Multi-region optimal deployment of renewable energy considering different interregional transmission scenarios

International Nuclear Information System (INIS)

Wang, Ge; Zhang, Qi; Mclellan, Benjamin C.; Li, Hailong

2016-01-01

Renewable energy is expected to play much more important role in future low-carbon energy system, however, renewable energy has problems with regard to load-following and regional imbalance. This study aims to plan the deployment of intermittent renewable energy in multiple regions considering the impacts of regional natural conditions and generation capacity mix as well as interregional transmission capacity using a multi-region dynamic optimization model. The model was developed to find optimized development paths toward future smart electricity systems with high level penetration of intermittent renewable energy considering regional differences and interregional transmission at national scale. As a case study, the model was applied to plan power generation in nine interconnected regions in Japan out to 2030. Four scenarios were proposed with different supporting policies for the interregional power transmission infrastructures and different nuclear power phase-out scenarios. The analysis results show that (i) the government's support for power transmission infrastructures is vital important to develop more intermittent renewable energy in appropriate regions and utilize renewable energy more efficiently; (ii) nuclear and renewable can complement rather than replace each other if enough interregional transmission capacity is provided. - Highlights: • Plan the optimal deployment of intermittent renewable energy in multiple regions. • A multi-region dynamic optimization model was developed. • The impacts of natural conditions and interregional transmission are studied. • The government's support for transmission is vital important for renewable energy. • Nuclear and renewable can complement rather than replace each other.

Rocket experiment METS - Microwave Energy Transmission in Space

Science.gov (United States)

Kaya, N.; Matsumoto, H.; Akiba, R.

A Microwave Energy Transmission in Space (METS) rocket experiment is being planned by the Solar Power Satellite Working Group at the Institute of Space and Astronautical Science in Japan for the forthcoming International Space Year, 1992. The METS experiment is an advanced version of the previous MINIX rocket experiment (Matsumoto et al., 1990). This paper describes a conceptual design of the METS rocket experiment. It aims at verifying a newly developed microwave energy transmission system for space use and to study nonlinear effects of the microwave energy beam in the space plasma environment. A high power microwave of 936 W will be transmitted by the new phased-array antenna from a mother rocket to a separated target (daughter rocket) through the ionospheric plasma. The active phased-array system has a capability of focusing the microwave energy around any spatial point by controlling the digital phase shifters individually.

Rocket experiment METS Microwave Energy Transmission in Space

Science.gov (United States)

Kaya, N.; Matsumoto, H.; Akiba, R.

A METS (Microwave Energy Transmission in Space) rocket experiment is being planned by the SPS (Solar Power Satellite) Working Group at the Institute of Space and Astronautical Science (ISAS) in Japan for the forthcoming International Space Year (ISY), 1992. The METS experiment is an advanced version of our MINIX rocket experiment. This paper describes the conceptual design for the METS rocket experiment. Aims are to verify the feasibility of a newly developed microwave energy transmission system designed for use in space and to study nonlinear effects of the microwave energy beam on space plasma. A high power microwave (936 W) will be transmitted by a new phase-array antenna from a mother rocket to a separate target (daughter rocket) through the Earth's ionospheric plasma. The active phased-array system has the capability of being able to focus the microwave energy at any spatial point by individually controlling the digital phase shifters.

Optimum transmission system expansion offshore considering renewable energy sources

NARCIS (Netherlands)

Torbaghan, Shahab S.; Gibescu, Madeleine

2017-01-01

This chapter provides an overview of transmission expansion planning (TEP) methods and their practical application. First, it discusses the strategic importance of the transmission system. Next, it describes the reasons why TEP remains a challenge for systems with a large share of renewable energy.

Method for analysis of averages over transmission energy of resonance neutrons

International Nuclear Information System (INIS)

Komarov, A.V.; Luk'yanov, A.A.

1981-01-01

Experimental data on transmissions on iron specimens in different energy groups have been analyzed on the basis of an earlier developed theoretical model for the description of resonance neutron averages in transmission energy, as the functions of specimen thickness and mean resonance parameters. The parameter values obtained agree with the corresponding data evaluated in the theory of mean neutron cross sections. The method suggested for the transmission description permits to reproduce experimental results for any thicknesses of specimens [ru

Cross-layer Energy Optimization Under Image Quality Constraints for Wireless Image Transmissions.

Science.gov (United States)

Yang, Na; Demirkol, Ilker; Heinzelman, Wendi

2012-01-01

Wireless image transmission is critical in many applications, such as surveillance and environment monitoring. In order to make the best use of the limited energy of the battery-operated cameras, while satisfying the application-level image quality constraints, cross-layer design is critical. In this paper, we develop an image transmission model that allows the application layer (e.g., the user) to specify an image quality constraint, and optimizes the lower layer parameters of transmit power and packet length, to minimize the energy dissipation in image transmission over a given distance. The effectiveness of this approach is evaluated by applying the proposed energy optimization to a reference ZigBee system and a WiFi system, and also by comparing to an energy optimization study that does not consider any image quality constraint. Evaluations show that our scheme outperforms the default settings of the investigated commercial devices and saves a significant amount of energy at middle-to-large transmission distances.

Low-energy electron transmission through high aspect ratio Al O nanocapillaries

DEFF Research Database (Denmark)

Milosavljević, A.R.; Jureta, J.; Víkor, G.

2009-01-01

Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined with resp......Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined...

Opportunities and Challenges of AC/DC Transmission Network Planning Considering High Proportion Renewable Energy

Directory of Open Access Journals (Sweden)

Arslan Habib

2018-03-01

Full Text Available The time and space distribution characteristics of future high proportion of renewable energy sources will bring unprecedented challenges to the electric power system’s processing and planning, the basic form of electric power system and operating characteristics will have fundamental changes. Based on the research status quo at home and abroad, this paper expounds the four scientific problems of the transmission network planning with high proportion of renewable energy. Respectively, from the network source collaborative planning, transmission network flexible planning. With the distribution network in conjunction with the transmission network planning, transmission planning program comprehensive evaluation and decision-making methods. This paper puts forward the research ideas and framework of transmission network planning considering the high proportion of renewable energy. At the end, the future high proportion of (renewable energy grid-connected transmission network’s opportunities and challenges are presented.

ACHP | Energy Development, Transmission, and Historic Preservation

Science.gov (United States)

with a focus on facilitating and expanding production within our borders, as well as creating the . While technologies vary (solar, wind, geo-thermal, bio-fuels, etc.), the challenges for the management proposing energy and transmission projects on federal land CEQ and ACHP's Handbook on Integrating NEPA and

California Energy Commission Public Interest EnergyResearch/Energy System Integration -- Transmission-Planning Research&Development Scoping Project

Energy Technology Data Exchange (ETDEWEB)

Eto, Joseph H.; Lesieutre, Bernard; Widergren, Steven

2004-07-01

The objective of this Public Interest Energy Research (PIER)scoping project is to identify options for public-interest research and development (R&D) to improve transmission-planning tools, techniques, and methods. The information presented was gathered through a review of current California utility, California Independent System Operator (ISO), and related western states electricity transmission-planning activities and emerging needs. This report presents the project teams findings organized under six topic areas and identifies 17 distinct R&D activities to improve transmission-planning in California and the West. The findings in this report are intended for use, along with other materials, by PIER staff, to facilitate discussions with stakeholders that will ultimately lead to development of a portfolio of transmission-planning R&D activities for the PIER program.

75 FR 68607 - CenterPoint Energy-Illinois Gas Transmission Company; Notice of Baseline Filing

Science.gov (United States)

2010-11-08

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. PR10-80-001] CenterPoint Energy--Illinois Gas Transmission Company; Notice of Baseline Filing November 1, 2010. Take notice that on October 28, 2010, CenterPoint Energy--Illinois Gas Transmission Company submitted a revised...

Microwave energy transmission test toward the SPS using the space station

Energy Technology Data Exchange (ETDEWEB)

Kaya, N.; Matsumoto, H.; Miyatake, S.; Kimura, I.; Nagatomo, M.

1986-12-01

An outline of a project METT (Microwave Energy Transmission Test) using the Space Station is described. The objectives of the METT are to develop and test the technology of microwave energy transmission for the future Solar Power Satellite (SPS), and to estimate the environmental effects of the high power microwaves on the ionosphere and the atmosphere. Energy generated with solar cells is transmitted from a transmitting antenna on the bus platform near the Space Station to a rectenna on the sub-satellite or the ground station in order to test the total efficiency and the functions of the developed system of the energy transmission. Plasma similar to that in the D and E layers in the ionosphere is produced in a large balloon opened on the sub-satellite in order to investigate possible interactions between the SPS microwave and the ionospheric plasma and to determine the maximum power density of the microwave beam which passes through the ionosphere.

Wireless data transmission for high energy physics applications

Science.gov (United States)

Dittmeier, Sebastian; Brenner, Richard; Dancila, Dragos; Dehos, Cedric; De Lurgio, Patrick; Djurcic, Zelimir; Drake, Gary; Gonzalez Gimenez, Jose Luis; Gustafsson, Leif; Kim, Do-Won; Locci, Elizabeth; Pfeiffer, Ullrich; Röhrich, Dieter; Rydberg, Anders; Schöning, André; Siligaris, Alexandre; Soltveit, Hans Kristian; Ullaland, Kjetil; Vincent, Pierre; Rodriguez Vazquez, Pedro; Wiedner, Dirk; Yang, Shiming

2017-08-01

Silicon tracking detectors operated at high luminosity collider experiments pose a challenge for current and future readout systems regarding bandwidth, radiation, space and power constraints. With the latest developments in wireless communications, wireless readout systems might be an attractive alternative to commonly used wired optical and copper based readout architectures. The WADAPT group (Wireless Allowing Data and Power Transmission) has been formed to study the feasibility of wireless data transmission for future tracking detectors. These proceedings cover current developments focused on communication in the 60 GHz band. This frequency band offers a high bandwidth, a small form factor and an already mature technology. Motivation for wireless data transmission for high energy physics application and the developments towards a demonstrator prototype are summarized. Feasibility studies concerning the construction and operation of a wireless transceiver system have been performed. Data transmission tests with a transceiver prototype operating at even higher frequencies in the 240 GHz band are described. Data transmission at rates up to 10 Gb/s have been obtained successfully using binary phase shift keying.

On Maximizing the Throughput of Packet Transmission under Energy Constraints.

Science.gov (United States)

Wu, Weiwei; Dai, Guangli; Li, Yan; Shan, Feng

2018-06-23

More and more Internet of Things (IoT) wireless devices have been providing ubiquitous services over the recent years. Since most of these devices are powered by batteries, a fundamental trade-off to be addressed is the depleted energy and the achieved data throughput in wireless data transmission. By exploiting the rate-adaptive capacities of wireless devices, most existing works on energy-efficient data transmission try to design rate-adaptive transmission policies to maximize the amount of transmitted data bits under the energy constraints of devices. Such solutions, however, cannot apply to scenarios where data packets have respective deadlines and only integrally transmitted data packets contribute. Thus, this paper introduces a notion of weighted throughput, which measures how much total value of data packets are successfully and integrally transmitted before their own deadlines. By designing efficient rate-adaptive transmission policies, this paper aims to make the best use of the energy and maximize the weighted throughput. What is more challenging but with practical significance, we consider the fading effect of wireless channels in both offline and online scenarios. In the offline scenario, we develop an optimal algorithm that computes the optimal solution in pseudo-polynomial time, which is the best possible solution as the problem undertaken is NP-hard. In the online scenario, we propose an efficient heuristic algorithm based on optimal properties derived for the optimal offline solution. Simulation results validate the efficiency of the proposed algorithm.

Exploration of Resource and Transmission Expansion Decisions in the Western Renewable Energy Zone Initiative

Energy Technology Data Exchange (ETDEWEB)

Mills, Andrew; Phadke, Amol; Wiser, Ryan

2010-02-16

Building transmission to reach renewable energy (RE) goals requires coordination among renewable developers, utilities and transmission owners, resource and transmission planners, state and federal regulators, and environmental organizations. The Western Renewable Energy Zone (WREZ) initiative brings together a diverse set of voices to develop data, tools, and a unique forum for coordinating transmission expansion in the Western Interconnection. In this report we use a new tool developed in the WREZ initiative to evaluate possible renewable resource selection and transmission expansion decisions. We evaluate these decisions under a number of alternative future scenarios centered on meeting 33% of the annual load in the Western Interconnection with new renewable resources located within WREZ-identified resource hubs. Of the renewable resources in WREZ resource hubs, and under the assumptions described in this report, our analysis finds that wind energy is the largest source of renewable energy procured to meet the 33% RE target across nearly all scenarios analyzed (38-65%). Solar energy is almost always the second largest source (14-41%). Solar exceeds wind by a small margin only when solar thermal energy is assumed to experience cost reductions relative to all other technologies. Biomass, geothermal, and hydropower are found to represent a smaller portion of the selected resources, largely due to the limited resource quantity of these resources identified within the WREZ-identified hubs (16-23% combined). We find several load zones where wind energy is the least cost resource under a wide range of sensitivity scenarios. Load zones in the Southwest, on the other hand, are found to switch between wind and solar, and therefore to vary transmission expansion decisions, depending on uncertainties and policies that affect the relative economics of each renewable option. Uncertainties and policies that impact bus-bar costs are the most important to evaluate carefully, but

Interregional power transmission: a component in planning for renewable energy technologies

International Nuclear Information System (INIS)

Krueger Nielsen, S.; Soerensen, B.

2000-01-01

We discuss the role played by interregional power transmission on the basis of recent scenario work. In a project dealing with long-term planning for energy efficiency and renewable energy in Europe we modelled a scenario for the present 15 EU countries' energy system in 2050. The basis for the scenario is the concept of 'fair pricing' for energy services, meaning that the price of energy should reflect all externalities, but not otherwise be taxed or subsidized. The project assessed resource availability and expected technology price developments over time for a number of energy-related technologies, both on the supply side, the intermediate conversion chain and on the demand side. Among these, transmission technologies play an important role, both in smoothing out renewable energy supplies within the European Union region, and also allowing substantial import of energy from countries outside the EU having a surplus of renewable energy based power. (orig.)

Exploration of resource and transmission expansion decisions in the Western Renewable Energy Zone initiative

International Nuclear Information System (INIS)

Mills, Andrew; Phadke, Amol; Wiser, Ryan

2011-01-01

The Western Renewable Energy Zone (WREZ) initiative brings together a diverse set of voices to develop data, tools, and a unique forum for coordinating transmission expansion in the Western Interconnection. In this paper we use a new tool developed in the WREZ initiative to evaluate possible renewable resource selection and transmission expansion decisions. We evaluate these decisions under a number of alternative future scenarios centered on meeting 33% of the annual load in the Western Interconnection with new renewable resources located within WREZ-identified resource hubs. Our analysis finds that wind energy is the largest source of renewable energy procured to meet the 33% RE target across nearly all scenarios analyzed (38-65%). Solar energy is almost always the second largest source (14-41%). We find several load zones where wind energy is the least cost resource under a wide range of sensitivity scenarios. Load zones in the Southwest, on the other hand, are found to switch between wind and solar, and therefore to vary transmission expansion decisions, depending on uncertainties and policies that affect the relative economics of each renewable option. Further, we find that even with total transmission expenditures of $17-34 billion these costs still represent just 10-19% of the total delivered cost of renewable energy. - Research highlights: → We describe a new tool to evaluate transmission expansion and renewable resource selection. → We examine a scenario where 33% of the energy in the Western Interconnection comes from renewables. → Wind energy provides the majority of new renewable energy. → For some loads, the decision to procure wind and the required transmission is insensitive to assumptions. → For other loads, assumptions can shift toward more solar, which also changes the needed transmission.

On the Energy Efficiency of Dual Clutch Transmissions and Automated Manual Transmissions

Directory of Open Access Journals (Sweden)

Fabio Vacca

2017-10-01

Full Text Available The main benefits of dual clutch transmissions (DCTs are: (i a higher energy efficiency than automatic transmission systems with torque converters; and (ii the capability to fill the torque gap during gear shifts to allow seamless longitudinal acceleration profiles. Therefore, DCTs are viable alternatives to automated manual transmissions (AMTs. For vehicles equipped with engines that can generate considerable torque, large clutch-slip energy losses occur during power-on gear shifts and, as a result, DCTs need wet clutches for effective heat dissipation. This requirement substantially reduces DCT efficiency because of the churning and ancillary power dissipations associated with the wet clutch pack. To the knowledge of the authors, this study is the first to analyse the detailed power loss contributions of a DCT with wet clutches, and their relative significance along a set of driving cycles. Based on these results, a novel hybridised AMT (HAMT with a single dry clutch and an electric motor is proposed for the same vehicle. The HAMT architecture combines the high mechanical efficiency typical of AMTs with a single dry clutch, with the torque-fill capability and operational flexibility allowed by the electric motor. The measured efficiency maps of a case study DCT and HAMT are compared. This is then complemented by the analysis of the respective fuel consumption along the driving cycles, which is simulated with an experimentally validated vehicle model. In its internal combustion engine mode, the HAMT reduces fuel consumption by >9% with respect to the DCT.

Energy-Efficient Algorithm for Sensor Networks with Non-Uniform Maximum Transmission Range

Directory of Open Access Journals (Sweden)

Yimin Yu

2011-06-01

Full Text Available In wireless sensor networks (WSNs, the energy hole problem is a key factor affecting the network lifetime. In a circular multi-hop sensor network (modeled as concentric coronas, the optimal transmission ranges of all coronas can effectively improve network lifetime. In this paper, we investigate WSNs with non-uniform maximum transmission ranges, where sensor nodes deployed in different regions may differ in their maximum transmission range. Then, we propose an Energy-efficient algorithm for Non-uniform Maximum Transmission range (ENMT, which can search approximate optimal transmission ranges of all coronas in order to prolong network lifetime. Furthermore, the simulation results indicate that ENMT performs better than other algorithms.

Alternative forms of energy transmission from OTEC plants. [Chemical and electrical

Energy Technology Data Exchange (ETDEWEB)

Konopka, A.; Biederman, N.; Talib, A.; Yudow, B.

1977-01-01

The transmission of OTEC-derived chemical and electrical energy is compared. The chemical energy-carriers considered are the following: gaseous and liquid hydrogen, liquid ammonia, methanol, gasoline, hydrazine hydrate, anhydrous hydrazine, unsymmetrical dimethylhydrazine (UDMH), 1,7-Octadiyne, and tetrahydrodicyclopentadiene. The assessment assumes that each of the above energy carriers were transported by barge and/or pipeline. The delivered costs were then compared with transmission of electricity by submarine cables. Because chemical and electrical energy are not equivalent, however, their comparison can only be done after the outputs are converted to a common form. Thus, in addition to presenting the delivered cost and overall energy efficiency of the chemical energy-carriers, we have provided a discussion of the equipment, costs, and efficiencies of converting the hydrogen and ammonia delivered into electricity, and the electricity delivered into hydrogen and ammonia. A concise technical assessment and economic analysis of components associated with the conversion, storage, transportation, and shore-based receiving facilities for the conversion of OTEC mechanical energy to chemical energy is provided and compared to the conversion and transmission of electrical power. Results concerning the hydrogen and ammonia analysis were determined as part of the OTEC program at IGT from May 1975 through May 1976 under Contract No. NSF-C1008 (AER-75-00033) with the National Science Foundation and ERDA. Information concerning carbonaceous fuels and high-energy fuels production was developed as part of the current IGT OTEC program under Contract No. E(49-18)-2426 with ERDA.

Large-scale wind energy application. Transporting wind energy over long distances using an HVDC transmission line, in combination with hydro energy or biomass energy

International Nuclear Information System (INIS)

Coelingh, J.P.; Van Wijk, A.J.M.; Betcke, J.W.H.; Geuzendam, C.; Gilijamse, W.; Westra, C.A.; Curvers, A.P.W.M.; Beurskens, H.J.M.

1995-08-01

The main objective of the study on the title subject is to assess the long-term prospects for large-scale application of wind energy, in combination with hydro energy in Norway and in combination with biomass energy in Scotland. These countries have high wind resource areas, however they are located far away from load centres. The development of new transmission technologies as High Voltage Direct Current (HVDC) transmission lines, in combination with highly suitable places for wind energy in Norway and Scotland, forms the driving force behind this study. The following two cases are being considered: (1) a large-scale wind farm (1,000 MW) in Norway from which electricity is transmitted to The Netherlands by using an HVDC transmission line, in combination with hydro energy. Hydro energy already makes a large contribution to the energy supply of Norway. Wind farms can contribute to the electricity production and save hydro energy generated electricity and make the export of electricity profitable; and (2) a large-scale wind farm (1,000 MW) in Scotland from which electricity is transmitted to The Netherlands by using an HVDC transmission line, in combination with biomass energy. Scotland has a large potential for biomass production such as energy crops and forestry. Poplars and willows cultivated on set-aside land can be gasified and fed into modern combined-cycle plants to generate electricity. In Scotland the usable potential of wind energy may be limited in the short and medium term by the capacity of the grid. New connections can overcome this constraint and allow wind energy to be treated as a European Union resource rather than as a national resource. Thus, the concept of this study is to look at the possibilities of making a 1,000 MW link from The Netherlands to Norway or to Scotland, in order to supply electricity at competitive costs generated with renewable energy sources. 16 figs., 24 tabs., 80 refs

76 FR 37809 - The Connecticut Transmission Municipal Electric Energy Cooperative; Notice of Request for Waiver...

Science.gov (United States)

2011-06-28

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TS11-4-000] The Connecticut Transmission Municipal Electric Energy Cooperative; Notice of Request for Waiver or Exemption Take notice that on June 8, 2011, the Connecticut Transmission Municipal Electric Energy Cooperative filed a petition...

Addressing preservation of elastic contrast in energy-filtered transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Brown, H.G.; D' Alfonso, A.J.; Forbes, B.D.; Allen, L.J., E-mail: lja@unimelb.edu.au

2016-01-15

Energy-filtered transmission electron microscopy (EFTEM) images with resolutions of the order of an Ångström can be obtained using modern microscopes corrected for chromatic aberration. However, the delocalized nature of the transition potentials for atomic ionization often confounds direct interpretation of EFTEM images, leading to what is known as “preservation of elastic contrast”. In this paper we demonstrate how more interpretable images might be obtained by scanning with a focused coherent probe and incoherently averaging the energy-filtered images over probe position. We dub this new imaging technique energy-filtered imaging scanning transmission electron microscopy (EFISTEM). We develop a theoretical framework for EFISTEM and show that it is in fact equivalent to precession EFTEM, where the plane wave illumination is precessed through a range of tilts spanning the same range of angles as the probe forming aperture in EFISTEM. It is demonstrated that EFISTEM delivers similar results to scanning transmission electron microscopy with an electron energy-loss spectrometer but has the advantage that it is immune to coherent aberrations and spatial incoherence of the probe and is also more resilient to scan distortions. - Highlights: • Interpretation of EFTEM images is complicated by preservation of elastic contrast. • More direct images obtained by scanning with a focused coherent probe and averaging. • This is equivalent to precession EFTEM through the solid angle defined by the probe. • Also yields similar results to energy-loss scanning transmission electron microscopy. • Scanning approach immune to probe aberrations and resilient to scan distortions.

Data Acquisition and Transmission System for Building Energy Consumption Monitoring

Directory of Open Access Journals (Sweden)

Liang Zhao

2013-01-01

Full Text Available Building energy consumption monitoring and management system have been developed widely in China in order to gain the real-time data of energy consumption in buildings for analyzing it in the next state work. This paper describes a low-cost and small-sized collector based on the STM32 microcontroller, which can be placed in a building easily to implement the work of data acquisition, storage, and transmission. The collector gathers the electricity, water, heat, and energy consumption data through the RS485 field bus and stores the data into an SD card with mass storage, finally, using Internet to finish the communication and transmission to data server through TCP protocol. The collector has been used in application for two years, and the results show that the system is reliable and stable.

75 FR 43519 - Parker-Davis Project; Transmission Capacity for Renewable Energy Between Electrical District No...

Science.gov (United States)

2010-07-26

... DEPARTMENT OF ENERGY Western Area Power Administration Parker-Davis Project; Transmission Capacity for Renewable Energy Between Electrical District No. 5 Substation and the Palo Verde Hub AGENCY... Department of Energy (DOE), is requesting SOIs from entities that are interested in purchasing transmission...

[Study on a wireless energy transmission system for the noninvasive examination micro system inside alimentary tracts].

Science.gov (United States)

He, Xiu; Yan, Guo-Zheng; Wang, Fu-Min

2008-01-01

A wireless energy transmission system for the MEMS system inside alimentary tracts is reported here in the paper. It consists of an automatic frequency tracking circuit of phase lock loop and phase shift PWM control circuit. Experimental results show that the energy transmission system is capable of automatic frequency-tracking and transmission power-adjusting and has stable received energy.

A Mixed Transmission Strategy to Achieve Energy Balancing in Wireless Sensor Networks

DEFF Research Database (Denmark)

Liu, Tong; Gu, Tao; Jin, Ning

2017-01-01

In this paper, we investigate the problem of energy balanced data collection in wireless sensor networks, aiming to balance energy consumption among all sensor nodes during the data propagation process. Energy balanced data collection can potentially save energy consumption and prolong network...... lifetime, and hence, it has many practical implications for sensor network design and deployment. The traditional hop-by-hop transmission model allows a sensor node to propagate its packets in a hop-by-hop manner toward the sink, resulting in poor energy balancing for the entire network. To address...... the problem, we apply a slice-based energy model, and divide the problem into inter-slice and intra-slice energy balancing problems. We then propose a probability-based strategy named inter-slice mixed transmission protocol and an intra-slice forwarding technique to address each of the problems. We propose...

Compressor-less Hydrogen Transmission Pipelines Deliver Large-scale Stranded Renewable Energy at Competitive Cost

International Nuclear Information System (INIS)

W Leighty; J Holloway; R Merer; B Somerday; C San Marchi; G Keith; D White

2006-01-01

We assume a transmission-constrained world, where large new wind plants and other renewable energies must pay all transmission costs for delivering their energy to distant markets. We modeled a 1,000 MW (1 GW) (name plate) wind plant in the large wind resource of the North America Great Plains, delivering exclusively hydrogen fuel, via a new gaseous hydrogen (GH2) pipeline, to an urban market at least 300 km distant. All renewable electric energy output would be converted, at the source, to hydrogen, via 100 bar output electrolyzers, directly feeding the GH2 transmission pipeline without costly compressor stations at inlet or at midline. The new GH2 pipeline is an alternative to new electric transmission lines. We investigate whether the pipeline would provide valuable energy storage. We present a simple model by which we estimate the cost of wind-source hydrogen fuel delivered to the distant city gate in year 2010, at GW scale. Ammonia, synthetic hydrocarbons, and other substances may also be attractive renewable-source energy carriers, storage media, and fuels; they are not considered in this paper. (authors)

Cross Layer Design for Optimizing Transmission Reliability, Energy Efficiency, and Lifetime in Body Sensor Networks.

Science.gov (United States)

Chen, Xi; Xu, Yixuan; Liu, Anfeng

2017-04-19

High transmission reliability, energy efficiency, and long lifetime are pivotal issues for wireless body area networks (WBANs. However, these performance metrics are not independent of each other, making it hard to obtain overall improvements through optimizing one single aspect. Therefore, a Cross Layer Design Optimal (CLDO) scheme is proposed to simultaneously optimize transmission reliability, energy efficiency, and lifetime of WBANs from several layers. Firstly, due to the fact that the transmission power of nodes directly influences the reliability of links, the optimized transmission power of different nodes is deduced, which is able to maximize energy efficiency in theory under the premise that requirements on delay and jitter are fulfilled. Secondly, a relay decision algorithm is proposed to choose optimized relay nodes. Using this algorithm, nodes will choose relay nodes that ensure a balance of network energy consumption, provided that all nodes transmit with optimized transmission power and the same packet size. Thirdly, the energy consumption of nodes is still unbalanced even with optimized transmission power because of their different locations in the topology of the network. In addition, packet size also has an impact on final performance metrics. Therefore, a synthesized cross layer method for optimization is proposed. With this method, the transmission power of nodes with more residual energy will be enhanced while suitable packet size is determined for different links in the network, leading to further improvements in the WBAN system. Both our comprehensive theoretical analysis and experimental results indicate that the performance of our proposed scheme is better than reported in previous studies. Relative to the relay selection and power control game (RSPCG) scheme, the CLDO scheme can enhance transmission reliability by more than 44.6% and prolong the lifetime by as much as 33.2%.

Nanoporous metal film: An energy-dependent transmission device for electron waves

International Nuclear Information System (INIS)

Grech, S.; Degiovanni, A.; Lapena, L.; Morin, R.

2011-01-01

We measure electron transmission through free-standing ultrathin nanoporous gold films, using the coherent electron beam emitted by sharp field emission tips in a low energy electron projection microscope setup. Transmission coefficient versus electron wavelength plots show periodic oscillations between 75 and 850 eV. These oscillations result from the energy dependence of interference between paths through the gold and paths through the nanometer-sized pores of the film. We reveal that these films constitute high transmittance quantum devices acting on electron waves through a wavelength-dependent complex transmittance defined by the porosity and the thickness of the film.

submitter Superconducting transmission lines – Sustainable electric energy transfer with higher public acceptance?

CERN Document Server

Thomas, Heiko; Chervyakov, Alexander; Stückrad, Stefan; Salmieri, Delia; Rubbia, Carlo

2016-01-01

Despite the extensive research and development investments into superconducting science and technology, both at the fundamental and at the applied levels, many benefits of superconducting transmission lines (SCTL) remain unknown to the public and decision makers at large. This paper aims at informing about the progress in this important research field. Superconducting transmission lines have a tremendous size advantage and lower total electrical losses for high capacity transmission plus a number of technological advantages compared to solutions based on standard conductors. This leads to a minimized environmental impact and enables an overall more sustainable transmission of electric energy. One of the direct benefits may be an increased public acceptance due to the low visual impact with a subsequent reduction of approval time. The access of remote renewable energy (RE) sources with high-capacity transmission is rendered possible with superior efficiency. That not only translates into further reducing $CO_2...

Regional Transmission Organizations and Wind Energy: A Happy Marriage or Divorce Proceedings?; Preprint

Energy Technology Data Exchange (ETDEWEB)

Parsons, B.; Porter, K.

2002-05-01

In 1996, the Federal Energy Regulatory Commission (FERC) issued Order 888, which required transmission-owning utilities under FERC jurisdiction to provide open access transmission service to eligible wholesale power customers. Among other things, the elements of electric service are unbundled, meaning that wind project developers must not only find a taker for the energy but also potentially make interconnection, ancillary service, and transmission arrangements for their wind projects. In 1999, the FERC issued Order 2000, which required transmission-owning utilities to file an intent with FERC on whether they have joined or plan to join a regional transmission organization (RTO). Order 2000 also required RTOs to meet certain criteria and be approved by FERC in order to begin operations as an RTO. More recently, FERC said it would issue a Notice of Proposed Rulemaking in 2002 on certain requirements and services, often termed''standard market design'' (SMD), that must be included in all transmission tariffs filed at FERC. This paper discusses the chronology of open access transmission issues, from Order 888 onward, and reviews some of the important issues raised by FERC's SMD initiative.

Prediction of transmission loss through an aircraft sidewall using statistical energy analysis

Science.gov (United States)

Ming, Ruisen; Sun, Jincai

1989-06-01

The transmission loss of randomly incident sound through an aircraft sidewall is investigated using statistical energy analysis. Formulas are also obtained for the simple calculation of sound transmission loss through single- and double-leaf panels. Both resonant and nonresonant sound transmissions can be easily calculated using the formulas. The formulas are used to predict sound transmission losses through a Y-7 propeller airplane panel. The panel measures 2.56 m x 1.38 m and has two windows. The agreement between predicted and measured values through most of the frequency ranges tested is quite good.

Potential impacts of nanotechnology on energy transmission applications and needs.

Energy Technology Data Exchange (ETDEWEB)

Elcock, D.; Environmental Science Division

2007-11-30

The application of nanotechnologies to energy transmission has the potential to significantly impact both the deployed transmission technologies and the need for additional development. This could be a factor in assessing environmental impacts of right-of-way (ROW) development and use. For example, some nanotechnology applications may produce materials (e.g., cables) that are much stronger per unit volume than existing materials, enabling reduced footprints for construction and maintenance of electricity transmission lines. Other applications, such as more efficient lighting, lighter-weight materials for vehicle construction, and smaller batteries having greater storage capacities may reduce the need for long-distance transport of energy, and possibly reduce the need for extensive future ROW development and many attendant environmental impacts. This report introduces the field of nanotechnology, describes some of the ways in which processes and products developed with or incorporating nanomaterials differ from traditional processes and products, and identifies some examples of how nanotechnology may be used to reduce potential ROW impacts. Potential environmental, safety, and health impacts are also discussed.

Effects of channel blocking on information transmission and energy efficiency in squid giant axons.

Science.gov (United States)

Liu, Yujiang; Yue, Yuan; Yu, Yuguo; Liu, Liwei; Yu, Lianchun

2018-04-01

Action potentials are the information carriers of neural systems. The generation of action potentials involves the cooperative opening and closing of sodium and potassium channels. This process is metabolically expensive because the ions flowing through open channels need to be restored to maintain concentration gradients of these ions. Toxins like tetraethylammonium can block working ion channels, thus affecting the function and energy cost of neurons. In this paper, by computer simulation of the Hodgkin-Huxley neuron model, we studied the effects of channel blocking with toxins on the information transmission and energy efficiency in squid giant axons. We found that gradually blocking sodium channels will sequentially maximize the information transmission and energy efficiency of the axons, whereas moderate blocking of potassium channels will have little impact on the information transmission and will decrease the energy efficiency. Heavy blocking of potassium channels will cause self-sustained oscillation of membrane potentials. Simultaneously blocking sodium and potassium channels with the same ratio increases both information transmission and energy efficiency. Our results are in line with previous studies suggesting that information processing capacity and energy efficiency can be maximized by regulating the number of active ion channels, and this indicates a viable avenue for future experimentation.

Exploration of Resource and Transmission Expansion Decisions in the Western Renewable Energy Zone Initiative

Energy Technology Data Exchange (ETDEWEB)

Mills, Andrew D.; Phadke, Amol A.; Wiser, Ryan H.

2010-06-10

The Western Renewable Energy Zone (WREZ) initiative brings together a diverse set of voices to develop data, tools, and a unique forum for coordinating transmission expansion in the Western Interconnection. In this paper we use a new tool developed in the WREZ initiative to evaluate possible renewable resource selection and transmission expansion decisions. We evaluate these decisions under a number of alternative future scenarios centered on meeting 33percent of the annual load in the Western Interconnection with new renewable resources located within WREZ-identified resource hubs. Our analysis finds that wind energy is the largest source of renewable energy procured to meet the 33percent RE target across nearly all scenarios analyzed (38-65percent). Solar energy is almost always the second largest source (14-41percent). We find several load zones where wind energy is the least cost resource under a wide range of sensitivity scenarios. Load zones in the Southwest, on the other hand, are found to switch between wind and solar, and therefore to vary transmission expansion decisions, depending on uncertainties and policies that affect the relative economics of each renewable option. Further, we find that even with total transmission expenditures of $17-34 billion these costs still represent just 10-19percent of the total delivered cost of renewable energy.

Transmission Power and Antenna Allocation for Energy-Efficient RF Energy Harvesting Networks with Massive MIMO

Directory of Open Access Journals (Sweden)

Yu Min Hwang

2017-06-01

Full Text Available The optimum transmission strategy for maximizing energy efficiency (EE of a multi-user massive multiple-input multiple-output (MIMO system in radio frequency energy harvesting networks is investigated. We focus on dynamic time-switching (TS antennas, to avoid the practical problems of power-splitting antennas, such as complex architectures, power loss and signal distortion when splitting the power of the received signal into power for information decoding (ID and energy harvesting (EH. However, since a single TS antenna cannot serve ID and EH simultaneously, the MIMO system is considered in this paper. We thus formulate an EE optimization problem and propose an iterative algorithm as a tractable solution, including an antenna selection strategy to optimally switch each TS antenna between ID mode and EH mode using nonlinear fractional programming and the Lagrange dual method. Further, the problem is solved under practical constraints of maximum transmission power and outage probabilities for a minimum amount of harvested power and rate capacity for each user. Simulation results show that the proposed algorithm is more energy-efficient than that of baseline schemes, and demonstrates the trade-off between the required amount of harvested power and energy efficiency.

Impact of Variable Renewable Energy on European Cross-Border Electricity Transmission

NARCIS (Netherlands)

Brancucci Martinez-Anido, C.; De Vries, L.J.; Fulli, G.

2012-01-01

The estimated growth of Europe’s electricity demand and the policy goals of mitigating climate change result in an expected increase in variable renewable energy. A high penetration of wind and solar energy will bring several new challenges to the European electricity transmission network. The

Investigation of Wave Transmission from a Floating Wave Dragon Wave Energy Converter

DEFF Research Database (Denmark)

Nørgaard, Jørgen Harck; Andersen, Thomas Lykke

2012-01-01

This paper focuses on the calibration of the MIKE21BW model against the measured wave height reduction behind a 24 kW/m Wave Dragon (WD) wave energy converter. A numerical model is used to determine the wave transmission through the floating WD in varying wave conditions. The transmission obtained...

A dual energy gamma-ray transmission technique for gold alloy identification

International Nuclear Information System (INIS)

Sumi, Tetsuo; Shingu, Hiroyasu; Iwase, Hirotoshi

1991-01-01

An application of the dual energy gamma-ray transmission techniques to gold alloy identification is presented. The measurement by dual energy gamma-ray transmission is independent of thickness and density of a sample. Due to this advantage, golden accessories such as necklaces, earrings and rings can be assayed in spite of their various thicknesses and irregular sectional shapes. Choice of a gamma-ray energy pair suitable for the object is important. The authors chose 511 keV and 1275 keV gamma-rays from 22 Na. With this energy pair, R value (a ratio of mass attenuation coefficients for low and high energy gamma-rays) is predominantly related to the weight fraction of gold of the sample. Using a 370 kBq 22 Na small source and a 50 mm dia.x 50 mm thick NaI(Tl) scintillator for 1200 seconds, a resolution of 2% for the R value was obtained. This corresponds to approximately 5% of the weight fraction of gold. A better resolution can be obtained by increasing the source activity or measurement time. (author)

77 FR 30551 - Commercial Renewable Energy Transmission on the Outer Continental Shelf (OCS) Offshore Rhode...

Science.gov (United States)

2012-05-23

... transmission grid on the Rhode Island mainland to Block Island. Deepwater Wind proposes to connect an onshore... Island LLC (Deepwater Wind) Transmission System (BITS) proposal submitted to the Bureau of Ocean Energy... electrical power from Deepwater Wind's proposed 30 megawatt (MW) offshore wind energy project located in...

Outage Analysis of Cooperative Transmission with Energy Harvesting Relay: Time Switching versus Power Splitting

Directory of Open Access Journals (Sweden)

Guanyao Du

2015-01-01

Full Text Available This paper investigates the multiuser transmission network with an energy harvesting (EH cooperative relay, where a source transmits independent information to multiple destinations with the help of an energy constrained relay. The relay can harvest energy from the radio frequency (RF signals transmitted from the source, and it helps the multiuser transmission only by consuming the harvested energy. By adopting the time switching and the power splitting relay receiver architectures, we firstly propose two protocols, the time switching cooperative multiuser transmission (TSCMT protocol and the power splitting cooperative multiuser transmission (PSCMT protocol, to enable the simultaneous information processing and EH at the relay for the system. To evaluate the system performance, we theoretically analyze the system outage probability for the two proposed protocols and then derive explicit expressions for each of them, respectively. Numerical results are provided to demonstrate the accuracy of our analytical results and reveal that compared with traditional noncooperative scheme our proposed protocols are green solutions to offer reliable communication and lower system outage probability without consuming additional energy. In particular, for the same transmit power at the source, the PSCMT protocol is superior to the TSCMT protocol to obtain lower system outage probability.

Electric power transmission for a Hanford Nuclear Energy Center (HNEC)

International Nuclear Information System (INIS)

Harty, H.; Dowis, W.J.

