WorldWideScience

Sample records for enrichment pcr procedure

  1. Detection of toxigenic vibrio cholera from environmental water samples by an enrichment broth cultivation-pit-stop semi-nested PCR procedure

    CSIR Research Space (South Africa)

    Theron, J

    2000-09-01

    Full Text Available V. cholerae. The PCR procedure coupled with an enrichment culture detected as few as four V. cholerae organisms in pure culture. Treated sewage, surface, ground and drinking water samples were seeded with V, cholerae and following enrichment, a...

  2. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  3. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  4. Mung bean nuclease treatment increases capture specificity of microdroplet-PCR based targeted DNA enrichment.

    Directory of Open Access Journals (Sweden)

    Zhenming Yu

    Full Text Available Targeted DNA enrichment coupled with next generation sequencing has been increasingly used for interrogation of select sub-genomic regions at high depth of coverage in a cost effective manner. Specificity measured by on-target efficiency is a key performance metric for target enrichment. Non-specific capture leads to off-target reads, resulting in waste of sequencing throughput on irrelevant regions. Microdroplet-PCR allows simultaneous amplification of up to thousands of regions in the genome and is among the most commonly used strategies for target enrichment. Here we show that carryover of single-stranded template genomic DNA from microdroplet-PCR constitutes a major contributing factor for off-target reads in the resultant libraries. Moreover, treatment of microdroplet-PCR enrichment products with a nuclease specific to single-stranded DNA alleviates off-target load and improves enrichment specificity. We propose that nuclease treatment of enrichment products should be incorporated in the workflow of targeted sequencing using microdroplet-PCR for target capture. These findings may have a broad impact on other PCR based applications for which removal of template DNA is beneficial.

  5. PCR-Free Enrichment of Mitochondrial DNA from Human Blood and Cell Lines for High Quality Next-Generation DNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Meetha P Gould

    Full Text Available Recent advances in sequencing technology allow for accurate detection of mitochondrial sequence variants, even those in low abundance at heteroplasmic sites. Considerable sequencing cost savings can be achieved by enriching samples for mitochondrial (relative to nuclear DNA. Reduction in nuclear DNA (nDNA content can also help to avoid false positive variants resulting from nuclear mitochondrial sequences (numts. We isolate intact mitochondrial organelles from both human cell lines and blood components using two separate methods: a magnetic bead binding protocol and differential centrifugation. DNA is extracted and further enriched for mitochondrial DNA (mtDNA by an enzyme digest. Only 1 ng of the purified DNA is necessary for library preparation and next generation sequence (NGS analysis. Enrichment methods are assessed and compared using mtDNA (versus nDNA content as a metric, measured by using real-time quantitative PCR and NGS read analysis. Among the various strategies examined, the optimal is differential centrifugation isolation followed by exonuclease digest. This strategy yields >35% mtDNA reads in blood and cell lines, which corresponds to hundreds-fold enrichment over baseline. The strategy also avoids false variant calls that, as we show, can be induced by the long-range PCR approaches that are the current standard in enrichment procedures. This optimization procedure allows mtDNA enrichment for efficient and accurate massively parallel sequencing, enabling NGS from samples with small amounts of starting material. This will decrease costs by increasing the number of samples that may be multiplexed, ultimately facilitating efforts to better understand mitochondria-related diseases.

  6. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  7. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

    Science.gov (United States)

    McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

  8. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium.

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  9. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  10. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Directory of Open Access Journals (Sweden)

    Germán eVillamizar-Rodríguez

    2015-11-01

    Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This

  11. Enrichment of methylated molecules using enhanced-ice-co-amplification at lower denaturation temperature-PCR (E-ice-COLD-PCR) for the sensitive detection of disease-related hypermethylation.

    Science.gov (United States)

    Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg

    2018-05-01

    The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.

  12. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  13. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  14. Use of enrichment real-time PCR to enumerate salmonella on chicken parts.

    Science.gov (United States)

    Oscar, T P

    2014-07-01

    Salmonella bacteria that survive cooking or that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. In the present study, enrichment real-time PCR (qPCR) was used to enumerate Salmonella bacteria that contaminate raw chicken parts at retail or that cross-contaminate cooked chicken during simulated meal preparation and serving. Whole raw chickens obtained at retail were partitioned into wings, breasts, thighs, and drumsticks using a sterilized knife and cutting board, which were then used to partition a cooked chicken breast to assess cross-contamination. After enrichment in buffered peptone water (400 ml, 8 h, 40°C, 80 rpm), subsamples were used for qPCR and cultural isolation of Salmonella. In some experiments, chicken parts were spiked with 0 to 3.6 log of Salmonella Typhimurium var. 5- to generate a standard curve for enumeration by qPCR. Of 10 raw chickens examined, 7 (70%) had one or more parts contaminated with Salmonella. Of 80 raw parts examined, 15 (19%) were contaminated with Salmonella. Of 20 cooked chicken parts examined, 2 (10%) were cross-contaminated with Salmonella. Predominant serotypes identified were Typhimurium (71%) and its variants (var. 5-, monophasic, and nonmotile) and Kentucky (18%). The number of Salmonella bacteria on contaminated parts ranged from one to two per part. Results of this study indicated that retail chicken parts examined were contaminated with low levels of Salmonella, which resulted in low levels of cross-contamination during simulated meal preparation and serving. Thus, if consumers properly handle and prepare the chicken, it should pose no or very low risk of consumer exposure to Salmonella.

  15. Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

    Science.gov (United States)

    Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

    2014-01-01

    The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

  16. Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL genes from selective enrichments from animals and retail meat.

    Directory of Open Access Journals (Sweden)

    Valeria Velasco

    Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA

  17. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples.

    Science.gov (United States)

    Naddaf, S R; Kishdehi, M; Siavashi, Mr

    2011-01-01

    The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  18. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  19. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia Persica in Animal Blood Samples

    Directory of Open Access Journals (Sweden)

    SR Naddaf

    2011-06-01

    Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

  20. Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples

    Directory of Open Access Journals (Sweden)

    SR Naddaf

    2011-06-01

    Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by mi­cros­copy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spi­ro­chetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR tar­get­ing flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were per­formed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spi­ro­chete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentra­tion as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml.  Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.  

  1. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  2. Mitochondrial capture enriches mito-DNA 100 fold, enabling PCR-free mitogenomics biodiversity analysis

    DEFF Research Database (Denmark)

    Liu, Shanlin; Wang, Xin; Xie, Lin

    2016-01-01

    Biodiversity analyses based on next-generation sequencing (NGS) platforms have developed by leaps and bounds in recent years. A PCR-free strategy, which can alleviate taxonomic bias, was considered as a promising approach to delivering reliable species compositions of targeted environments...... data is highly demanding on computing resources. Here, we present a mitogenome enrichment pipeline via a gene capture chip that was designed by virtue of the mitogenome sequences of the 1000 Insect Transcriptome Evolution project (1KITE, www.1kite.org). A mock sample containing 49 species was used...... in abundance. However, the frequencies of input taxa were largely maintained after capture (R2 = 0.81). We suggest that our mitogenome capture approach coupled with PCR-free shotgun sequencing could provide ecological researchers an efficient NGS method to deliver reliable biodiversity assessment....

  3. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  4. Detection of Salmonella spp. in veterinary samples by combining selective enrichment and real-time PCR.

    Science.gov (United States)

    Goodman, Laura B; McDonough, Patrick L; Anderson, Renee R; Franklin-Guild, Rebecca J; Ryan, James R; Perkins, Gillian A; Thachil, Anil J; Glaser, Amy L; Thompson, Belinda S

    2017-11-01

    Rapid screening for enteric bacterial pathogens in clinical environments is essential for biosecurity. Salmonella found in veterinary hospitals, particularly Salmonella enterica serovar Dublin, can pose unique challenges for culture and testing because of its poor growth. Multiple Salmonella serovars including Dublin are emerging threats to public health given increasing prevalence and antimicrobial resistance. We adapted an automated food testing method to veterinary samples and evaluated the performance of the method in a variety of matrices including environmental samples ( n = 81), tissues ( n = 52), feces ( n = 148), and feed ( n = 29). A commercial kit was chosen as the basis for this approach in view of extensive performance characterizations published by multiple independent organizations. A workflow was established for efficiently and accurately testing veterinary matrices and environmental samples by use of real-time PCR after selective enrichment in Rappaport-Vassiliadis soya (RVS) medium. Using this method, the detection limit for S. Dublin improved by 100-fold over subculture on selective agars (eosin-methylene blue, brilliant green, and xylose-lysine-deoxycholate). Overall, the procedure was effective in detecting Salmonella spp. and provided next-day results.

  5. Improved detection of Burkholderia pseudomallei from non-blood clinical specimens using enrichment culture and PCR: narrowing diagnostic gap in resource-constrained settings.

    Science.gov (United States)

    Tellapragada, Chaitanya; Shaw, Tushar; D'Souza, Annet; Eshwara, Vandana Kalwaje; Mukhopadhyay, Chiranjay

    2017-07-01

    To evaluate the diagnostic utility of enrichment culture and PCR for improved case detection rates of non-bacteraemic form of melioidosis in limited resource settings. Clinical specimens (n = 525) obtained from patients presenting at a tertiary care hospital of South India with clinical symptoms suggestive of community-acquired pneumonia, lower respiratory tract infections, superficial or internal abscesses, chronic skin ulcers and bone or joint infections were tested for the presence of Burkholderia pseudomallei using conventional culture (CC), enrichment culture (EC) and PCR. Sensitivity, specificity, positive and negative predictive values of CC and PCR were initially deduced using EC as the gold standard method. Further, diagnostic accuracies of all the three methods were analysed using Bayesian latent class modelling (BLCM). Detection rates of B. pseudomallei using CC, EC and PCR were 3.8%, 5.3% and 6%, respectively. Diagnostic sensitivities and specificities of CC and PCR were 71.4, 98.4% and 100 and 99.4%, respectively in comparison with EC as the gold standard test. With Bayesian latent class modelling, EC and PCR demonstrated sensitivities of 98.7 and 99.3%, respectively, while CC showed a sensitivity of 70.3% for detection of B. pseudomallei. An increase of 1.6% (95% CI: 1.08-4.32%) in the case detection rate of melioidosis was observed in the study population when EC and/or PCR were used in adjunct to the conventional culture technique. Our study findings underscore the diagnostic superiority of enrichment culture and/or PCR over conventional microbiological culture for improved case detection of melioidosis from non-blood clinical specimens. © 2017 John Wiley & Sons Ltd.

  6. Development of ISA procedure for uranium fuel fabrication and enrichment facilities

    International Nuclear Information System (INIS)

    Yamate, Kazuki; Arakawa, Tomoyuki; Yamashita, Masahiro; Sasaki, Noriaki; Hirano, Mitsumasa

    2011-01-01

    The integrated safety analysis (ISA) procedure has been developed to apply risk-informed regulation to uranium fuel fabrication and enrichment facilities. The major development efforts are as follows: (a) preparing the risk level matrix as an index for items-relied-on-for-safety (IROFS) identification, (b) defining requirements of IROFS, and (c) determining methods of IROFS importance based on the results of risk- and scenario-based analyses. For the risk level matrix, the consequence and likelihood categories have been defined by taking into account the Japanese regulatory laws, rules, and safety standards. The trial analyses using the developed procedure have been performed for several representative processes of the reference uranium fuel fabrication and enrichment facilities. This paper presents the results of the ISA for the sintering process of the reference fabrication facility. The results of the trial analyses have demonstrated the applicability of the procedure to the risk-informed regulation of these facilities. (author)

  7. Aspects of the licensing procedures for enrichment reduction in research reactors

    International Nuclear Information System (INIS)

    Krull, W.

    1983-01-01

    The enrichment reduction for research reactors requires a licensing procedure. For this purpose the qualification of the new fuel has to be demonstrated and changes in reactor safety have to be investigated like reactivity values, form-factors, Pu- and fission product inventory, safety margins and accidents. Calculations should be partly experimentally verified. The possible extent of the licensing procedure is discussed. (orig.) [de

  8. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures

    OpenAIRE

    McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...

  9. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  10. Procedure and technique critique for tritium enrichment by electrolysis at the IAEA Laboratory (effective November 1976)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1976-11-05

    This publication gives a detailed description of the experimental and calculation procedures for tritium enrichment. Most descriptive sections are divided into 2 parts: Section A describes the procedure in the IAEA laboratory; section B discusses the reasons behind the various procedures, and may indicate alternative acceptable, or in some cases even better, procedures. The description of the equipment focuses on electrolysis cells, cooling system and power supply. Routine procedures are discussed including handling and checking of samples after receipt, 'spike' and blank water, initial sample distillation, preparation of cells and samples for electrolysis, electrolysis and completion of electrolysis (weighing of cells, neutralisation and distillation) and precautions against contaminations (prevention, detection and cure). A list of equipment required for electrolytic enrichment of tritium is provided.

  11. Procedure and technique critique for tritium enrichment by electrolysis at the IAEA Laboratory (effective November 1976)

    International Nuclear Information System (INIS)

    1976-01-01

    This publication gives a detailed description of the experimental and calculation procedures for tritium enrichment. Most descriptive sections are divided into 2 parts: Section A describes the procedure in the IAEA laboratory; section B discusses the reasons behind the various procedures, and may indicate alternative acceptable, or in some cases even better, procedures. The description of the equipment focuses on electrolysis cells, cooling system and power supply. Routine procedures are discussed including handling and checking of samples after receipt, 'spike' and blank water, initial sample distillation, preparation of cells and samples for electrolysis, electrolysis and completion of electrolysis (weighing of cells, neutralisation and distillation) and precautions against contaminations (prevention, detection and cure). A list of equipment required for electrolytic enrichment of tritium is provided

  12. A Multiscale Enrichment Procedure for Nonlinear Monotone Operators

    KAUST Repository

    Efendiev, Yalchin R.

    2014-03-11

    In this paper, multiscale finite element methods (MsFEMs) and domain decomposition techniques are developed for a class of nonlinear elliptic problems with high-contrast coefficients. In the process, existing work on linear problems [Y. Efendiev, J. Galvis, R. Lazarov, S. Margenov and J. Ren, Robust two-level domain decomposition preconditioners for high-contrast anisotropic flows in multiscale media. Submitted.; Y. Efendiev, J. Galvis and X. Wu, J. Comput. Phys. 230 (2011) 937–955; J. Galvis and Y. Efendiev, SIAM Multiscale Model. Simul. 8 (2010) 1461–1483.] is extended to treat a class of nonlinear elliptic operators. The proposed method requires the solutions of (small dimension and local) nonlinear eigenvalue problems in order to systematically enrich the coarse solution space. Convergence of the method is shown to relate to the dimension of the coarse space (due to the enrichment procedure) as well as the coarse mesh size. In addition, it is shown that the coarse mesh spaces can be effectively used in two-level domain decomposition preconditioners. A number of numerical results are presented to complement the analysis.

  13. Modeling of 5 ' nuclease real-time responses for optimization of a high-throughput enrichment PCR procedure for Salmonella enterica

    DEFF Research Database (Denmark)

    Knutsson, R.; Löfström, Charlotta; Grage, H.

    2002-01-01

    The performance of a 5' nuclease real-time PCR assay was studied to optimize an automated method of detection of preenriched Salmonella enterica cells in buffered peptone water (BPW). The concentrations and interactions of the PCR reagents were evaluated on the basis of two detection responses, t...

  14. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

  15. Enrichment of Acinetobacter spp. from food samples.

    Science.gov (United States)

    Carvalheira, Ana; Ferreira, Vânia; Silva, Joana; Teixeira, Paula

    2016-05-01

    Relatively little is known about the role of foods in the chain of transmission of acinetobacters and the occurrence of different Acinetobacter spp. in foods. Currently, there is no standard procedure to recover acinetobacters from food in order to gain insight into the food-related ecology and epidemiology of acinetobacters. This study aimed to assess whether enrichment in Dijkshoorn enrichment medium followed by plating in CHROMagar™ Acinetobacter medium is a useful method for the isolation of Acinetobacter spp. from foods. Recovery of six Acinetobacter species from food spiked with these organisms was compared for two selective enrichment media (Baumann's enrichment and Dijkshoorn's enrichment). Significantly (p enrichment. Next, the Dijkshoorn's enrichment followed by direct plating on CHROMagar™ Acinetobacter was applied to detect Acinetobacter spp. in different foods. Fourteen different presumptive acinetobacters were recovered and assumed to represent nine different strains on the basis of REP-PCR typing. Eight of these strains were identified by rpoB gene analysis as belonging to the species Acinetobacter johnsonii, Acinetobacter calcoaceticus, Acinetobacter guillouiae and Acinetobacter gandensis. It was not possible to identify the species level of one strain which may suggests that it represents a distinct species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Detection of Small Numbers of Campylobacter jejuni and Campylobacter coli Cells in Environmental Water, Sewage, and Food Samples by a Seminested PCR Assay

    Science.gov (United States)

    Waage, Astrid S.; Vardund, Traute; Lund, Vidar; Kapperud, Georg

    1999-01-01

    A rapid and sensitive assay was developed for detection of small numbers of Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and food samples. Water and sewage samples were filtered, and the filters were enriched overnight in a nonselective medium. The enrichment cultures were prepared for PCR by a rapid and simple procedure consisting of centrifugation, proteinase K treatment, and boiling. A seminested PCR based on specific amplification of the intergenic sequence between the two Campylobacter flagellin genes, flaA and flaB, was performed, and the PCR products were visualized by agarose gel electrophoresis. The assay allowed us to detect 3 to 15 CFU of C. jejuni per 100 ml in water samples containing a background flora consisting of up to 8,700 heterotrophic organisms per ml and 10,000 CFU of coliform bacteria per 100 ml. Dilution of the enriched cultures 1:10 with sterile broth prior to the PCR was sometimes necessary to obtain positive results. The assay was also conducted with food samples analyzed with or without overnight enrichment. As few as ≤3 CFU per g of food could be detected with samples subjected to overnight enrichment, while variable results were obtained for samples analyzed without prior enrichment. This rapid and sensitive nested PCR assay provides a useful tool for specific detection of C. jejuni or C. coli in drinking water, as well as environmental water, sewage, and food samples containing high levels of background organisms. PMID:10103261

  17. Diversity of reductive dehalogenase genes from environmental samples and enrichment cultures identified with degenerate primer PCR screens.

    Directory of Open Access Journals (Sweden)

    Laura Audrey Hug

    2013-11-01

    Full Text Available Reductive dehalogenases are the critical enzymes for anaerobic organohalide respiration, a microbial metabolic process that has been harnessed for bioremediation efforts to resolve chlorinated solvent contamination in groundwater and is implicated in the global halogen cycle. Reductive dehalogenase sequence diversity is informative for the dechlorination potential of the site or enrichment culture. A suite of degenerate PCR primers targeting a comprehensive curated set of reductive dehalogenase genes was designed and applied to twelve DNA samples extracted from contaminated and pristine sites, as well as six enrichment cultures capable of reducing chlorinated compounds to non-toxic end-products. The amplified gene products from four environmental sites and two enrichment cultures were sequenced using Illumina HiSeq, and the reductive dehalogenase complement of each sample determined. The results indicate that the diversity of the reductive dehalogenase gene family is much deeper than is currently accounted for: one-third of the translated proteins have less than 70% pairwise amino acid identity to database sequences. Approximately 60% of the sequenced reductive dehalogenase genes were broadly distributed, being identified in four or more samples, and often in previously sequenced genomes as well. In contrast, 17% of the sequenced reductive dehalogenases were unique, present in only a single sample and bearing less than 90% pairwise amino acid identity to any previously identified proteins. Many of the broadly distributed reductive dehalogenases are uncharacterized in terms of their substrate specificity, making these intriguing targets for further biochemical experimentation. Finally, comparison of samples from a contaminated site and an enrichment culture derived from the same site eight years prior allowed examination of the effect of the enrichment process.

  18. A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.

    Science.gov (United States)

    Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V

    2014-01-01

    Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

  19. 9 CFR 147.16 - Procedure for the evaluation of mycoplasma reactors by in vivo bio-assay (enrichment).

    Science.gov (United States)

    2010-01-01

    ... mycoplasma reactors by in vivo bio-assay (enrichment). 147.16 Section 147.16 Animals and Animal Products... the evaluation of mycoplasma reactors by in vivo bio-assay (enrichment). This procedure has been shown... publications: (a) Bigland, C. H. and A. J. DaMassa, “A Bio-Assay for Mycoplasma Gallisepticum.” In: United...

  20. Evaluation of PCR and DNA hybridization protocols for detection of viable enterotoxigenic Clostridium perfringens in irradiated beef

    International Nuclear Information System (INIS)

    Baez, L.A.; Juneja, V.K.; Thayer, D.W.; Sackitey, S.

    1997-01-01

    The sensitivity of DNA hybridization and polymerase chain reaction (PCR), was evaluated in irradiated cooked and raw beef samples. A membrane-based colony hybridization assay and a PCR protocol, both with specificity for the enterotoxin A gene of Clostridium perfringens, were compared with viable plate counts. The results of the colony hybridization procedure were in agreement with viable plate counts for detection and enumeration of enterotoxigenic C. perfringens. The PCR procedure combined a 4 h enrichment followed by a nucleic acid extraction step and assessed the amplification of 183 and 750 base pair enterotoxin gene targets. Detection of C. perfringens by PCR did not show a reliable correlation with viable plate counts or the colony hybridization assay. C. perfringens killed by irradiation were not detected by the plate count or colony hybridization methods; however, killed cells were detected with the PCR technique. By relying on the growth of viable cells for detection and/or enumeration, the colony hybridization and plate count methods provided a direct correlation with the presence of viable bacteria

  1. Development of ISA procedure for uranium fuel fabrication and enrichment facilities: overview of ISA procedure and its application

    International Nuclear Information System (INIS)

    Yamate, Kazuki; Yamada, Takashi; Takanashi, Mitsuhiro; Sasaki, Noriaki

    2013-01-01

    Integrated Safety Analysis (ISA) procedure for uranium fuel fabrication and enrichment facilities has been developed for aiming at applying risk-informed regulation to these uranium facilities. The development has carried out referring to the ISA (NUREG-1520) by the Nuclear Regulatory Commission (NRC). The paper presents purpose, principles and activities for the development of the ISA procedure, including Risk Level (RL) matrix and grading evaluation method of IROFS (Items Relied on for Safety), as well as general description and features of the procedure. Also described in the paper is current status in application of risk information from the ISA. Japanese four licensees of the uranium facilities have been conducting ISA for their representative processes using the developed procedure as their voluntary safety activities. They have been accumulating experiences and knowledge on the ISA procedure and risk information through the field activities. NISA (Nuclear and Industrial Safety Agency) and JNES (Japan Nuclear Energy Safety Organization) are studying how to use such risk information for the safety regulation of the uranium facilities, taking into account the licensees' experiences and knowledge. (authors)

  2. Sensitivity of Direct Culture, Enrichment and PCR for Detection of Campylobacter jejuni and C. coli in Broiler Flocks at Slaughter.

    Science.gov (United States)

    Rodgers, J D; Simpkin, E; Lee, R; Clifton-Hadley, F A; Vidal, A B

    2017-06-01

    Broiler chicken flocks are a significant source of Campylobacter jejuni and Campylobacter coli that result in the major public health problem of campylobacteriosis. Accurate estimates of the prevalence of both C. coli and C. jejuni in flocks would enhance epidemiological understanding, risk assessment and control options. This study combined results from a panel of 10 detection tests (direct culture, enrichment and PCR) on caecal samples from flocks at slaughter. A parallel interpretation approach was used to determine the presence of Campylobacter spp. and for C. jejuni and C. coli individually. The sample was considered positive if at least one method detected the target and this interpretation was taken to represent a 'proxy gold standard' for detection in the absence of a gold standard reference test. The sensitivity of each individual method to detect Campylobacter spp., C. jejuni and C. coli was then estimated relative to the proxy gold standard. Enrichment in adapted Exeter broth (deficient in polymyxin B) with a resuscitation step was 100% sensitive, whilst direct culture on modified charcoal cefoperazone deoxycholate agar (mCCDA) was highly sensitive (97.9%). Enrichment methods using Preston broth and Bolton broth were significantly less sensitive. Enrichment in Exeter broth promoted the recovery of C. jejuni, whilst enrichment in Bolton broth favoured C. coli. A RT-PCR detection test could identify 80% of flocks that were co-colonised with both species. This study found that 76.3% (n = 127) of flocks were colonised with Campylobacter spp. The majority (95.9%) of Campylobacter-positive flocks were colonised with C. jejuni; however, approximately one-third of positive flocks were simultaneously colonised with both C. jejuni and C. coli. The findings highlight the impact of different detection methodologies on the accuracy of the estimated incidence of both C. jejuni and C. coli entering the abattoir within broiler flocks and the associated

  3. Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

    Science.gov (United States)

    Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

    2014-12-01

    Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

  4. Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.

    Science.gov (United States)

    Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina

    2010-02-01

    Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.

  5. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. A PCR procedure for the detection of Giardia intestinalis cysts and Escherichia coli in lettuce.

    Science.gov (United States)

    Ramirez-Martinez, M L; Olmos-Ortiz, L M; Barajas-Mendiola, M A; Giono Cerezo, S; Avila, E E; Cuellar-Mata, P

    2015-06-01

    Giardia intestinalis is a pathogen associated with foodborne outbreaks and Escherichia coli is commonly used as a marker of faecal contamination. Implementation of routine identification methods of G. intestinalis is difficult for the analysis of vegetables and the microbiological detection of E. coli requires several days. This study proposes a PCR-based assay for the detection of E. coli and G. intestinalis cysts using crude DNA isolated from artificially contaminated lettuce. The G. intestinalis and E. coli PCR assays targeted the β-giardin and uidA genes, respectively, and were 100% specific. Forty lettuces from local markets were analysed by both PCR and light microscopy and no cysts were detected, the calculated detection limit was 20 cysts per gram of lettuce; however, by PCR, E. coli was detected in eight of ten randomly selected samples of lettuce. These data highlight the need to validate procedures for routine quality assurance. These PCR-based assays can be employed as alternative methods for the detection of G. intestinalis and E. coli and have the potential to allow for the automation and simultaneous detection of protozoa and bacterial pathogens in multiple samples. Significance and impact of the study: There are few studies for Giardia intestinalis detection in food because methods for its identification are difficult for routine implementation. Here, we developed a PCR-based method as an alternative to the direct observation of cysts in lettuce by light microscopy. Additionally, Escherichia coli was detected by PCR and the sanitary quality of lettuce was evaluated using molecular and standard microbiological methods. Using PCR, the detection probability of Giardia cysts inoculated onto samples of lettuce was improved compared to light microscopy, with the advantage of easy automation. These methods may be employed to perform timely and affordable detection of foodborne pathogens. © 2015 The Society for Applied Microbiology.

  7. Comparative validation using quantitative real-time PCR (qPCR and conventional PCR of bovine semen centrifuged in continuous density gradient

    Directory of Open Access Journals (Sweden)

    M.V. Resende

    2011-06-01

    Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.

  8. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  9. Extraosseus enrichments in bone scintigraphy

    International Nuclear Information System (INIS)

    Jochens, R.; Schumacher, T.; Amthauer, H.; Wolter, M.; Stock, W.; Stroszczynski, C.; Moersler, J.P.; Eichstaedt, H.

    1996-01-01

    Extraosseus enrichments are common findings in bone scintigraphy. Main causes are artifacts by skin or cloth contamination, paravenous and subcutaneous injection. Physical examination, removal of cloths, skin cleaning or further images in differing projections lead to the correct diagnosis artefact or extraosseous enrichments. Further on, extraosseous enrichments are seen in physiological variants. In different diseases extraosseous enrichments are common, especially in urinary tract, liver and extremities. Further diagnostics, e.g. conventional radiologic procedures, sonography and CT scans, have to be performed. In individual cases side results in bone scintigraphy lead to formerly unknown diagnosis, further diagnostic procedure is influenced decisively. Own cases show for example a cerebral apoplectic insult, formerly unknown liver metastasis or metastasis in extraosseous Ewings's sarcoma. (orig.) [de

  10. Quantification of Growth of Campylobacter and Extended Spectrum β-Lactamase Producing Bacteria Sheds Light on Black Box of Enrichment Procedures.

    Science.gov (United States)

    Hazeleger, Wilma C; Jacobs-Reitsma, Wilma F; den Besten, Heidy M W

    2016-01-01

    Campylobacter is well recognized as the leading cause of bacterial foodborne diarrheal disease worldwide, and is routinely found in meat originating from poultry, sheep, pigs, and cattle. Effective monitoring of Campylobacter contamination is dependent on the availability of reliable detection methods. The method of the International Organization for Standardization for the detection of Campylobacter spp. in food (ISO 10272-1:2006) recommends the use of Bolton broth (BB) as selective enrichment medium, including a pre-enrichment step of 4-6 h at 37°C to revive sublethally damaged cells prior to incubation for 2 days at 41.5°C. Recently the presence of abundantly growing extended spectrum β-lactamase producing Enterobacteriaceae (ESBL bacteria) has become one of the most important factors that interfere with the isolation of Campylobacter, resulting in false-negative detection. However, detailed growth dynamics of Campylobacter and its competitors remain unclear, where these would provide a solid base for further improvement of the enrichment procedure for Campylobacter. Other enrichment broths, such as Preston broth (PB) and BB plus clavulanic acid (BBc) have been suggested to inhibit competitive flora. Therefore, these different broths were used as enrichments to measure the growth kinetics of several strains of Campylobacter jejuni and ESBL bacteria separately, in co-culture and of strains in chicken samples. The maximum cell numbers and often the growth rates of Campylobacter in mixed culture with ESBL bacteria were significantly lower than in single cultures, indicating severe suppression of Campylobacter by ESBL bacteria, also in naturally contaminated samples. PB and BBc successfully diminished ESBL bacteria and might therefore be a better choice as enrichment medium in possibly ESBL-bacteria contaminated samples. The efficacy of a pre-enrichment step in the BB ISO-procedure was not supported for cold-stressed and non-stressed cells. Therefore, omission of

  11. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  12. Comparison of the quantification of KRAS mutations by digital PCR and E-ice-COLD-PCR in circulating-cell-free DNA from metastatic colorectal cancer patients.

    Science.gov (United States)

    Sefrioui, David; Mauger, Florence; Leclere, Laurence; Beaussire, Ludivine; Di Fiore, Frédéric; Deleuze, Jean-François; Sarafan-Vasseur, Nasrin; Tost, Jörg

    2017-02-01

    Circulating cell-free DNA (ccfDNA) bears great promise as biomarker for personalized medicine, but ccfDNA is present only at low levels in the plasma or serum of cancer patients. E-ice-COLD-PCR is a recently developed enrichment method to detect and identify mutations present at low-abundance in clinical samples. However, recent studies have shown the importance to accurately quantify low-abundance mutations as clinically important decisions will depend on certain mutation thresholds. The possibility for an enrichment method to accurately quantify the mutation levels remains a point of concern and might limit its clinical applicability. In the present study, we compared the quantification of KRAS mutations in ccfDNA from metastatic colorectal cancer patients by E-ice-COLD-PCR with two digital PCR approaches. For the quantification of mutations by E-ice-COLD-PCR, cell lines with known mutations diluted into WT genomic DNA were used for calibration. E-ice-COLD-PCR and the two digital PCR approaches showed the same range of the mutation level and were concordant for mutation levels below the clinical relevant threshold. E-ice-COLD-PCR can accurately detect and quantify low-abundant mutations in ccfDNA and has a shorter time to results making it compatible with the requirements of analyses in a clinical setting without the loss of quantitative accuracy. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  14. Hybridization Capture Using Short PCR Products Enriches Small Genomes by Capturing Flanking Sequences (CapFlank)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas

    2014-01-01

    nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...

  15. PCR amplification of Bartonella koehlerae from human blood and enrichment blood cultures

    Directory of Open Access Journals (Sweden)

    Breitschwerdt Edward B

    2010-08-01

    Full Text Available Abstract Background Cats appear to be the primary reservoir host for Bartonella koehlerae, an alpha Proteobacteria that is most likely transmitted among cat populations by fleas (Ctenocephalides felis. Bartonella koehlerae has caused endocarditis in a dog and in one human patient from Israel, but other clinically relevant reports involving this bacterium are lacking. Despite publication of numerous, worldwide epidemiological studies designed to determine the prevalence of Bartonella spp. bacteremia in cats, B. koehlerae has never been isolated using conventional blood agar plates. To date, successful isolation of B. koehlerae from cats and from the one human endocarditis patient has consistently required the use of chocolate agar plates. Results In this study, Bartonella koehlerae bacteremia was documented in eight immunocompetent patients by PCR amplification and DNA sequencing, either prior to or after enrichment blood culture using Bartonella alpha Proteobacteria growth medium. Presenting symptoms most often included fatigue, insomnia, joint pain, headache, memory loss, and muscle pain. Four patients were also infected with Bartonella vinsonii subsp. berkhoffii genotype II. After molecular documentation of B. koehlerae infection in these patients, a serological test was developed and serum samples were tested retrospectively. Bartonella koehlerae antibodies were not detected (titers B. koehlerae antibody titers of 1:64 or greater. Conclusions Although biased by a study population consisting of individuals with extensive arthropod and animal exposure, the results of this study suggest that B. koehlerae bacteremia is more common in immunocompetent people than has been previously suspected. Future studies should more thoroughly define modes of transmission and risk factors for acquiring infection with B. koehlerae. In addition, studies are needed to determine if B. koehlerae is a cause or cofactor in the development of arthritis, peripheral

  16. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  17. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-05-01

    Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.

  18. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  19. Optimisation of Forensic Genetics Procedures Used in Disputed Paternity Testing: Adjustment of the PCR Reaction Volume

    Directory of Open Access Journals (Sweden)

    Damir Marjanović

    2006-05-01

    Full Text Available Standard molecular techniques, with only a slight modification, are very useful in obtaining and interpreting the final results in the field of forensic genetic. Data obtained through such analysis are highly reliable and can be used as a very powerful tool that produces valuable results. However, success and swiftness of DNA typing of biological evidence either that found at a crime scene or used in disputed paternity testing, depends on the optimization of numerous factors. One of the most important and critical phases that ensures reliability of the whole procedure is the choice of the most suitable volume for the amplification protocol. Buccal swabs were collected from volunteers. DNA was extracted by Qiagen Dnaeasy Tissue Kit. PowerPlex 16 kit was used to simultaneously amplify 15 STR loci by PCR. Amplification was carried out as described previously. The tested total working reaction volumes were 5, 10 and 25 microl. The PCR amplification was carried out in PE Gene Amp PCR System Thermal Cycler (ABI, Foster City, CA. Amplification products were analyzed on an ABI PRISM 377 instrument (ABI, Foster City, CA in 5% bis-acrilamide gel. Amplification was generally successful for all the tested reaction volumes. Lower partial to complete DNA profiles ratio, the quality of obtained STR profiles, significantly reduced amount of reaction's components give advantage to 5 microl reaction volume over other two tested volumes in this case.

  20. Hybridization Capture Using Short PCR Products Enriches Small Genomes by Capturing Flanking Sequences (CapFlank)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas

    2014-01-01

    , a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...

  1. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  2. A combined enrichment/polymerase chain reaction based method for the routine screening of Streptococcus agalactiae in pregnant women

    Directory of Open Access Journals (Sweden)

    F.M. Munari

    2012-03-01

    Full Text Available Group B Streptococcus (GBS is the most common cause of life-threatening infection in neonates. Guidelines from CDC recommend universal screening of pregnant women for rectovaginal GBS colonization. The objective of this study was to compare the performance of a combined enrichment/PCR based method targeting the atr gene in relation to culture using enrichment with selective broth medium (standard method to identify the presence of GBS in pregnant women. Rectovaginal GBS samples from women at ≥36 weeks of pregnancy were obtained with a swab and analyzed by the two methods. A total of 89 samples were evaluated. The prevalence of positive results for GBS detection was considerable higher when assessed by the combined enrichment/PCR method than with the standard method (35.9% versus 22.5%, respectively. The results demonstrated that the use of selective enrichment broth followed by PCR targeting the atr gene is a highly sensitive, specific and accurate test for GBS screening in pregnant women, allowing the detection of the bacteria even in lightly colonized patients. This PCR methodology may provide a useful diagnostic tool for GBS detection and contributes for a more accurate and effective intrapartum antibiotic and lower newborn mortality and morbidity.

  3. Effect of carryover and presampling procedures on the results of real-time PCR used for diagnosis of bovine intramammary infections with Streptococcus agalactiae at routine milk recordings

    DEFF Research Database (Denmark)

    Mahmmod, Yasser; Mweu, Marshal Mutinda; Nielsen, Søren Saxmose

    2014-01-01

    with Streptococcus agalactiae (S. agalactiae) in dairy herds with conventional milking parlours. Misclassification may result in unnecessary costs for treatment and culling. The objectives of this study were to (1) determine the effect of carryover on PCR-positivity for S. agalactiae at different PCR cycle threshold...... (Ct) cut-offs by estimating the between-cow correlation while accounting for the milking order, and (2) evaluate the effect of aseptic presampling procedures (PSP) on PCR-positivity at the different Ct-value cut-offs. The study was conducted in four herds with conventional milking parlours at routine...

  4. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  5. A standard curve based method for relative real time PCR data processing

    Directory of Open Access Journals (Sweden)

    Krause Andreas

    2005-03-01

    Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that

  6. Report of the Subcommittee on Domestic Uranium Enrichment

    International Nuclear Information System (INIS)

    1981-01-01

    A report by the Subcommittee on Domestic Uranium Enrichment to the Atomic Energy Commission is described; which covers the procedure of the domestic uranium enrichment by centrifugal process up to the commercial production, reviewing the current situation in this field. Domestic uranium enrichment is important in the aspects of securing stable enrichment service, establishing sound fuel cycle, and others. As the future target, the production around the year 2000 is set at 3,000 tons SWU per year at least. The business of uranium enrichment, which is now developed in the Power Reactor and Nuclear Fuel Development Corporation, is to be carried out by private enterprise. The contents are as follows: demand and supply balance of uranium enrichment service, significance of domestic uranium enrichment, evaluation of centrifugal uranium enrichment technology, the target of domestic uranium enrichment, the policy of domestic uranium enrichment promotion. (J.P.N.)

  7. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    Science.gov (United States)

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  8. Photochemical immobilization of anthraquinone conjugated oligonucleotides and PCR amplicons on solid surfaces

    DEFF Research Database (Denmark)

    Koch, T.; Jacobsen, N.; Fensholdt, J.

    2000-01-01

    Ligand immobilization on solid surfaces is an essential step in fields such as diagnostics, bio sensor manufacturing, and new material sciences in general. In this paper a photochemical approach based on anthraquinone as the chromophore is presented. Photochemical procedures offer special...... advantages as they are able to generate highly reactive species in an orientation specific manner. As presented here, anthraquinone (AQ) mediated covalent DNA immobilization appears to be superior to currently known procedures. A synthetic procedure providing AQ-phosphoramidites is presented. These reagents...... facilitate AQ conjugation during routine DNA synthesis, thus enabling the AQ-oligonucleotides to be immobilized in a very convenient and efficient manner. AQ-conjugated PCR primers can be used directly in PCR. When the PCR is performed in solution, the amplicons can be immobilized after the PCR. Moreover...

  9. A study of the material accountancy procedure at the uranium enrichment facility

    International Nuclear Information System (INIS)

    Shirahashi, J.; Akiba, M.; Omae, M.

    1984-01-01

    This paper describes an evaluation of material accountancy based on total uranium (U element MUF) to detect diversions of significant quantity in the uranium enrichment facility operating at a stated maximum enrichment level of 5%. Verification that material production is within the declared enrichment can be achieved by the inspection activities associated with limited - frequency unannounced access (LFUA) to cascade areas as treated extensively in HSP. According to the experience of the material accountancy at our facility, the reduction of the material accountancy capability by changing from U-235 isotope MUF to U element MUF is only about half. However, still the U element MUF approach can meet the current IAEA detection goals for the up to about 1000 tswu/a plant

  10. A survey of tools for the analysis of quantitative PCR (qPCR) data.

    Science.gov (United States)

    Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas

    2014-09-01

    Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.

  11. Developments in uranium enrichment

    International Nuclear Information System (INIS)

    Mohrhauer, H.

    1995-01-01

    The enrichment services market is still characterized by overcapacities. While consumption worldwide will rise by some 15% to 39,000 t SWU/a over the next ten years, capacities amount to nearly 50,000 t SWU/a. The price for enrichment services probably has reached its all time low. Prices below U.S. $ 100/kg SWU are not likely to cover costs even of the economically most advanced enrichment processes. Urenco has prepared for the difficult enrichment business in the years to come by streamlining and cost cutting measures. The company intends to hold and increase its share of more than 10% in the world market. The uranium enrichment plant of Gronau will be expanded further. Expansion beyond 1000 t is subject to another permit being granted under the Atomic Energy Act, an application for which was filed in December 1994. Centrifuge technology is the superior enrichment technology, i.e., there is still considerable potential for further development. Construction of enrichment plants employing the centrifuge technology in the United States and in France is being pursued in various phases, from feasibility studies to licensing procedures. Before these plants could be implemented, however, considerable problems of organization would have to be solved, and the market would have to change greatly, respectively. The laser process, at the present time, does not seem to be able to develop into a major industrial competitor. (orig.) [de

  12. Data analysis for neutron monitoring in an enrichment facility

    International Nuclear Information System (INIS)

    Markin, J.T.; Stewart, J.E.; Goldman, A.S.

    1982-01-01

    Area monitoring of neutron radiation to detect high-enriched uranium production is a potential strategy for inspector verification of operations in the cascade area of a centrifuge enrichment facility. This paper discusses the application of statistical filtering and hypothesis testing procedures to experimental data taken in an enrichment facility. The results demonstrate that these data analysis methods can enhance detection of facility misoperation by neutron monitoring

  13. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  14. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  15. Study On Application Of Molecular Techniques (RAPD-PCR And RAMP-PCR) To Detect Mutation In Rice Breeding

    International Nuclear Information System (INIS)

    Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham

    2007-01-01

    The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)

  16. Mangrove microniches determine the structural and functional diversity of enriched petroleum hydrocarbon-degrading consortia.

    Science.gov (United States)

    Gomes, Newton C M; Flocco, Cecilia G; Costa, Rodrigo; Junca, Howard; Vilchez, Ramiro; Pieper, Dietmar H; Krögerrecklenfort, Ellen; Paranhos, Rodolfo; Mendonça-Hagler, Leda C S; Smalla, Kornelia

    2010-11-01

    In this study, the combination of culture enrichments and molecular tools was used to identify bacterial guilds, plasmids and functional genes potentially important in the process of petroleum hydrocarbon (PH) decontamination in mangrove microniches (rhizospheres and bulk sediment). In addition, we aimed to recover PH-degrading consortia (PHDC) for future use in remediation strategies. The PHDC were enriched with petroleum from rhizosphere and bulk sediment samples taken from a mangrove chronically polluted with oil hydrocarbons. Southern blot hybridization (SBH) assays of PCR amplicons from environmental DNA before enrichments resulted in weak positive signals for the functional gene types targeted, suggesting that PH-degrading genotypes and plasmids were in low abundance in the rhizosphere and bulk sediments. However, after enrichment, these genes were detected and strong microniche-dependent differences in the abundance and composition of hydrocarbonoclastic bacterial populations, plasmids (IncP-1α, IncP-1β, IncP-7 and IncP-9) and functional genes (naphthalene, extradiol and intradiol dioxygenases) were revealed by in-depth molecular analyses [PCR-denaturing gradient gel electrophoresis and hybridization (SBH and microarray)]. Our results suggest that, despite the low abundance of PH-degrading genes and plasmids in the environmental samples, the original bacterial composition of the mangrove microniches determined the structural and functional diversity of the PHDC enriched. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  18. Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

    Science.gov (United States)

    Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

    2017-08-01

    Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

  19. Phylogenetic analysis of TCE-dechlorinating consortia enriched on a variety of electron donors.

    Science.gov (United States)

    Freeborn, Ryan A; West, Kimberlee A; Bhupathiraju, Vishvesh K; Chauhan, Sadhana; Rahm, Brian G; Richardson, Ruth E; Alvarez-Cohen, Lisa

    2005-11-01

    Two rapidly fermented electron donors, lactate and methanol, and two slowly fermented electron donors, propionate and butyrate, were selected for enrichment studies to evaluate the characteristics of anaerobic microbial consortia that reductively dechlorinate TCE to ethene. Each electron donor enrichment subculture demonstrated the ability to dechlorinate TCE to ethene through several serial transfers. Microbial community analyses based upon 16S rDNA, including terminal restriction fragment length polymorphism (T-RFLP) and clone library/sequencing, were performed to assess major changes in microbial community structure associated with electron donors capable of stimulating reductive dechlorination. Results demonstrated that five phylogenic subgroups or genera of bacteria were present in all consortia, including Dehalococcoides sp., low G+C Gram-positives (mostly Clostridium and Eubacterium sp.), Bacteroides sp., Citrobacter sp., and delta Proteobacteria (mostly Desulfovibrio sp.). Phylogenetic association indicates that only minor shifts in the microbial community structure occurred between the four alternate electron donor enrichments and the parent consortium. Inconsistent detection of Dehalococcoides spp. in clone libraries and T-RFLP of enrichment subcultures was resolved using quantitative polymerase chain reaction (Q-PCR). Q-PCR with primers specific to Dehalococcoides 16S rDNA resulted in positive detection of this species in all enrichments. Our results suggest that TCE-dechlorinating consortia can be stably maintained on a variety of electron donors and that quantities of Dehalococcoides cells detected with Dehalococcoides specific 16S rDNA primer/probe sets do not necessarily correlate well with solvent degradation rates.

  20. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

    2009-07-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  1. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    International Nuclear Information System (INIS)

    Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

    2009-01-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  2. Detection of uranium enrichment activities using environmental monitoring techniques

    International Nuclear Information System (INIS)

    Belew, W.L.; Carter, J.A.; Smith, D.H.; Walker, R.L.

