shojiro.
1980-01-01
In research reactors, highly enriched uranium (HEU) is used as fuel for their purposes of operation. However, the United States strongly required in 1977 that these HEU should be replaced by low enrichment uranium (LEU) of 20% or less, or even in unavoidable cases, it should be replaced by medium enrichment uranium (MEU). INFCE (International Nuclear Fuel Cycle Evaluation) which started its activity just at that time decided to discuss this problem in the research reactor group of No. 8 sectional committee. Japan has been able to forward the work, taking a leading part in the international opinion because she has taken the countermeasures quickly. INFCE investigated the problem along the lines of policy that the possibility of reducing the degree of enrichment should be limited to the degree in which the core structures and equipments of research reactors will be modified as little as possible, and the change of fuel element geometry will be done within the permissible thermohydrodynamic capacity, and concluded that it might be possible in near future to reduce the degree of enrichment to about 45% MEU, while the reduction to 20% LEU might require considerable research, development and verification. On the other hand, the joint researches by Kyoto University and ANL (Argonne National Laboratory) and by Japan Atomic Energy Research Institute and ANL are being continued. IAEA has edited the guidebook (IAEA-TECDOC-233) for reducing the degree of enrichment for developing countries. (Wakatsuki, Y.)
Environmental enrichment choices of shelter cats.
Ellis, J J; Stryhn, H; Spears, J; Cockram, M S
2017-08-01
Choices made by cats between different types of environmental enrichment may help shelters to prioritize how to most effectively enrich cat housing, especially when limited by space or funds. This study investigates the environmental enrichment use of cats in a choice test. Twenty-six shelter cats were kept singularly in choice chambers for 10days. Each chamber had a central area and four centrally-linked compartments containing different types of environmental enrichment: 1) an empty control, 2) a prey-simulating toy, 3) a perching opportunity, and 4) a hiding opportunity. Cat movement between compartments was quantitatively recorded using a data-logger. Enriched compartments were visited significantly more frequently during the light period than during the dark period. Cats spent a significantly greater percentage of time in the hiding compartment (median=55%, IQR=46) than in the toy compartment (median=2%, IQR=9), or in the empty control compartment (median=4%, IQR=4). These results provide additional evidence to support the value of a hiding box to cats housed in a novel environment, in that they choose hiding relative to other types of environmental enrichment. Copyright © 2017 Elsevier B.V. All rights reserved.
Toward a predictive theory for environmental enrichment.
Watters, Jason V
2009-11-01
There have been many applications of and successes with environmental enrichment for captive animals. The theoretical spine upon which much enrichment work hangs largely describes why enrichment should work. Yet, there remains no clear understanding of how enrichment should be applied to achieve the most beneficial results. This lack of understanding may stem in part from the assumptions that underlie the application of enrichment by practitioners. These assumptions are derived from an understanding that giving animals choice and control in their environment stimulates their motivation to perform behaviors that may indicate a heightened state of well-being. Learning theory provides a means to question the manner in which these constructs are routinely applied, and converting learning theory's findings to optimality predictions suggests a particularly vexing paradox-that motivation to perform appears to be maintained best when acquiring a payoff for expressing the behavior is uncertain. This effect occurs even when the actual value of the payoff is the same for all schedules of certainty of payoff acquisition. The paradox can be resolved by invoking rewards of an alternative type, such as cognitive rewards, or through an understanding of how the average payoff changes with changes in the probability of reward. This model, with measures of the average change of the payoff, suggests testable scenarios by which practitioners can measure the quality of environmental uncertainty in enrichment programs.
Oak Ridge National Laboratory's isotope enrichment program
International Nuclear Information System (INIS)
Tracy, J.G.; Aaron, W.C.
1997-01-01
The Isotope Enrichment Program (IEP) at Oak Ridge National Laboratory (ORNL) is responsible for the production and distribution of ∼225 enriched stable isotopes from 50 multi-isotopic elements. In addition, ORNL distributes enriched actinide isotopes and provides extensive physical- and chemical-form processing of enriched isotopes to meet customer requirements. For more than 50 yr, ORNL has been a major provider of enriched isotopes and isotope-related services to research, medical, and industrial institutions throughout the world. Consolidation of the Isotope Distribution Office (IDO), the Isotope Research Materials Laboratory (IRML), and the stable isotope inventories in the Isotope Enrichment Facility (IEF) have improved operational efficiencies and customer services. Recent changes in the IEP have included adopting policies for long-term contracts, which offer program stability and pricing advantages for the customer, and prorated service charges, which greatly improve pricing to the small research users. The former U.S. Department of Energy (DOE) Loan Program has been converted to a lease program, which makes large-quantity or very expensive isotopes available for nondestructive research at a nominal cost. Current efforts are being pursued to improve and expand the isotope separation capabilities as well as the extensive chemical- and physical-form processing that now exists. The IEF's quality management system is ISO 9002 registered and accredited in the United States, Canada, and Europe
Digital PCR for direct quantification of viruses without DNA extraction
Pav?i?, Jernej; ?el, Jana; Milavec, Mojca
2015-01-01
DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...
Directory of Open Access Journals (Sweden)
Blachutzik Jörg O
2012-08-01
Full Text Available Abstract Background Sterols and Sphingolipids form lipid clusters in the plasma membranes of cell types throughout the animal and plant kingdoms. These lipid domains provide a medium for protein signaling complexes at the plasma membrane and are also observed to be principal regions of membrane contact at the inception of infection. We visualized different specific fluorescent lipophilic stains of the both sphingolipid enriched and non-sphingolipid enriched regions in the plasma membranes of live protoplasts of Arabidopsis thaliana. Results Lipid staining protocols for several fluorescent lipid analogues in plants are presented. The most emphasis was placed on successful protocols for the single and dual staining of sphingolipid enriched regions and exclusion of sphingolipid enriched regions on the plasma membrane of Arabidopsis thaliana protoplasts. A secondary focus was placed to ensure that these staining protocols presented still maintain cell viability. Furthermore, the protocols were successfully tested with the spectrally sensitive dye Laurdan. Conclusion Almost all existing staining procedures of the plasma membrane with fluorescent lipid analogues are specified for animal cells and tissues. In order to develop lipid staining protocols for plants, procedures were established with critical steps for the plasma membrane staining of Arabidopsis leaf tissue and protoplasts. The success of the plasma membrane staining protocols was additionally verified by measurements of lipid dynamics by the fluorescence recovery after photobleaching technique and by the observation of new phenomena such as time dependent lipid polarization events in living protoplasts, for which a putative physiological relevance is suggested.
SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.
Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu
2017-12-18
Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first
Harrus, Shimon; Kenny, Martin; Miara, Limor; Aizenberg, Itzhak; Waner, Trevor; Shaw, Susan
2004-11-01
This report presents evidence that dogs recover from acute canine monocytic ehrlichiosis (CME) after 16 days of doxycycline treatment (10 mg/kg of body weight every 24 h). Blood PCR was as valuable as splenic aspirate PCR for early diagnosis of acute CME. Splenic aspirate PCR was, however, superior to blood PCR for the evaluation of ehrlichial elimination.
Rahmeier, Francine Luciano; Zavalhia, Lisiane Silveira; Tortorelli, Lucas Silva; Huf, Fernanda; Géa, Luiza Paul; Meurer, Rosalva Thereza; Machado, Aryadne Cardoso; Gomez, Rosane; Fernandes, Marilda da Cruz
2016-09-06
Diabetes mellitus (DM) has been studied recently as a major cause of cognitive deficits, memory and neurodegenerative damage. Taurine and enriched environment have stood out for presenting neuroprotective and stimulating effects that deserve further study. In this paper, we examined the effects of taurine and enriched environment in the context of diabetes, evaluating effects on behaviour, memory, death and cellular activity. Eighty-eight Wistar rats were divided into 2 groups (E=enriched environment; C=standard housing). Some animals (24/group) underwent induction of diabetes, and within each group, some animals (half of diabetics (D) and half of non-diabetics (ND)/group) were treated for 30days with taurine (T). Untreated animals received saline (S). In total, there were eight subgroups: DTC, DSC, NDTC, NDSC, DTE, DSE, NDTE and NDSE. During the experiment, short-term memory was evaluated. After 30th day of experiment, the animals were euthanized and was made removal of brains used to immunohistochemistry procedures for GFAP and cleaved caspase-3. As a result, we observed that animals treated with taurine showed better performance in behavioural and memory tasks, and the enriched environment had positive effects, especially in non-diabetic animals. Furthermore, taurine and enriched environment seemed to be able to interfere with neuronal apoptosis and loss of glial cells, and in some instances, these two factors seemed to have synergistic effects. From these data, taurine and enriched environment may have important neurostimulant and neuroprotective effects. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
UF/sub 6/ test loop for evaluation and implementation of international enrichment plant safeguards
International Nuclear Information System (INIS)
Cooley, J.N.; Fields, L.W.; Swindle, D.W. Jr.