1983-06-01

The original study of transmission for a Hanford Nuclear Energy Center (HNEC), which was completed in September 1975, was updated in June 1978. The present 1983 revision takes cognizance of recent changes in the electric power situation of the PNW with respect to: (1) forecasts of load growth, (2) the feasibility of early use of 1100 kV transmission, and (3) the narrowing opportunities for siting nuclear plants in the region. The purpose of this update is to explore and describe additions to the existing transmission system that would be necessary to accommodate three levels of generation at HNEC. Comparisons with a PNW system having new thermal generating capacity distributed throughout the marketing region are not made as was done in earlier versions

Highly efficient solutions for smart and bulk power transmission of 'green energy'

Energy Technology Data Exchange (ETDEWEB)

Breuer, Wilfried; Retzmann, Dietmar; Uecker, Karl

2010-09-15

Environmental constraints, loss minimization and CO2 reduction will play an increasingly more important role in future. Security and sustainability of power supply as well as economic efficiency needs application of advanced technologies. Innovative solutions with HVDC (High Voltage Direct Current) and FACTS (Flexible AC Transmission Systems) have the potential to cope with these challenges. They provide the features which are necessary to avoid technical problems in power systems, they increase the transmission capacity and system stability very efficiently and help prevent cascading outages. Furthermore, they are essential for Grid Access of Renewable Energy Sources such as Hydro, Wind and Solar-Energy.

Research on optimal investment path of transmission corridor under the global energy Internet

Science.gov (United States)

Huang, Yuehui; Li, Pai; Wang, Qi; Liu, Jichun; Gao, Han

2018-02-01

Under the background of the global energy Internet, the investment planning of transmission corridor from XinJiang to Germany is studied in this article, which passes through four countries: Kazakhstan, Russia, Belarus and Poland. Taking the specific situation of different countries into account, including the length of transmission line, unit construction cost, completion time, transmission price, state tariff, inflation rate and so on, this paper constructed a power transmission investment model. Finally, the dynamic programming method is used to simulate the example, and the optimal strategies under different objective functions are obtained.

Incorporating energy efficiency into electric power transmission planning: A western United States case study

International Nuclear Information System (INIS)

Barbose, Galen L.; Sanstad, Alan H.; Goldman, Charles A.

2014-01-01

Driven by system reliability goals and the need to integrate significantly increased renewable power generation, long-range, bulk-power transmission planning processes in the United States are undergoing major changes. At the same time, energy efficiency is an increasing share of the electricity resource mix in many regions, and has become a centerpiece of many utility resource plans and state policies as a means of meeting electricity demand, complementing supply-side sources, and reducing carbon dioxide emissions from the electric power system. The paper describes an innovative project in the western United States to explicitly incorporate end-use efficiency into load forecasts – projections of electricity consumption and demand – that are a critical input into transmission planning and transmission planning studies. Institutional and regulatory background and context are reviewed, along with a detailed discussion of data sources and analytical procedures used to integrate efficiency into load forecasts. The analysis is intended as a practical example to illustrate the kinds of technical and institutional issues that must be addressed in order to incorporate energy efficiency into regional transmission planning activities. - Highlights: • Incorporating energy efficiency into electric power transmission planning is an emergent analytical and policy priority. • A new methodology for this purpose was developed and applied in the western U.S. transmission system. • Efficiency scenarios were created and incorporated into multiple load forecasts. • Aggressive deployment of efficiency policies and programs can significantly reduce projected load. • The approach is broadly applicable in long-range transmission planning

Optimal Operation of Energy Storage in Power Transmission and Distribution

Science.gov (United States)

Akhavan Hejazi, Seyed Hossein

In this thesis, we investigate optimal operation of energy storage units in power transmission and distribution grids. At transmission level, we investigate the problem where an investor-owned independently-operated energy storage system seeks to offer energy and ancillary services in the day-ahead and real-time markets. We specifically consider the case where a significant portion of the power generated in the grid is from renewable energy resources and there exists significant uncertainty in system operation. In this regard, we formulate a stochastic programming framework to choose optimal energy and reserve bids for the storage units that takes into account the fluctuating nature of the market prices due to the randomness in the renewable power generation availability. At distribution level, we develop a comprehensive data set to model various stochastic factors on power distribution networks, with focus on networks that have high penetration of electric vehicle charging load and distributed renewable generation. Furthermore, we develop a data-driven stochastic model for energy storage operation at distribution level, where the distribution of nodal voltage and line power flow are modelled as stochastic functions of the energy storage unit's charge and discharge schedules. In particular, we develop new closed-form stochastic models for such key operational parameters in the system. Our approach is analytical and allows formulating tractable optimization problems. Yet, it does not involve any restricting assumption on the distribution of random parameters, hence, it results in accurate modeling of uncertainties. By considering the specific characteristics of random variables, such as their statistical dependencies and often irregularly-shaped probability distributions, we propose a non-parametric chance-constrained optimization approach to operate and plan energy storage units in power distribution girds. In the proposed stochastic optimization, we consider

A leader-followers model of transmission augmentation for considering strategic behaviours of generating companies in energy markets

International Nuclear Information System (INIS)

Hesamzadeh, M.R.; Hosseinzadeh, N.; Wolfs, P.J.

2010-01-01

This paper suggests an integrated mathematical framework developed based on the leader-followers game for augmentation of transmission networks. Transmission Network Service Provider moves first and designs the horizon year transmission system. Generating Companies compete for having the highest share from the energy market and they find their equilibrium point using the Nash equilibrium concept. Finally, Market Management Company receives the planning schedule of transmission system and the energy offer prices and clears the market. In addition to the exact mathematical modelling of the interested players of transmission planning problem, the methodology can design the future transmission system not only for improving the system social welfare but also for encouraging competition among horizon year generating companies. (author)

Space power transmission

Energy Technology Data Exchange (ETDEWEB)

Kuribayashi, Shizuma [Mitsubishi Heavy Industries, Ltd., Tokyo, (Japan)

1989-10-05

There being a conception to utilize solar energy by use of a space power station (SPS), a method to bring that universal grace to mankind is wireless energy transmission. The wireless energy transmission is regarded to be microwave transmission or laser beam transmission. The microwave transmission is to transmit 2.45GHz band microwave from the SPS to a receiving station on the ground to meet power demand on earth. The microwave, as small in attenuation in atmosphere and resistant against rain and cloud, is made candidate and, however, problematic in influence on organism, necessary large area of receiving antenna and many other points to be studied. While the laser transmission, as more convergent of beam than the microwave transmission, is advantageous with enabling the receiving area to be small and, however, disadvantageous with being not resistant against dust, rain and cloud, if used for the energy transmission between the space and earth. 2 refs., 2 figs.

Energy-water analysis of the 10-year WECC transmission planning study cases.

Energy Technology Data Exchange (ETDEWEB)

Tidwell, Vincent Carroll; Passell, Howard David; Castillo, Cesar; Moreland, Barbara

2011-11-01

In 2011 the Department of Energy's Office of Electricity embarked on a comprehensive program to assist our Nation's three primary electric interconnections with long term transmission planning. Given the growing concern over water resources in the western U.S. the Western Electricity Coordinating Council (WECC) requested assistance with integrating water resource considerations into their broader electric transmission planning. The result is a project with three overarching objectives: (1) Develop an integrated Energy-Water Decision Support System (DSS) that will enable planners in the Western Interconnection to analyze the potential implications of water stress for transmission and resource planning. (2) Pursue the formulation and development of the Energy-Water DSS through a strongly collaborative process between the Western Electricity Coordinating Council (WECC), Western Governors Association (WGA), the Western States Water Council (WSWC) and their associated stakeholder teams. (3) Exercise the Energy-Water DSS to investigate water stress implications of the transmission planning scenarios put forward by WECC, WGA, and WSWC. The foundation for the Energy-Water DSS is Sandia National Laboratories Energy-Power-Water Simulation (EPWSim) model (Tidwell et al. 2009). The modeling framework targets the shared needs of energy and water producers, resource managers, regulators, and decision makers at the federal, state and local levels. This framework provides an interactive environment to explore trade-offs, and 'best' alternatives among a broad list of energy/water options and objectives. The decision support framework is formulated in a modular architecture, facilitating tailored analyses over different geographical regions and scales (e.g., state, county, watershed, interconnection). An interactive interface allows direct control of the model and access to real-time results displayed as charts, graphs and maps. The framework currently supports

Natural gas transmission and distribution model of the National Energy Modeling System

International Nuclear Information System (INIS)

1997-02-01

The Natural Gas Transmission and Distribution Model (NGTDM) is the component of the National Energy Modeling System (NEMS) that is used to represent the domestic natural gas transmission and distribution system. NEMS was developed in the Office of Integrated Analysis and Forecasting of the Energy Information Administration (EIA). NEMS is the third in a series of computer-based, midterm energy modeling systems used since 1974 by the EIA and its predecessor, the Federal Energy Administration, to analyze domestic energy-economy markets and develop projections. From 1982 through 1993, the Intermediate Future Forecasting System (IFFS) was used by the EIA for its analyses, and the Gas Analysis Modeling System (GAMS) was used within IFFS to represent natural gas markets. Prior to 1982, the Midterm Energy Forecasting System (MEFS), also referred to as the Project Independence Evaluation System (PIES), was employed. NEMS was developed to enhance and update EIA's modeling capability by internally incorporating models of energy markets that had previously been analyzed off-line. In addition, greater structural detail in NEMS permits the analysis of a broader range of energy issues. The time horizon of NEMS is the midterm period (i.e., through 2015). In order to represent the regional differences in energy markets, the component models of NEMS function at regional levels appropriate for the markets represented, with subsequent aggregation/disaggregation to the Census Division level for reporting purposes

Natural gas transmission and distribution model of the National Energy Modeling System

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-02-01

The Natural Gas Transmission and Distribution Model (NGTDM) is the component of the National Energy Modeling System (NEMS) that is used to represent the domestic natural gas transmission and distribution system. NEMS was developed in the Office of Integrated Analysis and Forecasting of the Energy Information Administration (EIA). NEMS is the third in a series of computer-based, midterm energy modeling systems used since 1974 by the EIA and its predecessor, the Federal Energy Administration, to analyze domestic energy-economy markets and develop projections. From 1982 through 1993, the Intermediate Future Forecasting System (IFFS) was used by the EIA for its analyses, and the Gas Analysis Modeling System (GAMS) was used within IFFS to represent natural gas markets. Prior to 1982, the Midterm Energy Forecasting System (MEFS), also referred to as the Project Independence Evaluation System (PIES), was employed. NEMS was developed to enhance and update EIA`s modeling capability by internally incorporating models of energy markets that had previously been analyzed off-line. In addition, greater structural detail in NEMS permits the analysis of a broader range of energy issues. The time horizon of NEMS is the midterm period (i.e., through 2015). In order to represent the regional differences in energy markets, the component models of NEMS function at regional levels appropriate for the markets represented, with subsequent aggregation/disaggregation to the Census Division level for reporting purposes.

Marginal cost calculation of energy production in hydro thermoelectric systems considering the transmission system

International Nuclear Information System (INIS)

Pereira, M.V.F.; Gorenstin, B.G.; Alvarenga Filho, S.

1989-01-01

The alternatives for calculation of energy marginal cost in hydroelectric systems, considering the transmission one, was analysed, including fundamental concepts; generation/transmission systems, represented by linear power flow model; production marginal costs in hydrothermal systems and computation aspects. (C.G.C.). 11 refs, 5 figs

Wireless Energy and Information Transmission in FSO and RF-FSO Links

KAUST Repository

Makki, Behrooz; Svensson, Tommy; Buisman, Koen; Perez, Joaquin; Alouini, Mohamed-Slim

2017-01-01

We propose and analyze a wireless energy and information transmission scheme in free-space optical (FSO) links. The results are presented for both quasi-static and fast-fading conditions. We derive closed-form expressions for throughput, outage

Calculation and application of energy transaction allocation factors in electric power transmission systems

Science.gov (United States)

Fradi, Aniss

The ability to allocate the active power (MW) loading on transmission lines and transformers, is the basis of the "flow based" transmission allocation system developed by the North American Electric Reliability Council. In such a system, the active power flows must be allocated to each line or transformer in proportion to the active power being transmitted by each transaction imposed on the system. Currently, this is accomplished through the use of the linear Power Transfer Distribution Factors (PTDFs). Unfortunately, no linear allocation models exist for other energy transmission quantities, such as MW and MVAR losses, MVAR and MVA flows, etc. Early allocation schemes were developed to allocate MW losses due to transactions to branches in a transmission system, however they exhibited diminished accuracy, since most of them are based on linear power flow modeling of the transmission system. This thesis presents a new methodology to calculate Energy Transaction Allocation factors (ETA factors, or eta factors), using the well-known process of integration of a first derivative function, as well as consistent and well-established mathematical and AC power flow models. The factors give a highly accurate allocation of any non-linear system quantity to transactions placed on the transmission system. The thesis also extends the new ETA factors calculation procedure to restructure a new economic dispatch scheme where multiple sets of generators are economically dispatched to meet their corresponding load and their share of the losses.

Planning Electric Transmission Lines: A Review of Recent Regional Transmission Plans

Energy Technology Data Exchange (ETDEWEB)

Eto, Joseph H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2017-04-13

The first Quadrennial Energy Review (QER) recommends that the U.S. Department of Energy (DOE) conduct a national review of transmission plans and assess the barriers and incentives to their implementation. DOE tasked Lawrence Berkeley National Laboratory (LBNL) to prepare two reports to support the agency’s response to this recommendation. This report reviews regional transmission plans and regional transmission planning processes that have been directed by Federal Energy Regulatory Commission (FERC) Order Nos. 890 and 1000. We focus on the most recent regional transmission plans (those issued in 2015 and through approximately mid-year 2016) and current regional transmission planning processes. A companion report focuses on non-plan-related factors that affect transmission projects.

HTGR molten salt sensible energy transmission and storage system design and costs

International Nuclear Information System (INIS)

1981-09-01

This report, which was prepared for Gas-Cooled Reactor Associates by United Engineers and Constructors under Contract No. GCRA/UE and C 81-203, presents the design and cost for a molten salt Sensible Energy Transmission and Storage (SETS) System. Although the reference system for this study is sized to be compatible with an 1170 MW(t) HTGR Nuclear Heat Source, the results and conclusions should be generally applicable to most large scale molten salt energy transmission system applications. A preliminary conceptual design is presented and alternative configurations are discussed. The sensitivity of system costs to variations in important system parameters are also presented. Costs for a reference case conceptual design are reported in constant 1980 dollars and inflated 1995 dollars

75 FR 51990 - CenterPoint Energy-Illinois Gas Transmission Company; Notice of Baseline Filing

Science.gov (United States)

2010-08-24

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. PR10-80-000] CenterPoint Energy--Illinois Gas Transmission Company; Notice of Baseline Filing August 17, 2010. Take notice that on August 12, 2010, the applicant listed above submitted their baseline filing of its Statement of Operating...

Beacon-S TM: Non-uniform attenuation correction for SPECT imaging. The new medium-energy transmission device for AXIS and IRIX

International Nuclear Information System (INIS)

Daniel Gagnon, D.

1999-01-01

The paper presents new medium-energy transmission device for SPECT imaging. Beacon-S includes a 356-keV medium energy 133 Ba source with a 10.54-year half-life. Beacon-S provide high-resolution and high-contrast transmission scans. The higher energy of the gamma substantially improves the transmission contrast for larger patients by virtue of better penetration through the body

Optical fiber configurations for transmission of laser energy over great distances

Science.gov (United States)

Rinzler, Charles C; Zediker, Mark S

2013-10-29

There are provided optical fiber configurations that provide for the delivery of laser energy, and in particular, the transmission and delivery of high power laser energy over great distances. These configurations further are hardened to protect the optical fibers from the stresses and conditions of an intended application. The configurations provide means for determining the additional fiber length (AFL) need to obtain the benefits of such additional fiber, while avoiding bending losses.

Energy transmission through a double-wall curved stiffened panel using Green's theorem

Science.gov (United States)

Ghosh, Subha; Bhattacharya, Partha

2015-04-01

It is a common practice in aerospace and automobile industries to use double wall panels as fuselage skins or in window panels to improve acoustic insulation. However, the scientific community is yet to develop a reliable prediction method for a suitable vibro-acoustic model for sound transmission through a curved double-wall panel. In this quest, the present work tries to delve into the modeling of energy transmission through a double-wall curved panel. Subsequently the radiation of sound power into the free field from the curved panel in the low to mid frequency range is also studied. In the developed model to simulate a stiffened aircraft fuselage configuration, the outer wall is provided with longitudinal stiffeners. A modal expansion theory based on Green's theorem is implemented to model the energy transmission through an acoustically coupled double-wall curved panel. An elemental radiator approach is implemented to calculate the radiated energy from the curved surface in to the free field. The developed model is first validated with various numerical models available. It has been observed in the present study that the radius of curvature of the surface has a prominent effect on the behavior of radiated sound power into the free field. Effect of the thickness of the air gap between the two curved surfaces on the sound power radiation has also been noted.

Experimental observation on asymmetric energy flux within the forbidden frequency band in the LC transmission line

International Nuclear Information System (INIS)

Tao Feng; Chen Weizhong; Pan Junting; Xu Wen; Du Sidan

2012-01-01

We study the energy flux in a nonlinear electrical transmission line consisting of two coupled segments which are identical in structure and different in parameters. The asymmetry of energy flux caused by nonlinear wave has been observed experimentally in the forbidden band of the line. The experiment shows whether the energy can flow through the transmission line depends on the amplitude of the boundary driving voltages, which can be well explained in the theoretical framework of nonlinear supratransmission. The numerical simulation based on Kirchhoff’s laws further verifies the existence of the asymmetric energy flux in the forbidden band.

76 FR 49762 - FirstEnergy Service Co. v. Midwest Independent Transmission System Operator, Inc.; Notice of...

Science.gov (United States)

2011-08-11

... declaratory order asking that the Commission declare that Multi-Value Project (MVP) transmission usage charges... unreasonable to apply MVP transmission usage charges to FirstEnergy or its customers migrated from the Midwest...

eV-TEM: Transmission electron microscopy in a low energy cathode lens instrument

Energy Technology Data Exchange (ETDEWEB)

Geelen, Daniël, E-mail: geelen@physics.leidenuniv.nl [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Thete, Aniket [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Schaff, Oliver; Kaiser, Alexander [SPECS GmbH, Voltastrasse 5, D-13355 Berlin (Germany); Molen, Sense Jan van der [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Tromp, Rudolf [IBM T.J. Watson Research Center, 1101 Kitchawan Road, P.O. Box 218, Yorktown Heights, NY 10598 (United States)

2015-12-15

We are developing a transmission electron microscope that operates at extremely low electron energies, 0–40 eV. We call this technique eV-TEM. Its feasibility is based on the fact that at very low electron energies the number of energy loss pathways decreases. Hence, the electron inelastic mean free path increases dramatically. eV-TEM will enable us to study elastic and inelastic interactions of electrons with thin samples. With the recent development of aberration correction in cathode lens instruments, a spatial resolution of a few nm appears within range, even for these very low electron energies. Such resolution will be highly relevant to study biological samples such as proteins and cell membranes. The low electron energies minimize adverse effects due to radiation damage. - Highlights: • We present a new way of performing low energy transmission electron microscopy in an aberration corrected LEEM/PEEM instrument. • We show a proof of principle where we measure transmitted electrons through a suspended graphene monolayer with a preliminary setup. • We present an improved setup design that provides better control of the incident electron beam.

Study on the application of energy storage system in offshore wind turbine with hydraulic transmission

International Nuclear Information System (INIS)

Fan, Yajun; Mu, Anle; Ma, Tao

2016-01-01

Highlights: • Hydraulic offshore wind turbine is capable of outputting near constant power. • Open loop hydraulic transmission uses seawater as the working fluid. • Linear control strategy distributes total flow according to demand and supply. • Constant pressure hydraulic accumulator stores/releases the surplus energy. • Simulations show the dynamic performance of the hybrid system. - Abstract: A novel offshore wind turbine comprising fluid power transmission and energy storage system is proposed. In this wind turbine, the conventional mechanical transmission is replaced by an open-loop hydraulic system, in which seawater is sucked through a variable displacement pump in nacelle connected directly with the rotor and utilized to drive a Pelton turbine installed on the floating platform. Aiming to smooth and stabilize the output power, an energy storage system with the capability of flexible charging and discharging is applied. The related mathematical model is developed, which contains some sub-models that are categorized as the wind turbine rotor, hydraulic pump, transmission pipeline, proportional valve, accumulator and hydraulic turbine. A linear control strategy is adopted to distribute the flow out of the proportional valve through comparing the demand power with captured wind energy by hydraulic pump. Ultimately, two time domain simulations demonstrate the operation of the hybrid system when the hydraulic accumulator is utilized and show how this system can be used for load leveling and stabilizing the output power.

A stable wireless energy transmission system for gastrointestinal microsystems.

Science.gov (United States)

Xin, W H; Yan, G Z; Wang, W X

2010-01-01

A wireless energy transmission system using a Helmholtz primary coil outside and a 3-dimensional secondary coil inside the body is introduced. It is designed to transmit stable power to a gastrointestinal microsystem regardless of its position and orientation when working in the gastric tract. Up to 310 mW of usable DC power can be delivered under worst-case geometrical conditions. Measured data of the system performance are presented and evaluated.

Joint Planning Of Energy Storage and Transmission Considering Wind-Storage Combined System and Demand Side Response

Science.gov (United States)

Huang, Y.; Liu, B. Z.; Wang, K. Y.; Ai, X.

2017-12-01

In response to the new requirements of the operation mode of wind-storage combined system and demand side response for transmission network planning, this paper presents a joint planning of energy storage and transmission considering wind-storage combined system and demand side response. Firstly, the charge-discharge strategy of energy storage system equipped at the outlet of wind farm and demand side response strategy are analysed to achieve the best comprehensive benefits through the coordination of the two. Secondly, in the general transmission network planning model with wind power, both energy storage cost and demand side response cost are added to the objective function. Not only energy storage operation constraints and but also demand side response constraints are introduced into the constraint condition. Based on the classical formulation of TEP, a new formulation is developed considering the simultaneous addition of the charge-discharge strategy of energy storage system equipped at the outlet of the wind farm and demand side response strategy, which belongs to a typical mixed integer linear programming model that can be solved by mature optimization software. The case study based on the Garver-6 bus system shows that the validity of the proposed model is verified by comparison with general transmission network planning model. Furthermore, the results demonstrate that the joint planning model can gain more economic benefits through setting up different cases.

Highly efficient solutions for smart and bulk power transmission of 'green energy'

Energy Technology Data Exchange (ETDEWEB)

Breuer, Wilfried; Retzmann, Dietmar; Uecker, Karl

2010-09-15

Environmental constraints, loss minimization and CO2 reduction will play an increasingly more important role in future. Security and sustainability of power supply as well as economic efficiency needs application of advanced technologies. Innovative solutions with HVDC (High Voltage Direct Current) and FACTS (Flexible AC Transmission Systems) have the potential to cope with these challenges. They provide the features which are necessary to avoid technical problems in power systems, they increase the transmission capacity and system stability very efficiently and help prevent cascading outages. Furthermore, they are essential for Grid Access of Renewable Energy Sources such as Hydro, Wind and Solar-Energy.

Wireless (Power Transfer Transmission of Electrical Energy (Electricity Intended for Consumer Purposes up to 50 W

Directory of Open Access Journals (Sweden)

Marek Piri

2016-01-01

Full Text Available This project deals with Power Semiconductor Systems PSS for wireless transmission of electricity to the power of 50~W with regard to the distance and transmission efficiency. We decided to use electromagnetic resonance for electrical energy transmission. For experimental verification, we have wound two coils of identical dimensions. At a given power transmission solutions, we obtain the highest efficiency η = 70% at a distance of 5 cm, where the transmitted power was 48 W.

A Cognitive Radio-Based Energy-Efficient System for Power Transmission Line Monitoring in Smart Grids

Directory of Open Access Journals (Sweden)

Saeed Ahmed

2017-01-01

Full Text Available The research in industry and academia on smart grids is predominantly focused on the regulation of generated power and management of its consumption. Because transmission of bulk-generated power to the consumer is immensely reliant on secure and efficient transmission grids, comprising huge electrical and mechanical assets spanning a vast geographic area, there is an impending need to focus on the transmission grids as well. Despite the challenges in wireless technologies for SGs, cognitive radio networks are considered promising for provisioning of communications services to SGs. In this paper, first, we present an IEEE 802.22 wireless regional area network cognitive radio-based network model for smart monitoring of transmission lines. Then, for a prolonged lifetime of battery finite monitoring network, we formulate the spectrum resource allocation problem as an energy efficiency maximization problem, which is a nonlinear integer programming problem. To solve this problem in an easier way, we propose an energy-efficient resource-assignment scheme based on the Hungarian method. Performance analysis shows that, compared to a pure opportunistic assignment scheme with a throughput maximization objective and compared to a random scheme, the proposed scheme results in an enhanced lifetime while consuming less battery energy without compromising throughput performance.

Adaptive Control of the Packet Transmission Period with Solar Energy Harvesting Prediction in Wireless Sensor Networks

Directory of Open Access Journals (Sweden)

Kideok Kwon

2015-04-01

Full Text Available A number of research works has studied packet scheduling policies in energy scavenging wireless sensor networks, based on the predicted amount of harvested energy. Most of them aim to achieve energy neutrality, which means that an embedded system can operate perpetually while meeting application requirements. Unlike other renewable energy sources, solar energy has the feature of distinct periodicity in the amount of harvested energy over a day. Using this feature, this paper proposes a packet transmission control policy that can enhance the network performance while keeping sensor nodes alive. Furthermore, this paper suggests a novel solar energy prediction method that exploits the relation between cloudiness and solar radiation. The experimental results and analyses show that the proposed packet transmission policy outperforms others in terms of the deadline miss rate and data throughput. Furthermore, the proposed solar energy prediction method can predict more accurately than others by 6.92%.

Adaptive control of the packet transmission period with solar energy harvesting prediction in wireless sensor networks.

Science.gov (United States)

Kwon, Kideok; Yang, Jihoon; Yoo, Younghwan

2015-04-24

A number of research works has studied packet scheduling policies in energy scavenging wireless sensor networks, based on the predicted amount of harvested energy. Most of them aim to achieve energy neutrality, which means that an embedded system can operate perpetually while meeting application requirements. Unlike other renewable energy sources, solar energy has the feature of distinct periodicity in the amount of harvested energy over a day. Using this feature, this paper proposes a packet transmission control policy that can enhance the network performance while keeping sensor nodes alive. Furthermore, this paper suggests a novel solar energy prediction method that exploits the relation between cloudiness and solar radiation. The experimental results and analyses show that the proposed packet transmission policy outperforms others in terms of the deadline miss rate and data throughput. Furthermore, the proposed solar energy prediction method can predict more accurately than others by 6.92%.

Price-based optimal control of power flow in electrical energy transmission networks

NARCIS (Netherlands)

Jokic, A.; Lazar, M.; Bosch, van den P.P.J.; Bemporad, A.; Bicchi, A.; Buttazzo, G.

2007-01-01

This article presents a novel control scheme for achieving optimal power balancing and congestion control in electrical energy transmission networks via nodal prices. We develop an explicit controller that guarantees economically optimal steady-state operation while respecting all line flow

Research on energy transmission calculation problem on laser detecting submarine

Science.gov (United States)

Fu, Qiang; Li, Yingchao; Zhang, Lizhong; Wang, Chao; An, Yan

2014-12-01

The laser detection and identification is based on the method of using laser as the source of signal to scan the surface of ocean. If the laser detection equipment finds out the target, it will immediately reflect the returning signal, and then through receiving and disposing the returning signal by the receiving system, to realize the function of detection and identification. Two mediums channels should be though in the process of laser detection transmission, which are the atmosphere and the seawater. The energy loss in the process of water transport, mainly considering the surface reflection and scattering attenuation and internal attenuation factors such as seawater. The energy consumption though atmospheric transmission, mainly considering the absorption of atmospheric and the attenuation causing by scattering, the energy consumption though seawater transmission, mainly considering the element such as surface reflection, the attenuation of scattering and internal attenuation of seawater. On the basis of the analysis and research, through the mode of establishment of atmospheric scattering, the model of sea surface reflection and the model of internal attenuation of seawater, determine the power dissipation of emitting lasers system, calculates the signal strength that reaches the receiver. Under certain conditions, the total attenuation of -98.92 dB by calculation, and put forward the related experiment scheme by the use of Atmospheric analog channel, seawater analog channel. In the experiment of the theory, we use the simulation pool of the atmosphere and the sea to replace the real environment where the laser detection system works in this kind of situation. To start with, we need to put the target in the simulating seawater pool of 10 meters large and then control the depth of the target in the sea level. We, putting the laser detection system in position where it is 2 kilometers far from one side, secondly use the equipment to aim at the target in some

Model documentation: Natural gas transmission and distribution model of the National Energy Modeling System. Volume 1

International Nuclear Information System (INIS)

1995-01-01

The Natural Gas Transmission and Distribution Model (NGTDM) is the component of the National Energy Modeling System (NEMS) that is used to represent the domestic natural gas transmission and distribution system. NEMS was developed in the Office of integrated Analysis and Forecasting of the Energy information Administration (EIA). NEMS is the third in a series of computer-based, midterm energy modeling systems used since 1974 by the EIA and its predecessor, the Federal Energy Administration, to analyze domestic energy-economy markets and develop projections. The NGTDM is the model within the NEMS that represents the transmission, distribution, and pricing of natural gas. The model also includes representations of the end-use demand for natural gas, the production of domestic natural gas, and the availability of natural gas traded on the international market based on information received from other NEMS models. The NGTDM determines the flow of natural gas in an aggregate, domestic pipeline network, connecting domestic and foreign supply regions with 12 demand regions. The methodology employed allows the analysis of impacts of regional capacity constraints in the interstate natural gas pipeline network and the identification of pipeline capacity expansion requirements. There is an explicit representation of core and noncore markets for natural gas transmission and distribution services, and the key components of pipeline tariffs are represented in a pricing algorithm. Natural gas pricing and flow patterns are derived by obtaining a market equilibrium across the three main elements of the natural gas market: the supply element, the demand element, and the transmission and distribution network that links them. The NGTDM consists of four modules: the Annual Flow Module, the Capacity F-expansion Module, the Pipeline Tariff Module, and the Distributor Tariff Module. A model abstract is provided in Appendix A

Model documentation: Natural gas transmission and distribution model of the National Energy Modeling System. Volume 1

Energy Technology Data Exchange (ETDEWEB)

NONE

1995-02-17

The Natural Gas Transmission and Distribution Model (NGTDM) is the component of the National Energy Modeling System (NEMS) that is used to represent the domestic natural gas transmission and distribution system. NEMS was developed in the Office of integrated Analysis and Forecasting of the Energy information Administration (EIA). NEMS is the third in a series of computer-based, midterm energy modeling systems used since 1974 by the EIA and its predecessor, the Federal Energy Administration, to analyze domestic energy-economy markets and develop projections. The NGTDM is the model within the NEMS that represents the transmission, distribution, and pricing of natural gas. The model also includes representations of the end-use demand for natural gas, the production of domestic natural gas, and the availability of natural gas traded on the international market based on information received from other NEMS models. The NGTDM determines the flow of natural gas in an aggregate, domestic pipeline network, connecting domestic and foreign supply regions with 12 demand regions. The methodology employed allows the analysis of impacts of regional capacity constraints in the interstate natural gas pipeline network and the identification of pipeline capacity expansion requirements. There is an explicit representation of core and noncore markets for natural gas transmission and distribution services, and the key components of pipeline tariffs are represented in a pricing algorithm. Natural gas pricing and flow patterns are derived by obtaining a market equilibrium across the three main elements of the natural gas market: the supply element, the demand element, and the transmission and distribution network that links them. The NGTDM consists of four modules: the Annual Flow Module, the Capacity F-expansion Module, the Pipeline Tariff Module, and the Distributor Tariff Module. A model abstract is provided in Appendix A.

ENERGY EFFICIENCY OF DIESEL LOCOMOTIVE HYDRAULIC TRANSMISSION TESTS AT LOCOMOTIVE REPAIR PLANT

Directory of Open Access Journals (Sweden)

B. E. Bodnar

2015-10-01

Full Text Available Purpose. In difficult economic conditions, cost reduction of electricity consumption for the needs of production is an urgent task for the country’s industrial enterprises. Technical specifications of enterprises, which repair diesel locomotive hydraulic transmission, recommend conducting a certain amount of evaluation and regulatory tests to monitor their condition after repair. Experience shows that a significant portion of hydraulic transmission defects is revealed by bench tests. The advantages of bench tests include the ability to detect defects after repair, ease of maintenance of the hydraulic transmission and relatively low labour intensity for eliminating defects. The quality of these tests results in the transmission resource and its efficiency. Improvement of the technology of plant post-repairs hydraulic tests in order to reduce electricity consumption while testing. Methodology. The possible options for hydraulic transmission test bench improvement were analysed. There was proposed an energy efficiency method for diesel locomotive hydraulic transmission testing in locomotive repair plant environment. This is achieved by installing additional drive motor which receives power from the load generator. Findings. Based on the conducted analysis the necessity of improving the plant stand testing of hydraulic transmission was proved. The variants of the stand modernization were examined. The test stand modernization analysis was conducted. Originality. The possibility of using electric power load generator to power the stand electric drive motor or the additional drive motor was theoretically substantiated. Practical value. A variant of hydraulic transmission test stand based on the mutual load method was proposed. Using this method increases the hydraulic transmission load range and power consumption by stand remains unchanged. The additional drive motor will increase the speed of the input shaft that in its turn wil allow testing in

A method of applying two-pump system in automatic transmissions for energy conservation

Directory of Open Access Journals (Sweden)

Peng Dong

2015-06-01

Full Text Available In order to improve the hydraulic efficiency, modern automatic transmissions tend to apply electric oil pump in their hydraulic system. The electric oil pump can support the mechanical oil pump for cooling, lubrication, and maintaining the line pressure at low engine speeds. In addition, the start–stop function can be realized by means of the electric oil pump; thus, the fuel consumption can be further reduced. This article proposes a method of applying two-pump system (one electric oil pump and one mechanical oil pump in automatic transmissions based on the forward driving simulation. A mathematical model for calculating the transmission power loss is developed. The power loss transfers to heat which requires oil flow for cooling and lubrication. A leakage model is developed to calculate the leakage of the hydraulic system. In order to satisfy the flow requirement, a flow-based control strategy for the electric oil pump is developed. Simulation results of different driving cycles show that there is a best combination of the size of electric oil pump and the size of mechanical oil pump with respect to the optimal energy conservation. Besides, the two-pump system can also satisfy the requirement of the start–stop function. This research is extremely valuable for the forward design of a two-pump system in automatic transmissions with respect to energy conservation and start–stop function.

Efficiency and the public interest: QF transmission and the Energy Policy Act of 1992

International Nuclear Information System (INIS)

Fox-Penner, P.

1993-01-01

Prior to the enactment of the Energy Policy Act of 1992 (Act), most Federal Energy Regulatory Commission (FERC or Commission) deliberations involving transmission services did not occur in transmission rate or service proceedings per se. The Commission conducted a number of general inquiries or studies of the subject, including setting the terms and conditions of transmission services as part of merger proceedings and open-quotes market-basedclose quotes pricing proceedings. With the passage of the Act, the FERC is likely to be asked to confront the advisability of requiring transmission services in a more direct manner. The Act permits open-quotes[a]ny electric utility, Federal power marketing agency, or any other person generating electrical energy for sale for resaleclose quotes to petition the Commission for a wheeling order. The FERC may order wheeling in accordance with section 212 of the Federal Power Act (FPA) and a finding that such wheeling would open-quotes otherwise be in the public interest.close quotes When compounded with the need to find that wheeling is in the public interest, the requirements set forth in section 212 are considerable. This article focuses on an important area of section 212 criteria, namely the interplay between between the public interest and economic efficiency criteria in the case of Public Utility Regulatory Policies Act of 1978 (PURPA) Qualifying Facilities (QF). Two recent proceedings in which the FERC considered the need to provide power transmission service guarantees for QFs are analyzed from the standpoint of public and private economic welfare. The two proceedings are the merger of Utah Power ampersand Light Company, PacifiCorp, PC/UP ampersand L Merging Corporation (Utah) and the Western Systems Power Pool application (WSPP)

A Pilot Directional Protection for HVDC Transmission Line Based on Relative Entropy of Wavelet Energy

Directory of Open Access Journals (Sweden)

Sheng Lin

2015-07-01

Full Text Available On the basis of analyzing high-voltage direct current (HVDC transmission system and its fault superimposed circuit, the direction of the fault components of the voltage and the current measured at one end of transmission line is certified to be different for internal faults and external faults. As an estimate of the differences between two signals, relative entropy is an effective parameter for recognizing transient signals in HVDC transmission lines. In this paper, the relative entropy of wavelet energy is applied to distinguish internal fault from external fault. For internal faults, the directions of fault components of voltage and current are opposite at the two ends of the transmission line, indicating a huge difference of wavelet energy relative entropy; for external faults, the directions are identical, indicating a small difference. The simulation results based on PSCAD/EMTDC show that the proposed pilot protection system acts accurately for faults under different conditions, and its performance is not affected by fault type, fault location, fault resistance and noise.

Facilitating efficient augmentation of transmission networks to connect renewable energy generation: the Australian experience

International Nuclear Information System (INIS)

Wright, Glen

2012-01-01

Australia is heavily dependent on coal for electricity generation. The Renewable Energy Target has spurred growth in the utilization of renewable energy sources, with further growth expected into the future. Australia's strongest renewable energy sources are generally distant from the transmission network in resource ‘basins’. Investment is needed to augment the transmission network to enable delivery of electricity from these sources to consumers. Considerable economies of scale flow from anticipating the connection of numerous generators in an area over time and sizing augmentations accordingly. Following a lengthy rulemaking process, the National Electricity Rules were recently amended by a new rule, designed to facilitate the construction of such efficiently sized augmentations. However, the new rule is more conservative than initially envisaged, making little substantive change to the current frameworks for augmentation and connection. This paper outlines these frameworks and the rulemaking process and identifies the key debates surrounding the rule change are identified. This paper then provides a detailed analysis of the new rule, concluding that it is defective in a number of respects and is unlikely to result in the efficient and timely augmentation of the network needed to unlock the potential of Australia's strongest renewable energy resources. - Highlights: ► Remoteness of renewable energy sources is a barrier to greater renewable energy utilization. ► Significant economies of scale flow from efficiently-sized transmission network augmentation. ► Current frameworks in Australia do not incentivise efficiently-sized network augmentations. ► The lack of property rights in an augmentation is particularly problematic. ► The new Scale Efficient Network Extensions rule is not apt to facilitate efficiently-sized network augmentations.

The transmission business rate order application, 1999-2000 : application to the Ontario Energy Board

International Nuclear Information System (INIS)

1998-01-01

The Ontario government is restructuring the electric power industry by introducing competition to the generation and retailing sectors, as well as to the transmission and distribution sectors within the industry. This application marks the beginning of the regulation of the Ontario Hydro Services Company Inc.'s (OHSC) transmission business by the Ontario Energy Board (OEB). The OHSC has asked the OEB to approve a revenue requirement for the transmission business and rates derived from the revenue requirement for unbundled transmission services to customers for the year 1999. For the year 2000, the OHSC asked the OEB to approve the performance-based regulation mechanism and the transmission rates derived from that mechanism. This document includes the actual text of the application and provides the justification for the $1,327 million revenue requirement for 1999 and the PBR framework forecast of $ 1,291 million for the year 2000. tabs., figs

A Monte Carlo study of the energy spectra and transmission characteristics of scattered radiation from x-ray computed tomography.

Science.gov (United States)

Platten, David John

2014-06-01

Existing data used to calculate the barrier transmission of scattered radiation from computed tomography (CT) are based on primary beam CT energy spectra. This study uses the EGSnrc Monte Carlo system and Epp user code to determine the energy spectra of CT scatter from four different primary CT beams passing through an ICRP 110 male reference phantom. Each scatter spectrum was used as a broad-beam x-ray source in transmission simulations through seventeen thicknesses of lead (0.00-3.50 mm). A fit of transmission data to lead thickness was performed to obtain α, β and γ parameters for each spectrum. The mean energy of the scatter spectra were up to 12.3 keV lower than that of the primary spectrum. For 120 kVp scatter beams the transmission through lead was at least 50% less than predicted by existing data for thicknesses of 1.5 mm and greater; at least 30% less transmission was seen for 140 kVp scatter beams. This work has shown that the mean energy and half-value layer of CT scatter spectra are lower than those of the corresponding primary beam. The transmission of CT scatter radiation through lead is lower than that calculated with currently available data. Using the data from this work will result in less lead shielding being required for CT scanner installations.