    1993-01-01

    Uranium enrichment processes have the capability of producing weapons-grade material in the form of highly enriched uranium. Thus, detection of undeclared uranium enrichment activities is an international safeguards concern. The uranium separation technologies currently in use employ UF 6 gas as a separation medium, and trace quantities of enriched uranium are inevitably released to the environment from these facilities. The isotopic content of uranium in the vegetation, soil, and water near the plant site will be altered by these releases and can provide a signature for detecting the presence of enriched uranium activities. This paper discusses environmental sampling and analytical procedures that have been used for the detection of uranium enrichment facilities and possible safeguards applications of these techniques

  3. Comparison of noninvasive sample collection procedures for canine leishmaniasis diagnosis by PCR-hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Sidney de Almeida; Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mail: vidasnino@yahoo.com.br; antero@cdtn.br; Ituassu, Leonardo Trindade; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)]. E-mail: melo@mono.icb.ufmg.br; ltituassu@yahoo.com.br

    2007-07-01

    The dogs are the main reservoir of the visceral leishmaniasis etiological agent Leishmania chagasi and these animals have to be systematically monitored. The aim of present work was to standardize a method for canine leishmaniasis diagnosis using DNA samples obtained by a noninvasive ways. Two kind of samples were compared: conjunctival swab and blood. The samples were analyzed by the Polymerase Chain Reaction (PCR) associated with the hybridization of {sup 32}P labeled DNA probes. An in vitro test was carried out using cotton swabs seeded with L. chagasi parasites at different cell numbers. After that, the PCR and hybridization sensitivity was evaluated in two groups of 23 seropositive dogs. Conjunctival swabs and 1,0 mL of blood were collected from each animal. 90 {mu}L of these blood were spotted onto filter paper and the remaining used to prepare the buffy coat. The DNA purification from cotton swabs was carried out through the phenol-chloroform (group 1) or boiling (group 2). The Wizard kit was used to DNA extraction from buffy coat. The filters were treated according to Dialab protocol. The analysis of the seeded samples showed that the PCR was able to identify until ten parasites while the following hybridization of the PCR products allows the detection of until one parasite. The PCR positivity for the conjunctival swabs were 73.9% and 52.2% respectively to the groups 1 and 2. For buffy coat the positivities were 43.5% and 56.5% respectively. The filters presented the lowest positivity. The hybridization step was not accomplished yet for these samples. (author)

  4. Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

    African Journals Online (AJOL)

    Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

  5. A simple procedure for the extraction of DNA from long-term formalin-preserved brain tissues for the detection of EBV by PCR.

    Science.gov (United States)

    Hassani, Asma; Khan, Gulfaraz

    2015-12-01

    Long-term formalin fixed brain tissues are potentially an important source of material for molecular studies. Ironically, very few protocols have been published describing DNA extraction from such material for use in PCR analysis. In our attempt to investigate the role of Epstein-Barr virus (EBV) in the pathogenesis of multiple sclerosis (MS), extracting PCR quality DNA from brain samples fixed in formalin for 2-22 years, proved to be very difficult and challenging. As expected, DNA extracted from these samples was not only of poor quality and quantity, but more importantly, it was frequently found to be non-amplifiable due to the presence of PCR inhibitors. Here, we describe a simple and reproducible procedure for extracting DNA using a modified proteinase K and phenol-chloroform methodology. Central to this protocol is the thorough pre-digestion washing of the tissues in PBS, extensive digestion with proteinase K in low SDS containing buffer, and using low NaCl concentration during DNA precipitation. The optimized protocol was used in extracting DNA from meninges of 26 MS and 6 non-MS cases. Although the quality of DNA from these samples was generally poor, small size amplicons (100-200 nucleotides) of the house-keeping gene, β-globin could be reliably amplified from all the cases. PCR for EBV revealed positivity in 35% (9/26) MS cases, but 0/6 non-MS cases. These findings indicate that the method described here is suitable for PCR detection of viral sequences in long-term formalin persevered brain tissues. Our findings also support a possible role for EBV in the pathogenesis of MS. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. An improved cell recovery method for iron oxidizing bacterial (IOB) enrichments

    DEFF Research Database (Denmark)

    Yu, Ran; Graf, Joerg; Smets, Barth F.

    2008-01-01

    Two cell recovery methods for IOB enrichments were evaluated for DNA extraction and further PCR-based 16S rRNA gene clone library creation. One was a published method consisting of heating plus oxalic acid treatment and the other one was a new method based on enzymatic agarose digestion (using β...

  7. Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR

    Directory of Open Access Journals (Sweden)

    Ta-Hsien Lee

    2017-08-01

    Conclusion: The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic.

  8. Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples

    Directory of Open Access Journals (Sweden)

    Whyte Paul

    2008-09-01

    Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.

  9. Targeted resequencing and variant validation using pxlence PCR assays

    Directory of Open Access Journals (Sweden)

    Frauke Coppieters

    2016-01-01

    Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.

  10. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model - Towards an international standard

    DEFF Research Database (Denmark)

    D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.

    2004-01-01

    the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...

  11. The design of an automated electrolytic enrichment apparatus for tritium

    Energy Technology Data Exchange (ETDEWEB)

    Myers, J.L.

    1994-12-01

    The Radiation Analytical Sciences Section at Laboratory at Lawrence Livermore National Laboratory performs analysis of low-level tritium concentrations in various natural water samples from the Tri-Valley Area, DOE Nevada Test Site, Site 300 in Tracy, CA, and other various places around the world. Low levels of tritium, a radioactive isotope of hydrogen, which is pre-concentrated in the RAS laboratory using an electrolytic enrichment apparatus. Later these enriched waters are analyzed by liquid scintillation counting to determine the activity of tritium. The enrichment procedure and the subsequent purification process by vacuum distillation are currently undertaken manually, hence being highly labor-intensive. The whole process typically takes about 2 to 3 weeks to complete a batch of 30 samples, with a dedicated personnel operating the process. The goal is to automate the entire process, specifically having the operation PC-LabVIEW{trademark} controlled with real-time monitoring capability. My involvement was in the design and fabrication of a prototypical automated electrolytic enrichment cell. Work will be done on optimizing the electrolytic process by assessing the different parameters of the enrichment procedure. Hardware and software development have also been an integral component of this project.

  12. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

    2005-01-01

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  13. Same-day PCR testing of Salmonella in meat: from research to routine application at slaughterhouses

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Löfström, Charlotta; Josefsen, Mathilde Hartmann

    2011-01-01

    Development of a rapid PCR technique is described, which enables slaughterhouses to apply same-day testing for Salmonella in carcasses and fresh meat. The technique is based on a shortened pre-enrichment time and 1-h DNA purification using paramagnetic beads (or an easy-to-use boiling method) fol......) followed by Salmonella detection by real-time PCR. Final protocols have been approved for meat testing (fresh meat and carcass swabs) by the Nordval validation organization for Nordic countries....

  14. Enrichment and identification of polycyclic aromatic compound-degrading bacteria enriched from sediment samples.

    Science.gov (United States)

    Long, Rachel M; Lappin-Scott, Hilary M; Stevens, Jamie R

    2009-07-01

    The degradation of polycyclic aromatic compounds (PACs) has been widely studied. Knowledge of the degradation of PACs by microbial populations can be utilized in the remediation of contaminated sites. To isolate and identify PAC-degrading bacteria for potential use in future bioremediation programmes, we established a series of PAC enrichments under the same experimental conditions from a single sediment sample taken from a highly polluted estuarine site. Enrichment cultures were established using the pollutants: anthracene, phenanthrene and dibenzothiophene as a sole carbon source. The shift in microbial community structure on each of these carbon sources was monitored by analysis of a time series of samples from each culture using 16S rRNA polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). Significantly, our findings demonstrate that shifts in the constituent species within each degradative community are directly attributable to enrichment with different PACs. Subsequently, we characterized the microorganisms comprising the degradative communities within each enrichment using 16S rRNA sequence data. Our findings demonstrate that the ability to degrade PACs is present in five divisions of the Proteobacteria and Actinobacteria. By determining the precise identity of the PAC-degrading bacterial species isolated from a single sediment sample, and by comparing our findings with previously published research, we demonstrate how bacteria with similar PAC degrading capabilities and 16S rRNA signatures are found in similarly polluted environments in geographically very distant locations, e.g., China, Italy, Japan and Hawaii. Such a finding suggests that geographical barriers do not limit the distribution of key PAC-degrading bacteria; this finding is in accordance with the Baas-Becking hypothesis "everything is everywhere; the environment selects" and may have significant consequences for the global distribution of PAC-degrading bacteria and

  15. Development and testing of computer aided start-up procedures for U-235 enrichment separation nozzle cascades

    International Nuclear Information System (INIS)

    Hein, H.; Schuette, R.; Steinhaus, H.

    1978-09-01

    In industrial scale separation nozzle cascades measured data acquisition and process control will be performed by on-line computer systems. To develop the necessary measurement and monitoring techniques, on-line control of the ten stage pilot plant by the WANG 2200 miniature computer system was tested. On-line data processing at the same time has reduced the number of measurements because a large number of operating data which cannot be measured directly can be obtained from a reduced number of measurements by calculation from the material balances in the gas dynamics network of the enrichment cascade. This is performed on-line by means of a cascade monitoring code which produces diagrams of the deviations of major operating parameters from their set values and thus offers to cascade operators an improved picture of the present status of a cascade, thereby facilitating the detection of causes of defects. The graphic representation chosen for this purpose and the performance of the system in practical operation is explained by an example of cascade adjustment and by a few selected examples of cascade fault conditions. Calculation of the quantities derived at all stages from the pressure (po) and concentration (No) readings requires that the individual flow characteristics of the separation nozzles are known. Alos the compressor characteristics have to be determined. Since the monitoring computer in calculating the cascade status utilizes these component characteristics in current enrichment operation, routinely establishing and plotting these two characteristics is also attributed to the computer system (start-up procedures). (orig.) 891 HP [de

  16. Pathway-focused PCR array profiling of enriched populations of laser capture microdissected hippocampal cells after traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Deborah R Boone

    Full Text Available Cognitive deficits in survivors of traumatic brain injury (TBI are associated with irreversible neurodegeneration in brain regions such as the hippocampus. Comparative gene expression analysis of dying and surviving neurons could provide insight into potential therapeutic targets. We used two pathway-specific PCR arrays (RT2 Profiler Apoptosis and Neurotrophins & Receptors PCR arrays to identify and validate TBI-induced gene expression in dying (Fluoro-Jade-positive or surviving (Fluoro-Jade-negative pyramidal neurons obtained by laser capture microdissection (LCM. In the Apoptosis PCR array, dying neurons showed significant increases in expression of genes associated with cell death, inflammation, and endoplasmic reticulum (ER stress compared with adjacent, surviving neurons. Pro-survival genes with pleiotropic functions were also significantly increased in dying neurons compared to surviving neurons, suggesting that even irreversibly injured neurons are able to mount a protective response. In the Neurotrophins & Receptors PCR array, which consists of genes that are normally expected to be expressed in both groups of hippocampal neurons, only a few genes were expressed at significantly different levels between dying and surviving neurons. Immunohistochemical analysis of selected, differentially expressed proteins supported the gene expression data. This is the first demonstration of pathway-focused PCR array profiling of identified populations of dying and surviving neurons in the brain after TBI. Combining precise laser microdissection of identifiable cells with pathway-focused PCR array analysis is a practical, low-cost alternative to microarrays that provided insight into neuroprotective signals that could be therapeutically targeted to ameliorate TBI-induced neurodegeneration.

  17. PCR assay for the detection of Campylobacter in marinated and non-marinated poultry products

    DEFF Research Database (Denmark)

    Katzav, Marianne; Isohanni, Pauliina; Lund, Marianne

    2008-01-01

    and chicken products, respectively. In August, there was a peak with 28.9% positive Campylobacter samples. Campylobacter inoculation tests were carried out to test the detection limit of both methods. The PCR method used is faster than microbiological analyses. However, enrichment of the samples is necessary...

  18. Enrichment of the African catfish Clarias gariepinus (Burchell) with functional selenium originating from garlic: effect of enrichment period and depuration on total selenium level and sensory properties

    NARCIS (Netherlands)

    Schram, E.; Schelvis-Smit, A.A.M.; Heul, van der J.W.; Luten, J.B.

    2010-01-01

    We wanted to optimize the procedure for the selenium enrichment of farmed African catfish, using garlic as dietary selenium source. In the first experiment we established the relation between the length of the selenium enrichment period and the resulting total selenium level in the fillet of the

  19. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  20. A 2000-2010 years outlook of isotopic uranium enrichment

    International Nuclear Information System (INIS)

    Vasaru, G.

    1998-01-01

    The increase of the installed power in nuclear plants implies the following steps to be achieved: - developing a parallel industry for the nuclear fuel cycle able to ensure a rhythmic supply of natural uranium, possibly an isotopic enrichment of 235 U of around 1.2 - 3.2%, depending on the reactor system; - manufacturing the fuel elements and the operation of cycle back-end, which may, possibly, include a temporary storage of the irradiated fuel; - reprocessing the spend fuel; - radioactive waste processing in view of final disposal, as well as the recovery of un-spent uranium and of plutonium formed. The heavy water reactors of CANDU-PHW does not imply any isotopic enrichment but provides a lower burnup of only 7,000 MW day/tone. An enrichment to 1.2% in 235 U for this type of reactors could increase the burnup up to 20,000 MW day/tone. An advanced method of enriching 235 U is based on the Atomic Vapor Laser Isotop Separation (AVLIS). This procedure called AVLIS has several advantages which are pointed out in this paper, among which: a very high selectivity; high separation factors; a low energy consumption due to the fact that in the conditions of a selective photo ionization, the energy necessary to the process is only 6.2 eV for the separated 235 U atom vs 0.3 MeV in case of inertial separators or 3 MeV in case of gaseous diffusion procedure. With the current laser yields an energy consumption of 100 kWh/SWU is estimated for AVLIS procedures as compared with 2,400 kWh/SWU in case of gaseous diffusion; an almost entire extraction of 235 U, what ensures a more efficient utilisation of nuclear fuel. Due to its modular character and to potential improvement in the equipment which could be achieved, this procedure will ensure a reduction in the investment costs in the construction stage what will make AVLIS a substitute of the classical separation procedures

  1. Transgene detection by digital droplet PCR.

    Directory of Open Access Journals (Sweden)

    Dirk A Moser

    Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

  2. ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data.

    Directory of Open Access Journals (Sweden)

    Yuttachon Promworn

    Full Text Available Biochemical methods are available for enriching 5' ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5' ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance.We present Transformation of Nucleotide Enrichment Ratios (ToNER, a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5' ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5' ends than TSSAR. In general, the transcript 5' ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR.ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5'ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a

  3. ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data.

    Science.gov (United States)

    Promworn, Yuttachon; Kaewprommal, Pavita; Shaw, Philip J; Intarapanich, Apichart; Tongsima, Sissades; Piriyapongsa, Jittima

    2017-01-01

    Biochemical methods are available for enriching 5' ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq) and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5' ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance. We present Transformation of Nucleotide Enrichment Ratios (ToNER), a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5' ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5' ends than TSSAR. In general, the transcript 5' ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR. ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5'ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a.biotec.or.th/GI/tools/toner) and Git

  4. Detection of Mycobacterium Tuberculosis by using PCR

    International Nuclear Information System (INIS)

    Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

    1996-01-01

    Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

  5. DNA enrichment approaches to identify unauthorized genetically modified organisms (GMOs).

    Science.gov (United States)

    Arulandhu, Alfred J; van Dijk, Jeroen P; Dobnik, David; Holst-Jensen, Arne; Shi, Jianxin; Zel, Jana; Kok, Esther J

    2016-07-01

    With the increased global production of different genetically modified (GM) plant varieties, chances increase that unauthorized GM organisms (UGMOs) may enter the food chain. At the same time, the detection of UGMOs is a challenging task because of the limited sequence information that will generally be available. PCR-based methods are available to detect and quantify known UGMOs in specific cases. If this approach is not feasible, DNA enrichment of the unknown adjacent sequences of known GMO elements is one way to detect the presence of UGMOs in a food or feed product. These enrichment approaches are also known as chromosome walking or gene walking (GW). In recent years, enrichment approaches have been coupled with next generation sequencing (NGS) analysis and implemented in, amongst others, the medical and microbiological fields. The present review will provide an overview of these approaches and an evaluation of their applicability in the identification of UGMOs in complex food or feed samples.

  6. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  7. Diagnostic PCR tests for Microsporum audouinii, M. canis and Trichophyton infections

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, Anna; Swierkowska, Aleksandra; Lindhardt Saunte, Ditte Marie

    2010-01-01

    ; 25 routine specimens from patients suspected of having dermatophytosis; 10 hair specimens from guinea pigs experimentally infected with M. canis; and two samples from un-infected control animals. DNA was prepared by a 10-min procedure from pure cultures as previously described. The 302 bp PCR product....... Finally, the Microsporum PCR was positive for 10/10 guinea pig specimens from infected animals but for 0/2 of the control animal samples. The evaluation of the two PCR tests indicated excellent sensitivity and specificity....

  8. Detection of live Salmonella enterica in fresh-cut vegetables by a TaqMan-based one-step reverse transcription real-time PCR.

    Science.gov (United States)

    Miao, Y J; Xiong, G T; Bai, M Y; Ge, Y; Wu, Z F

    2018-05-01

    Fresh-cut produce is at greater risk of Salmonella contamination. Detection and early warning systems play an important role in reducing the dissemination of contaminated products. One-step Reverse Transcription Polymerase Chain Reaction (RT-qPCR) targeting Salmonella tmRNA with or without a 6-h enrichment was evaluated for the detection of Salmonella in fresh-cut vegetables after 6-h storage. LOD of one-step RT-qPCR was 1·0 CFU per ml (about 100 copies tmRNA per ml) by assessed 10-fold serially diluted RNA from 10 6 CFU per ml bacteria culture. Then, one-step RT-qPCR assay was applied to detect viable Salmonella cells in 14 fresh-cut vegetables after 6-h storage. Without enrichment, this assay could detect 10 CFU per g for fresh-cut lettuce, cilantro, spinach, cabbage, Chinese cabbage and bell pepper, and 10 2 CFU per g for other vegetables. With a 6-h enrichment, this assay could detect 10 CFU per g for all fresh-cut vegetables used in this study. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. Significance and Impact of the Study: Fresh-cut produce is at greater risk of Salmonella contamination. Rapid detection methods play an important role in reducing the dissemination of contaminated products. One-step RT-qPCR assay used in this study could detect 10 CFU per g Salmonella for 14 fresh-cut vegetables with a 6-h short enrichment. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. © 2018 The Society for Applied Microbiology.

  9. Comparative studies on mitochondria isolated from neuron-enriched and glia-enriched fractions of rabbit and beef brain.

    Science.gov (United States)

    Hamberger, A; Blomstrand, C; Lehninger, A L

    1970-05-01

    Fractions enriched in neuronal and glial cells were obtained from dispersions of whole beef brain and rabbit cerebral cortex by large-scale density gradient centrifugation procedures. The fractions were characterized by appropriate microscopic observation. Mitochondria were then isolated from these fractions by differential centrifugation of their homogenates. The two different types of mitochondria were characterized with respect to certain enzyme activities, respiratory rate, rate of protein synthesis, and their buoyant density in sucrose gradients. The mitochondria from the neuron-enriched fraction were distinguished by a higher rate of incorporation of amino acids into protein, higher cytochrome oxidase activity, and a higher buoyant density in sucrose density gradients. Mitochondria from the glia-enriched fraction showed relatively high monoamine oxidase and Na(+)- and K(+)-stimulated ATPase activities. The rates of oxidation of various substrates and the acceptor control ratios did not differ appreciably between the two types of mitochondria. The difference in the buoyant density of mitochondria isolated from the neuron-enriched and glia-enriched cell fractions was utilized in attempts to separate neuronal and glial mitochondria from the mixed mitochondria obtained from whole brain homogenates in shallow sucrose gradients. The appearance of two peaks of cytochrome oxidase, monoamine oxidase, and protein concentration in such gradients shows the potential feasibility of such an approach.

  10. Chicken microsatellite markers isolated from libraries enriched for simple tandem repeats.

    Science.gov (United States)

    Gibbs, M; Dawson, D A; McCamley, C; Wardle, A F; Armour, J A; Burke, T

    1997-12-01

    The total number of microsatellite loci is considered to be at least 10-fold lower in avian species than in mammalian species. Therefore, efficient large-scale cloning of chicken microsatellites, as required for the construction of a high-resolution linkage map, is facilitated by the construction of libraries using an enrichment strategy. In this study, a plasmid library enriched for tandem repeats was constructed from chicken genomic DNA by hybridization selection. Using this technique the proportion of recombinant clones that cross-hybridized to probes containing simple tandem repeats was raised to 16%, compared with < 0.1% in a non-enriched library. Primers were designed from 121 different sequences. Polymerase chain reaction (PCR) analysis of two chicken reference pedigrees enabled 72 loci to be localized within the collaborative chicken genetic map, and at least 30 of the remaining loci have been shown to be informative in these or other crosses.

  11. Identification, Selection, and Enrichment of Cardiomyocyte Precursors

    Directory of Open Access Journals (Sweden)

    Bianca Ferrarini Zanetti

    2013-01-01

    Full Text Available The large-scale production of cardiomyocytes is a key step in the development of cell therapy and tissue engineering to treat cardiovascular diseases, particularly those caused by ischemia. The main objective of this study was to establish a procedure for the efficient production of cardiomyocytes by reprogramming mesenchymal stem cells from adipose tissue. First, lentiviral vectors expressing neoR and GFP under the control of promoters expressed specifically during cardiomyogenesis were constructed to monitor cell reprogramming into precardiomyocytes and to select cells for amplification and characterization. Cellular reprogramming was performed using 5′-azacytidine followed by electroporation with plasmid pOKS2a, which expressed Oct4, Sox2, and Klf4. Under these conditions, GFP expression began only after transfection with pOKS2a, and less than 0.015% of cells were GFP+. These GFP+ cells were selected for G418 resistance to find molecular markers of cardiomyocytes by RT-PCR and immunocytochemistry. Both genetic and protein markers of cardiomyocytes were present in the selected cells, with some variations among them. Cell doubling time did not change after selection. Together, these results indicate that enrichment with vectors expressing GFP and neoR under cardiomyocyte-specific promoters can produce large numbers of cardiomyocyte precursors (CMPs, which can then be differentiated terminally for cell therapy and tissue engineering.

  12. PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.

    Science.gov (United States)

    Prevost, S; Andre, S; Remize, F

    2010-12-01

    Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.

  13. Production of Mo-99 using low-enriched uranium silicide

    International Nuclear Information System (INIS)

    Hutter, J.C.; Srinivasan, B.; Vicek, M.; Vandegrift, G.F.

    1994-01-01

    Over the last several years, uranium silicide fuels have been under development as low-enriched uranium (LEU) targets for Mo-99. The use of LEU silicide is aimed at replacing the UAl x alloy in the highly-enriched uranium dissolution process. A process to recover Mo-99 from low-enriched uranium silicide is being developed at Argonne National Laboratory. The uranium silicide is dissolved in alkaline hydrogen peroxide. Experiments performed to determine the optimum dissolution procedure are discussed, and the results of dissolving a portion of a high-burnup (>40%) U 3 Si 2 miniplate are presented. Future work related to Mo-99 separation and waste disposal are also discussed

  14. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  15. High-throughput STR analysis for DNA database using direct PCR.

    Science.gov (United States)

    Sim, Jeong Eun; Park, Su Jeong; Lee, Han Chul; Kim, Se-Yong; Kim, Jong Yeol; Lee, Seung Hwan

    2013-07-01

    Since the Korean criminal DNA database was launched in 2010, we have focused on establishing an automated DNA database profiling system that analyzes short tandem repeat loci in a high-throughput and cost-effective manner. We established a DNA database profiling system without DNA purification using a direct PCR buffer system. The quality of direct PCR procedures was compared with that of conventional PCR system under their respective optimized conditions. The results revealed not only perfect concordance but also an excellent PCR success rate, good electropherogram quality, and an optimal intra/inter-loci peak height ratio. In particular, the proportion of DNA extraction required due to direct PCR failure could be minimized to <3%. In conclusion, the newly developed direct PCR system can be adopted for automated DNA database profiling systems to replace or supplement conventional PCR system in a time- and cost-saving manner. © 2013 American Academy of Forensic Sciences Published 2013. This article is a U.S. Government work and is in the public domain in the U.S.A.

  16. MARCC (Matrix-Assisted Reader Chromatin Capture): an antibody-free method to enrich and analyze combinatorial nucleosome modifications

    Science.gov (United States)

    Su, Zhangli

    2016-01-01

    Combinatorial patterns of histone modifications are key indicators of different chromatin states. Most of the current approaches rely on the usage of antibodies to analyze combinatorial histone modifications. Here we detail an antibody-free method named MARCC (Matrix-Assisted Reader Chromatin Capture) to enrich combinatorial histone modifications. The combinatorial patterns are enriched on native nucleosomes extracted from cultured mammalian cells and prepared by micrococcal nuclease digestion. Such enrichment is achieved by recombinant chromatin-interacting protein modules, or so-called reader domains, which can bind in a combinatorial modification-dependent manner. The enriched chromatin can be quantified by western blotting or mass spectrometry for the co-existence of histone modifications, while the associated DNA content can be analyzed by qPCR or next-generation sequencing. Altogether, MARCC provides a reproducible, efficient and customizable solution to enrich and analyze combinatorial histone modifications. PMID:26131849

  17. Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome.

    Science.gov (United States)

    Shen, Haoran; Liang, Zhou; Zheng, Saihua; Li, Xuelian

    2017-11-01

    The purpose of this study was to identify promising candidate genes and pathways in polycystic ovary syndrome (PCOS). Microarray dataset GSE345269 obtained from the Gene Expression Omnibus database includes 7 granulosa cell samples from PCOS patients, and 3 normal granulosa cell samples. Differentially expressed genes (DEGs) were screened between PCOS and normal samples. Pathway enrichment analysis was conducted for DEGs using ClueGO and CluePedia plugin of Cytoscape. A Reactome functional interaction (FI) network of the DEGs was built using ReactomeFIViz, and then network modules were extracted, followed by pathway enrichment analysis for the modules. Expression of DEGs in granulosa cell samples was measured using quantitative RT-PCR. A total of 674 DEGs were retained, which were significantly enriched with inflammation and immune-related pathways. Eight modules were extracted from the Reactome FI network. Pathway enrichment analysis revealed significant pathways of each module: module 0, Regulation of RhoA activity and Signaling by Rho GTPases pathways shared ARHGAP4 and ARHGAP9; module 2, GlycoProtein VI-mediated activation cascade pathway was enriched with RHOG; module 3, Thromboxane A2 receptor signaling, Chemokine signaling pathway, CXCR4-mediated signaling events pathways were enriched with LYN, the hub gene of module 3. Results of RT-PCR confirmed the finding of the bioinformatic analysis that ARHGAP4, ARHGAP9, RHOG and LYN were significantly upregulated in PCOS. RhoA-related pathways, GlycoProtein VI-mediated activation cascade pathway, ARHGAP4, ARHGAP9, RHOG and LYN may be involved in the pathogenesis of PCOS.

  18. Evaluation of the impact of density gradient centrifugation on fetal cell loss during enrichment from maternal peripheral blood.

    Science.gov (United States)

    Emad, Ahmed; Drouin, Régen

    2014-09-01

    Physical separation by density gradient centrifugation (DGC) is usually used as an initial step of multistep enrichment protocols for purification of fetal cells (FCs) from maternal blood. Many protocols were designed but no single approach was efficient enough to provide noninvasive prenatal diagnosis. Procedures and methods were difficult to compare because of the nonuniformity of protocols among different groups. Recovery of FCs is jeopardized by their loss during the process of enrichment. Any loss of FCs must be minimized because of the multiplicative effect of each step of the enrichment process. The main objective of this study was to evaluate FC loss caused by DGC. Fetal cells were quantified in peripheral blood samples obtained from both euploid and aneuploid pregnancies before and after enrichment by buoyant DGC using Histopaque 1.119 g/mL. Density gradient centrifugation results in major loss of 60% to 80% of rare FCs, which may further complicate subsequent enrichment procedures. Eliminating aggressive manipulations can significantly minimize FC loss. Data obtained raise questions about the appropriateness of the DGC step for the enrichment of rare FCs and argues for the use of the alternative nonaggressive version of the procedure presented here or prioritizing other methods of enrichments. © 2014 John Wiley & Sons, Ltd.

  19. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

    Science.gov (United States)

    Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

    2001-07-01

    Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

  20. Monocyte enrichment from leukapheresis products by using the Elutra cell separator.

    Science.gov (United States)

    Kim, Sinyoung; Kim, Hyun Ok; Baek, Eun-Jung; Choi, Youjeong; Kim, Han-Soo; Lee, Min-Geul

    2007-12-01

    Dendritic cells (DCs), used in clinical trials for cancer immunotherapy, require processing on an expanded scale to conform to current good manufacturing practice guidelines. This study evaluated a large-scale monocyte enrichment procedure with a commercially available cell separator (Elutra, Gambro BCT) and analyzed the capacity of enriched monocytes to differentiate into DCs. Mononuclear cells were collected in two patients with malignant melanoma and seven healthy donors by leukapheresis. Continuous-counterflow elutriation with the Elutra was performed to enrich and purify monocytes from leukapheresis products. Purity and recovery of enriched monocytes were analyzed by flow cytometry. DCs were generated from the elutriated monocytes and characterized by phenotypic surface marker and stimulatory capacity in an allogeneic mixed lymphocyte reaction. In the leukapheresis products, the total MNC count was 7.3 x 10(9) +/- 0.7 x 10(9) and the mean percentage of CD14+ monocytes was 16.5 +/- 3.8 percent, which increased to 68.9 +/- 7.4 percent after elutriation with the Elutra. The mean monocyte recovery was 94.3 percent. Elutriated monocytes were successfully cultured into phenotypically and functionally mature DCs. These results indicate that the Elutra cell separator allows for fast and easy enrichment of monocytes within a closed system. Furthermore, these monocytes can be differentiated into functionally mature DCs. Compared to plastic adherence and immunomagnetic selection methods, the elutriation procedure is inexpensive, efficient, and very effective.

  1. Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

    2004-01-01

    Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

  2. Automated PCR setup for forensic casework samples using the Normalization Wizard and PCR Setup robotic methods.

    Science.gov (United States)

    Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C

    2006-12-20

    Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the

  3. Enrichment of Thermophilic Propionate-Oxidizing Bacteria in Syntrophy with Methanobacterium thermoautotrophicum or Methanobacterium thermoformicicum

    OpenAIRE

    Stams, Alfons J. M.; Grolle, Katja C. F.; Frijters, Carla T. M.; Van Lier, Jules B.

    1992-01-01

    Thermophilic propionate-oxidizing, proton-reducing bacteria were enriched from the granular methanogenic sludge of a bench-scale upflow anaerobic sludge bed reactor operated at 55°C with a mixture of volatile fatty acids as feed. Thermophilic hydrogenotrophic methanogens had a high decay rate. Therefore, stable, thermophilic propionate-oxidizing cultures could not be obtained by using the usual enrichment procedures. Stable and reproducible cultivation was possible by enrichment in hydrogen-p...

  4. Uranium Enrichment Determination of the InSTEC Sub Critical Ensemble Fuel by Gamma Spectrometry

    International Nuclear Information System (INIS)

    Borrell Munnoz, Jose L.; LopezPino, Neivy; Diaz Rizo, Oscar; D'Alessandro Rodriguez, Katia; Padilla Cabal, Fatima; Arbelo Penna, Yunieski; Garcia Rios, Aczel R.; Quintas Munn, Ernesto L.; Casanova Diaz, Amaya O.

    2009-01-01

    Low background gamma spectrometry was applied to analyze the uranium enrichment of the nuclear fuel used in the InSTEC Sub Critical ensemble. The enrichment was calculated by two variants: an absolute method using the Monte Carlo method to simulated detector volumetric efficiency, and an iterative procedure without using standard sources. The results confirm that the nuclear fuel of the ensemble is natural uranium without any additional degree of enrichment. (author)

  5. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy.

    Science.gov (United States)

    Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann

    2014-10-01

    Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.

  6. Mycobacterium paratuberculosis detection in cow's milk in Argentina by immunomagnetic separation-PCR.

    Science.gov (United States)

    Gilardoni, Liliana Rosa; Fernández, Bárbara; Morsella, Claudia; Mendez, Laura; Jar, Ana María; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor

    2016-01-01

    The aim of this study was to standardize a diagnosis procedure to detect Mycobacterium avium subsp. paratuberculosis (Map) DNA in raw cow milk samples under field conditions. A procedure that combines both immunomagnetic separation and IS900-PCR detection (IMS-IS1 PCR) was employed on milk samples from 265 lactating Holstein cows from Map infected and uninfected herds in Argentina. IMS-IS1 PCR results were analyzed and compared with those obtained from milk and fecal culture and serum ELISA. The extent of agreement between both tests was determined by the Kappa test. IMS-IS1 PCR showed a detection limit of 10(1) CFU of Map/mL of milk, when 50:50 mix of monoclonal and polyclonal antibodies were used to coat magnetic beads. All of the 118 samples from the Map uninfected herds were negative for the set of the tests. In Map infected herds, 80 out of 147 cows tested positive by milk IMS-IS1 PCR (55%), of which 2 (1.4%) were also positive by milk culture, 15 (10%) by fecal culture, and 20 (14%) by serum ELISA. Kappa statistics (95% CI) showed a slight agreement between the different tests (<0.20), and the proportions of agreement were ≤0.55. The IMS-IS1 PCR method detected Map in milk of the cows that were not positive in other techniques. This is the first report dealing with the application of IMS-IS1 PCR in the detection of Map in raw milk samples under field conditions in Argentina. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  7. Sampling methods for rumen microbial counts by Real-Time PCR techniques

    Directory of Open Access Journals (Sweden)

    S. Puppo

    2010-02-01

    Full Text Available Fresh rumen samples were withdrawn from 4 cannulated buffalo females fed a fibrous diets in order to quantify bacteria concentration in the rumen by Real-Time PCR techniques. To obtain DNA of a good quality from whole rumen fluid, eight (M1-M8 different pre-filtration methods (cheese cloths, glass-fibre and nylon filter in combination with various centrifugation speeds (1000, 5000 and 14,000 rpm were tested. Genomic DNA extraction was performed either on fresh or frozen samples (-20°C. The quantitative bacteria analysis was realized according to Real-Time PCR procedure for Butyrivibrio fibrisolvens reported in literature. M5 resulted the best sampling procedure allowing to obtain a suitable genomic DNA. No differences were revealed between fresh and frozen samples.

  8. Prevalence of Bartonella spp. by culture, PCR and serology, in veterinary personnel from Spain

    Directory of Open Access Journals (Sweden)

    José A. Oteo

    2017-11-01

    Full Text Available Abstract Background The genus Bartonella includes fastidious, facultative intracellular bacteria mainly transmitted by arthropods and distributed among mammalian reservoirs. Bartonella spp. implicated as etiological agents of zoonoses are increasing. Apart from the classical Bartonella henselae, B. bacilliformis or B. quintana, other species (B. elizabethae, B. rochalimae, B. vinsonii arupensis and B. v. berkhoffii, B. tamiae or B. koehlerae, among others have also been associated with human and/or animal diseases. Laboratory techniques for diagnosis (culture, PCR assays and serology usually show lack of sensitivity. Since 2005, a method based on a liquid enrichment Bartonella alphaproteobacteria growth medium (BAPGM followed by PCRs for the amplification of Bartonella spp. has been developed. We aimed to assess culture, molecular and serological prevalence of Bartonella infections in companion animal veterinary personnel from Spain. Methods Each of 89 participants completed a questionnaire. Immunofluorescence assays (IFA using B. vinsonii berkhoffii (genotypes I, II and III, B. henselae, B. quintana and B. koehlerae as antigens were performed. A cut-off of 1:64 was selected as a seroreactivity titer. Blood samples were inoculated into BAPGM and subcultured onto blood agar plates. Bartonella spp. was detected using conventional and quantitative real-time PCR assays and DNA sequencing. Results Among antigens corresponding to six Bartonella spp. or genotypes, the lowest seroreactivity was found against B. quintana (11.2% and the highest, against B. v. berkhoffii genotype III (56%. A total of 27% of 89 individuals were not seroreactive to any test antigen. Bartonella spp. IFA seroreactivity was not associated with any clinical sign or symptom. DNA from Bartonella spp., including B. henselae (n = 2, B. v. berkhoffii genotypes I (n = 1 and III (n = 2, and B. quintana (n = 2 was detected in 7/89 veterinary personnel. PCR and DNA sequencing

  9. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  10. By-Product Formation in Repetitive PCR Amplification of DNA Libraries during SELEX

    DEFF Research Database (Denmark)

    Tolle, Fabian; Wilke, Julian; Wengel, Jesper

    2014-01-01

    The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recogniz......The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target......-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments....... Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation...

  11. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Andersen, M. T.; Dalsgaard, Anders

    2005-01-01

    species-specific detection of Campylobacter spp. in naturally infected pig faecal samples after an enrichment step, whereas the hybridization approach enhanced the specific isolation of C. jejuni (present in minority to C. coli) from pigs. Conclusions: The rt-PCR was specific for Campylobacter jejuni, C...... by phenotypic methods and the developed rt-PCR provides an easy and fast method for such differentiation. Detection of C. jejuni by colony hybridization may increase the isolation rate of this species from pig faeces....

  12. DNA decontamination methods for internal quality management in clinical PCR laboratories.

    Science.gov (United States)

    Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen

    2018-03-01

    The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.

  13. Modular enrichment measurement system for in-situ enrichment assay

    International Nuclear Information System (INIS)

    Stewart, J.P.

    1976-01-01

    A modular enrichment measurement system has been designed and is in operation within General Electric's Nuclear Fuel Fabrication Facility for the in-situ enrichment assay of uranium-bearing materials in process containers. This enrichment assay system, which is based on the ''enrichment meter'' concept, is an integral part of the site's enrichment control program and is used in the in-situ assay of the enrichment of uranium dioxide (UO 2 ) powder in process containers (five gallon pails). The assay system utilizes a commercially available modular counting system and a collimnator designed for compatability with process container transport lines and ease of operator access. The system has been upgraded to include a microprocessor-based controller to perform system operation functions and to provide data acquisition and processing functions. Standards have been fabricated and qualified for the enrichment assay of several types of uranium-bearing materials, including UO 2 powders. The assay system has performed in excess of 20,000 enrichment verification measurements annually and has significantly contributed to the facility's enrichment control program

  14. Rapid detection of Mycobacterium avium subsp. paratuberculosis ...

    African Journals Online (AJOL)

    Therefore, alternative diagnostic tests such as PCR, are needed for quick detection of infected animals. In this study, the conventional enrichment and isolation procedure and two IS900-based PCR methods for detection of Mycobactrium avium subsp. paratuberculosis in clinical samples from zoo animals and cattle were ...

  15. Methods of staining and visualization of sphingolipid enriched and non-enriched plasma membrane regions of Arabidopsis thaliana with fluorescent dyes and lipid analogues

    Directory of Open Access Journals (Sweden)

    Blachutzik Jörg O

    2012-08-01

    Full Text Available Abstract Background Sterols and Sphingolipids form lipid clusters in the plasma membranes of cell types throughout the animal and plant kingdoms. These lipid domains provide a medium for protein signaling complexes at the plasma membrane and are also observed to be principal regions of membrane contact at the inception of infection. We visualized different specific fluorescent lipophilic stains of the both sphingolipid enriched and non-sphingolipid enriched regions in the plasma membranes of live protoplasts of Arabidopsis thaliana. Results Lipid staining protocols for several fluorescent lipid analogues in plants are presented. The most emphasis was placed on successful protocols for the single and dual staining of sphingolipid enriched regions and exclusion of sphingolipid enriched regions on the plasma membrane of Arabidopsis thaliana protoplasts. A secondary focus was placed to ensure that these staining protocols presented still maintain cell viability. Furthermore, the protocols were successfully tested with the spectrally sensitive dye Laurdan. Conclusion Almost all existing staining procedures of the plasma membrane with fluorescent lipid analogues are specified for animal cells and tissues. In order to develop lipid staining protocols for plants, procedures were established with critical steps for the plasma membrane staining of Arabidopsis leaf tissue and protoplasts. The success of the plasma membrane staining protocols was additionally verified by measurements of lipid dynamics by the fluorescence recovery after photobleaching technique and by the observation of new phenomena such as time dependent lipid polarization events in living protoplasts, for which a putative physiological relevance is suggested.

  16. Uranium enrichment: an activity for the riches

    International Nuclear Information System (INIS)

    Mundim, S.G.

    1985-01-01

    The United States in the first place, the European countries next, have begun to maintain strict control of the technology transfer of the methods of enrichment, helped largely by the International Atomic Energy Agency which creates additional obstacles with is so-called 'safeguards'. So that it can possess a complete energy cycle, Brazil needs to have access to the techniques of enrichment. The methods are many and still extremely costly. Committed to signing a risk contract with Germany in the scope of its nuclear treaty with the intention of implementing here the jetcentrofuge method, Brazil should, nevertheless, make an effort to cause to emerge from its laboratories a new procedure which would permit it to become independent in this sector. (Author) [pt

  17. Developing new microsatellite markers in walnut (Juglans regia L.) from Juglans nigra genomic GA enriched library

    Science.gov (United States)

    Hayat Topcu; Nergiz Coban; Keith Woeste; Mehmet Sutyemez; Salih. Kafkas

    2015-01-01

    We attempted to develop new polymorphic SSR primer pairs in walnut using sequences derived from Juglans nigra L. genomic enriched library with GA repeat. The designed 94 SSR primer pairs were subjected to gradient PCR in 12 walnut cultivars to determine their optimum annealing temperatures and to determine whether they produce bands. Then, the...

  18. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  19. Environmental enrichment imparts disease-modifying and transgenerational effects on genetically-determined epilepsy and anxiety.

    Science.gov (United States)

    Dezsi, Gabi; Ozturk, Ezgi; Salzberg, Michael R; Morris, Margaret; O'Brien, Terence J; Jones, Nigel C

    2016-09-01

    The absence epilepsies are presumed to be caused by genetic factors, but the influence of environmental exposures on epilepsy development and severity, and whether this influence is transmitted to subsequent generations, is not well known. We assessed the effects of environmental enrichment on epilepsy and anxiety outcomes in multiple generations of GAERS - a genetic rat model of absence epilepsy that manifests comorbid elevated anxiety-like behaviour. GAERS were exposed to environmental enrichment or standard housing beginning either prior to, or after epilepsy onset, and underwent EEG recordings and anxiety testing. Then, we exposed male GAERS to early enrichment or standard housing and generated F1 progeny, which also underwent EEG recordings. Hippocampal CRH mRNA expression and DNA methylation were assessed using RT-PCR and pyrosequencing, respectively. Early environmental enrichment delayed the onset of epilepsy in GAERS, and resulted in fewer seizures in adulthood, compared with standard housed GAERS. Enrichment also reduced the frequency of seizures when initiated in adulthood. Anxiety levels were reduced by enrichment, and these anti-epileptogenic and anxiolytic effects were heritable into the next generation. We also found reduced expression of CRH mRNA in GAERS exposed to enrichment, but this was not due to changes in DNA methylation. Environmental enrichment produces disease-modifying effects on genetically determined absence epilepsy and anxiety, and these beneficial effects are transferable to the subsequent generation. Reduced CRH expression was associated with these phenotypic improvements. Environmental stimulation holds promise as a naturalistic therapy for genetically determined epilepsy which may benefit subsequent generations. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. A fast and highly sensitive blood culture PCR method for clinical detection of Salmonella enterica serovar Typhi

    Directory of Open Access Journals (Sweden)

    Zhou Liqing

    2010-04-01

    Full Text Available Abstract Background Salmonella Typhi causes an estimated 21 million new cases of typhoid fever and 216,000 deaths every year. Blood culture is currently the gold standard for diagnosis of typhoid fever, but it is time-consuming and takes several days for isolation and identification of causative organisms. It is then too late to initiate proper antibiotic therapy. Serological tests have very low sensitivity and specificity, and no practical value in endemic areas. As early diagnosis of the disease and prompt treatment are essential for optimal management, especially in children, a rapid sensitive detection method for typhoid fever is urgently needed. Although PCR is sensitive and rapid, initial research indicated similar sensitivity to blood culture and lower specificity. We developed a fast and highly sensitive blood culture PCR method for detection of Salmonella Typhi, allowing same-day initiation of treatment after accurate diagnosis of typhoid. Methods An ox bile tryptone soy broth was optimized for blood culture, which allows the complete lysis of blood cells to release intracellular bacteria without inhibiting the growth of Salmonella Typhi. Using the optimised broth Salmonella Typhi bacteria in artificial blood samples were enriched in blood culture and then detected by a PCR targeting the fliC-d gene of Salmonella Typhi. Results Tests demonstrated that 2.4% ox bile in blood culture not only lyzes blood cells completely within 1.5 hours so that the intracellular bacteria could be released, but also has no inhibiting effect on the growth of Salmonella Typhi. Three hour enrichment of Salmonella Typhi in tryptone soya broth containing 2.4% ox bile could increase the bacterial number from 0.75 CFU per millilitre of blood which is similar to clinical typhoid samples to the level which regular PCR can detect. The whole blood culture PCR assay takes less than 8 hours to complete rather than several days for conventional blood culture

  1. Safeguarding uranium enrichment facilities. Review and analysis of the status of safeguards technology for uranium enrichment facilities

    International Nuclear Information System (INIS)

    1977-09-01

    The objective of this paper is to examine critically the diversion potential at uranium enrichment facilities and to outline a basic safeguards strategy which counters all identified hazards as completely as possible yet with a minimum of non-essential redundancy. Where existing technology does not appear to be adequate for effective safeguards, the limitations are examined, and suggestions for further R and D effort are made. Parts of this report are generally applicable to all currently known enrichment processes, while other parts are specifically directed toward facilities based on the gas centrifuge process. It is hoped that additional sections discussing a safeguards strategy for gas diffusion facilities can be added later. It should be emphasized that this is a technical report, and does not reflect any legal positions. The safeguards strategy and subsequent inspection procedures are intended as guidelines, not as negotiating positions

  2. Yersinia enterocolitica in slaughter pig tonsils: enumeration and detection by enrichment versus direct plating culture.