1987-01-01
A functional test loop capable of simulating UF/sub 6/ flows, pressures, and pipe deposits characteristic of gas centrifuge enrichment plant piping has been designed and fabricated by the Enrichment Safeguards Program of Martin Marietta Energy Systems, Inc., for use by the International Atomic Energy Agency (IAEA) at its Safeguards Analytical Laboratory in Seibersdorf, Austria. The purpose of the test loop is twofold: (1) to enable the IAEA to evaluate and to calibrate enrichment safeguards measurement instrumentation to be used in limited frequency-unannounced access (LFUA) inspection strategy measurements at gas centrifuge enrichment plants and (2) to train IAEA inspectors in the use of such instrumentation. The test loop incorporates actual sections of cascade header pipes from the centrifuge enrichment plants subject to IAEA inspections. The test loop is described, applications for its use by the IAEA are detailed, and results from an initial demonstration session using the test loop are summarized. By giving the IAEA the in-house capability to evaluate LFUA inspection strategy approaches, to develop inspection procedures, to calibrate instrumentation, and to train inspectors, the UF/sub 6/ cascade header pipe test loop will contribute to the IAEA's success in implementing LFUA strategy inspections at gas centrifuge enrichment facilities subject to international safeguards inspections
Optimized enrichment for the detection of Escherichia coli O26 in French raw milk cheeses.
Savoye, F; Rozand, C; Bouvier, M; Gleizal, A; Thevenot, D
2011-06-01
Our main objective was to optimize the enrichment of Escherichia coli O26 in raw milk cheeses for their subsequent detection with a new automated immunological method. Ten enrichment broths were tested for the detection of E. coli O26. Two categories of experimentally inoculated raw milk cheeses, semi-hard uncooked cheese and 'Camembert' type cheese, were initially used to investigate the relative efficacy of the different enrichments. The enrichments that were considered optimal for the growth of E. coli O26 in these cheeses were then challenged with other types of raw milk cheeses. Buffered peptone water supplemented with cefixim-tellurite and acriflavin was shown to optimize the growth of E. coli O26 artificially inoculated in the cheeses tested. Despite the low inoculum level (1-10 CFU per 25 g) in the cheeses, E. coli O26 counts reached at least 5.10(4) CFU ml(-1) after 24-h incubation at 41.5 °C in this medium. All the experimentally inoculated cheeses were found positive by the immunological method in the enrichment broth selected. Optimized E. coli O26 enrichment and rapid detection constitute the first steps of a complete procedure that could be used in routine to detect E. coli O26 in raw milk cheeses. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.
Liang, Shih-Yu; Hsia, Kan-Tai; Chan, Yun-Hsien; Fan, Chia-Kwung; Jiang, Donald Dah-Shyong; Landt, Olfert; Ji, Dar-Der
2010-08-01
A single-tube multiprobe real-time PCR assay for simultaneous detection of Entamoeba histolytica and Entamoeba dispar was developed. One primer pair with 2 species-specific probes was designed based on new SSU RNA regions of the ribosomal DNA-containing episome. The sensitivity is 1 parasite per milliliter of feces and thus superior to the conventional nested PCR and comparable to other published real-time PCR protocols. The applicability for clinical diagnosis was validated with 218 stool specimens from patients. A total of 51 E. histolytica and 39 E. dispar positive samples was detected by the multiprobe real-time PCR compared to 39 and 22 by routine nested PCR diagnosis. The detection rate of Entamoeba species for the multiprobe real-time PCR assays was significantly higher than the nested PCR (40.8% vs. 28.0%, P Entamoeba moshkovskii, Giardia lamblia , Cryptosporidium sp., Escherichia coli , or other nonpathogenic enteric parasites. The multiprobe real-time PCR assay is simple and rapid and has high specificity and sensitivity. The assay could streamline the laboratory diagnosis procedure and facilitate epidemiological investigation.
International Nuclear Information System (INIS)
Andrade, Antero Silva Ribeiro de; Moreno, Elizabeth Castro; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela; Fernandes, Octavio
2002-01-01
Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with 32 P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with 32 P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)
Directory of Open Access Journals (Sweden)
PAULO Z. PASSAMANI
2017-12-01
Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L
1993-01-01
We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
On-Line Enrichment Monitor for UF{sub 6} Gas Centrifuge Enrichment Plant
Energy Technology Data Exchange (ETDEWEB)
Ianakiev, K. D.; Boyer, B.; Favalli, A.; Goda, J. M.; Hill, T.; Keller, C.; Lombardi, M.; Paffett, M.; MacArthur, D. W.; McCluskey, C.; Moss, C. E.; Parker, R.; Smith, M. K.; Swinhoe, M. T. [Los Alamos National Laboratory, Los Alamos (United States)
2012-06-15
This paper is a continuation of the Advanced Enrichment Monitoring Technology for UF{sub 6} Gas Centrifuge Enrichment Plant (GCEP) work, presented in the 2010 IAEA Safeguards Symposium. Here we will present the system architecture for a planned side-by-side field trial test of passive (186-keV line spectroscopy and pressure-based correction for UF{sub 6} gas density) and active (186-keV line spectroscopy and transmission measurement based correction for UF{sub 6} gas density) enrichment monitoring systems in URENCO's enrichment plant in Capenhurst. Because the pressure and transmission measurements of UF{sub 6} are complementary, additional information on the importance of the presence of light gases and the UF{sub 6} gas temperature can be obtained by cross-correlation between simultaneous measurements of transmission, pressure and 186-keV intensity. We will discuss the calibration issues and performance in the context of accurate, on-line enrichment measurement. It is hoped that a simple and accurate on-line enrichment monitor can be built using the UF{sub 6} gas pressure provided by the Operator, based on online mass spectrometer calibration, assuming a negligible (a small fraction of percent) contribution of wall deposits. Unaccounted-for wall deposits present at the initial calibration will lead to unwanted sensitivity to changes in theUF{sub 6} gas pressure and thus to error in the enrichment results. Because the accumulated deposits in the cascade header pipe have been identified as an issue for Go/No Go measurements with the Cascade Header Enrichment Monitor (CHEM) and Continuous Enrichment Monitor (CEMO), it is important to explore their effect. Therefore we present the expected uncertainty on enrichment measurements obtained by propagating the errors introduced by deposits, gas density, etc. and will discuss the options for a deposit correction during initial calibration of an On-Line Enrichment Monitor (OLEM).
Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.
Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y
2017-12-08
No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Yogita Maheshwari
Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.
Clostridium perfringens isolate typing by multiplex PCR
Directory of Open Access Journals (Sweden)
MR Ahsani
2010-01-01
Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.
The enriched chromium neutrino source for GALLEX
International Nuclear Information System (INIS)
Hartmann, F.X.; Hahn, R.L.
1991-01-01
The preparation and study of an intense source of neutrinos in the form of neutron irradiated materials which are enriched in Cr-50 for use in the GALLEX solar neutrino experiment are discussed. Chromyl fluoride gas is enriched in the Cr-50 isotope by gas centrifugation and subsequently converted to a very stable form of chromium oxide. The results of neutron activation analyses of such chromium samples indicate low levels of any long-lived activities, but show that short-lived activities, in particular Na-24, may be of concern. These results show that irradiating chromium oxide enriched in Cr-50 is preferable to irradiating either natural chromium or argon gas as a means of producing a neutrino source to calibrate the GALLEX detector. These results of the impurity level analysis of the enriched chromyl fluoride gas and its conversion to the oxide are also of interest to work in progress by other members of the Collaboration investigating an alternative conversion of the enriched gas to chromium metal. 35 refs., 12 figs., 5 tabs
How is uranium supply affecting enrichment?
International Nuclear Information System (INIS)
Steve Kidd
2007-01-01
As a result of the enlivened uranium market, momentum has in turn picked up in the enrichment sector. What are the consequences of higher uranium prices? There is, of course, a link between uranium and enrichment supply to the extent that they are at least partial substitutes. On the enrichment supply side, the most obvious feature is the gradual replacement of the old gas diffusion facilities of Usec in the USA and EURODIF in France with more modern and economical centrifuge plants. Assuming Usec can overcome the financing and technical issues surrounding its plans, the last gas diffusion capacity should disappear around 2015 and the entire enrichment market should then be using centrifuges. On the commercial side, the key anticipated developments are mostly in Russia. Although there should still continue to be substantial quantities of surplus Russian HEU available for down blending in the period beyond 2013, it is now reasonable to expect that it will be mostly consumed by internal needs, to fuel Russian-origin reactors both at home and in export markets such as China and India. Finally, as a key sensitive area for the non-proliferation of nuclear weapons, the enrichment sector is likely to be a central point of the new international arrangements which must be developed to support a buoyant nuclear sector throughout this century.
The Helikon technique for isotope enrichment
International Nuclear Information System (INIS)
Haarhoff, P.C.