Development of transmission dose estimation algorithm for in vivo dosimetry in high energy radiation treatment

International Nuclear Information System (INIS)

Yun, Hyong Geun; Shin, Kyo Chul; Hun, Soon Nyung; Woo, Hong Gyun; Ha, Sung Whan; Lee, Hyoung Koo

2004-01-01

In vivo dosimetry is very important for quality assurance purpose in high energy radiation treatment. Measurement of transmission dose is a new method of in vivo dosimetry which is noninvasive and easy for daily performance. This study is to develop a tumor dose estimation algorithm using measured transmission dose for open radiation field. For basic beam data, transmission dose was measured with various field size (FS) of square radiation field, phantom thickness (Tp), and phantom chamber distance (PCD) with a acrylic phantom for 6 MV and 10 MV X-ray. Source to chamber distance (SCD) was set to 150 cm. Measurement was conducted with a 0.6 cc Farmer type ion chamber. By using regression analysis of measured basic beam data, a transmission dose estimation algorithm was developed. Accuracy of the algorithm was tested with flat solid phantom with various thickness in various settings of rectangular fields and various PCD. In our developed algorithm, transmission dose was equated to quadratic function of log(A/P) (where A/P is area-perimeter ratio) and the coefficients of the quadratic functions were equated to tertiary functions of PCD. Our developed algorithm could estimate the radiation dose with the errors within ±0.5% for open square field, and with the errors within ±1.0% for open elongated radiation field. Developed algorithm could accurately estimate the transmission dose in open radiation fields with various treatment settings of high energy radiation treatment. (author)

Principle of energy-filtering transmission electron microscopy and its applications

International Nuclear Information System (INIS)

Kurata, Hiroki

1997-01-01

Energy-filtering transmission electron microscopy (EFTEM) is widely used to make images and diffraction patterns more quantitative by removing the inelastic background, and to perform elemental and chemical mapping at high spatial resolution. The principal factors restricting the spatial resolution in elemental maps are discussed. The relativistic effect on inelastic scattering cross-section, which becomes significant for high-voltage EFTEM analysis, is also discussed in relation to the detection efficiency of core-loss signals. (author)

Energy-Efficient Multicast Transmission for Underlay Device-to-Device Communications: A Social-Aware Perspective

Directory of Open Access Journals (Sweden)

Fan Jiang

2017-01-01

Full Text Available In this paper, by utilizing the social relationships among mobile users, we present a framework of energy-efficient cluster formation and resource allocation for multicast D2D transmission. In particular, we first deal with D2D multicast cluster/group formation strategy from both physical distance and social trust level. Then we aim to maximize the overall energy-efficiency of D2D multicast groups through resource allocation and power control scheme, which considers the quality-of-service (QoS requirements of both cellular user equipment and D2D groups. A heuristic algorithm is proposed to solve above energy-efficiency problem with less complexity. After that, considering the limited battery capacity of mobile users, we propose an energy and social aware cluster head update algorithm, which incorporates both the energy constraint and social centrality measurement. Numerical results indicate that the proposed social-tie based D2D multicast group formation and update algorithm form a multicast group in an energy efficient way. Moreover, the proposed resource and power allocation scheme achieves better energy efficiency in terms of throughput per energy consumption. These results show that, by exploiting social domain information, underlay D2D multicast transmission has high practical potential in saving the source on wireless links and in the backhaul.

Research on hybrid transmission mode for HVDC with optimal thermal power and renewable energy combination

Science.gov (United States)

Zhang, Jinfang; Yan, Xiaoqing; Wang, Hongfu

2018-02-01

With the rapid development of renewable energy in Northwest China, curtailment phenomena is becoming more and more serve owing to lack of adjustment ability and enough transmission capacity. Based on the existing HVDC projects, exploring the hybrid transmission mode associated with thermal power and renewable power will be necessary and important. This paper has proposed a method on optimal thermal power and renewable energy combination for HVDC lines, based on multi-scheme comparison. Having established the mathematic model for electric power balance in time series mode, ten different schemes have been picked for figuring out the suitable one by test simulation. By the proposed related discriminated principle, including generation device utilization hours, renewable energy electricity proportion and curtailment level, the recommendation scheme has been found. The result has also validated the efficiency of the method.

Development of a secondary electron energy analyzer for a transmission electron microscope.

Science.gov (United States)

Magara, Hideyuki; Tomita, Takeshi; Kondo, Yukihito; Sato, Takafumi; Akase, Zentaro; Shindo, Daisuke

2018-04-01

A secondary electron (SE) energy analyzer was developed for a transmission electron microscope. The analyzer comprises a microchannel plate (MCP) for detecting electrons, a coil for collecting SEs emitted from the specimen, a tube for reducing the number of backscattered electrons incident on the MCP, and a retarding mesh for selecting the energy of SEs incident on the MCP. The detection of the SEs associated with charging phenomena around a charged specimen was attempted by performing electron holography and SE spectroscopy using the energy analyzer. The results suggest that it is possible to obtain the energy spectra of SEs using the analyzer and the charging states of a specimen by electron holography simultaneously.

System of failures diagnosis for energy transmission systems, using Petri nets

International Nuclear Information System (INIS)

Zapata, German; Grisales, John Faber; Gomez, Juan Camilo; Quintero Henao, Luis Fernando

2005-01-01

An expert system of second generation was used integrating the inverse Petri nets (RPN) and the systems based on rules (rule-based system) for the accomplishment of a program in Visual Basic that helps in the obtaining of an opportune and fast analysis of transmission of energy at the time of happening a fault in anymore of its components (line or bus). The program is proven in a portion of system IEEE -118 standard bus test system, in which two extracted cases of literature are developed and are the obtained results. Finally tests realized with the method developed in the laboratory of machines of the national university of Colombia, Medellin campus, simulating a system of transmission with two lines and two buses

Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

KAUST Repository

Rakia, Tamer; Yang, Hong-Chuan; Gebali, Fayez; Alouini, Mohamed-Slim

2017-01-01

In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different

Two-Stage Design Method for Enhanced Inductive Energy Transmission with Q-Constrained Planar Square Loops.

Directory of Open Access Journals (Sweden)

Akaa Agbaeze Eteng

Full Text Available Q-factor constraints are usually imposed on conductor loops employed as proximity range High Frequency Radio Frequency Identification (HF-RFID reader antennas to ensure adequate data bandwidth. However, pairing such low Q-factor loops in inductive energy transmission links restricts the link transmission performance. The contribution of this paper is to assess the improvement that is reached with a two-stage design method, concerning the transmission performance of a planar square loop relative to an initial design, without compromise to a Q-factor constraint. The first stage of the synthesis flow is analytical in approach, and determines the number and spacing of turns by which coupling between similar paired square loops can be enhanced with low deviation from the Q-factor limit presented by an initial design. The second stage applies full-wave electromagnetic simulations to determine more appropriate turn spacing and widths to match the Q-factor constraint, and achieve improved coupling relative to the initial design. Evaluating the design method in a test scenario yielded a more than 5% increase in link transmission efficiency, as well as an improvement in the link fractional bandwidth by more than 3%, without violating the loop Q-factor limit. These transmission performance enhancements are indicative of a potential for modifying proximity HF-RFID reader antennas for efficient inductive energy transfer and data telemetry links.

The Cost of Transmission for Wind Energy: A Review of Transmission Planning Studies

Energy Technology Data Exchange (ETDEWEB)

Mills, Andrew D.; Wiser, Ryan; Porter, Kevin

2009-02-02

The rapid development of wind power that the United States has experienced over the last several years has been coupled with a growing concern that wind development will require substantial additions to the nation's transmission infrastructure. Transmission is particularly important for wind power due to the locational dependence of wind resources, the relatively low capacity factor of wind plants, and the mismatch between the short lead time to build a new wind project and the longer lead time often needed to plan, permit, and construct transmission. It is clear that institutional issues related to transmission planning, siting, and cost allocation will pose major obstacles to accelerated wind power deployment, but also of concern is the potential cost of this infrastructure build out. Simply put, how much extra cost will society bear to deliver wind power to load centers? Without an answer to this question, there can be no consensus on whether or not the cost of developing transmission for wind will be a major barrier to further wind deployment, or whether the institutional barriers to transmission expansion are likely to be of more immediate concern. In this report, we review a sample of 40 detailed transmission studies that have included wind power. These studies cover a broad geographic area, and were completed from 2001-2008. Our primary goal in reviewing these studies is to develop a better understanding of the transmission costs needed to access growing quantities of wind generation. A secondary goal is to gain a better appreciation of the differences in transmission planning approaches in order to identify those methodologies that seem most able to estimate the incremental transmission costs associated with wind development. Finally, we hope that the resulting dataset and discussion might be used to inform the assumptions, methods, and results of higher-level assessment models that are sometimes used to estimate the cost of wind deployment (e.g. NEMS

High voltage transmission of electrical energy over long distances

Energy Technology Data Exchange (ETDEWEB)

Tewari, S W

1962-07-01

Technical aspects of ac transmission lines, additional means of improving stability ac transmisson lines, insulation problems, ac transmission by cables, high voltage dc transmission, advantages of dc over ac transmission, disadvantages of dc transmission, use of underground cables for dc transmission, history of the development of conversion equipment; transmission schemes adopted on Gotland Island, Sweden; and economics of ac and dc transmission are discussed.

Illumination, data transmission, and energy harvesting: the threefold advantage of VLC.

Science.gov (United States)

Sandalidis, Harilaos G; Vavoulas, Alexander; Tsiftsis, Theodoros A; Vaiopoulos, Nicholas

2017-04-20

Visible light communication (VLC) is a promising technology that meets illumination and information transmission requirements in an indoor environment. Because light waves convey energy, a VLC link may exploit that fact for energy harvesting purposes. In this context, a single light emitting diode lamp located at a close distance over a tablet or laptop PC can potentially offer simultaneous lighting, Internet access, and battery recharging without cables. The present study introduces this threefold role of VLC systems by properly adapting some energy harvesting receiver architectures recently launched for usage in RF communications. The rate-energy trade-off for these architectures is revealed in order to maximize the efficiency of simultaneous energy and information reception, by elaborating on indicative numerical results. Furthermore, the performance in terms of the bit-error rate for pulse amplitude modulated signals is investigated. The results obtained offer some useful insights into the effective optical receiver implementation from the aspect of information theory.

Analysis of Energy Transmission Modes of Flyback Converter

Directory of Open Access Journals (Sweden)

GONG Shu

2014-08-01

Full Text Available It is of significance to investigate energy transmission modes of a flyback converter for its optimum design. In this paper, the ETMs of a flyback converter are divided into three modes, which are continuous conduction mode-complete inductor supply mode, continuous conduction mode- incomplete inductor supply mode and discontinuous conduction mode-incomplete inductor supply mode, respectively. A deep analysis of the operation is made, a reduction of the boundary condition between the modes is conducted and a comparison of current stress, transformer AP and output ripple voltage between the modes is performed. A 30W prototype is developed and its experiment is done. The experiment results are in agreement with the theoretical analysis quite well.

Energy transmission re: Remote sites key to economic development for the Arctic and developing regions

Energy Technology Data Exchange (ETDEWEB)

Olds, G A [Dept. of Commerce and Development, Juneau, AK (United States)

1992-01-01

Recent developments of laser technology in energy beaming have converged to suggest the possibility of controlled experimentation in testing the viability, environmental soundness, and economic feasibility of wireless energy transmission in Alaska. The reasons why Alaska was thought to be an ideal setting for such experimental development are discussed.

Transmission of Helium Isotopes through Graphdiyne Pores: Tunneling versus Zero Point Energy Effects.

Science.gov (United States)

Hernández, Marta I; Bartolomei, Massimiliano; Campos-Martínez, José

2015-10-29

Recent progress in the production of new two-dimensional (2D) nanoporous materials is attracting considerable interest for applications to isotope separation in gases. In this paper we report a computational study of the transmission of (4)He and (3)He through the (subnanometer) pores of graphdiyne, a recently synthesized 2D carbon material. The He-graphdiyne interaction is represented by a force field parametrized upon ab initio calculations, and the (4)He/(3)He selectivity is analyzed by tunneling-corrected transition state theory. We have found that both zero point energy (of the in-pore degrees of freedom) and tunneling effects play an extraordinary role at low temperatures (≈20-30 K). However, both quantum features work in opposite directions in such a way that the selectivity ratio does not reach an acceptable value. Nevertheless, the efficiency of zero point energy is in general larger, so that (4)He tends to diffuse faster than (3)He through the graphdiyne membrane, with a maximum performance at 23 K. Moreover, it is found that the transmission rates are too small in the studied temperature range, precluding practical applications. It is concluded that the role of the in-pore degrees of freedom should be included in computations of the transmission probabilities of molecules through nanoporous materials.

Experiment of Power Supply Method for WLAN Sensor Using Both Energy Harvesting and Microwave Power Transmission

International Nuclear Information System (INIS)

Sakaguchi, K; Yamashita, S; Yamamoto, K; Nishio, T; Morikura, M; Huang, Y; Shinohara, N

2014-01-01

This paper proposes to improve effectiveness of supplying a sensor with energy using microwave power transmission (MPT) and energy harvesting (EH). The MPT duration should be as short as possible to avoid serious interference between the MPT and wireless local area network data transmission when co-channel operation of both microwave power transmission (MPT) and wireless data transmissions is performed. To shorten the MPT duration, we use multiple power sources such as an MPT source and an EH source to supply a sensor with power. Here, an overcharge or an energy shortage could occur at the sensor if the power supplied by both the MPT and EH sources is not adjusted appropriately. To solve this problem, the power supplied by multiple sources should be estimated precisely. In this paper, we propose a scheme for estimating the power supplied by multiple sources on the basis of an existing MPT scheduling system and then conducted an experiment using the scheme. From the experimental results, it is confirmed to estimate the power supplied by multiple sources successfully. In addition, the required MPT duration when the EH source is used is reduced compared to that when it is not used. Moreover, it is confirmed that the sensor station successfully estimates the power supplied by an MPT source and that by an EH source and adequately configures the MPT duration

Optical fiber cable for transmission of high power laser energy over great distances

Science.gov (United States)

Zediker, Mark S.; Rinzler, Charles C.; Faircloth, Brian O.; Moxley, Joel F.; Koblick, Yeshaya

2016-05-24

There is provided a system and apparatus for the transmission of high power laser energy over great distances without substantial power loss and without the presence of stimulated Raman scattering. There is further provided systems and optical fiber cable configurations and optical fiber structures for the delivering high power laser energy over great distances to a tool or surface to perform an operation or work with the tool or upon the surface.

Alternatives to electricity for transmission and annual-scale firming - Storage for diverse, stranded, renewable energy resources: hydrogen and ammonia

Energy Technology Data Exchange (ETDEWEB)

Leighty, William

2010-09-15

The world's richest renewable energy resources 'of large geographic extent and high intensity' are stranded: far from end-users with inadequate or nonexistent gathering and transmission systems to deliver energy. Output of most renewables varies greatly, at time scales of seconds-seasons: energy capture assets operate at low capacity factor; energy delivery is not 'firm'. New electric transmission systems, or fractions thereof, dedicated to renewables, suffer the same low CF: substantial stranded capital assets, increasing the cost of delivered renewable-source energy. Electricity storage cannot affordably firm large renewables at annual scale. Gaseous hydrogen and anhydrous ammonia fuels can: attractive alternatives.

The Role of Interconnecting Transmission Network in Energy Market Environment in Croatia

International Nuclear Information System (INIS)

Radmilovic, B.

2001-01-01

For energy market liberalisation in a small country like Croatia, it is necessary to build strong interconnecting lines to neighbouring systems. In that way it is possible to get power under favourable market conditions and also to export domestic production (especially from hydro power plants) to external markets. Geographical position of Croatia in Europe (East West, North South) is very interesting under liberalised energy market conditions. In that sense, the possibilities and role of Croatian transmission network (400 and 220 kV) for possible transits and other country needs should be analysed. (author)

Mode and climatic factors effect on energy losses in transient heat modes of transmission lines

Science.gov (United States)

Bigun, A. Ya; Sidorov, O. A.; Osipov, D. S.; Girshin, S. S.; Goryunov, V. N.; Petrova, E. V.

2018-01-01

Electrical energy losses increase in modern grids. The losses are connected with an increase in consumption. Existing models of electric power losses estimation considering climatic factors do not allow estimating the cable temperature in real time. Considering weather and mode factors in real time allows to meet effectively and safely the consumer’s needs to minimize energy losses during transmission, to use electric power equipment effectively. These factors increase an interest in the evaluation of the dynamic thermal mode of overhead transmission lines conductors. The article discusses an approximate analytic solution of the heat balance equation in the transient operation mode of overhead lines based on the least squares method. The accuracy of the results obtained is comparable with the results of solving the heat balance equation of transient thermal mode with the Runge-Kutt method. The analysis of mode and climatic factors effect on the cable temperature in a dynamic thermal mode is presented. The calculation of the maximum permissible current for variation of weather conditions is made. The average electric energy losses during the transient process are calculated with the change of wind, air temperature and solar radiation. The parameters having the greatest effect on the transmission capacity are identified.

A transmission power optimization with a minimum node degree for energy-efficient wireless sensor networks with full-reachability.

Science.gov (United States)

Chen, Yi-Ting; Horng, Mong-Fong; Lo, Chih-Cheng; Chu, Shu-Chuan; Pan, Jeng-Shyang; Liao, Bin-Yih

2013-03-20

Transmission power optimization is the most significant factor in prolonging the lifetime and maintaining the connection quality of wireless sensor networks. Un-optimized transmission power of nodes either interferes with or fails to link neighboring nodes. The optimization of transmission power depends on the expected node degree and node distribution. In this study, an optimization approach to an energy-efficient and full reachability wireless sensor network is proposed. In the proposed approach, an adjustment model of the transmission range with a minimum node degree is proposed that focuses on topology control and optimization of the transmission range according to node degree and node density. The model adjusts the tradeoff between energy efficiency and full reachability to obtain an ideal transmission range. In addition, connectivity and reachability are used as performance indices to evaluate the connection quality of a network. The two indices are compared to demonstrate the practicability of framework through simulation results. Furthermore, the relationship between the indices under the conditions of various node degrees is analyzed to generalize the characteristics of node densities. The research results on the reliability and feasibility of the proposed approach will benefit the future real deployments.

A Transmission Power Optimization with a Minimum Node Degree for Energy-Efficient Wireless Sensor Networks with Full-Reachability

Science.gov (United States)

Chen, Yi-Ting; Horng, Mong-Fong; Lo, Chih-Cheng; Chu, Shu-Chuan; Pan, Jeng-Shyang; Liao, Bin-Yih

2013-01-01

Transmission power optimization is the most significant factor in prolonging the lifetime and maintaining the connection quality of wireless sensor networks. Un-optimized transmission power of nodes either interferes with or fails to link neighboring nodes. The optimization of transmission power depends on the expected node degree and node distribution. In this study, an optimization approach to an energy-efficient and full reachability wireless sensor network is proposed. In the proposed approach, an adjustment model of the transmission range with a minimum node degree is proposed that focuses on topology control and optimization of the transmission range according to node degree and node density. The model adjusts the tradeoff between energy efficiency and full reachability to obtain an ideal transmission range. In addition, connectivity and reachability are used as performance indices to evaluate the connection quality of a network. The two indices are compared to demonstrate the practicability of framework through simulation results. Furthermore, the relationship between the indices under the conditions of various node degrees is analyzed to generalize the characteristics of node densities. The research results on the reliability and feasibility of the proposed approach will benefit the future real deployments. PMID:23519351

Transmission of wave energy through an offshore wind turbine farm

DEFF Research Database (Denmark)

Christensen, Erik Damgaard; Johnson, Martin; Sørensen, Ole Rene

2013-01-01

condition at infinity. From airborne and Satellite SAR (Synthetic Aperture Radar) a model has been derived for the change of the water surface friction C) inside and on the lee side of the offshore wind farm. The effects have been implemented in a spectral wind wave model,MIKE21 SW, and a parametric study......The transmission of wave energy passing an offshore wind farm is studied. Three effects that can change the wave field are analysed, which is the A) energy dissipation due to drag resistance, B) wave reflection/diffraction from structures, and C) the effect of a modified wind field inside...... and on the lee side of the wind farm. The drag dissipation, A), is quantified by a quadratic resistance law. The effect of B) is parameterised based on 1st order potential theory. A method to find the amount of reflected and transmitted wave energy is developed based on the panel method WAMIT™ and a radiation...

Small passenger car transmission test-Chevrolet 200 transmission

Science.gov (United States)

Bujold, M. P.

1980-01-01

The small passenger car transmission was tested to supply electric vehicle manufacturers with technical information regarding the performance of commerically available transmissions which would enable them to design a more energy efficient vehicle. With this information the manufacturers could estimate vehicle driving range as well as speed and torque requirements for specific road load performance characteristics. A 1979 Chevrolet Model 200 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. The transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. Torque, speed and efficiency curves map the complete performance characteristics for Chevrolet Model 200 transmission.

Low-energy electron transmission and secondary-electron emission experiments on crystalline and molten long-chain alkanes

International Nuclear Information System (INIS)

Ueno, N.; Sugita, K.; Seki, K.; Inokuchi, H.

1986-01-01

This paper describes the results of low-energy electron transmission and secondary-electron emission experiments on thin films of long-chain alkanes deposited on metal substrates. The spectral changes due to crystal-melt phase transition were measured in situ in both experiments. The ground-state energy V 0 of the quasifree electron in crystalline state was determined to be 0.5 +- 0.1 eV. The value of V 0 for the molten state was found to be negative. Further, in the crystalline state evidence is found for a direct correspondence between the transmission maxima and the high value of the density of states in the conduction bands

Energy-Efficient Resource and Power Allocation for Underlay Multicast Device-to-Device Transmission

Directory of Open Access Journals (Sweden)

Fan Jiang

2017-11-01

Full Text Available In this paper, we present an energy-efficient resource allocation and power control scheme for D2D (Device-to-Device multicasting transmission. The objective is to maximize the overall energy-efficiency of D2D multicast clusters through effective resource allocation and power control schemes, while considering the quality of service (QoS requirements of both cellular users (CUs and D2D clusters. We first build the optimization model and a heuristic resource and power allocation algorithm is then proposed to solve the energy-efficiency problem with less computational complexity. Numerical results indicate that the proposed algorithm outperforms existing schemes in terms of throughput per energy consumption.

Cross-Country Electricity Trade, Renewable Energy and European Transmission Infrastructure Policy

OpenAIRE

Abrell, Jan; Rausch, Sebastian

2016-01-01

This paper develops a multi-country multi-sector general equilibrium model, integrating high-frequency electricity dispatch and trade decisions, to study the e ects of electricity transmission infrastructure (TI) expansion and re- newable energy (RE) penetration in Europe for gains from trade and carbon dioxide emissions in the power sector. TI can bene t or degrade environ- mental outcomes, depending on RE penetration: it complements emissions abatement by mitigating dispatch problems associ...

Study of a conceptual nuclear energy center at Green River, Utah. Power demand, load center assessment and transmission

Energy Technology Data Exchange (ETDEWEB)

Smith, D.R.; Thaik, A.; Pingel, P.

1982-02-01

This document constitutes a segment of a feasibility study investigating the ramification of constructing a nuclear energy center in an arid western region. In this phase of the study. The projected power demands and load center locations were reviewed and assessed. Alternative transmission systems were analysed and a conceptual transmission for bulk power transportation is proposed with potential line routes. Environmental impacts of the proposed transmission were also identified.

Study of a conceptual nuclear energy center at Green River, Utah. Power demand, load center assessment and transmission

International Nuclear Information System (INIS)

Smith, D.R.; Thaik, A.; Pingel, P.

1982-02-01

This document constitutes a segment of a feasibility study investigating the ramification of constructing a nuclear energy center in an arid western region. In this phase of the study. The projected power demands and load center locations were reviewed and assessed. Alternative transmission systems were analysed and a conceptual transmission for bulk power transportation is proposed with potential line routes. Environmental impacts of the proposed transmission were also identified

Regional Transmission Projects: Finding Solutions

Energy Technology Data Exchange (ETDEWEB)

The Keystone Center

2005-06-15

The Keystone Center convened and facilitated a year-long Dialogue on "Regional Transmission Projects: Finding Solutions" to develop recommendations that will help address the difficult and contentious issues related to expansions of regional electric transmission systems that are needed for reliable and economic transmission of power within and across regions. This effort brought together a cross-section of affected stakeholders and thought leaders to address the problem with the collective wisdom of their experience and interests. Transmission owners sat at the table with consumer advocates and environmental organizations. Representatives from regional transmission organizations exchanged ideas with state and federal regulators. Generation developers explored common interests with public power suppliers. Together, the Dialogue participants developed consensus solutions about how to begin unraveling some of the more intractable issues surrounding identification of need, allocation of costs, and reaching consensus on siting issues that can frustrate the development of regional transmission infrastructure. The recommendations fall into three broad categories: 1. Recommendations on appropriate institutional arrangements and processes for achieving regional consensus on the need for new or expanded transmission infrastructure 2. Recommendations on the process for siting of transmission lines 3. Recommendations on the tools needed to support regional planning, cost allocation, and siting efforts. List of Dialogue participants: List of Dialogue Participants: American Electric Power American Transmission Company American Wind Energy Association California ISO Calpine Corporation Cinergy Edison Electric Institute Environmental Defense Federal Energy Regulatory Commission Great River Energy International Transmission Company ISO-New England Iowa Public Utility Board Kanner & Associates Midwest ISO National Association of Regulatory Utility Commissioners National Association

Grassroots Technological Resistance: The People's Power Project and the Impossible Dream of Wireless Transmission of Energy.

Science.gov (United States)

Schmidt, Pete

2017-09-01

In 1972, the Minnesota United Power Association (UPA) teamed up with the Minnesota Cooperative Power Association (CPA) to initiate an electrification project designed to bring power from North Dakota to the Twin Cities area. A significant backlash and protest began once farmers across the state became aware of the plan and the potential impending land seizure. In the midst of these actions, one group sought to create an alternative to the power line transmission system by designing a system of wireless energy transmission based on the plans of Nikola Tesla. This self-funded conglomeration of farmers and amateur researchers formed the People's Power Project (PPP) and set about building Tesla's system for the wireless transmission of energy. Using archival documents, this paper recounts this episode and argues that, in this case, the potential for successful grassroots action was derailed by the influence of longstanding myths about Tesla and his devices. Copyright © 2017 Elsevier Ltd. All rights reserved.

76 FR 12955 - CenterPoint Energy Gas Transmission Company, LLC; Notice of Intent To Prepare an Environmental...

Science.gov (United States)

2011-03-09

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP11-78-000] CenterPoint Energy Gas Transmission Company, LLC; Notice of Intent To Prepare an Environmental Assessment for the Proposed Line AM- 46 Replacement Project, Request for Comments on Environmental Issues, and Notice of Onsite Environmental Review The staff of the...

Improved Performance of Connected Foundations for Resilient Energy Transmission Infrastructure in Soft Soils

Directory of Open Access Journals (Sweden)

Doohyun Kyung

2015-12-01

Full Text Available The connected foundation is an effective structural type of foundation that can improve the sustainability of electrical transmission towers in soft soils to serve as a resilient energy supply system. In this study, the performance of electrical transmission towers reinforced with connected beams was investigated using a series of field load tests. Model transmission tower structures were manufactured and adopted into the tests. Based on the load capacity mobilization and failure mechanism, a criterion to define the load carrying capacity for connected foundation was proposed. It was found that the performance of connected foundation varies with the mechanical property of connection beam. The load capacity and differential settlement increased and decreased, respectively, with increasing connection beam stiffness. Such effect of connection beam was more pronounced as the height of load application point or tower height (zh increases. Based on the load test results, a design model was proposed that can be used to evaluate the sustainable performance and load carrying capacity of connected foundations. Field load tests with prototype transmission tower structure models were conducted to check and confirm the performance of connected foundation and the proposed design method.

Numerical study of influence of different dispersed components of crystal cloud on transmission of radiant energy

Science.gov (United States)

Shefer, Olga

2017-11-01

The calculated results of the transmission of visible and infrared radiation by an atmosphere layer involving ensembles of large preferentially oriented crystals and spherical particles are presented. To calculate extinction characteristics, the physical optics method and the Mie theory are applied. Among all atmospheric particles, both the small particles that are commensurable with the wavelength of the incident radiation and the large plates and the columns are distinguished by the most pronounced dependence of the transmission on spectra of radiant energy. The work illustrates features of influence of parameters of the particle size distribution, particle aspect ratios, orientation and particle refractive index, also polarization state of the incident radiation on the transmission. The predominant effect of the plates on the wavelength dependence of the transmission is shown. A separated and cooperative contributes of the large plates and the small volume shape particles to the common transmission by medium are considered.

Energy-Efficient Transmissions for Remote Wireless Sensor Networks: An Integrated HAP/Satellite Architecture for Emergency Scenarios.

Science.gov (United States)

Dong, Feihong; Li, Hongjun; Gong, Xiangwu; Liu, Quan; Wang, Jingchao

2015-09-03

A typical application scenario of remote wireless sensor networks (WSNs) is identified as an emergency scenario. One of the greatest design challenges for communications in emergency scenarios is energy-efficient transmission, due to scarce electrical energy in large-scale natural and man-made disasters. Integrated high altitude platform (HAP)/satellite networks are expected to optimally meet emergency communication requirements. In this paper, a novel integrated HAP/satellite (IHS) architecture is proposed, and three segments of the architecture are investigated in detail. The concept of link-state advertisement (LSA) is designed in a slow flat Rician fading channel. The LSA is received and processed by the terminal to estimate the link state information, which can significantly reduce the energy consumption at the terminal end. Furthermore, the transmission power requirements of the HAPs and terminals are derived using the gradient descent and differential equation methods. The energy consumption is modeled at both the source and system level. An innovative and adaptive algorithm is given for the energy-efficient path selection. The simulation results validate the effectiveness of the proposed adaptive algorithm. It is shown that the proposed adaptive algorithm can significantly improve energy efficiency when combined with the LSA and the energy consumption estimation.

Energy-Efficient Transmissions for Remote Wireless Sensor Networks: An Integrated HAP/Satellite Architecture for Emergency Scenarios

Science.gov (United States)

Dong, Feihong; Li, Hongjun; Gong, Xiangwu; Liu, Quan; Wang, Jingchao

2015-01-01

A typical application scenario of remote wireless sensor networks (WSNs) is identified as an emergency scenario. One of the greatest design challenges for communications in emergency scenarios is energy-efficient transmission, due to scarce electrical energy in large-scale natural and man-made disasters. Integrated high altitude platform (HAP)/satellite networks are expected to optimally meet emergency communication requirements. In this paper, a novel integrated HAP/satellite (IHS) architecture is proposed, and three segments of the architecture are investigated in detail. The concept of link-state advertisement (LSA) is designed in a slow flat Rician fading channel. The LSA is received and processed by the terminal to estimate the link state information, which can significantly reduce the energy consumption at the terminal end. Furthermore, the transmission power requirements of the HAPs and terminals are derived using the gradient descent and differential equation methods. The energy consumption is modeled at both the source and system level. An innovative and adaptive algorithm is given for the energy-efficient path selection. The simulation results validate the effectiveness of the proposed adaptive algorithm. It is shown that the proposed adaptive algorithm can significantly improve energy efficiency when combined with the LSA and the energy consumption estimation. PMID:26404292

Energy-Efficient Transmissions for Remote Wireless Sensor Networks: An Integrated HAP/Satellite Architecture for Emergency Scenarios

Directory of Open Access Journals (Sweden)

Feihong Dong

2015-09-01

Full Text Available A typical application scenario of remote wireless sensor networks (WSNs is identified as an emergency scenario. One of the greatest design challenges for communications in emergency scenarios is energy-efficient transmission, due to scarce electrical energy in large-scale natural and man-made disasters. Integrated high altitude platform (HAP/satellite networks are expected to optimally meet emergency communication requirements. In this paper, a novel integrated HAP/satellite (IHS architecture is proposed, and three segments of the architecture are investigated in detail. The concept of link-state advertisement (LSA is designed in a slow flat Rician fading channel. The LSA is received and processed by the terminal to estimate the link state information, which can significantly reduce the energy consumption at the terminal end. Furthermore, the transmission power requirements of the HAPs and terminals are derived using the gradient descent and differential equation methods. The energy consumption is modeled at both the source and system level. An innovative and adaptive algorithm is given for the energy-efficient path selection. The simulation results validate the effectiveness of the proposed adaptive algorithm. It is shown that the proposed adaptive algorithm can significantly improve energy efficiency when combined with the LSA and the energy consumption estimation.

High Voltage Power Transmission for Wind Energy

Science.gov (United States)

Kim, Young il

The high wind speeds and wide available area at sea have recently increased the interests on offshore wind farms in the U.S.A. As offshore wind farms become larger and are placed further from the shore, the power transmission to the onshore grid becomes a key feature. Power transmission of the offshore wind farm, in which good wind conditions and a larger installation area than an onshore site are available, requires the use of submarine cable systems. Therefore, an underground power cable system requires unique design and installation challenges not found in the overhead power cable environment. This paper presents analysis about the benefit and drawbacks of three different transmission solutions: HVAC, LCC/VSC HVDC in the grid connecting offshore wind farms and also analyzed the electrical characteristics of underground cables. In particular, loss of HV (High Voltage) subsea power of the transmission cables was evaluated by the Brakelmann's theory, taking into account the distributions of current and temperature.

Parametric study of variable renewable energy integration in Europe: Advantages and costs of transmission grid extensions

International Nuclear Information System (INIS)

Schaber, Katrin; Steinke, Florian; Mühlich, Pascal; Hamacher, Thomas

2012-01-01

Wind and solar energy will play an important role in the decarbonization of the European electricity generation. However, high shares of these variable renewable energies (VREs) challenge the power system considerably due to their temporal fluctuations and geographical dispersion. In this paper, we systematically analyze transmission grid extensions as an integration measure for VREs in Europe. We show the effects of grid extensions for fundamental properties of the power system as a function of the penetration and mix of wind and solar energy. Backup capacity requirements and overproduction are reduced with a powerful overlay transmission grid. We determine the costs of the grid extensions in dependence of the VRE penetration and mix and find that the grid integration costs remain below 25% of the VRE investment costs for all conceivable VRE configurations. Furthermore, robust design features of future power systems in terms of grid geometry and flexibility requirements for backup technologies are identified. We apply a spatially and temporally highly resolved techno-economic model of the European power system for our analysis. - Highlights: ► Quantification of the advantages and costs of a European overlay transmission grid. ► Grid integration costs for VREs in Europe remain below 6€/MWh. ► Application of a detailed power system model to a wide parameter space.

Power transmission study for a wave energy scheme based on Lancaster Flexible Bag devices. Supervisory and telecontrol system

Energy Technology Data Exchange (ETDEWEB)

1981-11-01

Various options are considered for power data transmission associated with the power collection and transmission system of a postulated wave energy conversion scheme off the Outer Hebrides. For data transmission between the off-shore and on-shore power collector stations a Power Line Carrier (PLC) system is judged to be most suitable. In the case of data transmission between power collector stations and the main control centre, a microwave/radio link is proposed as the amount of data does not lend itself to a PLC system. Cost estimates, in the main for equipment supply only, are given.

Common raven occurrence in relation to energy transmission line corridors transiting human-altered sagebrush steppe

Science.gov (United States)

Coates, Peter S.; Howe, Kristy B.; Casazza, Michael L.; Delehanty, David J.

2014-01-01

Energy-related infrastructure and other human enterprises within sagebrush steppe of the American West often results in changes that promote common raven (Corvus corax; hereafter, raven) populations. Ravens, a generalist predator capable of behavioral innovation, present a threat to many species of conservation concern. We evaluate the effects of detailed features of an altered landscape on the probability of raven occurrence using extensive raven survey (n= 1045) and mapping data from southern Idaho, USA. We found nonlinear relationships between raven occurrence and distances to transmission lines, roads, and facilities. Most importantly, raven occurrence was greater with presence of transmission lines up to 2.2 km from the corridor.We further explain variation in raven occurrence along anthropogenic features based on the amount of non-native vegetation and cover type edge, such that ravens select fragmented sagebrush stands with patchy, exotic vegetative introgression. Raven occurrence also increased with greater length of edge formed by the contact of big sagebrush (Artemisia tridentate spp.) with non-native vegetation cover types. In consideration of increasing alteration of sagebrush steppe, these findings will be useful for planning energy transmission corridor placement and other management activities where conservation of sagebrush obligate species is a priority.

Modeling and Characteristic Analysis of Wireless Ultrasonic Vibration Energy Transmission Channels through Planar and Curved Metal Barriers

Directory of Open Access Journals (Sweden)

DingXin Yang

2018-01-01

Full Text Available Wireless ultrasonic vibration energy transmission systems through metal barriers based on piezoelectric transducers have drawn a lot of focus due to the advantage of nonpenetration of the barriers, thus maintaining the integrity of sealed structures. It is meaningful to investigate appropriate modeling methods and to characterize such wireless ultrasonic energy transmission channels with different geometric shapes. In this paper, equivalent circuit modeling and finite element modeling methods are applied to the planar metal barrier channel, and a 3-dimensional finite element modeling method is applied to the cylindrical metallic barrier channel. Meanwhile, the experimental setup is established and measurements are carried out to validate the effectiveness of the corresponding modeling methods. The results show that Leach’s equivalent circuit modeling method and finite element modeling method are nearly similarly effective in characterizing the planar metal barrier channel. But for a cylindrical metal barrier, only the three-dimensional finite element modeling method is effective. Furthermore, we found that, for the planar barrier, the effect of standing waves on the efficiency of wireless energy transmission is dominated. But for the curved barrier, only the resonant phenomenon of the piezoelectric transducer exists.

Accounting-related transmission issues

International Nuclear Information System (INIS)

Niehaus, M.; Bjorn, P.; Pate, G.

1999-01-01

Various initiatives have been undertaken by the Federal Energy Regulatory Commission (FERC) to deregulate wholesale electric energy markets. These initiatives have focused on restructuring the transmission systems in the US and recently have culminated in a proposal requiring formation of and participation in regional transmission organizations. The overall form of regulation selected to determine rates for transmission entities as well as underlying regulatory decisions reached on key issues will have profound implications for transmission entities. For example, traditional cost-based regulation would require one set of accounting and reporting rules, while incentive-based regulation may not be subject to those same rules. An overview of some of the major accounting and financial reporting issues that will need to be considered is presented

Nanoscale Energy-Filtered Scanning Confocal Electron Microscopy Using a Double-Aberration-Corrected Transmission Electron Microscope

International Nuclear Information System (INIS)

Wang Peng; Behan, Gavin; Kirkland, Angus I.; Nellist, Peter D.; Takeguchi, Masaki; Hashimoto, Ayako; Mitsuishi, Kazutaka; Shimojo, Masayuki

2010-01-01

We demonstrate that a transmission electron microscope fitted with two spherical-aberration correctors can be operated as an energy-filtered scanning confocal electron microscope. A method for establishing this mode is described and initial results showing 3D chemical mapping with nanoscale sensitivity to height and thickness changes in a carbon film are presented. Importantly, uncorrected chromatic aberration does not limit the depth resolution of this technique and moreover performs an energy-filtering role, which is explained in terms of a combined depth and energy-loss response function.

An energy saving mechanism of EPON networks for real time video transmission

Science.gov (United States)

Liu, Chien-Ping; Wu, Ho-Ting; Chiang, Yun-Ting; Chien, Shieh-Chieh; Ke, Kai-Wei

2015-07-01

Modern access networks are constructed widely by passive optical networks (PONs) to meet the growing bandwidth demand. However, higher bandwidth means more energy consumption. To save energy, a few research works propose the dual-mode energy saving mechanism that allows the ONU to operate between active and sleep modes periodically. However, such dual-mode energy saving design may induce unnecessary power consumption or packet delay increase in the case where only downstream data exist for most of the time. In this paper, we propose a new tri-mode energy saving scheme for Ethernet PON (EPON). The new tri-mode energy saving design, combining the dual-mode saving mechanism with the doze mode, allows the ONU to switch among these three modes alternatively. In the doze mode, the ONU may receive downstream data while keeping its transmitter close. Such scenario is often observed for real time video downstream transmission. Furthermore, the low packet delay of high priority upstream data can be attained through the use of early wake-up mechanism employed in both energy saving modes. The energy saving and system efficiency can thus be achieved jointly while maintaining the differentiated QoS for data with various priorities. Performance results via simulation have demonstrated the effectiveness of such mechanism.

Voluntary transmission access: The PSI proposal

International Nuclear Information System (INIS)

Norris, J.E.