    Science.gov (United States)

    Van Damme, Inge; Habib, Ihab; De Zutter, Lieven

    2010-02-01

    Tonsil samples from 139 slaughter pigs were examined for the presence of pathogenic Yersinia enterocolitica by enrichment procedures based on the standard method ISO 10273:2003. In addition, samples were tested by direct plating method to evaluate its efficiency compared to the enrichment culture methods and to quantify the level of contamination in porcine tonsils. In total, 52 samples (37.4%) were positive for pathogenic Y. enterocolitica, all belonging to bioserotype 4/O:3. Fifty out of the 52 positive samples (96.2%) were detected by direct plating. Enumeration showed an average concentration of 4.5 log(10) CFU g(-1) and 4.4 log(10) CFU g(-1) tonsil on Salmonella-Shigella-desoxycholate-calcium chloride (SSDC) and cefsulodin-irgasan-novobiocin (CIN) agar plates, respectively. The enrichment procedures recommended by the ISO 10273:2003 method were not optimal for the isolation of pathogenic Y. enterocolitica from pig tonsils: two days enrichment in irgasan-ticarcillin-potassium chlorate (ITC) broth resulted in an isolation rate of 84.6%, while 5 days enrichment in peptone-sorbitol-bile (PSB) broth recovered only 59.6% of positive samples. Reducing the enrichment time in PSB from 5 to 2 days resulted in a significantly higher recovery rate (94.2%) and might serve as an appropriate enrichment protocol for the isolation of pathogenic Y. enterocolitica from pig tonsils. Compared to enrichment culture methods, results based on direct plating can be obtained in a shorter time course and provide quantitative data that might be needed for further risk assessment studies.

  3. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.

    Science.gov (United States)

    Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J

    2017-12-01

    qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.

  4. Enrichment and Molecular Analysis of Breast Cancer Disseminated Tumor Cells from Bone Marrow Using Microfiltration.

    Directory of Open Access Journals (Sweden)

    Sreeraj G Pillai

    Full Text Available Molecular characterization of disseminated tumor cells (DTCs in the bone marrow (BM of breast cancer (BC patients has been hindered by their rarity. To enrich for these cells using an antigen-independent methodology, we have evaluated a size-based microfiltration device in combination with several downstream biomarker assays.BM aspirates were collected from healthy volunteers or BC patients. Healthy BM was mixed with a specified number of BC cells to calculate recovery and fold enrichment by microfiltration. Specimens were pre-filtered using a 70 μm mesh sieve and the effluent filtered through CellSieve microfilters. Captured cells were analyzed by immunocytochemistry (ICC, FISH for HER-2/neu gene amplification status, and RNA in situ hybridization (RISH. Cells eluted from the filter were used for RNA isolation and subsequent qRT-PCR analysis for DTC biomarker gene expression.Filtering an average of 14×106 nucleated BM cells yielded approximately 17-21×103 residual BM cells. In the BC cell spiking experiments, an average of 87% (range 84-92% of tumor cells were recovered with approximately 170- to 400-fold enrichment. Captured BC cells from patients co-stained for cytokeratin and EpCAM, but not CD45 by ICC. RNA yields from 4 ml of patient BM after filtration averaged 135ng per 10 million BM cells filtered with an average RNA Integrity Number (RIN of 5.3. DTC-associated gene expression was detected by both qRT-PCR and RISH in filtered spiked or BC patient specimens but, not in control filtered normal BM.We have tested a microfiltration technique for enrichment of BM DTCs. DTC capture efficiency was shown to range from 84.3% to 92.1% with up to 400-fold enrichment using model BC cell lines. In patients, recovered DTCs can be identified and distinguished from normal BM cells using multiple antibody-, DNA-, and RNA-based biomarker assays.

  5. Enrichment and Determination of radionuclides by ion chromatography

    International Nuclear Information System (INIS)

    ZAFIMANJATO, J.L.R.

    1996-01-01

    The fundamentals of Ion Chromatography (IC) and Liquid Scintillation Counting (LSC) are reviewed. Ion Chromatography as separation method for cations is coupled with Liquid Scintillation Counting for the determination of Radionuclides in water samples. An experimental arrangement for investigations on the applicability of guard columns for cationic radionuclide enrichment is shown. The saturation behaviour of single and bivalentic cations and their combination is presented. Our results show that radioactive bivalentic cations like strontium-90 and radium-226 are enriched on a Ion Pac CG 12 Dionex guard column from 100 to 300ml natural water in one single step. The procedure is suitable for their determination in concentrations down to 10 -2 Bq.l -1 [fr

  6. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  7. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    Science.gov (United States)

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  8. A novel method of selective removal of human DNA improves PCR sensitivity for detection of Salmonella Typhi in blood samples.

    Science.gov (United States)

    Zhou, Liqing; Pollard, Andrew J

    2012-07-27

    Enteric fever is a major public health problem, causing an estimated 21million new cases and 216,000 or more deaths every year. Current diagnosis of the disease is inadequate. Blood culture only identifies 45 to 70% of the cases and is time-consuming. Serological tests have very low sensitivity and specificity. Clinical samples obtained for diagnosis of enteric fever in the field generally have blood, so that even PCR-based methods, widely used for detection of other infectious diseases, are not a straightforward option in typhoid diagnosis. We developed a novel method to enrich target bacterial DNA by selective removal of human DNA from blood samples, enhancing the sensitivity of PCR tests. This method offers the possibility of improving PCR assays directly using clinical specimens for diagnosis of this globally important infectious disease. Blood samples were mixed with ox bile for selective lysis of human blood cells and the released human DNA was then digested with addition of bile resistant micrococcal nuclease. The intact Salmonella Typhi bacteria were collected from the specimen by centrifugation and the DNA extracted with QIAamp DNA mini kit. The presence of Salmonella Typhi bacteria in blood samples was detected by PCR with the fliC-d gene of Salmonella Typhi as the target. Micrococcal nuclease retained activity against human blood DNA in the presence of up to 9% ox bile. Background human DNA was dramatically removed from blood samples through the use of ox bile lysis and micrococcal nuclease for removal of mammalian DNA. Consequently target Salmonella Typhi DNA was enriched in DNA preparations and the PCR sensitivity for detection of Salmonella Typhi in spiked blood samples was enhanced by 1,000 fold. Use of a combination of selective ox-bile blood cell lysis and removal of human DNA with micrococcal nuclease significantly improves PCR sensitivity and offers a better option for improved typhoid PCR assays directly using clinical specimens in diagnosis of

  9. Efficient clinical-scale enrichment of lymphocytes for use in adoptive immunotherapy using a modified counterflow centrifugal elutriation program.

    Science.gov (United States)

    Powell, Daniel J; Brennan, Andrea L; Zheng, Zhaohui; Huynh, Hong; Cotte, Julio; Levine, Bruce L

    2009-01-01

    Clinical-scale lymphocyte enrichment from a leukapheresis product has been performed most routinely using costly magnetic bead separation systems that deplete monocytes, but this procedure may leave behind residual beads or antibodies in the enriched cell product. Counterflow centrifugal elutriation has been demonstrated previously to enrich monocytes efficiently for generation of dendritic cells. This study describes a modified elutriation procedure for efficient bead-free economical enrichment of lymphocytes from leukapheresis products from healthy donors and study subjects with human immunodeficiency virus (HIV) infection or malignancy. Modified program settings and conditions for the CaridianBCT Elutra device were investigated to optimize lymphocyte enrichment and recovery. Lymphocyte enrichment was measured using a novel approach utilizing cell sizing analysis on a Beckman Coulter Multisizer and confirmed by flow cytometry phenotypic analysis. Efficient enrichment and recovery of lymphocytes from leukapheresis cell products was achieved using modified elutriation settings for flow rate and fraction volume. Elutriation allowed for enrichment of larger numbers of lymphocytes compared with depletion of monocytes by bead adherence, with a trend toward increased lymphocyte purity and yield via elutriation, resulting in a substantial reduction in the cost of enrichment per cell. Importantly, significant lymphocyte enrichment could be accomplished using leukapheresis samples from healthy donors (n=12) or from study subjects with HIV infection (n=15) or malignancy (n=12). Clinical-scale closed-system elutriation can be performed efficiently for the selective enrichment of lymphocytes for immunotherapy protocols. This represents an improvement in cost, yield and purity over current methods that require the addition of monocyte-depleting beads.

  10. Absolute quantification by droplet digital PCR versus analog real-time PCR

    Science.gov (United States)

    Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh

    2014-01-01

    Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387

  11. Comparing Multi-Step IMAC and Multi-Step TiO2 Methods for Phosphopeptide Enrichment

    Science.gov (United States)

    Yue, Xiaoshan; Schunter, Alissa; Hummon, Amanda B.

    2016-01-01

    Phosphopeptide enrichment from complicated peptide mixtures is an essential step for mass spectrometry-based phosphoproteomic studies to reduce sample complexity and ionization suppression effects. Typical methods for enriching phosphopeptides include immobilized metal affinity chromatography (IMAC) or titanium dioxide (TiO2) beads, which have selective affinity and can interact with phosphopeptides. In this study, the IMAC enrichment method was compared with the TiO2 enrichment method, using a multi-step enrichment strategy from whole cell lysate, to evaluate their abilities to enrich for different types of phosphopeptides. The peptide-to-beads ratios were optimized for both IMAC and TiO2 beads. Both IMAC and TiO2 enrichments were performed for three rounds to enable the maximum extraction of phosphopeptides from the whole cell lysates. The phosphopeptides that are unique to IMAC enrichment, unique to TiO2 enrichment, and identified with both IMAC and TiO2 enrichment were analyzed for their characteristics. Both IMAC and TiO2 enriched similar amounts of phosphopeptides with comparable enrichment efficiency. However, phosphopeptides that are unique to IMAC enrichment showed a higher percentage of multi-phosphopeptides, as well as a higher percentage of longer, basic, and hydrophilic phosphopeptides. Also, the IMAC and TiO2 procedures clearly enriched phosphopeptides with different motifs. Finally, further enriching with two rounds of TiO2 from the supernatant after IMAC enrichment, or further enriching with two rounds of IMAC from the supernatant TiO2 enrichment does not fully recover the phosphopeptides that are not identified with the corresponding multi-step enrichment. PMID:26237447

  12. Circulating tumor cell detection: A direct comparison between negative and unbiased enrichment in lung cancer.

    Science.gov (United States)

    Xu, Yan; Liu, Biao; Ding, Fengan; Zhou, Xiaodie; Tu, Pin; Yu, Bo; He, Yan; Huang, Peilin

    2017-06-01

    Circulating tumor cells (CTCs), isolated as a 'liquid biopsy', may provide important diagnostic and prognostic information. Therefore, rapid, reliable and unbiased detection of CTCs are required for routine clinical analyses. It was demonstrated that negative enrichment, an epithelial marker-independent technique for isolating CTCs, exhibits a better efficiency in the detection of CTCs compared with positive enrichment techniques that only use specific anti-epithelial cell adhesion molecules. However, negative enrichment techniques incur significant cell loss during the isolation procedure, and as it is a method that uses only one type of antibody, it is inherently biased. The detection procedure and identification of cell types also relies on skilled and experienced technicians. In the present study, the detection sensitivity of using negative enrichment and a previously described unbiased detection method was compared. The results revealed that unbiased detection methods may efficiently detect >90% of cancer cells in blood samples containing CTCs. By contrast, only 40-60% of CTCs were detected by negative enrichment. Additionally, CTCs were identified in >65% of patients with stage I/II lung cancer. This simple yet efficient approach may achieve a high level of sensitivity. It demonstrates a potential for the large-scale clinical implementation of CTC-based diagnostic and prognostic strategies.

  13. Modification of the BAX System PCR assay for detecting Salmonella in beef, produce, and soy protein isolate. Performance Tested Method 100201.

    Science.gov (United States)

    Peng, Linda X; Wallace, Morgan; Andaloro, Bridget; Fallon, Dawn; Fleck, Lois; Delduco, Dan; Tice, George

    2011-01-01

    The BAX System PCR assay for Salmonella detection in foods was previously validated as AOAC Research Institute (RI) Performance Tested Method (PTM) 100201. New studies were conducted on beef and produce using the same media and protocol currently approved for the BAX System PCR assay for E. coli O157:H7 multiplex (MP). Additionally, soy protein isolate was tested for matrix extension using the U.S. Food and Drug Administration-Bacteriological Analytical Manual (FDA-BAM) enrichment protocols. The studies compared the BAX System method to the U.S. Department of Agriculture culture method for detecting Salmonella in beef and the FDA-BAM culture method for detecting Salmonella in produce and soy protein isolate. Method comparison studies on low-level inoculates showed that the BAX System assay for Salmonella performed as well as or better than the reference method for detecting Salmonella in beef and produce in 8-24 h enrichment when the BAX System E. coli O157:H7 MP media was used, and soy protein isolate in 20 h enrichment with lactose broth followed by 3 h regrowth in brain heart infusion broth. An inclusivity panel of 104 Salmonella strains with diverse serotypes was tested by the BAX System using the proprietary BAX System media and returned all positive results. Ruggedness factors involved in the enrichment phase were also evaluated by testing outside the specified parameters, and none of the factors examined affected the performance of the assay.

  14. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  15. Real-time onestep RT-PCR for the detection and differentiation of European and North American types of PRRSV in boar semen

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...

  16. Alkaline Peptone Water-Based Enrichment Method for mcr-3 From Acute Diarrheic Outpatient Gut Samples

    Directory of Open Access Journals (Sweden)

    Qiaoling Sun

    2018-05-01

    Full Text Available A third plasmid-mediated colistin resistance gene, mcr-3, is increasingly being reported in Enterobacteriaceae and Aeromonas spp. from animals and humans. To investigate the molecular epidemiology of mcr in the gut flora of Chinese outpatients, 152 stool specimens were randomly collected from outpatients in our hospital from May to June, 2017. Stool specimens enriched in alkaline peptone water or Luria-Bertani (LB broth were screened for mcr-1, mcr-2, and mcr-3 using polymerase chain reaction (PCR-based assays. Overall, 19.1% (29/152 and 5.3% (8/152 of the stool samples enriched in alkaline peptone water were PCR-positive for mcr-1 and mcr-3, respectively, while 2.7% (4/152 of samples were positive for both mcr-1 and mcr-3. Strains isolated from the samples that were both mcr-1- and mcr-3-positive were subjected to antimicrobial susceptibility testing by broth microdilution. They were also screened for the presence of other resistance genes by PCR, while multilocus sequence typing and whole-genome sequencing were used to investigate the molecular epidemiology and genetic environment, respectively, of the resistance genes. mcr-3-positive Aeromonas veronii strain 126-14, containing a mcr-3.8-mcr-3-like2 segment, and mcr-1-positive Escherichia coli strain 126-1, belonging to sequence type 1485, were isolated from the sample from a diarrheic butcher with no history of colistin treatment. A. veronii 126-14 had a colistin minimum inhibitory concentration (MIC of 2 µg/mL and was susceptible to antibiotics in common use, while E. coli 126-1 produced TEM-1, CTX-M-55, and CTX-M-14 β-lactamases and was resistant to colistin, ceftazidime, and cefotaxime. Overall, there was a higher detection rate of mcr-3-carrying strains with low colistin MICs from the samples enriched in alkaline peptone water than from samples grown in LB broth.

  17. Uranium enrichment

    International Nuclear Information System (INIS)

    1990-01-01

    This report looks at the following issues: How much Soviet uranium ore and enriched uranium are imported into the United States and what is the extent to which utilities flag swap to disguise these purchases? What are the U.S.S.R.'s enriched uranium trading practices? To what extent are utilities required to return used fuel to the Soviet Union as part of the enriched uranium sales agreement? Why have U.S. utilities ended their contracts to buy enrichment services from DOE?

  18. Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR

    Energy Technology Data Exchange (ETDEWEB)

    Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)

    1994-09-01

    Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.

  19. PCR methodology as a valuable tool for identification of endodontic pathogens.

    Science.gov (United States)

    Siqueira, José F; Rôças, Isabela N

    2003-07-01

    This paper reviews the principles of polymerase chain reaction (PCR) methodology, its application in identification of endodontic pathogens and the perspectives regarding the knowledge to be reached with the use of this highly sensitive, specific and accurate methodology as a microbial identification test. Studies published in the medical, dental and biological literature. Evaluation of published epidemiological studies examining the endodontic microbiota through PCR methodology. PCR technology has enabled the detection of bacterial species that are difficult or even impossible to culture as well as cultivable bacterial strains showing a phenotypically divergent or convergent behaviour. Moreover, PCR is more rapid, much more sensitive, and more accurate when compared with culture. Its use in endodontics to investigate the microbiota associated with infected root canals has expanded the knowledge on the bacteria involved in the pathogenesis of periradicular diseases. For instance, Tannerella forsythensis (formerly Bacteroides forsythus), Treponema denticola, other Treponema species, Dialister pneumosintes, and Prevotella tannerae were detected in infected root canals for the first time and in high prevalence when using PCR analysis. The diversity of endodontic microbiota has been demonstrated by studies using PCR amplification, cloning and sequencing of the PCR products. Moreover, other fastidious bacterial species, such as Porphyromonas endodontalis, Porphyromonas gingivalis and some Eubacterium spp., have been reported in endodontic infections at a higher prevalence than those reported by culture procedures.

  20. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  1. Recovery of the Decorin-Enriched Fraction, Extract (D, From Human Skin: An Accelerated Protocol

    Directory of Open Access Journals (Sweden)

    Denys N. Wheatley

    2004-01-01

    Full Text Available The original extraction procedure of Engel and Catchpole [1] has often been used to recover decorin-enriched material from the skin. This material has a strong inhibitory effect on fibroblast proliferation, and clearly suppresses it in skin except after the first 5–6 days of wounding when new scaffold material is required. The aim of our present study has been to find and evaluate the product of a faster recovery method, and to check its consistency as a more reliable means of regularly obtaining sufficient material for topical application in wounds that might become hypertrophic. Modifications of the original Toole and Lowther [2] extraction procedure have been carefully evaluated in an attempt to cut preparation time without compromising biological activity of the inhibitory extract. We have devised a faster recovery procedure without compromising biological activity, even if initial recovery has been somewhat reduced. The latter problem could be offset by repeated cycles of the final extraction step. The main inhibitory activity is shown to be within the decorin-enriched “extract D,” as the core protein and DSPG II. Adjustment of the extract towards neutrality after dialysis against water keeps most of the extracted protein in solution and yielded a decorin-enriched preparation that had a specific activity equivalent to that of the old method. It also yielded a fraction that was readily lyophilised to give a small amount of material that could be stored indefinitely without loss of activity and readily redissolved in aqueous solution. A reliable and relatively quick method is presented for the production, from human skin, of a decorin-enriched preparation that has strong fibroblast inhibitory action. The value of the procedure is that it is inexpensive and can produce the quantities that might be used topically in reducing hypertrophic scarring of wounds.

  2. Gas-phase UF6 enrichment monitor for enrichment plant safeguards

    International Nuclear Information System (INIS)

    Strittmatter, R.B.; Tape, J.W.

    1980-03-01

    An in-line enrichment monitor is being developed to provide real-time enrichment data for the gas-phase UF 6 feed stream of an enrichment plant. The nondestructive gamma-ray assay method can be used to determine the enrichment of natural UF 6 with a relative precision of better than 1% for a wide range of pressures

  3. Analysis of microbial community and nitrogen transition with enriched nitrifying soil microbes for organic hydroponics.

    Science.gov (United States)

    Saijai, Sakuntala; Ando, Akinori; Inukai, Ryuya; Shinohara, Makoto; Ogawa, Jun

    2016-06-27

    Nitrifying microbial consortia were enriched from bark compost in a water system by regulating the amounts of organic nitrogen compounds and by controlling the aeration conditions with addition of CaCO 3 for maintaining suitable pH. Repeated enrichment showed reproducible mineralization of organic nitrogen via the conversion of ammonium ions ([Formula: see text]) and nitrite ions ([Formula: see text]) into nitrate ions ([Formula: see text]). The change in microbial composition during the enrichment was investigated by PCR-DGGE analysis with a focus on prokaryote, ammonia-oxidizing bacteria, nitrite-oxidizing bacteria, and eukaryote cell types. The microbial transition had a simple profile and showed clear relation to nitrogen ions transition. Nitrosomonas and Nitrobacter were mainly detected during [Formula: see text] and [Formula: see text] oxidation, respectively. These results revealing representative microorganisms acting in each ammonification and nitrification stages will be valuable for the development of artificial simple microbial consortia for organic hydroponics that consisted of identified heterotrophs and autotrophic nitrifying bacteria.

  4. Culture versus PCR for Salmonella Species Identification in Some Dairy Products and Dairy Handlers with Special Concern to Its Zoonotic Importance.

    Science.gov (United States)

    Gwida, Mayada M; Al-Ashmawy, Maha A M

    2014-01-01

    A total of 200 samples of milk and dairy products as well as 120 samples of dairy handlers were randomly collected from different dairy farms and supermarkets in Dakahlia Governorate, Egypt. The conventional cultural and serotyping methods for detection of Salmonella in dairy products were applied and the results were compared with those obtained by molecular screening assay using (ttr sequence). The obtained results revealed that 21% of milk and dairy products (42/200) were positive for Salmonella species using enrichment culture-based PCR method, while 12% of different dairy samples (24/200) were found to be positive for Salmonella species by using the conventional culture methods. Two stool specimens out of 40 apparently healthy dairy handlers were positive by the PCR method. Serotyping of Salmonella isolates revealed that 58.3% (14/24) from different dairy products were contaminated with Salmonella Typhimurium. We conclude that the enrichment culture-based PCR assay has high sensitivity and specificity for detection of Salmonella species in dairy products and handlers. High incidence of Salmonella Typhimurium in the examined dairy samples highlights the important role played by milk and dairy products as a vehicle in disease prevalence. Great effort should be applied for reducing foodborne risk for consumers.

  5. Enrichment of measles virus-like RNA in the nucleocapsid fraction isolated from subacute sclerosing panencephalitis brains

    International Nuclear Information System (INIS)

    Bedows, E.; Payne, F.E.; Kohne, D.E.; Tourtellotte, W.W.

    1982-01-01

    A procedure has been developed which facilitates the detection of measles virus RNA sequences in human brains. The procedure involves isolating subviral components (nucleocapsids) from brain tissues prior to RNA purification, followed by hybridization of these RNAs to cDNA synthesized from measles virus 50 S RNA template. Using these techniques we were able to obtain an RNA fraction which was manyfold enriched in measles virus-specific RNA, relative to unfractionated subacute sclerosing panencephalitis (SSPE) brain RNAs. 70-100% of the measles virus-specific RNA present in these SSPE brain samples were recovered in this enriched fraction. (Auth.)

  6. Enrichment of measles virus-like RNA in the nucleocapsid fraction isolated from subacute sclerosing panencephalitis brains

    Energy Technology Data Exchange (ETDEWEB)

    Bedows, E; Payne, F E [Michigan Univ., Ann Arbor (USA). School of Public Health; Kohne, D E [Center for Neurologic Study, San Diego, CA, USA; Tourtellotte, W W [Neurology Service, V.A. Wadsworth Hospital Center, Los Angeles, CA, USA

    1982-02-01

    A procedure has been developed which facilitates the detection of measles virus RNA sequences in human brains. The procedure involves isolating subviral components (nucleocapsids) from brain tissues prior to RNA purification, followed by hybridization of these RNAs to cDNA synthesized from measles virus 50 S RNA template. Using these techniques we were able to obtain an RNA fraction which was manyfold enriched in measles virus-specific RNA, relative to unfractionated subacute sclerosing panencephalitis (SSPE) brain RNAs. 70-100% of the measles virus-specific RNA present in these SSPE brain samples were recovered in this enriched fraction.

  7. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  8. Real-Time PCR Quantification of Chloroplast DNA Supports DNA Barcoding of Plant Species.

    Science.gov (United States)

    Kikkawa, Hitomi S; Tsuge, Kouichiro; Sugita, Ritsuko

    2016-03-01

    Species identification from extracted DNA is sometimes needed for botanical samples. DNA quantification is required for an accurate and effective examination. If a quantitative assay provides unreliable estimates, a higher quantity of DNA than the estimated amount may be used in additional analyses to avoid failure to analyze samples from which extracting DNA is difficult. Compared with conventional methods, real-time quantitative PCR (qPCR) requires a low amount of DNA and enables quantification of dilute DNA solutions accurately. The aim of this study was to develop a qPCR assay for quantification of chloroplast DNA from taxonomically diverse plant species. An absolute quantification method was developed using primers targeting the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene using SYBR Green I-based qPCR. The calibration curve was generated using the PCR amplicon as the template. DNA extracts from representatives of 13 plant families common in Japan. This demonstrates that qPCR analysis is an effective method for quantification of DNA from plant samples. The results of qPCR assist in the decision-making will determine the success or failure of DNA analysis, indicating the possibility of optimization of the procedure for downstream reactions.

  9. Silver surface enrichment controlled by simultaneous RBS for reliable PIXE analysis of ancient coins

    International Nuclear Information System (INIS)

    Beck, L.; Alloin, E.; Berthier, C.; Reveillon, S.; Costa, V.

    2008-01-01

    Evidence of silver surface enrichment of ancient silver-copper coins has been pointed out in the past years. Surface enrichment can be fortuitous or intentional. In this paper, we have investigated the cleaning procedures usually performed after excavation or in museums. We have shown that chemicals or commercial products routinely used dissolve preferentially the copper phase and consequently contribute to the silver surface enrichment. As a result, surface analyses such as PIXE or XRF can be strongly affected by this effect. By using simultaneously RBS and PIXE, it is possible to check through the silver surface enrichment and then select the reliable measurements, characteristic of the bulk composition. Results on coins recently discovered and mechanically or chemically cleaned are presented

  10. Detection of Salmonella Spp., Shigella (Flexneri and Sonnei) and Vibrio Cholerae O1 by Polymerase Chain Reaction (PCR) in Exported Shrimp from the Mexican Northeast Coast

    Energy Technology Data Exchange (ETDEWEB)

    Perez, L.; Nuñez, F.; Rubio, M.; Nicoli, M. [Universidad Nacional Autónoma de México, Facultad de Medicina Veterinaria y Zootecnia (Mexico)

    2005-01-15

    The objective of the present work was to use the PCR technique for the simultaneous detection of Salmonella spp and Vibrio cholerae O1 in frozen shrimp for export. The DNA segments located in the gene A [284 pairs of bases (pb)] from Salmonella spp. locus ial (217 and 320 pb) from Shigella flexneri and Shigella sonnei and the gene ctxA and ctxB (777 pb) from Vibrio cholerae O1 were amplified. The different primers that amplify these segments were assayed in a PCR reaction for the simultaneous detection of DNA from the microorganisms. It was not possible to amplify the gene of Shigella sonnei and Shigella flexneri under the assay’s conditions, whilst those of Salmonella spp. and Vibrio cholerae O1 were successfully amplified. The amplification conditions for the PCR were: 94° C, 58° C and 72° C during 30 cycles, allowing a reduction from 15 days test time with the official microbiological methods to 28 hours (24 for the pre-enrichment and four for the PCR). Samples of raw-frozen-headless shrimps were taken from production plants located in the State of Sinaloa, Mexico. A random sampling procedure was used, according to the guidelines described by the International Commission of Microbiological Specifications for Foods (ICMSF, 1999). Five packages per lot per production plant were obtained. From each individual package (5 pounds 80 OZ ≈ 2.27 kg) three samples were taken for the bacteriological assays to search for Salmonella spp. and Vibrio cholerae O1, respectively. The samples were also analyzed by PCR. Results showed that none of the samples were positive by PCR to any of the studied bacteria. Salmonella spp. and Vibrio cholerae O1 were not detected in these samples by the official methods. However, the latter were able to identify other Vibrio species and enterobacteria like Proteus and Acromobacter. These results confirmed PCR’s rapidity, sensitivity and specificity. (author)

  11. Salmonella testing of pooled pre-enrichment broth cultures for screening multiple food samples.

    Science.gov (United States)

    Price, W R; Olsen, R A; Hunter, J E

    1972-04-01

    A method has been described for testing multiple food samples for Salmonella without loss in sensitivity. The method pools multiple pre-enrichment broth cultures into single enrichment broths. The subsequent stages of the Salmonella analysis are not altered. The method was found applicable to several dry food materials including nonfat dry milk, dried egg albumin, cocoa, cottonseed flour, wheat flour, and shredded coconut. As many as 25 pre-enrichment broth cultures were pooled without apparent loss in the sensitivity of Salmonella detection as compared to individual sample analysis. The procedure offers a simple, yet effective, way to increase sample capacity in the Salmonella testing of foods, particularly where a large proportion of samples ordinarily is negative. It also permits small portions of pre-enrichment broth cultures to be retained for subsequent individual analysis if positive tests are found. Salmonella testing of pooled pre-enrichment broths provides increased consumer protection for a given amount of analytical effort as compared to individual sample analysis.

  12. Species-specific diagnostic assays for Bonamia ostreae and B. exitiosa in European flat oyster Ostrea edulis: conventional, real-time and multiplex PCR.

    Science.gov (United States)

    Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira

    2013-05-27

    Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.

  13. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

    Science.gov (United States)

    Smith, Cindy J; Osborn, A Mark

    2009-01-01

    Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

  14. Immunomagnetic separation combined with RT-qPCR for determining the efficacy of disinfectants against human noroviruses

    Directory of Open Access Journals (Sweden)

    Pengbo Liu

    2015-03-01

    Full Text Available Summary: Little is known about the effectiveness of disinfectants against human noroviruses (NoV partially because human NoV cannot be routinely cultured in laboratory. The objective of this study was to develop a NoV monoclonal antibody-conjugated immunomagnetic separation (IMS procedure combined with real-time reverse transcription polymerase chain reaction (RT-qPCR assays to study the in vitro efficacy of disinfectants against human NoV. Monoclonal antibodies against Norwalk virus (NV, GI.1 and NoV GII.4 were produced using unique NoV capsid proteins, and the antibodies were conjugated to magnetic Dynalbeads. The immunomagnetic beads were used to simultaneously capture intact NoV in samples and effectively remove PCR inhibitors. We examined the efficacy of ethanol, sodium hypochlorite, nine commercially available disinfectants, and one prototype disinfectant using the IMS/RT-qPCR. The sensitivity of this procedure was approximately 100 virus particles for both the NV and GII.4 viruses. The average log reductions in in vitro activities varied between disinfectants. The prototype disinfectant produced an average 3.19-log reduction in NV and a 1.38-log reduction in GII.4. The prototype disinfectant is promising of inactivating NoV. This method can be used to evaluate in vitro activity of disinfectants against human NoV. The IMS/RT-qPCR method is promising as an effective method to remove PCR inhibitors in disinfectants and enable the evaluation of the efficacy of disinfectants. Keywords: Disinfectant, Norovirus, Immunomagnetic separation, Real-time RT-PCR, PCR inhibition

  15. Development of Multiplex Microsatellite PCR Panels for the Seagrass Thalassia hemprichii (Hydrocharitaceae

    Directory of Open Access Journals (Sweden)

    Kor-jent van Dijk

    2014-11-01

    Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.

  16. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  17. Immunomagnetic separation and conventional culture procedure for detection of naturally occurring Salmonella in raw pork sausages and chicken meat.

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M

    1997-06-01

    The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.

  18. Uranium enrichment

    International Nuclear Information System (INIS)

    Rae, H.K.; Melvin, J.G.

    1988-06-01

    Canada is the world's largest producer and exporter of uranium, most of which is enriched elsewhere for use as fuel in LWRs. The feasibility of a Canadian uranium-enrichment enterprise is therefore a perennial question. Recent developments in uranium-enrichment technology, and their likely impacts on separative work supply and demand, suggest an opportunity window for Canadian entry into this international market. The Canadian opportunity results from three particular impacts of the new technologies: 1) the bulk of the world's uranium-enrichment capacity is in gaseous diffusion plants which, because of their large requirements for electricity (more than 2000 kW·h per SWU), are vulnerable to competition from the new processes; 2) the decline in enrichment costs increases the economic incentive for the use of slightly-enriched uranium (SEU) fuel in CANDU reactors, thus creating a potential Canadian market; and 3) the new processes allow economic operation on a much smaller scale, which drastically reduces the investment required for market entry and is comparable with the potential Canadian SEU requirement. The opportunity is not open-ended. By the end of the century the enrichment supply industry will have adapted to the new processes and long-term customer/supplier relationships will have been established. In order to seize the opportunity, Canada must become a credible supplier during this century

  19. Bacterial Community Profiling of H2/CO2 or Formate-Utilizing Acetogens Enriched from Diverse Ecosystems

    Science.gov (United States)

    Han, R.; Zhang, L.; Fu, B.; Liu, H.

    2014-12-01

    Synthetic gases are usually generated from either cellulosic agricultural waste combustion or industrial release and could be subsequently transformed into acetate, ethanol, and/or butyrate by homoacetogenic bacteria, which commonly possess reductive acetyl-CoA synthesis pathway. Homoacetogen-based syngas fermentation technology provides an alternative solution to link greenhouse gas emission control and cellulosic solid waste treatment with biofuels production. The objective of our current project is to hunt for homoacetogens with capabilities of highly efficiently converting syngases to chemical solvents. In this study, we evaluated homoacetogens population dynamics during enrichments and pinpointed dominant homoacetogens representing diverse ecosystems enriched by different substrates. We enriched homoacetogens from four different samples including waste activate sludge, freshwater sediment, anaerobic methanogenic sludge, and cow manure using H2/CO2 (4:1) or formate as substrate for homoacetogen enrichment. Along with the formyltetrahydrofolate synthetase (FTHFS) gene (fhs gene)-specific real time qPCR assay and Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis, 16S rRNA based 454 high-throughput pyrosequencing was applied to reveal the population dynamic and community structure during enrichment from different origins. Enrichment of homoacetogenic populations coincided with accumulations of short chain fatty acids such as acetate and butyrate. 454 high-throughput pyrosequencing revealed Firmicutes and Spirochaetes populations became dominant while the overall microbial diversity decreased after enrichment. The most abundant sequences among the four origins belonged to the following phyla: Firmicutes, Spirochaetes, Proteobacteria, and Bacteroidetes, accounting for 62.1%-99.1% of the total reads. The major putative homoacetogenic species enriched on H2/CO2 or formate belonged to Clostridium spp., Acetobacterium spp., Acetoanaerobium spp

  20. Determination of enrichment of recycle uranium fuels for different burnup values

    International Nuclear Information System (INIS)

    Zabunoglu, Okan H.

    2008-01-01

    Uranium (U) recovered from spent LWR fuels by reprocessing, which contains small amounts of U-236, is to be enriched before being re-irradiated as the recycle U. During the enrichment of recovered U in U-235, the mass fraction of U-236 also increases. Since the existence of U-236 in the recycle U has a negative effect on neutron economy, a greater enrichment of U-235 in the recycle U is required for reaching the same burnup as can be reached by the fresh U fuel. Two burnup values play the most important role in determining the enrichment of recycle U: (1) discharge burnup of spent fuel from which the recycle U is obtained and (2) desired discharge burnup of the recycle U fuel. A step-by-step procedure for calculating the enrichment of the recycle U as a function of these two burnup values is introduced. The computer codes MONTEBURNS and ORIGEN-S are made use of and a three-component (U-235, U-236, U-238) enrichment scheme is applied for calculating the amount of U-236 in producing the recycle U from the recovered U. As was aimed, the resulting expression is simple enough for quick/hand calculations of the enrichment of the recycle U for any given discharge burnup of spent fuel and for any desired discharge burnup of the recycle U fuel, most accurately within the range of 33,000-50,000 MWd/tonU

  1. Advanced enrichment techniques

    International Nuclear Information System (INIS)

    Johnson, A.

    1988-01-01

    BNFL is in a unique position in that it has commercial experience of diffusion enrichment, and of centrifuge enrichment through its associate company Urenco. In addition BNFL is developing laser enrichment techniques as part of a UK development programme in this area. The paper describes the development programme which led to the introduction of competitive centrifuge enrichment technology by Urenco and discusses the areas where improvements have and will continue to be made in the centrifuge process. It also describes the laser development programme currently being undertaken in the UK. The paper concludes by discussing the relative merits of the various methods of uranium enrichment, with particular reference to the enrichment market likely to obtain over the rest of the century

  2. Advanced enrichment techniques

    International Nuclear Information System (INIS)

    Johnson, A.

    1987-01-01

    BNFL is in a unique position in that it has commercial experience of diffusion enrichment, and of centrifuge enrichment through its associate company Urenco. In addition BNFL is developing laser enrichment techniques as part of a UK development programme in this area. The paper describes the development programme which led to the introduction of competitive centrifuge enrichment technology by Urenco and discusses the areas where improvements have and will continue to be made in the centrifuge process. It also describes the laser development programme currently being undertaken in the UK. The paper concludes by discussing the relative merits of the various methods of uranium enrichment, with particular reference to the enrichment market likely to obtain over the rest of the century. (author)

  3. Juvenile psittacine environmental enrichment.

    Science.gov (United States)

    Simone-Freilicher, Elisabeth; Rupley, Agnes E

    2015-05-01

    Environmental enrichment is of great import to the emotional, intellectual, and physical development of the juvenile psittacine and their success in the human home environment. Five major types of enrichment include social, occupational, physical, sensory, and nutritional. Occupational enrichment includes exercise and psychological enrichment. Physical enrichment includes the cage and accessories and the external home environment. Sensory enrichment may be visual, auditory, tactile, olfactory, or taste oriented. Nutritional enrichment includes variations in appearance, type, and frequency of diet, and treats, novelty, and foraging. Two phases of the preadult period deserve special enrichment considerations: the development of autonomy and puberty. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Uranium enrichment

    International Nuclear Information System (INIS)

    1989-01-01

    GAO was asked to address several questions concerning a number of proposed uranium enrichment bills introduced during the 100th Congress. The bill would have restructured the Department of Energy's uranium enrichment program as a government corporation to allow it to compete more effectively in the domestic and international markets. Some of GAO's findings discussed are: uranium market experts believe and existing market models show that the proposed DOE purchase of a $750 million of uranium from domestic producers may not significantly increase production because of large producer-held inventories; excess uranium enrichment production capacity exists throughout the world; therefore, foreign producers are expected to compete heavily in the United States throughout the 1990s as utilities' contracts with DOE expire; and according to a 1988 agreement between DOE's Offices of Nuclear Energy and Defense Programs, enrichment decommissioning costs, estimated to total $3.6 billion for planning purposes, will be shared by the commercial enrichment program and the government

  5. Isotope enrichment

    International Nuclear Information System (INIS)

    Lydtin, H-J.; Wilden, R.J.; Severin, P.J.W.

    1978-01-01

    The isotope enrichment method described is based on the recognition that, owing to mass diffusion and thermal diffusion in the conversion of substances at a heated substrate while depositing an element or compound onto the substrate, enrichment of the element, or a compound of the element, with a lighter isotope will occur. The cycle is repeated for as many times as is necessary to obtain the degree of enrichment required

  6. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  7. Two-stage electrolysis to enrich tritium in environmental water

    International Nuclear Information System (INIS)

    Shima, Nagayoshi; Muranaka, Takeshi

    2007-01-01

    We present a two-stage electrolyzing procedure to enrich tritium in environmental waters. Tritium is first enriched rapidly through a commercially-available electrolyser with a large 50A current, and then through a newly-designed electrolyser that avoids the memory effect, with a 6A current. Tritium recovery factor obtained by such a two-stage electrolysis was greater than that obtained when using the commercially-available device solely. Water samples collected in 2006 in lakes and along the Pacific coast of Aomori prefecture, Japan, were electrolyzed using the two-stage method. Tritium concentrations in these samples ranged from 0.2 to 0.9 Bq/L and were half or less, that in samples collected at the same sites in 1992. (author)

  8. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  9. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  10. Laser-induced photochemical enrichment of boron isotopes

    International Nuclear Information System (INIS)

    Freund, S.M.; Ritter, J.J.

    1976-01-01

    A boron trichloride starting material containing both boron-10 isotopes and boron-11 isotopes is selectively enriched in one or the other of these isotopes by a laser-induced photochemical method involving the reaction of laser-excited boron trichloride with either H 2 S or D 2 S. The method is carried out by subjecting a low pressure gaseous mixture of boron trichloride starting material and the sulfide to infrared radiation from a carbon dioxide TE laser. The wave length of the radiation is selected so as to selectively excite one or the other of boron-10 BCl 3 molecules or boron-11 BCl 3 molecules, thereby making them preferentially more reactive with the sulfide. The laser-induced reaction produces both a boron-containing solid phase reaction product and a gaseous phase containing mostly unreacted BCl 3 and small amounts of sulfhydroboranes. Pure boron trichloride selectively enriched in one of the isotopes is recovered as the primary product of the method from the gaseous phase by a multi-step recovery procedure. Pure boron trichloride enriched in the other isotope is recovered as a secondary product of the method by the subsequent chlorination of the solid phase reaction product followed by separation of BCl 3 from the mixture of gaseous products resulting from the chlorination

  11. Isolate PM1 populations are dominant and novel methyl tert-butyl ether-degrading bacterial in compost biofilter enrichments.

    Science.gov (United States)

    Bruns, M A; Hanson, J R; Mefford, J; Scow, K M

    2001-03-01

    The gasoline additive MTBE, methyl tert-butyl ether, is a widespread and persistent groundwater contaminant. MTBE undergoes rapid mineralization as the sole carbon and energy source of bacterial strain PM1, isolated from an enrichment culture of compost biofilter material. In this report, we describe the results of microbial community DNA profiling to assess the relative dominance of isolate PM1 and other bacterial strains cultured from the compost enrichment. Three polymerase chain reaction (PCR)-based profiling approaches were evaluated: denaturing gradient gel electrophoresis (DGGE) analysis of 230 bp 16S rDNA fragments; thermal gradient gel electrophoresis (TGGE) analysis of 575 bp 16S rDNA fragments; and non-denaturing polyacrylamide gel electrophoresis of 300-1,500 bp fragments containing 16S/23S ribosomal intergenic transcribed spacer (ITS) regions. Whereas all three DNA profiling approaches indicated that PM1-like bands predominated in mixtures from MTBE-grown enrichments, ITS profiling provided the most abundant and specific sequence data to confirm strain PM1's presence in the enrichment. Moreover, ITS profiling did not produce non-specific PCR products that were observed with T/DGGE. A further advantage of ITS community profiling over other methods requiring restriction digestion (e.g. terminal restriction fragment length polymorphisms) was that it did not require an additional digestion step or the use of automated sequencing equipment. ITS bands, excised from similar locations in profiles of the enrichment and PM1 pure culture, were 99.9% identical across 750 16S rDNA positions and 100% identical across 691 spacer positions. BLAST comparisons of nearly full-length 16S rDNA sequences showed 96% similarity between isolate PM1 and representatives of at least four different genera in the Leptothrix subgroup of the beta-Proteobacteria (Aquabacterium, Leptothrix, Rubrivivax and Ideonella). Maximum likelihood and parsimony analyses of 1,249 nucleotide

  12. A Dual Filtration-Based Multiplex PCR Method for Simultaneous Detection of Viable Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus on Fresh-Cut Cantaloupe.

    Directory of Open Access Journals (Sweden)

    Ke Feng

    Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.

  13. Polyphasic characterization of a PCP-to-phenol dechlorinating microbial community enriched from paddy soil

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Naoko [EcoTopia Science Institute, Nagoya University Nagoya 464-8603 (Japan)]. E-mail: ysd75@esi.nagoya-u.ac.jp; Yoshida, Yukina [Graduate School of Engineering, Nagoya University, Nagoya 464-8603 (Japan); Handa, Yuko [Graduate School of Engineering, Nagoya University, Nagoya 464-8603 (Japan); Kim, Hyo-Keun [Korea Ginseng and Tobacco Research Institute, Taejon 305-345 (Korea, Republic of); Ichihara, Shigeyuki [Faculty of Agriculture, Meijo University, Nagoya 468-8502 (Japan); Katayama, Arata [EcoTopia Science Institute, Nagoya University Nagoya 464-8603 (Japan); Graduate School of Engineering, Nagoya University, Nagoya 464-8603 (Japan)

    2007-08-01

    Dechlorination of PCP has been observed previously under anaerobic condition in paddy soil. However, there is poor information about the dechlorination pathway of PCP and the microbial community associated with the PCP dechlorination in paddy soil. In this study, an anaerobic microbial community dechlorinating PCP was enriched by serial transfers from a paddy soil using a medium containing PCP, lactate and the steam-sterilized paddy soil. The enriched microbial community dechlorinated PCP completely to phenol under the anaerobic condition by a dechlorinating pathway as follows; PCP {sup {yields}} 2,3,4,5-tetrachlorophenol {sup {yields}} 3,4,5-trichlorophenol {sup {yields}} 3,5-dichlorophenol {sup {yields}} 3-chlorophenol {sup {yields}} phenol. Intermediate products such as 3-chlorophenol were not accumulated, which were immediately dechlorinated to phenol. The enriched microbial community was characterized physiologically by testing the effects of electron donors and electron acceptors on the dechlorinating activity. The dechlorinating activity was promoted with lactate, pyruvate, and hydrogen as electron donors but not with acetate. Electron acceptors, nitrate and sulphate, inhibited the dechlorinating activity competitively but not iron (III). The microbial group associated with the anaerobic dechlorination was characterized by the effect of specific inhibitors on the PCP dechlorination. Effects of specific metabolic inhibitors and antibiotics indicated the involvement of Gram-positive spore-forming bacteria with the PCP dechlorinating activity, which was represented as bacteria of phylum Firmicutes. The structure of the microbial community was characterized by fluorescence in situ hybridization, quinone profiling, and PCR-DGGE (denaturing gel gradient electrophoresis). The combined results indicated the predominance of Clostridium species of phylum Firmicutes in the microbial community. Desulfitobacterium spp. known as anaerobic Gram-positive spore

  14. Polyphasic characterization of a PCP-to-phenol dechlorinating microbial community enriched from paddy soil

    International Nuclear Information System (INIS)

    Yoshida, Naoko; Yoshida, Yukina; Handa, Yuko; Kim, Hyo-Keun; Ichihara, Shigeyuki; Katayama, Arata

    2007-01-01

    Dechlorination of PCP has been observed previously under anaerobic condition in paddy soil. However, there is poor information about the dechlorination pathway of PCP and the microbial community associated with the PCP dechlorination in paddy soil. In this study, an anaerobic microbial community dechlorinating PCP was enriched by serial transfers from a paddy soil using a medium containing PCP, lactate and the steam-sterilized paddy soil. The enriched microbial community dechlorinated PCP completely to phenol under the anaerobic condition by a dechlorinating pathway as follows; PCP → 2,3,4,5-tetrachlorophenol → 3,4,5-trichlorophenol → 3,5-dichlorophenol → 3-chlorophenol → phenol. Intermediate products such as 3-chlorophenol were not accumulated, which were immediately dechlorinated to phenol. The enriched microbial community was characterized physiologically by testing the effects of electron donors and electron acceptors on the dechlorinating activity. The dechlorinating activity was promoted with lactate, pyruvate, and hydrogen as electron donors but not with acetate. Electron acceptors, nitrate and sulphate, inhibited the dechlorinating activity competitively but not iron (III). The microbial group associated with the anaerobic dechlorination was characterized by the effect of specific inhibitors on the PCP dechlorination. Effects of specific metabolic inhibitors and antibiotics indicated the involvement of Gram-positive spore-forming bacteria with the PCP dechlorinating activity, which was represented as bacteria of phylum Firmicutes. The structure of the microbial community was characterized by fluorescence in situ hybridization, quinone profiling, and PCR-DGGE (denaturing gel gradient electrophoresis). The combined results indicated the predominance of Clostridium species of phylum Firmicutes in the microbial community. Desulfitobacterium spp. known as anaerobic Gram-positive spore-forming bacteria dechlorinating PCP were not detected by PCR using a

  15. New generation enrichment monitoring technology for gas centrifuge enrichment plants

    International Nuclear Information System (INIS)

    Ianakiev, Kiril D.; Alexandrov, Boian S.; Boyer, Brian D.; Hill, Thomas R.; Macarthur, Duncan W.; Marks, Thomas; Moss, Calvin E.; Sheppard, Gregory A.; Swinhoe, Martyn T.