1976-11-01
The separating element employed in the UCOR process for uranium enrichment has an enriched stream which is much smaller than the depleted stream. To deal with this small cut and to exploit the full potential of the process, a new cascade technique has been developed, the so-called helikon technique. It is based on the principle that an axial flow compressor can simultaneously compress a number of streams of different isotopic composition, which flow through it in parallel, without any significant mixing between them. The technique makes it possible to achieve the desired enrichment with a relatively small number of separating units, by making the best use of the high enrichment factor available. A further feature of the helikon technique is that a module yields an enrichment factor which is not constant, but can vary. In this way a cascade can be built up from modules of a fixed size, which is a great advantage when compared to conventional cascade arrangements where several unit sizes are required. A general theoretical treatment of the helikon technique is given and the similarity between helikon and conventional cascades is pointed out. Practical helikon cascades are subsequently discussed on the basis of the UCOR process
Linking nutrient enrichment, sediment erodibility and biofilms
Conrad, B.; Mahon, R.; Sojka, S. L.
2014-12-01
Sediment movement in coastal lagoons affects nutrient flux and primary producer growth. Previous research has shown that sediment erodibility is affected by biofilm concentration and that growth of benthic organisms, which produce biofilm, is affected by nutrient enrichment. However, researchers have not examined possible links between nutrient addition and sediment erodibility. We manipulated nutrient levels in the water column of 16 microcosms filled with homogenized sediment from a shallow coastal lagoon and artificial seawater to determine the effects on biofilm growth, measured through chlorophyll a and colloidal carbohydrate concentrations. Erosion tests using a Gust microcosm were conducted to determine the relationship between sediment erodibility and biofilm concentration. Results show that carbohydrate levels decreased with increasing nutrient enrichment and were unrelated to chlorophyll concentrations and erodibility. The nutrient levels did not predictably affect the chlorophyll levels, with lower chlorophyll concentrations in the control and medium enrichment treatments than the low and high enrichment treatments. Controls on biofilm growth are still unclear and the assumed relationship between carbohydrates and erodibility may be invalid. Understanding how biofilms respond to nutrient enrichment and subsequent effects on sediment erodibility is essential for protecting and restoring shallow coastal systems.
Profile of World Uranium Enrichment Programs-2009
International Nuclear Information System (INIS)
Laughter, Mark D.
2009-01-01
It is generally agreed that the most difficult step in building a nuclear weapon is acquiring fissile material, either plutonium or highly enriched uranium (HEU). Plutonium is produced in a nuclear reactor, whereas HEU is produced using a uranium enrichment process. Enrichment is also an important step in the civil nuclear fuel cycle, in producing low enriched uranium (LEU) for use as fuel for nuclear reactors to generate electricity. However, the same equipment used to produce LEU for nuclear reactor fuel can also be used to produce HEU for weapons. Safeguards at an enrichment plant are the array of assurances and verification techniques that ensure uranium is not diverted or enriched to HEU. There are several techniques for enriching uranium. The two most prevalent are gaseous diffusion, which uses older technology and requires a lot of energy, and gas centrifuge separation, which uses more advanced technology and is more energy efficient. Gaseous diffusion plants (GDPs) provide about 40% of current world enrichment capacity but are being phased out as newer gas centrifuge enrichment plants (GCEPs) are constructed. Estimates of current and future enrichment capacity are always approximate, due to the constant upgrades, expansions, and shutdowns occurring at enrichment plants, largely determined by economic interests. Currently, the world enrichment capacity is approximately 56 million kilogram separative work units (SWU) per year, with 22.5 million in gaseous diffusion and more than 33 million in gas centrifuge plants. Another 34 million SWU/year of capacity is under construction or planned for the near future, almost entirely using gas centrifuge separation. Other less-efficient techniques have also been used in the past, including electromagnetic and aerodynamic separations, but these are considered obsolete, at least from a commercial perspective. Laser isotope separation shows promise as a possible enrichment technique of the future but has yet to be
Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J
2017-12-01
qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.
A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.
Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S
2010-01-01
Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers
Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.
Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H
Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.
Sampling methods for rumen microbial counts by Real-Time PCR techniques
Directory of Open Access Journals (Sweden)
S. Puppo
2010-02-01
Full Text Available Fresh rumen samples were withdrawn from 4 cannulated buffalo females fed a fibrous diets in order to quantify bacteria concentration in the rumen by Real-Time PCR techniques. To obtain DNA of a good quality from whole rumen fluid, eight (M1-M8 different pre-filtration methods (cheese cloths, glass-fibre and nylon filter in combination with various centrifugation speeds (1000, 5000 and 14,000 rpm were tested. Genomic DNA extraction was performed either on fresh or frozen samples (-20°C. The quantitative bacteria analysis was realized according to Real-Time PCR procedure for Butyrivibrio fibrisolvens reported in literature. M5 resulted the best sampling procedure allowing to obtain a suitable genomic DNA. No differences were revealed between fresh and frozen samples.
31 CFR 540.308 - Low Enriched Uranium (LEU).
2010-07-01
... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Low Enriched Uranium (LEU). 540.308... OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY HIGHLY ENRICHED URANIUM (HEU) AGREEMENT ASSETS CONTROL REGULATIONS General Definitions § 540.308 Low Enriched Uranium (LEU). The term low enriched...
International Nuclear Information System (INIS)
Harley, J.H.
1977-08-01
Additions and corrections to the following sections of the HASL Procedures Manual are provided: General, Sampling, Field Measurements; General Analytical Chemistry, Chemical Procedures, Data Section, and Specifications
Development of on-line uranium enrichment monitor of gaseous UF6 for uranium enrichment plant
International Nuclear Information System (INIS)
Lu Xuesheng; Liu Guorong; Jin Huimin; Zhao Yonggang; Li Jinghuai; Hao Xueyuan; Ying Bin; Yu Zhaofei
2013-01-01
An on-line enrichment monitor was developed to measure the enrichment of UF 6 , flowing through the processing pipes in uranium enrichment plant. A Nal (Tl) detector was used to measure the count rates of the 185.7 keV γ-ray emitted from 235 U, and the total quantity of uranium was determined from thermodynamic characteristics of gaseous uranium hexafluoride. The results show that the maximum relative standard deviation is less than 1% when the measurement time is 120 s or more and the pressure is more than 2 kPa in the measurement chamber. Uranium enrichment of gaseous uranium hexafluoride in the output end of cascade can be monitored continuously by using the device. It should be effective for nuclear materials accountability verifications and materials balance verification at uranium enrichment plant. (authors)
Uranium enrichment management review: summary of analysis
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
In May 1980, the Assistant Secretary for Resource Applications within the Department of Energy requested that a group of experienced business executives be assembled to review the operation, financing, and management of the uranium enrichment enterprise as a basis for advising the Secretary of Energy. After extensive investigation, analysis, and discussion, the review group presented its findings and recommendations in a report on December 2, 1980. The following pages contain background material on which that final report was based. This report is arranged in chapters that parallel those of the uranium enrichment management review final report - chapters that contain summaries of the review group's discussion and analyses in six areas: management of operations and construction; long-range planning; marketing of enrichment services; financial management; research and development; and general management. Further information, in-depth analysis, and discussion of suggested alternative management practices are provided in five appendices.
Uranium enrichment management review: summary of analysis
International Nuclear Information System (INIS)
1981-01-01
In May 1980, the Assistant Secretary for Resource Applications within the Department of Energy requested that a group of experienced business executives be assembled to review the operation, financing, and management of the uranium enrichment enterprise as a basis for advising the Secretary of Energy. After extensive investigation, analysis, and discussion, the review group presented its findings and recommendations in a report on December 2, 1980. The following pages contain background material on which that final report was based. This report is arranged in chapters that parallel those of the uranium enrichment management review final report - chapters that contain summaries of the review group's discussion and analyses in six areas: management of operations and construction; long-range planning; marketing of enrichment services; financial management; research and development; and general management. Further information, in-depth analysis, and discussion of suggested alternative management practices are provided in five appendices
Method of deuterium isotope separation and enrichment
International Nuclear Information System (INIS)
Benson, S.W.
1979-01-01
A method is described for separating and enriching deuterium containing molecules comprising the steps of: providing a source of organic molecules containing a normal abundance of deuterium atoms, the organic molecules having a structural formula RX, in which R is an organic radical selected from ethyl, isopropyl, t-butyl and 3-cyclopentenyl, and in which X is selected from F, Cl, Br and OH, and wherein R represents 3-cyclopentenyl, X may additionally represent H; exposing the molecules to the radiation of at least one pulsed infrared laser source which has been specifically tuned and focussed to selectively decompose RX molecules containing deuterium to form an enriched olefin specie containing deuterium, and HX; and separating the deuterium enriched olefin specie from the undecomposed deuterium depleted RX molecules and HX. (author)
Method of deuterium isotope separation and enrichment
International Nuclear Information System (INIS)
Benson, S.W.