1990-01-01

This article examines a proposal from PSI Energy, Inc. (formerly Public Service Company of Indiana) to allow open access to its power transmission facilities and the response of the Federal Energy Regulatory Commission's response to that proposal. The topics discussed include transmission tariffs, competition, market share, expansion of transmission capacity and its funding, and reciprocal agreements to provide similar service

Simulation calculation for the energy deposition profile and the transmission fraction of intense pulsed electron beam at various incident angles

International Nuclear Information System (INIS)

Yang Hailiang; Qiu Aici; Zhang Jiasheng; Huang Jianjun; Sun Jianfeng

2002-01-01

The incident angles have a heavy effect on the intense pulsed electron beam energy deposition profile, energy deposition fraction and beam current transmission fraction in material. The author presents electron beam energy deposition profile and energy deposition fraction versus electron energy (0.5-2.0 MeV), at various incident angles for three aluminum targets of various thickness via theoretical calculation. The intense pulsed electron beam current transmission fractions versus electron energy (0.4-1.4 MeV) at various incident angles for three thickness of carbon targets were also theoretically calculated. The calculation results indicate that the deposition energy in unit mass of material surface layer increase with the rise of electron beam incident angle, and electron beam with low incident angle (closer to normal incident angle) penetrates deeper into the target material. The electron beams deposit more energy in unit mass of material surface layer at 60 degree-70 degree incident angle

Response analysis and energy transmissibility of a vibration isolation system with real-power nonlinearities under a NMPPF controller

International Nuclear Information System (INIS)

Huang, Dongmei; Xu, Wei; Shi, Lingling

2016-01-01

Highlights: • The nonlinear modified positive position feedback (NMPPF) scheme and the real-power form of restoring and damping forces are combined to improve the response performance of a vibration isolation system. • The primary resonance, dynamical stability and energy transmissibility of the real-power vibration isolation system are studied. • The sensitivity of the controller parameters on the responses has been analyzed. • In order to suppress the amplitude peak, the feedback parameters have been determined by the frequency response. • The energy transmissibility is investigated. - Abstract: In this paper, the nonlinear modified positive position feedback (NMPPF) scheme and the real-power form of restoring and damping forces are combined to improve the response performance of a vibration isolation system. Based on the method of multiple scales, the frequency response, the stability and the energy transmissibility of the real-power vibration isolation system are studied. It is found that the controlled isolation system exhibits a softening behavior for sub-linear restoring force, while it exhibits the two peak response characteristic rather than a hardening behavior for over-linear restoring force. Further, the sensitivity of the feedback parameters on the responses is discussed. The results, compared to the conventional PPF and IRC methods, show that the proposed method is significantly more effective in controlling the steady-state response, and slightly advantageous for the steady-state dynamics control. The effectiveness of this method is also verified by time domain analysis. Then, the suitable feedback and controller parameters are derived by simulation results in which the amplitude peak is suppressed and the resonance stability is maintained. Finally, the energy transmissibility of the vibration isolation system is investigated. The results show that the feedback gain can reduce the whole transmissibility level and greatly suppress vibration

Economics and a novel voltage conversion technique associated with exporting Wyoming's energy by HVDC transmission

Science.gov (United States)

Xu, Kaili

Wyoming is by far the largest coal producing state in the US, but local utilization is extremely low. As much as 92% of Wyoming's coal is shipped to the other states and is mainly consumed by their electricity producers. Coal accounts for more than 50% of the US electricity generation and is one of the least expensive energy sources. Wyoming could utilize its coal better by exporting electricity instead of exporting the coal only in its raw form. Natural gas is another important energy resource in Wyoming but local utilization is even lower. As a result of the development in coalbed methane fields, natural gas production in Wyoming is almost in pace with its coal production. In addition to constructing more new pipelines, new transmission lines should be considered as an alternative way of exporting this energy. Because of their enormous electricity market sizes and high electricity prices, California, Texas and Illinois are chosen to be the target markets for Wyoming's electricity. The proposed transmission schemes use High Voltage DC (HVDC) lines, which are suitable for long distance and cross-system power transmission. Technical and economic feasibilities are studied in details. The Wyoming-California scheme has a better return of investment than both the Wyoming-Texas and the Wyoming-Illinois schemes. A major drawback of HVDC transmission is the high level of harmonics generated by the converters. Elaborate filtering is required at both the AC and the DC sides. A novel pulse-multiplication method is proposed in the thesis to reduce the harmonics from the converter source. By introducing an averaging inductor, the proposed method uses less thyristors to achieve the same high-pulse operation as the existing series scheme. The reduction of thyristors makes the switching circuit more reliable and easier to control and maintain. Harmonic analysis shows that the harmonic level can be reduced to about one third of the original system. The proposed method is also

Wireless transmission: state of research, applications, trends

International Nuclear Information System (INIS)

Berger, A.

2016-01-01

At the end of the 19th century Nikola Tesla started his work in the field of wireless energy transmission. More than 100 years after Tesla, the progress in modern semiconductor technology offer developers the possibility to realize highly efficient systems and have led to a revival of wireless energy transmission. The application ranges from the transmission of a few milliwatts in biomedical applications, over a few watts for the charging of mobile phones, to hundreds of kilowatts in the automotive sector. Depending on the used method, the possible transmission distances vary between a few centimeters up to thousands of kilometers. The physical basis of these technologies is the transmission of energy by electromagnetic waves. State-of-the-art systems use wavelengths ranging from radio waves to microwaves, to ultraviolet light. Current research focuses on optimizing transmission efficiency, increasing the possible transmission distance between transmitter and receiver, and improving spatial freedom of movement. This lecture gives an overview of the different approaches of wireless energy transmission and their physical background, the established industrial standards and the current state of research. In addition, the advantages and disadvantages of the individual methods are illustrated by selected commercial and scientific applications. (rössner) [de

NorthernLights Transmission : bringing competitive cogen energy from the oil sands to west coast markets

International Nuclear Information System (INIS)

Hogan, M.J.C.

2005-01-01

NorthernLights Transmission is an initiative by TransCanada that proposes 2 major high-voltage direct current (HVDC) transmission lines to bring low cost, fossil fuelled and renewable generation from the Fort McMurray area to growing electricity markets in the Pacific Northwest, Nevada, Arizona and California. This presentation demonstrated why oil sands cogeneration, shipped via NorthernLights Transmission, is a very attractive resource for these markets. It was shown that the best generation resources are tied to natural resources such as coal, wind, oil sands cogeneration and hydro. Both the Pacific Northwest and California markets prefer low carbon dioxide generation. The proposed HVDC transmission lines would maximize the use of existing energy infrastructure corridors and rights-of-way where possible. This paper presented details of the proposed Celilo Project and the Inland Project, and noted that both are attractive from a technical and economic perspective. The transmission line for the Celilo project would originate in Fort McMurray and connect highly efficient cogeneration and other developing forms of generation to growing loads in the Pacific Northwest and northern California. The cogeneration plants will supply steam and electricity to northern Alberta's oil sands developments along with surplus electricity for export. tabs., figs

Energy efficient downlink MIMO transmission with linear precoding

Institute of Scientific and Technical Information of China (English)

XU Jie; LI ShiChao; QIU Ling; SLIMANE Ben S.; YU ChengWen

2013-01-01

Energy efficiency （EE） is becoming increasingly important for wireless cellular networks. This paper addresses EE optimization problems in downlink multiuser MIMO systems with linear precoding. Referring to different active transmit/receive antenna sets and transmission schemes as different modes, we propose a joint bandwidth/power optimization and mode switching scheme to maximize EE. With a specific mode, we prove that the optimal bandwidth and transmit power is either full transmit power or full bandwidth. After deriving the optimal bandwidth and transmit power, we further propose mode switching to select the mode with optimal EE. Since the optimal mode switching, i.e. exhaustive search, is too complex to implement, an alternative heuristic method is developed to decrease the complexity through reducing the search size and avoiding the EE calculation during each search. Through simulations, we demonstrate that the proposed methods can significantly improve EE and the performance is similar to the optimal exhaustive search.

Theoretical study of the transmission of low-energy (0-10 eV) electrons through thin-film organic molecular solids: benzene

International Nuclear Information System (INIS)

Goulet, T.; Jay-Gerin, J.-P.

1986-01-01

A theoretical study of the transmission of low-energy (0 to 10 eV) electrons incident from vacuum through thin-film organic molecular solids deposited on a cold metal substrate is presented and developed for the specific case of solid benzene. In essence, using a semiclassical description of electron transport in solids with an energy-independent scattering mean free path and assuming an isotropic electron scattering, the behavior of a penetrating electron in the film is simulated when a large number of scattering events are present. The good agreement between the calculated electron transmission spectra and those obtained experimentally indicates that our study provides a realistic description of the electron transport in the film, and accounts for the influence of the various electron-molecule scattering processes upon the energy dependence of the transmitted current. In particular, we show that the excitonic subionization energy losses are at the origin of the main structures of the observed electron transmission spectra. It is also shown that our study can successfully be used to estimate the probabilities of the various electron scattering processes which occur in the film, as well as the electron mean free path (l). For solid benzene, l is about 8 A in the considered electron energy range. (author)

Numerical method to calculate the quantum transmission, resonance and eigenvalue energies: application to a biased multibarrier systems

Energy Technology Data Exchange (ETDEWEB)

Maiz, F., E-mail: fethimaiz@gmail.com [University of Cartage, Nabeul Engineering Preparatory Institute, Merazka, 8000 Nabeul (Tunisia); King Khalid University, Faculty of Science, Physics Department, PO Box 9004, Abha 61413 (Saudi Arabia)

2015-04-15

A novel method to calculate the quantum transmission, resonance and eigenvalue energies forming the sub-bands structure of non-symmetrical, non-periodical semiconducting heterostructure potential has been proposed in this paper. The method can be applied on a multilayer system with varying thickness of the layer and effective mass of electrons and holes. Assuming an approximated effective mass and using Bastard's boundary conditions, Schrödinger equation at each media is solved and then using a confirmed recurrence method, the transmission and reflection coefficients and the energy quantification condition are expressed. They are simple combination of coupled equations. Schrödinger's equation solutions are Airy functions or plane waves, depending on the electrical potential energy slope. To illustrate the feasibility of the proposed method, the N barriers – (N−1) wells structure for N=3, 5, 8, 9, 17 and 35 are studied. All results show very good agreements with previously published results obtained from applying different methods on similar systems.

Transmission Congestion Management using a Wind Integrated Compressed Air Energy Storage System

Directory of Open Access Journals (Sweden)

S. Gope

2017-08-01

Full Text Available Transmission congestion is a vital problem in the power system security and reliability sector. To ensure the stable operation of the system, a congestion free power network is desirable. In this paper, a new Congestion Management (CM technique, the Wind integrated Compressed Air Energy Storage (WCAES system is used to alleviate transmission congestion and to minimize congestion mitigation cost. The CM problem has been solved by using the Generator Sensitivity Factor (GSF and the Bus Sensitivity Factor (BSF. BSF is used for finding the optimal location of WCAES in the system. GSF with a Moth Flame Optimization (MFO algorithm is used for rescheduling the generators to alleviate congestion and to minimize congestion cost by improving security margin. The impact of the WCAES system is tested with a 39 bus system. To validate this approach, the same problem has been solved with a Particle Swarm Optimization (PSO algorithm and the obtained results are compared with the ones from the MFO algorithm.

Neutron resonance transmission spectroscopy with high spatial and energy resolution at the J-PARC pulsed neutron source

Energy Technology Data Exchange (ETDEWEB)

Tremsin, A.S., E-mail: ast@ssl.berkeley.edu [University of California at Berkeley, 7 Gauss Way, Berkeley, CA 94720 (United States); Shinohara, T.; Kai, T.; Ooi, M. [Japan Atomic Energy Agency, 2–4 Shirakata-shirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Kamiyama, T.; Kiyanagi, Y.; Shiota, Y. [Hokkaido University, Kita 13 Nishi 8 Kita-ku, Sapporo-shi, Hokkaido 060-8628 (Japan); McPhate, J.B.; Vallerga, J.V.; Siegmund, O.H.W. [University of California at Berkeley, 7 Gauss Way, Berkeley, CA 94720 (United States); Feller, W.B. [NOVA Scientific, Inc., 10 Picker Rd., Sturbridge, MA 01566 (United States)

2014-05-11

The sharp variation of neutron attenuation at certain energies specific to particular nuclides (the lower range being from ∼1 eV up to ∼1 keV), can be exploited for the remote mapping of element and/or isotope distributions, as well as temperature probing, within relatively thick samples. Intense pulsed neutron beam-lines at spallation sources combined with a high spatial, high-timing resolution neutron counting detector, provide a unique opportunity to measure neutron transmission spectra through the time-of-flight technique. We present the results of experiments where spatially resolved neutron resonances were measured, at energies up to 50 keV. These experiments were performed with the intense flux low background NOBORU neutron beamline at the J-PARC neutron source and the high timing resolution (∼20 ns at epithermal neutron energies) and spatial resolution (∼55 µm) neutron counting detector using microchannel plates coupled to a Timepix electronic readout. Simultaneous element-specific imaging was carried out for several materials, at a spatial resolution of ∼150 µm. The high timing resolution of our detector combined with the low background beamline, also enabled characterization of the neutron pulse itself – specifically its pulse width, which varies with neutron energy. The results of our measurements are in good agreement with the predicted results for the double pulse structure of the J-PARC facility, which provides two 100 ns-wide proton pulses separated by 600 ns, broadened by the neutron energy moderation process. Thermal neutron radiography can be conducted simultaneously with resonance transmission spectroscopy, and can reveal the internal structure of the samples. The transmission spectra measured in our experiments demonstrate the feasibility of mapping elemental distributions using this non-destructive technique, for those elements (and in certain cases, specific isotopes), which have resonance energies below a few keV, and with lower

Wireless Energy and Information Transmission in FSO and RF-FSO Links

KAUST Repository

Makki, Behrooz

2017-09-22

We propose and analyze a wireless energy and information transmission scheme in free-space optical (FSO) links. The results are presented for both quasi-static and fast-fading conditions. We derive closed-form expressions for throughput, outage probability and optimal power allocation optimizing the system throughput/outage probability. Finally, we complement the FSO link with an additional radio frequency (RF) link to create a hybrid RF-FSO system and reduce the system outage probability. The results show that joint implementation of the RF and FSO links leads to considerable performance improvement, compared to the cases with only FSO-based communication.

Fiber optic transmission system delivered to Fusion Research Center of Japan Atomic Energy Research Institute

International Nuclear Information System (INIS)

Hayashida, Mutsuo; Hiramoto, Kiyoshi; Yamazaki, Kunihiro

1983-01-01

In general there are many electromagnetically induced noises in the premises of factories, power plants and substations. Under such electrically bad environments, for the computer data transmission that needs high speed processing and high reliability, the optical fiber cable is superion to the coaxial cable or the flat-type cable in aspects of the inductionlessness and a wide bandwidth. Showa Electric Wire and Cable Co., Ltd. has delivered and installed a computer data transmission system consisting of optical modems and optical fiber cables for connecting every experiment building in the premises of Fusion Research Center of Japan Atomic Energy Research Institute. This paper describes the outline of this system. (author)

National transmission grid study

Energy Technology Data Exchange (ETDEWEB)

Abraham, Spencer [USDOE Office of the Secretary of Energy, Washington, DC (United States)

2003-05-31

The National Energy Policy Plan directed the U.S. Department of Energy (DOE) to conduct a study to examine the benefits of establishing a national electricity transmission grid and to identify transmission bottlenecks and measures to address them. DOE began by conducting an independent analysis of U.S. electricity markets and identifying transmission system bottlenecks using DOE’s Policy Office Electricity Modeling System (POEMS). DOE’s analysis, presented in Section 2, confirms the central role of the nation’s transmission system in lowering costs to consumers through increased trade. More importantly, DOE’s analysis also confirms the results of previous studies, which show that transmission bottlenecks and related transmission system market practices are adding hundreds of millions of dollars to consumers’ electricity bills each year. A more detailed technical overview of the use of POEMS is provided in Appendix A. DOE led an extensive, open, public input process and heard a wide range of comments and recommendations that have all been considered.1 More than 150 participants registered for three public workshops held in Detroit, MI (September 24, 2001); Atlanta, GA (September 26, 2001); and Phoenix, AZ (September 28, 2001).

Evidence of localized wave transmission

International Nuclear Information System (INIS)

Anon.

1988-01-01

LLNL [Lawrence Livermore National Lab.] experiments to test the feasibility of launching an acoustic, directed-energy pulse train (ADEPT) in water have demonstrated localized transmission of wave energy far beyond the classical Rayleigh length that defines the boundary between near-field and far-field transmission for Gaussian (diffraction-limited) pulses. The results of the experiments are in excellent agreement with computer simulations

75 FR 63826 - Transmission Infrastructure Program-TransWest Express Transmission Project Capacity

Science.gov (United States)

2010-10-18

... Administration (Western), a Federal power marketing administration of the United States Department of Energy (DOE... operates an integrated 17,000 circuit mile, high-voltage transmission system across 15 western states... transmission lines and related facilities with at least one terminus in Western's marketing area, that deliver...

Design of an effective energy receiving adapter for microwave wireless power transmission application

Directory of Open Access Journals (Sweden)

Peng Xu

2016-10-01

Full Text Available In this paper, we demonstrate the viability of an energy receiving adapter in a 8×8 array form with high power reception efficiency with the resonator of artificial electromagnetic absorber being used as the element. Unlike the conventional reported rectifying antenna resonators, both the size of the element and the separations between the elements are electrically small in our design. The energy collecting process is explained with an equivalent circuit model, and a RF combining network is designed to combine the captured AC power from each element to one main terminal for AC-to-DC conversion. The energy receiving adapter yields a total reception efficiency of 67% (including the wave capture efficiency of 86% and the AC-to-DC conversion efficiency of 78%, which is quite promising for microwave wireless power transmission.

An Algorithm for Timely Transmission of Solicitation Messages in RPL for Energy-Efficient Node Mobility.

Science.gov (United States)

Park, Jihong; Kim, Ki-Hyung; Kim, Kangseok

2017-04-19

The IPv6 Routing Protocol for Low Power and Lossy Networks (RPL) was proposed for various applications of IPv6 low power wireless networks. While RPL supports various routing metrics and is designed to be suitable for wireless sensor network environments, it does not consider the mobility of nodes. Therefore, there is a need for a method that is energy efficient and that provides stable and reliable data transmission by considering the mobility of nodes in RPL networks. This paper proposes an algorithm to support node mobility in RPL in an energy-efficient manner and describes its operating principle based on different scenarios. The proposed algorithm supports the mobility of nodes by dynamically adjusting the transmission interval of the messages that request the route based on the speed and direction of the motion of mobile nodes, as well as the costs between neighboring nodes. The performance of the proposed algorithm and previous algorithms for supporting node mobility were examined experimentally. From the experiment, it was observed that the proposed algorithm requires fewer messages per unit time for selecting a new parent node following the movement of a mobile node. Since fewer messages are used to select a parent node, the energy consumption is also less than that of previous algorithms.

Energy and Transmissibility in Nonlinear Viscous Base Isolators

Science.gov (United States)

Markou, Athanasios A.; Manolis, George D.

2016-09-01

High damping rubber bearings (HDRB) are the most commonly used base isolators in buildings and are often combined with other systems, such as sliding bearings. Their mechanical behaviour is highly nonlinear and dependent on a number of factors. At first, a physical process is suggested here to explain the empirical formula introduced by J.M. Kelly in 1991, where the dissipated energy of a HDRB under cyclic testing, at constant frequency, is proportional to the amplitude of the shear strain, raised to a power of approximately 1.50. This physical process is best described by non-Newtonian fluid behaviour, originally developed by F.H. Norton in 1929 to describe creep in steel at high-temperatures. The constitutive model used includes a viscous term, that depends on the absolute value of the velocity, raised to a non-integer power. The identification of a three parameter Kelvin model, the simplest possible system with nonlinear viscosity, is also suggested here. Furthermore, a more advanced model with variable damping coefficient is implemented to better model in this complex mechanical process. Next, the assumption of strain-rate dependence in their rubber layers under cyclic loading is examined in order to best interpret experimental results on the transmission of motion between the upper and lower surfaces of HDRB. More specifically, the stress-relaxation phenomenon observed with time in HRDB can be reproduced numerically, only if the constitutive model includes a viscous term, that depends on the absolute value of the velocity raised to a non-integer power, i. e., the Norton fluid previously mentioned. Thus, it becomes possible to compute the displacement transmissibility function between the top and bottom surfaces of HDRB base isolator systems and to draw engineering-type conclusions, relevant to their design under time-harmonic loads.

Influence of the Integral Quality Monitor transmission detector on high energy photon beams: A multi-centre study.

Science.gov (United States)

Casar, Bozidar; Pasler, Marlies; Wegener, Sonja; Hoffman, David; Talamonti, Cinzia; Qian, Jianguo; Mendez, Ignasi; Brojan, Denis; Perrin, Bruce; Kusters, Martijn; Canters, Richard; Pallotta, Stefania; Peterlin, Primoz

2017-09-01

The influence of the Integral Quality Monitor (IQM) transmission detector on photon beam properties was evaluated in a preclinical phase, using data from nine participating centres: (i) the change of beam quality (beam hardening), (ii) the influence on surface dose, and (iii) the attenuation of the IQM detector. For 6 different nominal photon energies (4 standard, 2 FFF) and square field sizes from 1×1cm 2 to 20×20cm 2 , the effect of IQM on beam quality was assessed from the PDD 20,10 values obtained from the percentage dose depth (PDD) curves, measured with and without IQM in the beam path. The change in surface dose with/without IQM was assessed for all available energies and field sizes from 4×4cm 2 to 20×20cm 2 . The transmission factor was calculated by means of measured absorbed dose at 10cm depth for all available energies and field sizes. (i) A small (0.11-0.53%) yet statistically significant beam hardening effect was observed, depending on photon beam energy. (ii) The increase in surface dose correlated with field size (pphoton energies except for 18MV. The change in surface dose was smaller than 3.3% in all cases except for the 20×20cm 2 field and 10MV FFF beam, where it reached 8.1%. (iii) For standard beams, transmission of the IQM showed a weak dependence on the field size, and a pronounced dependence on the beam energy (0.9412 for 6MV to 0.9578 for 18MV and 0.9440 for 6MV FFF; 0.9533 for 10MV FFF). The effects of the IQM detector on photon beam properties were found to be small yet statistically significant. The magnitudes of changes which were found justify treating IQM either as tray factors within the treatment planning system (TPS) for a particular energy or alternatively as modified outputs for specific beam energy of linear accelerators, which eases the introduction of the IQM into clinical practice. Copyright © 2017. Published by Elsevier GmbH.

Influence of the Integral Quality Monitor transmission detector on high energy photon beams. A multi-centre study

Energy Technology Data Exchange (ETDEWEB)

Casar, Bozidar [Institute of Oncology, Ljubljana (Slovenia). Dept. of Radiation Physics; Pasler, Marlies [Lake Constance Radiation Oncology Center, Singen and Friedrichshafen (Germany); Wegener, Sonja [Wuerzburg Univ. (Germany). Dept. of Radiation Oncology; and others

2017-10-01

The influence of the Integral Quality Monitor (IQM) transmission detector on photon beam properties was evaluated in a preclinical phase, using data from nine participating centres: (i) the change of beam quality (beam hardening), (ii) the influence on surface dose, and (iii) the attenuation of the IQM detector. For 6 different nominal photon energies (4 standard, 2 FFF) and square field sizes from 1 x 1 cm{sup 2} to 20 x 20 cm{sup 2}, the effect of IQM on beam quality was assessed from the PDD{sub 20,10} values obtained from the percentage dose depth (PDD) curves, measured with and without IQM in the beam path. The change in surface dose with/without IQM was assessed for all available energies and field sizes from 4 x 4 cm{sup 2} to 20 x 20 cm{sup 2}. The transmission factor was calculated by means of measured absorbed dose at 10 cm depth for all available energies and field sizes. (i) A small (0.11-0.53%) yet statistically significant beam hardening effect was observed, depending on photon beam energy. (ii) The increase in surface dose correlated with field size (p < 0.01) for all photon energies except for 18 MV. The change in surface dose was smaller than 3.3% in all cases except for the 20 x 20 cm{sup 2} field and 10 MV FFF beam, where it reached 8.1%. (iii) For standard beams, transmission of the IQM showed a weak dependence on the field size, and a pronounced dependence on the beam energy (0.9412 for 6 MV to 0.9578 for 18 MV and 0.9440 for 6 MV FFF; 0.9533 for 10 MV FFF). The effects of the IQM detector on photon beam properties were found to be small yet statistically significant. The magnitudes of changes which were found justify treating IQM either as tray factors within the treatment planning system (TPS) for a particular energy or alternatively as modified outputs for specific beam energy of linear accelerators, which eases the introduction of the IQM into clinical practice.

Tunable electronic transmission gaps in a graphene superlattice

International Nuclear Information System (INIS)

Lu Weitao; Wang Shunjin; Li Wen; Wang Yonglong; Jiang Hua

2012-01-01

The transmission in graphene superlattices with adjustable barrier height is investigated using transfer-matrix method. It is found that one could control the angular range of transmission by changing the ratio of incidence energy and barrier height. The transmission as a function of incidence energy has more than one gaps, due to the appearance of evanescent waves in different barriers. Accordingly, more than one conductivity minimums are induced. The transmission gaps could be controlled by adjusting the incidence angle, the barrier height, and the barrier number, which gives the possibility to construct an energy-dependent wavevector filter.

Energy Efficient Data Transmission for Sensors with Wireless Charging.

Science.gov (United States)

Fang, Xiaolin; Luo, Junzhou; Wu, Weiwei; Gao, Hong

2018-02-08

This paper studies the problem of maximizing the energy utilization for data transmission in sensors with periodical wireless charging process while taking into account the thermal effect. Two classes of problems are analyzed: one is the case that wireless charging can process for only a limited period of time, and the other is the case that wireless charging can process for a long enough time. Algorithms are proposed to solve the problems and analysis of these algorithms are also provided. For the first problem, three subproblems are studied, and, for the general problem, we give an algorithm that can derive a performance bound of ( 1 - 1 2 m ) ( O P T - E ) compared to an optimal solution. In addition, for the second problem, we provide an algorithm with 2 m 2 m - 1 O P T + 1 performance bound for the general problem. Simulations confirm the analysis of the algorithms.

Electric power transmission for a Hanford Nuclear Energy Center (HNEC)

International Nuclear Information System (INIS)

1975-09-01

The major issues examined in the comparison of the DIST and HNEC transmission concepts are: (1) type of transmission to be employed and an assessment of its technical feasibility, (2) availability of rights-of-way, (3) economics, (4) environmental impact, and (5) overall reliability of the transmission system. The type of transmission selected for bulk power transfer from an HNEC for the time period studied is overhead AC, 500 kV double or single circuit, a voltage currently used in the PNW system. This type of system can accommodate growth up to at least 23,000 MW of thermal capacity at an HNEC. Significant additional transmountain capacity needs would require 1100 kV transmission, which should be technologically proved by the end of the 1970s. (auth)

North-east transmission networks : organization and operations

International Nuclear Information System (INIS)

Roberge, F.

2003-01-01

A review of Quebec's electric power industry was presented along with an outline of non-regulated activity and regulated activities in terms of power generation, transmission, distribution and customer service. Both the transmission and distribution components of Quebec's electric power industry are regulated by the Regie de l'energie. Transmission networks offer access to all wholesalers. Hydro-Quebec TransEnergie was created in 1997 as a functionally independent open access transmission provider with high reliability standards. TransEnergie can address seams issues with neighbouring networks. The three types of services offered in terms of tariffs were also discussed along with data regarding Hydro-Quebec assets, revenue and net income. Hydro-Quebec's relation with the New Brunswick, Ontario, New York and New England were presented along with the issue of congestion and congestion costs. Congestion was defined as an incapacity to deliver energy at low cost because of a limited grid capacity, which results in a need to use more expensive energy. Solutions to decrease congestion include: building new transmission lines; using specialized equipment at existing distribution points; constructing strategically placed power generating stations; reducing the power load; and, increasing network control. The factors that influence investments in transport were also discussed. 1 tab., 9 figs

A Cross-Layer Wireless Sensor Network Energy-Efficient Communication Protocol for Real-Time Monitoring of the Long-Distance Electric Transmission Lines

Directory of Open Access Journals (Sweden)

Jun Yu

2015-01-01

Full Text Available Optimization of energy consumption in Wireless Sensor Network (WSN nodes has become a critical link that constrains the engineering application of the smart grid due to the fact that the smart grid is characterized by long-distance transmission in a special environment. The paper proposes a linear hierarchical network topological structure specific to WSN energy conservation in environmental monitoring of the long-distance electric transmission lines in the smart grid. Based on the topological structural characteristics and optimization of network layers, the paper also proposes a Topological Structure be Layered Configurations (TSLC routing algorithm to improve the quality of WSN data transmission performance. Coprocessing of the network layer and the media access control (MAC layer is achieved by using the cross-layer design method, accessing the status for the nodes in the network layer and obtaining the status of the network nodes of the MAC layer. It efficiently saves the energy of the whole network, improves the quality of the network service performance, and prolongs the life cycle of the network.

Floating microbial fuel cells as energy harvesters for signal transmission from natural water bodies

Science.gov (United States)

Schievano, Andrea; Colombo, Alessandra; Grattieri, Matteo; Trasatti, Stefano P.; Liberale, Alessandro; Tremolada, Paolo; Pino, Claudio; Cristiani, Pierangela

2017-02-01

A new type of floating microbial fuel cell (fMFC) was developed for power supply of remote environmental sensors and data transmission. Ten operating fMFCs generated a cell potential in the range 100-800 mV depending on the external resistance applied. Power production peaked around 3-3.5 mW (power density of 22-28 mW m-2 cathode) after about 20-30 days of start-up period. The average of daily electrical energy harvested ranged between 10 and 35 mWh/d. Long-term performances were ensured in the presence of dense rice plants (Oryza Sativa). A power management system, based on a step-up DC/DC converter and a low-power data transmission system via SIGFOX™ technology, have been set up for the fMFCs. The tested fMFCs systems allowed to: i) harvest produced energy, ii) supply electronic devices (intermittent LED-light and a buzzer); iii) transmit remote data at low speed (three message of 12 bites each, in 6 s). Several 'floating garden' MFCs were set in the context of demonstrative events at EXPO2015 world exposition held in Milan between May-October 2015. Some of the 'floating garden' MFCs were operating for more than one year.

A New Energy-Efficient Data Transmission Scheme Based on DSC and Virtual MIMO for Wireless Sensor Network

OpenAIRE

Li, Na; Zhang, Liwen; Li, Bing

2015-01-01

Energy efficiency in wireless sensor network (WSN) is one of the primary performance parameters. For improving the energy efficiency of WSN, we introduce distributed source coding (DSC) and virtual multiple-input multiple-output (MIMO) into wireless sensor network and then propose a new data transmission scheme called DSC-MIMO. DSC-MIMO compresses the source data using distributed source coding before transmitting, which is different from the existing communication schemes. Data compression c...

Dual-Hop VLC/RF Transmission System with Energy Harvesting Relay under Delay Constraint

KAUST Repository

Rakia, Tamer

2017-02-09

In this paper, we introduce a dual-hop visible light communication (VLC) / radio frequency (RF) transmission system to extend the coverage of indoor VLC systems. The relay between the two hops is able to harvest light energy from different artificial light sources and sunlight entering the room. The relay receives data packet over a VLC channel and uses the harvested energy to retransmit it to a mobile terminal over an RF channel. We develop a novel statistical model for the harvested electrical power and analyze the probability of data packet loss. We define a system design parameter (α ∈ [0, 1)) that controls the time dedicated for excess energy harvesting and data packet retransmission. It was found that the parameter has an optimal value which minimizes the packet loss probability. Further more, this optimal value is independent of the RF channel path loss. However, optimal showed inverse dependence on the packet size.

Our views on transmission policy

International Nuclear Information System (INIS)

Wellford, W.H.; Sutley, N.H.

1990-01-01

In this article the authors discuss the need for predictable and fair access to transmission facilities in order to ensure competitive generation of power. They propose that the Federal Energy Regulatory Commission should regulate transmission to prevent a utility from gaining a competitive advantage in electricity generation markets, the incorporation of transmission access into every bidding program under state jurisdiction, and requirement of transmission rates, terms and conditions for all in-state utilities be included in the request for proposal

Modeling and simulation of hydrostatic transmission system with energy regeneration using hydraulic accumulator

International Nuclear Information System (INIS)

Ho, Triet Hung; Ahn, Kyoung Kwan

2010-01-01

A new hydraulic closed-loop hydrostatic transmission (HST) energy-saving system is proposed in this paper. The system improves the efficiency of the primary power source. Furthermore, the system is energy regenerative, highly efficient even under partial load conditions. It can work in either a flow or pressure coupling configuration, allowing it to avoid the disadvantages of each configuration. A hydraulic accumulator, the key component of the energy regenerative modality, can be decoupled from or coupled to the HST circuit to improve the efficiency of the system in low-speed, high-torque situations. The accumulator is used in a novel way to recover the kinetic energy without reversion of fluid flow. Both variable displacement hydraulic pump /motors are used when the system operates in the flow coupling configuration so as to enable it to meet the difficult requirements of some industrial and mobile applications. Modeling and a simulation were undertaken with regard to testing the primary energy sources in the two configurations and recovering the energy potential of the system. The results indicated that the low efficiency of traditional HSTs under partial load conditions can be improved by utilizing the pressure coupling configuration. The round-trip efficiency of the system in the energy recovery testing varied from 32% to 66% when the losses of the load were taken into account

Transmission line capital costs

International Nuclear Information System (INIS)

Hughes, K.R.; Brown, D.R.

1995-05-01

The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs

76 FR 59394 - Big Eddy-Knight Transmission Project

Science.gov (United States)

2011-09-26

... DEPARTMENT OF ENERGY Bonneville Power Administration Big Eddy-Knight Transmission Project AGENCY... Eddy-Knight Transmission Project in Wasco County, Oregon and Klickitat County, Washington. Construction of the Big Eddy-Knight Transmission Project will accommodate long-term firm transmission requests...

An Energy-Efficient and High-Quality Video Transmission Architecture in Wireless Video-Based Sensor Networks

Directory of Open Access Journals (Sweden)

Yasaman Samei

2008-08-01

Full Text Available Technological progress in the fields of Micro Electro-Mechanical Systems (MEMS and wireless communications and also the availability of CMOS cameras, microphones and small-scale array sensors, which may ubiquitously capture multimedia content from the field, have fostered the development of low-cost limited resources Wireless Video-based Sensor Networks (WVSN. With regards to the constraints of videobased sensor nodes and wireless sensor networks, a supporting video stream is not easy to implement with the present sensor network protocols. In this paper, a thorough architecture is presented for video transmission over WVSN called Energy-efficient and high-Quality Video transmission Architecture (EQV-Architecture. This architecture influences three layers of communication protocol stack and considers wireless video sensor nodes constraints like limited process and energy resources while video quality is preserved in the receiver side. Application, transport, and network layers are the layers in which the compression protocol, transport protocol, and routing protocol are proposed respectively, also a dropping scheme is presented in network layer. Simulation results over various environments with dissimilar conditions revealed the effectiveness of the architecture in improving the lifetime of the network as well as preserving the video quality.

An Energy-Efficient and High-Quality Video Transmission Architecture in Wireless Video-Based Sensor Networks.

Science.gov (United States)

Aghdasi, Hadi S; Abbaspour, Maghsoud; Moghadam, Mohsen Ebrahimi; Samei, Yasaman

2008-08-04

Technological progress in the fields of Micro Electro-Mechanical Systems (MEMS) and wireless communications and also the availability of CMOS cameras, microphones and small-scale array sensors, which may ubiquitously capture multimedia content from the field, have fostered the development of low-cost limited resources Wireless Video-based Sensor Networks (WVSN). With regards to the constraints of videobased sensor nodes and wireless sensor networks, a supporting video stream is not easy to implement with the present sensor network protocols. In this paper, a thorough architecture is presented for video transmission over WVSN called Energy-efficient and high-Quality Video transmission Architecture (EQV-Architecture). This architecture influences three layers of communication protocol stack and considers wireless video sensor nodes constraints like limited process and energy resources while video quality is preserved in the receiver side. Application, transport, and network layers are the layers in which the compression protocol, transport protocol, and routing protocol are proposed respectively, also a dropping scheme is presented in network layer. Simulation results over various environments with dissimilar conditions revealed the effectiveness of the architecture in improving the lifetime of the network as well as preserving the video quality.

Open access to transmission

International Nuclear Information System (INIS)

Keith, D.M.

1996-01-01

For the past 12 to 15 years, the US electric power and energy industry and its federal regulators have been going through a prolonged exercise leading to opening up the national interconnected transmission grid for all qualified wholesale users to have open and equal access. The debates have been painful in a sense that not all parties - especially some of the transmission system owning utilities - believe that the concept of Open Access is achievable, due to technical constraints on the systems. The present Open Access activity is limited to wholesales transaction under the federal jurisdiction, but several states are either experimenting with or considering retail wheeling. In fact, the FERC - Federal Energy Regulatory Commission - has already expanded its view to embrace retail transmission, if the retail transaction involves the use of the interstate transmission systems which are under FERC's jurisdiction. This paper delves into some of the results of the technical cost and pricing analysis for open access. The statutes and resulting regulations are not addressed herein. (author). 1 fig

THE MAIN DIRECTIONS OF IMPROVING THE EFFICIENCY OF PRODUCTION, TRANSMISSION AND DISTRIBUTION OF ELECTRICAL ENERGY

Directory of Open Access Journals (Sweden)

I. V. Zhezhelenko

2018-01-01

Full Text Available The main directions of increase of efficiency of production, transmission and distribution of electric energy have been formulated. The relation between the values of electricity losses during transmission via power grids of different countries and the level of the economies of these countries characterized by the value of gross domestic product at purchasing power parity per capita has been established. In the countries with a gross domestic product at purchasing power parity per capita less than 20 thousand US dollars electricity losses during its transmission via power grids are 1.5–2.5 times more than the ones transmitted via power grids of the industrialized countries where the specified purchasing power parity is in the range of 30.4–54.5 thousand US dollars. In the countries with more developed economies the technical culture of production, transmission and distribution of electricity is higher; the modern control systems of operation modes of electrical networks are used as well as of monitoring and accounting of electricity; also there are solvent and disciplined consumers in such countries as well as clear regulatory framework and tariff regulation system. However, the process of transmission and distribution of electricity is effective if not only low relative losses take place, but the normal (contractual requirements for carrying capacity, quality and reliability of electricity supply are provided. The possibility of analytical determination of the optimum value of reserve capacity of power plants providing the required level of reliability of the power system has been considered.

Optimizing Transmission and Shutdown for Energy-Efficient Real-time Packet Scheduling in Clustered Ad Hoc Networks

Directory of Open Access Journals (Sweden)

Rajkumar Ragunathan

2005-01-01

Full Text Available Energy efficiency is imperative to enable the deployment of ad hoc networks. Conventional power management focuses independently on the physical or MAC layer and approaches differ depending on the abstraction level. At the physical layer, the fundamental tradeoff between transmission rate and energy is exploited, which leads to transmit as slow as possible. At MAC level, power reduction techniques aim to transmit as fast as possible to maximize the radios power-off interval. The two approaches seem conflicting and it is not obvious which one is the most appropriate. We propose a transmission strategy that optimally mixes both techniques in a multiuser context. We present a cross-layer solution considering the transceiver power characteristics, the varying system load, and the dynamic channel constraints. Based on this, we derive a low-complexity online scheduling algorithm. Results considering an -ary quadrature amplitude modulation radio show that for a range of scenarios a large power reduction is achieved, compared to the case where only scaling or shutdown is considered.

Energy sustainability through green energy

CERN Document Server

Sharma, Atul

2015-01-01

This book shares the latest developments and advances in materials and processes involved in the energy generation, transmission, distribution and storage. Chapters are written by researchers in the energy and materials field. Topics include, but are not limited to, energy from biomass, bio-gas and bio-fuels; solar, wind, geothermal, hydro power, wave energy; energy-transmission, distribution and storage; energy-efficient lighting buildings; energy sustainability; hydrogen and fuel cells; energy policy for new and renewable energy technologies and education for sustainable energy development

Terminological dictionary of electrical power industry in range of generation, transmission and distribution of electric energy

International Nuclear Information System (INIS)

Biernacki, T.; Cegla, S.; Ciszewski, W.

1990-08-01

The dictionary contains about 5000 terms about conventional and nuclear power plants, energy sources, transmission lines, automation, power systems, environment protection, statistics etc. Each term is given with definition and its equivalents in English, French, German and Russian. Indexes of Polish, English, French, German and Russian terms are provided at the back of dictionary. (A.S.)