    2008-01-01

    The continuous enrichment monitor, developed and fielded in the 1990s by the International Atomic Energy Agency, provided a go-no-go capability to distinguish between UF 6 containing low enriched (approximately 4% 235 U) and highly enriched (above 20% 235 U) uranium. This instrument used the 22-keV line from a 109 Cd source as a transmission source to achieve a high sensitivity to the UF 6 gas absorption. The 1.27-yr half-life required that the source be periodically replaced and the instrument recalibrated. The instrument's functionality and accuracy were limited by the fact that measured gas density and gas pressure were treated as confidential facility information. The modern safeguarding of a gas centrifuge enrichment plant producing low-enriched UF 6 product aims toward a more quantitative flow and enrichment monitoring concept that sets new standards for accuracy stability, and confidence. An instrument must be accurate enough to detect the diversion of a significant quantity of material, have virtually zero false alarms, and protect the operator's proprietary process information. We discuss a new concept for advanced gas enrichment assay measurement technology. This design concept eliminates the need for the periodic replacement of a radioactive source as well as the need for maintenance by experts. Some initial experimental results will be presented.

  16. A random PCR screening system for the identification of type 1 human herpes simplex virus.

    Science.gov (United States)

    Yu, Xuelian; Shi, Bisheng; Gong, Yan; Zhang, Xiaonan; Shen, Silan; Qian, Fangxing; Gu, Shimin; Hu, Yunwen; Yuan, Zhenghong

    2009-10-01

    Several viral diseases exhibit measles-like symptoms. Differentiation of suspected cases of measles with molecular epidemiological techniques in the laboratory is useful for measles surveillance. In this study, a random PCR screening system was undertaken for the identification of isolates from patients with measles-like symptoms who exhibited cytopathic effects, but who had negative results for measles virus-specific reverse transcription (RT)-PCR and indirect immunofluorescence assays. Sequence analysis of random amplified PCR products showed that they were highly homologous to type 1 human herpes simplex virus (HSV-1). The results were further confirmed by an HSV-1-specific TaqMan real-time PCR assay. The random PCR screening system described in this study provides an efficient procedure for the identification of unknown viral pathogens. Measles-like symptoms can also be caused by HSV-1, suggesting the need to include HSV-1 in differential diagnoses of measles-like diseases.

  17. Population diversity of ammonium oxidizers investigated by specific PCR amplification

    Science.gov (United States)

    Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

    1997-01-01

    The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

  18. High throughput detection of Coxiella burnetii by real-time PCR with internal control system and automated DNA preparation

    Directory of Open Access Journals (Sweden)

    Kramme Stefanie

    2008-05-01

    Full Text Available Abstract Background Coxiella burnetii is the causative agent of Q-fever, a widespread zoonosis. Due to its high environmental stability and infectivity it is regarded as a category B biological weapon agent. In domestic animals infection remains either asymptomatic or presents as infertility or abortion. Clinical presentation in humans can range from mild flu-like illness to acute pneumonia and hepatitis. Endocarditis represents the most common form of chronic Q-fever. In humans serology is the gold standard for diagnosis but is inadequate for early case detection. In order to serve as a diagnostic tool in an eventual biological weapon attack or in local epidemics we developed a real-time 5'nuclease based PCR assay with an internal control system. To facilitate high-throughput an automated extraction procedure was evaluated. Results To determine the minimum number of copies that are detectable at 95% chance probit analysis was used. Limit of detection in blood was 2,881 copies/ml [95%CI, 2,188–4,745 copies/ml] with a manual extraction procedure and 4,235 copies/ml [95%CI, 3,143–7,428 copies/ml] with a fully automated extraction procedure, respectively. To demonstrate clinical application a total of 72 specimens of animal origin were compared with respect to manual and automated extraction. A strong correlation between both methods was observed rendering both methods suitable. Testing of 247 follow up specimens of animal origin from a local Q-fever epidemic rendered real-time PCR more sensitive than conventional PCR. Conclusion A sensitive and thoroughly evaluated real-time PCR was established. Its high-throughput mode may show a useful approach to rapidly screen samples in local outbreaks for other organisms relevant for humans or animals. Compared to a conventional PCR assay sensitivity of real-time PCR was higher after testing samples from a local Q-fever outbreak.

  19. Detection of EGFR somatic mutations in non-small cell lung cancer (NSCLC) using a novel mutant-enriched liquidchip (MEL) technology.

    Science.gov (United States)

    Zhang, Li; Yang, Huiyi; Zhao, Yanwei; Liu, Wenchao; Wu, Shiyang; He, Jiaying; Luo, Xiaodi; Zhu, Zeyao; Xu, Jiasen; Zhou, Qinghua; Ren-Heidenreich, Lifen

    2012-09-01

    We have developed and standardized a novel technology, mutant-enriched liquidchip (MEL), for clinical detection of EGFR mutations. The MEL integrates a mutant-enriched PCR procedure with liquidchip technology for detections of EGFR exon 19 deletions and L858R mutation on both formalin-fixed and paraffin-embedded (FFPE) slides and plasma samples from patients with non-small cell lung cancer (NSCLC). The detection sensitivity was 0.1% of mutant DNA in the presence of its wild-type DNA. The cross-reaction rate was lower than 5%. To evaluate the MEL platform, the EGFR mutation status of 59 patients with advanced NSCLC treated with EGFRTKIs (Tyrosine Kinase Inhibitors) were tested on their FFPE samples. EGFR exon 19 deletions and L858R were detected in 21 patients (21/59) and 76.2% (16/21) of them had partial response to the EGFR-TKIs, while by sequencing method, only 4 (4/59) mutations were detected. Plasma samples from 627 patients with various stages of NSCLC were examined with the MEL and 22% of EGFR exon 19 deletions and L858R were detected. Furthermore, in patients with advanced disease there are more mutations detected in plasma samples than in patients with less advanced disease. In conclusion, the MEL is a sensitive, stable, and robust technology for detecting EGFR DNA mutations from both FFPE and plasma samples from patients with NSCLC and is now routinely used for clinical diagnosis.

  20. Development of dissolution process for metal foil target containing low enriched uranium

    International Nuclear Information System (INIS)

    Srinivasan, B.; Hutter, J.C.; Johnson, G.K.; Vandegrift, G.F.

    1994-01-01

    About six times more low enriched uranium (LEU) metal is needed to produce the same quantity of 99 Mo as from a high enriched uranium (HEU) oxide target, under similar conditions of neutron irradiation. In view of this, the post-irradiation processing procedures of the LEU target are likely to be different from the Cintichem process procedures now in use for the HEU target. The authors have begun a systematic study to develop modified procedures for LEU target dissolution and 99 Mo separation. The dissolution studies include determination of the dissolution rate, chemical state of uranium in the solution, and the heat evolved in the dissolution reaction. From these results the authors conclude that a mixture of nitric and sulfuric acid is a suitable dissolver solution, albeit at higher concentration of nitric acid than in use for the HEU targets. Also, the dissolver vessel now in use for HEU targets is inadequate for the LEU target, since higher temperature and higher pressure will be encountered in the dissolution of LEU targets. The desire is to keep the modifications to the Cintichem process to a minimum, so that the switch from HEU to LEU can be achieved easily

  1. The impact of early postnatal environmental enrichment on maternal care and offspring behaviour following weaning.

    Science.gov (United States)

    Li, Ki Angel; Lund, Emilie Torp; Voigt, Jörg-Peter W

    2016-01-01

    The early postnatal period is a sensitive period in rodents as behavioural systems are developing and maturing during this time. However, relatively little information is available about the impact of environmental enrichment on offspring behaviour if enrichment is implemented only during this period. Here, environmental enrichment was provided from postnatal day 1 until weaning. On post-natal day 9, maternal behaviour and nonmaternal behaviour of the dam was observed. Nursing time in the enriched group was reduced but dams showed more non-maternal appetitive behaviours. Offspring were exposed to either the open field or the elevated plus maze (EPM) after weaning. In the open field, rats from the enriched group approached the more aversive inner zone of the open field later than control rats. Offspring from the enriched group made fewer entries into the inner zone and spent less time in this part of the arena. Enrichment had no impact on behaviour in the EPM. The present study provides evidence that postnatal enrichment can interfere with maternal behaviour in rats and can possibly lead to increased anxiety in the offspring. The findings suggest that enrichment procedures can have potentially unintended effects, interfering with the development of emotional behaviours in rats. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  3. Use of a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental survey of Mobile Bay.

    Science.gov (United States)

    Blackstone, George M; Nordstrom, Jessica L; Bowen, Michael D; Meyer, Richard F; Imbro, Paula; DePaola, Angelo

    2007-02-01

    Toxigenic Vibrio cholerae, the etiological agent of cholera, is a natural inhabitant of the marine environment and causes severe diarrheal disease affecting thousands of people each year in developing countries. It is the subject of extensive testing of shrimp produced and exported from these countries. We report the development of a real time PCR (qPCR) assay to detect the gene encoding cholera toxin, ctxA, found in toxigenic V. cholerae strains. This assay was tested against DNA isolated from soil samples collected from diverse locations in the US, a panel of eukaryotic DNA from various sources, and prokaryotic DNA from closely related and unrelated bacterial sources. Only Vibrio strains known to contain ctxA generated a fluorescent signal with the 5' nuclease probe targeting the ctxA gene, thus confirming the specificity of the assay. In addition, the assay was quantitative in pure culture across a six-log dynamic range down to <10 CFU per reaction. To test the robustness of this assay, oysters, aquatic sediments, and seawaters from Mobile Bay, AL, were analyzed by qPCR and traditional culture methods. The assay was applied to overnight alkaline peptone water enrichments of these matrices after boiling the enrichments for 10 min. Toxigenic V. cholerae strains were not detected by either qPCR or conventional methods in the 16 environmental samples examined. A novel exogenous internal amplification control developed by us to prevent false negatives identified the samples that were inhibitory to the PCR. This assay, with the incorporated internal control, provides a highly specific, sensitive, and rapid detection method for the detection of toxigenic strains of V. cholerae.

  4. Uranium enrichment plans

    International Nuclear Information System (INIS)

    Thomas, D.C.; Gagne, R.W.

    1978-01-01

    The following topics are covered: the status of the Government's existing uranium enrichment services contracts, natural uranium requirements based on the latest contract information, uncertainty in predicting natural uranium requirements based on uranium enrichment contracts, and domestic and foreign demand assumed in enrichment planning

  5. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Science.gov (United States)

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  6. SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.

    Science.gov (United States)

    Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu

    2017-12-18

    Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first

  7. A real-time PCR antibiogram for drug-resistant sepsis.

    Directory of Open Access Journals (Sweden)

    John R Waldeisen

    Full Text Available Current molecular diagnostic techniques for susceptibility testing of septicemia rely on genotyping for the presence of known resistance cassettes. This technique is intrinsically vulnerable due to the inability to detect newly emergent resistance genes. Traditional phenotypic susceptibility testing has always been a superior method to assay for resistance; however, relying on the multi-day growth period to determine which antimicrobial to administer jeopardizes patient survival. These factors have resulted in the widespread and deleterious use of broad-spectrum antimicrobials. The real-time PCR antibiogram, described herein, combines universal phenotypic susceptibility testing with the rapid diagnostic capabilities of PCR. We have developed a procedure that determines susceptibility by monitoring pathogenic load with the highly conserved 16S rRNA gene in blood samples exposed to different antimicrobial drugs. The optimized protocol removes heme and human background DNA from blood, which allows standard real-time PCR detection systems to be employed with high sensitivity (<100 CFU/mL. Three strains of E. coli, two of which were antimicrobial resistant, were spiked into whole blood and exposed to three different antibiotics. After real-time PCR-based determination of pathogenic load, a ΔC(t<3.0 between untreated and treated samples was found to indicate antimicrobial resistance (P<0.01. Minimum inhibitory concentration was determined for susceptible bacteria and pan-bacterial detection was demonstrated with 3 gram-negative and 2 gram-positive bacteria. Species identification was performed via analysis of the hypervariable amplicons. In summary, we have developed a universal diagnostic phenotyping technique that assays for the susceptibility of drug-resistant septicemia with the speed of PCR. The real-time PCR antibiogram achieves detection, susceptibility testing, minimum inhibitory concentration determination, and identification in less than 24

  8. Value of PCR in sonication fluid for the diagnosis of orthopedic hardware-associated infections: Has the molecular era arrived?

    Science.gov (United States)

    Renz, Nora; Cabric, Sabrina; Morgenstern, Christian; Schuetz, Michael A; Trampuz, Andrej

    2018-04-01

    Bone healing disturbance following fracture fixation represents a continuing challenge. We evaluated a novel fully automated polymerase chain reaction (PCR) assay using sonication fluid from retrieved orthopedic hardware to diagnose infection. In this prospective diagnostic cohort study, explanted orthopedic hardware materials from consecutive patients were investigated by sonication and the resulting sonication fluid was analyzed by culture (standard procedure) and multiplex PCR (investigational procedure). Hardware-associated infection was defined as visible purulence, presence of a sinus tract, implant on view, inflammation in peri-implant tissue or positive culture. McNemar's chi-squared test was used to compare the performance of diagnostic tests. For the clinical performance all pathogens were considered, whereas for analytical performance only microorganisms were considered for which primers are included in the PCR assay. Among 51 patients, hardware-associated infection was diagnosed in 38 cases (75%) and non-infectious causes in 13 patients (25%). The sensitivity for diagnosing infection was 66% for peri-implant tissue culture, 84% for sonication fluid culture, 71% (clinical performance) and 77% (analytical performance) for sonication fluid PCR, the specificity of all tests was >90%. The analytical sensitivity of PCR was higher for gram-negative bacilli (100%), coagulase-negative staphylococci (89%) and Staphylococcus aureus (75%) than for Cutibacterium (formerly Propionibacterium) acnes (57%), enterococci (50%) and Candida spp. (25%). The performance of sonication fluid PCR for diagnosis of orthopedic hardware-associated infection was comparable to culture tests. The additional advantage of PCR was short processing time (PCR has the potential to complement conventional cultures. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Comparison of strategies for the isolation of PCR-compatible, genomic DNA from a municipal biogas plants.

    Science.gov (United States)

    Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth

    2007-06-15

    The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.

  10. Other enrichment related contracts

    International Nuclear Information System (INIS)

    Hall, J.C.

    1978-01-01

    In addition to long-term enrichment contracts, DOE has other types of contracts: (1) short-term, fixed-commitment enrichment contract; (2) emergency sales agreement for enriched uranium; (3) feed material lease agreement; (4) enriched uranium storage agreement; and (5) feed material usage agreement

  11. Reduced enrichment fuel and its reactivity effects in the University Training Reactor Moata

    International Nuclear Information System (INIS)

    Wilson, D.J.

    1983-08-01

    Concern for nuclear proliferation is likely to preclude future supply of highly enriched uranium fuel for research reactors such as the University Training Reactor Moata. This study calculates the fuel densities necessary to maintain the reactivity per plate of the present high enrichment (90 per cent 235 U) fuel for a range of lower enrichments assuming that no geometry changes are allowed. The maximum uranium density for commercially available aluminium-type research reactor fuels is generally considered to be about 1.7 g cm -3 . With this density limitation, the minimum enrichment to maintain present reactivity per plate is about 35 per cent 235 U. For low enrichment (max. 20 per cent 235 U) fuel, the required U density is about 2.9 g cm -3 , which is beyond the expected range for UAl/sub x/-Al but within that projected for the longer term development and full qualification for U 3 O 8 -Al. Medium enrichment (nominally 45 per cent 235 U) Al/sub x/-Al would be entirely satisfactory as an immediate replacement fuel, requiring no modifications to the reactor and operating procedures, and minimal reappraisal of safety issues. Included in this study are calculations of the fuel coefficients at various enrichments, the effect of replacing standard fuel plates or complete elements with 45 per cent enriched fuel, and the reactivity to be gained by replacing 12-plate with 13-plate elements

  12. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  13. High-resolution melt PCR analysis for genotyping of Ureaplasma parvum isolates directly from clinical samples.

    Science.gov (United States)

    Payne, Matthew S; Tabone, Tania; Kemp, Matthew W; Keelan, Jeffrey A; Spiller, O Brad; Newnham, John P

    2014-02-01

    Ureaplasma sp. infection in neonates and adults underlies a variety of disease pathologies. Of the two human Ureaplasma spp., Ureaplasma parvum is clinically the most common. We have developed a high-resolution melt (HRM) PCR assay for the differentiation of the four serovars of U. parvum in a single step. Currently U. parvum strains are separated into four serovars by sequencing the promoter and coding region of the multiple-banded antigen (MBA) gene. We designed primers to conserved sequences within this region for PCR amplification and HRM analysis to generate reproducible and distinct melt profiles that distinguish clonal representatives of serovars 1, 3, 6, and 14. Furthermore, our HRM PCR assay could classify DNA extracted from 74 known (MBA-sequenced) test strains with 100% accuracy. Importantly, HRM PCR was also able to identify U. parvum serovars directly from 16 clinical swabs. HRM PCR performed with DNA consisting of mixtures of combined known serovars yielded profiles that were easily distinguished from those for single-serovar controls. These profiles mirrored clinical samples that contained mixed serovars. Unfortunately, melt curve analysis software is not yet robust enough to identify the composition of mixed serovar samples, only that more than one serovar is present. HRM PCR provides a single-step, rapid, cost-effective means to differentiate the four serovars of U. parvum that did not amplify any of the known 10 serovars of Ureaplasma urealyticum tested in parallel. Choice of reaction reagents was found to be crucial to allow sufficient sensitivity to differentiate U. parvum serovars directly from clinical swabs rather than requiring cell enrichment using microbial culture techniques.

  14. Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.

  15. Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques

    Directory of Open Access Journals (Sweden)

    PAULO Z. PASSAMANI

    2017-12-01

    Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

  16. Development of Quantitative Competitive PCR and Absolute Based Real-Time PCR Assays for Quantification of The Butyrate Producing Bacterium: Butyrivibrio fibrisolvens

    Directory of Open Access Journals (Sweden)

    Mojtaba Tahmoorespur

    2016-04-01

    Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio

  17. On-Line Enrichment Monitor for UF{sub 6} Gas Centrifuge Enrichment Plant

    Energy Technology Data Exchange (ETDEWEB)

    Ianakiev, K. D.; Boyer, B.; Favalli, A.; Goda, J. M.; Hill, T.; Keller, C.; Lombardi, M.; Paffett, M.; MacArthur, D. W.; McCluskey, C.; Moss, C. E.; Parker, R.; Smith, M. K.; Swinhoe, M. T. [Los Alamos National Laboratory, Los Alamos (United States)

    2012-06-15

    This paper is a continuation of the Advanced Enrichment Monitoring Technology for UF{sub 6} Gas Centrifuge Enrichment Plant (GCEP) work, presented in the 2010 IAEA Safeguards Symposium. Here we will present the system architecture for a planned side-by-side field trial test of passive (186-keV line spectroscopy and pressure-based correction for UF{sub 6} gas density) and active (186-keV line spectroscopy and transmission measurement based correction for UF{sub 6} gas density) enrichment monitoring systems in URENCO's enrichment plant in Capenhurst. Because the pressure and transmission measurements of UF{sub 6} are complementary, additional information on the importance of the presence of light gases and the UF{sub 6} gas temperature can be obtained by cross-correlation between simultaneous measurements of transmission, pressure and 186-keV intensity. We will discuss the calibration issues and performance in the context of accurate, on-line enrichment measurement. It is hoped that a simple and accurate on-line enrichment monitor can be built using the UF{sub 6} gas pressure provided by the Operator, based on online mass spectrometer calibration, assuming a negligible (a small fraction of percent) contribution of wall deposits. Unaccounted-for wall deposits present at the initial calibration will lead to unwanted sensitivity to changes in theUF{sub 6} gas pressure and thus to error in the enrichment results. Because the accumulated deposits in the cascade header pipe have been identified as an issue for Go/No Go measurements with the Cascade Header Enrichment Monitor (CHEM) and Continuous Enrichment Monitor (CEMO), it is important to explore their effect. Therefore we present the expected uncertainty on enrichment measurements obtained by propagating the errors introduced by deposits, gas density, etc. and will discuss the options for a deposit correction during initial calibration of an On-Line Enrichment Monitor (OLEM).

  18. One-stop polymerase chain reaction (PCR): An improved PCR ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.

  19. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  20. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  1. Quantification of Campylobacter spp. in chicken rinse samples by using flotation prior to real-time PCR

    DEFF Research Database (Denmark)

    Wolffs, Petra; Norling, Börje; Hoorfar, Jeffrey

    2005-01-01

    Real-time PCR is fast, sensitive, specific, and can deliver quantitative data; however, two disadvantages are that this technology is sensitive to inhibition by food and that it does not distinguish between DNA originating from viable, viable nonculturable (VNC), and dead cells. For this reason......, real-time PCR has been combined with a novel discontinuous buoyant density gradient method, called flotation, in order to allow detection of only viable and VNC cells of thermotolerant campylobacters in chicken rinse samples. Studying the buoyant densities of different Campylobacter spp. showed...... enrichment and amounts as low as 2.6 X 10(3) CFU/ml could be quantified. Furthermore, subjecting viable cells and dead cells to flotation showed that viable cells were recovered after flotation treatment but that dead cells and/or their DNA was not detected. Also, when samples containing VNC cells mixed...

  2. Preclinical detection of porcine circovirus type 2 infection using an ultrasensitive nanoparticle DNA probe-based PCR assay.

    Directory of Open Access Journals (Sweden)

    Yong Huang

    Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.

  3. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Science.gov (United States)

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Uranium Enrichment, an overview

    International Nuclear Information System (INIS)

    Coates, J.H.

    1994-01-01

    This general presentation on uranium enrichment will be followed by lectures on more specific topics including descriptions of enrichment processes and assessments of the prevailing commercial and industrial situations. I shall therefore avoid as much as possible duplications with these other lectures, and rather dwell on: some theoretical aspects of enrichment in general, underlying the differences between statistical and selective processes, a review and comparison between enrichment processes, remarks of general order regarding applications, the proliferation potential of enrichment. It is noteworthy that enrichment: may occur twice in the LWR fuel cycle: first by enriching natural uranium, second by reenriching uranium recovered from reprocessing, must meet LWR requirements, and in particular higher assays required by high burn up fuel elements, bears on the structure of the entire front part of the fuel cycle, namely in the conversion/reconversion steps only involving UF 6 for the moment. (author). tabs., figs., 4 refs

  5. Evaluation of a new single-tube multiprobe real-time PCR for diagnosis of Entamoeba histolytica and Entamoeba dispar.

    Science.gov (United States)

    Liang, Shih-Yu; Hsia, Kan-Tai; Chan, Yun-Hsien; Fan, Chia-Kwung; Jiang, Donald Dah-Shyong; Landt, Olfert; Ji, Dar-Der

    2010-08-01

    A single-tube multiprobe real-time PCR assay for simultaneous detection of Entamoeba histolytica and Entamoeba dispar was developed. One primer pair with 2 species-specific probes was designed based on new SSU RNA regions of the ribosomal DNA-containing episome. The sensitivity is 1 parasite per milliliter of feces and thus superior to the conventional nested PCR and comparable to other published real-time PCR protocols. The applicability for clinical diagnosis was validated with 218 stool specimens from patients. A total of 51 E. histolytica and 39 E. dispar positive samples was detected by the multiprobe real-time PCR compared to 39 and 22 by routine nested PCR diagnosis. The detection rate of Entamoeba species for the multiprobe real-time PCR assays was significantly higher than the nested PCR (40.8% vs. 28.0%, P Entamoeba moshkovskii, Giardia lamblia , Cryptosporidium sp., Escherichia coli , or other nonpathogenic enteric parasites. The multiprobe real-time PCR assay is simple and rapid and has high specificity and sensitivity. The assay could streamline the laboratory diagnosis procedure and facilitate epidemiological investigation.

  6. PCR detection of Helicobacter pylori in string-absorbed gastric juice.

    Science.gov (United States)

    Domínguez-Bello, M G; Cienfuentes, C; Romero, R; García, P; Gómez, I; Mago, V; Reyes, N; Gueneau de Novoa, P

    2001-04-20

    Molecular methods for detection of Helicobacter pylori infection have been shown to be highly sensitive in gastric biopsies and cultures. The objective of this work was to compare PCR detection of H. pylori DNA in string-absorbed gastric juice and in gastric biopsies. The study was performed in 47 dyspeptic adult patients undergoing endoscopy, and infection was detected by amplification of a segment of H. pylori ureA gene. Of the 29 patients positive in biopsy analysis, 23 (79%) were also positive in the gastric string. PCR analysis of gastric strings is a sensitive and safe procedure to detect H. pylori when endoscopy is not indicated, and may be of great clinical and epidemiological usefulness in determining effectiveness of eradication therapies, typing virulence genes and detecting antibiotic resistance mutations.

  7. Identification of circulating miRNA biomarkers based on global quantitative real-time PCR profiling

    Directory of Open Access Journals (Sweden)

    Kang Kang

    2012-02-01

    Full Text Available Abstract MicroRNAs (miRNAs are small noncoding RNAs (18-25 nucleotides that regulate gene expression at the post-transcriptional level. Recent studies have demonstrated the presence of miRNAs in the blood circulation. Deregulation of miRNAs in serum or plasma has been associated with many diseases including cancers and cardiovascular diseases, suggesting the possible use of miRNAs as diagnostic biomarkers. However, the detection of the small amount of miRNAs found in serum or plasma requires a method with high sensitivity and accuracy. Therefore, the current study describes polymerase chain reaction (PCR-based methods for measuring circulating miRNAs. Briefly, the procedure involves four major steps: (1 sample collection and preparation; (2 global miRNAs profiling using quantitative real-time PCR (qRT-PCR; (3 data normalization and analysis; and (4 selection and validation of miRNA biomarkers. In conclusion, qRT-PCR is a promising method for profiling of circulating miRNAs as biomarkers.

  8. Quantitative (real-time) PCR

    International Nuclear Information System (INIS)

    Denman, S.E.; McSweeney, C.S.

    2005-01-01

    Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

  9. Propidium Monoazide Coupled with PCR Predicts Infectivity of Enteric Viruses in Swine Manure and Biofertilized Soil.

    Science.gov (United States)

    Fongaro, Gislaine; Hernández, Marta; García-González, María Cruz; Barardi, Célia Regina Monte; Rodríguez-Lázaro, David

    2016-03-01

    The use of propidium monoazide (PMA) coupled with real-time PCR (RT-qPCR or qPCR for RNA or DNA viruses, respectively) was assessed to discriminate infectious enteric viruses in swine raw manure, swine effluent from anaerobic biodigester (AB) and biofertilized soils. Those samples were spiked either with infectious and heat-inactivated human adenovirus-2 (HAdV-2) or mengovirus (vMC0), and PMA-qPCR/RT-qPCR allowed discriminating inactivated viruses from the infective particles, with significant reductions (>99.9%). Then, the procedure was further assayed to evaluate the presence and stability of two non-cultivable viruses (porcine adenovirus and rotavirus A) in natural samples (swine raw manure, swine effluent from AB and biofertilized soils); it demonstrated viral inactivation during the storage period at 23 °C. As a result, the combination of PMA coupled to real-time PCR can be a promising alternative for prediction of viral infectivity in comparison to more labour-intensive and costly techniques such as animal or tissue-culture infectivity methods, and for those viruses that do not have currently available cell culture techniques.

  10. Uranium enrichment

    International Nuclear Information System (INIS)

    Mohrhauer, H.

    1982-01-01

    The separation of uranium isotopes in order to enrich the fuel for light water reactors with the light isotope U-235 is an important part of the nuclear fuel cycle. After the basic principals of isotope separation the gaseous diffusion and the centrifuge process are explained. Both these techniques are employed on an industrial scale. In addition a short review is given on other enrichment techniques which have been demonstrated at least on a laboratory scale. After some remarks on the present situation on the enrichment market the progress in the development and the industrial exploitation of the gas centrifuge process by the trinational Urenco-Centec organisation is presented. (orig.)

  11. United States uranium enrichment policies

    International Nuclear Information System (INIS)

    Roberts, R.W.

    1977-01-01

    ERDA's uranium enrichment program policies governing the manner in which ERDA's enrichment complex is being operated and expanded to meet customer requirements for separative work, research and development activities directed at providing technology alternatives for future enrichment capacity, and establishing the framework for additional domestic uranium enrichment capacity to meet the domestic and foreign nuclear industry's growing demand for enrichment services are considered. The ERDA enrichment complex consists of three gaseous diffusion plants located in Oak Ridge, Tennessee; Paducah, Kentucky; and Portsmouth, Ohio. Today, these plants provide uranium enrichment services for commercial nuclear power generation. These enrichment services are provided under contracts between the Government and the utility customers. ERDA's program involves a major pilot plant cascade, and pursues an advanced isotope separation technique for the late 1980's. That the United States must develop additional domestic uranium enrichment capacity is discussed

  12. Integrating molecular QTL data into genome-wide genetic association analysis: Probabilistic assessment of enrichment and colocalization.

    Directory of Open Access Journals (Sweden)

    Xiaoquan Wen

    2017-03-01

    Full Text Available We propose a novel statistical framework for integrating the result from molecular quantitative trait loci (QTL mapping into genome-wide genetic association analysis of complex traits, with the primary objectives of quantitatively assessing the enrichment of the molecular QTLs in complex trait-associated genetic variants and the colocalizations of the two types of association signals. We introduce a natural Bayesian hierarchical model that treats the latent association status of molecular QTLs as SNP-level annotations for candidate SNPs of complex traits. We detail a computational procedure to seamlessly perform enrichment, fine-mapping and colocalization analyses, which is a distinct feature compared to the existing colocalization analysis procedures in the literature. The proposed approach is computationally efficient and requires only summary-level statistics. We evaluate and demonstrate the proposed computational approach through extensive simulation studies and analyses of blood lipid data and the whole blood eQTL data from the GTEx project. In addition, a useful utility from our proposed method enables the computation of expected colocalization signals using simple characteristics of the association data. Using this utility, we further illustrate the importance of enrichment analysis on the ability to discover colocalized signals and the potential limitations of currently available molecular QTL data. The software pipeline that implements the proposed computation procedures, enloc, is freely available at https://github.com/xqwen/integrative.

  13. Influence of DNA isolation on Q-PCR-based quantification of methanogenic Archaea in biogas fermenters.

    Science.gov (United States)

    Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M

    2010-03-01

    Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.

  14. COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS

    Directory of Open Access Journals (Sweden)

    Tülin GÜVEN GÖKMEN

    Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.

  15. Blueprint for domestic uranium enrichment

    International Nuclear Information System (INIS)

    1981-01-01

    The AEC advisory committee on domestic production of uranium enrichment has studied for more than a year how to achieve the domestic enrichment of uranium by the construction and operation of a commercial enriching plant using centrifugal separation method, and the report was submitted to the Atomic Energy Commission on August 18, 1980. Japan has depended wholly on overseas services for her uranium enrichment needs, but the development of domestic enrichment has been carried on in parallel. The AEC decided to construct a uranium enrichment pilot plant using centrifuges, and it has been forwarded as a national project. The plant is operated by the Power Reactor and Nuclear Fuel Development Corp. since 1979. The capacity of the plant will be raised to approximately 75 ton SWU a year. The centrifuges already operated have provided the first delivery of fuel of about 1 ton for the ATR ''Fugen''. The demand-supply balance of uranium enrichment service, the significance of the domestic enrichment of uranium, the evaluation of uranium enrichment technology, the target for domestic enrichment plan, the measures to promote domestic uranium enrichment, and the promotion of the construction of a demonstration plant are reported. (Kako, I.)

  16. From the 'PCR' function to the 'PCR' profession; de la fonction 'PCR' au metier 'PCR'

    Energy Technology Data Exchange (ETDEWEB)

    Perrin, L. [CERAP, 91 - Gif sur Yvette (France)

    2008-07-01

    After having recalled the legal context concerning the appointment and training of a radiation protection expert (PCR for 'personne competente en radioprotection'), the author outlines that the PCR's role has notably evolved: his function is now of primary importance in the company and his activity does not correspond to the legal framework any longer. Moreover, with the application of a European directive, some small establishments possessing ionizing radiation sources are disadvantaged, and the PCR is now facing an increasing number of missions and tasks. The author gives a list of them and assesses a needed time of 146 days per year: this means PCRs cannot have an other activity within their company

  17. Licensing procedures and safety criteria for core conversion in Japan

    International Nuclear Information System (INIS)

    Kanda, K.; Nakagome, Y.; Hayashi, M.

    1983-01-01

    Procedures relating to the construction and operation of reactor facilities are discussed. Specifically, the Safety Analysis Report on the Kyoto University Critical Assembly (KUCA) core conversion (93% to 45% enrichment) is noted. The results of critical experiments in the KUCA and of burnup tests in the Oak Ridge Research (ORR) Reactor will be used in the final determination of the feasibility of the conversion of the Kyoto University High Flux Reactor (KUHFR) to the use of 45% enrichment

  18. UF/sub 6/ test loop for evaluation and implementation of international enrichment plant safeguards

    International Nuclear Information System (INIS)

    Cooley, J.N.; Fields, L.W.; Swindle, D.W. Jr.

    1987-01-01

    A functional test loop capable of simulating UF/sub 6/ flows, pressures, and pipe deposits characteristic of gas centrifuge enrichment plant piping has been designed and fabricated by the Enrichment Safeguards Program of Martin Marietta Energy Systems, Inc., for use by the International Atomic Energy Agency (IAEA) at its Safeguards Analytical Laboratory in Seibersdorf, Austria. The purpose of the test loop is twofold: (1) to enable the IAEA to evaluate and to calibrate enrichment safeguards measurement instrumentation to be used in limited frequency-unannounced access (LFUA) inspection strategy measurements at gas centrifuge enrichment plants and (2) to train IAEA inspectors in the use of such instrumentation. The test loop incorporates actual sections of cascade header pipes from the centrifuge enrichment plants subject to IAEA inspections. The test loop is described, applications for its use by the IAEA are detailed, and results from an initial demonstration session using the test loop are summarized. By giving the IAEA the in-house capability to evaluate LFUA inspection strategy approaches, to develop inspection procedures, to calibrate instrumentation, and to train inspectors, the UF/sub 6/ cascade header pipe test loop will contribute to the IAEA's success in implementing LFUA strategy inspections at gas centrifuge enrichment facilities subject to international safeguards inspections

  19. Procedures for the retention of gaseous tritium released from a tritium enrichment plant

    International Nuclear Information System (INIS)

    Gutowski, H.; Bracha, M.

    1987-01-01

    General aim of the study is the comparison of two alternative processes for the retention of gaseous tritium which is released during normal operation and emergency operation in a tritium-enrichment-plant. Two processes for the retention of tritium were compared: 1. Oxidation-process. The hydrogen-gas containing HT will be burnt on an oxidation catalyst to H 2 O and HTO. In a subsequent step the water will be removed from the process by condensation, freezing and adsorption. 2. TROC-process (Tritium Removal by Organic Compounds). The tritium is added to an organic compound (acid) via catalyst. This reaction is irreversible and leads to solid products. (orig./RB) [de

  20. ALARA (As Low As Reasonable Achievable) procedure applied to fuel assembly fabrication with enriched reprocessing uranium (ERU)

    International Nuclear Information System (INIS)

    Guimaraes, Leonam dos Santos; Degrange, Jean Pierre

    1998-01-01

    The study introduced by this paper compose the first step to the implementation of ALARA (As Low As Reasonable Achievable) for a nuclear fuel assembly factory which one of its two production lines will be designed to work with Enriched Reprocessing Uranium (ERU). This step includes the reference situation analysis is based on previsional dosimetric evaluations for individual and collective exposures of each factory operator (117 in total) working on 7 work stations, considering 6 annual production scenarios (10, 50 75, 100 and 150 ERU tons), which corresponds to an annual production of 600 tons (ERU plus enriched natural uranium ENU). The exposure indicators evolution, expressed in terms of collective dose, annual individual dose and radiological detrimental cost for workers, is also used in a complimentary way to guide the analysis. (author)

  1. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  2. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics.

    Science.gov (United States)

    van Ginkel, Joost H; van den Broek, Daan A; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M; Huibers, Manon M H

    2017-10-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for detecting rare mutational targets. In order to perform ddPCR on blood samples, a standardized procedure for processing and analyzing blood samples is necessary to facilitate implementation into clinical practice. Therefore, we assessed the technical sample workup procedure for ddPCR on blood plasma samples. Blood samples from healthy individuals, as well as lung cancer patients were analyzed. We compared different methods and protocols for sample collection, storage, centrifugation, isolation, and quantification. Cell-free DNA (cfDNA) concentrations of several wild-type targets and BRAF and EGFR-mutant ctDNA concentrations quantified by ddPCR were primary outcome measurements. Highest cfDNA concentrations were measured in blood collected in serum tubes. No significant differences in cfDNA concentrations were detected between various time points of up to 24 h until centrifugation. Highest cfDNA concentrations were detected after DNA isolation with the Quick cfDNA Serum & Plasma Kit, while plasma isolation using the QIAamp Circulating Nucleic Acid Kit yielded the most consistent results. DdPCR results on cfDNA are highly dependent on multiple factors during preanalytical sample workup, which need to be addressed during the development of this diagnostic tool for cancer diagnostics in the future. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  3. Uranium enrichment. Enrichment processes

    International Nuclear Information System (INIS)

    Alexandre, M.; Quaegebeur, J.P.

    2009-01-01

    Despite the remarkable progresses made in the diversity and the efficiency of the different uranium enrichment processes, only two industrial processes remain today which satisfy all of enriched uranium needs: the gaseous diffusion and the centrifugation. This article describes both processes and some others still at the demonstration or at the laboratory stage of development: 1 - general considerations; 2 - gaseous diffusion: physical principles, implementation, utilisation in the world; 3 - centrifugation: principles, elementary separation factor, flows inside a centrifuge, modeling of separation efficiencies, mechanical design, types of industrial centrifuges, realisation of cascades, main characteristics of the centrifugation process; 4 - aerodynamic processes: vortex process, nozzle process; 5 - chemical exchange separation processes: Japanese ASAHI process, French CHEMEX process; 6 - laser-based processes: SILVA process, SILMO process; 7 - electromagnetic and ionic processes: mass spectrometer and calutron, ion cyclotron resonance, rotating plasmas; 8 - thermal diffusion; 9 - conclusion. (J.S.)

  4. Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

    Science.gov (United States)

    Ogrean, Christy; Jackson, Ben; Covino, James

    2010-01-01

    The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

  5. Promotion of uranium enrichment business

    International Nuclear Information System (INIS)

    Kurushima, Morihiro

    1981-01-01

    The Committee on Nuclear Power has studied on the basic nuclear power policy, establishing its five subcommittees, entrusted by the Ministry of Nternational Trade and Industry. The results of examination by the subcommittee on uranium enrichment business are given along with a report in this connection by the Committee. In order to establish the nuclear fuel cycle, the aspect of uranium enrichment is essential. The uranium enrichment by centrifugal process has proceeded steadily in Power Reactor and Nuclear Fuel Development Corporation. The following matters are described: the need for domestic uranium enrichment, the outlook for overseas enrichment services and the schedule for establishing domestic enrichment business, the current state of technology development, the position of the prototype enrichment plant, the course to be taken to establish enrichment business the main organization operating the prototype and commercial plants, the system of supplying centrifuges, the domestic conversion of natural uranium the subsidies for uranium enrichment business. (J.P.N.)

  6. 9 CFR 147.14 - Procedures to determine status and effectiveness of sanitation monitored program.

    Science.gov (United States)

    2010-01-01

    ... status and effectiveness of sanitation monitored program. The following monitoring procedures 10 may be applied at the discretion of the Official State Agency: 10 Laboratory procedures for monitoring operations... egg conalbumin; and (ii) Tetrathionate selective enrichment broths, competitor-controlling plating...

  7. ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq data

    Directory of Open Access Journals (Sweden)

    Perkins James R

    2012-07-01

    Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.

  8. European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.

    Science.gov (United States)

    Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario

    2014-08-01

    The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. From high enriched to low enriched uranium fuel in research reactors

    Energy Technology Data Exchange (ETDEWEB)

    Van Den Berghe, S.; Leenaers, A.; Koonen, E.; Moons, F.; Sannen, L. [Nuclear Materials Science Institute, SCK.CEN, Boeretang 200, B-2400 Mol (Belgium)

    2010-07-01

    Since the 1970's, global efforts have been going on to replace the high-enriched (>90% {sup 235}U), low-density UAlx research reactor fuel with high-density, low enriched (<20% {sup 235}U) replacements. This search is driven by the attempt to reduce the civil use of high-enriched material because of proliferation risks and terrorist threats. American initiatives, such as the Global Threat Reduction Initiative (GTRI) and the Reduced Enrichment for Research and Test Reactors (RERTR) program have triggered the development of reliable low-enriched fuel types for these reactors, which can replace the high enriched ones without loss of performance. Most success has presently been obtained with U{sub 3}Si{sub 2} dispersion fuel, which is currently used in many research reactors in the world. However, efforts to search for a replacement with even higher density, which will also allow the conversion of some high flux research reactors that currently cannot change to U{sub 3}Si{sub 2} (eg. BR2 in Belgium), have continued and are for the moment mainly directed towards the U(Mo) alloy fuel (7-10 w% Mo). This paper provides an overview of the past efforts and presents the current status of the U(Mo) development. (authors)

  10. From high enriched to low enriched uranium fuel in research reactors

    International Nuclear Information System (INIS)

    Van Den Berghe, S.; Leenaers, A.; Koonen, E.; Moons, F.; Sannen, L.

    2010-01-01

    Since the 1970's, global efforts have been going on to replace the high-enriched (>90% 235 U), low-density UAlx research reactor fuel with high-density, low enriched ( 235 U) replacements. This search is driven by the attempt to reduce the civil use of high-enriched material because of proliferation risks and terrorist threats. American initiatives, such as the Global Threat Reduction Initiative (GTRI) and the Reduced Enrichment for Research and Test Reactors (RERTR) program have triggered the development of reliable low-enriched fuel types for these reactors, which can replace the high enriched ones without loss of performance. Most success has presently been obtained with U 3 Si 2 dispersion fuel, which is currently used in many research reactors in the world. However, efforts to search for a replacement with even higher density, which will also allow the conversion of some high flux research reactors that currently cannot change to U 3 Si 2 (eg. BR2 in Belgium), have continued and are for the moment mainly directed towards the U(Mo) alloy fuel (7-10 w% Mo). This paper provides an overview of the past efforts and presents the current status of the U(Mo) development. (authors)

  11. Uranium enrichment by gas centrifuge

    International Nuclear Information System (INIS)

    Heriot, I.D.

    1988-01-01

    After recalling the physical principles and the techniques of centrifuge enrichment the report describes the centrifuge enrichment programmes of the various countries concerned and compares this technology with other enrichment technologies like gaseous diffusion, laser, aerodynamic devices and chemical processes. The centrifuge enrichment process is said to be able to replace with advantage the existing enrichment facilities in the short and medium term. Future prospects of the process are also described, like recycled uranium enrichment and economic improvements; research and development needs to achieve the economic prospects are also indicated. Finally the report takes note of the positive aspect of centrifuge enrichment as far as safeguards and nuclear safety are concerned. 27 figs, 113 refs

  12. Derived enriched uranium market

    International Nuclear Information System (INIS)

    Rutkowski, E.

    1996-01-01

    The potential impact on the uranium market of highly enriched uranium from nuclear weapons dismantling in the Russian Federation and the USA is analyzed. Uranium supply, conversion, and enrichment factors are outlined for each country; inventories are also listed. The enrichment component and conversion components are expected to cause little disruption to uranium markets. The uranium component of Russian derived enriched uranium hexafluoride is unresolved; US legislation places constraints on its introduction into the US market

  13. Quantitation of next generation sequencing library preparation protocol efficiencies using droplet digital PCR assays - a systematic comparison of DNA library preparation kits for Illumina sequencing.

    Science.gov (United States)

    Aigrain, Louise; Gu, Yong; Quail, Michael A

    2016-06-13

    The emergence of next-generation sequencing (NGS) technologies in the past decade has allowed the democratization of DNA sequencing both in terms of price per sequenced bases and ease to produce DNA libraries. When it comes to preparing DNA sequencing libraries for Illumina, the current market leader, a plethora of kits are available and it can be difficult for the users to determine which kit is the most appropriate and efficient for their applications; the main concerns being not only cost but also minimal bias, yield and time efficiency. We compared 9 commercially available library preparation kits in a systematic manner using the same DNA sample by probing the amount of DNA remaining after each protocol steps using a new droplet digital PCR (ddPCR) assay. This method allows the precise quantification of fragments bearing either adaptors or P5/P7 sequences on both ends just after ligation or PCR enrichment. We also investigated the potential influence of DNA input and DNA fragment size on the final library preparation efficiency. The overall library preparations efficiencies of the libraries show important variations between the different kits with the ones combining several steps into a single one exhibiting some final yields 4 to 7 times higher than the other kits. Detailed ddPCR data also reveal that the adaptor ligation yield itself varies by more than a factor of 10 between kits, certain ligation efficiencies being so low that it could impair the original library complexity and impoverish the sequencing results. When a PCR enrichment step is necessary, lower adaptor-ligated DNA inputs leads to greater amplification yields, hiding the latent disparity between kits. We describe a ddPCR assay that allows us to probe the efficiency of the most critical step in the library preparation, ligation, and to draw conclusion on which kits is more likely to preserve the sample heterogeneity and reduce the need of amplification.

  14. External PCR, ASN's decision

    International Nuclear Information System (INIS)

    Anon.

    2012-01-01

    The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)

  15. PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains

    Directory of Open Access Journals (Sweden)

    Nowak Magdalena

    2009-11-01

    Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.