1978-01-01
A method of separating deuterium, i.e., heavy hydrogen, from certain naturally occurring sources using tuned infrared lasers to selectively decompose specified classes of organic molecules (i.e., RX) into enriched molecular products containing deuterium atoms is described. The deuterium containing molecules are easily separated from the starting material by absorption, distillation or other simple chemical separation techniques and methods. After evaporation such deuterium containing molecules can be burned to form water with an enriched deuterium content or pyrolyzed to form hydrogen gas with an enriched deuterium content. The undecomposed molecules and the other reaction products which are depleted of their deuterium containing species can be catalytically treated, preferably using normal water, to restore the natural abundance of deuterium and such restored molecules can then be recycled
A consideration on laser enrichment module
International Nuclear Information System (INIS)
Arisawa, Takashi; Shiba, Koreyuki
1983-09-01
Several problems are discussed for designing a simplified enrichment module based on Atomic Laser Isotope Separation Method, which involve the vaporization of metal, laser excitation, laser ionization and ion recovery. The conditions at which the consumed energy has the minimum value are obtained by calculating the specific energy consumption for producing unit amount of enriched products. It is found that there should be an appropriate relationship between the processing atomic density and the electrode gap in order to avoid the enrichment loss caused by the charge exchange during the ion recovery. Moreover it is also found that this relation depends on the electrode length measured along both the atomic beam direction and the laser beam direction. (author)
Energy consumption of chemical uranium enrichment
International Nuclear Information System (INIS)
Miyake, T.; Takeda, K.; Obanawa, H.
1987-01-01
A quantitative study of chemical separation energy for enriching uranium-235 by the redox chromatography was conducted. Isotope exchange reactions between U 4+ -UO 2 2+ ions in the enrichment column are maintained by the redox reactions. The chemical separation energy is ultimately supplied by hydrogen and oxygen gas for regenerating redox agents. The redox energy for the isotope separation is theoretically predicted as a function of the dynamic enrichment factor observed in the chromatographic development of uranium adsorption band. Thermodynamic treatments of the equilibrium reactions implies and inverse redox reaction which can be enhanced by the chemical potential of the ion-exchange reaction of oxidant. Experimental results showed 30 to 90% recovery of the redox energy by the inverse reaction. These results will devise a simplified redox chromatography process where a number of columns in one module is reduced
Method of deuterium isotope separation and enrichment
International Nuclear Information System (INIS)
Benson, S.W.
1980-01-01
A method of deuterium isotope separation and enrichment using infrared laser technology in combination with chemical processes for treating and recycling the unreacted and deuterium-depleted starting materials is described. Organic molecules of the formula RX (where R is an ethyl, isopropyl, t-butyl, or cyclopentenyl group and X is F, Cl, Br or OH) containing a normal abundance of hydrogen and deuterium are exposed to intense laser infrared radiation. An olefin containing deuterium (olefin D) will be formed, along with HX. The enriched olefin D can be stripped from the depleted stream of RX and HX, and can be burned to form enriched water or pyrolyzed to produce hydrogen gas with elevated deuterium content. The depleted RX is decomposed to olefins and RX, catalytically exchanged with normal water to restore the deuterium content to natural levels, and recombined to form RX which can be recycled. (LL)
The evolution of the enriched uranium markets
International Nuclear Information System (INIS)
Arnaiz, J.; Moleres, C.; Tarin, F.
2004-01-01
This paper deals with the evolution of the enriched uranium component markets (uranium concentrates, conversion and enrichment), starting with the situation of historically low prices that occurred during 2000. The situation that has been reached as on December 2003, when the concentrates and conversion markets were 44% and 70% (current US$) respectively, and the enrichment prices 30%, higher, is analysed. Finally, the negative impact of the 90's depressed prices, due to abundant alternative sources of uranium components, on the primary production of all three components and, as a conclusion, the impact of the new situation on the transport logistics, and the need of appropriate economic conditions to make the future primary production sustainable, is commented. (Author)
Nutrient enrichment increases mortality of mangroves.
Directory of Open Access Journals (Sweden)
Catherine E Lovelock
Full Text Available Nutrient enrichment of the coastal zone places intense pressure on marine communities. Previous studies have shown that growth of intertidal mangrove forests is accelerated with enhanced nutrient availability. However, nutrient enrichment favours growth of shoots relative to roots, thus enhancing growth rates but increasing vulnerability to environmental stresses that adversely affect plant water relations. Two such stresses are high salinity and low humidity, both of which require greater investment in roots to meet the demands for water by the shoots. Here we present data from a global network of sites that documents enhanced mortality of mangroves with experimental nutrient enrichment at sites where high sediment salinity was coincident with low rainfall and low humidity. Thus the benefits of increased mangrove growth in response to coastal eutrophication is offset by the costs of decreased resilience due to mortality during drought, with mortality increasing with soil water salinity along climatic gradients.
Enrichment Rescues Contextual Discrimination Deficit Associated With Immediate Shock
Clemenson, Gregory D.; Lee, Star W.; Deng, Wei; Barrera, Vanessa R.; Iwamoto, Kei S.; Fanselow, Michael S.; Gage, Fred H.
2015-01-01
Adult animals continue to modify their behavior throughout life, a process that is highly influenced by past experiences. To shape behavior, specific mechanisms of neural plasticity to learn, remember, and recall information are required. One of the most robust examples of adult plasticity in the brain occurs in the dentate gyrus (DG) of the hippocampus, through the process of adult neurogenesis. Adult neurogenesis is strongly upregulated by external factors such as voluntary wheel running (RUN) and environmental enrichment (EE); however, the functional differences between these two factors remain unclear. Although both manipulations result in increased neurogenesis, RUN dramatically increases the proliferation of newborn cells and EE promotes their survival. We hypothesize that the method by which these newborn neurons are induced influences their functional role. Furthermore, we examine how EE-induced neurons may be primed to encode and recognize features of novel environments due to their previous enrichment experience. Here, we gave mice a challenging contextual fear-conditioning (FC) procedure to tease out the behavioral differences between RUN-induced neurogenesis and EE-induced neurogenesis. Despite the robust increases in neurogenesis seen in the RUN mice, we found that only EE mice were able to discriminate between similar contexts in this task, indicating that EE mice might use a different cognitive strategy when processing contextual information. Furthermore, we showed that this improvement was dependent on EE-induced neurogenesis, suggesting a fundamental functional difference between RUN-induced neurogenesis and EE-induced neurogenesis. PMID:25330953
Permit issued for expansion of the Gronau uranium enrichment plant
International Nuclear Information System (INIS)
2005-01-01
Over the next few years, the Gronau Uranium Enrichment Plant (UAG) will be able to raise its capacity in steps from 1 800 tonnes to 4 500 tonnes SWU per annum. This development in steps depends on the extent to which demand on the world market can be turned into contracts for Urenco. After a procedure taking more than six years to complete, Urenco Deutschland GmbH was issued the required permit by the North Rhine-Westphalian State Ministry for Transport, Energy, and Planning on February 14 this year. The permit was preceded by the drafting and examination of two safety reports of several hundred pages each, and of over 1 000 detailed documents. The application documents were examined by a large number of expert consultants and public authorities from all over Germany acting on behalf of the nuclear licensing authority. Urenco Ltd. sells enrichment services worldwide, at present holding a share of approx. 19% of the world market for uranium separative work. Although this world market is not going to grow for a foreseeable period of time, Urenco is expanding its capacities. This is based on the latest centrifuge technology characterized by extremely low power consumption and high availability. It replaces diffusion technology, which currently holds a share of approx. 40% of the world market. (orig.)
Stable isotope enrichment by thermal diffusion
International Nuclear Information System (INIS)
Vasaru, Gheorghe
2003-01-01
Thermal diffusion (TD) in both gaseous and liquid phase has been the subject of extensive experimental and theoretical investigations, especially after the invention by K. Clusius and G. Dickel of the thermal diffusion column, sixty years ago. This paper gives a brief overview of the most important applications and developments of this transport phenomenon for enrichment of 13 C and of some noble gases isotopes in our institute. The results of calculations of the transport coefficients H and K for a concentric tube type TD column, operated with methane as process gas, are presented. Static separation factor at equilibrium vs gas pressure has been calculated for various molecular models. The experimental separation factors for different gas pressure were found to be consistent with those calculated for the inverse power repulsion model and the Lennard-Jones model. The most important characteristics of a seven-stage cascade consisting of 19 TD columns of concentric tube type are given. This system has been constructed and successfully operated at a temperature of 673 K and produces an enrichment of methane of natural isotopic 13 C abundance, up to the concentration of 25% 13 CH 4 . Enrichment of the noble gases isotopes implies: - a . Enrichment of 20 Ne and 22 Ne in a eight-stage cascade consisting of 8 TD columns; - b. enrichment of 46 Ar in a seven-stage cascade consisting of TD columns and finally; - c. enrichment of 78 Kr and 86 Kr in a fifteen-stage cascade, consisting of 35 TD columns. For all these installations we have adopted TD columns of hot wire type (4 m in length), operated at a temperature of 1073 K. (author)
Uranium enrichment by centrifuge in Japan
International Nuclear Information System (INIS)
Watanabe, T.; Murase, T.