EFFICIENCY ANALYSIS OF ENERGY ACCUMULATING MECHANISM FOR TRACTOR WITH ELECTROMECHANICAL TRANSMISSION

Directory of Open Access Journals (Sweden)

Ch. I. Zhdanovich

2017-01-01

Full Text Available Dependence of tractor wheel torque on theoretical tractor motion speed has been used for comparison of tractor operation with electromechanical transmission with installation of energy accumulating mechanism and without its installation. In this case a traction asynchronous electric motor is operating under nominal and limit conditions. The paper also considers dependence diagrams of actual input power for the traction asynchronous electric motor and its losses due to theoretical tractor motion speed. Tractor wheel torque is limited during the operation of the traction asynchronous electric motor with energy accumulating mechanisms by the following factors: maximum electric motor torque at the given frequency of supply voltage; maximum value of internal combustion motor output which can be transferred to the traction asynchronous electric motor; grip of the wheels. During the operation of the traction asynchronous electric motor with energy accumulating mechanisms there is a possibility for short power consumption without regard to the second limitation because it is possible to use power not only of internal combustion motor but also the power which is stored in the energy accumulating mechanisms. Comparison of characteristics has been made when a tractor is operating at high gear and when it is operating at all gears (that is two gears. Operation of the 5th class tractors has been analyzed for all possible cases (operation with energy accumulating mechanisms and without the mechanisms while being operated at all gears and various types of work: tilling, sowing, cultivation, bulldozing work, transport mode. In this case equipment has been used which is aggregated with the 5th class tractor. 

Long-distance power transmission technology. Microwave power transmission; Denryoku no chokyori yuso gijutsu. Micro ha musen soden

Energy Technology Data Exchange (ETDEWEB)

Kaya, N [Kobe University, Kobe (Japan). Faculty of Engineering

1994-11-05

This paper explains the principles of microwave power transmission as a long-distance power transmission technology, and the status of its development. Under an assumption of using a wave length of 12 cm (2.45 GHz) and a transmission distance of 1 km, an ideal wireless power transmission can realize transmitting the power at an efficiency of 95% or higher if transmitting and receiving antennas with a radius of 8.8 m are used. What remains as important requirements is raising the efficiency of conversion from power supply into microwaves, and the efficiency of rectification after the power has been received. By using microwave energy sent from a transmission antenna installed on the roof of an automobile, a model airplane with a receiving antenna installed at its rear flew successfully for 40 seconds under the microwave lifted airplane experiment (MILAX). In an experiment of transmitting microwave power in space, power was successfully transmitted to the child rocket as an event under the International Space Year - Microwave Energy Transmission in Space (ISY-METS). The microwave wireless power transmission on the ground would have a possibility of taking over the overhead line transmission into islands. An attempt is scheduled to send power of 5 kW by using transmission and receiving antennas with a diameter of 3 m to investigate effects on transmission efficiency, and communications and electromagnetic environments, and to collect basic data. 3 refs., 3 figs.

A soft computing scheme incorporating ANN and MOV energy in fault detection, classification and distance estimation of EHV transmission line with FSC.

Science.gov (United States)

Khadke, Piyush; Patne, Nita; Singh, Arvind; Shinde, Gulab

2016-01-01

In this article, a novel and accurate scheme for fault detection, classification and fault distance estimation for a fixed series compensated transmission line is proposed. The proposed scheme is based on artificial neural network (ANN) and metal oxide varistor (MOV) energy, employing Levenberg-Marquardt training algorithm. The novelty of this scheme is the use of MOV energy signals of fixed series capacitors (FSC) as input to train the ANN. Such approach has never been used in any earlier fault analysis algorithms in the last few decades. Proposed scheme uses only single end measurement energy signals of MOV in all the 3 phases over one cycle duration from the occurrence of a fault. Thereafter, these MOV energy signals are fed as input to ANN for fault distance estimation. Feasibility and reliability of the proposed scheme have been evaluated for all ten types of fault in test power system model at different fault inception angles over numerous fault locations. Real transmission system parameters of 3-phase 400 kV Wardha-Aurangabad transmission line (400 km) with 40 % FSC at Power Grid Wardha Substation, India is considered for this research. Extensive simulation experiments show that the proposed scheme provides quite accurate results which demonstrate complete protection scheme with high accuracy, simplicity and robustness.

Microwave power - An energy transmission alternative for the year 2000

Science.gov (United States)

Nalos, E.; Sperber, R.

1980-01-01

Recent technological advances related to the feasibility of efficient RF-dc rectification make it likely that by the year 2000 the transmission of power through space will have become a practical reality. Proposals have been made to power helicopters, aircraft, balloons, and rockets remotely. Other proposals consider the transfer of power from point to point on earth via relay through space or a transmission of power from large power sources in space. Attention has also been given to possibilities regarding the transmission of power between various points in the solar system. An outline is provided of the microwave power transmission system envisaged for the solar power satellite, taking into account the transmitting antenna, the receiver on earth, aspects of beam formation and control, transmitter options, the receiving antenna design, and cost and efficiency considerations.

Model documentation: Natural Gas Transmission and Distribution Model of the National Energy Modeling System; Volume 1

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-02-24

The Natural Gas Transmission and Distribution Model (NGTDM) is a component of the National Energy Modeling System (NEMS) used to represent the domestic natural gas transmission and distribution system. NEMS is the third in a series of computer-based, midterm energy modeling systems used since 1974 by the Energy Information Administration (EIA) and its predecessor, the Federal Energy Administration, to analyze domestic energy-economy markets and develop projections. This report documents the archived version of NGTDM that was used to produce the natural gas forecasts used in support of the Annual Energy Outlook 1994, DOE/EIA-0383(94). The purpose of this report is to provide a reference document for model analysts, users, and the public that defines the objectives of the model, describes its basic design, provides detail on the methodology employed, and describes the model inputs, outputs, and key assumptions. It is intended to fulfill the legal obligation of the EIA to provide adequate documentation in support of its models (Public Law 94-385, Section 57.b.2). This report represents Volume 1 of a two-volume set. (Volume 2 will report on model performance, detailing convergence criteria and properties, results of sensitivity testing, comparison of model outputs with the literature and/or other model results, and major unresolved issues.) Subsequent chapters of this report provide: (1) an overview of the NGTDM (Chapter 2); (2) a description of the interface between the National Energy Modeling System (NEMS) and the NGTDM (Chapter 3); (3) an overview of the solution methodology of the NGTDM (Chapter 4); (4) the solution methodology for the Annual Flow Module (Chapter 5); (5) the solution methodology for the Distributor Tariff Module (Chapter 6); (6) the solution methodology for the Capacity Expansion Module (Chapter 7); (7) the solution methodology for the Pipeline Tariff Module (Chapter 8); and (8) a description of model assumptions, inputs, and outputs (Chapter 9).

76 FR 18210 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2011-04-01

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP11-138-000] Texas Eastern Transmission, LP; Notice of Application On March 15, 2011, Texas Eastern Transmission Corporation (Texas Eastern), 5400 Westheimer Court, Houston, Texas 77056-5310, filed with the Federal Energy Regulatory...

Electromagnetic Compatibility of Transcutaneous Energy Transmission Systemfor Totally Implantable Artificial Heart

Science.gov (United States)

Shiba, Kenji; Koshiji, Kohji

Transcutaneous Energy Transmission (TET) is one way of providing the energy needed to power a totally implantable artificial heart (TIAH). In the present study, an externally coupled TET system was implanted in a prototype human phantom to evaluate emission and immunity. In the emission evaluation, measurements were conducted based on CISPR Pub.11 and VDE 0871 standards, while immunity tests were based on the standards of the IEC 61000-4 series. The magnetic field of the radiated emission was measured using a loop antenna. At 0.1[MHz], we found the greatest magnetic field of 47.8 [dBμA/m], somewhat less than CISPR’s upper limit of 54 [dBμA/m]. For the conducted emission, by installing a noise filter and ferrite beads in the input section of the DC-power supply, conducted emission could be kept within the allowable limits of CISPR Pub.11 and VDE 0871. Finally, the immunity tests against radiated and conducted emission, electrostatic discharge and voltage fluctuation proved that the prototype could withstand the maximum level of disturbance. These results confirmed that the TET system implanted in a human phantom could, through modification, meet the emission and immunity standards.

Alternative approaches to transmission investment

Energy Technology Data Exchange (ETDEWEB)

Welch, J.L. [International Transmission Co., Detroit, MI (United States)

2004-07-01

The International Transmission Company (ITC) is an independent power transmission company that owns, operates and maintains the high voltage transmission system in southeastern Michigan. The company's current focus is on investing in the transmission infrastructure to improve reliability, relieve congestion, improve access to generation and reduce energy costs for consumers. There is a need for investment in power transmission. Trends indicate that power transactions are on the rise while transmission investment is lagging because pricing protocols are inadequate and there is no regional tariff mechanism to allocate the benefits of new investment. The presentation reviewed the applicability of FTRs to transmission owners and the pitfalls of participant funding pricing. It also outlined the regional benefit allocation mechanism (RBAM) with an illustrative example. It was concluded that existing pricing policies must be improved to address the growing need for transmission investment. RBAM is needed to help investors recover costs from project beneficiaries. figs.

76 FR 49760 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2011-08-11

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP11-524-000] Texas Eastern Transmission, LP; Notice of Application Take notice that on July 29, 2011, Texas Eastern Transmission, LP (Texas Eastern), 5400 Westheimer Court, Houston, Texas 77056-5310, filed with the Federal Energy...

Transport Schemes for Fiber-Wireless Technology: Transmission Performance and Energy Efficiency

Directory of Open Access Journals (Sweden)

Christina Lim

2014-04-01

Full Text Available Fiber-wireless technology has been actively researched as a potential candidate for next generation broadband wireless signal distribution. Despite the popularity, this hybrid scheme has many technical challenges that impede the uptake and commercial deployment. One of the inherent issues is the transport of the wireless signals over a predominantly digital optical network in today’s telecommunication infrastructure. Many different approaches have been introduced and demonstrated with digitized RF transport of the wireless signals being the most compatible with the existing optical fiber networks. In this paper, we review our work in the area of digitized RF transport to address the inherent issues related to analog transport in the fiber-wireless links and compare the transmission performance and energy efficiency with the other transport strategies.

Integrating Renewable Energy into the Transmission and Distribution System of the U. S. Virgin Islands

Energy Technology Data Exchange (ETDEWEB)

Burman, K.; Olis, D.; Gevorgian, V.; Warren, A.; Butt, R.; Lilienthal, P.; Glassmire, J.

2011-09-01

This report focuses on the economic and technical feasibility of integrating renewable energy technologies into the U.S. Virgin Islands transmission and distribution systems. The report includes three main areas of analysis: 1) the economics of deploying utility-scale renewable energy technologies on St. Thomas/St. John and St. Croix; 2) potential sites for installing roof- and ground-mount PV systems and wind turbines and the impact renewable generation will have on the electrical subtransmission and distribution infrastructure, and 3) the feasibility of a 100- to 200-megawatt power interconnection of the Puerto Rico Electric Power Authority (PREPA), Virgin Islands Water and Power Authority (WAPA), and British Virgin Islands (BVI) grids via a submarine cable system.

Natural Gas Transmission and Distribution Model of the National Energy Modeling System. Volume 1

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-01-01

The Natural Gas Transmission and Distribution Model (NGTDM) is the component of the National Energy Modeling System (NEMS) that is used to represent the domestic natural gas transmission and distribution system. The NGTDM is the model within the NEMS that represents the transmission, distribution, and pricing of natural gas. The model also includes representations of the end-use demand for natural gas, the production of domestic natural gas, and the availability of natural gas traded on the international market based on information received from other NEMS models. The NGTDM determines the flow of natural gas in an aggregate, domestic pipeline network, connecting domestic and foreign supply regions with 12 demand regions. The purpose of this report is to provide a reference document for model analysts, users, and the public that defines the objectives of the model, describes its basic design, provides detail on the methodology employed, and describes the model inputs, outputs, and key assumptions. Subsequent chapters of this report provide: an overview of NGTDM; a description of the interface between the NEMS and NGTDM; an overview of the solution methodology of the NGTDM; the solution methodology for the Annual Flow Module; the solution methodology for the Distributor Tariff Module; the solution methodology for the Capacity Expansion Module; the solution methodology for the Pipeline Tariff Module; and a description of model assumptions, inputs, and outputs.

Transmission of electrons through Al2O3 nanocapillaries

DEFF Research Database (Denmark)

Milosavljević, A.R.; Jureta, J.J.; Víkor, Gy.

2012-01-01

We investigate transmission of low-energy electrons (250 eV) through insulating AlO nanocapillaries (270 nm diameter and 15 μm length). Kinetic energy distribution of electrons transmitted through the nanocapillaries in the straightforward direction, time dependence of the transmission rate both...

Transmission Challenges and Best Practices for Cost-Effective Renewable Energy Delivery across State and Provincial Boundaries

Energy Technology Data Exchange (ETDEWEB)

Zhou, Shengru [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Hurlbut, David J. [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Bird, Lori A. [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Wang, Qin [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

2017-08-22

A strategically planned transmission network is an important source of flexibility for the integration of large-scale renewable energy (RE). Such a network can offer access to a broad geographic diversity of resources, which can reduce flexibility needs and facilitate sharing between neighboring balancing areas. This report builds on two previous NREL technical reports - Advancing System Flexibility for High Penetration Renewable Integration (Milligan et al. 2015) and 'Renewables-Friendly' Grid Development Strategies (Hurlbut et al. 2015) - which discuss various flexibility options and provide an overview of U.S. market models and grid planning. This report focuses on addressing issues with cross-regional/provincial transmission in China with the aim of integrating renewable resources that are concentrated in remote areas and require inter-regional/provincial power exchange.

Transmission Challenges and Best Practices for Cost-Effective Renewable Energy Delivery across State and Provincial Boundaries

Energy Technology Data Exchange (ETDEWEB)

Hurlbut, David [National Renewable Energy Lab. (NREL), Golden, CO (United States); Zhou, Ella [National Renewable Energy Lab. (NREL), Golden, CO (United States); Bird, Lori [National Renewable Energy Lab. (NREL), Golden, CO (United States); Wang, Qin [National Renewable Energy Lab. (NREL), Golden, CO (United States)

2017-03-21

A strategically planned transmission network is an important source of flexibility for the integration of large-scale renewable energy (RE). Such a network can offer access to a broad geographic diversity of resources, which can reduce flexibility needs and facilitate sharing between neighboring balancing areas. This report builds on two previous NREL technical reports - Advancing System Flexibility for High Penetration Renewable Integration (Milligan et al. 2015) and 'Renewables-Friendly' Grid Development Strategies (Hurlbut et al. 2015) - which discuss various flexibility options and provide an overview of U.S. market models and grid planning. This report focuses on addressing issues with cross-regional/provincial transmission in China with the aim of integrating renewable resources that are concentrated in remote areas and require inter-regional/provincial power exchange.

The insertion of environmental impact assessment in the planning process of electrical energy transmission systems

International Nuclear Information System (INIS)

Pires, S.H.

1994-03-01

The main objective of this work is to identify and propose adequate methodologies in each stage of the planning process of electrical energy transmission systems. The aim is to incorporate the environmental dimension as a variable of this process, along with the economic and technical aspects. All these factors are to be taken into consideration in the decision-making, design and management of these projects. The environmental impact assessment (EIA) concepts, methods and procedures were analysed, as well as the roles that it should play, as a means to become the effective instrument of the Environmental Policy. In this study we analysed the whole planning process of the implementation of transmission lines and their impact on the environment. The current attitudes about this subject were investigated and scrutinized. Critical evaluations were made to suggest an orientation in the formulation of the proposed methodology. (author). 125 refs, 11 figs, 13 tabs

The limits of HVDC transmission

International Nuclear Information System (INIS)

Pickard, William F.

2013-01-01

Renewable energy is abundant, but not necessarily near the urban centers where it will be used. Therefore, it must be transported; and this transport entails a systemic energy penalty. In this paper simple qualitative calculations are introduced to show (i) that high-voltage direct-current (HVDC) power lines for megameter and greater distances are unlikely to achieve power capacities much beyond 2 GW, although they can be paralleled; (ii) that most sources and sinks of electric power are rather less than 10,000 km apart; (iii) that such long lines can be constructed to have transmission losses -tilde 2%; and (iv) that lines of such low loss in fact meet minimal standards of intergenerational equity. - Highlights: • Renewable Energy is abundant, but not necessarily near population centers. • Its transportation requires energy and can be a major systemic inefficiency. • HVDC can be transmitted 10,000 km with 2% loss and near-optimal embodied energy. • Such transmission meets the requirements of intergenerational equity

Electrical transmission

Energy Technology Data Exchange (ETDEWEB)

Sayers, D P

1960-05-01

After briefly tracing the history of electricity transmission, trends in high voltage transmission and experiments being conducted on 650 kV are discussed. 5000 miles of the U.K. grid are operated at 132 kV and 1000 at 275 kV, ultimately to provide a super grid at 380 kV. Problems are insulation, radio interference and the cost of underground lines (16 times that of overhead lines). Also considered are the economics of the grid as a means of transporting energy and as a means of spreading the peak load over the power stations in the most efficient manner. Finally, the question of amenities is discussed.

Characterization of a quadrant diamond transmission X-ray detector including a precise determination of the mean electron-hole pair creation energy.

Science.gov (United States)

Keister, Jeffrey W; Cibik, Levent; Schreiber, Swenja; Krumrey, Michael

2018-03-01

Precise monitoring of the incoming photon flux is crucial for many experiments using synchrotron radiation. For photon energies above a few keV, thin semiconductor photodiodes can be operated in transmission for this purpose. Diamond is a particularly attractive material as a result of its low absorption. The responsivity of a state-of-the art diamond quadrant transmission detector has been determined, with relative uncertainties below 1% by direct calibration against an electrical substitution radiometer. From these data and the measured transmittance, the thickness of the involved layers as well as the mean electron-hole pair creation energy were determined, the latter with an unprecedented relative uncertainty of 1%. The linearity and X-ray scattering properties of the device are also described.

Transmission access raises unresolved economic issues

International Nuclear Information System (INIS)

Happ, H.H.

1994-01-01

The electric utility industry is in the process of gradual change from a fully regulated industry to one of partial deregulation. Instead of relying on regulation to achieve a fair and equitable price to the consumer for electric energy, the reliance is placed more and more on market forces, through competition, to provide wholesale energy at the best market price. Clearly, open transmission access is required to create a viable competitive wholesale market for new generation resources. This article describes four unresolved, or at least partially unresolved, issues associated with transmission access for wholesale wheeling. Wheeling has been defined as the use of a utility's transmission facilities to transmit power for other buyers and sellers. At least three parties are involved in a wheeling transaction: a seller, a buyer, and one or more wheeling utilities that transmit the power from the seller to the buyer. This article considers wholesale or bulk wheeling only, and does not consider retail wheeling. The four unresolved economic issues described in this article pertain to transmission access: Actual cost of providing transmission services, Methodology or methodologies used in evaluating the cost of wheeling, Contract path versus the actual power flows of the wheel, Issues associated with the formation of transmission regions

Development of laser surface cladding through energy transmission over optical fiber

International Nuclear Information System (INIS)

Hirano, Kenji; Morishige, Norio; Irisawa, Toshio

1990-01-01

Much attention has recently been paid to laser cladding techniques as an approach in controlling the composition and structure of the metal surface. If YAG laser is used as the cladding method, the flexibility of laser cladding process increases extremely because YAG laser beam is transmitted through an optical fiber, and enabling cladding on pipes installed in actual plants. So experiments on YAG laser cladding through energy transmission over an optical fiber were performed to prevent stress corrosion cracking in austenitic stainless steel pipes. In order to build a cladding layer, mixed metal powder were pre-placed on the inner surface of the pipe using organic binder and the pre-placed powder beds were melted with YAG laser beam transmitted using an optical fiber. This paper introduces the method of building a cladding layer on pipes in actual nuclear plants. (author)

Transmission and wind investment in a deregulated electricity industry

DEFF Research Database (Denmark)

Maurovich-Horvat, Lajos; Boomsma, Trine Krogh; Siddiqui, Afzal S.

2015-01-01

Adoption of dispersed renewable energy technologies requires transmission network expansion. Besides the transmission system operator (TSO), restructuring of electricity industries has introduced a merchant investor (MI), who earns congestion rents from constructing new lines. We compare these tw...... proportion of energy is produced by wind. In effect, withholding of generation capacity by producers prompts more transmission investment since the TSO aims to increase welfare by subsidizing wind and the MI creates more flow to maximize profit....

Electric Power Transmission Lines

Data.gov (United States)

Department of Homeland Security — Transmission Lines are the system of structures, wires, insulators and associated hardware that carry electric energy from one point to another in an electric power...

Creating a robust and integrated electrical transmission system

International Nuclear Information System (INIS)

McLain, S.

2004-01-01

The service territory for Puget Sound Energy (PSE) was presented in terms of electric power and gas transmission. Issues affecting the Puget Sound area include high growth and the west coast energy crisis which has had an adverse financial impact on the power industry. The transmission system is basically at capacity and has been impacted by imports and exports between the United States and Canada. Other issues include the separation between energy resources and transmission, modernizing the power grid, and challenges for independent power producers (IPPs). The Northwest Transmission Assessment Committee (NTAC), which was formed under the Northwest Power Pool, has the potential to bring interested parties to study constrained paths and to plan a single utility concept for the region. It is expected that new challenges such as financing and risk management will emerge once the technical solutions are identified and agreed upon. The issue of enforceable and mandatory reliability standards was also discussed. 1 fig

Elemental distribution imaging by energy-filtering transmission electron microscopy (EFTEM) and its applications

International Nuclear Information System (INIS)

Kurata, Hiroki

1996-01-01

EFTEM is new microscopy with the object of visualizing high resolution quantitative elemental distribution. The measurement principles and the present state of EFTEM studies are explained by the examples of measurement of the elemental distributions. EFTEM is a combination of the transmission electron microscope with the electron energy loss spectroscopy (EFLS). EFTEM method sets the slit in the specific energy field and put the electron passing the slit back in the microscopic image. The qualitative elemental analysis is obtained by observing the position of the absorption end of core electronic excitation spectrum and the quantitative one by determining the core electronic excitation strength of the specific atom depend on filtering with energy selector slit. The binding state and the local structure in the neighborhood of excited atom is determined by the fine structure of absorption end. By the chemical mapping method, the distribution image of chemical binding state is visualized by the imaging chemical map obtained by filtering the specific peak strength of fine structure with the narrow energy selector slit. The fine powder of lead chromate (PbCrO 4 ) covered with silica glass was shown as a typical example of the elemental distribution image of core electronic excitation spectrum. The quantitative analysis method of elemental distribution image is explained. The possibility of single atom analysis at nanometer was shown by the example of nanotube observed by EFTEM. (S.Y.)

Model documentation Natural Gas Transmission and Distribution Model of the National Energy Modeling System. Volume 1

International Nuclear Information System (INIS)

1996-01-01

The Natural Gas Transmission and Distribution Model (NGTDM) of the National Energy Modeling System is developed and maintained by the Energy Information Administration (EIA), Office of Integrated Analysis and Forecasting. This report documents the archived version of the NGTDM that was used to produce the natural gas forecasts presented in the Annual Energy Outlook 1996, (DOE/EIA-0383(96)). The purpose of this report is to provide a reference document for model analysts, users, and the public that defines the objectives of the model, describes its basic approach, and provides detail on the methodology employed. Previously this report represented Volume I of a two-volume set. Volume II reported on model performance, detailing convergence criteria and properties, results of sensitivity testing, comparison of model outputs with the literature and/or other model results, and major unresolved issues

Model documentation Natural Gas Transmission and Distribution Model of the National Energy Modeling System. Volume 1

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-02-26

The Natural Gas Transmission and Distribution Model (NGTDM) of the National Energy Modeling System is developed and maintained by the Energy Information Administration (EIA), Office of Integrated Analysis and Forecasting. This report documents the archived version of the NGTDM that was used to produce the natural gas forecasts presented in the Annual Energy Outlook 1996, (DOE/EIA-0383(96)). The purpose of this report is to provide a reference document for model analysts, users, and the public that defines the objectives of the model, describes its basic approach, and provides detail on the methodology employed. Previously this report represented Volume I of a two-volume set. Volume II reported on model performance, detailing convergence criteria and properties, results of sensitivity testing, comparison of model outputs with the literature and/or other model results, and major unresolved issues.

Provisioning Strategies for Transparent Optical Networks Considering Transmission Quality, Security, and Energy Efficiency

Energy Technology Data Exchange (ETDEWEB)

Jirattigalachote, Amornrat

2012-07-01

The continuous growth of traffic demand driven by the brisk increase in number of Internet users and emerging online services creates new challenges for communication networks. The latest advances in Wavelength Division Multiplexing (WDM) technology make it possible to build Transparent Optical Networks (TONs) which are expected to be able to satisfy this rapidly growing capacity demand. The work in this thesis addresses three important aspects. In particular, this thesis focuses on routing and wavelength assignment (RWA) strategies specifically devised to target: (i) the lightpath transmission quality, (ii) the network security (i.e., in terms of vulnerability to physical-layer attacks), and (iii) the reduction of the network energy consumption. Our contributions are summarized below. A number of Impairment Constraint Based Routing (ICBR) algorithms have been proposed in the literature to consider physical-layer impairments during the connection provisioning phase. Their objective is to prevent the selection of optical connections (referred to as lightpaths) with poor signal quality. These ICBR approaches always assign each connection request the least impaired lightpath and support only a single threshold of transmission quality, used for all connection requests. However, next generation networks are expected to support a variety of services with disparate requirements for transmission quality. To address this issue, in this thesis we propose an ICBR algorithm supporting differentiation of services at the Bit Error Rate (BER) level, referred to as ICBR-Diff. Our approach takes into account the effect of physical-layer impairments during the connection provisioning phase where various BER thresholds are considered for accepting/blocking connection requests, depending on the signal quality requirements of the connection requests. We tested the proposed ICBR-Diff approach in different network scenarios, including also a fiber heterogeneity. It is shown that it can

75 FR 14386 - Interpretation of Transmission Planning Reliability Standard

Science.gov (United States)

2010-03-25

...] Interpretation of Transmission Planning Reliability Standard March 18, 2010. AGENCY: Federal Energy Regulatory... transmission planning Reliability Standard TPL-002-0 provides that planning authorities and transmission... Reliability Standard TPL-002-0. In this order, the Commission proposes to reject NERC's proposed...

The planning of transmission grids. Conditions of the energy policy turnaround; Die Planung der Uebertragungsnetze. Bedingung der Energiewende.

Energy Technology Data Exchange (ETDEWEB)

Witt, Siegfried de; Durinke, Peter; Kause, Harriet [DE WITT Rechtsanwaltsgesellschaft mbH, Berlin (Germany)

2012-07-01

The book reports on planning processes for the power transmission grid. The design and implementation of a high-voltage line of the transmission system consists of four stages (Part I): (a) National planning of requirements; (b) Planning procedures or federal sector planning; (c) Planning approval procedure; (d) Expropriation proceedings. Part II of this book describes the planning according to the Energy Economy Law (EnWG) and Electricity Grid Expansion Act (EnLAG). The Part III of the book under consideration describes the procedures to be taken out by the NABEG (Act for the Acceleration of Network Expansion) from the scope of paragraph 15 ROG (Regional Planning Act) and paragraph 43 EnWG.

Topics on Electricity Transmission Pricing

Energy Technology Data Exchange (ETDEWEB)

Bjoerndal, Mette

2000-02-01

Within the last decade we have experienced deregulation of several industries, such as airlines, telecommunications and the electric utility industry, the last-mentioned being the focus of this work. Both the telecommunications and the electricity sector depend on network facilities, some of which are still considered as natural monopolies. In these industries, open network access is regarded as crucial in order to achieve the gains from increased competition, and transmission tariffs are important in implementing this. Based on the Energy Act that was introduced in 1991, Norway was among the first countries to restructure its electricity sector. On the supply side there are a large number of competing firms, almost exclusively hydro plants, with a combined capacity of about 23000 MW, producing 105-125 TWh per year, depending on the availability of water. Hydro plants are characterized by low variable costs of operation, however since water may be stored in dams, water has an opportunity cost, generally known as the water value, which is the shadow price of water when solving the generator's inter temporal profit maximization problem. Water values are the main factor of the producers' short run marginal cost. Total consumption amounts to 112-117 TWh a year, and consumers, even households, may choose their electricity supplier independent of the local distributor to which the customer is connected. In fact, approximately 10% of the households have actually changed supplier. The web-site www.konkurransetilsynet.no indicates available contracts, and www.dinside.no provides an ''energy-calculator'' where one can check whether it is profitable to switch supplier. If a customer buys energy from a remote supplier, the local distributor only provides transportation facilities for the energy and is compensated accordingly. Transmission and distribution have remained monopolized and regulated by the Norwegian Water Resources and Energy

Topics in Electricity Transmission Pricing

Energy Technology Data Exchange (ETDEWEB)

Bjoerndal, Mette

2000-02-01

Within the last decade we have experienced deregulation of several industries, such as airlines, telecommunications and the electric utility industry, the last-mentioned being the focus of this work. Both the telecommunications and the electricity sector depend on network facilities, some of which are still considered as natural monopolies. In these industries, open network access is regarded as crucial in order to achieve the gains from increased competition, and transmission tariffs are important in implementing this. Based on the Energy Act that was introduced in 1991, Norway was among the first countries to restructure its electricity sector. On the supply side there are a large number of competing firms, almost exclusively hydro plants, with a combined capacity of about 23000 MW, producing 105-125 TWh per year, depending on the availability of water. Hydro plants are characterized by low variable costs of operation, however since water may be stored in dams, water has an opportunity cost, generally known as the water value, which is the shadow price of water when solving the generator's inter temporal profit maximization problem. Water values are the main factor of the producers' short run marginal cost. Total consumption amounts to 112-117 TWh a year, and consumers, even households, may choose their electricity supplier independent of the local distributor to which the customer is connected. In fact, approximately 10% of the households have actually changed supplier. The web-site www.konkurransetilsynet.no indicates available contracts, and www.dinside.no provides an ''energy-calculator'' where one can check whether it is profitable to switch supplier. If a customer buys energy from a remote supplier, the local distributor only provides transportation facilities for the energy and is compensated accordingly. Transmission and distribution have remained monopolized and regulated by the Norwegian Water Resources and Energy

Topics on Electricity Transmission Pricing

International Nuclear Information System (INIS)

Bjoerndal, Mette

2000-02-01

Within the last decade we have experienced deregulation of several industries, such as airlines, telecommunications and the electric utility industry, the last-mentioned being the focus of this work. Both the telecommunications and the electricity sector depend on network facilities, some of which are still considered as natural monopolies. In these industries, open network access is regarded as crucial in order to achieve the gains from increased competition, and transmission tariffs are important in implementing this. Based on the Energy Act that was introduced in 1991, Norway was among the first countries to restructure its electricity sector. On the supply side there are a large number of competing firms, almost exclusively hydro plants, with a combined capacity of about 23000 MW, producing 105-125 TWh per year, depending on the availability of water. Hydro plants are characterized by low variable costs of operation, however since water may be stored in dams, water has an opportunity cost, generally known as the water value, which is the shadow price of water when solving the generator's inter temporal profit maximization problem. Water values are the main factor of the producers' short run marginal cost. Total consumption amounts to 112-117 TWh a year, and consumers, even households, may choose their electricity supplier independent of the local distributor to which the customer is connected. In fact, approximately 10% of the households have actually changed supplier. The web-site www.konkurransetilsynet.no indicates available contracts, and www.dinside.no provides an ''energy-calculator'' where one can check whether it is profitable to switch supplier. If a customer buys energy from a remote supplier, the local distributor only provides transportation facilities for the energy and is compensated accordingly. Transmission and distribution have remained monopolized and regulated by the Norwegian Water Resources and Energy Directorate (NVE). To prevent cross

76 FR 30869 - Promoting Transmission Investment Through Pricing Reform

Science.gov (United States)

2011-05-27

...] Promoting Transmission Investment Through Pricing Reform May 19, 2011. AGENCY: Federal Energy Regulatory... varied. \\1\\ Promoting Transmission Investment through Pricing Reform, Order No. 679, 71 FR 43294 (Jul. 31... issued Order No. 679, Promoting Transmission Investment through Pricing Reform, which was further refined...

78 FR 64933 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2013-10-30

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP14-4-000] Texas Eastern Transmission, LP; Notice of Application Take notice that on October 10, 2013, Texas Eastern Transmission, (Texas Eastern), having its principal place of business at 5400 Westheimer Court, Houston, Texas, 77056...

Unforeseen consequences of dedicated renewable energy transmission: Potential implications for renewable electricity development

Energy Technology Data Exchange (ETDEWEB)

Bezdek, Roger

2010-09-15

Renewable electricity generation requires expansion of electricity transmission, and the U.S. is planning to build a 'green' transmission lines restricted to renewable electricity. However, local jurisdictions are resisting this unless the transmission serves local constituents and existing power plants. This paper finds that if such transmission is built and local access allowed, then the major beneficiaries may be existing power plants. Their access to added transmission could enable them to sell electric power at rates against which renewables cannot compete. These issues must be addressed if large additions of new transmission lines are to facilitate expansion of renewable electricity generation worldwide.

Transmission X-ray mirror

International Nuclear Information System (INIS)

Lairson, B.M.; Bilderback, D.H.

1982-01-01

Transmission X-ray mirrors have been made from 400 A to 10 000 A thick soap films and have been shown to have novel properties. Using grazing angles of incidence, low energy X-rays were reflected from the front surface while more energetic X-rays were transmitted through the mirror largely unattenuated. A wide bandpass monochromator was made from a silicon carbide mirror followed by a soap film transmission mirror and operated in the white beam at the cornell High Energy Synchrotron Source (CHESS). Bandpasses of ΔE/E=12% to 18% were achieved at 13 keV with peak efficiencies estimated to be between 55% and 75%, respectively. Several wide angle scattering photographs of stretched polyethylene and a phospholipid were obtained in 10 s using an 18% bandpass. (orig.)

78 FR 43874 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2013-07-22

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP13-514-000] Texas Eastern Transmission, LP; Notice of Application On July 2, 2013, Texas Eastern Transmission, LP (Texas Eastern) filed... natural gas facilities no longer in service. As described more fully in the Application, Texas Eastern...

76 FR 38381 - Texas Eastern Transmission, LP; Notice of Amendment

Science.gov (United States)

2011-06-30

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP11-67-001] Texas Eastern Transmission, LP; Notice of Amendment Take notice that on June 13, 2011, Texas Eastern Transmission, LP (Texas Eastern), 5400 Westheimer Court, Houston, Texas 77056, filed in the above referenced docket an amendment...

77 FR 20015 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2012-04-03

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP12-88-000] Texas Eastern Transmission, LP; Notice of Application Take notice that on March 19, 2012, Texas Eastern Transmission, LP (Texas Eastern), 5400 Westheimer Court, Houston, Texas 77056-5310, filed an application in Docket No...

77 FR 12045 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2012-02-28

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP12-68-000] Texas Eastern Transmission, LP; Notice of Application Take notice that on February 16, 2012, Texas Eastern Transmission, LP (Texas Eastern), PO Box 1642, Houston, Texas 77056 filed an application in the above referenced docket...

Energy transmission using microwaves and its possibility. Maikuroha ni yoru energy yuso to sono kanosei

Energy Technology Data Exchange (ETDEWEB)

Matsumoto, H.; Shinohara, N. (Kyoto University, Kyoto (Japan))

1993-09-01

Transmitting of electric energy in the form of electromagnetic waves is a century-old idea, which has reached its final step of realization at last. This paper describes a review and future prospects on electric power transmitting technologies using microwaves (a wavelength of 12 cm is thought as the most promising candidate). Electric power was transmitted successfully to a flying helicopter in the U.S.A. in 1964. Transmission of 30-kW power was performed in 1975 to a power receiving rectenna (an antenna with microwave receiving rectification circuit) placed 1.6 tm away using a parabola as a transmitting antenna. These studies were carried over to the investigative studies on space power stations (SPS). This is a conception to install a static satellite equipped with a huge solar cell array in the sky of about 36,000 km high to generate power, convert the power to microwaves, and transmit the power of ten million kilowatt class to the ground. A number of results of advanced experiments have been obtained in Japan using rockets or aircraft. 26 refs., 5 figs.

Transmission electron microscopy study of ion energy deposition in gold: evidence for a spike threshold

International Nuclear Information System (INIS)

Ruault, M.O.; Bernas, H.; Chaumont, J.

1978-01-01

Nine different atomic species, from K to Yb, were implanted into gold at energies ranging from 20 to 150 keV. The nature and depth-distribution of the resultant defect clusters were studied by transmission electron microscopy techniques as well as a modification of the '2 1/2-D' stereo technique developed by Mitchell and Bell. The effect of implanted ion dose and sample purity were determined. The cluster depth distributions are in overall agreement with the damage distributions deduced from the energy deposition calculations of Winterbon, Sigmund, and Sanders. The nature of the defect clusters is found to depend on the mass and energy of the incoming ion, in agreement with our previously reported work. These results are suggested to provide evidence for the decisive influence of the deposited energy density on the nature of visible damage. We conclude that it is possible to distinguish between cascade and 'spike' effects, the latter setting in when the average energy per atom in the cascade is approximately 2 eV/atom. All results (obtained -at low doses on pure samples- for a variety of ion species in Au, Al, Cu, W, Mo and Ni) may be related to each other in this way

Atlas transmission line/transition design and fabrication status

CERN Document Server

Ballard, E O; Davis, H A; Elizondo, J M; Gribble, R F; Nielsen, K E; Parker, G V; Ricketts, R L; Valdez, G A

1999-01-01

Atlas is a pulsed-power facility under development at Los Alamos National Laboratory to drive high-energy density experiments. Design has been completed for this new generation pulsed-power machine consisting of an azimuthal array of 24, 240-kV Marx modules and transmission lines supplying current to the load region at the machine center. The transmission line consists of a cable header, load protection switch, and tri-plate assembly interfacing to the center transition section. The cable header interface to the Marx module provides a mechanism to remove the Marx module for maintenance without removing other components of the transmission line. The load protection switch provides a mechanism for protecting the load during charging of the Marx in the event of a pre-fire condition. The aluminum tri-plate is a low-inductance transmission line that carries radial current flow from the Marx energy storage system at the machine periphery toward the load. All transmission line components are oil insulated except the...

Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Ming, W.Q.; Chen, J.H., E-mail: jhchen123@hnu.edu.cn

2013-11-15

Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations.

Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

International Nuclear Information System (INIS)

Ming, W.Q.; Chen, J.H.

2013-01-01

Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations

An on-line identification device for coal and gangue based on dual-energy γ-ray transmission and microcontroller

International Nuclear Information System (INIS)

Chen Guojie; Zhu Xing

2004-01-01

The operating principle, hardware design, software design and stabled-spectrum method of on-line identification device for coal and gangue based on dual-energy γ-ray transmission and microcontroller are introduced. The integrated linear amplifier and integrated single channel pulse height analyzer are analyzed. The on-line identification device has advantages of small size, low cost as well stabilization. (authors)

78 FR 66352 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2013-11-05

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP14-9-000] Texas Eastern Transmission, LP; Notice of Application Take notice that on October 17, 2013, Texas Eastern Transmission, LP (Texas Eastern), 5400 Westheimer Court, Houston, Texas 77056, filed an application in Docket No. CP14-9...

78 FR 79687 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2013-12-31

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP14-29-000] Texas Eastern Transmission, LP; Notice of Application Take notice that on December 10, 2013 Texas Eastern Transmission, LP (Texas Eastern), at 5400 Westheimer Court, Houston, Texas 77056, filed an application in Docket No. CP14...

77 FR 26534 - Texas Eastern Transmission, LP; Notice of Application

Science.gov (United States)

2012-05-04

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP12-164-000] Texas Eastern Transmission, LP; Notice of Application Take notice that on April 19, 2012, Texas Eastern Transmission, LP (Texas Eastern), 5400 Westheimer Court, Houston, Texas 77056, filed in Docket No. CP12-164-000, a request...

Storage and transmission of secondary energy

International Nuclear Information System (INIS)

Taube, M.

1979-09-01

In the area of the total energy flow, possibilities and limits of shifts in time (storage) and in space (transfer) of secondary energy, i.e. electrical, chemical and thermal energy are examined and formulated. These shifts are linked to the qualitative conversions of secondary energy. The multiple technological possibilities, the spectrum of governing factors and the numerous technical and economical parameters show that only a complex optimization is possible. (Auth.)

Strategic Generation with Conjectured Transmission Price Responses in a Mixed Transmission Pricing System. Part 2. Application

International Nuclear Information System (INIS)

Wals, A.F.; Hobbs, B.F.; Rijkers, F.A.M.