  16. A procedure for preparing alkali metal hydrides

    International Nuclear Information System (INIS)

    Lemieux, R.U.; Sanford, C.E.; Prescott, J.F.

    1976-01-01

    A plain low cost, procedure for the continuous, low temperature preparation of sodium or potassium hydrides using cheap reagents is presented. Said invention is especially concerned with a process of purifying of a catalytic exchange liquid used for deuterium enrichment, in which an alkali metal hydride is produced as intermediate product. The procedure for producing the sodium and potassium hydrides consists in causing high pressure hydrogen to be absorbed by a mixture of at least a lower monoalkylamine and an alkylamide of an alkali metal from at least one of said amines [fr

  17. Inter-laboratory assessment of different digital PCR platforms for quantification of human cytomegalovirus DNA.

    Science.gov (United States)

    Pavšič, Jernej; Devonshire, Alison; Blejec, Andrej; Foy, Carole A; Van Heuverswyn, Fran; Jones, Gerwyn M; Schimmel, Heinz; Žel, Jana; Huggett, Jim F; Redshaw, Nicholas; Karczmarczyk, Maria; Mozioğlu, Erkan; Akyürek, Sema; Akgöz, Müslüm; Milavec, Mojca

    2017-04-01

    Quantitative PCR (qPCR) is an important tool in pathogen detection. However, the use of different qPCR components, calibration materials and DNA extraction methods reduces comparability between laboratories, which can result in false diagnosis and discrepancies in patient care. The wider establishment of a metrological framework for nucleic acid tests could improve the degree of standardisation of pathogen detection and the quantification methods applied in the clinical context. To achieve this, accurate methods need to be developed and implemented as reference measurement procedures, and to facilitate characterisation of suitable certified reference materials. Digital PCR (dPCR) has already been used for pathogen quantification by analysing nucleic acids. Although dPCR has the potential to provide robust and accurate quantification of nucleic acids, further assessment of its actual performance characteristics is needed before it can be implemented in a metrological framework, and to allow adequate estimation of measurement uncertainties. Here, four laboratories demonstrated reproducibility (expanded measurement uncertainties below 15%) of dPCR for quantification of DNA from human cytomegalovirus, with no calibration to a common reference material. Using whole-virus material and extracted DNA, an intermediate precision (coefficients of variation below 25%) between three consecutive experiments was noted. Furthermore, discrepancies in estimated mean DNA copy number concentrations between laboratories were less than twofold, with DNA extraction as the main source of variability. These data demonstrate that dPCR offers a repeatable and reproducible method for quantification of viral DNA, and due to its satisfactory performance should be considered as candidate for reference methods for implementation in a metrological framework.

  18. Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y

    2017-12-08

    No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Measures and experiments to the reduction of mercury in the waste recycling plant Bonn. The gold amalgam procedure - Attempt of precipitation in the scrubber with TMT 15 - enrichment of the Dioxorb absorbent with activated charcoal; Massnahmen und Versuche zur Quecksilberminderung in der Abfallverwertungsanlage Bonn. Das Gold-Amalgamverfahren: Faellungsversuch im Waescher mit TMT 15 - Anreicherung des Dioxorb-Absorbens mit Aktivkohle

    Energy Technology Data Exchange (ETDEWEB)

    Heidrich, R. [Muellverwertungsanlage Bonn GmbH, Bonn (Germany)

    2007-07-01

    MVA Bonn GmbH (Bonn, Federal Republic of Germany) operates a plant for the thermal utilization of settlement wastes. The author of the contribution under consideration reports on measures and attempts according to the reduction of mercury in the waste processing plant Bonn. In particular, three procedures are discussed: (a) The gold amalgam procedure; (b) attempt of precipitation in the scrubber with TMT-15; (c) enrichment of the adsorbent Dioxorb with activated charcoal. The gold amalgam procedure is a reliable procedure for the reduction of the mercury content in exhaust gases. Additionally, it is a very expensive procedure. The filling material containers of all three procedures should be replaced in the next revisions gradually with new containers. The danger of an enrichment of considerable quantities of mercury on the filling material packing is large. A further possibility is the filling of the finished solution over a mist eliminator. Here the danger of the blockage plays a substantial role. A thorough and reliable lowering of the mercury emission can be achieved by means of the active charcoal containing Dioxorb.

  20. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Directory of Open Access Journals (Sweden)

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  1. DNA profiling of spermatozoa by laser capture microdissection and low volume-PCR.

    Directory of Open Access Journals (Sweden)

    Cai-xia Li

    Full Text Available Genetic profiling of sperm from complex biological mixtures such as sexual assault casework samples requires isolation of a pure sperm population and the ability to analyze low abundant samples. Current standard procedure for sperm isolation includes preferential lysis of epithelial contaminants followed by collection of intact sperm by centrifugation. While effective for samples where sperm are abundant, this method is less effective when samples contain few spermatozoa. Laser capture microdissection (LCM is a proven method for the isolation of cells biological mixtures, even when found in low abundance. Here, we demonstrate the efficacy of LCM coupled with on-chip low volume PCR (LV-PCR for the isolation and genotyping of low abundance sperm samples. Our results indicate that this method can obtain complete profiles (13-16 loci from as few as 15 sperm cells with 80% reproducibility, whereas at least 40 sperm cells are required to profile 13-16 loci by standard 'in-tube' PCR. Further, LCM and LV-PCR of a sexual assault casework sample generated a DNA genotype that was consistent with that of the suspect. This method was unable, however, to analyze a casework sample from a gang rape case in which two or more sperm contributors were in a mixed population. The results indicate that LCM and LV-PCR is sensitive and effective for genotyping sperm from sperm/epithelial cell mixtures when epithelial lysis may be insufficient due to low abundance of sperm; LCM and LV-PCR, however, failed in a casework sample when spermatozoa from multiple donors was present, indicating that further study is necessitated.

  2. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas

    2012-02-20

    Microfluidic chips have a variety of applications in the biological sciences and medicine. In contrast with traditional experimental approaches, microfluidics entails lower sample and reagent consumption, allows faster reactions and enables efficient separation. Additionally microfluidics offers other advantages accruing from the fluids’ various distinct behaviors, such as energy dissipation, fluidic resistance, laminar flow, and surface tension. Biological molecules suspended in fluid and transported through microfluidics channels interact with the channel-wall material. This interaction is even stronger in high surface-area-to-volume ratio (SAVR) microfluidic channels. Adsorption and inhibition of biomolecules occur when these materials come in contact with biomolecular reaction components. Polymerase chain reaction (PCR) is a thermal cycling procedure for amplifying target DNA. The PCR compatibility of silicon, silicon dioxide (SiO2) and other surfaces have been studied; however the results are inconclusive. Usually for protein-surface interaction measurements, bulky and expensive equipment is used, such as Atomic Force Microscopy (AFM), Scanning or Transmission Electron Microscopy (SEM, TEM), spectrophotometric protein concentration measurement, Fourier transform infrared spectroscopy (FTIR) or X-Ray photoelectron spectroscopy (XPS). \\tThe PCR reaction components include the DNA template, primers, DNA polymerase (the main component), dNTPs, a buffer, divalent ions (MgCl2), and KCl. \\tWe designed a simple, relatively quick measurement that only requires a PCR cycler; thus it mimics actual conditions in PCR cycling. In our study, we evaluated the inhibitory affect of different materials on PCR, which is one of the most frequently used enzymatic reactions in microfluidics. PCR reaction optimization through choice of surface materials is of the upmost importance, as it enables and improves enzymatic reaction in microfluidics. Our assessment of the PCR

  3. Radiometric enrichment of nonradioactive ores

    International Nuclear Information System (INIS)

    Mokrousov, V.A.; Lileev, V.A.

    1979-01-01

    Considered are the methods of mineral enrichment based on the use of the radioation of various types. The physical essence of enrichment processes is presented, their classification is given. Described are the ore properties influencing the efficiency of radiometric enrichment, methods of the properties study and estimation of ore enrichment. New possibilities opened by radiometric enrichment in the technology of primary processing of mineral raw materials are elucidated. A considerable attention is paid to the main and auxiliary equipment for radiometric enrichment. The foundations of the safety engineering are presented in a brief form. Presented are also results of investigations and practical works in the field of enrichment of ores of non-ferrous, ferrous and non-metallic minerals with the help of radiometric methods

  4. Evaluation of PCR for cutaneous leishmaniasis diagnosis and species identification using filter paper samples in Panama, Central America.

    Science.gov (United States)

    Miranda, A; Saldaña, A; González, K; Paz, H; Santamaría, G; Samudio, F; Calzada, J E

    2012-09-01

    Cutaneous leishmaniasis (CL) is a major vectorborne disease in Panama. In this study, the diagnostic performance and usefulness of two DNA extraction procedures from skin scraping samples collected on FTA filter paper for subsequent PCR diagnosis of CL was evaluated. A positive CL laboratory diagnosis was based on a positive parasitological test (Giemsa-stained smears or in vitro culture) and/or positive PCR test performed from skin scrapings collected in TE buffer (PCR-TE). Of 100 patients with skin lesions suggestive of CL, 82 (82%) were confirmed as CL positive. The sensitivity was calculated for each of the PCR approaches from samples collected on filter paper. The highest sensitivity was achieved by PCR-FTA processed by Chelex 100 (PCR-Chelex) (0.94). PCR-FTA extracted using the FTA purification reagent presented a lower sensitivity (0.60). Good concordance between routine PCR-TE and PCR-Chelex was observed (percent agreement=0.88, κ index=0.65). In conclusion, use of FTA filter paper for skin scraping collection combined with PCR is a reliable and convenient method for CL diagnosis in Panama, with comparable performance to the routine PCR method and with improved sensitivity compared with those of conventional parasitological methods. Copyright © 2012 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

  5. PWR fuel of high enrichment with erbia and enriched gadolinia

    International Nuclear Information System (INIS)

    Bejmer, Klaes-Håkan; Malm, Christian

    2011-01-01

    Today standard PWR fuel is licensed for operation up to 65-70 MWd/kgU, which in most cases corresponds to an enrichment of more than 5 w/o "2"3"5U. Due to criticality safety reason of storage and transportation, only fuel up to 5 w/o "2"3"5U enrichment is so far used. New fuel storage installations and transportation casks are necessary investments before the reactivity level of the fresh fuel can be significantly increased. These investments and corresponding licensing work takes time, and in the meantime a solution that requires burnable poisons in all pellets of the fresh high-enriched fuel might be used. By using very small amounts of burnable absorber in every pellet the initial reactivity can be reduced to today's levels. This study presents core calculations with fuel assemblies enriched to almost 6 w/o "2"3"5U mixed with a small amount of erbia. Some of the assemblies also contain gadolinia. The results are compared to a reference case containing assemblies with 4.95 w/o "2"3"5U without erbia, utilizing only gadolinia as burnable poison. The comparison shows that the number of fresh fuel assemblies can be reduced by 21% (which increases the batch burnup by 24%) by utilizing the erbia fuel concept. However, increased cost of uranium due to higher enrichment is not fully compensated for by the cost gain due to the reduction of the number assemblies. Hence, the fuel cycle cost becomes slightly higher for the high enrichment erbia case than for the reference case. (author)

  6. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    Science.gov (United States)

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  7. Nuclear calculation for employing medium enrichment in reactors of Japan Atomic Energy Research Institute

    International Nuclear Information System (INIS)

    Miyasaka, Yasuhiko

    1979-01-01

    The fuel used for the research reactors of Japan Atomic Energy Research Institute (JAERI) is presently highly enriched uranium of 93%. However, the U.S. government (the supplier of fuel) is claiming to utilize low or medium enriched uranium from the viewpoint of resistivity to nuclear proliferation, and the availability of highly enriched uranium is becoming hard owing to the required procedure. This report is described on the results of nuclear calculation which is the basis of fuel design in the countermeasures to the reduction of enrichment. The basic conception in the reduction of enrichment is three-fold: to lower the latent potential of nuclear proliferation as far as possible, to hold the present reactor performance as far as possible, and to limit the reduction in the range which is not accompanied by the modification of reactor core construction and cooling system. This time, the increase of the density and thickness of fuel plates and the effect of enrichment change to 45% on reactivity and neutron flux were investigated. The fuel of UAl sub(x) - Al system was assumed, which was produced by powder metallurgical method. The results of investigations on JRR-2 and JMTR reactors revealed that 45% enriched fuel does not affect the performances much. However, deterioration of the performances is not neglegible if further reduction is needed. In future, the influence of the burn-up effect of fuel on the life of reactor cores must be investigated. (Wakatsuki, Y.)

  8. 77 FR 14838 - General Electric-Hitachi Global Laser Enrichment LLC, Commercial Laser-Based Uranium Enrichment...

    Science.gov (United States)

    2012-03-13

    ... Laser Enrichment LLC, Commercial Laser-Based Uranium Enrichment Facility, Wilmington, North Carolina... a license to General Electric-Hitachi Global Laser Enrichment LLC (GLE or the applicant) to authorize construction of a laser-based uranium enrichment facility and possession and use of byproduct...

  9. One-tube semi-nested PCR-ELISA for the detection of human cytomegalovirus DNA sequences: comparison with hybridization-based and semi-nested-based PCR-ELISA procedures

    Czech Academy of Sciences Publication Activity Database

    Smrž, Daniel; Dráber, Petr

    2003-01-01

    Roč. 283, 1-2 (2003), s. 163-172 ISSN 0022-1759 R&D Projects: GA AV ČR IBS5052201; GA AV ČR IAA5052310; GA ČR GA204/03/0594; GA ČR GA301/03/0596; GA MŠk LN00A026 Institutional research plan: CEZ:AV0Z5052915 Keywords : PCR * DNA labelin * HCMV Subject RIV: EC - Immunology Impact factor: 2.744, year: 2003

  10. Sonication-based isolation and enrichment of Chlorella protothecoides chloroplasts for illumina genome sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Angelina [University of Arizona; Park, Sang-Hycuk [University of Arizona; Kyndt, John [Bellevue University; Fitzsimmons, Kevin [University of Arizona; Brown, Judith K [University of Arizona

    2013-09-01

    With the increasing world demand for biofuel, a number of oleaginous algal species are being considered as renewable sources of oil. Chlorella protothecoides Krüger synthesizes triacylglycerols (TAGs) as storage compounds that can be converted into renewable fuel utilizing an anabolic pathway that is poorly understood. The paucity of algal chloroplast genome sequences has been an important constraint to chloroplast transformation and for studying gene expression in TAGs pathways. In this study, the intact chloroplasts were released from algal cells using sonication followed by sucrose gradient centrifugation, resulting in a 2.36-fold enrichment of chloroplasts from C. protothecoides, based on qPCR analysis. The C. protothecoides chloroplast genome (cpDNA) was determined using the Illumina HiSeq 2000 sequencing platform and found to be 84,576 Kb in size (8.57 Kb) in size, with a GC content of 30.8 %. This is the first report of an optimized protocol that uses a sonication step, followed by sucrose gradient centrifugation, to release and enrich intact chloroplasts from a microalga (C. prototheocoides) of sufficient quality to permit chloroplast genome sequencing with high coverage, while minimizing nuclear genome contamination. The approach is expected to guide chloroplast isolation from other oleaginous algal species for a variety of uses that benefit from enrichment of chloroplasts, ranging from biochemical analysis to genomics studies.

  11. A twin purification/enrichment procedure based on two versatile solid/liquid extracting agents for efficient uptake of ultra-trace levels of lorazepam and clonazepam from complex bio-matrices.

    Science.gov (United States)

    Hemmati, Maryam; Rajabi, Maryam; Asghari, Alireza

    2017-11-17

    In this research work, two consecutive dispersive solid/liquid phase microextractions based on efficient extraction media were developed for the influential and clean pre-concentration of clonazepam and lorazepam from complicated bio-samples. The magnetism nature of the proposed nanoadsorbent proceeded the clean-up step conveniently and swiftly (∼5min), pursued by a further enrichment via a highly effective and rapid emulsification microextraction process (∼4min) based on a deep eutectic solvent (DES). Finally, the instrumental analysis step was practicable via high performance liquid chromatography-ultraviolet detection. The solid phase used was an adequate magnetic nanocomposite termed as polythiophene-sodium dodecyl benzene sulfonate/iron oxide (PTh-DBSNa/Fe 3 O 4 ), easily and cost-effectively prepared by the impressive co-precipitation method followed by the efficient in situ sonochemical oxidative polymerization approach. The identification techniques viz. FESEM, XRD, and EDX certified the supreme physico-chemical properties of this effective nanosorbent. Also the powerful liquid extraction agent, DES, based on bio-degradable choline chloride, possessed a high efficiency, tolerable safety, low cost, and facile and mild synthesis route. The parameters involved in this versatile hyphenated procedure, efficiently evaluated via the central composite design (CCD), showed that the best extraction conditions consisted of an initial pH value of 7.2, 17mg of the PTh-DBSNa/Fe 3 O 4 nanocomposite, 20 air-agitation cycles (first step), 245μL of methanol, 250μL of DES, 440μL of THF, and 8 air-agitation cycles (second step). Under the optimal conditions, the understudied drugs could be accurately determined in the wide linear dynamic ranges (LDRs) of 4.0-3000ngmL -1 and 2.0-2000ngmL -1 for clonazepam and lorazepam, respectively, with low limits of detection (LODs) ranged from 0.7 to 1.0ngmL -1 . The enrichment factor (EF) and percentage extraction recovery (%ER

  12. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  13. Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.

    Science.gov (United States)

    Doyle, Laura; Vogel, Sherilynn; Procop, Gary W

    2017-01-01

    The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.

  14. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  15. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Directory of Open Access Journals (Sweden)

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  16. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    Science.gov (United States)

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  17. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  18. TRIGA low enrichment fuel

    International Nuclear Information System (INIS)

    Gietzen, A.

    1993-01-01

    Sixty TRIGA reactors have been sold and the earliest of these are now passing twenty years of operation. All of these reactors use the uranium zirconium hydride fuel (UZrH) which provides certain unique advantages arising out of its large prompt negative temperature coefficient, very low fission product release, and high temperature capability. Eleven of these Sixty reactors are conversions from plate fuel to TRIGA fuel which were made as a result of these advantages. With only a few exceptions, TRIGA reactors have always used low-enriched uranium (LEU) fuel with an enrichment of 19.9%. The exceptions have either been converted from the standard low-enriched fuel to the 70% enriched FLIP fuel in order to achieve extended lifetime, or are higher powered reactors which were designed for long life using 93%-enriched uranium during the time when the use and export of highly enriched uranium (HEU) was not restricted. The advent of international policies focusing attention on nonproliferation and safeguards made the HEU fuels obsolete. General Atomic immediately undertook a development effort (nearly two years ago) in order to be in a position to comply with these policies for all future export sales and also to provide a low-enriched alternative to fully enriched plate-type fuels. This important work was subsequently partially supported by the U.S. Department of Energy. The laboratory and production tests have shown that higher uranium densities can be achieved to compensate for reducing the enrichment to 20%, and that the fuels maintain the characteristics of the very thoroughly proven standard TRIGA fuels. In May of 1978, General Atomic announced that these fuels were available for TRIGA reactors and for plate-type reactors with power levels up to 15 MW with General Atomic's standard commercial warranty

  19. TRIGA low enrichment fuel

    International Nuclear Information System (INIS)

    Gietzen, A.

    1993-01-01

    Sixty TRIGA reactors have been sold and the earliest of these are now passing twenty years of operation. All of these reactors use the uranium-zirconium hydride fuel (UZrH) which provides certain unique advantages arising out of its large prompt negative temperature coefficient, very low fission product release, and high temperature capability. Eleven of these Sixty reactors are conversions from plate fuel to TRIGA fuel which were made as a result of these advantages. With only a few exceptions, TRIGA reactors have always used low-enriched-uranium (LEU) fuel with an enrichment of 19.9%. The exceptions have either been converted from the standard low-enriched fuel to the 70% enriched FLIP fuel in order to achieve extended lifetime, or are higher powered reactors which were designed for long life using 93%-enriched uranium during the time when the use and export of highly enriched uranium (HEU) was not restricted. The advent of international policies focusing attention on nonproliferation and safeguards made the HEU fuels obsolete. General Atomic immediately undertook a development effort (nearly two years ago) in order to be in a position to comply with these policies for all future export sales and also to provide a low-enriched alternative to fully enriched plate-type fuels. This important work was subsequently partially supported by the U.S. Department of Energy. The laboratory and production tests have shown that higher uranium densities can be achieved to compensate for reducing the enrichment to 20%, and that the fuels maintain the characteristics of the very thoroughly proven standard TRIGA fuels. In May of 1978, General Atomic announced that these fuels were available for TRIGA reactors and for plate-type reactors with power levels up to 15 MW with GA's standard commercial warranty

  20. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  1. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  2. Turkey's regulatory plans for high enriched to low enriched conversion of TR-2 reactor core

    International Nuclear Information System (INIS)

    Guelol Oezdere, Oya

    2003-01-01

    Turkey is a developing country and has three nuclear facilities two of which are research reactors and one pilot fuel production plant. One of the two research reactors is TR-2 which is located in Cekmece site in Istanbul. TR-2 Reactor's core is composed of both high enriched and low enriched fuel and from high enriched to low enriched core conversion project will take place in year 2005. This paper presents the plans for drafting regulations on the safety analysis report updates for high enriched to low enriched core conversion of TR-2 reactor, the present regulatory structure of Turkey and licensing activities of nuclear facilities. (author)

  3. Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

    International Nuclear Information System (INIS)

    Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.

    2013-01-01

    Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25

  4. Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia

    2013-07-01

    Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83

  5. Real-time PCR in virology.

    Science.gov (United States)

    Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

    2002-03-15

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

  6. COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

    Directory of Open Access Journals (Sweden)

    Ivona Djurkin Kušec

    2015-09-01

    Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

  7. High enrichment to low enrichment core's conversion. Technical securities

    International Nuclear Information System (INIS)

    Abbate, P.; Madariaga, M.R.

    1990-01-01

    This work presents the fulfillment of the technical securities subscribed by INVAP S.E. for the conversion of a high enriched uranium core. The reactor (of 5 thermal Mw), built in the 50's and 60's, is of the 'swimming pool' type, with light water and fuel elements of the curve plates MTR type, enriched at 93.15 %. These are neutronic and thermohydraulic securities. (Author) [es

  8. Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts.

    Science.gov (United States)

    Weßling, Ralf; Panstruga, Ralph

    2012-08-31

    The powdery mildew disease represents a valuable patho-system to study the interaction between plant hosts and obligate biotrophic fungal pathogens. Numerous discoveries have been made on the basis of the quantitative evaluation of plant-powdery mildew interactions, especially in the context of hyper-susceptible and/or resistant plant mutants. However, the presently available methods to score the pathogenic success of powdery mildew fungi are laborious and thus not well suited for medium- to high-throughput analysis. Here we present two new protocols that allow the rapid quantitative assessment of powdery mildew disease development. One procedure depends on quantitative polymerase chain reaction (qPCR)-based evaluation of fungal biomass, while the other relies on the quantification of fungal conidiospores. We validated both techniques using the powdery mildew pathogen Golovinomyces orontii on a set of hyper-susceptible and resistant Arabidopsis thaliana mutants and found that both cover a wide dynamic range of one to two (qPCR) and four to five (quantification of conidia) orders of magnitude, respectively. The two approaches yield reproducible results and are easy to perform without specialized equipment. The qPCR and spore count assays rapidly and reproducibly quantify powdery mildew pathogenesis. Our methods are performed at later stages of infection and discern mutant phenotypes accurately. The assays therefore complement currently used procedures of powdery mildew quantification and can overcome some of their limitations. In addition, they can easily be adapted to other plant-powdery mildew patho-systems.

  9. Beta activity of enriched uranium

    International Nuclear Information System (INIS)

    Nambiar, P.P.V.J.; Ramachandran, V.

    1975-01-01

    Use of enriched uranium as reactor fuel necessitates its handling in various forms. For purposes of planning and organising radiation protection measures in enriched uranium handling facilities, it is necessary to have a basic knowledge of the radiation status of enriched uranium systems. The theoretical variations in beta activity and energy with U 235 enrichment are presented. Depletion is considered separately. Beta activity build up is also studied for two specific enrichments, in respect of which experimental values for specific alpha activity are available. (author)

  10. Direct-to-PCR tissue preservation for DNA profiling.

    Science.gov (United States)

    Sorensen, Amy; Berry, Clare; Bruce, David; Gahan, Michelle Elizabeth; Hughes-Stamm, Sheree; McNevin, Dennis

    2016-05-01

    Disaster victim identification (DVI) often occurs in remote locations with extremes of temperatures and humidities. Access to mortuary facilities and refrigeration are not always available. An effective and robust DNA sampling and preservation procedure would increase the probability of successful DNA profiling and allow faster repatriation of bodies and body parts. If the act of tissue preservation also released DNA into solution, ready for polymerase chain reaction (PCR), the DVI process could be further streamlined. In this study, we explored the possibility of obtaining DNA profiles without DNA extraction, by adding aliquots of preservative solutions surrounding fresh human muscle and decomposing human muscle and skin tissue samples directly to PCR. The preservatives consisted of two custom preparations and two proprietary solutions. The custom preparations were a salt-saturated solution of dimethyl sulfoxide (DMSO) with ethylenediaminetetraacetic (EDTA) and TENT buffer (Tris, EDTA, NaCl, Tween 20). The proprietary preservatives were DNAgard (Biomatrica(®)) and Tissue Stabilising Kit (DNA Genotek). We obtained full PowerPlex(®) 21 (Promega) and GlobalFiler(®) (Life Technologies) DNA profiles from fresh and decomposed tissue preserved at 35 °C for up to 28 days for all four preservatives. The preservative aliquots removed from the fresh muscle tissue samples had been stored at -80 °C for 4 years, indicating that long-term archival does not diminish the probability of successful DNA typing. Rather, storage at -80 °C seems to reduce PCR inhibition.

  11. Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

    Science.gov (United States)

    Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

    2013-12-01

    Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) for large genomic rearrangements (LGRs) detection: A new approach to assess quantitative status of BRCA1 gene in a reference laboratory.

    Science.gov (United States)

    Minucci, Angelo; De Paolis, Elisa; Concolino, Paola; De Bonis, Maria; Rizza, Roberta; Canu, Giulia; Scaglione, Giovanni Luca; Mignone, Flavio; Scambia, Giovanni; Zuppi, Cecilia; Capoluongo, Ettore

    2017-07-01

    Evaluation of copy number variation (CNV) in BRCA1/2 genes, due to large genomic rearrangements (LGRs), is a mandatory analysis in hereditary breast and ovarian cancers families, if no pathogenic variants are found by sequencing. LGRs cannot be detected by conventional methods and several alternative methods have been developed. Since these approaches are expensive and time consuming, identification of alternative screening methods for LGRs detection is needed in order to reduce and optimize the diagnostic procedure. The aim of this study was to investigate a Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) as molecular tool to detect recurrent BRCA1 LGRs. C-PCR-HRMA was performed on exons 3, 14, 18, 19, 20 and 21 of the BRCA1 gene; exons 4, 6 and 7 of the ALB gene were used as reference fragments. This study showed that it is possible to identify recurrent BRCA1 LGRs, by melting peak height ratio between target (BRCA1) and reference (ALB) fragments. Furthermore, we underline that a peculiar amplicon-melting profile is associated to a specific BRCA1 LGR. All C-PCR-HRMA results were confirmed by Multiplex ligation-dependent probe amplification. C-PCR-HRMA has proved to be an innovative, efficient and fast method for BRCA1 LGRs detection. Given the sensitivity, specificity and ease of use, c-PCR-HRMA can be considered an attractive and powerful alternative to other methods for BRCA1 CNVs screening, improving molecular strategies for BRCA testing in the context of Massive Parallel Sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Development of a nucleic acid lateral flow immunoassay for simultaneous detection of Listeria spp. and Listeriamonocytogenes in food

    NARCIS (Netherlands)

    Blazkova, M.; Koets, M.; Rauch, P.; Amerongen, van A.

    2009-01-01

    We present a new nucleic acid lateral flow immunoassay (NALFIA) for the assessment of listeria contamination. The detection procedure starts with enrichment of sample in Half Fraser broth (24 h). Following isolation of DNA, a duplex PCR is performed with two labelled primer sets, one generic and

  14. PCR-Based Seamless Genome Editing with High Efficiency and Fidelity in Escherichia coli

    DEFF Research Database (Denmark)

    Liu, Yilan; Yang, Maohua; Yan, Daojiang

    2016-01-01

    Efficiency and fidelity are the key obstacles for genome editing toolboxes. In the present study, a PCR-based tandem repeat assisted genome editing (TRAGE) method with high efficiency and fidelity was developed. The design of TRAGE is based on the mechanism of repair of spontaneous double...... for seamlessly deleting, substituting and inserting targeted genes using PCR products. The effects of different manipulations including sucrose addition time, subculture times in LB with sucrose and stages of inoculation on the efficiency were investigated. With our recommended procedure, seamless excision...... of cat-sacB cassette can be realized in 48 h efficiently. We believe that the developed method has great potential for seamless genome editing in E. coli....

  15. Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.

    Science.gov (United States)

    Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H

    Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

    Science.gov (United States)

    Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

    2010-01-01

    Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

  17. Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

    Science.gov (United States)

    Jamjoom, Manal; Sultan, Amal H

    2009-04-01

    The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity

  18. Isotope enrichment

    International Nuclear Information System (INIS)

    Garbuny, M.

    1979-01-01

    The invention discloses a method for deriving, from a starting material including an element having a plurality of isotopes, derived material enriched in one isotope of the element. The starting material is deposited on a substrate at less than a critical submonatomic surface density, typically less than 10 16 atoms per square centimeter. The deposit is then selectively irradiated by a laser (maser or electronic oscillator) beam with monochromatic coherent radiation resonant with the one isotope causing the material including the one istope to escape from the substrate. The escaping enriched material is then collected. Where the element has two isotopes, one of which is to be collected, the deposit may be irradiated with radiation resonant with the other isotope and the residual material enriched in the one isotope may be evaporated from the substrate and collected

  19. Laser and gas centrifuge enrichment

    Energy Technology Data Exchange (ETDEWEB)

    Heinonen, Olli [Senior Fellow, Belfer Center for Science and International Affairs, Harvard Kennedy School, Cambridge, Massachusetts (United States)

    2014-05-09

    Principles of uranium isotope enrichment using various laser and gas centrifuge techniques are briefly discussed. Examples on production of high enriched uranium are given. Concerns regarding the possibility of using low end technologies to produce weapons grade uranium are explained. Based on current assessments commercial enrichment services are able to cover the global needs of enriched uranium in the foreseeable future.

  20. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  1. City model enrichment

    Science.gov (United States)

    Smart, Philip D.; Quinn, Jonathan A.; Jones, Christopher B.

    The combination of mobile communication technology with location and orientation aware digital cameras has introduced increasing interest in the exploitation of 3D city models for applications such as augmented reality and automated image captioning. The effectiveness of such applications is, at present, severely limited by the often poor quality of semantic annotation of the 3D models. In this paper, we show how freely available sources of georeferenced Web 2.0 information can be used for automated enrichment of 3D city models. Point referenced names of prominent buildings and landmarks mined from Wikipedia articles and from the OpenStreetMaps digital map and Geonames gazetteer have been matched to the 2D ground plan geometry of a 3D city model. In order to address the ambiguities that arise in the associations between these sources and the city model, we present procedures to merge potentially related buildings and implement fuzzy matching between reference points and building polygons. An experimental evaluation demonstrates the effectiveness of the presented methods.

  2. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-07-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  3. Enrichment technology. Dependable vendor of gas centrifuges; Enrichment Technology. Zuverlaessiger Lieferant von Gaszentrifugen

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2011-10-15

    Enrichment Technology is an innovative, high-tech company that develops, manufactures and installs gas centrifuges for enriching uranium. In addition, Enrichment Technology designs enrichment plants that use gas centrifuge technology. This technology offers the most efficient and cost-effective method for enriching uranium yet: high-performance, safe technology that dominates the market with a global share of 45 percent. A determining factor in Enrichment Technology's success is its mission: supplying its customers with safe, reliable technology. Production of the centrifuges requires versatile know-how and collaboration between different departments as well as interdisciplinary teams at the various sites. More than 2000 operators at 8 sites in 5 countries contribute their individual knowledge and personal skills in order to produce this exceptional technology. The head office is in Beaconsfield near London and the operational headquarters are in Almelo in the Netherlands. There are other sites in Germany (Juelich und Gronau), Great Britain (Capenhurst) as well as project sites in the USA and France. Capenhurst is where experienced engineers design new enrichment plants and organise their construction. Centrifuge components are manufactured in Almelo and Juelich, while the pipework needed to connect up the centrifuges is produced at the site in Gronau. In Juelich, highly qualified scientists in interdisciplinary teams are continuously researching ways of improving the current centrifuges. Communication between specialists in the fields of chemistry, physics and engineering forms the basis for the company's success and the key to extending this leading position in the global enrichment market. (orig.)

  4. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    Science.gov (United States)

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  5. 76 FR 11523 - Atomic Safety and Licensing Board; AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility...

    Science.gov (United States)

    2011-03-02

    ... and Licensing Board; AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility); Notice of... Governmental Entities Regarding Environmental Portion of Enrichment Facility Licensing Proceeding February 24.... White. In this 10 CFR part 70 proceeding regarding the request of applicant AREVA Enrichment Services...

  6. 76 FR 34103 - In the Matter of Areva Enrichment Services, LLC (Eagle Rock Enrichment Facility); Notice of...

    Science.gov (United States)

    2011-06-10

    .... 10-899-02-ML-BD01] In the Matter of Areva Enrichment Services, LLC (Eagle Rock Enrichment Facility...'' portion of this proceeding regarding the December 2008 application by AREVA Enrichment Services, LLC (AES... gas centrifuge uranium enrichment facility--denoted as the Eagle Rock Enrichment Facility (EREF)--in...

  7. European validation of a real-time PCR-based method for detection of Listeria monocytogenes in soft cheese.

    Science.gov (United States)

    Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario

    2014-08-01

    The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Detection and discrimination of five E. coli pathotypes using a combinatory SYBR® Green qPCR screening system.

    Science.gov (United States)

    Barbau-Piednoir, Elodie; Denayer, Sarah; Botteldoorn, Nadine; Dierick, Katelijne; De Keersmaecker, Sigrid C J; Roosens, Nancy H

    2018-04-01

    A detection and discrimination system for five Escherichia coli pathotypes, based on a combination of 13 SYBR® Green qPCR, has been developed, i.e., combinatory SYBR® Green qPCR screening system for pathogenic E. coli (CoSYPS Path E. coli). It allows the discrimination on isolates and the screening of potential presence in food of the following pathotypes of E. coli: shigatoxigenic (STEC) (including enterohemorrhagic (EHEC)), enteropathogenic (EPEC), enteroaggregative (EAggEC), enteroaggregative shigatoxigenic (EAggSTEC), and enteroinvasive (EIEC) E. coli. The SYBR® Green qPCR assays target the uidA, ipaH, eae, aggR, aaiC, stx1, and stx2 genes. uidA controls for E. coli presence and all the other genes are specific targets of E. coli pathotypes. For each gene, two primer pairs have been designed to guarantee a sufficient detection even in case of deletion or polymorphisms in the target gene. Moreover, all the qPCR have been designed to be run together in a single analytical PCR plate. This study includes the primer pairs' design, in silico and in situ selectivity, sensitivity, repeatability, and reproducibility evaluation of the 13 SYBR® Green qPCR assays. Each target displayed a selectivity of 100%. The limit of detection of the 13 assays is between 1 and 10 genomic copies. Their repeatability and reproducibility comply with the European requirements. As a preliminary feasibility study on food, the CoSYPS Path E. coli system was subsequently evaluated on four food matrices artificially contaminated with pathogenic E. coli. It allowed the detection of an initial contamination level as low as 2 to 7 cfu of STEC/25 g of food matrix after 24 h of enrichment.

  9. Integrated microfluidic system for rapid screening of CRP aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX).

    Science.gov (United States)

    Huang, Chao-June; Lin, Hsin-I; Shiesh, Shu-Chu; Lee, Gwo-Bin

    2010-03-15

    The systematic evolution of ligands by exponential enrichment (SELEX) is an experimental procedure that allows screening of given molecular targets by desired binding affinities from an initial random pool of oligonucleotides and oligomers. The final products of SELEX are usually referred as aptamers, which are recognized as promising molecules for a variety of biomedical applications. However, SELEX is an iterative process requiring multiple rounds of extraction and amplification that demands significant time and labor. Therefore, this study presents a novel, automatic, miniature SELEX platform. As a demonstration, the rapid screening of C-reactive protein (CRP) aptamers was performed. By utilizing microfluidic technologies and magnetic beads conjugated with CRP, aptamers with a high affinity to CRP were extracted from a random single-strand deoxyribonucleic acid (ssDNA) pool. These aptamers were further amplified by an on-chip polymerase chain reaction (PCR) process. After five consecutive extraction and amplification cycles, a specific aptamer with the highest affinity was screened automatically. The screened aptamers were used as a recognition molecule for the detection of CRP. The developed microsystem demonstrated fast screening of CRP aptamers and can be used as a powerful tool to select analyte-specific aptamers for biomedical applications. (c) 2009 Elsevier B.V. All rights reserved.

  10. Enrichment plants. A survey of major new uranium enriching projects

    International Nuclear Information System (INIS)

    Kovan, D.

    1976-01-01

    The work enrichment situation is reported. The development of enrichment in the U.S. and in Europe is outlined. A brief description is given of the technology of separation by diffusion and by centrifugation and the advantages and disadvantages of the two processes are compared. Finally the supply and demand situation is briefly considered. (U.K.)

  11. Real-time PCR detection of Fe-type nitrile hydratase genes from environmental isolates suggests horizontal gene transfer between multiple genera.

    Science.gov (United States)

    Coffey, Lee; Owens, Erica; Tambling, Karen; O'Neill, David; O'Connor, Laura; O'Reilly, Catherine

    2010-11-01

    Nitriles are widespread in the environment as a result of biological and industrial activity. Nitrile hydratases catalyse the hydration of nitriles to the corresponding amide and are often associated with amidases, which catalyze the conversion of amides to the corresponding acids. Nitrile hydratases have potential as biocatalysts in bioremediation and biotransformation applications, and several successful examples demonstrate the advantages. In this work a real-time PCR assay was designed for the detection of Fe-type nitrile hydratase genes from environmental isolates purified from nitrile-enriched soils and seaweeds. Specific PCR primers were also designed for amplification and sequencing of the genes. Identical or highly homologous nitrile hydratase genes were detected from isolates of numerous genera from geographically diverse sites, as were numerous novel genes. The genes were also detected from isolates of genera not previously reported to harbour nitrile hydratases. The results provide further evidence that many bacteria have acquired the genes via horizontal gene transfer. The real-time PCR assay should prove useful in searching for nitrile hydratases that could have novel substrate specificities and therefore potential in industrial applications.

  12. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  13. Differential Gene Expression Profiling of Enriched Human Spermatogonia after Short- and Long-Term Culture

    Directory of Open Access Journals (Sweden)

    Sabine Conrad

    2014-01-01

    Full Text Available This study aimed to provide a molecular signature for enriched adult human stem/progenitor spermatogonia during short-term (<2 weeks and long-term culture (up to more than 14 months in comparison to human testicular fibroblasts and human embryonic stem cells. Human spermatogonia were isolated by CD49f magnetic activated cell sorting and collagen−/laminin+ matrix binding from primary testis cultures obtained from ten adult men. For transcriptomic analysis, single spermatogonia-like cells were collected based on their morphology and dimensions using a micromanipulation system from the enriched germ cell cultures. Immunocytochemical, RT-PCR and microarray analyses revealed that the analyzed populations of cells were distinct at the molecular level. The germ- and pluripotency-associated genes and genes of differentiation/spermatogenesis pathway were highly expressed in enriched short-term cultured spermatogonia. After long-term culture, a proportion of cells retained and aggravated the “spermatogonial” gene expression profile with the expression of germ and pluripotency-associated genes, while in the majority of long-term cultured cells this molecular profile, typical for the differentiation pathway, was reduced and more genes related to the extracellular matrix production and attachment were expressed. The approach we provide here to study the molecular status of in vitro cultured spermatogonia may be important to optimize the culture conditions and to evaluate the germ cell plasticity in the future.

  14. Economic evaluation of laser enrichment plant

    International Nuclear Information System (INIS)

    Arisawa, Takashi; Shiba, Koreyuki

    1983-08-01

    Operational characteristics of Laser Enrichment Plant are described based on the data available at present. And its economy is also discussed from the view point of investment and energy consumption. In the procedure of this estimation, the composition of the plant is firstly considered, secondly each component is designed, and thirdly the production cost of each component is estimated. Then the sensitivity of the component cost on the plant cost is analysed, which leads to the optimization of the product cost and the determination of the economic plant size, etc. The results shows that the power cost of the electric gun occupies the large majority of the total power cost, and that the capital cost of laser devices occupies most of the total capital cost. (author)

  15. Uranium enrichment plans

    International Nuclear Information System (INIS)

    Gagne, R.W.; Thomas, D.C.

    1977-01-01

    The status of existing uranium enrichment contracts in the US is reviewed and expected natural uranium requirements for existing domestic uranium enrichment contracts are evaluated. Uncertainty in natural uranium requirements associated with requirements-type and fixed-commitment type contracts is discussed along with implementation of variable tails assay

  16. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

    Science.gov (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

    2017-08-14

    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  17. Centrifuge enrichment program

    International Nuclear Information System (INIS)

    Astley, E.R.

    1976-01-01

    Exxon Nuclear has been active in privately funded research and development of centrifuge enrichment technology since 1972. In October of 1975, Exxon Nuclear submitted a proposal to design, construct, and operate a 3000-MT SWU/yr centrifuge enrichment plant, under the provisions of the proposed Nuclear Fuel Assurance Act of 1975. The U.S. Energy Research and Development Administration (ERDA) accepted the proposal as a basis for negotiation. It was proposed to build a 1000-MT SWU/yr demonstration increment to be operational in 1982; and after successful operation for about one year, expand the facilities into a 3000-MT SWU/yr plant. As part of the overall centrifuge enrichment plant, a dedicated centrifuge manufacturing plant would be constructed; sized to support the full 3000-MT SWU/yr plant. The selection of the centrifuge process by Exxon Nuclear was based on an extremely thorough evaluation of current and projected enrichment technology; results show that the technology is mature and the process will be cost effective. The substantial savings in energy (about 93%) from utilization of the centrifuge option rather than gaseous diffusion is a compelling argument. As part of this program, Exxon Nuclear has a large hardware R and D program, plus a prototype centrifuge manufacturing capability in Malta, New York. To provide a full-scale machine and limited cascade test capability, Exxon Nuclear is constructing a $4,000,000 Centrifuge Test Facility in Richland, Washington. This facility was to initiate operations in the Fall of 1976. Exxon Nuclear is convinced that the centrifuge enrichment process is the rational selection for emergence of a commercial enrichment industry

  18. Optimized enrichment for the detection of Escherichia coli O26 in French raw milk cheeses.

    Science.gov (United States)

    Savoye, F; Rozand, C; Bouvier, M; Gleizal, A; Thevenot, D

    2011-06-01

    Our main objective was to optimize the enrichment of Escherichia coli O26 in raw milk cheeses for their subsequent detection with a new automated immunological method. Ten enrichment broths were tested for the detection of E. coli O26. Two categories of experimentally inoculated raw milk cheeses, semi-hard uncooked cheese and 'Camembert' type cheese, were initially used to investigate the relative efficacy of the different enrichments. The enrichments that were considered optimal for the growth of E. coli O26 in these cheeses were then challenged with other types of raw milk cheeses. Buffered peptone water supplemented with cefixim-tellurite and acriflavin was shown to optimize the growth of E. coli O26 artificially inoculated in the cheeses tested. Despite the low inoculum level (1-10 CFU per 25 g) in the cheeses, E. coli O26 counts reached at least 5.10(4) CFU ml(-1) after 24-h incubation at 41.5 °C in this medium. All the experimentally inoculated cheeses were found positive by the immunological method in the enrichment broth selected. Optimized E. coli O26 enrichment and rapid detection constitute the first steps of a complete procedure that could be used in routine to detect E. coli O26 in raw milk cheeses. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  19. Microbial Community Dynamics of Lactate Enriched Hanford Groundwaters

    International Nuclear Information System (INIS)

    Mosher, Jennifer J.; Drake, Meghan M.; Carroll, Susan L.; Yang, Zamin K.; Schadt, Christopher W.; Brown, Stephen D.; Podar, Mircea; Hazen, Terry C.; Arkin, Adam P.; Phelps, Tommy J.; Palumbo, Anthony V.; Faybishenko, Boris A.; Elias, Dwayne A.

    2010-01-01

    The Department of Energy site at Hanford, WA, has been historically impacted by U and Cr from the nuclear weapons industry. In an attempt to stimulate microbial remediation of these metals, in-situ lactate enrichment experiments are ongoing. In order to bridge the gap from the laboratory to the field, we inoculated triplicate anaerobic, continuous-flow glass reactors with groundwater collected from well Hanford 100-H in order to obtain a stable, enriched community while selecting for metal-reducing bacteria. Each reactor was fed from a single carboy containing defined media with 30 mM lactate at a rate of 0.223 ml/min under continuous nitrogen flow at 9 ml/min. Cell counts, organic acids, gDNA (for qPCR and pyrosequencing) and gases were sampled during the experiment. Cell counts remained low (less than 1x107 cells/ml) during the first two weeks of the experiment, but by day 20, had reached a density greater than 1x108 cells/ml. Metabolite analysis showed a decrease in the lactate concentrations over time. Pyruvate concentrations ranged from 20-40 uM the first week of the experiment then was undetectable after day 10. Likewise, formate appeared in the reactors during the first week with concentrations of 1.48-1.65 mM at day 7 then the concentrations decreased to 0.69-0.95 on day 10 and were undetectable on day 15. Acetate was present in low amounts on day 3 (0.15-0.33 mM) and steadily increased to 3.35-5.22 mM over time. Similarly, carbon dioxide was present in low concentrations early on and increased to 0.28-0.35 mM as the experiment progressed. We also were able to detect low amounts of methane (10-20 uM) during the first week of the experiment, but by day 10 the methane was undetectable. From these results and pyrosequencing analysis, we conclude that a shift in the microbial community dynamics occurred over time to eventually form a stable and enriched microbial community. Comprehensive investigations such as these allow for the examination of not only which

  20. The micro-scale synthesis of (117)Sn-enriched tributyltin chloride and its characterization by GC-ICP-MS and NMR techniques.