1977-01-01
The demand for enriched uranium is on the increase with nuclear power capacity in which the LWR predominates and is estimated to exceed the supply from the present facilities in the world in less than ten years. Therefore, the basic strategy for enriched uranium is investigated on the following three-point long-range program in Japan: 1. To continue negotiations to extend the current allocation by the long-term contract; 2. To seek active participation in international enrichment projects; and 3. To make efforts to develop uranium enrichment technology and to construct inland facilities. On this basis, a vigorous development program of gas centrigue process for industrialization was launched out in 1972 as a national project. Ever since substantial progress in this field has been made and development works have been increased year after year. At present, a concrete plan of a pilot plant is taking shape. Up to now, several types of centrifuges were developed, of which some were completed as prototype models, and subjected to life tests and also to extensive earthquake-resistivity tests for the characteristics of Japanese geological condition. An enrichment plant is composed of so many centrifuges that the installation and piping system of centrifuges is an important factor which has an effect on plant economy and reliability. Two types of the experimental cascade were constructed in Japan. One has been in operation since 1973, and the other since 1975. Valuable empirical data have been accumulated on cascade characteristics, maintenance scheme and so on. It will be important for the coming plants to have a flexibility to escalation of labor and energy cost, or to variation of the separative work requirement and further. An economic prospect of centrifuge enrichment process is presented
Energy Technology Data Exchange (ETDEWEB)
Bedows, E; Payne, F E [Michigan Univ., Ann Arbor (USA). School of Public Health; Kohne, D E [Center for Neurologic Study, San Diego, CA, USA; Tourtellotte, W W [Neurology Service, V.A. Wadsworth Hospital Center, Los Angeles, CA, USA
1982-02-01
A procedure has been developed which facilitates the detection of measles virus RNA sequences in human brains. The procedure involves isolating subviral components (nucleocapsids) from brain tissues prior to RNA purification, followed by hybridization of these RNAs to cDNA synthesized from measles virus 50 S RNA template. Using these techniques we were able to obtain an RNA fraction which was manyfold enriched in measles virus-specific RNA, relative to unfractionated subacute sclerosing panencephalitis (SSPE) brain RNAs. 70-100% of the measles virus-specific RNA present in these SSPE brain samples were recovered in this enriched fraction.
International Nuclear Information System (INIS)
Bedows, E.; Payne, F.E.; Kohne, D.E.; Tourtellotte, W.W.
1982-01-01
A procedure has been developed which facilitates the detection of measles virus RNA sequences in human brains. The procedure involves isolating subviral components (nucleocapsids) from brain tissues prior to RNA purification, followed by hybridization of these RNAs to cDNA synthesized from measles virus 50 S RNA template. Using these techniques we were able to obtain an RNA fraction which was manyfold enriched in measles virus-specific RNA, relative to unfractionated subacute sclerosing panencephalitis (SSPE) brain RNAs. 70-100% of the measles virus-specific RNA present in these SSPE brain samples were recovered in this enriched fraction. (Auth.)
Enrichment situation outside the United States
International Nuclear Information System (INIS)
Anon.
1979-01-01
Different enrichment technologies are briefly characterized which include gaseous diffusion, which is presently the production mainstay of the United States and France; the gaseous centrifuge which is the production plant for Urenco and the technology for future United States enrichment expansion; the aero-dynamic processes which include the jet nozzle (also known as the Becker process) and the fixed-wall centrifuge (also known as the Helikon process); chemical processes; laser isotope separation processes (also referred to in the literature as LIS); and plasma technology
Phosphopeptide enrichment by immobilized metal affinity chromatography
DEFF Research Database (Denmark)
Thingholm, Tine E.; Larsen, Martin R.
2016-01-01
Immobilized metal affinity chromatography (IMAC) has been the method of choice for phosphopeptide enrichment prior to mass spectrometric analysis for many years and it is still used extensively in many laboratories. Using the affinity of negatively charged phosphate groups towards positively...... charged metal ions such as Fe3+, Ga3+, Al3+, Zr4+, and Ti4+ has made it possible to enrich phosphorylated peptides from peptide samples. However, the selectivity of most of the metal ions is limited, when working with highly complex samples, e.g., whole-cell extracts, resulting in contamination from...
Isotopic enrichment in a plasma centrifuge
International Nuclear Information System (INIS)
Del Bosco, E.; Dallaqua, R.S.; Ludwig, G.O.; Bittencourt, J.A.
1986-05-01
A rotating fully ionized plasma column was produced in a vacuum-arc centrifuge. The apparatus is described and new results for the rotational velocity and isotope enrichment of carbon and metal plasmas are shown. The ion rotation velocity is derived from electrostatic probes measurents and from the azimuthal displacement of the material deposited behind of a narrow slit. The isotope enrichment is measured with a modified quadrupole mass spectrometer, which determines, in situ, the relative abundance of the isotopes at the end of the plasm column at various radil positions. (Author) [pt
Uranium-enriched granites in Sweden
International Nuclear Information System (INIS)
Wilson, M.R.; Aakerblom, G.
1980-01-01
Granites with uranium contents higher than normal occur in a variety of geological settings in the Swedish Precambrian, and represent a variety of granite types and ages. They may have been generated by the anatexis of continental crust or processes occurring at a much greater depth. They commonly show enrichment in F, Sn, W and/or Mo. Only in one case is an important uranium mineralization thought to be directly related to a uranium-enriched granite, while the majority of epigenetic uranium mineralizations with economic potential are related to hydrothermal processes in areas where the bedrock is regionally uranium-enhanced. (author)
Enrichment and Preservation of Architectural Knowledge
DEFF Research Database (Denmark)
Beetz, Jakob; Blümel, Ina; Dietze, Stefan
2016-01-01
In the context of the EU FP7 DURAARK project (2013–2016), inter-disciplinary methods, technologies and tools have been researched and developed, that support the Long Term Preservation of semantically enriched digital representations of built structures. The results of the research efforts include...... approaches of semi-automatically deriving building models from point cloud data sets acquired from laser scans and the integration and overlay of such representations with explicit Building Information Models (BIM). We introduce novel ways for the further semantic enrichment of such hybrid building models...
Uranium enrichment: heading for the abyss
International Nuclear Information System (INIS)
Norman, C.
1983-01-01
This article discusses the federal government's $2.3 billion a year business enriching uranium for nuclear power plants which is heading toward a major crisis. Due to miscalculations by the Department of Energy, it is caught with billions of dollars of construction in progress just as projected demand for enriched uranium is decreasing. At the center of the controversy is the Gas Centrifuge Plant at Portsmouth, Ohio - estimated to cost $10 billion dollars. A review of how DOE got into this situation and how they plan to solve it is presented
Slightly enriched uranium fuel for a PHWR
International Nuclear Information System (INIS)
Notari, C.; Marajofsky, A.
1997-01-01
An improved fuel element design for a PHWR using slightly enriched uranium fuel is presented. It maintains the general geometric disposition of the currently used in the argentine NPP's reactors, replacing the outer ring of rods by rods containing annular pellets. Power density reduction is achieved with modest burnup losses and the void volume in the pellets can be used to balance these two opposite effects. The results show that with this new design, the fuel can be operated at higher powers without violating thermohydraulic limits and this means an improvement in fuel management flexibility, particularly in the transition from natural uranium to slightly enriched uranium cycle. (author)
Unattended safeguards instrumentation at centrifuge enrichment plants
International Nuclear Information System (INIS)
Smith, L. Eric; Lebrun, Alain R.; Labella, Rocco
2014-01-01
As global uranium enrichment capacity under international safeguards expands, the International Atomic Energy Agency (IAEA) is challenged to develop effective safeguards approaches at gaseous centrifuge enrichment plants, particularly high‑capacity plants, while working within budgetary constraints. New safeguards approaches should meet the high‑level verification objectives for such facilities (i.e., timely detection of: diversion of declared material, excess production beyond declared amounts, and production of enrichment levels higher than declared), but should also strive for efficiency advantages in implementation, for both the IAEA and operators. Under the Agency’s State- level approach to safeguards implementation, the Agency needs a flexible toolbox of technologies, allowing tailoring of safeguards measures for each individual enrichment facility. In this paper, the potential roles and development status for three different types of unattended measurement instrumentation are discussed. On‑Line Enrichment Monitors (OLEM) could provide continuous enrichment measurement for 100% of the declared gas flowing through unit header pipes. Unattended Cylinder Verification Stations (UCVS) could provide unattended verification of the declared uranium mass and enrichment of 100% of the cylinders moving through the plant, but also apply and verify an ‘NDA Fingerprint’ to preserve verification knowledge on the contents of each cylinder throughout its life in the facility. Sharing of the operator’s load cell signals from feed and withdrawal stations could count all cylinders introduced to the process and provide periodic monitoring of the uranium mass balance for in‑process material. The integration of load cell, OLEM and UCVS data streams offers the possibility for 100% verification of declared cylinder flow, and enables the periodic verification of the declared 235 U mass balance in the plant. These new capabilities would enhance the IAEA
Enriched lithium collection from lithium plasma flow
International Nuclear Information System (INIS)
Karchevsky, A.I.; Laz'ko, V.S.; Muromkin, Y.A.; Pashkovsky, V.G.; Ustinov, A.L.; Dolgolenko, D.A.