2004-05-01

The conjectured transmission price response model presented in the first of this two-paper series considers the expectations of oligopolistic generators regarding how demands for transmission services affect the prices of those services. Here, the model is applied to northwest Europe, simulating a mixed transmission pricing system including export fees, a path-based auction system for between-country interfaces, and implicit congestion-based pricing of internal country constraints. The path-based system does not give credit for counterflows when calculating export capability. The application shows that this no-netting policy can exacerbate the economic inefficiencies caused by oligopolistic pricing by generators. The application also illustrates the effects of different generator conjectures regarding rival supply responses and transmission prices. If generators anticipate that their increased demand for transmission services will increase transmission prices, then competitive intensity diminishes and energy prices rise. In the example here, the effect of this anticipation is to double the price increase that results from oligopolistic (Cournot) competition among generators

Transmission and reflection properties of terahertz fractal metamaterials

DEFF Research Database (Denmark)

Malureanu, Radu; Lavrinenko, Andrei; Cooke, David

2010-01-01

We use THz time-domain spectroscopy to investigate transmission and reflection properties of metallic fractal metamaterial structures. We observe loss of free-space energy at certain resonance frequencies, indicating excitation of surface modes of the metamaterial.......We use THz time-domain spectroscopy to investigate transmission and reflection properties of metallic fractal metamaterial structures. We observe loss of free-space energy at certain resonance frequencies, indicating excitation of surface modes of the metamaterial....

A Vision of China-Arab Interconnection Transmission Network Planning with UHVDC Technology

Science.gov (United States)

Wu, Dan; Liu, Yujun; Yin, Hongyuan; Xu, Qingshan; Xu, Xiaohui; Ding, Maosheng

2017-05-01

Developments in ultra-high-voltage (UHV) power systems and clean energy technologies are paving the way towards unprecedented energy market globalization. In accordance with the international community’s enthusiasm for building up the Global Energy Internet, this paper focuses on the feasibility of transmitting large-size electricity from northwest China to Arab world through a long-distance transnational power interconnection. The complete investigations on the grids of both the sending-end and receiving-end is firstly presented. Then system configuration of the transmission scheme and corridor route planning is proposed with UHVDC technology. Based on transmission costs’ investigation about similar transmission projects worldwide, the costs of the proposed transmission scheme are estimated through adjustment factors which represent differences in latitude, topography and economy. The proposed China-Arab transmission line sheds light on the prospects of power cooperation and resource sharing between China and Arab states, and appeals for more emphasis on green energy concentrated power interconnections from a global perspective.

Collaborative Image Coding and Transmission over Wireless Sensor Networks

Directory of Open Access Journals (Sweden)

Min Wu

2007-01-01

Full Text Available The imaging sensors are able to provide intuitive visual information for quick recognition and decision. However, imaging sensors usually generate vast amount of data. Therefore, processing and coding of image data collected in a sensor network for the purpose of energy efficient transmission poses a significant technical challenge. In particular, multiple sensors may be collecting similar visual information simultaneously. We propose in this paper a novel collaborative image coding and transmission scheme to minimize the energy for data transmission. First, we apply a shape matching method to coarsely register images to find out maximal overlap to exploit the spatial correlation between images acquired from neighboring sensors. For a given image sequence, we transmit background image only once. A lightweight and efficient background subtraction method is employed to detect targets. Only the regions of target and their spatial locations are transmitted to the monitoring center. The whole image can then be reconstructed by fusing the background and the target images as well as their spatial locations. Experimental results show that the energy for image transmission can indeed be greatly reduced with collaborative image coding and transmission.

Priority image transmission in wireless sensor networks

International Nuclear Information System (INIS)

Nasri, M.; Helali, A.; Sghaier, H.; Maaref, H.

2011-01-01

The emerging technology during the last years allowed the development of new sensors equipped with wireless communication which can be organized into a cooperative autonomous network. Some application areas for wireless sensor networks (WSNs) are home automations, health care services, military domain, and environment monitoring. The required constraints are limited capacity of processing, limited storage capability, and especially these nodes are limited in energy. In addition, such networks are tiny battery powered which their lifetime is very limited. During image processing and transmission to the destination, the lifetime of sensor network is decreased quickly due to battery and processing power constraints. Therefore, digital image transmissions are a significant challenge for image sensor based Wireless Sensor Networks (WSNs). Based on a wavelet image compression, we propose a novel, robust and energy-efficient scheme, called Priority Image Transmission (PIT) in WSN by providing various priority levels during image transmissions. Different priorities in the compressed image are considered. The information for the significant wavelet coeffcients are transmitted with higher quality assurance, whereas relatively less important coefficients are transmitted with lower overhead. Simulation results show that the proposed scheme prolongs the system lifetime and achieves higher energy efficiency in WSN with an acceptable compromise on the image quality.

Study of the nanostructure of Gum Metal using energy-filtered transmission electron microscopy

International Nuclear Information System (INIS)

Yano, T.; Murakami, Y.; Shindo, D.; Kuramoto, S.

2009-01-01

The nanostructure of Gum Metal, which has many anomalous mechanical properties, was investigated using transmission electron microscopy with energy filtering. A precise analysis of the weak diffuse electron scattering that was observed in the electron diffraction patterns of the Gum Metal specimen revealed that Gum Metal contains a substantial amount of the nanometer-sized ω phase. The morphology of the ω phase appeared to have a correlation with the faulting in the {2 1 1} planes, which are one of the characteristic lattice imperfections of the Gum Metal specimen. It is likely that the nanometer-sized ω phase may be a type of obstacle related to the restriction of the dislocation movement, which has been a significant problem in research on Gum Metal

75 FR 45611 - Texas Eastern Transmission LP; Notice of Application

Science.gov (United States)

2010-08-03

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP10-471-000] Texas Eastern Transmission LP; Notice of Application July 27, 2010. Take notice that on July 15, 2010, Texas Eastern Transmission (Texas Eastern), P.O. Box 1642, Houston, Texas 77251-1642, filed in Docket No. CP10-471-000, an...

What drives renewable energy development?

International Nuclear Information System (INIS)

Alagappan, L.; Orans, R.; Woo, C.K.

2011-01-01

This viewpoint reviews renewable energy development in 14 markets that differ in market structure (restructured vs. not restructured), use of feed-in-tariff (FIT) (yes vs. no), transmission planning (anticipatory vs. reactive), and transmission interconnection cost allocated to a renewable generator (high vs. low). We find that market restructuring is not a primary driver of renewable energy development. Renewable generation has the highest percent of total installed capacity in markets that use a FIT, employ anticipatory transmission planning, and have loads or end-users paying for most, if not all, of the transmission interconnection costs. In contrast, renewable developers have been less successful in markets that do not use a FIT, employ reactive transmission planning, and have generators paying for most, if not all, of the transmission interconnection costs. While these policies can lead to higher penetration of renewable energy in the short run, their high cost to ratepayers can threaten the economic sustainability of renewable energy in the long-run. - Highlights: → Market structure seems to have little effect on renewable energy development. → Renewable energy development is more successful in markets that use a FIT. → Anticipatory transmission planning aids renewable energy development. → Low interconnection costs for developers also aids renewable energy development.

Sound transmission loss of composite sandwich panels

Science.gov (United States)

Zhou, Ran

Light composite sandwich panels are increasingly used in automobiles, ships and aircraft, because of the advantages they offer of high strength-to-weight ratios. However, the acoustical properties of these light and stiff structures can be less desirable than those of equivalent metal panels. These undesirable properties can lead to high interior noise levels. A number of researchers have studied the acoustical properties of honeycomb and foam sandwich panels. Not much work, however, has been carried out on foam-filled honeycomb sandwich panels. In this dissertation, governing equations for the forced vibration of asymmetric sandwich panels are developed. An analytical expression for modal densities of symmetric sandwich panels is derived from a sixth-order governing equation. A boundary element analysis model for the sound transmission loss of symmetric sandwich panels is proposed. Measurements of the modal density, total loss factor, radiation loss factor, and sound transmission loss of foam-filled honeycomb sandwich panels with different configurations and thicknesses are presented. Comparisons between the predicted sound transmission loss values obtained from wave impedance analysis, statistical energy analysis, boundary element analysis, and experimental values are presented. The wave impedance analysis model provides accurate predictions of sound transmission loss for the thin foam-filled honeycomb sandwich panels at frequencies above their first resonance frequencies. The predictions from the statistical energy analysis model are in better agreement with the experimental transmission loss values of the sandwich panels when the measured radiation loss factor values near coincidence are used instead of the theoretical values for single-layer panels. The proposed boundary element analysis model provides more accurate predictions of sound transmission loss for the thick foam-filled honeycomb sandwich panels than either the wave impedance analysis model or the

Transmission sputtering of gold thin-films by low-energy (< 1 keV) xenon ions: I. The system and the measurement

International Nuclear Information System (INIS)

Ayrault, G.; Seidman, D.N.

1978-01-01

A novel system for direct measurement of the transmission sputtering yields of ion-irradiated thin films is described. The system was specifically designed for the study of the transmission sputtering caused by low energy ( 0 A thick) which was mounted in a JEM 200 transmission electron-microscope holder. The temperature of the specimen could be varied between approx. 25 and 300 K employing a continuous-transfer liquid-helium cryostat. The particles (atoms or ions) ejected from the unirradiated surface of the gold thin-film were detected by two channetron electron-multiplier arrays in the Chevron configuration; the Chevron detector was able to detect individual transmission sputtered particles when operated in the saturated mode. To further enhance resolution the electron cascades, produced by the CEMA, were amplified and shaped electronically into uniform square pulses. The shaped signals were detected with an Ithaco 391A lock-in amplifier (LIA). With the aid of a ratiometer feature in the LIA we were able to measure directly the ratio of the transmission sputtered-current (I/sub t/) to the incident ion-current (I/sub b/); for I/sub b/ = μA cm -2 a ratio of I/sub t//I/sub b/ as small as 1 x 10 -9 was measured. A detailed discussion of the calibration procedure and the experimental errors, involved in this technique, are also presented. 45 references

Transmission Electron Microscopy Physics of Image Formation

CERN Document Server

Kohl, Helmut

2008-01-01

Transmission Electron Microscopy: Physics of Image Formation presents the theory of image and contrast formation, and the analytical modes in transmission electron microscopy. The principles of particle and wave optics of electrons are described. Electron-specimen interactions are discussed for evaluating the theory of scattering and phase contrast. Also discussed are the kinematical and dynamical theories of electron diffraction and their applications for crystal-structure analysis and imaging of lattices and their defects. X-ray microanalysis and electron energy-loss spectroscopy are treated as analytical methods. Specimen damage and contamination by electron irradiation limits the resolution for biological and some inorganic specimens. This fifth edition includes discussion of recent progress, especially in the area of aberration correction and energy filtering; moreover, the topics introduced in the fourth edition have been updated. Transmission Electron Microscopy: Physics of Image Formation is written f...

Graphical prediction of quantum interference-induced transmission nodes in functionalized organic molecules

DEFF Research Database (Denmark)

Markussen, Troels; Stadler, Robert; Thygesen, Kristian Sommer

2011-01-01

Quantum interference (QI) in molecular transport junctions can lead to dramatic reductions of the electron transmission at certain energies. In a recent work [Markussen et al., Nano Lett., 2010, 10, 4260] we showed how the presence of such transmission nodes near the Fermi energy can be predicted...... solely from the structure of a conjugated molecule when the energies of the atomic pz orbitals do not vary too much. Here we relax the assumption of equal on-site energies and generalize the graphical scheme to molecules containing different atomic species. We use this diagrammatic scheme together......, the transmission functions of functionalized aromatic molecules generally display a rather complex nodal structure due to the interplay between molecular topology and the energy of the side group orbital....

The transmission of differing energy beta particles through various materials

International Nuclear Information System (INIS)

Quayle, D.R.

1996-04-01

The transmission of beta particles is frequently calculated in the same fashion as that of gamma rays, where the mass attenuation coefficient is defined by the slope of the exponential function. Numerous authors have used this approximation including Evans (1955), Loevinger (1952), and Chabot et. al. (1988). Recent work by McCarthy et. al. (1995) indicated that the exponential function seemed to fit well over a particular region of the transmission curve. Upon further investigation, the author decided to verify McCarthy's results by the use of different absorber materials and attempt to reproduce the experiments. A theoretical method will be used to estimate the transmission of the beta particles through the three absorbers, aluminum, zirconium, and iron. An alternate Monte Carlo code, the Electron Gamma Shower version 4 code (EGS4) will also be used to verify that the experiment is approximating a pencil beam of beta particles. Although these two methods offer a good cross check for the experimental data, they pose a conflict in regards to the type of beam that is to be generated. The experimental lab setup uses a collimated beam of electrons that will impinge upon the absorber, while the codes are written using a pencil beam. A minor discrepancy is expected to be observed in the experimental results and is currently under investigation by McCarthy. The results of this project supported the theory that the beta mass attenuation coefficient was accurately represented by the slope of an exponential function, but only for that particular region of the transmission curve that has a minimal absorber thickness. By fitting the data beyond 50% of the beta particle range this theory does not hold true. The theory generated by McCarthy (1995) and the EGS4 Monte Carlo code indicated that the transmission curve for a pencil beam was not accurately represented by an exponential function. The results of this experiment appeared to provide additional support to this assumption

Cost and Benefit Analysis of VSC-HVDC Schemes for Offshore Wind Power Transmission

Institute of Scientific and Technical Information of China (English)

Sheng WANG; Chunmei FENG; An WEN; Jun LIANG

2013-01-01

Due to low load factors of wind power generation,it is possible to reduce transmission capacity to minimize the cost of transmission system construction.Two VSC-HVDC schemes for offshore wind farm,called the point to point (PTP) and DC mesh connections are compared in terms of the utilization of transmission system and its cost.A Weibull distribution is used for estimating offshore wind power generation,besides,the cross correlation between wind farms is considered.The wind energy curtailment is analyzed using the capacity output possibility table (COPT).The system power losses,costs of transmission investment and wind energy curtailment are also computed.A statistic model for the wind generation and transmission is built and simulated in MATLAB to validate the study.It is concluded that a DC mesh transmission can reduce the energy curtailment and power losses.Further benefit is achievable as the wind cross correlation between wind farms decreases.

18 CFR 37.7 - Auditing Transmission Service Information.

Science.gov (United States)

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Auditing Transmission Service Information. 37.7 Section 37.7 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... SYSTEMS § 37.7 Auditing Transmission Service Information. (a) All OASIS database transactions, except...

Energy systems security

CERN Document Server

Voeller, John G

2014-01-01

Energy Systems Security features articles from the Wiley Handbook of Science and Technology for Homeland Security covering topics related to electricity transmission grids and their protection, risk assessment of energy systems, analysis of interdependent energy networks. Methods to manage electricity transmission disturbances so as to avoid blackouts are discussed, and self-healing energy system and a nano-enabled power source are presented.

Theoretical analysis of a wind heating conversion and long distance transmission system

International Nuclear Information System (INIS)

Cheng, Wen-Long; Han, Bing-Chuan; Nian, Yong-Le; Han, Bing-Bing

2017-01-01

Highlights: • A novel long distance wind power heating system was proposed. • Heat losses could be reduced effectively due to latent heat transmission. • Power consumption and cost would drop greatly compared to hot water convey system. • The maximum transmission distance is 10 times that of conventional system. - Abstract: As a clean and renewable energy, wind power gets a rapid growth in recent years. With the increasing proportion of wind power generation, the fluctuation and intermittency of wind energy impedes the safe and stable operation of national power grids, which causes wind curtailment and energy waste, hindering further development of wind power industry in China. To solve this problem, wind heating conversion was proposed. However, long distance transmission between wind fields and residential areas for thermal energy is an urgent issue for wind heating. This paper presents a novel wind heating conversion and long distance transmission system. A simple device was utilized for wind heating conversion in the present system, then thermal energy was transported to heat demand site through latent heat transmission of the working fluids. A model of the novel system was built and thermodynamics analysis showed that maximum transmission distance of the novel system could extended to 240 km, 9.6 times of that of typical hot water transmission system. And the novel system also could cut down the cost by greatly reducing pump work and pipe diameter. In addition, efficiency and circulation ratio was almost unchanged while wind power density increased from 350 W/m 2 to 650 W/m 2 .

Economic Aspect of HVDC Transmission System for Indonesia Consideration in Nuclear Power Development

International Nuclear Information System (INIS)

Edwaren Liun

2009-01-01

As a country with hundreds million people, Indonesia needs to generate large scale power and distribute it to thorough country to improve gross domestic product of the population. In the power transmission domain, the High Voltage Direct Current (HVDC) transmission system should be considered for the next decades concerning any technical and economical problems with HVAC transmission. HVDC transmission system is the answer for the Indonesian condition. This system can connect the high energy potential regions to the high energy demand regions. HVDC is the most efficient to transport energy from one region to another one region. Dismantling and removing assets costs are included to the estimated for capital costs, while the environmental and property costs are the costs of securing designations and resource consents, and valuation and legal advice for the HVDC investment. Although converter terminals are expensive however, for long transmissions HVDC system can compensate the costs over breakeven distance through very efficient transmission system. Efficiency of HVDC is appearing from conductor wire, supporting tower, low energy loses and free space used by route of the transmission line. HVDC system is also free from some problem, concerning stability, inductive and capacitive load components, phase differences and frequency system. In the economic aspect the HVDC capital costs for the transmission options comprise estimates of the cost to design, purchase and construct new HVDC transmission components. While operating and maintenance costs of HVDC assets comprise the costs for replacement the old existing overhead transmission lines, underground and submarine cables, and HVDC converter station components. (author)

The examination of calcium ion implanted alumina with energy filtered transmission electron microscopy

International Nuclear Information System (INIS)

Hunt, E.M.; Hampikian, J.M.

1997-01-01

Ion implantation can be used to alter in the optical response of insulators through the formation of embedded nano-sized particles. Single crystal alumina has been implanted at ambient temperature with 50 keV Ca + to a fluence of 5 x 10 16 ions/cm 2 . Ion channeling, Knoop microhardness measurements, and transmission electron microscopy (TEM) indicate that the alumina surface layer was amorphized by the implant. TEM also revealed nano-sized crystals ∼7--8 nm in diameter. These nanocrystals are randomly oriented, and exhibit a face-centered cubic structure (FCC) with a lattice parameter of 0.409 nm ± 0.002 nm. The similarity between this crystallography and that of pure aluminum suggests that they are metallic aluminum nanocrystals with a slightly dilated lattice parameter, possibly due to the incorporation of a small amount of calcium. Energy-filtered transmission electron microscopy (EFTEM) provides an avenue by which to confirm the metallic nature of the aluminum involved in the nanocrystals. EFTEM has confirmed that the aluminum present in the particles is metallic in nature, that the particles are oxygen deficient in comparison with the matrix material and that the particles are deficient in calcium, and therefore not likely to be calcia. The particles thus appear to be FCC Al (possibly alloyed with a few percent Ca) with a lattice parameter of 0.409nm. A similar result was obtained for yttrium ion implantation into alumina

77 FR 58126 - Columbia Gas Transmission, LLC; Notice of Offer of Settlement

Science.gov (United States)

2012-09-19

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. RP12-1021-000] Columbia Gas Transmission, LLC; Notice of Offer of Settlement Take notice that on September 4, 2012, Columbia Gas Transmission, LLC (Columbia) filed a Stipulation and Agreement (Settlement), including pro forma tariff records...

A mobility based vibroacoustic energy transmission simulation into an enclosure through a double-wall panel.

Science.gov (United States)

Sahu, Atanu; Bhattacharya, Partha; Niyogi, Arup Guha; Rose, Michael

2017-06-01

Double-wall panels are known for their superior sound insulation properties over single wall panels as a sound barrier. The sound transmission phenomenon through a double-wall structure is a complex process involving vibroacoustic interaction between structural panels, the air-cushion in between, and the secondary acoustic domain. It is in this context a versatile and a fully coupled technique based on the finite-element-boundary element model is developed that enables estimation of sound transfer through a double-wall panel into an adjacent enclosure while satisfying the displacement compatibility across the interface. The contribution of individual components in the transmitted energy is identified through numerical simulations.

Transmission reliability faces future challenges

International Nuclear Information System (INIS)

Beaty, W.

1993-01-01

The recently published Washington International Energy Group's 1993 Electric Utility Outlook states that nearly one-third (31 percent) of U.S. utility executives expect reliability to decrease in the near future. Electric power system stability is crucial to reliability. Stability analysis determines whether a system will stay intact under normal operating conditions, during minor disturbances such as load fluctuations, and during major disturbances when one or more parts of the system fails. All system elements contribute to reliability or the lack of it. However, this report centers on the transmission segment of the electric system. The North American Electric Reliability Council (NERC) says the transmission systems as planned will be adequate over the next 10 years. However, delays in building new lines and increasing demands for transmission services are serious concerns. Reliability concerns exist in the Mid-Continent Area Power Pool and the Mid-America Interconnected Network regions where transmission facilities have not been allowed to be constructed as planned. Portions of the transmission systems in other regions are loaded at or near their limits. NERC further states that utilities must be allowed to complete planned generation and transmission as scheduled. A reliable supply of electricity also depends on adhering to established operating criteria. Factors that could complicate operations include: More interchange schedules resulting from increased transmission services. Increased line loadings in portions of the transmission systems. Proliferation of non-utility generators

Data driven transmission power control for wireless sensor networks

NARCIS (Netherlands)

kotian, Roshan; Exarchakos, Georgios; Liotta, Antonio; Di Fatta, G.; Fortino, G.; Li, W.; Pathan, M.; Stahl, F.; Guerrieri, A.

2015-01-01

Transmission Power Control (TPC) is employed in the sensor nodes with the main objective of minimizing transmission power consumption. However, major drawbacks with well-known TPC are time consuming and energy inefficient initialization phase. Moreover, they employ Received Signal Strength Indicator

Contract networks for competition in transmission grids

International Nuclear Information System (INIS)

Hogan, W.W.

1992-01-01

Increased reliance on competition in energy markets requires pricing, access, and investment reform for the essential transmission grids. Due to the complexity of the network interactions, the usual analogies to economic concepts from other settings have little or no meaning in transmission grids. A contract network framework builds from first principles to define the conditions of an efficient market. 8 refs

Effects of lattice fluctuations on electronic transmission in metal/conjugated-oligomer/metal structures

International Nuclear Information System (INIS)

Yu, Z.G.; Smith, D.L.; Saxena, A.; Bishop, A.R.

1997-01-01

The electronic transmission across metal/conjugated-oligomer/metal structures in the presence of lattice fluctuations is studied for short oligomer chains. The lattice fluctuations are approximated by static white noise disorder. Resonant transmission occurs when the energy of an incoming electron coincides with a discrete electronic level of the oligomer. The corresponding transmission peak diminishes in intensity with increasing disorder strength. Because of disorder there is an enhancement of the electronic transmission for energies that lie within the electronic gap of the oligomer. If fluctuations are sufficiently strong, a transmission peak within the gap is found at the midgap energy E=0 for degenerate conjugated oligomers (e.g., trans-polyacetylene) and E≠0 for AB-type degenerate oligomers. These results can be interpreted in terms of soliton-antisoliton states created by lattice fluctuations. copyright 1997 The American Physical Society

A multilevel shape fit analysis of neutron transmission data

International Nuclear Information System (INIS)

Naguib, K.; Sallam, O.H.; Adib, M.

1989-01-01

A multilevel shape fit analysis of neutron transmission data is presented. A multilevel computer code SHAPE is used to analyse clean transmission data obtained from time-of-flight (TOF) measurements. The shape analysis deduces the parameters of the observed resonances in the energy region considered in the measurements. The shape code is based upon a least square fit of a multilevel Breit-Wigner formula and includes both instrumental resolution and Doppler broadenings. Operating the SHAPE code on a test example of a measured transmission data of 151 Eu, 153 Eu and natural Eu in the energy range 0.025-1 eV acquired a good result for the used technique of analysis. (author)

ENTSOE Role in Transmission Network Planning Following the Provisons of the EU's Third Energy Package

International Nuclear Information System (INIS)

Medjimorec, D.

2011-01-01

In the initial period of its operation the European network of transmission system operators for electricity (ENTSO-E) has prepared and published the first edition of its ten-year network development plan (TYNDP) for period 2010-2020, by which has fulfilled one of the ENTSO-E's tasks according to the new Directive 714/09/EZ on grid accessing conditions for cross-border electricity exchange. In this process, ENTSO-E has carried out a broad public debates, which provided, together with general reactions of a number of major European power industry stakeholders, expectations regarding new editions of this non-binding paper (TYNDP), which followed every two years. Following these experiences, and the experiences of individual transmission system operators as participants of making TYNDP ''pilot'' through ENTSO-E, a plan and a time schedule of activities were adopted until the publication of the next TYNDP in the spring of 2012. Important step in this represents parallel preparation and creation of six regional investment plans (RIP) in order to reduce the scope of activities at the pan-European TYNDP level and to ensure their consistency. Namely among this six regions agreed between transmission system operators, which are members of ENTSO-E, there are certain overlaps in the area which they include (and thus in included projects). One of the three main reasons for launching investment projects in new or reconstructed transmission facilities which are covered with TYNDP or RIP is the integration of electricity market. Therefore is, within the methodology improvement of making TYNDP or RIP, further expanded treatment of input data, especially in terms of market-relevant data and data needed for modeling electricity market and its impact on investment in the transmission system. Also, additional scenarios that are used by all RIP are defined, where the most important scenario is so called 20-20-20 which as the basic input parameters takes National investment plans whose

Elemental mapping in achromatic atomic-resolution energy-filtered transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Forbes, B.D. [School of Physics, University of Melbourne, Parkville, VIC 3010 (Australia); Houben, L. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Gruenberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Mayer, J. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Gruenberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Central Facility for Electron Microscopy, RWTH Aachen University, D-52074 Aachen (Germany); Dunin-Borkowski, R.E. [Ernst Ruska-Centre for Microscopy and Spectroscopy with Electrons and Peter Gruenberg Institute, Forschungszentrum Jülich, D-52425 Jülich (Germany); Allen, L.J., E-mail: lja@unimelb.edu.au [School of Physics, University of Melbourne, Parkville, VIC 3010 (Australia)

2014-12-15

We present atomic-resolution energy-filtered transmission electron microscopy (EFTEM) images obtained with the chromatic-aberration-corrected FEI Titan PICO at the Ernst-Ruska Centre, Jülich, Germany. We find qualitative agreement between experiment and simulation for the background-subtracted EFTEM images of the Ti–L{sub 2,3} and O–K edges for a specimen of SrTiO{sub 3} oriented down the [110] zone axis. The simulations utilize the transition potential formulation for inelastic scattering, which permits a detailed investigation of contributions to the EFTEM image. We find that energy-filtered images of the Ti–L{sub 2,3} and O–K edges are lattice images and that the background-subtracted core-loss maps may not be directly interpretable as elemental maps. Simulations show that this is a result of preservation of elastic contrast, whereby the qualitative details of the image are determined primarily by elastic, coherent scattering. We show that this effect places a constraint on the range of specimen thicknesses which could theoretically yield directly useful elemental maps. In general, interpretation of EFTEM images is ideally accompanied by detailed simulations. - Highlights: • Achromatic atomic-resolution EFTEM images were obtained for STO 〈110〉. • Simulations were in qualitative agreement with Ti–L{sub 2,3} and O–K edge maps. • The experimental EFTEM maps are not directly interpretable as elemental maps. • Image intensities are strongly determined by preservation of elastic contrast. • Interpretation of EFTEM images is ideally accompanied by detailed simulations.

Evaluating the merchant transmission market

International Nuclear Information System (INIS)

Hsieh, E.; Bartholomew Fisher, E.

2007-01-01

This paper reviewed the North American bulk electric transmission system, with particular reference to the following merchant power transmission projects that have applied to sell transmission at negotiated rates by the Federal Energy Regulatory Commission (FERC): Cross Sound Cable; Neptune Phase 1; TransCanada's Northern Lights HVDC line; Montana Alberta Tie; Juan de Fuca Cable; Linden VFT; Connecticut-Long Island Cable; Lake Erie Link; Empire Connection; Harbor Cable; Chesapeake Transmission; and the Neptune/Green Line. The projects were sorted by status as either active, inactive and restructured. Each summary included the interconnection points, capacity, and sponsor. This paper also identified the major hurdles in their approvals. The relative success of the merchant transmission framework in attracting new investment was then reviewed. The successful projects shared 3 common attributes. They connected areas with large price differentials and they used advanced flow control technology such as HVDC, PARs, and VFTs. The successful projects also bridged some type of border, either geographic, electrical, economic, or a combination. Three of the active projects crossed the Canadian-US border, while the other 3 connected New York City to neighbouring regions. It was shown that merchant transmission fills a niche, enabling market responses to connect areas that may be overlooked by a regional planning process. 27 refs

Elemental mapping in scanning transmission electron microscopy

International Nuclear Information System (INIS)

Allen, L J; D'Alfonso, A J; Lugg, N R; Findlay, S D; LeBeau, J M; Stemmer, S

2010-01-01

We discuss atomic resolution chemical mapping in scanning transmission electron microscopy (STEM) based on core-loss electron energy loss spectroscopy (EELS) and also on energy dispersive X-ray (EDX) imaging. Chemical mapping using EELS can yield counterintuitive results which, however, can be understood using first principles calculations. Experimental chemical maps based on EDX bear out the thesis that such maps are always likely to be directly interpretable. This can be explained in terms of the local nature of the effective optical potential for ionization under those imaging conditions. This is followed by an excursion into the complementary technique of elemental mapping using energy-filtered transmission electron microscopy (EFTEM) in a conventional transmission electron microscope. We will then consider the widely used technique of Z-contrast or high-angle annular dark field (HAADF) imaging, which is based on phonon excitation, where it has recently been shown that intensity variations can be placed on an absolute scale by normalizing the measured intensities to the incident beam. Results, showing excellent agreement between theory and experiment to within a few percent, are shown for Z-contrast imaging from a sample of PbWO 4 .

Dynamics of the Solar Wind Electromagnetic Energy Transmission Into Magnetosphere during Large Geomagnetic Storms

Science.gov (United States)

Kuznetsova, Tamara; Laptukhov, Alexej; Petrov, Valery

Causes of the geomagnetic activity (GA) in the report are divided into temporal changes of the solar wind parameters and the changes of the geomagnetic moment orientation relative directions of the solar wind electric and magnetic fields. Based on our previous study we concluded that a reconnection based on determining role of mutual orientation of the solar wind electric field and geomagnetic moment taking into account effects of the Earth's orbital and daily motions is the most effective compared with existing mechanisms. At present a reconnection as paradigma that has applications in broad fields of physics needs analysis of experimental facts to be developed. In terms of reconnection it is important not only mutual orientation of vectors describing physics of interaction region but and reconnection rate which depends from rate of energy flux to those regions where the reconnection is permitted. Applied to magnetosphere these regions first of all are dayside magnetopause and polar caps. Influence of rate of the energy flux to the lobe magnetopause (based on calculations of the Poyting electromagnetic flux component controlling the reconnection rate along the solar wind velocity Pv) on planetary GA (Dst, Kp indices) is investigated at different phases of geomagnetic storms. We study also the rate of energy flux to the polar caps during storms (based on calculations of the Poyting flux vector component along the geomagnetic moment Pm) and its influence on magnetic activity in the polar ionosphere: at the auroral zone (AU,AL indices). Results allow to evaluate contributions of high and low latitude sources of electromagnetic energy to the storm development and also to clear mechanism of the electromagnetic energy transmission from the solar wind to the magnetosphere. We evaluate too power of the solar wind electromagnetic energy during well-known large storms and compare result with power of the energy sources of other geophysical processes (atmosphere, ocean

Interference-Robust Transmission in Wireless Sensor Networks.

Science.gov (United States)

Han, Jin-Seok; Lee, Yong-Hwan

2016-11-14

Low-power wireless sensor networks (WSNs) operating in unlicensed spectrum bands may seriously suffer from interference from other coexisting radio systems, such as IEEE 802.11 wireless local area networks. In this paper, we consider the improvement of the transmission performance of low-power WSNs by adjusting the transmission rate and the payload size in response to the change of co-channel interference. We estimate the probability of transmission failure and the data throughput and then determine the payload size to maximize the throughput performance. We investigate that the transmission time maximizing the normalized throughput is not much affected by the transmission rate, but rather by the interference condition. We adjust the transmission rate and the transmission time in response to the change of the channel and interference condition, respectively. Finally, we verify the performance of the proposed scheme by computer simulation. The simulation results show that the proposed scheme significantly improves data throughput compared with conventional schemes while preserving energy efficiency even in the presence of interference.

Nash Equilibrium of an Energy Saving Strategy with Dual Rate Transmission in Wireless Regional Area Network

Directory of Open Access Journals (Sweden)

Zhanqiang Huo

2017-01-01

Full Text Available Wireless regional area network (WRAN adopts centralized network architecture and is currently one of the most typical cognitive radio networks. In order to reduce the energy consumption of the communication networks with the constraint of spectrum resource utilization, a working sleep mechanism is introduced into the base station (BS, and a novel energy saving strategy with dual rate transmission is proposed. Combining the multiple-vacation queue and priority queue, using the quasi-birth-death process and the matrix-geometric solution method, we assess the average latency and the forced termination probability of secondary user packets, as well as the energy saving ratio and the channel utilization of system. Based on the revenue-expenditure structure, a profit function is built, and then the Nash equilibrium behavior and the socially optimal behavior are investigated. With the help of the particle swarm optimization, an intelligent optimization algorithm to search the socially optimal arrival rate of secondary user packets is presented. In order to unify the arrival rates of secondary user packets with Nash equilibrium and social optimization, a reasonable pricing policy is formulated. In addition, system experiments are carried out to verify the effectiveness of the energy saving strategy and the rationality of the pricing policy.

Bottlenecks reduction using superconductors in high voltage transmission lines

Directory of Open Access Journals (Sweden)

Daloub Labib

2016-01-01

Full Text Available Energy flow bottlenecks in high voltage transmission lines known as congestions are one of the challenges facing power utilities in fast developing countries. Bottlenecks occur in selected power lines when transmission systems are operated at or beyond their transfer limits. In these cases, congestions result in preventing new power supply contracts, infeasibility in existing contracts, price spike and market power abuse. The “Superconductor Technology” in electric power transmission cables has been used as a solution to solve the problem of bottlenecks in energy transmission at high voltage underground cables and overhead lines. The increase in demand on power generation and transmission happening due to fast development and linked to the intensive usage of transmission network in certain points, which in turn, lead to often frequent congestion in getting the required power across to where it is needed. In this paper, a bottleneck in high voltage double overhead transmission line with Aluminum Conductor Steel Reinforced was modeled using conductor parameters and replaced by Gap-Type Superconductor to assess the benefit of upgrading to higher temperature superconductor and obtain higher current carrying capacity. This proved to reduce the high loading of traditional aluminum conductors and allow more power transfer over the line using superconductor within the same existing right-of-way, steel towers, insulators and fittings, thus reducing the upgrade cost of building new lines.

Transmission of electric dipole radiation through an interface

Energy Technology Data Exchange (ETDEWEB)

Arnoldus, Henk F., E-mail: hfa1@msstate.edu [Department of Physics and Astronomy, Mississippi State University, P.O. Drawer 5167, Mississippi State, MS 39762-5167 (United States); Berg, Matthew J., E-mail: matt.berg@msstate.edu [Department of Physics and Astronomy, Mississippi State University, P.O. Drawer 5167, Mississippi State, MS 39762-5167 (United States); Li, Xin, E-mail: Xin.Li@millersville.edu [Department of Physics, P.O. Box 1002, Millersville University, Millersville, PA 17551 (United States)

2014-02-07

We consider the transmission of electric dipole radiation through an interface between two dielectrics, for the case of a vertical dipole. Energy flows along the field lines of the Poynting vector, and in the optical near field these field lines are curves (as opposed to optical rays). When the radiation passes through the interface into a thicker medium, the field lines bend to the normal (as rays do), but the transmission angle is not related to the angle of incidence. The redirection of the radiation at the interface is determined by the angle dependence of the transmission coefficient. This near-field redistribution is responsible for the far-field angular power pattern. When the transmission medium is thinner than the embedding medium of the dipole, some energy flows back and forth through the interface in an oscillating fashion. In each area where field lines dip below the interface, an optical vortex appears just above the interface. The centers of these vortices are concentric singular circles around the dipole axis.

Force transmissibility versus displacement transmissibility

Science.gov (United States)

Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

2014-10-01

It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this

Method for the transmission of energy

International Nuclear Information System (INIS)

Weissenbach, B.

1976-01-01

According ot the invention, chemical energy and/or chemically bound latent energy from a heat source (preferably from a nuclear reactor), is conveyed to a consumer by means of ordinary, saturated hydrocarbons, or their oxygen-containing derivates (preferably methanol), or synthesis gas in open- or closed-cycle systems. (GG) [de

A hybrid finite element - statistical energy analysis approach to robust sound transmission modeling

Science.gov (United States)

Reynders, Edwin; Langley, Robin S.; Dijckmans, Arne; Vermeir, Gerrit

2014-09-01

When considering the sound transmission through a wall in between two rooms, in an important part of the audio frequency range, the local response of the rooms is highly sensitive to uncertainty in spatial variations in geometry, material properties and boundary conditions, which have a wave scattering effect, while the local response of the wall is rather insensitive to such uncertainty. For this mid-frequency range, a computationally efficient modeling strategy is adopted that accounts for this uncertainty. The partitioning wall is modeled deterministically, e.g. with finite elements. The rooms are modeled in a very efficient, nonparametric stochastic way, as in statistical energy analysis. All components are coupled by means of a rigorous power balance. This hybrid strategy is extended so that the mean and variance of the sound transmission loss can be computed as well as the transition frequency that loosely marks the boundary between low- and high-frequency behavior of a vibro-acoustic component. The method is first validated in a simulation study, and then applied for predicting the airborne sound insulation of a series of partition walls of increasing complexity: a thin plastic plate, a wall consisting of gypsum blocks, a thicker masonry wall and a double glazing. It is found that the uncertainty caused by random scattering is important except at very high frequencies, where the modal overlap of the rooms is very high. The results are compared with laboratory measurements, and both are found to agree within the prediction uncertainty in the considered frequency range.

Analog data transmission via fiber optics

International Nuclear Information System (INIS)

Cisneros, E.L.; Burgueno, G.F.

1987-01-01

In the SLAC Linear Collider Detector (SLD), as in most high-energy particle detectors, the electromagnetic noise environment is the limiting factor in electronic readout performance. Front-end electronics are particularly susceptible to electromagnetic interference (EMI), and great care has been taken to minimize its effects. The transfer of preprocessed analog signals from the detector environs, to the remote digital processing electronics, by conventional means (via metal conductors), may ultimately limit the performance of the system. Because it is highly impervious to EMI and ground loops, a fiber-optic medium has been chosen for the transmission of these signals. This paper describes several fiber-optic transmission schemes which satisfy the requirements of the SLD analog data transmission

Analog data transmission via fiber optics

International Nuclear Information System (INIS)

Cisneros, E.L.; Burgueno, G.F.

1986-10-01

In the SLAC Linear Collider Detector (SLD), as in most high-energy particle detectors, the electromagnetic noise environment is the limiting factor in electronic readout performance. Front-end electronics are particulary susceptible to electromagnetic interference (EMI), and great care has been taken to minimize its effects. The transfer of preprocessed analog signals from the detector environs, to the remote digital processing electronics, by conventional means (via metal conductors), may ultimately limit the performance of the system. Because it is highly impervious to EMI and ground loops, a fiber-optic medium has been chosen for the transmission of these signals. This paper describes several fiber-optic transmission schemes which satisfy the requirements of the SLD analog data transmission

Development of a transmission positron microscope

Energy Technology Data Exchange (ETDEWEB)

Matsuya, M., E-mail: matsuya@jeol.co.jp [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Jinno, S. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan); Ootsuka, T.; Inoue, M. [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Kurihara, T. [High Energy Accelerator Research Organization, Oho, Tsukuba, Ibaraki 305-0801 (Japan); Doyama, M.; Inoue, M. [Teikyo University of Science and Technology, Uenohara, Yamanashi 409-0913 (Japan); Fujinami, M. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan)

2011-07-21

A practical transmission positron microscope (TPM) JEM-1011B has been developed to survey differences in the interaction of positron and electron beams with materials, and is installed in the Slow Positron Facility of High Energy Accelerator Research Organization (KEK). The TPM can share positron and electron beams, and can also be used as a transmission electron microscope (TEM). Positron transmission images up to magnification 10,000x (resolution: 50 nm) and positron diffraction patterns up to 044 family were successfully obtained by the TPM comparing them with those of electrons. The differences in material transmittances for both beams have been measured, and can be explained by the calculated results of the Monte Carlo simulation code PENELOPE-2008.

Transmission channels through Na and Al atom wire

DEFF Research Database (Denmark)

Kobayashi, N.; Brandbyge, Mads; Tsukada, M.