    Science.gov (United States)

    Peeters, Kelly; Iskra, Jernej; Zuliani, Tea; Ščančar, Janez; Milačič, Radmila

    2014-07-01

    Organotin compounds (OTCs) are among the most toxic substances ever introduced to the environment by man. They are common pollutants in marine ecosystems, but are also present in the terrestrial environment, accumulated mainly in sewage sludge and landfill leachates. In investigations of the degradation and methylation processes of OTC in environmental samples, the use of enriched isotopic tracers represents a powerful analytical tool. Sn-enriched OTC are also necessary in application of the isotope dilution mass spectrometry technique for their accurate quantification. Since Sn-enriched monobutyltin (MBT), dibutyltin (DBT) and tributyltin (TBT) are not commercially available as single species, "in house" synthesis of individual butyltin-enriched species is necessary. In the present work, the preparation of the most toxic butyltin, namely TBT, was performed via a simple synthetic path, starting with bromination of metallic Sn, followed by butylation with butyl lithium. The tetrabutyltin (TeBT) formed was transformed to tributyltin chloride (TBTCl) using concentrated hydrochloric acid (HCl). The purity of the synthesized TBT was verified by speciation analysis using the techniques of gas chromatography coupled to inductively coupled plasma mass spectrometry (GC-ICP-MS) and nuclear magnetic resonance (NMR). The results showed that TBT had a purity of more than 97%. The remaining 3% corresponded to DBT. TBT was quantified by reverse isotope dilution GC-ICP-MS. The synthesis yield was around 60%. The advantage of this procedure over those previously reported lies in its possibility to be applied on a micro-scale (starting with 10mg of metallic Sn). This feature is of crucial importance, since enriched metallic Sn is extremely expensive. The procedure is simple and repeatable, and was successfully applied for the preparation of (117)Sn-enriched TBTCl from (117)Sn-enriched metal. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Stable isotopes. Enriched wheat: a new chance for nutrition research

    International Nuclear Information System (INIS)

    Chagvardieff, P.

    1996-01-01

    The Department of Plant Eco-physiology (DEV) from the CEA/Life Sciences Department of Cadarache (France) has artificially produced two kg of carbon 13 labelled wheat for nutrition research. It is the first successful stable isotope labelling of complex nutriments with a 10% enrichment in carbon 13. This wheat has been used for the manufacturing of pastas to follow the assimilation of nutrients by the organism. This short paper gives some details about the experimental procedure of labelled wheat cultivation. (J.S.)

  2. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  3. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi; PCR associado a hibridizacao com sondas radioativas de DNA para a identificacao de infeccao subclinica causada por Leishmania Chagasi

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN), Belo Horizonte, MG (Brazil); Moreno, Elizabeth Castro [Fundacao Nacional de Saude, Belo Horizonte, MG (Brazil). Coordenacao Regional de Minas Gerais; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela [Minas Gerais Univ., Belo Horizonte, MG (Brazil). Dept. de Parasitologia; Fernandes, Octavio [Fundacao Inst. Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Medicina Tropical

    2002-07-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with {sup 32} P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with {sup 32} P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  4. Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.

    Science.gov (United States)

    Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro

    2010-01-01

    The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.

  5. By-product formation in repetitive PCR amplification of DNA libraries during SELEX.

    Science.gov (United States)

    Tolle, Fabian; Wilke, Julian; Wengel, Jesper; Mayer, Günter

    2014-01-01

    The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments. Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation and improving the success rate of aptamer selection.

  6. A Systematic Approach to Marital Enrichment.

    Science.gov (United States)

    Dinkmeyer, Don; Carlson, Jon

    1986-01-01

    Presents a systematic approach to enriching marital relationships. The history and current status of marital enrichment is reviewed. An Adlerian approach to marital enrichment is described. Applications of the program in enrichment groups, marriage therapy and couple groups are included. (Author)

  7. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Science.gov (United States)

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

    2015-07-01

    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  8. 77 FR 13367 - General Electric-Hitachi Global Laser Enrichment, LLC, Proposed Laser-Based Uranium Enrichment...

    Science.gov (United States)

    2012-03-06

    ... NUCLEAR REGULATORY COMMISSION [NRC-2009-0157] General Electric-Hitachi Global Laser Enrichment, LLC, Proposed Laser-Based Uranium Enrichment Facility, Wilmington, NC AGENCY: Nuclear Regulatory... Impact Statement (EIS) for the proposed General Electric- Hitachi Global Laser Enrichment, LLC (GLE...

  9. The enrichment secondary market

    International Nuclear Information System (INIS)

    Einbund, D.R.

    1986-01-01

    This paper will addresses two topics: the background to the present status of the enrichment secondary market and the future outlook of the secondary market in enrichment services, and the viability of the nuclear fuel brokerage industry. These two topics are inevitably connected, as most secondary market activity, not only in enrichment but also in natural uranium, has traditionally been conducted with the participation of brokers. Therefore, the author interrelates these topics

  10. Thermal breeder fuel enrichment zoning

    International Nuclear Information System (INIS)

    Capossela, H.J.; Dwyer, J.R.; Luce, R.G.; McCoy, D.F.; Merriman, F.C.

    1992-01-01

    A method and apparatus for improving the performance of a thermal breeder reactor having regions of higher than average moderator concentration are disclosed. The fuel modules of the reactor core contain at least two different types of fuel elements, a high enrichment fuel element and a low enrichment fuel element. The two types of fuel elements are arranged in the fuel module with the low enrichment fuel elements located between the high moderator regions and the high enrichment fuel elements. Preferably, shim rods made of a fertile material are provided in selective regions for controlling the reactivity of the reactor by movement of the shim rods into and out of the reactor core. The moderation of neutrons adjacent the high enrichment fuel elements is preferably minimized as by reducing the spacing of the high enrichment fuel elements and/or using a moderator having a reduced moderating effect. 1 figure

  11. Uranium enrichment in the United States

    International Nuclear Information System (INIS)

    Hill, J.H.; Parks, J.W.

    1975-01-01

    History, improvement programs, status of electrical power availability, demands for uranium enrichment, operating plan for the U. S. enriching facilities, working inventory of enriched uranium, possible factors affecting deviations in the operating plan, status of gaseous diffusion technology, status of U. S. gas centrifuge advances, transfer of enrichment technology, gaseous diffusion--gas centrifuge comparison, new enrichment capacity, U. S. separative work pricing, and investment in nuclear energy are discussed. (LK)

  12. Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay

    Directory of Open Access Journals (Sweden)

    Farzaneh Lotfipour

    2015-06-01

    Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.

  13. Enrichment into the 21st century

    International Nuclear Information System (INIS)

    Rutkowski, E.

    1995-01-01

    This article discusses the future of the enrichment services market into the next century. It is estimated that demand for enrichment services will reach 31 million SWU by the end of the century and remain constant for the following 10 years. The current world enrichment capacity is 44 million SWU, or some 50% ahead of the demand. This oversupply is projected to continue into the next century, but in spite of this, several suppliers are planning new enrichment facilities. HEU as a source of enriched uranium is examined. Overall, long-term prices for enrichment services are expected to decline in the coming decade

  14. The commercial role for centrifuge enrichment

    International Nuclear Information System (INIS)

    Readle, P.H.; Wilcox, P.

    1987-01-01

    The enrichment market is extremely competitive and capacity greatly exceeds demand. BNFL [British Nuclear Fuels Ltd.] is in a unique position in having commercial experience of the two enrichment technologies currently used industrially: diffusion, and centrifuge enrichment through its associate company Urenco. In addition, BNFL is developing laser enrichment techniques as part of a UK development programme. The paper describes the enrichment market, briefly discusses the relative merits of the various methods of uranium enrichment and concludes that the gas centrifuge will be best able to respond to market needs for at least the remainder of the century. (author)

  15. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  16. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia

    2012-01-01

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  17. High enrichment to low enrichment core's conversion. Accidents analysis

    International Nuclear Information System (INIS)

    Abbate, P.; Rubio, R.; Doval, A.; Lovotti, O.

    1990-01-01

    This work analyzes the different accidents that may occur in the reactor's facility after the 20% high-enriched uranium core's conversion. The reactor (of 5 thermal Mw), built in the 50's and 60's, is of the 'swimming pool' type, with light water and fuel elements of the curve plates MTR type, enriched at 93.15 %. This analysis includes: a) accidents by reactivity insertion; b) accidents by coolant loss; c) analysis by flow loss and d) fission products release. (Author) [es

  18. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Uranium hexafluoride: Handling procedures and container descriptions

    International Nuclear Information System (INIS)

    1987-09-01

    The US Department of Energy (DOE) guidelines for packaging, measuring, and transferring uranium hexafluoride (UF 6 ) have been undergoing continual review and revision for several years to keep them in phase with developing agreements for the supply of enriched uranium. Initially, K-1323 ''A Brief Guide to UF 6 Handling,'' was issued in 1957. This was superceded by ORO-651, first issued in 1966, and reissued in 1967 to make editorial changes and to provide minor revisions in procedural information. In 1968 and 1972, Revisions 2 and 3, respectively, were issued as part of the continuing effort to present updated information. Revision 4 issued in 1977 included revisions to UF 6 cylinders, valves, and methods to use. Revision 5 adds information dealing with pigtails, overfilled cylinders, definitions and handling precautions, and cylinder heel reduction procedures. Weighing standards previously presented in ORO-671, Vol. 1 (Procedures for Handling and Analysis of UF 6 ) have also been included. This revision, therefore, supercedes ORO-671-1 as well as all prior issues of this report. These guidelines will normally apply in all transactions involving receipt or shipment of UF 6 by DOE, unless stipulated otherwise by contracts or agreements with DOE or by notices published in the Federal Register. Any questions or requests for additional information on the subject matter covered herein should be directed to the United States Department of Energy, P.O. Box E, Oak Ridge, Tennessee 37831, Attention: Director, Uranium Enrichment Operations Division. 33 figs., 12 tabs

  20. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  1. Advanced Neutron Source enrichment study

    International Nuclear Information System (INIS)

    Bari, R.A.; Ludewig, H.; Weeks, J.R.

    1996-01-01

    A study has been performed of the impact on performance of using low-enriched uranium (20% 235 U) or medium-enriched uranium (35% 235 U) as an alternative fuel for the Advanced Neutron Source, which was initially designed to use uranium enriched to 93% 235 U. Higher fuel densities and larger volume cores were evaluated at the lower enrichments in terms of impact on neutron flux, safety, safeguards, technical feasibility, and cost. The feasibility of fabricating uranium silicide fuel at increasing material density was specifically addressed by a panel of international experts on research reactor fuels. The most viable alternative designs for the reactor at lower enrichments were identified and discussed. Several sensitivity analyses were performed to gain an understanding of the performance of the reactor at parametric values of power, fuel density, core volume, and enrichment that were interpolations between the boundary values imposed on the study or extrapolations from known technology

  2. PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

    Science.gov (United States)

    Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

    2004-01-01

    A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

  3. Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu Panel for Detection of 2009 A (H1N1) Pandemic Influenza Virus▿†‡

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-01-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10−1.3∼−0.7 50% infectious doses (ID50) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation. PMID:21593260

  4. The measurement of tritium in water samples with electrolytic enrichment using liquid scintillation counter

    Directory of Open Access Journals (Sweden)

    Janković Marija M.

    2012-01-01

    Full Text Available Tritium (3H present in the environment decreased in the last decades and nowadays it has low activity concentrations. Measurement of low-level tritium activities in natural waters, e. g. in precipitation, groundwater, and river water requires special techniques for water pretreatment and detection of low-level radioactivity. In order to increase the tritium concentration to an easily measurable level, electrolytic enrichment must be applied. This paper presents the enrichment method performed by electrolysis in a battery of 18 cells, giving an enrichment factor of 5.84 (calculated from 59 electrolyses. The calculated mean values of the separation factor and enrichment parameter were 4.10 and 0.84, respectively. Results for tritium activity in precipitation and surface water collected in Belgrade during 2008 and 2009 are presented. The Radiation and Environmental Protection Department of the Vinča Institute of Nuclear Sciences, participated in the IAEA TRIC2008 international intercomparison exercise. The participation in the intercomparisons for any laboratory doing low-level 3H measurements in the waters is very important and useful. It is considered the best way to check the entire procedure and methods of the measurements and the reliability of the standard used. The analysis of the reported 3H activity results showed that all results for five intercomparison samples, for which electrolytic enrichment were applied prior to the 3H measurement, are acceptable.

  5. Assessing chlorinated ethene degradation in a large scale contaminant plume by dual carbon–chlorine isotope analysis and quantitative PCR

    DEFF Research Database (Denmark)

    Hunkeler, D.; Abe, Y.; Broholm, Mette Martina

    2011-01-01

    The fate of chlorinated ethenes in a large contaminant plume originating from a tetrachloroethene (PCE) source in a sandy aquifer in Denmark was investigated using novel methods including compound-specific carbon and chlorine isotope analysis and quantitative real-time polymerase chain reaction (q...... reduction by pyrite as indicated by the formation of cDCE and stable carbon isotope data. TCE and cDCE showed carbon isotope trends typical for reductive dechlorination with an initial depletion of 13C in the daughter products followed by an enrichment of 13C as degradation proceeded. At 1000 m downgradient......DCE. The significant enrichment of 13C in VC indicates that VC was transformed further, although the mechanismcould not be determined. The transformation of cDCEwas the rate limiting step as no accumulation of VC occurred. In summary, the study demonstrates that carbon–chlorine isotope analysis and qPCR combinedwith...

  6. Modification of gDNA extraction from soil for PCR designed for the routine examination of soil samples contaminated with Toxocara spp. eggs.

    Science.gov (United States)

    Borecka, A; Gawor, J

    2008-06-01

    A modification of gDNA extraction was developed for the polymerase chain reaction (PCR) technique, intended for the detection and differentiation of Toxocara spp. eggs in soil or sediments. Sand samples from sandpits confirmed as being contaminated with Toxocara spp. eggs by the flotation technique were analysed by PCR. The use of proteinase K made it possible to obtain genomic DNA from the sample without needing to isolate eggs using flotation or to inactivate PCR inhibitors present in the sand. Specific primers in the PCR reaction allowed discrimination between T. canis and T. cati eggs. The modification simplified the procedure, thanks to eliminating the step of gDNA isolation from eggs, which is both laborious and difficult.

  7. On-line solid-phase enrichment coupled to packed reactor flow injection analysis in a green analytical procedure to determine low levels of folic acid using fluorescence detection

    Directory of Open Access Journals (Sweden)

    Emara Samy

    2012-12-01

    Full Text Available Abstract Background Analysis of folic acid (FA is not an easy task because of its presence in lower concentrations, its lower stability under acidic conditions, and its sensitiveness against light and high temperature. The present study is concerned with the development and validation of an automated environmentally friendly pre-column derivatization combined by solid-phase enrichment (SPEn to determine low levels of FA. Results Cerium (IV trihydroxyhydroperoxide (CTH as a packed oxidant reactor has been used for oxidative cleavage of FA into highly fluorescent product, 2-amino-4-hydroxypteridine-6-carboxylic acid. FA was injected into a carrier stream of 0.04 M phosphate buffer, pH 3.4 at a flow-rate of 0.25 mL/min. The sample zone containing the analyte was passed through the CTH reactor thermostated at 40°C, and the fluorescent product was trapped and enriched on a head of small ODS column (10 mm x 4.6 mm i.d., 5 μm particle size. The enriched product was then back-flush eluted by column-switching from the small ODS column to the detector with a greener mobile phase consisting of ethanol and phosphate buffer (0.04M, pH 3.4 in the ratio of 5:95 (v/v. The eluent was monitored fluorimetrically at emission and excitation wavelengths of 463 and 367 nm, respectively. The calibration graph was linear over concentrations of FA in the range of 1.25-50 ng/mL, with a detection limit of 0.49 ng/mL. Conclusion A new simple and sensitive green analytical procedure including on-line pre-column derivatization combined by SPEn has been developed for the routine quality control and dosage form assay of FA at very low concentration level. The method was a powerful analytical technique that had excellent sensitivity, sufficient accuracy and required relatively simple and inexpensive instrumentation.

  8. Use of a two-step ultrafiltration procedure to concentrate viral hemorrhagic septicemia virus (VHSV) in seawater.

    Science.gov (United States)

    Kim, Soo-Jin; Kim, Jong-Oh; Kim, Wi-Sik; Oh, Myung-Joo

    2015-11-01

    Viral hemorrhagic septicemia virus (VHSV) has been reported to be stable in both fresh as well as seawater, suggesting that VHSV exists in natural aquatic environments and might have an effect on the wild and cultured fish. However, VHSV is below the detectable limits of laboratory tests in natural seawater. In this study, a two-step ultrafiltration (UF) procedure was used to concentration of VHSV in seawater, providing samples that were tested for infectivity by cell culture and the presence of VHSV by quantitative reverse transcriptase PCR (qRT-PCR) methods. Overall, VHSV was approximately concentrated 100-1000 times in 1, 5 and 10 L, seawater volumes respectively: from 2.81×10(6) to 6.53×10(7)/mL and 10(3.3) to 10(3.8)TCID50/mL prior to the UF procedure, to 3.78×10(8), 1.16 × 10(11), and 9.12 × 10(10)/mL after the procedure. This is the first report of concentrating VHSV using an UF method that was specifically designed for seawater samples. In addition, the two-step UF procedure appears to be compatible with viral cell culture and qRT-PCR methods. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Prospects and problems of uranium enrichment

    International Nuclear Information System (INIS)

    Imai, Ryukichi

    1974-01-01

    The problem of uranium enrichment now concerns principally peaceful nuclear power generation. With the current oil crisis, energy resources assume unprecedented importance. However, the requirements for enriched uranium vary with the vicissitude of the world situation in nuclear power generation; the enterprise of uranium enrichment is related to economic aspect. The following matters are described: dimension of enrichment problem, political factors, changes in requirements, projects in each country, and strategy of enrichment in Japan. (Mori, K.)

  10. Uranium enrichment: an overview

    International Nuclear Information System (INIS)

    Cazalet, J.

    1995-01-01

    This paper is a general presentation of uranium enrichment processes and assessments of the prevailing commercial and industrial situations. It gives first some theoretical aspects of enrichment in general and explains the differences between statistical and selective processes in particular. Then a review of the different processes is made with a comparison between them. Finally, some general remarks concerning applications are given and the risks of proliferation related to enrichment are mentioned. (J.S.). 4 refs., 5 figs., 8 tabs

  11. Supply of low enriched (LEU) and highly enriched uranium (HEU) for research reactors

    International Nuclear Information System (INIS)

    Mueller, H.

    1997-01-01

    Enriched uranium for research reactors in the form of LEU /= low enriched uranium at 19.75% U-235) and HEU (= highly enriched uranium at 90 to 93% U-235) was and is - due to its high U-235 enrichment - a political fuel other than enriched uranium for power reactors. The sufficient availability of LEU and HEU is a vital question for research reactors, especially in Europe, in order to perform their peaceful research reactor programs. In the past the USA were in the Western hemisphere sole supplier of LEU and HEU. Today the USA have de facto stopped the supply of LEU and HEU, for HEU mainly due to political reasons. This paper deals, among others, with the present availability of LEU and HEU for European research reactors and touches the following topics: - historical US supplies, - influence of the RERTR-program, - characteristics of LEU and HEU, - military HEU enters the civil market, -what is the supply situation for LEU and HEU today? - outlook for safe supplies of LEU and HEU. (author)

  12. Real-time PCR and enzyme-linked fluorescent assay methods for detecting Shiga-toxin-producing Escherichia coli in mincemeat samples.

    Science.gov (United States)

    Stefan, A; Scaramagli, S; Bergami, R; Mazzini, C; Barbanera, M; Perelle, S; Fach, P

    2007-03-01

    This work aimed to compare real-time polymerase chain reaction (PCR) with the commercially available enzyme-linked fluorescent assay (ELFA) VIDAS ECOLI O157 for detecting Escherichia coli O157 in mincemeat. In addition, a PCR-based survey on Shiga-toxin-producing E. coli (STEC) in mincemeat collected in Italy is presented. Real-time PCR assays targeting the stx genes and a specific STEC O157 sequence (SILO157, a small inserted locus of STEC O157) were tested for their sensitivity on spiked mincemeat samples. After overnight enrichment, the presence of STEC cells could be clearly determined in the 25 g samples containing 10 bacterial cells, while the addition of five bacteria provided equivocal PCR results with Ct values very close to or above the threshold of 40. The PCR tests proved to be more sensitive than the ELFA-VIDAS ECOLI O157, whose detection level started from 50 bacterial cells/25 g of mincemeat. The occurrence of STEC in 106 mincemeat (bovine, veal) samples collected from September to November 2004 at five different points of sale in Italy (one point of sale in Arezzo, Tuscany, central Italy, two in Mantova, Lombardy, Northern Italy, and two in Bologna, Emilia-Romagna, upper-central Italy) was less than 1%. Contamination by the main STEC O-serogroups representing a major public health concern, including O26, O91, O111, O145, and O157, was not detected. This survey indicates that STEC present in these samples are probably not associated with pathogenesis in humans.

  13. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  14. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  15. Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

    OpenAIRE

    Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

    1993-01-01

    We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

  16. Spectrographic determination of impurities in enriched uranium solutions

    International Nuclear Information System (INIS)

    Capdevila, C.; Roca, M.

    1980-01-01

    A spectrographic procedure for the determination of trace amounts of Al, B, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Fe, K, L i , Hg, Mn, Mo, Na, Nb, Ni, P, Pb, Ru, Sb, Sn, Sr, Ti, V, Zn, and Zr in enriched uranyl nitrate solutions from the reprocessing of spent nuclear fuels is described. After removal of uranium by either TBP or TNOA solvent extraction, the aqueous phase Is analysed by the graphite spark technique. TBP is adequate for all impurities, excepting boron and phosphorus; both of these elements can sat is factory be determined by using TNOA after the addition of mannitol to avoid boron losses. (Author) 4 refs

  17. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  18. Comparison of DNA probe, PCR amplification, ELISA and culture methods for the rapid detection of Salmonella in poultry

    International Nuclear Information System (INIS)

    Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.

    2005-01-01

    The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)

  19. An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

    Directory of Open Access Journals (Sweden)

    Islay Rodríguez

    2014-08-01

    Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

  20. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  1. Direct PCR amplification of forensic touch and other challenging DNA samples: A review.

    Science.gov (United States)

    Cavanaugh, Sarah E; Bathrick, Abigail S

    2018-01-01

    DNA evidence sample processing typically involves DNA extraction, quantification, and STR amplification; however, DNA loss can occur at both the DNA extraction and quantification steps, which is not ideal for forensic evidence containing low levels of DNA. Direct PCR amplification of forensic unknown samples has been suggested as a means to circumvent extraction and quantification, thereby retaining the DNA typically lost during those procedures. Direct PCR amplification is a method in which a sample is added directly to an amplification reaction without being subjected to prior DNA extraction, purification, or quantification. It allows for maximum quantities of DNA to be targeted, minimizes opportunities for error and contamination, and reduces the time and monetary resources required to process samples, although data analysis may take longer as the increased DNA detection sensitivity of direct PCR may lead to more instances of complex mixtures. ISO 17025 accredited laboratories have successfully implemented direct PCR for limited purposes (e.g., high-throughput databanking analysis), and recent studies indicate that direct PCR can be an effective method for processing low-yield evidence samples. Despite its benefits, direct PCR has yet to be widely implemented across laboratories for the processing of evidentiary items. While forensic DNA laboratories are always interested in new methods that will maximize the quantity and quality of genetic information obtained from evidentiary items, there is often a lag between the advent of useful methodologies and their integration into laboratories. Delayed implementation of direct PCR of evidentiary items can be attributed to a variety of factors, including regulatory guidelines that prevent laboratories from omitting the quantification step when processing forensic unknown samples, as is the case in the United States, and, more broadly, a reluctance to validate a technique that is not widely used for evidence samples. The

  2. The effect of taurine and enriched environment on behaviour, memory and hippocampus of diabetic rats.

    Science.gov (United States)

    Rahmeier, Francine Luciano; Zavalhia, Lisiane Silveira; Tortorelli, Lucas Silva; Huf, Fernanda; Géa, Luiza Paul; Meurer, Rosalva Thereza; Machado, Aryadne Cardoso; Gomez, Rosane; Fernandes, Marilda da Cruz

    2016-09-06

    Diabetes mellitus (DM) has been studied recently as a major cause of cognitive deficits, memory and neurodegenerative damage. Taurine and enriched environment have stood out for presenting neuroprotective and stimulating effects that deserve further study. In this paper, we examined the effects of taurine and enriched environment in the context of diabetes, evaluating effects on behaviour, memory, death and cellular activity. Eighty-eight Wistar rats were divided into 2 groups (E=enriched environment; C=standard housing). Some animals (24/group) underwent induction of diabetes, and within each group, some animals (half of diabetics (D) and half of non-diabetics (ND)/group) were treated for 30days with taurine (T). Untreated animals received saline (S). In total, there were eight subgroups: DTC, DSC, NDTC, NDSC, DTE, DSE, NDTE and NDSE. During the experiment, short-term memory was evaluated. After 30th day of experiment, the animals were euthanized and was made removal of brains used to immunohistochemistry procedures for GFAP and cleaved caspase-3. As a result, we observed that animals treated with taurine showed better performance in behavioural and memory tasks, and the enriched environment had positive effects, especially in non-diabetic animals. Furthermore, taurine and enriched environment seemed to be able to interfere with neuronal apoptosis and loss of glial cells, and in some instances, these two factors seemed to have synergistic effects. From these data, taurine and enriched environment may have important neurostimulant and neuroprotective effects. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

    Science.gov (United States)

    Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

    2017-08-01

    Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Bias in the Listeria monocytogenes enrichment procedure: Lineage 2 strains outcompete lineage 1 strains in University of Vermont selective enrichments

    DEFF Research Database (Denmark)

    Bruhn, Jesper Bartholin; Vogel, Birte Fonnesbech; Gram, Lone

    2005-01-01

    compounds in UVM I and II influenced this bias. The results of the present study demonstrate that the selective procedures used for isolation of L. monocytogenes may not allow a true representation of the types present in foods. Our results could have a significant impact on epidemiological studies...

  5. PCR em tempo real para diagnóstico da leucose enzoótica bovina Enzootic bovine leukosis real time PCR

    Directory of Open Access Journals (Sweden)

    Natanael Lamas Dias

    2012-08-01

    Full Text Available O objetivo deste trabalho foi realizar a validação de uma reação em cadeia da polimerase em tempo real com o sistema Plexor® (qPCR para o diagnóstico da Leucose Enzoótica Bovina (LEB, por meio da comparação com testes de diagnóstico recomendados pela Organização Mundial de Saúde Animal (OIE. A qPCR foi comparada com duas outras técnicas: a PCR nested (nPCR e a imunodifusão em gel de ágar (IDGA. Das 82 amostras analisadas pela qPCR e nPCR, 79 apresentaram resultados concordantes, sendo a concordância, classificada pelo Índice Kappa, como alta. Entre as PCRs e a IDGA, o número de resultados concordantes foi de 71 e 69, respectivamente, para qPCR e nPCR, sendo a concordância classificada como considerável. A qPCR apresentou altos valores de sensibilidade e especificidade. Os valores preditivos da qPCR observados demonstraram a alta capacidade de classificação dos casos positivos e negativos. A qPCR não foi capaz de detectar três amostras positivas e tem custo ligeiramente superior que a nPCR. Entretanto, a qPCR é uma técnica mais rápida, menos susceptível a contaminações, tem alta sensibilidade, não utiliza e não gera resíduos carcinogênicos. Concluímos que a qPCR pode substituir a nPCR recomendada pela OIE no diagnóstico de rotina em áreas em que a LEB é endêmica, como no Brasil.The goal of this research was to validate a Plexor® real time Polymerase Chain Reaction (qPCR for Enzootic Bovine Leukosis (EBL diagnosis by comparison with methods recommend by the World Animal Health Organization (OIE. The qPCR was compared with two other techniques: the nested PCR (nPCR and to the agar gel immunodiffusion (AGID. Of 82 qPCR and nPCR analysed samples, 79 presented concordant results, being the concordance classified by Kappa Index as high. Between the PCRs and AGID, the number of concordant results was 71 and 69, out of 82, to qPCR and nPCR, respectively, being the concordance classified as considerable, in both

  6. The competitive enrichment market

    International Nuclear Information System (INIS)

    Parks, J.W.; Huffman, F.C.

    1984-01-01

    With the enactment of the ''Private Ownership of Special Nuclear Materials Act'' in 1964, the U.S. Government made provisions to enter into the uranium enrichment services business. Since nuclear power was in its infancy and the Government was promoting its growth as well as trying to help U.S. industry sell reactors overseas, the initial contracts (Requirements Contracts) for enrichment services placed most of the risks associated with the supplying of the services on the Government. Projections of nuclear power additions continued to grow and in 1972 the Atomic Energy Commission (AEC) stopped contracting under Requirements Contracts in order to study which mode of contracting best suited the commercial development of the industry. In mid-1973, the AEC introduced the Long-Term Fixed Commitment (LTFC) contract which shifted the risk to the customer. By mid-1974, AEC had contracts which completely used the enrichment capacity of its complex and refused to accept requests for additional contracts. This action further convinced European nations that they should continue to develop their own enrichment capacity and resulted in the EURODIF and URENCO projects. Before this time the U.S. supplied 100% of the world market for enriching services

  7. Enrichment: Dealing with overcapacity

    International Nuclear Information System (INIS)

    Peterson, C.H.

    1989-01-01

    Today's surplus of enrichment capacity will continue until at least the end of this century. This will challenge the ingenuity of the separative work unit (SWU) suppliers as they attempt to keep market share and remain profitable in a very competitive marketplace. The utilities will be faced with attractive choices, but making the best choice will require careful analysis and increased attention to market factors. Current demand projections will probably prove too high to the extent that more reactors are canceled or delayed. The DOE has the vast majority of the unused capacity, so it will feel the most immediate impact of this large surplus in productive capacity. The DOE has responded to these market challenges by planning another reorganization of its enriching operations. Without a major agreement among the governments affected by the current surplus in enrichment capacity, the future will see lower prices, more competitive terms, and the gradual substitution of centrifuge or laser enrichment for the gaseous diffusion plants. The competition that is forcing the gaseous diffusion prices down to marginal cost will provide the long-term price basis for the enrichment industry

  8. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Science.gov (United States)

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. PCR analysis is superior to histology for diagnosis of Whipple's disease mimicking seronegative rheumatic diseases.

    Science.gov (United States)

    Lehmann, P; Ehrenstein, B; Hartung, W; Dragonas, C; Reischl, U; Fleck, M

    2017-03-01

    The diagnosis of Whipple's disease (WD) is commonly confirmed by histology demonstrating Periodic Acid Schiff (PAS)-positive macrophages in the duodenal mucosa. Analysis of intestinal tissue or other specimens using polymerase chain reaction (PCR) is a more sensitive method. However, the relevance of positive PCR findings is still controversial. Therefore, we evaluated the relevance of histology and PCR findings to establishing the diagnosis of WD in a series of WD patients initially presenting with suspected rheumatic diseases. Between 2006 and 2014, 20 patients with seronegative rheumatic diseases tested positive for Tropheryma whipplei (Tw) by PCR and/or histology and were enrolled in a retrospective analysis of the diagnostic value of both procedures. Seven of the 20 cases (35%) were diagnosed with 'classic' WD as indicated by PAS-positive macrophages. In the remaining 13 patients, the presence of Tw was detected by intestinal (n = 10) or synovial PCR analysis (n = 3). Two of the 20 patients (10%) with evidence of Tw did not respond to antibiotic therapy. They were not considered to suffer from WD. Therefore, relying only on histological findings of intestinal biopsies would have missed 11 (61%) of the 18 patients with WD in our cohort. In comparison, PCR of intestinal biopsies detected Tw-DNA in 14 (93%) of the 15 WD patients evaluated. Patients with a positive histology did not differ from PCR-positive patients with regard to sex, age, or duration of disease, but more often presented with gastrointestinal symptoms. A substantial number of WD patients present without typical intestinal histology findings. Additional PCR analysis of intestinal tissue or synovial fluid increased the sensitivity of the diagnostic evaluation and should be considered particularly in patients presenting with atypical seronegative rheumatic diseases and a high-risk profile for WD.

  10. Solution-based targeted genomic enrichment for precious DNA samples

    Directory of Open Access Journals (Sweden)

    Shearer Aiden

    2012-05-01

    Full Text Available Abstract Background Solution-based targeted genomic enrichment (TGE protocols permit selective sequencing of genomic regions of interest on a massively parallel scale. These protocols could be improved by: 1 modifying or eliminating time consuming steps; 2 increasing yield to reduce input DNA and excessive PCR cycling; and 3 enhancing reproducible. Results We developed a solution-based TGE method for downstream Illumina sequencing in a non-automated workflow, adding standard Illumina barcode indexes during the post-hybridization amplification to allow for sample pooling prior to sequencing. The method utilizes Agilent SureSelect baits, primers and hybridization reagents for the capture, off-the-shelf reagents for the library preparation steps, and adaptor oligonucleotides for Illumina paired-end sequencing purchased directly from an oligonucleotide manufacturing company. Conclusions This solution-based TGE method for Illumina sequencing is optimized for small- or medium-sized laboratories and addresses the weaknesses of standard protocols by reducing the amount of input DNA required, increasing capture yield, optimizing efficiency, and improving reproducibility.

  11. Development of on-line uranium enrichment monitor of gaseous UF6 for uranium enrichment plant

    International Nuclear Information System (INIS)

    Lu Xuesheng; Liu Guorong; Jin Huimin; Zhao Yonggang; Li Jinghuai; Hao Xueyuan; Ying Bin; Yu Zhaofei

    2013-01-01

    An on-line enrichment monitor was developed to measure the enrichment of UF 6 , flowing through the processing pipes in uranium enrichment plant. A Nal (Tl) detector was used to measure the count rates of the 185.7 keV γ-ray emitted from 235 U, and the total quantity of uranium was determined from thermodynamic characteristics of gaseous uranium hexafluoride. The results show that the maximum relative standard deviation is less than 1% when the measurement time is 120 s or more and the pressure is more than 2 kPa in the measurement chamber. Uranium enrichment of gaseous uranium hexafluoride in the output end of cascade can be monitored continuously by using the device. It should be effective for nuclear materials accountability verifications and materials balance verification at uranium enrichment plant. (authors)

  12. Comparison of a Commercially Available Repetitive-Element PCR System (DiversiLab) with PCR Ribotyping for Typing of Clostridium difficile Strains ▿

    OpenAIRE

    Eckert, C.; Van Broeck, J.; Spigaglia, P.; Burghoffer, B.; Delmée, M.; Mastrantonio, P.; Barbut, F.

    2011-01-01

    This study compared a repetitive-element PCR (rep-PCR) method (DiversiLab system) to PCR ribotyping. The discriminatory power of rep-PCR was 0.997. Among the PCR ribotype 027 isolates tested, different rep types could be distinguished. rep-PCR showed a higher discriminatory power than PCR ribotyping. Nevertheless, this method requires technical skill, and visual interpretation of rep-PCR fingerprint patterns may be difficult.

  13. Oxygen enrichment incineration

    International Nuclear Information System (INIS)

    Kim, Jeong Guk; Yang, Hee Chul; Park, Geun Il; Kim, Joon Hyung

    2000-10-01

    Oxygen enriched combustion technology has recently been used in waste incineration. To apply the oxygen enrichment on alpha-bearing waste incineration, which is being developed, a state-of-an-art review has been performed. The use of oxygen or oxygen-enriched air instead of air in incineration would result in increase of combustion efficiency and capacity, and reduction of off-gas product. Especially, the off-gas could be reduced below a quarter, which might reduce off-gas treatment facilities, and also increase an efficiency of off-gas treatment. However, the use of oxygen might also lead to local overheating and high nitrogen oxides (NOx) formation. To overcome these problems, an application of low NOx oxy-fuel burner and recycling of a part of off-gas to combustion chamber have been suggested

  14. Oxygen enrichment incineration

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jeong Guk; Yang, Hee Chul; Park, Geun Il; Kim, Joon Hyung

    2000-10-01

    Oxygen enriched combustion technology has recently been used in waste incineration. To apply the oxygen enrichment on alpha-bearing waste incineration, which is being developed, a state-of-an-art review has been performed. The use of oxygen or oxygen-enriched air instead of air in incineration would result in increase of combustion efficiency and capacity, and reduction of off-gas product. Especially, the off-gas could be reduced below a quarter, which might reduce off-gas treatment facilities, and also increase an efficiency of off-gas treatment. However, the use of oxygen might also lead to local overheating and high nitrogen oxides (NOx) formation. To overcome these problems, an application of low NOx oxy-fuel burner and recycling of a part of off-gas to combustion chamber have been suggested.

  15. Determining the prevalence of inv-positive and ail-positive Yersinia enterocolitica in pig tonsils using PCR and culture methods.

    Science.gov (United States)

    Stachelska, Milena Alicja

    2017-01-01

    Yersiniosis is believed to be the third most common intestinal zoonosis in the European Union, after campylobacteriosis and salmonellosis. Yersinia enterocolitica is the most common species responsible for human infections. Pigs are regarded as the biggest reservoir of pathogenic Y. enterocolitica strains, which are mainly isolated from pig tonsils. The aim of this paper is to examine the prevalence of inv-positive and ail-positive Y. enterocolitica in pigs which were slaughtered in a Polish abattoir. Real-time PCR and culture methods were used to assess the prevalence of patho- genic Y. enterocolitica strains in pig tonsils. Real-time PCR was applied to detect inv-positive and ail-positive Y. enterocolitica. Y. enterocolitica was also isolated by applying direct plating, unselective (tryptic soy broth) and selective (irgasan-ticarcillin-potassium chlorate bouillon) enrichment. A total of 180 pigs were studied, of which 85% and 32% respectively were found to be infected with inv-positive and ail-positive Y. enterocolitica. The 92 inv-positive and ail-positive isolates, from 57 culture- positive tonsils, underwent bio- and serotyping. The most common was bioserotype 4/O:3, which was found in 53 (93%) out of 57 culture-positive tonsils. Strains of bioserotypes 2/O:5, 2/O:9 and 2/O:5.27 occurred in significantly lower numbers. The prevalence of inv-positive and ail-positive Y. enterocolitica was found to be high in the ton- sils of slaughtered pigs, using real-time PCR. The real-time PCR method for the detection and identification of pathogenic Y. enterocolitica is sensitive and specific, which has been verified by specificity and sensitivity tests using the pure cultures. Serotypes were distinguished from each other using PCR serotyping. The PCR method was essential in forming our conclusions.

  16. Internal quality control of PCR-based genotyping methods

    DEFF Research Database (Denmark)

    Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen

    2002-01-01

    Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...

  17. Critical assessment of the efficiency of CD34 and CD133 antibodies for enrichment of rabbit hematopoietic stem cells.

    Science.gov (United States)

    Vašíček, Jaromír; Shehata, Medhat; Schnabl, Susanne; Hilgarth, Martin; Hubmann, Rainer; Jäger, Ulrich; Bauer, Miroslav; Chrenek, Peter

    2018-06-08

    Rabbits have many hereditary diseases common to humans and are therefore a valuable model for regenerative disease and hematopoietic stem cell (HSC) therapies. Currently, there is no substantial data on the isolation and/or enrichment of rabbit HSCs. This study was initiated to evaluate the efficiency of the commercially available anti-CD34 and anti-CD133 antibodies for the detection and potential enrichment of rabbit HSCs from peripheral blood. PBMCs from rabbit and human blood were labelled with different clones of anti-human CD34 monoclonal antibodies (AC136, 581 and 8G12) and rabbit polyclonal CD34 antibody (pCD34) and anti-human CD133 monoclonal antibodies (AC133 and 293C3). Flow cytometry showed a higher percentage of rabbit CD34 + cells labelled by AC136 in comparison to the clone 581 and pCD34 (Penrichment of rabbit CD34 + cells using magnetic-activated cell sorting (MACS). The enrichment of the rabbit CD34 + cells after sorting was low in comparison to human samples (2.4% vs. 39.6%). PCR analyses confirmed the efficient enrichment of human CD34 + cells and the low expression of CD34 mRNA in rabbit positive fraction. In conclusion, the tested antibodies might be suitable for detection, but not for sorting the rabbit CD34 + HSCs and new specific anti-rabbit CD34 antibodies are needed for efficient enrichment of rabbit HSCs. This article is protected by copyright. All rights reserved. © 2018 American Institute of Chemical Engineers.

  18. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi

    International Nuclear Information System (INIS)

    Andrade, Antero Silva Ribeiro de; Moreno, Elizabeth Castro; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela; Fernandes, Octavio

    2002-01-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with 32 P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with 32 P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  19. 75 FR 10525 - In the Matter of: AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility) and All Other...

    Science.gov (United States)

    2010-03-08

    ...: AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility) and All Other Persons Who Seek or Obtain... for the Implementation of a Safeguards Information Program (Effective Immediately) I AREVA Enrichment... it to construct and operate a uranium enrichment facility in Bonneville County, Idaho. AES submitted...

  20. Detection and Identification of Free-living Amoeba from Environmental Water in Taiwan by PCR Method

    Science.gov (United States)

    Tsai, H. F.; Hsu, B. M.; Huang, K. H.; She, C. Y.; Kao, P. M.; Shen, S. M.; Tseng, S. F.; Chen, J. S.

    2012-04-01

    Acanthamoeba, Naegleria, Balamuthia and Hartmannella all belong to free-living amoebae that are present ubiquitously in the environment including water, soil, and air. Free-living amoebae are parasites which can infect humans and can lead to serious illness and even death. The aim of this study is to investigate the presence of free-living amoebae in aquatic environment in Taiwan, and to compare the differences between Acanthamoeba and Naegleria in diverse cultivation methods and conditions. In this study, we used molecular method by PCR amplification with specific primers to analyze the occurrence of free-living amoebae. We collected 176 samples from environmental water including drinking water treatment plants, stream water, and hot spring recreational areas in Taiwan. Based on the results of PCR, 43 water samples (24.4%) were detected positive for free-living amoebae. The most common Acanthamoeba genotype isolated from samples including T2, T4, T5, T12, and T15. N. australiensis and N. lovaniensis were also identified by molecular biology techniques. Furthermore, we found that both Acanthamoeba and Naegleria can be cultured by PYG in 30° C, but not all free-living amoebae can be isolated and enriched by using storage-cultivation method. Because of the widespread presence of Acanthamoeba and Naegleria in aquatic environments, the water quality and safety of aquatic environments should be more conscious in Taiwan and worldwide. Keywords: free-living amoebae; Acanthamoeba; Naegleria; Balamuthia; Hartmannella; PCR

  1. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena

    2013-04-01

    Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.

  2. Quantification of integrated HIV DNA by repetitive-sampling Alu-HIV PCR on the basis of poisson statistics.

    Science.gov (United States)

    De Spiegelaere, Ward; Malatinkova, Eva; Lynch, Lindsay; Van Nieuwerburgh, Filip; Messiaen, Peter; O'Doherty, Una; Vandekerckhove, Linos

    2014-06-01

    Quantification of integrated proviral HIV DNA by repetitive-sampling Alu-HIV PCR is a candidate virological tool to monitor the HIV reservoir in patients. However, the experimental procedures and data analysis of the assay are complex and hinder its widespread use. Here, we provide an improved and simplified data analysis method by adopting binomial and Poisson statistics. A modified analysis method on the basis of Poisson statistics was used to analyze the binomial data of positive and negative reactions from a 42-replicate Alu-HIV PCR by use of dilutions of an integration standard and on samples of 57 HIV-infected patients. Results were compared with the quantitative output of the previously described Alu-HIV PCR method. Poisson-based quantification of the Alu-HIV PCR was linearly correlated with the standard dilution series, indicating that absolute quantification with the Poisson method is a valid alternative for data analysis of repetitive-sampling Alu-HIV PCR data. Quantitative outputs of patient samples assessed by the Poisson method correlated with the previously described Alu-HIV PCR analysis, indicating that this method is a valid alternative for quantifying integrated HIV DNA. Poisson-based analysis of the Alu-HIV PCR data enables absolute quantification without the need of a standard dilution curve. Implementation of the CI estimation permits improved qualitative analysis of the data and provides a statistical basis for the required minimal number of technical replicates. © 2014 The American Association for Clinical Chemistry.

  3. Label-free detection of gliadin food allergen mediated by real-time apta-PCR.

    Science.gov (United States)

    Pinto, Alessandro; Polo, Pedro Nadal; Henry, Olivier; Redondo, M Carmen Bermudo; Svobodova, Marketa; O'Sullivan, Ciara K

    2014-01-01

    Celiac disease is an immune-mediated enteropathy triggered by the ingestion of gluten. The only effective treatment consists in a lifelong gluten-free diet, requiring the food industry to tightly control the gluten contents of their products. To date, several gluten quantification approaches using antibodies are available and recommended by the legal authorities, such as Codex Alimentarius. However, whilst these antibody-based tests exhibit high sensitivity and specificity, the production of antibodies inherently requires the killing of host animals and is time-consuming and relatively expensive. Aptamers are structured single-stranded nucleic acid ligands that bind with high affinity and specificity to their cognate target, and aiming for a cost-effective viable alternative to the use of antibodies. Herein, we report the systematic evolution of ligands by exponential enrichment (SELEX)-based selection of a DNA aptamer against gliadin from a combinatorial DNA library and its application in a novel detection assay. Taking into account the hydrophobic nature of the gliadin target, a microtitre plate format was exploited for SELEX, where the target was immobilised via hydrophobic interactions, thus exposing aptatopes accessible for interaction with the DNA library. Evolution was followed using surface plasmon resonance, and following eight rounds of SELEX, the enriched DNA pool was cloned, sequenced and a clear consensus motif was identified. An apta-PCR assay was developed where competition for the aptamer takes place between the surface-immobilised gliadin and gliadin in the target sample, akin to an ELISA competitive format where the more target present in the sample, the less aptamer will bind to the immobilised gliadin. Following competition, any aptamer bound to the immobilised gliadin was heat-eluted and quantitatively amplified using real-time PCR, achieving a detection limit of approx. 2 nM (100 ng mL(-1)). The specificity of the selected aptamer was

  4. Procedure, algorithm and criterions of determination of a burnup of a irradiated nuclear fuel in process of overloading

    International Nuclear Information System (INIS)

    Bilej, D.V.; Fridman, N.A.; Maslov, O.V.; Maksimov, M.V.