1994-01-01
In order to understand the physical processes concerned with the selective heating by ion cyclotron resonance and with the subsequent collection of heated particles, experiments were carried out with the extraction of lithium samples, enriched with 6 Li isotopes. Probe and integral extractors allow to collect enriched Li at the end of the selective heating region. Surface density distribution on the collector and local isotopic content of lithium are measured, as a function of the screen height and the retarding potential. Dependence of the collected amount of lithium and of its isotopic content on the value of the magnetic field is also measured. 4 figs., 2 tabs., 5 refs
Uranium enrichment services in the United States
International Nuclear Information System (INIS)
Jelinek, P.; Lenders, M.
1994-01-01
The United States of America is the world's largest market for uranium enrichment services. After the disintegration of the Soviet Union, Russian uranium is entering the world market on an increasing scale. The U.S. tries to protect its market and, in this connection, also the European market from excessive price drops by taking anti-dumping measures. In order to become more competitive, American companies have adapted modern enrichment techniques from Europe. European - U.S. joint ventures are to help, also technically and economically, to integrate military uranium, accumulating as a consequence of worldwide disarmament, into the commercial fuel cycle for the peaceful use of nuclear power. (orig.) [de
Uranium enrichment. Industrial and commercial aspect
International Nuclear Information System (INIS)
Lamorlette, G.
1983-01-01
The uranium enrichment, a key stage in the fuel cycle of light-water nuclear power stations, applies sophisticated and protected techniques in installations on a very large scale. This article shows how there was a sudden change from a monopoly position in production to a severe competition in a market which is depressed today but offers good prospects for the future. It indicates how the enrichment industrialist have adapted themselves to the fluctuations of the demand, while safeguarding the reliability of the rendered service and the necessary security of supplies for the proper development of the nuclear electric power [fr
Delgado, Susana; Rachid, Caio T C C; Fernández, Elena; Rychlik, Tomasz; Alegría, Angel; Peixoto, Raquel S; Mayo, Baltasar
2013-10-01
Thermophilic lactic acid bacteria (LAB) species, such as Streptococcus thermophilus, Lactobacillus delbrueckii and Lactobacillus helveticus, enjoy worldwide economic importance as dairy starters. To assess the diversity of thermophilic bacteria in milk, milk samples were enriched in thermophilic organisms through a stepwise procedure which included pasteurization of milk at 63 °C for 30 min (PM samples) and pasteurization followed by incubation at 42 °C for 24 h (IPM samples). The microbial composition of these samples was analyzed by culture-dependent (at 42 °C) and culture-independent (PCR-DGGE and pyrosequencing of 16S rRNA gene amplicons) microbial techniques. The results were then compared to those obtained for their corresponding starting raw milk counterparts (RM samples). Twenty different species were scored by culturing among 352 isolates purified from the counting plates and identified by molecular methods. Mesophilic LAB species (Lactococcus lactis, Lactococcus garvieae) were dominant (87% of the isolates) among the RM samples. However, S. thermophilus and Lb. delbrueckii were found to be the dominant recoverable organisms in both PM and IPM samples. The DGGE profiles of RM and PM samples were found to be very similar; the most prominent bands belonging to Lactococcus, Leuconostoc and Streptococcus species. In contrast, just three DGGE bands were obtained for IPM samples, two of which were assigned to S. thermophilus. The pyrosequencing results scored 95 operational taxonomic units (OTUs) at 3% sequence divergence in an RM sample, while only 13 were encountered in two IPM samples. This technique identified Leuconostoc citreum as the dominant microorganism in the RM sample, while S. thermophilus constituted more than 98% of the reads in the IPM samples. The procedure followed in this study allowed to estimate the bacterial diversity in milk and afford a suitable strategy for the isolation of new thermophilic LAB strains, among which adequate
Solution-based targeted genomic enrichment for precious DNA samples
Directory of Open Access Journals (Sweden)
Shearer Aiden
2012-05-01
Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.
2010-03-08
...: AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility) and All Other Persons Who Seek or Obtain... for the Implementation of a Safeguards Information Program (Effective Immediately) I AREVA Enrichment... it to construct and operate a uranium enrichment facility in Bonneville County, Idaho. AES submitted...
2012-03-13
... Laser Enrichment LLC, Commercial Laser-Based Uranium Enrichment Facility, Wilmington, North Carolina... a license to General Electric-Hitachi Global Laser Enrichment LLC (GLE or the applicant) to authorize construction of a laser-based uranium enrichment facility and possession and use of byproduct...
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Detection and Identification of Free-living Amoeba from Environmental Water in Taiwan by PCR Method
Tsai, H. F.; Hsu, B. M.; Huang, K. H.; She, C. Y.; Kao, P. M.; Shen, S. M.; Tseng, S. F.; Chen, J. S.
2012-04-01
Acanthamoeba, Naegleria, Balamuthia and Hartmannella all belong to free-living amoebae that are present ubiquitously in the environment including water, soil, and air. Free-living amoebae are parasites which can infect humans and can lead to serious illness and even death. The aim of this study is to investigate the presence of free-living amoebae in aquatic environment in Taiwan, and to compare the differences between Acanthamoeba and Naegleria in diverse cultivation methods and conditions. In this study, we used molecular method by PCR amplification with specific primers to analyze the occurrence of free-living amoebae. We collected 176 samples from environmental water including drinking water treatment plants, stream water, and hot spring recreational areas in Taiwan. Based on the results of PCR, 43 water samples (24.4%) were detected positive for free-living amoebae. The most common Acanthamoeba genotype isolated from samples including T2, T4, T5, T12, and T15. N. australiensis and N. lovaniensis were also identified by molecular biology techniques. Furthermore, we found that both Acanthamoeba and Naegleria can be cultured by PYG in 30° C, but not all free-living amoebae can be isolated and enriched by using storage-cultivation method. Because of the widespread presence of Acanthamoeba and Naegleria in aquatic environments, the water quality and safety of aquatic environments should be more conscious in Taiwan and worldwide. Keywords: free-living amoebae; Acanthamoeba; Naegleria; Balamuthia; Hartmannella; PCR
Floren, C; Wiedemann, I; Brenig, B; Schütz, E; Beck, J
2015-04-15
Species fraud and product mislabelling in processed food, albeit not being a direct health issue, often results in consumer distrust. Therefore methods for quantification of undeclared species are needed. Targeting mitochondrial DNA, e.g. CYTB gene, for species quantification is unsuitable, due to a fivefold inter-tissue variation in mtDNA content per cell resulting in either an under- (-70%) or overestimation (+160%) of species DNA contents. Here, we describe a reliable two-step droplet digital PCR (ddPCR) assay targeting the nuclear F2 gene for precise quantification of cattle, horse, and pig in processed meat products. The ddPCR assay is advantageous over qPCR showing a limit of quantification (LOQ) and detection (LOD) in different meat products of 0.01% and 0.001%, respectively. The specificity was verified in 14 different species. Hence, determining F2 in food by ddPCR can be recommended for quality assurance and control in production systems. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Uranium hexafluoride: handling procedures and container criteria
International Nuclear Information System (INIS)
1977-04-01
The U.S. Energy Research and Development Administration's (ERDA) procedures for packaging, measuring, and transferring uranium hexafluoride (UF 6 ) have been undergoing continual review and revision for several years to keep them in phase with developing agreements for the supply of enriched uranium. This report, first issued in 1966, was reissued in 1967 to make editorial changes and to provide for minor revisions in procedural information. In 1968 and 1972, Revisions 2 and 3, respectively, were issued as part of the continuing effort to present updated information. This document, Revision 4, includes primarily revisions to UF 6 cylinders, valves, and methods of use. This revision supersedes all previous issues of this report. The procedures will normally apply in all transactions involving receipt or shipment of UF 6 by ERDA, unless stipulated otherwise by contracts or agreements with ERDA or by notices published in the Federal Register
De Spiegelaere, Ward; Malatinkova, Eva; Lynch, Lindsay; Van Nieuwerburgh, Filip; Messiaen, Peter; O'Doherty, Una; Vandekerckhove, Linos
2014-06-01
Quantification of integrated proviral HIV DNA by repetitive-sampling Alu-HIV PCR is a candidate virological tool to monitor the HIV reservoir in patients. However, the experimental procedures and data analysis of the assay are complex and hinder its widespread use. Here, we provide an improved and simplified data analysis method by adopting binomial and Poisson statistics. A modified analysis method on the basis of Poisson statistics was used to analyze the binomial data of positive and negative reactions from a 42-replicate Alu-HIV PCR by use of dilutions of an integration standard and on samples of 57 HIV-infected patients. Results were compared with the quantitative output of the previously described Alu-HIV PCR method. Poisson-based quantification of the Alu-HIV PCR was linearly correlated with the standard dilution series, indicating that absolute quantification with the Poisson method is a valid alternative for data analysis of repetitive-sampling Alu-HIV PCR data. Quantitative outputs of patient samples assessed by the Poisson method correlated with the previously described Alu-HIV PCR analysis, indicating that this method is a valid alternative for quantifying integrated HIV DNA. Poisson-based analysis of the Alu-HIV PCR data enables absolute quantification without the need of a standard dilution curve. Implementation of the CI estimation permits improved qualitative analysis of the data and provides a statistical basis for the required minimal number of technical replicates. © 2014 The American Association for Clinical Chemistry.