1999-01-01

First-principles calculations of the transmission channels of single-atom-width Na and Al atom wires bridged between metallic jellium electrodes are presented. For the Na wire, a single channel contributes to the conduction with an almost full quantization value, 2e(2)/h. The conductance...... is insensitive to the geometrical change since the Fermi energy is located above the onset energy of the channel showing the quantization of conductance. On the other hand, for the Al wire. three channels contribute to the conduction. The Fermi energy is placed just at the onset of the second and the third...... channels, and the channel transmissions are very sensitive to the geometrical changes of the wires. (C) 1999 Elsevier Science B.V. All rights reserved....

Time and Energy Efficient Relay Transmission for Multi-Hop Wireless Sensor Networks.

Science.gov (United States)

Kim, Jin-Woo; Barrado, José Ramón Ramos; Jeon, Dong-Keun

2016-06-27

The IEEE 802.15.4 standard is widely recognized as one of the most successful enabling technologies for short range low rate wireless communications and it is used in IoT applications. It covers all the details related to the MAC and PHY layers of the IoT protocol stack. Due to the nature of IoT, the wireless sensor networks are autonomously self-organized networks without infrastructure support. One of the issues in IoT is the network scalability. To address this issue, it is necessary to support the multi-hop topology. The IEEE 802.15.4 network can support a star, peer-to-peer, or cluster-tree topology. One of the IEEE 802.15.4 topologies suited for the high predictability of performance guarantees and energy efficient behavior is a cluster-tree topology where sensor nodes can switch off their transceivers and go into a sleep state to save energy. However, the IEEE 802.15.4 cluster-tree topology may not be able to provide sufficient bandwidth for the increased traffic load and the additional information may not be delivered successfully. The common drawback of the existing approaches is that they do not address the poor bandwidth utilization problem in IEEE 802.15.4 cluster-tree networks, so it is difficult to increase the network performance. Therefore, to solve this problem in this paper we study a relay transmission protocol based on the standard protocol in the IEEE 802.15.4 MAC. In the proposed scheme, the coordinators can relay data frames to their parent devices or their children devices without contention and can provide bandwidth for the increased traffic load or the number of devices. We also evaluate the performance of the proposed scheme through simulation. The simulation results demonstrate that the proposed scheme can improve the reliability, the end-to-end delay, and the energy consumption.

The paradox of transmission system value

International Nuclear Information System (INIS)

Haddad, S.Z.; Feldman, R.D.; Charnetzki, P.

1995-01-01

The central importance of utility strategic planning with respect to transmission systems has developed as a result of the passage of the Energy Policy Act and the rapid emergence of the era of open grid access. As a consequence, utilities have had to redefine transmission as being more than a cost center managed with reliability as the principal focus and regulated on a rate of return basis. Transmission must now be managed with a view to protection of customers, where possible, and to revenue maximization, both through pricing strategy and through operations. This shift has been compounded by the pressures being thrust upon utilities by regulators or being fomented by competitors to unbundle transmission and distribution from generation. This paper explores how the value of the transmission system can be viewed from the vantage points of different organizations (utilities, regulators, customers, independent generators, etc.). The paper addresses the uncertain and apparently paradoxical nature of transmission system value as it will be impacted by the possible alternative future structures of the electric power industry. Lastly, this paper suggests the strategic possibilities for utilities that this uncertainty presents

Adequacy assessment of composite generation and transmission systems incorporating wind energy conversion systems

Science.gov (United States)

Gao, Yi

The development and utilization of wind energy for satisfying electrical demand has received considerable attention in recent years due to its tremendous environmental, social and economic benefits, together with public support and government incentives. Electric power generation from wind energy behaves quite differently from that of conventional sources. The fundamentally different operating characteristics of wind energy facilities therefore affect power system reliability in a different manner than those of conventional systems. The reliability impact of such a highly variable energy source is an important aspect that must be assessed when the wind power penetration is significant. The focus of the research described in this thesis is on the utilization of state sampling Monte Carlo simulation in wind integrated bulk electric system reliability analysis and the application of these concepts in system planning and decision making. Load forecast uncertainty is an important factor in long range planning and system development. This thesis describes two approximate approaches developed to reduce the number of steps in a load duration curve which includes load forecast uncertainty, and to provide reasonably accurate generating and bulk system reliability index predictions. The developed approaches are illustrated by application to two composite test systems. A method of generating correlated random numbers with uniform distributions and a specified correlation coefficient in the state sampling method is proposed and used to conduct adequacy assessment in generating systems and in bulk electric systems containing correlated wind farms in this thesis. The studies described show that it is possible to use the state sampling Monte Carlo simulation technique to quantitatively assess the reliability implications associated with adding wind power to a composite generation and transmission system including the effects of multiple correlated wind sites. This is an important

78 FR 69660 - Association of Businesses Advocating Tariff Equity, Coalition of Miso Transmission Customers...

Science.gov (United States)

2013-11-20

... Businesses Advocating Tariff Equity, Coalition of Miso Transmission Customers, Illinois Industrial Energy... LLC, Duke Energy Business Services, LLC, Entergy Arkansas, Inc., Entergy Gulf States Louisiana, LLC....206 (2013), Association of Businesses Advocating Tariff Equity, Coalition of Miso Transmission...

76 FR 20973 - Northeast Transmission Development, LLC; Notice of Petition for Declaratory Order

Science.gov (United States)

2011-04-14

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. EL11-33-000] Northeast Transmission Development, LLC; Notice of Petition for Declaratory Order Take notice that on April 6, 2011... (Commission) Rules of Practice and Procedure, 18 CFR 385.207, and Order No. 679,\\2\\ Northeast Transmission...

State and performance of on-stream ash content determination in lignite and black coal using 2-energy transmission technique

International Nuclear Information System (INIS)

Thuemmel, H.W.; Koerner, G.; Leonhardt, J.

1986-01-01

The total r.m.s. ash error of the 2-energy transmission on-stream ash gauges KRAS-2 (CIIRR, GDR) and SIROASH (Australia) are 4 weight percentage for raw lignite and 0.5 weight percentage for black coal, respectively. A detailed error analysis shows that this difference is due to the high water content and to strong variations in the ash composition of raw lignite. Both gauges show essentially the same radiometric performance. (author)

Superconducting qubit in a nonstationary transmission line cavity: Parametric excitation, periodic pumping, and energy dissipation

Energy Technology Data Exchange (ETDEWEB)

Zhukov, A.A. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); National Research Nuclear University (MEPhI), 115409 Moscow (Russian Federation); Shapiro, D.S., E-mail: shapiro.dima@gmail.com [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); V.A. Kotel' nikov Institute of Radio Engineering and Electronics, Russian Academy of Sciences, 125009 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region 141700 (Russian Federation); National University of Science and Technology MISIS, 119049 Moscow (Russian Federation); Remizov, S.V. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); V.A. Kotel' nikov Institute of Radio Engineering and Electronics, Russian Academy of Sciences, 125009 Moscow (Russian Federation); Pogosov, W.V. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region 141700 (Russian Federation); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412 Moscow (Russian Federation); Lozovik, Yu.E. [N.L. Dukhov All-Russia Research Institute of Automatics, 127055 Moscow (Russian Federation); National Research Nuclear University (MEPhI), 115409 Moscow (Russian Federation); Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region 141700 (Russian Federation); Institute of Spectroscopy, Russian Academy of Sciences, 142190 Moscow Region, Troitsk (Russian Federation)

2017-02-12

We consider a superconducting qubit coupled to the nonstationary transmission line cavity with modulated frequency taking into account energy dissipation. Previously, it was demonstrated that in the case of a single nonadiabatical modulation of a cavity frequency there are two channels of a two-level system excitation which are due to the absorption of Casimir photons and due to the counterrotating wave processes responsible for the dynamical Lamb effect. We show that the parametric periodical modulation of the resonator frequency can increase dramatically the excitation probability. Remarkably, counterrotating wave processes under such a modulation start to play an important role even in the resonant regime. Our predictions can be used to control qubit-resonator quantum states as well as to study experimentally different channels of a parametric qubit excitation. - Highlights: • Coupled qubit-resonator system under the modulation of a resonator frequency is considered. • Counterrotating terms of the Hamiltonian are of importance even in the resonance. • Qubit excited state population is highest if driving frequency matches dressed-state energy.

Prediction of sound transmission loss through multilayered panels by using Gaussian distribution of directional incident energy

Science.gov (United States)

Kang; Ih; Kim; Kim

2000-03-01

In this study, a new prediction method is suggested for sound transmission loss (STL) of multilayered panels of infinite extent. Conventional methods such as random or field incidence approach often given significant discrepancies in predicting STL of multilayered panels when compared with the experiments. In this paper, appropriate directional distributions of incident energy to predict the STL of multilayered panels are proposed. In order to find a weighting function to represent the directional distribution of incident energy on the wall in a reverberation chamber, numerical simulations by using a ray-tracing technique are carried out. Simulation results reveal that the directional distribution can be approximately expressed by the Gaussian distribution function in terms of the angle of incidence. The Gaussian function is applied to predict the STL of various multilayered panel configurations as well as single panels. The compared results between the measurement and the prediction show good agreements, which validate the proposed Gaussian function approach.

Simulation of loss electron in vacuum magnetically insulated transmission lines

International Nuclear Information System (INIS)

Zhang Pengfei; Li Yongdong; Liu Chunliang; Wang Hongguang; Guo Fan; Yang Hailiang; Qiu Aici; Su Zhaofeng; Sun Jianfeng; Sun Jiang; Gao Yi

2011-01-01

In the beginning of magnetic insulated period, loss electron in coaxial vacuum magnetically insulated transmission line (MITL) strikes anode and the bremsstrahlung photons are generated in the mean time. Based on the self-limited flow model, velocity in direction of energy transport, energy spectrum and angular distribution of loss electron are simulated by PIC code, energy spectrum of bremsstrahlung photons as well calculated though Monte Carlo method. Computational results show that the velocity of loss electron is less than 2.998 x 108 m/s, the angular excursion of electron is not much in a board extent of energy spectrum. These results show an indirect diagnosis of vacuum insulted transmission line working status based on loss electron bremsstrahlung. (authors)

Transmission factors for neutrons produced by radioisotopes production used in PET

International Nuclear Information System (INIS)

Hernandez G, D.; Cruzate, J.A.

1996-01-01

The dose transmission factor for normal concrete and the neutrons produced in the 18 O(p,n) 18 F and 13 C(p,n) 13 N reactions are presented in this paper. These transmission factors permit to simplify the calculation of the necessary accelerator shielding to be used in the radioisotope production for positron emission tomography. The energy distributions of the neutrons resulting from the irradiation of thick targets, with 10 to 13 MeV protons, were determined using the thin target cross sections, the energy loss per path length and the energy balance of the reaction (Q-equation). The one dimensional discrete ordinate transport code ANISN and the conversion coefficients from fluence to dose, presented in the ICRP Publication 51 were employed to obtain the transmission factors. (authors). 12 refs., 3 figs., 2 tabs

Feasibility study of wireless power transmission systems

Science.gov (United States)

Robinson, W. J., Jr.

1968-01-01

Wireless microwave or laser energy transfers power from a manned earth-orbiting central station to unmanned astronomical substations. More efficient systems are required for the microwave power transmission.

Estimating electricity storage power rating and discharge duration for utility transmission and distribution deferral :a study for the DOE energy storage program.

Energy Technology Data Exchange (ETDEWEB)

Eyer, James M. (Distributed Utility Associates, Livermore, CA); Butler, Paul Charles; Iannucci, Joseph J., Jr. (,.Distributed Utility Associates, Livermore, CA)

2005-11-01

This report describes a methodology for estimating the power and energy capacities for electricity energy storage systems that can be used to defer costly upgrades to fully overloaded, or nearly overloaded, transmission and distribution (T&D) nodes. This ''sizing'' methodology may be used to estimate the amount of storage needed so that T&D upgrades may be deferred for one year. The same methodology can also be used to estimate the characteristics of storage needed for subsequent years of deferral.

Impacts of Demand-Side Resources on Electric Transmission Planning

Energy Technology Data Exchange (ETDEWEB)

Hadley, Stanton W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sanstad, Alan H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2015-01-01

Will demand resources such as energy efficiency (EE), demand response (DR), and distributed generation (DG) have an impact on electricity transmission requirements? Five drivers for transmission expansion are discussed: interconnection, reliability, economics, replacement, and policy. With that background, we review the results of a set of transmission studies that were conducted between 2010 and 2013 by electricity regulators, industry representatives, and other stakeholders in the three physical interconnections within the United States. These broad-based studies were funded by the US Department of Energy and included scenarios of reduced load growth due to EE, DR, and DG. While the studies were independent and used different modeling tools and interconnect-specific assumptions, all provided valuable results and insights. However, some caveats exist. Demand resources were evaluated in conjunction with other factors, and limitations on transmission additions between scenarios made understanding the role of demand resources difficult. One study, the western study, included analyses over both 10- and 20-year planning horizons; the 10-year analysis did not show near-term reductions in transmission, but the 20-year indicated fewer transmission additions, yielding a 36percent capital cost reduction. In the eastern study the reductions in demand largely led to reductions in local generation capacity and an increased opportunity for low-cost and renewable generation to export to other regions. The Texas study evaluated generation changes due to demand, and is in the process of examining demand resource impacts on transmission.

Reciprocal relations for transmission coefficients - Theory and application

Science.gov (United States)

Qu, Jianmin; Achenbach, Jan D.; Roberts, Ronald A.

1989-01-01

The authors present a rigorous proof of certain intuitively plausible reciprocal relations for time harmonic plane-wave transmission and reflection at the interface between a fluid and an anisotropic elastic solid. Precise forms of the reciprocity relations for the transmission coefficients and for the transmitted energy fluxes are derived, based on the reciprocity theorem of elastodynamics. It is shown that the reciprocity relations can be used in conjunction with measured values of peak amplitudes for transmission through a slab of the solid (water-solid-water) to obtain the water-solid coefficients. Experiments were performed for a slab of a unidirectional fiber-reinforced composite. Good agreement of the experimentally measured transmission coefficients with theoretical values was obtained.

78 FR 65641 - Recommendation From the Western Area Power Administration To Pursue Regional Transmission...

Science.gov (United States)

2013-11-01

... energy purchases and optimized short-term energy sales. As a result, Western-UGP has performed an... experts, combined with stakeholder comments, detailed discussions with the Midcontinent Independent System... implemented the Integrated Transmission System (IS). The IS includes approximately 9,848 miles of transmission...

76 FR 44323 - National Grid Transmission Services Corporation; Bangor Hydro Electric Company; Notice of...

Science.gov (United States)

2011-07-25

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. EL11-49-000] National Grid Transmission Services Corporation; Bangor Hydro Electric Company; Notice of Petition for Declaratory Order Take..., 18 CFR 385.207, National Grid Transmission Services Corporation and Bangor Hydro Electric Company...

75 FR 26746 - ONEOK Westex Transmission, L.L.C.; Notice of Baseline Filing

Science.gov (United States)

2010-05-12

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. PR10-19-000] ONEOK Westex Transmission, L.L.C.; Notice of Baseline Filing May 5, 2010. Take notice that on April 29, 2010, ONEOK Westex Transmission, L.L.C. submitted its baseline filing of its Statement of Operating Conditions for transportation...

76 FR 29234 - Texas Eastern Transmission, LP; Notice of Request Under Blanket Authorization

Science.gov (United States)

2011-05-20

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP11-477-000] Texas Eastern Transmission, LP; Notice of Request Under Blanket Authorization Take notice that on May 10, 2011 Texas Eastern Transmission, LP (Texas Eastern), 5400 Westheimer Court, Houston, Texas 77056, filed in Docket No. CP11-477-000...

78 FR 20896 - Renewable Energy and Energy Efficiency Advisory Committee

Science.gov (United States)

2013-04-08

... DEPARTMENT OF COMMERCE International Trade Administration Renewable Energy and Energy Efficiency... of an Open Meeting. SUMMARY: The Renewable Energy and Energy Efficiency Advisory Committee (RE&EEAC... industry-specific teams--renewable energy, energy efficiency, energy storage and transmission, and biofuels...

Realistic modeling of radiation transmission inspection systems

International Nuclear Information System (INIS)

Sale, K.E.

1993-01-01

We have applied Monte Carlo particle transport methods to assess a proposed neutron transmission inspection system for checked luggage. The geometry of the system and the time, energy and angle dependence of the source have been modeled in detail. A pulsed deuteron beam incident on a thick Be target generates a neutron pulse with a very broad energy spectrum which is detected after passage through the luggage item by a plastic scintillator detector operating in current mode (as opposed to pulse counting mode). The neutron transmission as a function of time information is used to infer the densities of hydrogen, carbon, oxygen and nitrogen in the volume sampled. The measured elemental densities can be compared to signatures for explosives or other contraband. By using such computational modeling it is possible to optimize many aspects of the design of an inspection system without costly and time consuming prototyping experiments or to determine that a proposed scheme will not work. The methods applied here can be used to evaluate neutron or photon schemes based on transmission, scattering or reaction techniques

Transmission Power Control for Wireless Sensor Network

Directory of Open Access Journals (Sweden)

Kuo-Hsien Hsia

2017-02-01

Full Text Available Wireless sensor networks can be widely applied for a security system or a smart home system. Since some of the wireless remote sensor nodes may be powered by energy storage devices such as batteries, it is a very important issue to transmit signals at lower power with the consideration of the communication effectiveness. In this paper, we will provide a fuzzy controller with two inputs and one output for received signal strength indicator (RSSI and link quality indicator (LQI to adjust transmission power suitably in order to maintaining a certain communication level with a reduced energy consumption. And we will divide the sampling period of a sensor node into four intervals so that the sensor node radio device does not in receiving or transmission status all the time. Hence the sensor node can adjust transmission power automatically and reduce sensor node power consumption. Experimental results show that the battery life can be extended to about 10 times for the designed sensor node comparing to a normal node.

Data Transmission Scheme Using Mobile Sink in Static Wireless Sensor Network

Directory of Open Access Journals (Sweden)

Awais Ahmad

2015-01-01

Full Text Available Multihop communication in wireless sensor network (WSN brings new challenges in reliable data transmission. Recent work shows that data collection from sensor nodes using mobile sink minimizes multihop data transmission and improves energy efficiency. However, due to continuous movements, mobile sink has limited communication time to collect data from sensor nodes, which results in rapid depletion of node’s energy. Therefore, we propose a data transmission scheme that addresses the aforementioned constraints. The proposed scheme first finds out the group based region on the basis of localization information of the sensor nodes and predefined trajectory information of a mobile sink. After determining the group region in the network, selection of master nodes is made. The master nodes directly transmit their data to the mobile sink upon its arrival at their group region through restricted flooding scheme. In addition, the agent node concept is introduced for swapping of the role of the master nodes in each group region. The master node when consuming energy up to a certain threshold, neighboring node with second highest residual energy is selected as an agent node. The mathematical analysis shows that the selection of agent node maximizes the throughput while minimizing transmission delay in the network.

The year in review: Electric transmission

International Nuclear Information System (INIS)

Hebert, C. Jr.

1999-01-01

This writing and the comments contained herein support the conclusion that mandating a solution to transmission woes is not the proper choice. Even if it were the right choice, it would not be the way to go. FERC exists in a sophisticated energy world and must comprehend that without the help of the energy industry it is doomed to fail. Technology changes, economies change, and even the FERC itself changes, and will again. This is all part of the energy journey. RTOs, pools, ISOs, RTOs, and, yes, Transcos are a part of the evolution of energy regulation and perhaps deregulation to some degree

Transmission pricing and expansion methodology: lessons from Argentina

International Nuclear Information System (INIS)

Anderson, K.P.; McCarthy, A.

1999-01-01

This paper focuses on the pricing of electric transmission service in Argentina and on the mechanisms for expanding the transmission system as of late 1998. We also discuss the pricing of energy and generating capacity, since locational differences in their prices constitute charges for transmission service. We find that the methods in place for pricing transmission service are, in the main, consistent with the principles of efficient pricing but that the incentives and mechanisms established for expanding transmission are deficient in some respects. Most notable is the failure to provide for transmission rights, given the system's heavy reliance on user-driven expansion. We find that Argentina can improve upon its pioneering effort to implement user-driven expansion and indeed is exploring ways to do so. The most important tasks are to investigate (a) whether a system of financial transmission rights can be made to work as part of the process of user-driven expansion and (b) whether a backstop role for centrally planned expansion can be preserved without inhibiting or preempting the user-driven process. (author)

Wireless transmission of monitoring data out of the Hades underground laboratory

International Nuclear Information System (INIS)

Schroeder, T.J.; Hart, J.

2012-01-01

Document available in extended abstract form only. For the monitoring of geological waste disposal in the post-closure phase, data acquired by the underground monitoring system inside the repository need to be transmitted wirelessly through the underground to the surface. Low frequency magneto-induction techniques as applied in mine communication and rescue can potentially be used for the wireless transmission of data from the repository to the surface. However, the propagation of magnetic fields through porous argillaceous rocks like the Boom Clay is hindered by the high electrical conductivity of the rock. As part of the European 7. framework project MoDeRn, Monitoring Developments for safe Repository operation and staged closure, NRG is conducting tests on the wireless transmission of monitoring data under conditions representative for a generic Dutch disposal in Boom Clay. This should help to judge the general feasibility of long-term wireless data transmission from an underground repository through the enclosing host rock and the overlying geosphere to the surface. Experimental work As contribution to the MoDeRn Work Package 3, In-situ demonstration of innovative monitoring techniques, NRG conducts tests on the wireless transmission of signals and data. The wireless data transmission experiments of NRG are being performed at the HADES Underground Research Laboratory (URL) in Mol, Belgium, situated at 225 m depth in a 100 m thick layer of Boom Clay. The main objective of the contribution is to quantify and optimise the energy efficiency of the transmission technique used. Because the Boom Clay and the overlying aquifers attenuate the magnetic fields more strongly than other host rocks, it is assumed that transmission experiments performed in the HADES give a more realistic picture on field propagation than experiments performed e.g. in granite, salt rock or Opalinus clay. Although the generic depth for the Dutch disposal design is 500 m, the experiments

Transmission solutions : a 10 year plan for the province of Ontario 2005-2014

International Nuclear Information System (INIS)

2005-02-01

This paper present a 10 year transmission plan for Ontario by Hydro One Networks Inc., the largest electricity delivery company in the province. A history of Hydro One Network's activities during the past century was provided as well as information about the company and details of their mission and objectives. A list of their accomplishments during 2004 was also presented. An outline of the current transmission infrastructure system was presented. Elements of the plan include customer connections; area supply reliability; facilitation of electricity supply; and transmission needs and solutions. Plans specific to central, western, eastern and northeastern zones were also presented, including zone maps of transmission lines and generating stations. Changes included: Bill 100, the Electricity Restructuring Act in 2004 and the establishment of the Ontario Power Authority (OPA); changes to the Ontario Energy Board's Transmission System Code (TSC); government measures to increase the supply of electricity through requests for proposals (RFPs) for new renewable and clean energy; and the announcement of an increase in the amount of wind energy through the Wind Power Production Incentive program. refs., tabs., figs

Marginal cost calculation of energy production in hydro thermoelectric systems considering the transmission system; Calculo do custo marginal de producao de energia em sistemas hidrotermoeletricos levando em consideracao a rede de transmissao

Energy Technology Data Exchange (ETDEWEB)

Pereira, M V.F. [Pontificia Univ. Catolica do Rio de Janeiro, RJ (Brazil); Gorenstin, B G [Centro de Pesquisas de Energia Eletrica, Rio de Janeiro, RJ (Brazil); Alvarenga Filho, S [ELETROBRAS, Rio de Janeiro, RJ (Brazil)

1990-12-31

The alternatives for calculation of energy marginal cost in hydroelectric systems, considering the transmission one, was analysed, including fundamental concepts; generation/transmission systems, represented by linear power flow model; production marginal costs in hydrothermal systems and computation aspects. (C.G.C.). 11 refs, 5 figs.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

HVDC Transmission an Outlook and Significance for Pakistani Power Sector

Science.gov (United States)

Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

2018-04-01

Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

Providing all global energy with wind, water, and solar power, Part II: Reliability, system and transmission costs, and policies

International Nuclear Information System (INIS)

Delucchi, Mark A.; Jacobson, Mark Z.

2011-01-01

This is Part II of two papers evaluating the feasibility of providing all energy for all purposes (electric power, transportation, and heating/cooling), everywhere in the world, from wind, water, and the sun (WWS). In Part I, we described the prominent renewable energy plans that have been proposed and discussed the characteristics of WWS energy systems, the global demand for and availability of WWS energy, quantities and areas required for WWS infrastructure, and supplies of critical materials. Here, we discuss methods of addressing the variability of WWS energy to ensure that power supply reliably matches demand (including interconnecting geographically dispersed resources, using hydroelectricity, using demand-response management, storing electric power on site, over-sizing peak generation capacity and producing hydrogen with the excess, storing electric power in vehicle batteries, and forecasting weather to project energy supplies), the economics of WWS generation and transmission, the economics of WWS use in transportation, and policy measures needed to enhance the viability of a WWS system. We find that the cost of energy in a 100% WWS will be similar to the cost today. We conclude that barriers to a 100% conversion to WWS power worldwide are primarily social and political, not technological or even economic. - Research highlights: → We evaluate the feasibility of global energy supply from wind, water, and solar energy. → WWS energy can be supplied reliably and economically to all energy-use sectors. → The social cost of WWS energy generally is less than the cost of fossil-fuel energy. → Barriers to 100% WWS power worldwide are socio-political, not techno-economic.

Multiple Timescale Energy Scheduling for Wireless Communication with Energy Harvesting Devices

Directory of Open Access Journals (Sweden)

H. Xiao

2012-09-01

Full Text Available The primary challenge in wireless communication with energy harvesting devices is to efficiently utilize the harvesting energy such that the data packet transmission could be supported. This challenge stems from not only QoS requirement imposed by the wireless communication application, but also the energy harvesting dynamics and the limited battery capacity. Traditional solar predictable energy harvesting models are perturbed by prediction errors, which could deteriorate the energy management algorithms based on this models. To cope with these issues, we first propose in this paper a non-homogenous Markov chain model based on experimental data, which can accurately describe the solar energy harvesting process in contrast to traditional predictable energy models. Due to different timescale between the energy harvesting process and the wireless data transmission process, we propose a general framework of multiple timescale Markov decision process (MMDP model to formulate the joint energy scheduling and transmission control problem under different timescales. We then derive the optimal control policies via a joint dynamic programming and value iteration approach. Extensive simulations are carried out to study the performances of the proposed schemes.

Improving the Energy Market: Algorithms, Market Implications, and Transmission Switching

Science.gov (United States)

Lipka, Paula Ann

This dissertation aims to improve ISO operations through a better real-time market solution algorithm that directly considers both real and reactive power, finds a feasible Alternating Current Optimal Power Flow solution, and allows for solving transmission switching problems in an AC setting. Most of the IEEE systems do not contain any thermal limits on lines, and the ones that do are often not binding. Chapter 3 modifies the thermal limits for the IEEE systems to create new, interesting test cases. Algorithms created to better solve the power flow problem often solve the IEEE cases without line limits. However, one of the factors that makes the power flow problem hard is thermal limits on the lines. The transmission networks in practice often have transmission lines that become congested, and it is unrealistic to ignore line limits. Modifying the IEEE test cases makes it possible for other researchers to be able to test their algorithms on a setup that is closer to the actual ISO setup. This thesis also examines how to convert limits given on apparent power---as is in the case in the Polish test systems---to limits on current. The main consideration in setting line limits is temperature, which linearly relates to current. Setting limits on real or apparent power is actually a proxy for using the limits on current. Therefore, Chapter 3 shows how to convert back to the best physical representation of line limits. A sequential linearization of the current-voltage formulation of the Alternating Current Optimal Power Flow (ACOPF) problem is used to find an AC-feasible generator dispatch. In this sequential linearization, there are parameters that are set to the previous optimal solution. Additionally, to improve accuracy of the Taylor series approximations that are used, the movement of the voltage is restricted. The movement of the voltage is allowed to be very large at the first iteration and is restricted further on each subsequent iteration, with the restriction

76 FR 49764 - Notice of FERC Staff Attendance at the Entergy ICT Transmission Planning Summit and Entegry...

Science.gov (United States)

2011-08-11

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Notice of FERC Staff Attendance at the Entergy ICT Transmission Planning Summit and Entegry Regional State Committee Meeting The Federal Energy.... Their attendance is part of the Commission's ongoing outreach efforts. Entergy ICT Transmission Planning...

Guidelines for clockspeed acceleration in the US natural gas transmission industry

International Nuclear Information System (INIS)

Weijermars, Ruud

2010-01-01

This study presents the clockspeed analysis of a peer group comprising six major integrated US energy companies with substantial US interstate natural gas pipeline business activities: El Paso, Williams, NiSource, Kinder Morgan, MidAmerican and CMS Energy. For this peer group, the three clockspeed accelerators have been benchmarked at both corporate level and gas transmission business level, using time-series analysis and cross-sectional analysis over a 6-year period (2002-2007). The results are visualized in so-called clockspeed radargraphs. Overall corporate clockspeed winners - over the performance period studied - are: Williams, El Paso and Kinder Morgan; MidAmerican is a close follower. Corporate clockspeed laggards are: CMS Energy and NiSource. The peer group ranking for the natural gas transmission business segment shows similar clockspeed winners, but with different ranking in the following order: Kinder Morgan, MidAmerican and El Paso; Williams is a close follower. Clockspeed laggards for the natural gas transmission segments coincide with the corporate clockspeed laggards of the peer group: CMS Energy and NiSource (over the performance period studied); laggards of the past may become clockspeed leaders of the future if adjustments are made. Practical recommendations are formulated for achieving competitive clockspeed optimization in the US gas transmission industry as a whole. Recommendations for clockspeed acceleration at individual companies are also given. Although the US natural gas market is subject to specific regulations and its own geographical dynamics, this study also provides hints for improving the competitive clockspeed performance of gas transmission companies elsewhere, in other world regions. (author)

Guidelines for clockspeed acceleration in the US natural gas transmission industry

Energy Technology Data Exchange (ETDEWEB)

Weijermars, Ruud [Department of Geotechnology, Delft University of Technology, PO Box 5048, 2600GA Delft (Netherlands)

2010-08-15

This study presents the clockspeed analysis of a peer group comprising six major integrated US energy companies with substantial US interstate natural gas pipeline business activities: El Paso, Williams, NiSource, Kinder Morgan, MidAmerican and CMS Energy. For this peer group, the three clockspeed accelerators have been benchmarked at both corporate level and gas transmission business level, using time-series analysis and cross-sectional analysis over a 6-year period (2002-2007). The results are visualized in so-called clockspeed radargraphs. Overall corporate clockspeed winners - over the performance period studied - are: Williams, El Paso and Kinder Morgan; MidAmerican is a close follower. Corporate clockspeed laggards are: CMS Energy and NiSource. The peer group ranking for the natural gas transmission business segment shows similar clockspeed winners, but with different ranking in the following order: Kinder Morgan, MidAmerican and El Paso; Williams is a close follower. Clockspeed laggards for the natural gas transmission segments coincide with the corporate clockspeed laggards of the peer group: CMS Energy and NiSource (over the performance period studied); laggards of the past may become clockspeed leaders of the future if adjustments are made. Practical recommendations are formulated for achieving competitive clockspeed optimization in the US gas transmission industry as a whole. Recommendations for clockspeed acceleration at individual companies are also given. Although the US natural gas market is subject to specific regulations and its own geographical dynamics, this study also provides hints for improving the competitive clockspeed performance of gas transmission companies elsewhere, in other world regions. (author)

Time and Energy Efficient Relay Transmission for Multi-Hop Wireless Sensor Networks

Directory of Open Access Journals (Sweden)

Jin-Woo Kim

2016-06-01

Full Text Available The IEEE 802.15.4 standard is widely recognized as one of the most successful enabling technologies for short range low rate wireless communications and it is used in IoT applications. It covers all the details related to the MAC and PHY layers of the IoT protocol stack. Due to the nature of IoT, the wireless sensor networks are autonomously self-organized networks without infrastructure support. One of the issues in IoT is the network scalability. To address this issue, it is necessary to support the multi-hop topology. The IEEE 802.15.4 network can support a star, peer-to-peer, or cluster-tree topology. One of the IEEE 802.15.4 topologies suited for the high predictability of performance guarantees and energy efficient behavior is a cluster-tree topology where sensor nodes can switch off their transceivers and go into a sleep state to save energy. However, the IEEE 802.15.4 cluster-tree topology may not be able to provide sufficient bandwidth for the increased traffic load and the additional information may not be delivered successfully. The common drawback of the existing approaches is that they do not address the poor bandwidth utilization problem in IEEE 802.15.4 cluster-tree networks, so it is difficult to increase the network performance. Therefore, to solve this problem in this paper we study a relay transmission protocol based on the standard protocol in the IEEE 802.15.4 MAC. In the proposed scheme, the coordinators can relay data frames to their parent devices or their children devices without contention and can provide bandwidth for the increased traffic load or the number of devices. We also evaluate the performance of the proposed scheme through simulation. The simulation results demonstrate that the proposed scheme can improve the reliability, the end-to-end delay, and the energy consumption.

The integration of renewable energies into the German transmission grid—A scenario comparison

International Nuclear Information System (INIS)

Schroeder, Andreas; Oei, Pao-Yu; Sander, Aram; Hankel, Lisa; Laurisch, Lilian Charlotte

2013-01-01

This article presents a quantitative assessment of the need for electricity transmission capacity investments in Germany for 2030. Congestion is analyzed and its possible relief through appropriate grid reinforcements as those described in the Ten Year Network Development Plan (TYNDP) of the European Commission. Congestion is investigated in three scenarios which differ in the location of power resources and the line expansion projects accomplished. Results show that the TYNDP and overlay line projects proposed in 2011 are not sufficient measures to cope with the increasing demand for transmission capacity. The paper also concludes that if power generation resources are moved closer to demand centers grid bottlenecks can be partly relieved by 2030. The introduction of a high-voltage direct current (HVDC) backbone grid does not relieve congestion significantly. - Highlights: • The need for power transmission capacity in Germany for 2030 is assessed. • The TYNDP is insufficient to cope with increasing demand for transmission. • If generation is moved closer to demand grid bottlenecks are partly relieved. • An HVDC backbone grid does not relieve congestion significantly

Impact of GB transmission charging on renewable electricity generation

International Nuclear Information System (INIS)

2006-01-01

The Government is committed to meeting its objective of producing 10% of UK electricity supplies from renewable sources by 2010, subject to the cost to the consumer being acceptable. It is generally believed that northern Scotland - and the Highlands and Islands in particular - will be a significant source of renewable energy in future, mostly in the form of wind power; wave and tidal energy may also be important. The National Grid Company (NGC) is responsible for formulating a cost-reflective and. non-discriminatory electricity transmission charging methodology for Great Britain (GB). This determines Transmission Network Use of System (TNUoS) tariffs, which are paid by transmission-connected generators and suppliers for the use of the high voltage transmission network. Following the publication of National Grid Company's 'GB Transmission Charging: Initial Thoughts' document on 16 December 2003, there was particular concern that the level of future Transmission Network Use of System (TNUoS) tariffs in northern Scotland might impede the achievement of the Government's 2010 target for renewable electricity supplies. That document and subsequent revisions indicate that generation TNUoS charges in northern Scotland were likely to be significantly higher than anywhere else in GB. The study attempts to quantify the effect of the proposed GB-wide TNUoS charging methodology on the future growth of renewable electricity so as to ascertain the impact on the likelihood of meeting the Government's 2010 target. (UK)

Efficient utilization of wind power: Long-distance transmission or local consumption?

Science.gov (United States)

Sun, Yuanzhang; Ma, Xiyuan; Xu, Jian; Bao, Yi; Liao, Siyang

2017-09-01

Excess wind power produced in wind-intensive areas is normally delivered to remote load centers via long-distance transmission lines. This paper presents a comparison between long-distance transmission, which has gained popularity, and local energy consumption, in which a fraction of the generated wind power can be locally consumed by energy-intensive industries. First, the challenges and solutions to the long-distance transmission and local consumption of wind power are presented. Then, the two approaches to the utilization of wind power are compared in terms of system security, reliability, cost, and capability to utilize wind energy. Finally, the economic feasibility and technical feasibility of the local consumption of wind power are demonstrated by a large and isolated industrial power system, or supermicrogrid, in China. The coal-fired generators together with the short-term interruptible electrolytic aluminum load in the supermicrogrid are able to compensate for the intermittency of wind power. In the long term, the transfer of high-energy-consumption industries to wind-rich areas and their local consumption of the available wind power are beneficial.

Design of a transmission electron positron microscope

International Nuclear Information System (INIS)

Doyama, Masao; Inoue, M.; Kogure, Y.; Hayashi, Y.; Yoshii, T.; Kurihara, T.; Tsuno, K.

2003-01-01

This paper reports the plans and design of positron-electron microscopes being built at KEK (High Energy Accelerator Research Organization), Tsukuba, Japan. A used electron microscope is altered. The kinetic energies of positrons produced by accelerators or by nuclear decays are not a unique value but show a spread over in a wide range. Positron beam is guided to a transmission electron microscope (JEM100SX). Positrons are moderated by a tungsten foil, are accelerated and are focused on a nickel sheet. The monochromatic focused beam is injected into an electron microscope. The focusing and aberration of positrons are the same as electrons in a magnetic system which are used in commercial electron microscopes. Imaging plates are used to record positron images for the transmission electron microscope. (author)

Transmission of wave energy in curved ducts

Science.gov (United States)

Rostafinski, W.

1973-01-01

A formation of wave energy flow was developed for motion in curved ducts. A parametric study over a range of frequencies determined the ability of circular bends to transmit energy for the case of perfectly rigid walls.

Study of the energy band in n-type GaAs and p-type In P by transmission and photoluminescence spectroscopy

International Nuclear Information System (INIS)

Banai, N.; Khanzadeh, M.

1998-01-01

Optical characterization of the n-type In P grown by horizontal Bridgman method was carried out using modular photoluminescence and optical transmission spectroscopy. The measured transmission spectra at room temperature using Cary 17 DX spectrophotometer reveals the band gap energies of 1.4 and 1.34 eV for p-type In P and the n-type GaAs, respectively. Photoluminescence spectra of the above samples was measured at 77 K with the excitation intensity of (20 W/Cm 2 ). The (B-A) transitions occur at 1.405 eV and at 1.382 eV respectively. Three spectra were observed for the n-type GaAs sample, namely, (B-B), (B-A) and another relatively wide spectra at wavelengths above the absorption edge caused by the deep level impurities. The peak position of these spectra are 1.482, 1.4 and 1.36 eV respectively. (author)

Energy law novelties

International Nuclear Information System (INIS)

Butnaru, Paula

2004-01-01

Energy Law no. 318/2003 has been worked out in compliance with the EU Electricity Directive based on the following principles and objectives: - clearly defining the positions and roles of various institutional entities and structures; - introducing the competitions in energy generation and supply; - creation and functioning of electricity competitive markets; - right of certain consumers to buy electricity directly from the producers; - direct, fair and regulated access to electrical network of all the participants in the electricity market; - generators, distributors and consumers; - achieving the activities in the field under reliable conditions and at the quality standards for optimally using the primary energy resources by observing the environmental protection norms in force; - promoting, in a balanced manner, the interests of the National Power System based on the European regulations and requirements on optimal and efficient resources use by observing the environmental criteria and norms; - ensuring the sustainable development of the national economy; - diversifying the primary energy resources basis; - transparency of electricity tariffs, prices and taxes; - creating the security stocks of needed fuels for electricity and heat co-generation; - ensuring the interconnected operation of the NPS with the energy systems in the neighboring countries and with the ones in the UCTE; - promoting the use of renewable energy sources. Among the novelties brought by this Law by the definitions given to the terms used it is worth mentioning: - Access to the public electricity network; - Energy capacity; - Passageway of the electric line; - Natural monopoly in the energy field; - Electricity market operator; - Distribution system operator; - Transmission system operator; -Merit order (i.e the order in which an electricity producer is taken into consideration according to the price offered to cover the NPS electricity demand); - Electricity market; - Rehabilitation

The Karlsruhe Neutron Transmission Experiment (KANT): Spherical shell transmission measurements with 14 MeV neutrons on beryllium

International Nuclear Information System (INIS)

Moellendorff, U. von; Fischer, U.; Giese, H.; Kappler, F.; Tayama, R.; Wiegner, E.; Klein, H.; Alevra, A.