    2001-01-01

    The procedure, algorithm and criterions of determination of a burnup of the irradiated nuclear fuel in process of overloading are described. The feature of the procedure, algorithm and criterions consists in the account of initial enrichment and cooling time nuclear fuel after irradiation

  5. Rapid measurement of plasma free fatty acid concentration and isotopic enrichment using LC/MS

    Science.gov (United States)

    Persson, Xuan-Mai T.; Błachnio-Zabielska, Agnieszka Urszula; Jensen, Michael D.

    2010-01-01

    Measurements of plasma free fatty acids (FFA) concentration and isotopic enrichment are commonly used to evaluate FFA metabolism. Until now, gas chromatography-combustion-isotope ratio mass spectrometry (GC/C/IRMS) was the best method to measure isotopic enrichment in the methyl derivatives of 13C-labeled fatty acids. Although IRMS is excellent for analyzing enrichment, it requires time-consuming derivatization steps and is not optimal for measuring FFA concentrations. We developed a new, rapid, and reliable method for simultaneous quantification of 13C-labeled fatty acids in plasma using high-performance liquid chromatography-mass spectrometry (HPLC/MS). This method involves a very quick Dole extraction procedure and direct injection of the samples on the HPLC system. After chromatographic separation, the samples are directed to the mass spectrometer for electrospray ionization (ESI) and analysis in the negative mode using single ion monitoring. By employing equipment with two columns connected parallel to a mass spectrometer, we can double the throughput to the mass spectrometer, reducing the analysis time per sample to 5 min. Palmitate flux measured using this approach agreed well with the GC/C/IRMS method. This HPLC/MS method provides accurate and precise measures of FFA concentration and enrichment. PMID:20526002

  6. Species identification and quantification in meat and meat products using droplet digital PCR (ddPCR).

    Science.gov (United States)

    Floren, C; Wiedemann, I; Brenig, B; Schütz, E; Beck, J

    2015-04-15

    Species fraud and product mislabelling in processed food, albeit not being a direct health issue, often results in consumer distrust. Therefore methods for quantification of undeclared species are needed. Targeting mitochondrial DNA, e.g. CYTB gene, for species quantification is unsuitable, due to a fivefold inter-tissue variation in mtDNA content per cell resulting in either an under- (-70%) or overestimation (+160%) of species DNA contents. Here, we describe a reliable two-step droplet digital PCR (ddPCR) assay targeting the nuclear F2 gene for precise quantification of cattle, horse, and pig in processed meat products. The ddPCR assay is advantageous over qPCR showing a limit of quantification (LOQ) and detection (LOD) in different meat products of 0.01% and 0.001%, respectively. The specificity was verified in 14 different species. Hence, determining F2 in food by ddPCR can be recommended for quality assurance and control in production systems. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Evaluation of gamma-sterilization (60Co) by RT-PCR by DHFR expression detection

    International Nuclear Information System (INIS)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de; Vieira, Daniel P.

    2007-01-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a 60 Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  8. 76 FR 387 - Atomic Safety and Licensing Board; AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility)

    Science.gov (United States)

    2011-01-04

    ... and Licensing Board; AREVA Enrichment Services, LLC (Eagle Rock Enrichment Facility) December 17, 2010... construction and operation of a gas centrifuge uranium enrichment facility--denoted as the Eagle Rock... site at http://www.nrc.gov/materials/fuel-cycle-fac/arevanc.html . These and other documents relating...

  9. Digital gene expression profiling of flax (Linum usitatissimum L.) stem peel identifies genes enriched in fiber-bearing phloem tissue.

    Science.gov (United States)

    Guo, Yuan; Qiu, Caisheng; Long, Songhua; Chen, Ping; Hao, Dongmei; Preisner, Marta; Wang, Hui; Wang, Yufu

    2017-08-30

    To better understand the molecular mechanisms and gene expression characteristics associated with development of bast fiber cell within flax stem phloem, the gene expression profiling of flax stem peels and leaves were screened, using Illumina's Digital Gene Expression (DGE) analysis. Four DGE libraries (2 for stem peel and 2 for leaf), ranging from 6.7 to 9.2 million clean reads were obtained, which produced 7.0 million and 6.8 million mapped reads for flax stem peel and leave, respectively. By differential gene expression analysis, a total of 975 genes, of which 708 (73%) genes have protein-coding annotation, were identified as phloem enriched genes putatively involved in the processes of polysaccharide and cell wall metabolism. Differential expression genes (DEGs) was validated using quantitative RT-PCR, the expression pattern of all nine genes determined by qRT-PCR fitted in well with that obtained by sequencing analysis. Cluster and Gene Ontology (GO) analysis revealed that a large number of genes related to metabolic process, catalytic activity and binding category were expressed predominantly in the stem peels. The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of the phloem enriched genes suggested approximately 111 biological pathways. The large number of genes and pathways produced from DGE sequencing will expand our understanding of the complex molecular and cellular events in flax bast fiber development and provide a foundation for future studies on fiber development in other bast fiber crops. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. A Review of Conventional PCR Assays for the Detection of Selected Phytopathogens of Wheat.

    Science.gov (United States)

    Kuzdraliński, Adam; Kot, Anna; Szczerba, Hubert; Nowak, Michał; Muszyńska, Marta

    2017-01-01

    Infection of phyllosphere (stems, leaves, husks, and grains) by pathogenic fungi reduces the wheat yield and grain quality. Detection of the main wheat pathogenic fungi provides information about species composition and allows effective and targeted plant treatment. Since conventional procedures for the detection of these organisms are unreliable and time consuming, diagnostic DNA-based methods are required. Nucleic acid amplification technologies are independent of the morphological and biochemical characteristics of fungi. Microorganisms do not need to be cultured. Therefore, a number of PCR-based methodologies have been developed for the identification of key pathogenic fungi, such as Fusarium spp., Puccinia spp., Zymoseptoria tritici, Parastagonospora nodorum, Blumeria graminis f. sp. tritici, and Pyrenophora tritici-repentis. This article reviews frequently used DNA regions for fungus identification and discusses already known PCR assays for detection of the aforementioned wheat pathogens. We demonstrate that PCR-based wheat pathogen identification assays require further research. In particular, the number of diagnostic tests for Fusarium graminearum, Puccinia spp., and P. tritici-repentis are insufficient. © 2017 S. Karger AG, Basel.

  11. The low-enrichment fuel development program

    International Nuclear Information System (INIS)

    Stahl, D.

    1993-01-01

    In the 1950s and 1960s, low-power research reactors were built around the world utilized MTR-type fuel elements containing 20% enriched uranium. However, the demand for higher specific power created a need for greater uranium-235 concentrations. Early difficulties in increasing uranium content led to the substitution of highly enriched uranium in place of the 20% enriched fuel previously utilized. The highly enriched material also yielded other benefits including longer core residence time, higher specific reactivity, and somewhat lower cost. Highly enriched material then became readily available and was used for high-power reactors as well as in low-power reactors where 20% enriched material would have sufficed. The trend toward higher and higher specific power also led to the development of the dispersion-type fuels which utilized highly enriched uranium at a concentration of about 40 wt%. In the 1970's, however, concerns were raised about the proliferation resistance of fuels and fuel cycles. As a consequence, the U.S. Department of State has recently prohibited the foreign shipment of highly enriched material, except where prior contractual obligation or special merit exists. This will impact on the availability and utilization of highly enriched uranium for research and test reactor fuel. It has also stimulated development programs on fuels with higher uranium content which would allow the use of uranium of lower enrichment. The purpose of this report is to briefly describe the overall fuel-development program which is coordinated by Argonne National Laboratory for the Department of Energy, and to indicate the current and potential uranium loadings. Other reports will address the individual fuel-development activities in greater detail

  12. Simplified Enrichment of Plasma Membrane Proteins from Arabidopsis thaliana Seedlings Using Differential Centrifugation and Brij-58 Treatment.

    Science.gov (United States)

    Collins, Carina A; Leslie, Michelle E; Peck, Scott C; Heese, Antje

    2017-01-01

    The plasma membrane (PM) forms a barrier between a plant cell and its environment. Proteins at this subcellular location play diverse and complex roles, including perception of extracellular signals to coordinate cellular changes. Analyses of PM proteins, however, are often limited by the relatively low abundance of these proteins in the total cellular protein pool. Techniques traditionally used for enrichment of PM proteins are time consuming, tedious, and require extensive optimization. Here, we provide a simple and reproducible enrichment procedure for PM proteins from Arabidopsis thaliana seedlings starting from total microsomal membranes isolated by differential centrifugation. To enrich for PM proteins, total microsomes are treated with the nonionic detergent Brij-58 to decrease the abundance of contaminating organellar proteins. This protocol combined with the genetic resources available in Arabidopsis provides a powerful tool that will enhance our understanding of proteins at the PM.

  13. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  14. Two unusual hepatitis C virus subtypes, 2j and 2q, in Spain: Identification by nested-PCR and sequencing of a NS5B region.

    Science.gov (United States)

    Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P

    2015-10-01

    Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.

  15. Testing the applicability of the SASS5 scoring procedure for ...

    African Journals Online (AJOL)

    A study was undertaken between 29th January and 17th February 2004 to test the applicability of the South African Scoring System Version 5 (SASS5) scoring and calculation procedure in nutrient-enriched palustrine wetlands in the midlands of KwaZulu-Natal, South Africa. Four reference wetlands and three dairy-effluent ...

  16. MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

    Science.gov (United States)

    Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

    2016-05-01

    The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

  17. Directed PCR-free engineering of highly repetitive DNA sequences

    Directory of Open Access Journals (Sweden)

    Preissler Steffen

    2011-09-01

    Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.

  18. AEC determines uranium enrichment policy

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The Advisory Committee on Uranium Enrichment of the Atomic Energy Commission (AEC) has submitted a report to AEC chairman concerning the promotion of the introduction of advanced material, high performance centrifuges to replace conventional metallic drum centrifuges, and the development of next generation advanced centrifuges. The report also called for the postponement until around 1997 of the decision whether the development should be continued or not on atomic vapor laser isotope separation (AVLIS) and molecular laser isotope separation (MLIS) processes, as well as the virtual freezing of the construction of a chemical process demonstration plant. The report was approved by the AEC chairman in August. The uranium enrichment service market in the world will continue to be characterized by oversupply. The domestic situation of uranium enrichment supply-demand trend, progress of the expansion of Rokkasho enrichment plant, the trend in the development of gas centrifuge process and the basic philosophy of commercializing domestic uranium enrichment are reported. (K.I.)

  19. Gaseous diffusion -- the enrichment workhorse

    International Nuclear Information System (INIS)

    Shoemaker, J.E. Jr.

    1984-01-01

    Construction of the first large-scale gaseous diffusion facility was started as part of the Manhattan Project in Oak Ridge, Tennessee, in 1943. This facility, code named ''K-25,'' began operation in January 1945 and was fully on stream by September 1945. Four additional process buildings were later added in Oak Ridge as the demand for enriched uranium escalated. New gaseous diffusion plants were constructed at Paducah, Kentucky, and Portsmouth, Ohio, during this period. The three gaseous diffusion plants were the ''workhorses'' which provided the entire enriched uranium demand for the United States during the 1950s and 1960s. As the demand for enriched uranium for military purposes decreased during the early 1960s, power to the diffusion plants was curtailed to reduce production. During the 1960s, as plans for the nuclear power industry were formulated, the role of the diffusion plants gradually changed from providing highly-enriched uranium for the military to providing low-enriched uranium for power reactors

  20. Accurate episomal HIV 2-LTR circles quantification using optimized DNA isolation and droplet digital PCR.

    Science.gov (United States)

    Malatinkova, Eva; Kiselinova, Maja; Bonczkowski, Pawel; Trypsteen, Wim; Messiaen, Peter; Vermeire, Jolien; Verhasselt, Bruno; Vervisch, Karen; Vandekerckhove, Linos; De Spiegelaere, Ward

    2014-01-01

    In HIV-infected patients on combination antiretroviral therapy (cART), the detection of episomal HIV 2-LTR circles is a potential marker for ongoing viral replication. Quantification of 2-LTR circles is based on quantitative PCR or more recently on digital PCR assessment, but is hampered due to its low abundance. Sample pre-PCR processing is a critical step for 2-LTR circles quantification, which has not yet been sufficiently evaluated in patient derived samples. We compared two sample processing procedures to more accurately quantify 2-LTR circles using droplet digital PCR (ddPCR). Episomal HIV 2-LTR circles were either isolated by genomic DNA isolation or by a modified plasmid DNA isolation, to separate the small episomal circular DNA from chromosomal DNA. This was performed in a dilution series of HIV-infected cells and HIV-1 infected patient derived samples (n=59). Samples for the plasmid DNA isolation method were spiked with an internal control plasmid. Genomic DNA isolation enables robust 2-LTR circles quantification. However, in the lower ranges of detection, PCR inhibition caused by high genomic DNA load substantially limits the amount of sample input and this impacts sensitivity and accuracy. Moreover, total genomic DNA isolation resulted in a lower recovery of 2-LTR templates per isolate, further reducing its sensitivity. The modified plasmid DNA isolation with a spiked reference for normalization was more accurate in these low ranges compared to genomic DNA isolation. A linear correlation of both methods was observed in the dilution series (R2=0.974) and in the patient derived samples with 2-LTR numbers above 10 copies per million peripheral blood mononuclear cells (PBMCs), (R2=0.671). Furthermore, Bland-Altman analysis revealed an average agreement between the methods within the 27 samples in which 2-LTR circles were detectable with both methods (bias: 0.3875±1.2657 log10). 2-LTR circles quantification in HIV-infected patients proved to be more

  1. Enrichment of Geobacter species in response to stimulation of Fe(III) reduction in sandy aquifer sediments

    Science.gov (United States)

    Snoeyenbos-West, O.L.; Nevin, K.P.; Anderson, R.T.; Lovely, D.R.

    2000-01-01

    Engineered stimulation of Fe(III) has been proposed as a strategy to enhance the immobilization of radioactive and toxic metals in metal-contaminated subsurface environments. Therefore, laboratory and field studies were conducted to determine which microbial populations would respond to stimulation of Fe(III) reduction in the sediments of sandy aquifers. In laboratory studies, the addition of either various organic electron donors or electron shuttle compounds stimulated Fe(III) reduction and resulted in Geobacter sequences becoming important constituents of the Bacterial 16S rDNA sequences that could be detected with PCR amplification and denaturing gradient gel electrophoresis (DGGE). Quantification of Geobacteraceae sequences with a PCR most-probable-number technique indicated that the extent to which numbers of Geobacter increased was related to the degree of stimulation of Fe(III) reduction. Geothrix species were also enriched in some instances, but were orders of magnitude less numerous than Geobacter species. Shewanella species were not detected, even when organic compounds known to be electron donors for Shewanella species were used to stimulate Fe(III) reduction in the sediments. Geobacter species were also enriched in two field experiments in which Fe(III) reduction was stimulated with the addition of benzoate or aromatic hydrocarbons. The apparent growth of Geobacter species concurrent with increased Fe(III) reduction suggests that Geobacter species were responsible for much of the Fe(III) reduction in all of the stimulation approaches evaluated in three geographically distinct aquifers. Therefore, strategies for subsurface remediation that involve enhancing the activity of indigenous Fe(III)-reducing populations in aquifers should consider the physiological properties of Geobacter species in their treatment design.

  2. NetGen: a novel network-based probabilistic generative model for gene set functional enrichment analysis.

    Science.gov (United States)

    Sun, Duanchen; Liu, Yinliang; Zhang, Xiang-Sun; Wu, Ling-Yun

    2017-09-21

    High-throughput experimental techniques have been dramatically improved and widely applied in the past decades. However, biological interpretation of the high-throughput experimental results, such as differential expression gene sets derived from microarray or RNA-seq experiments, is still a challenging task. Gene Ontology (GO) is commonly used in the functional enrichment studies. The GO terms identified via current functional enrichment analysis tools often contain direct parent or descendant terms in the GO hierarchical structure. Highly redundant terms make users difficult to analyze the underlying biological processes. In this paper, a novel network-based probabilistic generative model, NetGen, was proposed to perform the functional enrichment analysis. An additional protein-protein interaction (PPI) network was explicitly used to assist the identification of significantly enriched GO terms. NetGen achieved a superior performance than the existing methods in the simulation studies. The effectiveness of NetGen was explored further on four real datasets. Notably, several GO terms which were not directly linked with the active gene list for each disease were identified. These terms were closely related to the corresponding diseases when accessed to the curated literatures. NetGen has been implemented in the R package CopTea publicly available at GitHub ( http://github.com/wulingyun/CopTea/ ). Our procedure leads to a more reasonable and interpretable result of the functional enrichment analysis. As a novel term combination-based functional enrichment analysis method, NetGen is complementary to current individual term-based methods, and can help to explore the underlying pathogenesis of complex diseases.

  3. Optimization of a Real Time PCR based method for the detection of Listeria monocytogenes in pork meat.

    Science.gov (United States)

    Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David

    2014-08-01

    The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Microbial community analysis of shallow subsurface samples with PCR-DGGE

    Energy Technology Data Exchange (ETDEWEB)

    Itaevaara, M.; Suihko, M. -L.; Kapanen, A.; Piskonen, R.; Juvonen, R. [VTT Biotechnology, Espoo (Finland)

    2005-11-15

    This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing

  5. Microbial community analysis of shallow subsurface samples with PCR-DGGE

    International Nuclear Information System (INIS)

    Itaevaara, M.; Suihko, M.-L.; Kapanen, A.; Piskonen, R.; Juvonen, R.

    2005-11-01

    This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing

  6. Survival in soil and detection of co-transformed Trichoderma harzianum by nested PCR Sobrevivência em solo e detecção de co-transformantes de Trichoderma harzianum por PCR "nested"

    Directory of Open Access Journals (Sweden)

    Paulo Roberto Queiroz

    2004-04-01

    Full Text Available The objective of this work was to evaluate the survival of two Trichoderma harzianum co-transformants, TE 10 and TE 41, carrying genes for green fluorescent protein (egfp and for resistance to benomyl, during four weeks in a contained soil microcosm. Selective culture media were used to detect viable fungal material, whose identity was confirmed by the observation of the fluorescent phenotype by direct epifluorence microscopy. PCR using two nested primer pairs specific to the egfp gene was also used to detect the transformed fungi. Although it was not possible to reliably detect the egfp gene directly from soil extracts, an enrichment step involving selective culture of soil samples in liquid medium prior to DNA extraction enabled the consistent detection of the T. harzianum co-transformants by nested PCR for the duration of the incubation period.O objetivo deste trabalho foi avaliar a sobrevivência de dois co-transformantes de Trichoderma harzianum, TE 10 e TE 41, expressando o gene da proteína de fluorescência verde (egfp e resistência a benomil, por um período de quatro semanas em microcosmo de solo, sob condições controladas. Foi utilizado um meio seletivo para detecção de material fúngico viável, o qual foi confirmado por observação quanto ao fenótipo de fluorescência em microscópio de epifluorescência direta. O fungo transformado foi detectado por PCR "nested", utilizando-se dois pares de primers específicos para o gene egfp. Foram utilizados meios líquidos enriquecidos no cultivo de amostras de solo, permitindo uma detecção consistente de co-transformantes de T. harzianum, uma vez que não foi possível a detecção do gene egfp por PCR de amostras de DNA extraídas diretamente de solo.

  7. Considering the post-1995 enrichment market

    International Nuclear Information System (INIS)

    Gunter, L.

    1994-01-01

    World demand for uranium enrichment services is likely to grow only a little over the next decade, from the current 28 million separative work units (SWU) per year to 33 MSWU per year. Much of the growth will come from Asia where nuclear generating capacity is still increasing. The current situation of the primary enrichment companies is summarized. The primary Western suppliers, Cogema, United States Enrichment Corporation and Urenco, are competing for increased market share in the USA, Europe and Asia as utilities purchase their post-1995 requirements. Entry of the Russian enrichment company, Tenex, into Western markets has been limited by trade restrictions. As a consequence of disarmament, blended weapons material has resulted in a surplus of low-enriched uranium. Together with over-capacity amongst the primary enrichers this has led to an expectation that reduced prices will be negotiable in the medium term. (3 figures). (UK)

  8. Present state of development of uranium enrichment

    International Nuclear Information System (INIS)

    1979-01-01

    The pilot plant for uranium enrichment started the operation on September 12, 1979. The pilot plant has been constructed by the Power Reactor and Nuclear Fuel Development Corp. in Ningyo Pass, Okayama Prefecture. 7000 centrifugal separators will be installed by mid 1981, and yearly production of 70 t SWU is expected. The Uranium Enrichment Committee of Japan Atomic Industrial Forum has made the proposal on the method of forwarding the development of uranium enrichment in Japan to Atomic Energy Commission and related government offices in December, 1978. This survey summarized the trends of uranium enrichment in Japan and foreign countries and the problems about nuclear non-proliferation, and provides with the reference materials. The demand and supply of uranium enrichment in the world, the present states and plans in USA, Europe, USSR and others, the demand and supply of uranium enrichment and the measures for securing it in Japan, the present state and future plan of uranium enrichment project in Japan, the international regulation of uranium enrichment, the recent policy of USA and INFCE, and the trend of the regulation of utilizing enriched uranium are described. Moreover, the concept of separation works in uranium enrichment and the various technologies of separation are explained. (Kako, I.)

  9. Environmental enrichment for neotropical primates in captivity Enriquecimento ambiental para primatas neotropicais em cativeiro

    Directory of Open Access Journals (Sweden)

    Vanner Boere

    2001-06-01

    Full Text Available Captivity is an extreme non-natural environment for primates. The success of a breeding colony depends of management and veterinarian procedures which must rely on the knowledge of primates' behavioral needs. Environmental enrichment consists of a series of procedures that improve the quality of life of captive animals by meeting their ethological needs. Enrichment can reduce stress, while increasing animal well being in captivity. Suitable ethical conditions, incidences of behavioral disorders, minimal clinical interventions, low mortality, higher reproduction rates and cost/benefit relationship, reflect directly on the quality of captive breeding colonies. Anthropoids like Neotropical primates possess complex neural structures and relate, in a sophisticated manner, to the environment. This review reports important experiences on enrichment procedures for Neotropical primates and the physiological events which could explain improvement of animal well-being.Cativeiro é um ambiente de extremos não naturais para primatas. O sucesso de uma criação de primatas depende do manejo e de procedimentos veterinários que devem considerar as necessidades etológicas dos animais cativos. Enriquecimento ambiental é um conjunto de técnicas que modificam o ambiente, resultando em uma melhora na qualidade de vida dos animais, ao satisfazer as suas necessidades comportamentais. O enriquecimento pode diminuir o estresse e melhorar o bem-estar. Primatas neotropicais se caracterizam por complexas estruturas neurais e se relacionam de maneira sofisticada com o ambiente. O enriquecimento ambiental pode aumentar a qualidade de uma criação ao adequar o manejo a padrões éticos aceitáveis, estimular o repertório normal do comportamento, diminuir a casuística clínica, diminuir a mortalidade, incrementar a taxa reprodutiva e maximizar a relação custo/benefício em uma criação. Esta revisão relata experiências relevantes nos procedimentos de

  10. Uranium hexafluoride: handling procedures and container criteria

    International Nuclear Information System (INIS)

    1977-04-01

    The U.S. Energy Research and Development Administration's (ERDA) procedures for packaging, measuring, and transferring uranium hexafluoride (UF 6 ) have been undergoing continual review and revision for several years to keep them in phase with developing agreements for the supply of enriched uranium. This report, first issued in 1966, was reissued in 1967 to make editorial changes and to provide for minor revisions in procedural information. In 1968 and 1972, Revisions 2 and 3, respectively, were issued as part of the continuing effort to present updated information. This document, Revision 4, includes primarily revisions to UF 6 cylinders, valves, and methods of use. This revision supersedes all previous issues of this report. The procedures will normally apply in all transactions involving receipt or shipment of UF 6 by ERDA, unless stipulated otherwise by contracts or agreements with ERDA or by notices published in the Federal Register

  11. Real-time PCR in virology

    OpenAIRE

    Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

    2002-01-01

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

  12. Inoculation stress hypothesis of environmental enrichment.

    Science.gov (United States)

    Crofton, Elizabeth J; Zhang, Yafang; Green, Thomas A

    2015-02-01

    One hallmark of psychiatric conditions is the vast continuum of individual differences in susceptibility vs. resilience resulting from the interaction of genetic and environmental factors. The environmental enrichment paradigm is an animal model that is useful for studying a range of psychiatric conditions, including protective phenotypes in addiction and depression models. The major question is how environmental enrichment, a non-drug and non-surgical manipulation, can produce such robust individual differences in such a wide range of behaviors. This paper draws from a variety of published sources to outline a coherent hypothesis of inoculation stress as a factor producing the protective enrichment phenotypes. The basic tenet suggests that chronic mild stress from living in a complex environment and interacting non-aggressively with conspecifics can inoculate enriched rats against subsequent stressors and/or drugs of abuse. This paper reviews the enrichment phenotypes, mulls the fundamental nature of environmental enrichment vs. isolation, discusses the most appropriate control for environmental enrichment, and challenges the idea that cortisol/corticosterone equals stress. The intent of the inoculation stress hypothesis of environmental enrichment is to provide a scaffold with which to build testable hypotheses for the elucidation of the molecular mechanisms underlying these protective phenotypes and thus provide new therapeutic targets to treat psychiatric/neurological conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  14. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  15. Monitoring the Various Types of Clostridium botulinumin in Four Kinds of Food Stuffs Using Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mohammad Vahid Sadeghi Sarvestani

    2014-03-01

    Full Text Available Background &Objective: Food poisoning (FP caused by C. botulinum is the most serious feature of FP inpeople consuming the contaminated foodstuffs (Canned meat, vegetarian foods, dairy products and seafood products. Botulism is basically detected by the identification of live bacteria and/or its toxins. Among various types of microorganisms (i.e. A, B, C1, C2, D, E, F, serotypes A, B, E and F are considered as the main human pathogens. The present study was aimed at investigating the possible roles of various foodstuffs to induce the food intoxication and also to compare the culture and molecular assays for identifying the microorganism.Materials &Methods: Three Lab techniques including biochemical, culture (enriched in TPGY and cooked meat medium and MPCR were used to detect C. botulinum in the samples. As the molecular based techniques have recently employed for the rapid and reliable identification of the bacteria and its toxins, the PCR assay, using three pairs of primers were designed and optimized to identify A, B and E strains in the contaminated specimens. The PCR was able to amplify 782, 205 and 389 bp genes specified for A, B and E types of the bacteria, respectively. Results: Total number of 290 specimens including fish, honey,"kashk"and"Dough" were tested, in which 5%, 4%, 2.5% and 1.25%, were found positive, respectively. Using selective culture of the specimens on the enriched samples, it was shown that just four samples were found positive.Conclusion: As a final conclusion, the molecular based techniques are recommended as a reliable tool to detect C. botulinum and, its toxins and spores in foodstuffs. Moreover, it is strongly advised to use it in food microbial Lab and also the epidemiological surveys.

  16. Carbonate ion-enriched hot spring water promotes skin wound healing in nude rats.

    Directory of Open Access Journals (Sweden)

    Jingyan Liang

    Full Text Available Hot spring or hot spa bathing (Onsen is a traditional therapy for the treatment of certain ailments. There is a common belief that hot spring bathing has therapeutic effects for wound healing, yet the underlying molecular mechanisms remain unclear. To examine this hypothesis, we investigated the effects of Nagano hot spring water (rich in carbonate ion, 42°C on the healing process of the skin using a nude rat skin wound model. We found that hot spring bathing led to an enhanced healing speed compared to both the unbathed and hot-water (42°C control groups. Histologically, the hot spring water group showed increased vessel density and reduced inflammatory cells in the granulation tissue of the wound area. Real-time RT-PCR analysis along with zymography revealed that the wound area of the hot spring water group exhibited a higher expression of matrix metalloproteinases-2 and -9 compared to the two other control groups. Furthermore, we found that the enhanced wound healing process induced by the carbonate ion-enriched hot spring water was mediated by thermal insulation and moisture maintenance. Our results provide the evidence that carbonate ion-enriched hot spring water is beneficial for the treatment of skin wounds.

  17. PCR-based methods for identification of potentially zoonotic ascaridoid parasites of the dog, fox and cat.

    Science.gov (United States)

    Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B

    1997-11-01

    Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.

  18. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas

    2010-04-23

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  19. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Gong, Xiuqing; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yi, Xin

    2010-01-01

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  20. TiO{sub 2}-enriched polymeric powder coatings support human mesenchymal cell spreading and osteogenic differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Mozumder, Mohammad Sayem; Zhu, Jesse [Department of Chemical and Biochemical Engineering, University of Western Ontario, London, Ontario, N6A 5B9 (Canada); Perinpanayagam, Hiran, E-mail: Hiran.Perinpanayagam@schulich.uwo.ca [Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, N6A 5C1 (Canada)

    2011-06-15

    Novel polymeric powder coatings (PPC) were prepared by ultrafine powder coating technology and shown to support human mesenchymal cell attachment and growth. PPC surfaces enriched with nano-TiO{sub 2} (nTiO{sub 2}) showed enhanced cellular responses, and were compared to commercially pure titanium (cpTi). After cell attachment and growth, osteogenic differentiation and bone matrix formation ensures osseointegration for implantable biomaterials. Therefore, the objective of this study was to determine if mesenchymal cells grown on PPC could undergo osteogenic differentiation by inducing Runx2 and bone matrix proteins, and then initiate mineralization. Atomic force microscopy revealed intricate three-dimensional micro-topographies, and the measures of nano-roughness and porosity were similar for all PPC surfaces. Scanning electron microscopy showed that the cells attached and spread out over all of the surfaces. After 1 week in osteogenic media, RT-PCR analysis showed the induction of Runx2, the up-regulation of type I collagen, and the initial detection of alkaline phosphatase and bone sialoprotein. After 4 weeks, Alizarin Red staining showed mineral deposition. However, cell spreading and osteogenic differentiation were significantly (P < 0.05) higher on the cpTi controls than on the PPC surfaces. Furthermore, spreading and differentiation were consistently higher on the titanium-enriched PPC-2, -3 and -4 than on the titanium-free PPC-1. Therefore, despite the presence of complex micro-topographies and nano-features, titanium-enrichment enhanced the cellular response, and pure titanium still provided the best substrate. These findings confirm the cytocompatibility of these novel polymeric coatings and suggest that titanium-enrichment and nTiO{sub 2} additives may enhance their performance.

  1. Noble gas enrichment studies at JET

    International Nuclear Information System (INIS)

    Groth, M.; Andrew, P.; Fundamenski, W.; Guo, H.Y.; Hillis, D.L.; Hogan, J.T.; Horton, L.D.; Matthews, G.F.; Meigs, A.G.; Morgan, P.M.; Stamp, M.F.; Hellermann, M. von

    2001-01-01

    Adequate helium exhaust has been achieved in reactor-relevant ELMy H-mode plasmas in JET performed in the MKII AP and MKII GB divertor geometry. The divertor-characteristic quantities of noble gas compression and enrichment have been experimentally inferred from Charge Exchange Recombination Spectroscopy measurements in the core plasma, and from spectroscopic analysis of a Penning gauge discharge in the exhaust gas. The retention of helium was found to be satisfactory for a next-step device, with enrichment factors exceeding 0.1. The helium enrichment decreases with increasing core plasma density, while the neon enrichment has the opposite behaviour. Analytic and numerical analyses of these plasmas using the divertor impurity code package DIVIMP/NIMBUS support the explanation that the enrichment of noble gases depends significantly on the penetration depth of the impurity neutrals with respect to the fuel atoms. Changes of the divertor plasma configuration and divertor geometry have no effect on the enrichment

  2. Simplified PCR protocols for INNO-LiPA HBV Genotyping and INNO-LiPA HBV PreCore assays

    NARCIS (Netherlands)

    Qutub, Mohammed O.; Germer, Jeffrey J.; Rebers, Sjoerd P. H.; Mandrekar, Jayawant N.; Beld, Marcel G. H. M.; Yao, Joseph D. C.

    2006-01-01

    INNO-LiPA HBV Genotyping (LiPA HBV GT) and INNO-LiPA HBV PreCore (LiPA HBV PC) are commercially available assays for hepatitis B virus (HBV) characterization. These assays are labor-intensive and may be prone to exogenous DNA contamination due to their use of nested PCR amplification procedures and

  3. 31 CFR 540.316 - Uranium enrichment.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Uranium enrichment. 540.316 Section 540.316 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... REGULATIONS General Definitions § 540.316 Uranium enrichment. The term uranium enrichment means the process of...

  4. Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

    Science.gov (United States)

    Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

    2016-02-01

    Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Determination of D2O - 2% enriched uranium lattice parameters by means of a critical system

    International Nuclear Information System (INIS)

    Raisic, N.; Takac, S.; Markovic, H.; Bosevski, T.

    1963-01-01

    In order to specify experimental procedures for few standard measurements sufficient to provide consistent set of lattice parameters, a series of experiments were performed at the RB reactor using 2% enriched tubular fuel elements. Obtained results were compared to standard two-group diffusion calculation indicating high degree of accuracy for a broad variety of reactor lattice configurations

  6. Anaerobic Oxidization of Methane in a Minerotrophic Peatland: Enrichment of Nitrite-Dependent Methane-Oxidizing Bacteria

    Science.gov (United States)

    Zhu, Baoli; van Dijk, Gijs; Fritz, Christian; Smolders, Alfons J. P.; Pol, Arjan; Jetten, Mike S. M.

    2012-01-01

    The importance of anaerobic oxidation of methane (AOM) as a methane sink in freshwater systems is largely unexplored, particularly in peat ecosystems. Nitrite-dependent anaerobic methane oxidation (n-damo) was recently discovered and reported to be catalyzed by the bacterium “Candidatus Methylomirabilis oxyfera,” which is affiliated with the NC10 phylum. So far, several “Ca. Methylomirabilis oxyfera” enrichment cultures have been obtained using a limited number of freshwater sediments or wastewater treatment sludge as the inoculum. In this study, using stable isotope measurements and porewater profiles, we investigated the potential of n-damo in a minerotrophic peatland in the south of the Netherlands that is infiltrated by nitrate-rich ground water. Methane and nitrate profiles suggested that all methane produced was oxidized before reaching the oxic layer, and NC10 bacteria could be active in the transition zone where countergradients of methane and nitrate occur. Quantitative PCR showed high NC10 bacterial cell numbers at this methane-nitrate transition zone. This soil section was used to enrich the prevalent NC10 bacteria in a continuous culture supplied with methane and nitrite at an in situ pH of 6.2. An enrichment of nitrite-reducing methanotrophic NC10 bacteria was successfully obtained. Phylogenetic analysis of retrieved 16S rRNA and pmoA genes showed that the enriched bacteria were very similar to the ones found in situ and constituted a new branch of NC10 bacteria with an identity of less than 96 and 90% to the 16S rRNA and pmoA genes of “Ca. Methylomirabilis oxyfera,” respectively. The results of this study expand our knowledge of the diversity and distribution of NC10 bacteria in the environment and highlight their potential contribution to nitrogen and methane cycles. PMID:23042166

  7. A simplified and cost-effective enrichment protocol for the isolation of Campylobacter spp. from retail broiler meat without microaerobic incubation

    LENUS (Irish Health Repository)

    Zhou, Ping

    2011-08-03

    Abstract Background To simplify the methodology for the isolation of Campylobacter spp. from retail broiler meat, we evaluated 108 samples (breasts and thighs) using an unpaired sample design. The enrichment broths were incubated under aerobic conditions (subsamples A) and for comparison under microaerobic conditions (subsamples M) as recommended by current reference protocols. Sensors were used to measure the dissolved oxygen (DO) in the broth and the percentage of oxygen (O2) in the head space of the bags used for enrichment. Campylobacter isolates were identified with multiplex PCR assays and typed using pulsed-field gel electrophoresis (PFGE). Ribosomal intergenic spacer analyses (RISA) and denaturing gradient gel electrophoresis (DGGE) were used to study the bacterial communities of subsamples M and A after 48 h enrichment. Results The number of Campylobacter positive subsamples were similar for A and M when all samples were combined (P = 0.81) and when samples were analyzed by product (breast: P = 0.75; thigh: P = 1.00). Oxygen sensors showed that DO values in the broth were around 6 ppm and O2 values in the head space were 14-16% throughout incubation. PFGE demonstrated high genomic similarity of isolates in the majority of the samples in which isolates were obtained from subsamples A and M. RISA and DGGE results showed a large variability in the bacterial populations that could be attributed to sample-to-sample variations and not enrichment conditions (aerobic or microaerobic). These data also suggested that current sampling protocols are not optimized to determine the true number of Campylobacter positive samples in retail boiler meat. Conclusions Decreased DO in enrichment broths is naturally achieved. This simplified, cost-effective enrichment protocol with aerobic incubation could be incorporated into reference methods for the isolation of Campylobacter spp. from retail broiler meat.

  8. Comparison of simultaneous splenic sample PCR with blood sample PCR for diagnosis and treatment of experimental Ehrlichia canis infection.

    Science.gov (United States)

    Harrus, Shimon; Kenny, Martin; Miara, Limor; Aizenberg, Itzhak; Waner, Trevor; Shaw, Susan

    2004-11-01

    This report presents evidence that dogs recover from acute canine monocytic ehrlichiosis (CME) after 16 days of doxycycline treatment (10 mg/kg of body weight every 24 h). Blood PCR was as valuable as splenic aspirate PCR for early diagnosis of acute CME. Splenic aspirate PCR was, however, superior to blood PCR for the evaluation of ehrlichial elimination.

  9. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Microbiological Methods (NordVal) in comparative and collaborative trials, and was approved for detection of Campylobacter in chicken neck skin, cloacal swab and boot swab samples. A comparison study on probe chemistries for real-time PCR was performed on locked nucleic acid (LNA), minor groove binder (MGB...... of the optimization strategy were observed from increasing 1) the sampling volume from the pre-enrichment, 2) the paramagnetic particles applied in the DNA extraction procedure, and 3) the amount of DNA template in the PCR. This method was subsequently validated according to the recommendations of NordVal...

  10. Digital PCR: A brief history

    OpenAIRE

    Morley, Alexander A.

    2014-01-01

    Digital PCR for quantification of a target of interest has been independently developed several times, being described in 1990 and 1991 using the term “limiting dilution PCR” and in 1999 using the term “digital PCR”. It came into use in the decade following its first development but its use was cut short by the description of real-time PCR in 1996. However digital PCR has now had a renaissance due to the recent development of new instruments and chemistry which have made it a much simpler and...

  11. Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.

    Science.gov (United States)

    Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P

    2003-08-01

    The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.

  12. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas

    2010-05-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  13. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian

    2010-01-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  14. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Zhiyuan Wu

    2014-01-01

    Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.

  15. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Science.gov (United States)

    Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

    2014-01-01

    A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

  16. Evaluation of gamma-sterilization ({sup 60}Co) by RT-PCR by DHFR expression detection

    Energy Technology Data Exchange (ETDEWEB)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil)]. E-mail: anapaulagconverso@gmail.com; hfandrad@usp.br; Vieira, Daniel P. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: dperezv@usp.br

    2007-07-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a {sup 60}Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  17. The Resistome of Farmed Fish Feces Contributes to the Enrichment of Antibiotic Resistance Genes in Sediments below Baltic Sea Fish Farms.

    Science.gov (United States)

    Muziasari, Windi I; Pitkänen, Leena K; Sørum, Henning; Stedtfeld, Robert D; Tiedje, James M; Virta, Marko

    2016-01-01

    Our previous studies showed that particular antibiotic resistance genes (ARGs) were enriched locally in sediments below fish farms in the Northern Baltic Sea, Finland, even when the selection pressure from antibiotics was negligible. We assumed that a constant influx of farmed fish feces could be the plausible source of the ARGs enriched in the farm sediments. In the present study, we analyzed the composition of the antibiotic resistome from the intestinal contents of 20 fish from the Baltic Sea farms. We used a high-throughput method, WaferGen qPCR array with 364 primer sets to detect and quantify ARGs, mobile genetic elements (MGE), and the 16S rRNA gene. Despite a considerably wide selection of qPCR primer sets, only 28 genes were detected in the intestinal contents. The detected genes were ARGs encoding resistance to sulfonamide ( sul1 ), trimethoprim ( dfrA1 ), tetracycline [ tet(32), tetM, tetO, tetW ], aminoglycoside ( aadA1, aadA2 ), chloramphenicol ( catA1 ), and efflux-pumps resistance genes ( emrB, matA, mefA, msrA ). The detected genes also included class 1 integron-associated genes ( intI1, qacE Δ 1 ) and transposases ( tnpA ). Importantly, most of the detected genes were the same genes enriched in the farm sediments. This preliminary study suggests that feces from farmed fish contribute to the ARG enrichment in farm sediments despite the lack of contemporaneous antibiotic treatments at the farms. We observed that the intestinal contents of individual farmed fish had their own resistome compositions. Our result also showed that the total relative abundances of transposases and tet genes were significantly correlated ( p = 0.001, R 2 = 0.71). In addition, we analyzed the mucosal skin and gill filament resistomes of the farmed fish but only one multidrug-efflux resistance gene ( emrB ) was detected. To our knowledge, this is the first study reporting the resistome of farmed fish using a culture-independent method. Determining the possible sources of

  18. Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

    Science.gov (United States)

    Ye, Y W; Ling, N; Han, Y J; Wu, Q P

    2014-11-01

    Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Screening for group B Streptococcus (GBS) at labour onset using PCR: accuracy and potential impact - a pilot study.

    Science.gov (United States)

    Ramesh Babu, Sandhya; McDermott, Rachel; Farooq, Irum; Le Blanc, David; Ferguson, Wendy; McCallion, Naomi; Drew, Richard; Eogan, Maeve

    2018-01-01

    This pilot study assessed the diagnostic accuracy and potential impact of a rapid PCR-based screening test for the detection of group B Streptococcus (GBS) at the onset of labour for the purpose of optimising intrapartum antibiotic prophylaxis (IAP). Vaginal and rectal swabs from a convenience sample of 158 women were analysed by conventional broth-enriched culture and a rapid PCR test. Overall, GBS carriage was 18.98% by culture and 19.62% by PCR. PCR for the detection of GBS had a sensitivity of 93.1%, specificity of 96.67% and area under the curve (AUC) of 0.95. Only 19.3% GBS-positive women received IAP. Three-fourths of babies born to GBS-positive mothers did not receive surveillance for early-onset GBS disease. Of the women who received IAP, only 32.5% were GBS carriers. Seventy-four percent of the GBS-positive mothers delivered more than 5 h after recruitment, which gives adequate swab to delivery interval for appropriate antibiotic prophylaxis in labour. Impact statement What is already known about this subject: Appropriate intra-partum treatment of colonized mothers reduces the risk of GBS transmission to neonates. Universal ante partum screening of pregnant women or IAP based on risk factors in labour for GBS prevention fail to accurately identify and treat the woman who actually harbors GBS in the birth canal in labour. A PCR based rapid test, allows for real-time assessment of GBS carriage in labour. This study highlights the fact that a large number of GBS carriers in labour, who could potentially infect their babies, do not receive IAP, and most of their babies do not receive added surveillance in the neonatal period for EOGBS disease. It also confirms that PCR testing at onset of labour is a highly sensitive and reliable test that identifies the women who are GBS carriers in labour and hence need IAP. What the implications are of these findings for clinical practice and/or further research: Timely provision of IAP for the appropriate woman is

  20. Microbial Community Response of an Organohalide Respiring Enrichment Culture to Permanganate Oxidation.

    Science.gov (United States)

    Sutton, Nora B; Atashgahi, Siavash; Saccenti, Edoardo; Grotenhuis, Tim; Smidt, Hauke; Rijnaarts, Huub H M

    2015-01-01

    While in situ chemical oxidation is often used to remediate tetrachloroethene (PCE) contaminated locations, very little is known about its influence on microbial composition and organohalide respiration (OHR) activity. Here, we investigate the impact of oxidation with permanganate on OHR rates, the abundance of organohalide respiring bacteria (OHRB) and reductive dehalogenase (rdh) genes using quantitative PCR, and microbial community composition through sequencing of 16S rRNA genes. A PCE degrading enrichment was repeatedly treated with low (25 μmol), medium (50 μmol), or high (100 μmol) permanganate doses, or no oxidant treatment (biotic control). Low and medium treatments led to higher OHR rates and enrichment of several OHRB and rdh genes, as compared to the biotic control. Improved degradation rates can be attributed to enrichment of (1) OHRB able to also utilize Mn oxides as a terminal electron acceptor and (2) non-dechlorinating community members of the Clostridiales and Deltaproteobacteria possibly supporting OHRB by providing essential co-factors. In contrast, high permanganate treatment disrupted dechlorination beyond cis-dichloroethene and caused at least a 2-4 orders of magnitude reduction in the abundance of all measured OHRB and rdh genes, as compared to the biotic control. High permanganate treatments resulted in a notably divergent microbial community, with increased abundances of organisms affiliated with Campylobacterales and Oceanospirillales capable of dissimilatory Mn reduction, and decreased abundance of presumed supporters of OHRB. Although OTUs classified within the OHR-supportive order Clostridiales and OHRB increased in abundance over the course of 213 days following the final 100 μmol permanganate treatment, only limited regeneration of PCE dechlorination was observed in one of three microcosms, suggesting strong chemical oxidation treatments can irreversibly disrupt OHR. Overall, this detailed investigation into dose

  1. The reduced enrichment program for JRR-4

    International Nuclear Information System (INIS)

    Takayanagi, M.

    1992-01-01

    Japan Research Reactor No. 4(JRR-4) with the rated power of 3.5 MW, swimming pool type research reactor, 93 % enriched uranium ETR-type fuel used, light water moderated and cooled. The first criticality reached on 28th January, 1965. The reactor has operated for about 26 years. However, it was planed to the reduced enrichment of the fuels to low enrichment according to the International Reduced Enrichment for Research and Test Reactors (RERTR) program. This paper describes the program for conversion of the enrichment of fuel from 93 % to less than 20 %. (author)

  2. Quantification of Campylobacter spp. in chicken rinse samples by using flotation prior to real-time PCR.

    Science.gov (United States)

    Wolffs, Petra; Norling, Börje; Hoorfar, Jeffrey; Griffiths, Mansel; Rådström, Peter

    2005-10-01

    Real-time PCR is fast, sensitive, specific, and can deliver quantitative data; however, two disadvantages are that this technology is sensitive to inhibition by food and that it does not distinguish between DNA originating from viable, viable nonculturable (VNC), and dead cells. For this reason, real-time PCR has been combined with a novel discontinuous buoyant density gradient method, called flotation, in order to allow detection of only viable and VNC cells of thermotolerant campylobacters in chicken rinse samples. Studying the buoyant densities of different Campylobacter spp. showed that densities changed at different time points during growth; however, all varied between 1.065 and 1.109 g/ml. These data were then used to develop a flotation assay. Results showed that after flotation and real-time PCR, cell concentrations as low as 8.6 x 10(2) CFU/ml could be detected without culture enrichment and amounts as low as 2.6 x 10(3) CFU/ml could be quantified. Furthermore, subjecting viable cells and dead cells to flotation showed that viable cells were recovered after flotation treatment but that dead cells and/or their DNA was not detected. Also, when samples containing VNC cells mixed with dead cells were treated with flotation after storage at 4 or 20 degrees C for 21 days, a similar percentage resembling the VNC cell fraction was detected using real-time PCR and 5-cyano-2,3-ditolyl tetrazolium chloride-4',6'-diamidino-2-phenylindole staining (20% +/- 9% and 23% +/- 4%, respectively, at 4 degrees C; 11% +/- 4% and 10% +/- 2%, respectively, at 20 degrees C). This indicated that viable and VNC Campylobacter cells could be positively selected and quantified using the flotation method.