Testing the applicability of the SASS5 scoring procedure for ...
African Journals Online (AJOL)
A study was undertaken between 29th January and 17th February 2004 to test the applicability of the South African Scoring System Version 5 (SASS5) scoring and calculation procedure in nutrient-enriched palustrine wetlands in the midlands of KwaZulu-Natal, South Africa. Four reference wetlands and three dairy-effluent ...
Analysis of extracellular RNA by digital PCR
Directory of Open Access Journals (Sweden)
Kenji eTakahashi
2014-06-01
Full Text Available The transfer of extracellular RNA is emerging as an important mechanism for intracellular communication. The ability for the transfer of functionally active RNA molecules from one cell to another within vesicles such as exosomes enables a cell to modulate cellular signaling and biological processes within recipient cells. The study of extracellular RNA requires sensitive methods for the detection of these molecules. In this methods article, we will describe protocols for the detection of such extracellular RNA using sensitive detection technologies such as digital PCR. These protocols should be valuable to researchers interested in the role and contribution of extracellular RNA to tumor cell biology.
Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen
2011-02-01
Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection
Computer assisted procedure maintenance
International Nuclear Information System (INIS)
Bisio, R.; Hulsund, J. E.; Nilsen, S.
2004-04-01
The maintenance of operating procedures in a NPP is a tedious and complicated task. Through the whole life cycle of the procedures they will be dynamic, 'living' documents. Several aspects of the procedure must be considered in a revision process. Pertinent details and attributes of the procedure must be checked. An organizational structure must be created and responsibilities allotted for drafting, revising, reviewing and publishing procedures. Available powerful computer technology provides solutions within document management and computerisation of procedures. These solutions can also support the maintenance of procedures. Not all parts of the procedure life cycle are equally amenable to computerized support. This report looks at the procedure life cycle in todays NPPs and discusses the possibilities associated with introduction of computer technology to assist the maintenance of procedures. (Author)
Low-enriched fuel particle performance review
International Nuclear Information System (INIS)
Homan, F.; Nabielek, H.; Yang, L.
1978-08-01
The available data on low-enriched (LEU) fuel particles were reviewed under the United States-Federal Republic of Germany Agreement. The most influential factors controlling the irradiation performance of LEU fuel particles were found to be plutonium transport, fission product transport, fuel particle mechanical performance and fuel particle chemical performande. (orig.) [de
Low-enriched fuel particle performance review
International Nuclear Information System (INIS)
Homan, F.; Nabielek, H.; Yang, L.
1978-08-01
The available data on low-enriched uranium (LEU) fuel particles were reviewed under the United States-Federal Republic of Germany Agreement. The most influential factors controlling the irradiation performance of LEU fuel particles were found to be plutonium transport, fission product transport, fuel particle mechanical performance, and fuel particle chemical performance
GRAN SASSO: Enriched germanium in action
Energy Technology Data Exchange (ETDEWEB)
Anon.
1991-12-15
Two large crystals of carefully enriched germanium, one weighing 1 kilogram and the other 2.9 kilograms, and worth many millions of dollars, are being carefully monitored in the Italian Gran Sasso Laboratory in the continuing search for neutrinoless double beta decay.
Isotope enrichment by photolysis on ordered surfaces
International Nuclear Information System (INIS)
Epling, G.A.; Florio, E.
1981-01-01
A surface was prepared as a micelle model which could be altered, by reacting trichlorododecylsilane with silica gel. Adsorption of dibenzyl ketone onto this surface followed by irradiation resulted in a recovered dibenzyl ketone enriched in 13 C. The plot of log S vs -log (1-f) had a slope of 1.66
Isotope enrichment by photolysis on ordered surfaces
Energy Technology Data Exchange (ETDEWEB)
Epling, G.A.; Florio, E.
1981-03-11
A surface was prepared as a micelle model which could be altered, by reacting trichlorododecylsilane with silica gel. Adsorption of dibenzyl ketone onto this surface followed by irradiation resulted in a recovered dibenzyl ketone enriched in /sup 13/C. The plot of log S vs -log (1-f) had a slope of 1.66. (DLC)
Isotopic enrichment in a plasma centrifuge
International Nuclear Information System (INIS)
Del Bosco, E.; Dallaqua, R.S.; Ludwig, G.O.; Bittencourt, J.A.
1987-01-01
High rotational velocity and centrifugal isotopic separation of carbon in a vacuum-arc plasma centrifuge are presented. Enrichments of up to 390% for 13 C are measured at 6 cm radius with angular rotation frequencies in excess of 1.0 x 10 5 rad/s in an axial magnetic field of 0.12 T
Drama in English: An Enriching Experience.
Geffen, Mitzi
1998-01-01
Examines the rationale behind using musical drama in English-as-a-Second-Language classes, explaining that it is an enjoyable experience that enriches students' English while they are relaxed, working as a team, and having fun with their imaginations. The article explains the process of putting on a play and evaluates the effect such a project had…
GRAN SASSO: Enriched germanium in action
International Nuclear Information System (INIS)
Anon.
1991-01-01
Two large crystals of carefully enriched germanium, one weighing 1 kilogram and the other 2.9 kilograms, and worth many millions of dollars, are being carefully monitored in the Italian Gran Sasso Laboratory in the continuing search for neutrinoless double beta decay
Genetic enrichment of cardiomyocytes derived from mouse ...
African Journals Online (AJOL)
Genetic enrichment of cardiomyocytes derived from mouse embryonic stem cells. WJ He, SC Li, LL Ye, H Liu, QW Wang, WD Han, XB Fu, ZL Chen. Abstract. Pluripotent embryonic stem cells (ESC) have the ability to differentiate into a variety of cell lineages in vitro, including cardiomyocytes. Successful applications of ...
Recommendations based on semantically enriched museum collections
Wang, Y.; Stash, N.; Aroyo, L.M.; Gorgels, P.; Rutledge, L.W.; Schreiber, G.
2008-01-01
This article presents the CHIP demonstrator1 for providing personalized access to digital museum collections. It consists of three main components: Art Recommender, Tour Wizard, and Mobile Tour Guide. Based on the semantically enriched Rijksmuseum Amsterdam2 collection, we show how Semantic Web
Review of environmental enrichment for broiler chickens
Riber, A.B.; De Weerd, Van H.A.; Jong, De I.C.; Steenfeldt, S.
2018-01-01
Welfare problems are commonly found in both conventional and organic production of broiler chickens. In order to reduce the extent of welfare problems, it has been suggested to provide stimulating, enriched environments. The aim of the present paper is to provide a review of the effect on behavior
Feasibility of uranium enrichment in Australia
International Nuclear Information System (INIS)
1979-10-01
The Council considered that provided the balance between costs and markets was found to be acceptable, there was no valid reason against the Government proceeding with a study on the feasibility of, and perhaps participating in the establishment of a commercial uranium enrichment industry in Australia. Areas covered include technical expertise and industrial structure in Australia, environmental aspects and safeguards
21 CFR 137.165 - Enriched flour.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Enriched flour. 137.165 Section 137.165 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... riboflavin, 24 milligrams of niacin, 0.7 milligrams of folic acid, and 20 milligrams of iron. (b) It may...
Gas Enrichment at Liquid-Wall Interfaces
Dammer, S.M.; Lohse, Detlef
2006-01-01
Molecular dynamics simulations of Lennard-Jones systems are performed to study the effects of dissolved gas on liquid-wall and liquid-gas interfaces. Gas enrichment at walls, which for hydrophobic walls can exceed more than 2 orders of magnitude when compared to the gas density in the bulk liquid,
Metacognitive Enrichment for Community College Students
Wyre, Steven H.
2012-01-01
Recent research was conducted to explore how introducing metacognitive enrichment into courses containing implicit or explicit critical thinking goals would affect the students' personal epistemological maturity. At the beginning of a fall semester at a moderate sized community college in the southeastern United States, 733 students were divided…
Status report on uranium enrichment associates
International Nuclear Information System (INIS)
Langley, R.A. Jr.; O'Donnell, A.J.; Garrett, G.A.
1977-01-01
Uranium Enrichment Associates (UEA) had as its priority project financing, an approach in which the total project is financially self-liquidating. UEA worked with financial institutions to define the combination of assurances and guarantees required by lenders in order to provide the required debt funding. UEA's assets against which the debt liability for the plant would be balanced would be the facilities under construction and the equipment on order. On the customer side, there was major concern on the part of the utilities of whether private industry would be able to complete and operate the plant owing to many of the same possibilities which concerned financial institutions. The disparity between the conditions under which financing could be obtained and the terms acceptable to utilities was a significant element in EUA's choice of process to use for its enrichment plants. UEA's technical staff then began to parallel conceptual designs of gaseous diffusion and gas cenrifuge plants. UEA negotiated with ERDA on the terms of a Cooperative Arrangement, within the provisions of the NFAA, providing the minimum conditions necessary to obtain financing and contracts with utilities for enrichment sources. The UEA plant has several features different from the ERDA plants. The UEA plant used only two basic stage sizes. The UEA design employed four main process buildings. The partners in UEA have mutually agreed to follow the private uranium enrichment project to a logical conclusion. 6 figures
PROTEIN ENRICHMENT OF SPENT SORGHUM RESIDUE USING ...