  3. Accurate quantification of supercoiled DNA by digital PCR

    Science.gov (United States)

    Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul

    2016-01-01

    Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649

  4. Competing for the non-US enrichment markets

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    The article discusses three basic steps: first, the historical perspectives; second, where the enrichment industry and the non-US markets for enrichment stand today (the present situation); and third, the likely future developments, which, for practical purposes, are dealt with in two parts: the non-US enrichment markets in the 1980s; and the non-US enrichment markets beyond the 1980s;

  5. Enriched uranium sales: effect on supply industry

    International Nuclear Information System (INIS)

    Andersen, R.K.

    1985-01-01

    The subject is covered in sections: introduction (combined effect of low-enriched uranium (LEU) inventory sales and utility services enrichment contract terms); enrichment market overview; enrichment market dynamics; the reaction of the US Department of Energy; elimination of artificial demand; draw down of inventories; purchase and sale of LEU inventories; tails assay option; unfulfilled requirements for U 3 O 8 ; conclusions. (U.K.)

  6. Research to Improve the Efficiency of Double Stereo PCR Microfluidic Chip by Passivating the Inner Surface of Steel Capillary with NOA61.

    Science.gov (United States)

    Wu, Jian; Guo, Wei; Wang, Chunyan; Yu, Kuanxin; Ma, Ying; Chen, Tao; Li, Yinghui

    2015-06-01

    In this paper, we report the improvement of PCR microfluidic chip efficiency achieved by coating the inner surface of steel capillary microchannel with a 22-µm film of the ultraviolet-solidified NOA61 using a device invented by us. Our results indicate that with this treatment, the roughness of the inside wall of steel capillary was improved from Ra = 0.921 to Ra = 0.254. The contact angle was decreased from about 95° to 56°, and the surface hydrophobicity was also increased. The flow pressure for performing the real-time PCR in the microfluidic chip with modified surface was reduced by twofold (2.11/1) and that resulted in a substantially increased efficiency of PCR. A modification of the microchannel interior surface improved the quality of the on-chip integrated PCR procedure.

  7. Stable isotope enrichment: Current and future potential

    International Nuclear Information System (INIS)

    Tracy, J.G.; Aaron, W.S.

    1992-01-01

    Oak Ridge National Laboratory (ORNL) operates the Isotope Enrichment Facility for the purpose of providing enriched stable isotopes, selected radioactive isotopes (including the actinides), and isotope-related materials and services for use in various research applications. ORNL is responsible for isotope enrichment and the distribution of approximately 225 nongaseous stable isotopes from 50 multi-isotopic elements. Many enriched isotope products are of prime importance in the fabrication of nuclear targets and the subsequent production of special radionuclides. State-of-the-art techniques to achieve special isotopic, chemical, and physical requirements are performed at ORNL This report describes the status and capabilities of the Isotope Enrichment Facility and the Isotope Research Materials Laboratory as well as emphasizing potential advancements in enrichment capabilities

  8. Stable isotope enrichment - current and future potential

    International Nuclear Information System (INIS)

    Tracy, J.G.; Aaron, W.S.

    1993-01-01

    Oak Ridge National Laboratory (ORNL) operates the Isotope Enrichment Facility for the purpose of providing enriched stable isotopes, selected radioactive isotopes (including the actinides), and isotope-related materials and services for use in various research applications. ORNL is responsible for isotope enrichment and the distribution of approximately 225 nongaseous stable isotopes from 50 multi-isotopic elements. Many enriched isotope products are of prime importance in the fabrication of nuclear targets and the subsequent production of special radionuclides. State-of-the-art techniques to achieve special isotopic, chemical, and physical requirements are performed at ORNL. This report describes the status and capabilities of the Isotope Enrichment Facility and the Isotope Research Materials Laboratory as well as emphasizing potential advancements in enrichment capabilities. (orig.)

  9. Comparison of ELISA, nested PCR and sequencing and a novel qPCR for detection of Giardia isolates from Jordan.

    Science.gov (United States)

    Hijjawi, Nawal; Yang, Rongchang; Hatmal, Ma'mon; Yassin, Yasmeen; Mharib, Taghrid; Mukbel, Rami; Mahmoud, Sameer Alhaj; Al-Shudifat, Abdel-Ellah; Ryan, Una

    2018-02-01

    Little is known about the prevalence of Giardia duodenalis in human patients in Jordan and all previous studies have used direct microscopy, which lacks sensitivity. The present study developed a novel quantitative PCR (qPCR) assay at the β-giardin (bg) locus and evaluated its use as a frontline test for the diagnosis of giardiasis in comparison with a commercially available ELISA using nested PCR and sequencing of the glutamate dehydrogenase (gdh) locus (gdh nPCR) as the gold standard. A total of 96 human faecal samples were collected from 96 patients suffering from diarrhoea from 5 regions of Jordan and were screened using the ELISA and qPCR. The analytical specificity of the bg qPCR assay revealed no cross-reactions with other genera and detected all the Giardia isolates tested. Analytical sensitivity was 1 Giardia cyst per μl of DNA extract. The overall prevalence of Giardia was 64.6%. The clinical sensitivity and specificity of the bg qPCR was 89.9% and 82.9% respectively compared to 76.5 and 68.0% for the ELISA. This study is the first to compare three different methods (ELISA, bg qPCR, nested PCR and sequencing at the gdh locus) to diagnose Jordanian patients suffering from giardiasis and to analyze their demographic data. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  11. U.S. forms uranium enrichment corporation

    International Nuclear Information System (INIS)

    Seltzer, R.

    1993-01-01

    After almost 40 years of operation, the federal government is withdrawing from the uranium enrichment business. On July 1, the Department of Energy turned over to a new government-owned entity--the US Enrichment Corp. (USEC)--both the DOE enrichment plants at Paducah, Ky., and Portsmouth, Ohio, and domestic and international marketing of enriched uranium from them. Pushed by the inability of DOE's enrichment operations to meet foreign competition, Congress established USEC under the National Energy Policy Act of 1992, envisioning the new corporation as the first step to full privatization. With gross revenues of $1.5 billion in fiscal 1992, USEC would rank 275th on the Fortune 500 list of top US companies. USEC will lease from DOE the Paducah and Portsmouth facilities, built in the early 1950s, which use the gaseous diffusion process for uranium enrichment. USEC's stock is held by the US Treasury, to which it will pay annual dividends. Martin Marietta Energy Systems, which has operated Paducah since 1984 and Portsmouth since 1986 for DOE, will continue to operate both plants for USEC. Closing one of the two facilities will be studied, especially in light of a 40% world surplus of capacity over demand. USEC also will consider other nuclear-fuel-related ventures. USEC will produce only low-enriched uranium, not weapons-grade material. Indeed, USEC will implement a contract now being completed under which the US will purchase weapons-grade uranium from dismantled Russian nuclear weapons and convert it into low-enriched uranium for power reactor fuel

  12. Marine sediment sample pre-processing for macroinvertebrates metabarcoding: mechanical enrichment and homogenization

    Directory of Open Access Journals (Sweden)

    Eva Aylagas

    2016-10-01

    Full Text Available Metabarcoding is an accurate and cost-effective technique that allows for simultaneous taxonomic identification of multiple environmental samples. Application of this technique to marine benthic macroinvertebrate biodiversity assessment for biomonitoring purposes requires standardization of laboratory and data analysis procedures. In this context, protocols for creation and sequencing of amplicon libraries and their related bioinformatics analysis have been recently published. However, a standardized protocol describing all previous steps (i.e. processing and manipulation of environmental samples for macroinvertebrate community characterization is lacking. Here, we provide detailed procedures for benthic environmental sample collection, processing, enrichment for macroinvertebrates, homogenization, and subsequent DNA extraction for metabarcoding analysis. Since this is the first protocol of this kind, it should be of use to any researcher in this field, having the potential for improvement.

  13. Uranium Conversion & Enrichment

    Energy Technology Data Exchange (ETDEWEB)

    Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-02-06

    The isotopes of uranium that are found in nature, and hence in ‘fresh’ Yellowcake’, are not in relative proportions that are suitable for power or weapons applications. The goal of conversion then is to transform the U3O8 yellowcake into UF6. Conversion and enrichment of uranium is usually required to obtain material with enough 235U to be usable as fuel in a reactor or weapon. The cost, size, and complexity of practical conversion and enrichment facilities aid in nonproliferation by design.

  14. Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance.

    Science.gov (United States)

    Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; Ep Mundhofir, Farmaditya; Mh Faradz, Sultana; Hisatome, Ichiro

    2017-03-01

    High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100-400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1 .

  15. [E-MTAB-587] PCR_artifacts

    NARCIS (Netherlands)

    Muino Acuna, J.M.

    2011-01-01

    WARNING: This library was yield low amount of material and it was over-amplified by PCR. This libraries are used study the robustness of several statitical methods against PCR artifacts. ChIP experiments were performed on Arabidopsis wildtype inflorescences using an antibody raised against a

  16. Uranium enrichment. Technology, economics, capacity

    International Nuclear Information System (INIS)

    Voigt, W.R. Jr.; Saire, D.E.; Gestson, D.K.; Peske, S.E.; Vanstrum, P.R.

    1983-01-01

    Large-scale enrichment of uranium has now been carried out for 40 years. While the gaseous diffusion process was the original choice of several countries and continues today to provide the major component of the world production of separative work, the last two decades have witnessed the development of a number of alternative processes for enrichment. These processes, which are being studied and deployed around the world, offer a wide range of technical and economic characteristics which will be useful in assuring adequate capacity to meet projected reactor fuel market needs through the rest of this century at competitive prices. With present uncertainties in future enriched uranium needs, it is apparent that flexibility in the deployment and operation of any enrichment process will be one of the prime considerations for the future. More economical production of separative work not only can have a beneficial impact on reactor fuel costs, but also tends to conserve natural uranium resources. This paper reviews the world scene in the enrichment component of the fuel cycle, including existing or planned commercial-scale facilities and announced R+D efforts on various processes. (author)

  17. Uranium enrichment: technology, economics, capacity

    Energy Technology Data Exchange (ETDEWEB)

    Voigt, Jr., W. R.; Vanstrum, P. R.; Saire, D. E.; Gestson, D. K.; Peske, S. E.

    1982-08-01

    Large-scale enrichment of uranium has now been carried out for 40 years. While the gaseous diffusion process was the original choice of several countries and continues today to provide the major component of the world production of separative work, the last two decades have witnessed the development of a number of alternative processes for enrichment. These processes, which are being studied and deployed around the world, offer a wide range of technical and economic characteristics which will be useful in assuring adequate capacity to meet projected reactor fuel market needs through the rest of this century at competitive prices. With present uncertainties in future enriched uranium needs, it is apparent that flexibility in the deployment and operation of any enrichment process will be one of the prime considerations for the future. More economical production of separative work not only can have a beneficial impact on reactor fuel costs, but also tends to conserve natural uranium resources. This paper reviews the world scene in the enrichment component of the fuel cycle, including existing or planned commercial-scale facilities and announced R and D efforts on various processes.

  18. Uranium enrichment: technology, economics, capacity

    International Nuclear Information System (INIS)

    Voigt, W.R. Jr.; Vanstrum, P.R.; Saire, D.E.; Gestson, D.K.; Peske, S.E.

    1982-01-01

    Large-scale enrichment of uranium has now been carried out for 40 years. While the gaseous diffusion process was the original choice of several countries and continues today to provide the major component of the world production of separative work, the last two decades have witnessed the development of a number of alternative processes for enrichment. These processes, which are being studied and deployed around the world, offer a wide range of technical and economic characteristics which will be useful in assuring adequate capacity to meet projected reactor fuel market needs through the rest of this century at competitive prices. With present uncertainties in future enriched uranium needs, it is apparent that flexibility in the deployment and operation of any enrichment process will be one of the prime considerations for the future. More economical production of separative work not only can have a beneficial impact on reactor fuel costs, but also tends to conserve natural uranium resources. This paper reviews the world scene in the enrichment component of the fuel cycle, including existing or planned commercial-scale facilities and announced R and D efforts on various processes

  19. Molecular methods (digital PCR and real-time PCR) for the quantification of low copy DNA of Phytophthora nicotianae in environmental samples.

    Science.gov (United States)

    Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A

    2016-04-01

    Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.

  20. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    DEFF Research Database (Denmark)

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  1. Development of long-life low enrichment fuel

    International Nuclear Information System (INIS)

    Gietzen, A.J.; West, G.B.

    1978-01-01

    With only a few exceptions, TRIGA reactors have always used low-enriched-uranium (LEU) fuel with an enrichment of 19.9%. The exceptions have either been converted from the standard low-enriched fuel to the 70% enriched FLIP fuel in order to achieve extended lifetime, or are higher powered reactors which were designed for long life using 93%-enriched uranium during the time when the use and export of highly enriched uranium (HEU) was not restricted. The advent of international policies focusing attention on non-proliferation and safeguards made the HEU fuels obsolete. General Atomic immediately undertook a development effort (nearly two years ago) in order to be in a position to comply with these policies for all future export sales and also to provide a low-enriched alternative to fully enriched plate-type fuels. This important work was subsequently partially supported by the U. S. Department of Energy. The laboratory and production tests have shown that higher uranium densities can be achieved to compensate for reducing the enrichment to 20%, and that the fuels maintain the characteristics of the very thoroughly proven standard TRIGA fuels. In May of this year, General Atomic announced that these fuels were available for TRIGA reactors and for plate-type reactors with power levels up to 15 MW with GA's standard commercial warranty

  2. Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

    Science.gov (United States)

    Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

    2018-03-16

    Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

  3. World enrichment requirements to 2005

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    The primary enrichment suppliers-Eurodif, Techsnabexport, Urenco, and the US DOE - are positioning themselves to take advantage of the post - 1995 market. Overall, unfilled requirements represent about 40 percent of world requirements in the year 2000. The USA will be the primary market, as US utilities' unfilled enrichment requirements account for over 60 percent of the world's total unfilled requirements. The enrichment market is moving toward more global competition, as each supplier tries to maintain its current regional market base and then to capture additional market share in other regions

  4. Sensitive PCR Detection of Meloidogyne arenaria, M. incognita, and M. javanica Extracted from Soil

    Science.gov (United States)

    Qiu, Jinya Jack; Westerdahl, Becky B.; Anderson, Cindy; Williamson, Valerie M.

    2006-01-01

    We have developed a simple PCR assay protocol for detection of the root-knot nematode (RKN) species Meloidogyne arenaria, M. incognita, and M. javanica extracted from soil. Nematodes are extracted from soil using Baermann funnels and centrifugal flotation. The nematode-containing fraction is then digested with proteinase K, and a PCR assay is carried out with primers specific for this group of RKN and with universal primers spanning the ITS of rRNA genes. The presence of RKN J2 can be detected among large numbers of other plant-parasitic and free-living nematodes. The procedure was tested with several soil types and crops from different locations and was found to be sensitive and accurate. Analysis of unknowns and spiked soil samples indicated that detection sensitivity was the same as or higher than by microscopic examination. PMID:19259460

  5. DOE enrichment plants-safeguards means business

    International Nuclear Information System (INIS)

    Donnelly, R.

    1987-01-01

    The Portsmouth Gaseous Diffusion Plant, owned by the US Department of Energy (DOE) and operated by Martin Marietta Energy Systems, Inc., is a full service enrichment plant. Its long enriching cascade can process uranium hexafluoride (UF 6 ) feeds at almost any 235 U level and can produce UF 6 over the complete spectrum from depleted to very highly enriched uranium. The DOE uranium enrichment program is a government-owned enterprise operating as a business. The operating concerns of the DOE uranium enrichment plants and their safeguards programs have evolved together over the past three decades, and that evolution will likely continue. As the risk associated with possession, processing, and shipment of strategic nuclear material increased, the protection and control of it increased; as the value of the product grew with time, better ways were found to measure and conserve it. In each of these areas, safeguards objectives and the business requirements of the plant are complementary, and the progress made in one area has been reflected by progress in the other. The plant's material control and accountability program has become crucial to such business requirements as quantifying the enriched uranium (separative work units) produced in each monthly period and convincing financial auditors that the multibillion dollar enriched uranium assets located at the Portsmouth plant are properly stated

  6. Pathogen Causing Disease of Diagnosis PCR Tecnology

    OpenAIRE

    SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel

    2013-01-01

    Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...

  7. Uranium enrichment

    International Nuclear Information System (INIS)

    1991-08-01

    This paper reports that in 1990 the Department of Energy began a two-year project to illustrate the technical and economic feasibility of a new uranium enrichment technology-the atomic vapor laser isotope separation (AVLIS) process. GAO believes that completing the AVLIS demonstration project will provide valuable information about the technical viability and cost of building an AVLIS plant and will keep future plant construction options open. However, Congress should be aware that DOE still needs to adequately demonstrate AVLIS with full-scale equipment and develop convincing cost projects. Program activities, such as the plant-licensing process, that must be completed before a plant is built, could take many years. Further, an updated and expanded uranium enrichment analysis will be needed before any decision is made about building an AVLIS plant. GAO, which has long supported legislation that would restructure DOE's uranium enrichment program as a government corporation, encourages DOE's goal of transferring AVLIS to the corporation. This could reduce the government's financial risk and help ensure that the decision to build an AVLIS plant is based on commercial concerns. DOE, however, has no alternative plans should the government corporation not be formed. Further, by curtailing a planned public access program, which would have given private firms an opportunity to learn about the technology during the demonstration project, DOE may limit its ability to transfer AVLIS to the private sector

  8. The density of GM1-enriched lipid rafts correlates inversely with the efficiency of transfection mediated by cationic liposomes.

    Science.gov (United States)

    Kovács, Tamás; Kárász, Andrea; Szöllosi, János; Nagy, Peter

    2009-08-01

    Although cationic liposome-mediated transfection has become a standard procedure, the mechanistic details of the process are unknown. It has been suggested that endocytic uptake of lipoplexes is efficient, and transfectability is largely determined by later steps. In this article, we stained GM1-enriched membrane microdomains, a subclass of lipid rafts, with subunit B of cholera toxin and correlated transfection efficiency with their density by quantitatively evaluating microscopic images. We found a strong anticorrelation between the density of GM1-enriched membrane microdomains and the efficacy of transfection monitored by measuring the expression level of GFP in different cell lines transfected by lipofection using two different transfection agents. These findings imply that GM1-enriched membrane microdomains interfere with the process of lipofection. The blocked step must be endocytosis since the accumulation of fluorescently labeled plasmids was lower in cells with high content of GM1-enriched membrane microdomains. Such a correlation was not observed in cells transfected by electroporation. By comparing the efficiency of lipofection in several cell lines we found that those with a high density of GM1-enriched membrane microdomains were the most resistant to transfection. We conclude that the inhibition of lipofection by GM1-enriched membrane microdomains is a general rule, and that endocytosis of lipoplexes can be rate limiting in cells with high density of GM1-enriched membrane rafts. Copyright 2009 International Society for Advancement of Cytometry.

  9. Enrichment of circulating tumor cells from a large blood volume using leukapheresis and elutriation: proof of concept.

    Science.gov (United States)

    Eifler, Robert L; Lind, Judith; Falkenhagen, Dieter; Weber, Viktoria; Fischer, Michael B; Zeillinger, Robert

    2011-03-01

    The aim of this study was to determine the applicability of a sequential process using leukapheresis, elutriation, and fluorescence-activated cell sorting (FACS) to enrich and isolate circulating tumor cells from a large blood volume to allow further molecular analysis. Mononuclear cells were collected from 10 L of blood by leukapheresis, to which carboxyfluorescein succinimidyl ester prelabeled CaOV-3 tumor cells were spiked at a ratio of 26 to 10⁶ leukocytes. Elutriation separated the spiked leukapheresates primarily by cell size into distinct fractions, and leukocytes and tumor cells, characterized as carboxyfluorescein succinimidyl ester positive, EpCAM positive and CD45 negative events, were quantified by flow cytometry. Tumor cells were isolated from the last fraction using FACS or anti-EpCAM coupled immunomagnetic beads, and their recovery and purity determined by fluorescent microscopy and real-time PCR. Leukapheresis collected 13.5 x 10⁹ mononuclear cells with 87% efficiency. In total, 53 to 78% of spiked tumor cells were pre-enriched in the last elutriation fraction among 1.6 x 10⁹ monocytes. Flow cytometry predicted a circulating tumor cell purity of ~90% giving an enrichment of 100,000-fold following leukapheresis, elutriation, and FACS, where CaOV-3 cells were identified as EpCAM positive and CD45 negative events. FACS confirmed this purity. Alternatively, immunomagnetic bead adsorption recovered 10% of tumor cells with a median purity of 3.5%. This proof of concept study demonstrated that elutriation and FACS following leukapheresis are able to enrich and isolate tumor cells from a large blood volume for molecular characterization. Copyright © 2010 International Clinical Cytometry Society.

  10. Availability of enrichment services

    International Nuclear Information System (INIS)

    Svenke, E.

    1977-01-01

    The report summarizes major uncertainties which are likely to influence future demands for uranium isotopic enrichment. Since for the next decade the development of nuclear power will be largely concerned with the increment in demand the timely need for enrichment capacity will be particularly sensitive to assumptions about growth rates. Existing worldwide capacity together with capacities under construction will be sufficient well into the 1980's. However, long decision and construction leadtime, uncertainty as to future demand as well as other factors, specifically high capital need, all of which entail financial risks, create hindrances to a timely development of increment. The adequacy of current technology is well demonstrated in plant operation and new technology is under way. Technology is, however, not freely available on a purely commercial basis. Commercial willingness, which anticipates a limited degree of financial risk, is requesting both long term back-up from the utilities that would parallel their firm decisions on the acquisition of nuclear power units, and a protective government umbrella. This situation depends on the symbiotic relationship that exists between the nuclear power generating organizations, the enrichment undertakings and the governments involved. The report accordingly stresses the need for a more cooperative approach and this, moreover, at the multinational level. There is otherwise a risk that proper resources and financing means will not be allocated to the enrichment sector. Export limitations that request the highest degree of industrial processing of nuclear fuel, i.e. the compulsory enrichment of natural uranium, do not serve the interests of overall industrial efficiency

  11. Comparative study of Gram stain, potassium hydroxide smear, culture and nested PCR in the diagnosis of fungal keratitis.

    Science.gov (United States)

    Badiee, Parisa; Nejabat, Mahmood; Alborzi, Abdolvahab; Keshavarz, Fatemeh; Shakiba, Elaheh

    2010-01-01

    This study seeks to evaluate the efficacy and practicality of the molecular method, compared to the standard microbiological techniques for diagnosing fungal keratitis (FK). Patients with eye findings suspected of FK were enrolled for cornea sampling. Scrapings from the affected areas of the infected corneas were obtained and were divided into two parts: one for smears and cultures, and the other for nested PCR analysis. Of the 38 eyes, 28 were judged to have fungal infections based on clinical and positive findings in the culture, smear and responses to antifungal treatment. Potassium hydroxide, Gram staining, culture and nested PCR results (either positive or negative) matched in 76.3, 42.1, 68.4 and 81.6%, respectively. PCR is a sensitive method but due to the lack of sophisticated facilities in routine laboratory procedures, it can serve only complementarily and cannot replace conventional methods. Copyright © 2010 S. Karger AG, Basel.

  12. Analysis of the performance of fuel cells PWR with a single enrichment and radial distribution of enrichments

    International Nuclear Information System (INIS)

    Vargas, S.; Gonzalez, J. A.; Alonso, G.; Del Valle, E.; Xolocostli M, J. V.

    2008-01-01

    One of the main challenges in the design of fuel assemblies is the efficient use of uranium achieving burnt homogeneous of the fuel rods as well as the burnt maximum possible of the same ones to the unload. In the case of the assemblies type PWR has been decided actually for fuel assemblies with a single radial enrichment. The present work has like effect to show the because of this decision, reason why a comparison of the neutronic performance of two fuel cells takes place with the same enrichment average but one of them with radial distribution of enrichment and the other with a single enrichment equal to the average. The results shown in the present study of the behavior of the neutron flow as well as the power distribution through of assembly sustain the because of a single radial enrichment. (Author)

  13. Civilian inventories of plutonium and highly enriched uranium

    International Nuclear Information System (INIS)

    Albright, D.

    1987-01-01

    In the future, commercial laser isotope enrichment technologies, currently under development, could make it easier for national to produce highly enriched uranium secretly. The head of a US firm that is developing a laser enrichment process predicts that in twenty years, major utilities and small countries will have relatively small, on-site, laser-based uranium enrichment facilities. Although these plants will be designed for the production of low enriched uranium, they could be modified to produce highly enriched uranium, an option that raises the possibility of countries producing highly enriched uranium in small, easily hidden facilities. Against this background, most of this report describes the current and future quantities of plutonium and highly enriched uranium in the world, their forms, the facilities in which they are produced, stored, and used, and the extent to which they are transported. 5 figures, 10 tables

  14. Enriching Students’ Vocabulary Mastery Using Graphic Organizers

    Directory of Open Access Journals (Sweden)

    Syaifudin Latif Darmawan

    2017-04-01

    Full Text Available This action research is carried out to (1 identify whether graphic organizers enrich student’s vocabulary mastery; and (2 to describe the classroom situation when graphic organizers are employed in instructional process of vocabulary. The research is conducted in two cycles from March to May 2016/2017 in the eight years of SMP Muhammadiyah Sekampung, East lampung. The procedure of the research consists of identifying the problem, planning the action, implementing the action, observing the action, and reflecting the result of the research. Qualitative data are collected through interview, observation, questionnaire, and research diary. Quantitative data are collected through test. To analyze qualitative data, the researcher used constant comparative method. It consists of four steps: (1 comparing incidents applicable to each category; (2 Integrating categories and their properties; (3 delimiting the theory; (4 Writing the theory. Meanwhile, to analyze quantitative data, the researcher employed descriptive statistic.    The result of the research shows that using graphic organizers can enrich students’ vocabulary mastery and classroom situation. The improvement on students’ vocabulary included; a the students are able to speak English; b the students are able to understand the meaning of the text as they have a lot of vocabularies. The improvement of the classroom situation; (a students come on time in the class (b students are more motivated to join the class (c Students pay more attention in the instructional process (d students’ participation in responding the questions are high.

  15. NRC licensing of uranium enrichment plants

    International Nuclear Information System (INIS)

    Moran, B.W.

    1991-01-01

    The US Nuclear Regulatory Commission (NRC) is preparing a rule making that establishes the licensing requirements for low-enriched uranium enrichment plants. Although implementation of this rule making is timed to correspond with receipt of a license application for the Louisiana Energy Services centrifuge enrichment plant, the rule making is applicable to all uranium enrichment technologies. If ownership of the US gaseous diffusion plants and/or atomic vapor laser isotope separation is transferred to a private or government corporation, these plants also would be licensable under the new rule making. The Safeguards Studies Department was tasked by the NRC to provide technical assistance in support of the rule making and guidance preparation process. The initial and primary effort of this task involved the characterization of the potential safeguards concerns associated with a commercial enrichment plant, and the licensing issues associated with these concerns. The primary safeguards considerations were identified as detection of the loss of special nuclear material, detection of unauthorized production of material of low strategic significance, and detection of production of uranium enriched to >10% 235 U. The primary safeguards concerns identified were (1) large absolute limit of error associated with the material balance closing, (2) the inability to shutdown some technologies to perform a cleanout inventory of the process system, and (3) the flexibility of some technologies to produce higher enrichments. Unauthorized production scenarios were identified for some technologies that could prevent conventional material control and accounting programs from detecting the production and removal of 5 kg 235 U as highly enriched uranium. Safeguards techniques were identified to mitigate these concerns

  16. Determination of D{sub 2}O - 2% enriched uranium lattice parameters by means of a critical system

    Energy Technology Data Exchange (ETDEWEB)

    Raisic, N; Takac, S; Markovic, H; Bosevski, T [Boris Kidric Institute of Nuclear Sciences Belgrade (Yugoslavia)

    1963-07-01

    In order to specify experimental procedures for few standard measurements sufficient to provide consistent set of lattice parameters, a series of experiments were performed at the RB reactor using 2% enriched tubular fuel elements. Obtained results were compared to standard two-group diffusion calculation indicating high degree of accuracy for a broad variety of reactor lattice configurations.

  17. Environmental enrichment choices of shelter cats.

    Science.gov (United States)

    Ellis, J J; Stryhn, H; Spears, J; Cockram, M S

    2017-08-01

    Choices made by cats between different types of environmental enrichment may help shelters to prioritize how to most effectively enrich cat housing, especially when limited by space or funds. This study investigates the environmental enrichment use of cats in a choice test. Twenty-six shelter cats were kept singularly in choice chambers for 10days. Each chamber had a central area and four centrally-linked compartments containing different types of environmental enrichment: 1) an empty control, 2) a prey-simulating toy, 3) a perching opportunity, and 4) a hiding opportunity. Cat movement between compartments was quantitatively recorded using a data-logger. Enriched compartments were visited significantly more frequently during the light period than during the dark period. Cats spent a significantly greater percentage of time in the hiding compartment (median=55%, IQR=46) than in the toy compartment (median=2%, IQR=9), or in the empty control compartment (median=4%, IQR=4). These results provide additional evidence to support the value of a hiding box to cats housed in a novel environment, in that they choose hiding relative to other types of environmental enrichment. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

    Science.gov (United States)

    Tu, Thomas; Jilbert, Allison R

    2017-01-01

    Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

  19. Standardized Environmental Enrichment Supports Enhanced Brain Plasticity in Healthy Rats and Prevents Cognitive Impairment in Epileptic Rats

    Science.gov (United States)

    Kouchi, Hayet Y.; Bodennec, Jacques; Morales, Anne; Georges, Béatrice; Bonnet, Chantal; Bouvard, Sandrine; Sloviter, Robert S.; Bezin, Laurent

    2013-01-01

    Environmental enrichment of laboratory animals influences brain plasticity, stimulates neurogenesis, increases neurotrophic factor expression, and protects against the effects of brain insult. However, these positive effects are not constantly observed, probably because standardized procedures of environmental enrichment are lacking. Therefore, we engineered an enriched cage (the Marlau™ cage), which offers: (1) minimally stressful social interactions; (2) increased voluntary exercise; (3) multiple entertaining activities; (4) cognitive stimulation (maze exploration), and (5) novelty (maze configuration changed three times a week). The maze, which separates food pellet and water bottle compartments, guarantees cognitive stimulation for all animals. Compared to rats raised in groups in conventional cages, rats housed in Marlau™ cages exhibited increased cortical thickness, hippocampal neurogenesis and hippocampal levels of transcripts encoding various genes involved in tissue plasticity and remodeling. In addition, rats housed in Marlau™ cages exhibited better performances in learning and memory, decreased anxiety-associated behaviors, and better recovery of basal plasma corticosterone level after acute restraint stress. Marlau™ cages also insure inter-experiment reproducibility in spatial learning and brain gene expression assays. Finally, housing rats in Marlau™ cages after severe status epilepticus at weaning prevents the cognitive impairment observed in rats subjected to the same insult and then housed in conventional cages. By providing a standardized enriched environment for rodents during housing, the Marlau™ cage should facilitate the uniformity of environmental enrichment across laboratories. PMID:23342033

  20. Standardized environmental enrichment supports enhanced brain plasticity in healthy rats and prevents cognitive impairment in epileptic rats.

    Directory of Open Access Journals (Sweden)

    Raafat P Fares

    Full Text Available Environmental enrichment of laboratory animals influences brain plasticity, stimulates neurogenesis, increases neurotrophic factor expression, and protects against the effects of brain insult. However, these positive effects are not constantly observed, probably because standardized procedures of environmental enrichment are lacking. Therefore, we engineered an enriched cage (the Marlau™ cage, which offers: (1 minimally stressful social interactions; (2 increased voluntary exercise; (3 multiple entertaining activities; (4 cognitive stimulation (maze exploration, and (5 novelty (maze configuration changed three times a week. The maze, which separates food pellet and water bottle compartments, guarantees cognitive stimulation for all animals. Compared to rats raised in groups in conventional cages, rats housed in Marlau™ cages exhibited increased cortical thickness, hippocampal neurogenesis and hippocampal levels of transcripts encoding various genes involved in tissue plasticity and remodeling. In addition, rats housed in Marlau™ cages exhibited better performances in learning and memory, decreased anxiety-associated behaviors, and better recovery of basal plasma corticosterone level after acute restraint stress. Marlau™ cages also insure inter-experiment reproducibility in spatial learning and brain gene expression assays. Finally, housing rats in Marlau™ cages after severe status epilepticus at weaning prevents the cognitive impairment observed in rats subjected to the same insult and then housed in conventional cages. By providing a standardized enriched environment for rodents during housing, the Marlau™ cage should facilitate the uniformity of environmental enrichment across laboratories.

  1. Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR

    Directory of Open Access Journals (Sweden)

    Roman Wölfel

    2012-08-01

    Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.

  2. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  3. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  4. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  5. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  6. Evaluation of PCR procedures for detecting and quantifying Leishmania donovani DNA in large numbers of dried human blood samples from a visceral leishmaniasis focus in Northern Ethiopia.

    Science.gov (United States)

    Abbasi, Ibrahim; Aramin, Samar; Hailu, Asrat; Shiferaw, Welelta; Kassahun, Aysheshm; Belay, Shewaye; Jaffe, Charles; Warburg, Alon

    2013-03-27

    Visceral Leishmaniasis (VL) is a disseminated protozoan infection caused by Leishmania donovani parasites which affects almost half a million persons annually. Most of these are from the Indian sub-continent, East Africa and Brazil. Our study was designed to elucidate the role of symptomatic and asymptomatic Leishmania donovani infected persons in the epidemiology of VL in Northern Ethiopia. The efficacy of quantitative real-time kinetoplast DNA/PCR (qRT-kDNA PCR) for detecting Leishmania donovani in dried-blood samples was assessed in volunteers living in an endemic focus. Of 4,757 samples, 680 (14.3%) were found positive for Leishmania k-DNA but most of those (69%) had less than 10 parasites/ml of blood. Samples were re-tested using identical protocols and only 59.3% of the samples with 10 parasite/ml or less were qRT-kDNA PCR positive the second time. Furthermore, 10.8% of the PCR negative samples were positive in the second test. Most samples with higher parasitemias remained positive upon re-examination (55/59 =93%). We also compared three different methods for DNA preparation. Phenol-chloroform was more efficient than sodium hydroxide or potassium acetate. DNA sequencing of ITS1 PCR products showed that 20/22 samples were Leishmania donovani while two had ITS1 sequences homologous to Leishmania major. Although qRT-kDNA PCR is a highly sensitive test, the dependability of low positives remains questionable. It is crucial to correlate between PCR parasitemia and infectivity to sand flies. While optimal sensitivity is achieved by targeting k-DNA, it is important to validate the causative species of VL by DNA sequencing.

  7. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    Science.gov (United States)

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

  8. Tritium Activity Measurement of Water Samples Using Liquid Scintillation Counter and Electrolytical Enrichment

    International Nuclear Information System (INIS)

    Baresic, J.; Krajcar Bronic, I.; Horvatincic, N.; Obelic, B.; Sironic, A.; Kozar-Logar J.

    2011-01-01

    Tritium (3H) activity of natural waters (precipitation, groundwater, surface waters) has recently become too low to be directly measured by low-level liquid scintillation (LSC) techniques. It is therefore necessary to perform electrolytical enrichment of tritium in such waters prior to LSC measurements. Electrolytical enrichment procedure has been implemented at the Rudjer Boskovic Institute (RBI) Tritium Laboratory in 2008, and since then 19 electrolyses have been completed. The mean enrichment factor E (a ratio between the final and initial 3H activities) after stabilisation of the system is E R BI = 22.5 @ 0.5, and the mean enrichment parameter (which describes the process of water mass reduction during electrolysis) is P R BI 0.949 @ 0.003. These values are comparable with those obtained at the Jo@ef Stefan Institute (JSI) Laboratory for liquid scintillation counting, at the electrolysis equipment of the same producer (AGH University of Science and Technology, Krakow, Poland) after 66 electrolyses carried out under identical conditions since 2007: E J SI = 18.9 @ 1.5, and P J SI = 0.896 @ 0.021. Both RBI and JSI laboratories have Ultra-low-level LSC Quantulus 1220 (Wallac, PerkinElmer) for measurement of 3H activity. A set of water samples having 3H activities in the range from 0 TU (''dead-water'' samples) to 18 000 TU (1 TU 0.118 Bq/L) were measured at both laboratories. Samples having 3H activity <200 TU were electrolytically enriched, while the others were measured directly in LSC. A very good agreement was obtained (correlation coefficient 0.991). Both laboratories participated in the IAEA TRIC2008 international intercomparison exercise. The analyses of reported 3H activity results in terms of z and u parameters showed that all results in both laboratories were acceptable. (author)

  9. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  10. Uranium enrichment: heading for a cliff

    International Nuclear Information System (INIS)

    Norman, C.

    1987-01-01

    Thanks to drastic cost cutting in the past 2 years, US enrichment plants now have the lowest cost production in the world, but US prices are still higher than those of overseas competitors because the business is paying for past mistakes. The most serious difficulty is that the Department of Energy (DOE), which owns and operates the US enrichment enterprise, is paying more than $500 million a year to the Tennessee Valley Authority (TVA) for electricity it once thought it would need but no longer requires. Another is that billions of dollars were spent in the 1970s and early 1980s to build new capacity that is now not needed. As a result, the enrichment enterprise has accumulated a debt to the US Treasury that the General Accounting Office (GAO) estimates at $8.8 billion. This paper presents the background and current debate in Congress about the difficulties facing the enrichment industry. In the midst of this debate over the future of the enterprise, the development of the next generation of enrichment technology is being placed in jeopardy. Known as atomic vapor laser isotope separation, or AVLIS, the process was viewed as the key to the long-term competitiveness of US enrichment. As the federal deficit mounted, however, funding for the AVLIS program was cut back and the timetable was stretched out. The US enrichment program has reached the point at which Congress will be forced to make some politically difficult decisions

  11. Safety of uranium enrichment plant

    International Nuclear Information System (INIS)

    Yonekawa, Shigeru; Morikami, Yoshio; Morita, Minoru; Takahashi, Tsukasa; Tokuyasu, Takashi.

    1991-01-01

    With respect to safety evaluation of the gas centrifuge enrichment facility, several characteristic problems are described as follows. Criticality safety in the cascade equipments can be obtained to maintain the enrichment of UF 6 below 5 %. External radiation dose equivalent rate of the 30B cylinder is low enough, the shield is not necessary. Penetration ratio of the two-stage HEPA filters for UF 6 aerosol is estimated at 10 -9 . From the experimental investigation, vacuum tightness is not damaged by destruction of gas centrifuge rotor. Carbon steel can be used for uranium enrichment equipments under the condition below 100degC. (author)

  12. Profile of World Uranium Enrichment Programs - 2007

    International Nuclear Information System (INIS)

    Laughter, Mark D.

    2007-01-01

    It is generally agreed that the most difficult step in building a nuclear weapon is acquiring weapons grade fissile material, either plutonium or highly enriched uranium (HEU). Plutonium is produced in a nuclear reactor, while HEU is produced using a uranium enrichment process. Enrichment is also an important step in the civil nuclear fuel cycle, in producing low enriched uranium (LEU) for use in fuel for nuclear reactors. However, the same equipment used to produce LEU for nuclear fuel can also be used to produce HEU for weapons. Safeguards at an enrichment plant are the array of assurances and verification techniques that ensure uranium is only enriched to LEU, no undeclared LEU is produced, and no uranium is enriched to HEU or secretly diverted. There are several techniques for enriching uranium. The two most prevalent are gaseous diffusion, which uses older technology and requires a lot of energy, and gas centrifuge separation, which uses more advanced technology and is more energy efficient. Gaseous diffusion plants (GDPs) provide about 40% of current world enrichment capacity, but are being phased out as newer gas centrifuge enrichment plants (GCEPs) are constructed. Estimates of current and future enrichment capacity are always approximate, due to the constant upgrades, expansions, and shutdowns occurring at enrichment plants, largely determined by economic interests. Currently, the world enrichment capacity is approximately 53 million kg-separative work units (SWU) per year, with 22 million in gaseous diffusion and 31 million in gas centrifuge plants. Another 23 million SWU/year of capacity are under construction or planned for the near future, almost entirely using gas centrifuge separation. Other less-efficient techniques have also been used in the past, including electromagnetic and aerodynamic separations, but these are considered obsolete, at least from a commercial perspective. Laser isotope separation shows promise as a possible enrichment technique

  13. Propidium monoazide reverse transcription PCR and RT-qPCR for detecting infectious enterovirus and norovirus

    Science.gov (United States)

    Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...

  14. A ROADMAP FOR GENERATING SEMANTICALLY ENRICHED BUILDING MODELS ACCORDING TO CITYGML MODEL VIA TWO DIFFERENT METHODOLOGIES

    Directory of Open Access Journals (Sweden)

    G. Floros

    2016-10-01

    Full Text Available The methodologies of 3D modeling techniques have increasingly increased due to the rapid advances of new technologies. Nowadays, the focus of 3D modeling software is focused, not only to the finest visualization of the models, but also in their semantic features during the modeling procedure. As a result, the models thus generated are both realistic and semantically enriched. Additionally, various extensions of modeling software allow for the immediate conversion of the model’s format, via semi-automatic procedures with respect to the user’s scope. The aim of this paper is to investigate the generation of a semantically enriched Citygml building model via two different methodologies. The first methodology includes the modeling in Trimble SketchUp and the transformation in FME Desktop Manager, while the second methodology includes the model’s generation in CityEngine and its transformation in the CityGML format via the 3DCitiesProject extension for ArcGIS. Finally, the two aforesaid methodologies are being compared and specific characteristics are evaluated, in order to infer the methodology that is best applied depending on the different projects’ purposes.

  15. Rapid detection of Salmonella in meat: Comparative and collaborative validation of a non-complex and cost effective pre-PCR protocol

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, F.; Mansdal, S.

    2011-01-01

    samples using a real-time PCR method. The protocol included incubation in buffered peptone water, centrifugation of an aliquot and a boiling procedure. The validation study included comparative and collaborative trials recommended by the Nordic Organization for Validation of Alternative Methods (NordVal......). The comparative trial was performed against a culture based reference method (NMKL187, 2007) and a previously NordVal approved PCR method with a semi-automated magnetic bead-based DNA extraction step using 122 artificially contaminated samples. The limit of detection (LOD50) was found to be 3.0, 3.2 and 3.4 CFU...

  16. Quadruplex genotype analysis at HumTH01, HumTPOX, HumCSF1PO and amelogenin Loci by FoLT-PCR

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Y.H.; Lim, S.K.; Kang, P.W.; Choi, D.H.; Yoon, S.R.; Han, M.S. [National Institute of Scientific Investigation, Seoul (Korea)

    1999-06-01

    A simple and rapid procedure, called FoLT-PCR(Formamide Low Temperature-Polymerase Chain Reaction) was applied to amplifying DNA directly from various forensic biological evidences including human blood, saliva, hair root, or semen without any DNA preparative steps. We added washing step with non-ionic detergent, 1% Triton X-100, and used Taq DNA polymerase instead of Tth DNA polymerase to amplify 3 STR loci and gender allele simultaneously. Optimal concentration of formamide and annealing temperature were determined empirically to 8%(v/v), and 48{sup o} C respectively. We also compared this method with standard PCR. 8 refs., 4 figs.

  17. Leucine-Enriched Essential Amino Acids Augment Muscle Glycogen Content in Rats Seven Days after Eccentric Contraction

    Directory of Open Access Journals (Sweden)

    Hiroyuki Kato

    2017-10-01

    Full Text Available Eccentric contractions induce muscle damage, which impairs recovery of glycogen and adenosine tri-phosphate (ATP content over several days. Leucine-enriched essential amino acids (LEAAs enhance the recovery in muscles that are damaged after eccentric contractions. However, the role of LEAAs in this process remains unclear. We evaluated the content in glycogen and high energy phosphates molecules (phosphocreatine (PCr, adenosine di-phosphate (ADP and ATP in rats that were following electrically stimulated eccentric contractions. Muscle glycogen content decreased immediately after the contraction and remained low for the first three days after the stimulation, but increased seven days after the eccentric contraction. LEAAs administration did not change muscle glycogen content during the first three days after the contraction. Interestingly, however, it induced a further increase in muscle glycogen seven days after the stimulation. Contrarily, ATP content decreased immediately after the eccentric contraction, and remained lower for up to seven days after. Additionally, LEAAs administration did not affect the ATP content over the experimental period. Finally, ADP and PCr levels did not significantly change after the contractions or LEAA administration. LEAAs modulate the recovery of glycogen content in muscle after damage-inducing exercise.

  18. The future cost of uranium enrichment

    International Nuclear Information System (INIS)

    Pouris, A.

    1986-01-01

    The cost of uranium enrichment is the most important factor determining the fuel cost of nuclear energy. This paper attempts to forecast the future direction of the price of separative work by examining the forces that determine it. It is argued that the interplay among the characteristics of enrichment technologies, the structure of the international market, and the balance of supply and demand determine the enrichment price. The analysis indicates that all forces point towards a price much lower than the current one. It is predicted that, depending on the technological advances, the price of separative work unit for uranium enrichment will range between $40 and $90 by the year 2000. (author)

  19. 31 CFR 540.308 - Low Enriched Uranium (LEU).

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Low Enriched Uranium (LEU). 540.308... OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE TREASURY HIGHLY ENRICHED URANIUM (HEU) AGREEMENT ASSETS CONTROL REGULATIONS General Definitions § 540.308 Low Enriched Uranium (LEU). The term low enriched...

  20. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...