African Journals Online (AJOL)
BSN
The optimum concentration of spent sorghum for protein enrichment with S. cerevisiae was 7.Sg/100 ml. Th.: protein ... production of single sell protein using Candida utilis and cassava starch effluem as substrate. ... wastes as substrates, Kluyveromyces fragilis and milk whey coconut water as substrate (Rahmat et al.,. 1995 ...
Challenges when developing omega-3 enriched foods
DEFF Research Database (Denmark)
Jacobsen, Charlotte
2010-01-01
the influence of important factors such as oil quality, delivery systems for omega-3 fatty acids, processing conditions, composition of the food matrix on lipid oxidation in different omega-3 enriched foods (milk, yoghurt, mayonnaise and mayonnaise-based salads, dressing, energy bar and fish paté). Moreover...
Uranium enrichment management review. Final report
International Nuclear Information System (INIS)
Ellett, J.D.; Rieke, W.B.; Simpson, J.W.; Sullivan, P.E.
1980-01-01
The uranium enrichment enterprise of the US Department of Energy (DOE) provides enriched nuclear fuel for private and government utilities domestically and abroad. The enterprise, in effect, provides a commercial service and represents a signficant business operation within the US government: more than $1 billion in revenues annually and future capital expenditures estimated at several billions of dollars. As a result, in May 1980, the Assistant Secretary for Resource Applications within DOE requested that a group of experienced business executives be assembled to review the operation, financing, and management of the uranium enrichment enterprise as a basis for advising the Secretary of Energy. The review group was specifically asked to focus on the management activities to which sound business practices could be applied. The group developed findings and recommendations in six areas: management of operations and construction; long-range planning; marketing of enrichment services; financial management; research and development; and general management. The chapters of this report present first the management review group's recommendations in the six areas evaluated and then the findings and issues in each area. An appendix provides the group's calendar of meetings. A list of major reference sources used in the course of the study is also included. 12 references
Books to Expand and Enrich Experiences.
Winfield, Evelyn T.
1983-01-01
Books are briefly described that parents can read and discuss with their children to enrich travel and cultural activities. Books on the nation's capital city, the Liberty Bell, the Statue of Liberty, architecture, zoos, dinosaurs, and other subjects are included. (PP)
Laser enrichment: a new path to proliferation
International Nuclear Information System (INIS)
Casper, B.M.
1977-01-01
The use of lasers to obtain enriched uranium is an easier and cheaper method than methods currently in use. The immediate concern is that it could promote easy access to nuclear weapons by countries that do not presently have them. Mr. Casper feels that the U.S. government is working against itself; while the State Department is seeking to block one path to proliferation, ERDA laboratories are developing new technology that could open another. The proliferation implications have not been factored in a serious way into the decisions to proceed with this research. It is also clear that the United States does not now have a comprehensive policy that deals with all potentially important paths to proliferation, including laser enrichment. Mr. Casper states that there is still time to stop and consider whether laser enrichment should be developed, in light of its broader consequences. But this will not happen if the decisions are left exclusively in the hands of those promoting the technology, the author says. It is just this sort of situation that prompted the creation of several government institutions to provide independent assessments of new technologies. The Office of Technology Assessment, the Nuclear Regulatory Commission, and the Arms Control and Disarmament Agency all have the authority to intervene. Laser enrichment provides a good test of these institutions and of the viability of the concept of technology assessment. The status, benefits and risks, and the policy needed on laser research are discussed
Topical papers on uranium conversion and enrichment
International Nuclear Information System (INIS)
Uranium conversion and enrichment are discussed in 5 papers by representatives of the USA, Great Britain and Switzerland. The state of the art is reviewed, and future prospects are given. Supply assurance is directly related to the necessary production capacities and the supply agreements
Directory of Open Access Journals (Sweden)
Yong Huang
Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.
Determining Fungi rRNA Copy Number by PCR
The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within ...
Real-Time PCR for Universal Phytoplasma Detection and Quantification
DEFF Research Database (Denmark)
Christensen, Nynne Meyn; Nyskjold, Henriette; Nicolaisen, Mogens
2013-01-01
Currently, the most efficient detection and precise quantification of phytoplasmas is by real-time PCR. Compared to nested PCR, this method is less sensitive to contamination and is less work intensive. Therefore, a universal real-time PCR method will be valuable in screening programs and in other...
Renz, Nora; Cabric, Sabrina; Morgenstern, Christian; Schuetz, Michael A; Trampuz, Andrej
2018-04-01
Bone healing disturbance following fracture fixation represents a continuing challenge. We evaluated a novel fully automated polymerase chain reaction (PCR) assay using sonication fluid from retrieved orthopedic hardware to diagnose infection. In this prospective diagnostic cohort study, explanted orthopedic hardware materials from consecutive patients were investigated by sonication and the resulting sonication fluid was analyzed by culture (standard procedure) and multiplex PCR (investigational procedure). Hardware-associated infection was defined as visible purulence, presence of a sinus tract, implant on view, inflammation in peri-implant tissue or positive culture. McNemar's chi-squared test was used to compare the performance of diagnostic tests. For the clinical performance all pathogens were considered, whereas for analytical performance only microorganisms were considered for which primers are included in the PCR assay. Among 51 patients, hardware-associated infection was diagnosed in 38 cases (75%) and non-infectious causes in 13 patients (25%). The sensitivity for diagnosing infection was 66% for peri-implant tissue culture, 84% for sonication fluid culture, 71% (clinical performance) and 77% (analytical performance) for sonication fluid PCR, the specificity of all tests was >90%. The analytical sensitivity of PCR was higher for gram-negative bacilli (100%), coagulase-negative staphylococci (89%) and Staphylococcus aureus (75%) than for Cutibacterium (formerly Propionibacterium) acnes (57%), enterococci (50%) and Candida spp. (25%). The performance of sonication fluid PCR for diagnosis of orthopedic hardware-associated infection was comparable to culture tests. The additional advantage of PCR was short processing time (PCR has the potential to complement conventional cultures. Copyright © 2018 Elsevier Ltd. All rights reserved.
Eckert, C.; Van Broeck, J.; Spigaglia, P.; Burghoffer, B.; Delmée, M.; Mastrantonio, P.; Barbut, F.
2011-01-01
This study compared a repetitive-element PCR (rep-PCR) method (DiversiLab system) to PCR ribotyping. The discriminatory power of rep-PCR was 0.997. Among the PCR ribotype 027 isolates tested, different rep types could be distinguished. rep-PCR showed a higher discriminatory power than PCR ribotyping. Nevertheless, this method requires technical skill, and visual interpretation of rep-PCR fingerprint patterns may be difficult.
Directory of Open Access Journals (Sweden)
Janković Marija M.
2012-01-01
Full Text Available Tritium (3H present in the environment decreased in the last decades and nowadays it has low activity concentrations. Measurement of low-level tritium activities in natural waters, e. g. in precipitation, groundwater, and river water requires special techniques for water pretreatment and detection of low-level radioactivity. In order to increase the tritium concentration to an easily measurable level, electrolytic enrichment must be applied. This paper presents the enrichment method performed by electrolysis in a battery of 18 cells, giving an enrichment factor of 5.84 (calculated from 59 electrolyses. The calculated mean values of the separation factor and enrichment parameter were 4.10 and 0.84, respectively. Results for tritium activity in precipitation and surface water collected in Belgrade during 2008 and 2009 are presented. The Radiation and Environmental Protection Department of the Vinča Institute of Nuclear Sciences, participated in the IAEA TRIC2008 international intercomparison exercise. The participation in the intercomparisons for any laboratory doing low-level 3H measurements in the waters is very important and useful. It is considered the best way to check the entire procedure and methods of the measurements and the reliability of the standard used. The analysis of the reported 3H activity results showed that all results for five intercomparison samples, for which electrolytic enrichment were applied prior to the 3H measurement, are acceptable.
Salmonella testing of pooled pre-enrichment broth cultures for screening multiple food samples.
Price, W R; Olsen, R A; Hunter, J E
1972-04-01
A method has been described for testing multiple food samples for Salmonella without loss in sensitivity. The method pools multiple pre-enrichment broth cultures into single enrichment broths. The subsequent stages of the Salmonella analysis are not altered. The method was found applicable to several dry food materials including nonfat dry milk, dried egg albumin, cocoa, cottonseed flour, wheat flour, and shredded coconut. As many as 25 pre-enrichment broth cultures were pooled without apparent loss in the sensitivity of Salmonella detection as compared to individual sample analysis. The procedure offers a simple, yet effective, way to increase sample capacity in the Salmonella testing of foods, particularly where a large proportion of samples ordinarily is negative. It also permits small portions of pre-enrichment broth cultures to be retained for subsequent individual analysis if positive tests are found. Salmonella testing of pooled pre-enrichment broths provides increased consumer protection for a given amount of analytical effort as compared to individual sample analysis.