1996-01-01

This is a set of viewgraphs (no additional text) of a presentation on spherical shell transmission measurements with 14 MeV neutrons on beryllium; the cross for 9 Be(n,2n)2α for the energy range between threshold (1.85 MeV) and 20 MeV neutron energy is measured and the measurement is compared with the literature. Also, neutron leakage multiplication in spherical Be shells with various thicknesses are presented. Figs, tabs

Benchmarking European Gas Transmission System Operators

DEFF Research Database (Denmark)

Agrell, Per J.; Bogetoft, Peter; Trinkner, Urs

This is the final report for the pan-European efficiency benchmarking of gas transmission system operations commissioned by the Netherlands Authority for Consumers and Markets (ACM), Den Haag, on behalf of the Council of European Energy Regulators (CEER) under the supervision of the authors....

Intelligent Cooperative MAC Protocol for Balancing Energy Consumption

Science.gov (United States)

Wu, S.; Liu, K.; Huang, B.; Liu, F.

To extend the lifetime of wireless sensor networks, we proposed an intelligent balanced energy consumption cooperative MAC protocol (IBEC-CMAC) based on the multi-node cooperative transmission model. The protocol has priority to access high-quality channels for reducing energy consumption of each transmission. It can also balance the energy consumption among cooperative nodes by using high residual energy nodes instead of excessively consuming some node's energy. Simulation results show that IBEC-CMAC can obtain longer network lifetime and higher energy utilization than direct transmission.

Frequency division transmission imaging and synthetic aperture reconstruction

DEFF Research Database (Denmark)

Gran, Fredrik; Jensen, Jørgen Arendt

2006-01-01

In synthetic transmit aperture imaging only a few transducer elements are used in every transmission, which limits the signal-to-noise ratio (SNR). The penetration depth can be increased by using all transmitters in every transmission. In this paper, a method for exciting all transmitters in every...... corresponding to the excitation waveforms, the different transmitters can be decoded at the receiver. The matched filter of a specific waveform will allow information only from this waveform to pass through, thereby separating it from the other waveforms. This means that all transmitters can be used in every...... transmission, and the information from the different transmitters can be separated instantaneously. Compared to traditional synthetic transmit aperture (STA) imaging, in which the different transmitters are excited sequentially, more energy is transmitted in every transmission, and a better signal...

Guided transmission of highly charged ions through nanocapillaries in PET. Study of the energy dependencies

International Nuclear Information System (INIS)

Helhammer, R.; Pesic, Z.D.; Sobocinski, P.; Bundesmann, J.; Fink, D.; Stolterfoht, N.; Sulik, B.

2004-01-01

Full text: Recently we reported experiments in which slow highly charged ions are transmitted through nanocapillaries of 100nm diameter in an insulating PET foil of 10μm thickness [1]. The results of this work differ significantly from previous studies, which have been focused on capillaries in metals [2]. We measured the transmission of 3 keV Ne 7+ ions through the capillaries and focused the attention on ions whose charge has not changed during the passage through the capillary. The observation that the angular distribution for PET has a peak maximum whose position is equal to the tilt angle indicates a guiding of the Ne 7+ ion within the capillary. This guiding shows that the inner walls of the capillaries are charged up in a self-organizing process and collisions with the surface are finally prevented. We studied the time evolution of the capillary guiding as well as dependencies on the tilt angle [3]. Our most recent measurements were focussed on the investigation of the energy dependency for the guiding of Ne 7+ through capillaries. The measurements were done in an energy range from 2 keV up to 10 keV.We measured higher guiding efficiency for lower energies consistent with a previously developed model, which predicted an increase of the guiding efficiency with decreasing projectile energy [3]. In addition we found the effect of a narrower width of the angular distribution of transmitted ions. This effect is also well described by the model. However, further work is needed to explain the amount of charges to build up the deflection field at the end of the capillaries

Ten-year development plan for the GRTgaz transmission network 2015-2024 period

International Nuclear Information System (INIS)

2015-11-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. In accordance with the French Energy Code, GRTgaz publishes a 10-year development plan for its gas distribution network in France every year. This document is produced in line with European and French energy policies. It identifies the transport infrastructure that will need to be built over the next three years, and presents the main infrastructure that is likely to be developed within the next ten years. It incorporates the supply security obligations that TSOs are required to fulfil. It takes account of interested parties' needs and projects at the national, supranational and European levels. It is based on existing gas supply and demand and reasonable medium-term development forecasts for gas infrastructure, consumption and international trade

10-year development statement on GRTgaz's transmission system 2010-2019

International Nuclear Information System (INIS)

2010-10-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. In accordance with the French Energy Code, GRTgaz publishes a 10-year development plan for its gas distribution network in France every year. This document is produced in line with European and French energy policies. It identifies the transport infrastructure that will need to be built over the next three years, and presents the main infrastructure that is likely to be developed within the next ten years. It incorporates the supply security obligations that TSOs are required to fulfil. It takes account of interested parties' needs and projects at the national, supranational and European levels. It is based on existing gas supply and demand and reasonable medium-term development forecasts for gas infrastructure, consumption and international trade

Ten-year development plan for the GRTgaz transmission network 2016-2025 period

International Nuclear Information System (INIS)

2016-11-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. In accordance with the French Energy Code, GRTgaz publishes a 10-year development plan for its gas distribution network in France every year. This document is produced in line with European and French energy policies. It identifies the transport infrastructure that will need to be built over the next three years, and presents the main infrastructure that is likely to be developed within the next ten years. It incorporates the supply security obligations that TSOs are required to fulfil. It takes account of interested parties' needs and projects at the national, supranational and European levels. It is based on existing gas supply and demand and reasonable medium-term development forecasts for gas infrastructure, consumption and international trade

Ten-Year Development Plan for the GRTgaz Transmission Network 2011-2020 Period

International Nuclear Information System (INIS)

2011-10-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. In accordance with the French Energy Code, GRTgaz publishes a 10-year development plan for its gas distribution network in France every year. This document is produced in line with European and French energy policies. It identifies the transport infrastructure that will need to be built over the next three years, and presents the main infrastructure that is likely to be developed within the next ten years. It incorporates the supply security obligations that TSOs are required to fulfil. It takes account of interested parties' needs and projects at the national, supranational and European levels. It is based on existing gas supply and demand and reasonable medium-term development forecasts for gas infrastructure, consumption and international trade

Attenuation correction using simultaneous emission - transmission tomography

International Nuclear Information System (INIS)

Ljubenov, V.; Marinkovic, P.

1998-01-01

In order to reduce degrading influence of attenuation on SPECT image quality, possibility for correction, based on simultaneous emission / transmission measurements, is discussed. Numerical photon transport simulations through the phantom and acquisition of of tomographic projections are performed by using Monte Carlo code MCNP-4A. Amount of contamination in transmission data due to photon Compton scattering for emission energy window is specially analyzed and appropriate spatial depending 'noise / signal' factors for three different external sources, applied with Tc-99m, are determined (author)

Current issues and strategies for transmission planning

Energy Technology Data Exchange (ETDEWEB)

Isaacs, A.L. [Electranix, Winnipeg, MB (Canada); Rajapakse, A. [Manitoba Univ., Winnipeg, MB (Canada)

2008-07-01

Following the widespread deregulation of the electric power industry in the early 1990s, significant changes occurred in the regulatory and planning environments of the industry. Several regions of North America remain fully or partially regulated in the traditional sense including most Canadian provinces, except for Alberta and Ontario. Although the Mexican system has separate generation and transmission companies and current restructuring efforts are underway, all companies are state-owned, and private investment in energy is heavily constrained by the Mexican constitution. In these regulated regions, traditional generation and transmission expansion planning methods remain in use. This paper presented an overview of current trends in transmission planning strategies that have evolved in response to the restructuring of the power industry, and a conceptual framework of a procedure that would guide planners faced with the challenges of incorporating large scale wind generation in deregulated environments. The paper provided background information on the effect of deregulation on transmission planning. Planning strategies that were discussed included quantifying risk to help identify best alternatives; use of reference systems to estimate generator costs and reduce uncertainty; project based transmission expansion; transmission construction ahead of generation; and generation ahead of transmission. The impact of wind on transmission planning as well as future work addressing challenges posed by wind were also addressed. Research is continuing in this area to illustrate the concepts proposed through a detailed case study. 15 refs., 2 figs.

DTU international energy report 2013. Energy storage options for future sustainable energy systems

Energy Technology Data Exchange (ETDEWEB)

Hvidtfeldt Larsen, H.; Soenderberg Petersen, L. (eds.)

2013-11-01

One of the great challenges in the transition to a non-fossil energy system with a high share of fluctuating renewable energy sources such as solar and wind is to align consumption and production in an economically satisfactory manner. Energy storage could provide the necessary balancing power to make this possible. This energy report addresses energy storage from a broad perspective: It analyses smaller stores that can be used locally in for example heat storage in the individual home or vehicle, such as electric cars or hydrogen cars. The report also addresses decentralized storage as flywheels and batteries linked to decentralized energy systems. In addition it addresses large central storages as pumped hydro storage and compressed air energy storage and analyse this in connection with international transmission and trading over long distances. The report addresses electrical storage, thermal storage and other forms of energy storage, for example conversion of biomass to liquid fuel and conversion of solar energy directly into hydrogen, as well as storage in transmission, grid storage etc. Finally, the report covers research, innovation and the future prospects and addresses the societal challenges and benefits of the use of energy storage. (Author)

R-matrix analysis of 235U neutron transmission and cross sections in the energy range 0 to 2.25 keV

International Nuclear Information System (INIS)

Leal, L.C.; Derrien, H.; Larson, N.M.; Wright, R.Q.

1997-11-01

This document describes a new R-matrix analysis of 235 U cross section data in the energy range from 0 to 2,250 eV. The analysis was performed with the computer code SAMMY, that has recently been updated to permit, for the first time, inclusion of both differential and integral data within the analysis process. Fourteen differential data sets and six integral quantities were used in this evaluation: two measurements of fission plus capture, one of fission plus absorption, six of fission alone, two of transmission, and one of eta, plus standard values of thermal cross sections for fission, capture, and scattering, and of K1 and the Westcott g-factors for both fission and absorption. An excellent representation was obtained for the high-resolution transmission, fission, and capture cross-section data as well as for the integral quantities. The result is a single set of resonance parameters spanning the entire range up to 2,250 eV, a decided improvement over the present ENDF/VI evaluation, in which eleven discrete resonance parameter sets are required to cover that same energy range. This new evaluation is expected to greatly improve predictability of the criticality safety margins for nuclear systems in which 235 U is present

Energy-efficient wireless mesh infrastructures

OpenAIRE

Al-Hazmi, Y.; de Meer, Hermann; Hummel, Karin Anna; Meyer, Harald; Meo, Michela; Remondo Bueno, David

2011-01-01

The Internet comprises access segments with wired and wireless technologies. In the future, we can expect wireless mesh infrastructures (WMIs) to proliferate in this context. Due to the relatively low energy efficiency of wireless transmission, as compared to wired transmission, energy consumption of WMIs can represent a significant part of the energy consumption of the Internet as a whole. We explore different approaches to reduce energy consumption in WMIs, taking into accoun...

Grounding modelling for transient overvoltage simulation in electric power transmission

International Nuclear Information System (INIS)

Moreno O, German; Valencia V, Jaime A; Villada, Fernando

1992-01-01

Grounding plays an important role in transmission line outages and consequently on electric energy transmission quality indexes. Fundamentals of an accurate modelling for transient behaviour analysis, particularly for the response of transmission lines to lightning, are presented. Also, a method to take into account the electromagnetic propagation guided by the grounding electrodes and finally to assess the grounding impedance in order to simulate the transmission line behaviour under lightning is presented. Analysis of impedance behaviour for diverse configurations and simulation results of over voltages on a real 220 kV line are presented to illustrate the capabilities of the method and of the computational program developed

Incentives for an adequate, economic and reliable Swiss transmission grid. Final version

International Nuclear Information System (INIS)

Twomey, P.; Neuhoff, K.; Newbery, D.

2006-11-01

This comprehensive final report for the Swiss Federal Office of Energy (SFOE) discusses incentives necessary for the implementation of an adequate, economic and reliable Swiss electricity transmission grid. As Switzerland moves towards a more liberalised and competitive electricity market, an essential task of policy makers will be to ensure that incentives are in place for the construction, maintenance and operation of adequate, economic and reliable transmission infrastructure. As well as continuing to serve the domestic market, the location of Switzerland at the centre of Europe also means that policy should embrace opportunities in servicing the developing European Internal Market by providing transit and other services. Topics discussed include the economic evaluation of transmission investment proposals, regulated transmission investment, investments in transmission lines by power merchants, power auctions and congestion management as well as inter-TSO compensation mechanisms. European regulations and practice are discussed as are access questions and transmission charges. Developments in interconnection management and harmonisation are examined. The particular characteristics of the Swiss energy system, its prices and its legal frameworks are discussed. Cross-border trading and security of supply are also discussed

Incentives for an adequate, economic and reliable Swiss transmission grid. Final version

Energy Technology Data Exchange (ETDEWEB)

Twomey, P.; Neuhoff, K.; Newbery, D.

2006-11-15

This comprehensive final report for the Swiss Federal Office of Energy (SFOE) discusses incentives necessary for the implementation of an adequate, economic and reliable Swiss electricity transmission grid. As Switzerland moves towards a more liberalised and competitive electricity market, an essential task of policy makers will be to ensure that incentives are in place for the construction, maintenance and operation of adequate, economic and reliable transmission infrastructure. As well as continuing to serve the domestic market, the location of Switzerland at the centre of Europe also means that policy should embrace opportunities in servicing the developing European Internal Market by providing transit and other services. Topics discussed include the economic evaluation of transmission investment proposals, regulated transmission investment, investments in transmission lines by power merchants, power auctions and congestion management as well as inter-TSO compensation mechanisms. European regulations and practice are discussed as are access questions and transmission charges. Developments in interconnection management and harmonisation are examined. The particular characteristics of the Swiss energy system, its prices and its legal frameworks are discussed. Cross-border trading and security of supply are also discussed

Performance analysis of a model-sized superconducting DC transmission system based VSC-HVDC transmission technologies using RTDS

International Nuclear Information System (INIS)

Dinh, Minh-Chau; Ju, Chang-Hyeon; Kim, Sung-Kyu; Kim, Jin-Geun; Park, Minwon; Yu, In-Keun

2012-01-01

The combination of a high temperature superconducting DC power cable and a voltage source converter based HVDC (VSC-HVDC) creates a new option for transmitting power with multiple collection and distribution points for long distance and bulk power transmissions. It offers some greater advantages compared with HVAC or conventional HVDC transmission systems, and it is well suited for the grid integration of renewable energy sources in existing distribution or transmission systems. For this reason, a superconducting DC transmission system based HVDC transmission technologies is planned to be set up in the Jeju power system, Korea. Before applying this system to a real power system on Jeju Island, system analysis should be performed through a real time test. In this paper, a model-sized superconducting VSC-HVDC system, which consists of a small model-sized VSC-HVDC connected to a 2 m YBCO HTS DC model cable, is implemented. The authors have performed the real-time simulation method that incorporates the model-sized superconducting VSC-HVDC system into the simulated Jeju power system using Real Time Digital Simulator (RTDS). The performance analysis of the superconducting VSC-HVDC systems has been verified by the proposed test platform and the results were discussed in detail.

Performance analysis of a model-sized superconducting DC transmission system based VSC-HVDC transmission technologies using RTDS

Energy Technology Data Exchange (ETDEWEB)

Dinh, Minh-Chau, E-mail: thanchau7787@gmail.com [Changwon National University, 9 Sarim-Dong, Changwon 641-733 (Korea, Republic of); Ju, Chang-Hyeon; Kim, Sung-Kyu; Kim, Jin-Geun; Park, Minwon [Changwon National University, 9 Sarim-Dong, Changwon 641-733 (Korea, Republic of); Yu, In-Keun, E-mail: yuik@changwon.ac.kr [Changwon National University, 9 Sarim-Dong, Changwon 641-733 (Korea, Republic of)

2012-08-15

The combination of a high temperature superconducting DC power cable and a voltage source converter based HVDC (VSC-HVDC) creates a new option for transmitting power with multiple collection and distribution points for long distance and bulk power transmissions. It offers some greater advantages compared with HVAC or conventional HVDC transmission systems, and it is well suited for the grid integration of renewable energy sources in existing distribution or transmission systems. For this reason, a superconducting DC transmission system based HVDC transmission technologies is planned to be set up in the Jeju power system, Korea. Before applying this system to a real power system on Jeju Island, system analysis should be performed through a real time test. In this paper, a model-sized superconducting VSC-HVDC system, which consists of a small model-sized VSC-HVDC connected to a 2 m YBCO HTS DC model cable, is implemented. The authors have performed the real-time simulation method that incorporates the model-sized superconducting VSC-HVDC system into the simulated Jeju power system using Real Time Digital Simulator (RTDS). The performance analysis of the superconducting VSC-HVDC systems has been verified by the proposed test platform and the results were discussed in detail.

New transmission planning methodology for requesting proposals for wind generation

Science.gov (United States)

Isaacs, Andrew L.

The increasing interest in renewable energy technologies during the last decade has caused conventional transmission and generation expansion planning methodologies to be strained and in some cases abandoned. This is due both to the quantity of generator interconnection requests and the constraints imposed by deregulated energy industry structures. One technique used to control the influx of renewable generation while maintaining competitive principles is a Request for Proposals (RFP). However, lack of transmission planning due to a disconnection between generation and transmission owners, difficulty in identifying viable projects, and high risk for proponents stand as obstacles to the goals of an RFP. This research proposes a procedure which minimizes the effect of these obstacles; meeting the purchaser requirements for low price and combining conventional planning concepts with feedback from competitive structures. The general features of the method include definition of generation limits and study area, expansion plan design, transmission cost evaluation, optimal selection of requested generation levels, and final selection of successful proponents. The method is shown to be effective in creating an RFP where proponents are well-informed and provided with cost certainty to reduce bid price, buyers are able to determine end costs of their energy, and good expansion planning principles are maintained. A case study using a real system in New Mexico demonstrates these concepts.

Wireless transmission of power

International Nuclear Information System (INIS)

Grotz, T.

1991-01-01

This paper reports that it has been proven by researchers that electrical energy can be propagated around the world between the surface of the Earth and the ionosphere at extremely low frequencies in what is known as the Schumann Cavity. Experiments to data have shown that electromagnetic waves with frequencies in the range of 8 Hz, the fundamental Schumann Resonance frequency, propagate with litter attenuation around the planet within the Schumann Cavity. It is the intent of this research to determine if the Schumann Cavity can be resonated, if the power that is delivered to the cavity propagated with very low losses, and if power can be extracted at other locations within the cavity. Experimental data collected and calculations made in recent years support the hypothesis that wireless power transmission is a viable and practical alternative to the present systems of power transmission

Technical and economic aspects of the transmission of energy at extra high voltages

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1967-01-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

Flux Cloning in Josephson Transmission Lines

International Nuclear Information System (INIS)

Gulevich, D.R.; Kusmartsev, F.V.

2006-01-01

We describe a novel effect related to the controlled birth of a single Josephson vortex. In this phenomenon, the vortex is created in a Josephson transmission line at a T-shaped junction. The 'baby' vortex arises at the moment when a 'mother' vortex propagating in the adjacent transmission line passes the T-shaped junction. In order to give birth to a new vortex, the mother vortex must have enough kinetic energy. Its motion can also be supported by an externally applied driving current. We determine the critical velocity and the critical driving current for the creation of the baby vortices and briefly discuss the potential applications of the found effect

Smart Transmission Grids - Benefits and Risks

Directory of Open Access Journals (Sweden)

Velasco-Ramírez E.

2013-01-01

Full Text Available Nowadays the Power Systems are working near their stability limits, for this reason it is necessary and essential a transition to new transmission systems that ensure efficient delivery of electrical energy, with the objective to prevent “blackouts” that causesignificant losses in the economy of any country in the world. This paper analyzes important elements to consider having a healthy and efficient transition from a power grid vertically integrated into a smart transmission grid. A comparative analysis in the model, development, benefits and risks of the implementation of these systems, between two of the main marc of references of smart grids, the EU and the USA is presented.

77 FR 22773 - Texas Eastern Transmission, L.P.; Notice of Response

Science.gov (United States)

2012-04-17

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [ Docket No. RP12-318-001] Texas Eastern... order of the Federal Energy Regulatory Commission in the above- captioned proceeding Texas Eastern Transmission, LP (Texas Eastern) submits its response to show cause why it should not be required to file...

CHANDRA HIGH-ENERGY TRANSMISSION GRATING SPECTRUM OF AE AQUARII

International Nuclear Information System (INIS)

Mauche, Christopher W.

2009-01-01

The nova-like cataclysmic binary AE Aqr, which is currently understood to be a former supersoft X-ray binary and current magnetic propeller, was observed for over two binary orbits (78 ks) in 2005 August with the High-Energy Transmission Grating (HETG) on board the Chandra X-ray Observatory. The long, uninterrupted Chandra observation provides a wealth of details concerning the X-ray emission of AE Aqr, many of which are new and unique to the HETG. First, the X-ray spectrum is that of an optically thin multi-temperature thermal plasma; the X-ray emission lines are broad, with widths that increase with the line energy from σ ∼ 1 eV (510 km s -1 ) for O VIII to σ ∼ 5.5 eV (820 km s -1 ) for Si XIV; the X-ray spectrum is reasonably well fit by a plasma model with a Gaussian emission measure distribution that peaks at log T(K) = 7.16, has a width σ = 0.48, an Fe abundance equal to 0.44 times solar, and other metal (primarily Ne, Mg, and Si) abundances equal to 0.76 times solar; and for a distance d = 100 pc, the total emission measure EM = 8.0 x 10 53 cm -3 and the 0.5-10 keV luminosity L X = 1.1 x 10 31 erg s -1 . Second, based on the f/(i + r) flux ratios of the forbidden (f), intercombination (i), and recombination (r) lines of the Heα triplets of N VI, O VII, and Ne IX measured by Itoh et al. in the XMM-Newton Reflection Grating Spectrometer spectrum and those of O VII, Ne IX, Mg XI, and Si XIII in the Chandra HETG spectrum, either the electron density of the plasma increases with temperature by over three orders of magnitude, from n e ∼ 6 x 10 10 cm -3 for N VI [log T(K) ∼ 6] to n e ∼ 1 x 10 14 cm -3 for Si XIII [log T(K) ∼ 7], and/or the plasma is significantly affected by photoexcitation. Third, the radial velocity of the X-ray emission lines varies on the white dwarf spin phase, with two oscillations per spin cycle and an amplitude K ∼ 160 km s -1 . These results appear to be inconsistent with the recent models of Itoh et al., Ikhsanov, and

Regional Transmission Planning: A review of practices following FERC Order Nos. 890 and 1000

Energy Technology Data Exchange (ETDEWEB)

Eto, Joseph H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Gallo, Guilia [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2017-11-15

Federal Energy Regulatory Commission (FERC) Order Nos. 890 and 10001 established requirements that transmission planning regions must follow in regional transmission planning and allocating the costs of new transmission facilities. Order No. 890, issued in 2007, outlined general requirements for local as well as regional transmission planning practices and procedures. Order No. 1000, issued in 2011, laid out specific requirements for: (1) regional transmission planning; (2) consideration of transmission needs driven by public policy requirements; (3) non-incumbent transmission development; (4) interregional transmission coordination; and (5) cost allocation for transmission facilities that have been selected in a regional transmission plan for purposes of cost allocation. This report reviews how these FERC orders are being implemented by the 12 transmission planning regions recognized by FERC.

Simple and efficient way of speeding up transmission calculations with k-point sampling

DEFF Research Database (Denmark)

Falkenberg, Jesper Toft; Brandbyge, Mads

2015-01-01

The transmissions as functions of energy are central for electron or phonon transport in the Landauer transport picture. We suggest a simple and computationally "cheap" post-processing scheme to interpolate transmission functions over k-points to get smooth well-converged average transmission...

Transmission : roadway to a competitive electricity market

Energy Technology Data Exchange (ETDEWEB)

Thon, S. [AltaLink L.P., AB (Canada)

2002-07-01

Having a variety of suppliers, marketers and retailers is the key to developing a successful electricity market which is more competitive on pricing, with less price volatility, more innovative customer products and higher levels of customer services. Some areas of Alberta are developing their own power markets with limited capacity to interact. These include Pincher Creek, Empress, Calgary, Edmonton, and Fort McMurray. It was noted that increasing transmission capacity is the key to ensuring a bigger and more competitive electricity market. Transmission constraints only encourage a small number of suppliers to control the market. The current cost of transmission capacity accounts for less than 5 per cent of an average residential customer's bill, but it plays a major role in providing more choice to competitive electricity suppliers. Developing more transmission capacity will create an even more competitive market that benefits both consumers and suppliers. Prices in Alberta have been very volatile in the past couple of years because of supply and demand issues, and there is a need to increase market liquidity. Alberta's Transmission Administrator is looking to expand the transmission network to alleviate constraints and to lower the cost of power generation, regardless of location. These expansions are not expected to affect customers' bills by more than 2 to 3 per cent. Such transmission concerns are being felt all over North America. The Federal Energy Regulatory Commission (FERC) in the United States also recognizes the link between transmission and creating a competitive electricity market.

Energy consumption and information transmission in model neurons

International Nuclear Information System (INIS)

Torrealdea, Francisco J.; Sarasola, Cecilia; D'Anjou, Alicia

2009-01-01

This work deals with the problem of whether biological computation optimizes energy use in the way neurons communicate. By assigning an electrical energy function to a Hindmarsh-Rose neuron we are able to find its average energy consumption when it reacts to incoming signals sent by another neuron coupled to it by an electrical synapse. We find that there are values of the coupling strength at which the ratio of mutual information to energy consumption is maximum and, therefore, communicating at these coupling values would be energetically the most efficient option.

Energy consumption and information transmission in model neurons

Energy Technology Data Exchange (ETDEWEB)

Torrealdea, Francisco J. [Department of Computer Science, University of the Basque Country, 20018 San Sebastian (Spain)], E-mail: francisco.torrealdea@ehu.es; Sarasola, Cecilia [Department of Physics of Materials, University of the Basque Country, 20018 San Sebastian (Spain); D' Anjou, Alicia [Department of Computer Science, University of the Basque Country, 20018 San Sebastian (Spain)

2009-04-15

This work deals with the problem of whether biological computation optimizes energy use in the way neurons communicate. By assigning an electrical energy function to a Hindmarsh-Rose neuron we are able to find its average energy consumption when it reacts to incoming signals sent by another neuron coupled to it by an electrical synapse. We find that there are values of the coupling strength at which the ratio of mutual information to energy consumption is maximum and, therefore, communicating at these coupling values would be energetically the most efficient option.

Transmission of Er:YAG laser through different dental ceramics.

Science.gov (United States)

Sari, Tugrul; Tuncel, Ilkin; Usumez, Aslihan; Gutknecht, Norbert

2014-01-01

The aim of this study was to determine the erbium-doped yttrium aluminum garnet (Er:YAG) laser transmission ratio through different dental ceramics with different thicknesses. Laser debonding procedure of adhesively luted all-ceramic restorations is based on the transmission of laser energy through the ceramic and the ablation of resin cement, because of the transmitted laser energy. Five different dental ceramics were evaluated in this study: sintered zirconium-oxide core ceramic, monolithic zirconium-oxide ceramic, feldspathic ceramic, leucite-reinforced glass ceramic, and lithium disilicate-reinforced glass ceramic. Two ceramic discs with different thicknesses (0.5 and 1 mm) were fabricated for each group. Ceramic discs were placed between the sensor membrane of the laser power meter and the tip of the contact handpiece of an Er:YAG laser device with the aid of a custom- made acrylic holder. The transmission ratio of Er:YAG laser energy (500 mJ, 2 Hz, 1 W, 1000 μs) through different ceramic discs was measured with the power meter. Ten measurements were made for each group and the results were analyzed with two way analysis of variance (ANOVA) and Tukey honestly significant difference (HSD) tests. The highest transmission ratio was determined for lithium disilicate-reinforced ceramic with 0.5 mm thickness (88%) and the lowest was determined for feldspathic ceramic with 1 mm thickness (44%). The differences among the different ceramics and between the different thicknesses were significant (pCeramic type and thickness should be taken into consideration to adjust the laser irradiation parameters during laser debonding of adhesively luted all-ceramic restorations.

Design of synchromesh mechanism to optimization manual transmission's electric vehicle

Science.gov (United States)

Zainuri, Fuad; Sumarsono, Danardono A.; Adhitya, Muhammad; Siregar, Rolan

2017-03-01

Significant research has been attempted on a vehicle that lead to the development of transmission that can reduce energy consumption and improve vehicle efficiency. Consumers also expect safety, convenience, and competitive prices. Automatic transmission (AT), continuously variable transmission (CVT), and dual clutch transmission (DCT) is the latest transmission developed for road vehicle. From literature reviews that have been done that this transmission is less effective on electric cars which use batteries as a power source compared to type manual transmission, this is due to the large power losses when making gear changes. Zeroshift system is the transmission can do shift gears with no time (zero time). It was developed for the automatic manual transmission, and this transmission has been used on racing vehicles to eliminate deceleration when gear shift. Zeroshift transmission still use the clutch to change gear in which electromechanical be used to replace the clutch pedal. Therefore, the transmission is too complex for the transmission of electric vehicles, but its mechanism is considered very suitable to increase the transmission efficiency. From this idea, a new innovation design transmission will be created to electric car. The combination synchromesh with zeroshift mechanism for the manual transmission is a transmission that is ideal for improving the transmission efficiency. Installation synchromesh on zeroshift mechanism is expected to replace the function of the clutch MT, and assisted with the motor torque setting when to change gear. Additionally to consider is the weight of the transmission, ease of manufacturing, ease of installation with an electric motor, as well as ease of use by drivers is a matter that must be done to obtain a new transmission system that is suitable for electric cars.

Transmission of power at high voltages

Energy Technology Data Exchange (ETDEWEB)

Lane, F J

1963-01-01

High voltage transmission is considered to be concerned with circuits and systems operating at or above 132 kV. While the general examination is concerned with ac transmission, dc systems are also included. The choice of voltage for a system will usually involve hazardous assessments of the future requirements of industry, commerce and a changing population. Experience suggests that, if the estimated economic difference between two voltages is not significant, there is good reason to choose the higher voltage, as this will make the better provision for unexpected future expansion. Two principal functions served by transmission circuits in a supply system are: (a) the transportation of energy in bulk from the generator to the reception point in the distribution system; and (b) the interconnection and integration of the generating plant and associated loads. These functions are considered and various types of system are discussed in terms of practicability, viability, quality and continuity of supply. Future developments requiring transmission voltages up to 750 kV will raise many problems which are in the main empirical. Examples are given of the type of problem envisaged and it is suggested that these can only be partially solved by theory and model operation.

Structural defects in multiferroic BiMnO3 studied by transmission electron microscopy and electron energy-loss spectroscopy

International Nuclear Information System (INIS)

Yang, H.; Chi, Z. H.; Yao, L. D.; Zhang, W.; Li, F. Y.; Jin, C. Q.; Yu, R. C.

2006-01-01

The multiferroic material BiMnO 3 synthesized under high pressure has been systematically studied by transmission electron microscopy and electron energy-loss spectroscopy, and some important structural defects are revealed in this multiferroic material. The frequently observed defects are characterized to be Σ3(111) twin boundaries, Ruddlesden-Popper [Acta Crystallogr. 11, 54 (1958)] antiphase boundaries, and a p p superdislocations connected with a small segment of Ruddlesden-Popper defect. These defects are present initially in the as-synthesized sample. In addition, we find that ordered voids (oxygen vacancies) are easily introduced into the multiferroic BiMnO 3 by electron-beam irradiation

Transmission service charges: cost allocation and rate design

International Nuclear Information System (INIS)

Poray, A. T.

2000-01-01

The application of the Ontario Hydro Networks Company (OHNC) to the Ontario Energy Board to seek approval for cost allocation and rate design methodology to recover revenue requirements for the provision of transmission services in Ontario are summarized. Insights that led to the arguments made in support of the application are also described. The paper contains an overview of plans for the operation of the transmission system, the agreement between Ontario Hydro Services Company (OHSC) and the Independent Market Operator (IMO), the stakeholder consultation process by OHNC to develop the transmission cost allocation and rate design methodology, a discussion of the major rate design issues, a summary of stakeholder opinions and a summary of OHNC's final proposal for transmission pricing. Public hearings on the OHNC application were held between February 16 and March 20, 2000. Final decision by the OEB is expected sometime in May 2000

Transmissions in vehicles 2010

Energy Technology Data Exchange (ETDEWEB)

NONE

2010-07-01

Within the international VDI congress 'Gears in vehicles 2010' of the VDI Wissensforum GmbH (Duesseldorf, Federal Republic of Germany) between 22nd and 23rd June, 2010, in Friedrichshafen (Federal Republic of Germany), the following lectures were held: (1) 8HP70H - The moldhybrid transmission from ZF - Cjallenges and achievements (P. Gutmann); (2) GETRAG boosted range extender - A highly flexible electric powertrain for maximum CO{sub 2} reduction (S. Huepkes); (3) E-Transmission between full-hybrid and E-drive (P. Tenberge); (4) Reducing NO{sub x} and particulate emissions in electrified drivelines (R. Kuberczyk); (5) Simulation aided HEV and EV development: from the component to the whole powertrain (A. Gacometti); (6) Investigations on operating behaviour of the optimized CVT hybrid driveline (B.-R. Hoehn); (7) Customer-oriented dimensioning of electrified drivetrains (M. Eghtessad); (8) Decentralized optimal control strategy for parallel hybrid electric vehicles (A. Frenkel); (9) The new generation 6-speed automatic transmission AF40 (G. Bednarek); (10) Customized mechatronic solutions for integrated transmission control units (M. Wieczorek); (11) The optimal automatic transmission for front-transverse applications - Planetary transmissions or dual clutch transmissions? (G. Gumpoltsberger); (12) The new shift-by-wire gearshift lever for the Audi A8 - Requirements and concept (T. Guttenbergere); (13) The new shift-by-wire gearshift lever for the Audi A8 - Realization (A. Giefer); (14) Fuel-efficient transmissions of the future: Calculation of the efficiency factor for vehicle transmissions (B. Volpert); (15) HT-ACM: A new polymer generation for static and dynamic gearbox sealing solutions (E. Osen); (16) 'Energy efficiency equipped solutions by SKF' for power train applications - A contribution to CO{sub 2} - emission reduction and sustainability (T. Bobke); (17) 6-Ratio planetary shift transmission controlled by 4 external brakes, and design

Improvement of air transport data and wall transmission/reflection data in the SKYSHINE code. 2. Calculation of gamma-ray wall transmission and reflection data

Energy Technology Data Exchange (ETDEWEB)

Hayashida, Yoshihisa [Toshiba Corp., Kawasaki, Kanagawa (Japan); Ishikawa, Satoshi; Harima, Yoshiko [CRC Research Institute Inc., Tokyo (Japan); Hayashi, Katsumi; Tayama, Ryuichi [Hitachi Engineering Co. Ltd., Ibaraki (Japan); Hirayama, Hideo [High Energy Accelerator Research Organization, Tsukuba, Ibaraki (Japan); Sakamoto, Yukio [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Makoto [Visible Information Center, Tokai, Ibaraki (Japan); Sato, Osamu [Mitsubishi Research Inst., Inc., Tokyo (Japan)

2000-03-01

Transmission and reflection data of concrete and steel for 6.2 MeV gamma-ray in the SKYSHINE code have been generated using up-to-date data and method with a view to improving an accuracy of results. The transmission and reflection data depend on energy and angle. The invariant embedding method, which has merits of producing no negative angular flux and of taking small computer time, is suitable and adopted to the present purpose. Transmission data were calculated for concrete of 12 {approx} 160 cm thick and steel of 4 {approx} 39 cm thick based on the PHOTX library. Reflection data were calculated for semi-infinite slabs of concrete and steel. Consequently, smooth and consistent differential data over whole angle and energy were obtained compared with the original data calculated by discrete ordinates Sn code and Monte Carlo code. In order to use these data in the SKYSHINE code, further verification is needed using various calculation method or experimental data. (author)

BC Hydro's transmission business : transition to a competitive marketplace

International Nuclear Information System (INIS)

Threlkeld, R.J.

1998-01-01

Progress made by BC Hydro to facilitate the use of the transmission system for wholesale electricity transactions, including the separation of the system operation function from generation and merchant functions, was discussed. BC Hydro, Canada's third largest electric utility, was the first Canadian utility to offer open access to its transmission system for wholesale transactions. The utility has an installed generating capacity of about 10.8 gigawatts, 90 per cent of which is hydroelectric. The remainder is thermal, gas turbine and stationary and mobile diesel generation. The key element in establishing wholesale transmission transactions was the FERC-mandated open access same-time information system (OASIS) on which BC Hydro posts available transmission capacity, planned outages and pricing. The system operates on BC Hydro's internet node and interfaces to a Transmission Scheduling System (TSS). The TSS was developed in-house to handle the increased complexity of scheduling multiple energy and capacity transactions for users of the transmission system. Operation of the system and the challenge to constantly improve it were discussed

Performance Limits of Communication with Energy Harvesting

KAUST Repository

Znaidi, Mohamed Ridha

2016-01-01

In energy harvesting communications, the transmitters have to adapt transmission to the availability of energy harvested during communication. The performance of the transmission depends on the channel conditions which vary randomly due to mobility

Efficient utilization of wind power: Long-distance transmission or local consumption?

Institute of Scientific and Technical Information of China (English)

Yuanzhang SUN; Xiyuan MA; Jian XU; Yi BAO; Siyang LIAO

2017-01-01

Excess wind power produced in wind-intensive areas is normally delivered to remote load centers via long-distance transmission lines.This paper presents a comparison between long-distance transmission,which has gained popularity,and local energy consumption,in which a fraction of the generated wind power can be locally consumed by energy-intensive industries.First,the challenges and solutions to the long-distance transmission and local consumption of wind power are presented.Then,the two approaches to the utilization of wind power are compared in terms of system security,reliability,cost,and capability to utilize wind energy.Finally,the economic feasibility and technical feasibility of the local consumption of wind power are demonstrated by a large and isolated industrial power system,or supermicrogrid,in China.The coal-fired generators together with the shortterm interruptible electrolytic aluminum load in the supermicrogrid are able to compensate for the intermittency of wind power.In the long term,the transfer of highenergy-consumption industries to wind-rich areas and their local consumption of the available wind power are beneficial.

Analysis and dashboards on GRTgaz transmission activity - January-December 2014

International Nuclear Information System (INIS)

2015-01-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the monthly key figures of GRTgaz activity in 2014: Shipper markets, Consumer markets; Transported quantities (GRTgaz network inputs and outputs, Monthly allocated quantities at PIR and PITTM); Consumptions (Gross monthly consumptions and average temperature, Gross consumptions and daily temperatures, Gross and climate-corrected consumptions for the public distributions, Industrial customers: consumptions by sectors of activity); GRTgaz customers (Key figures); Up-stream capacities (Capacities reserved on the Network Interface Points (PIR) and N/S and S/N links, Daily delivery service, Secondary capacities' market) Down-stream capacities (Industrial customers, Public distributions); Wholesale markets PEG (Volumes exchanged and number of exchanges at PEGs, Average price P1 by zones)

Analysis and dashboards on GRTgaz transmission activity - January-December 2015

International Nuclear Information System (INIS)

2016-01-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the monthly key figures of GRTgaz activity in 2015: Shipper markets, Consumer markets; Transported quantities (GRTgaz network inputs and outputs, Monthly allocated quantities at PIR and PITTM); Consumptions (Gross monthly consumptions and average temperature, Gross consumptions and daily temperatures, Gross and climate-corrected consumptions for the public distributions, Industrial customers: consumptions by sectors of activity); GRTgaz customers (Key figures); Up-stream capacities (Capacities reserved on the Network Interface Points (PIR) and N/S and S/N links, Daily delivery service, Secondary capacities' market) Down-stream capacities (Industrial customers, Public distributions); Wholesale markets PEG (Volumes exchanged and number of exchanges at PEGs, Average price P1 by zones)

Analysis and dashboards on GRTgaz transmission activity - January-December 2013

International Nuclear Information System (INIS)

2014-01-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the monthly key figures of GRTgaz activity in 2013: Shipper markets, Consumer markets; Transported quantities (GRTgaz network inputs and outputs, Monthly allocated quantities at PIR and PITTM); Consumptions (Gross monthly consumptions and average temperature, Gross consumptions and daily temperatures, Gross and climate-corrected consumptions for the public distributions, Industrial customers: consumptions by sectors of activity); GRTgaz customers (Key figures); Up-stream capacities (Capacities reserved on the Network Interface Points (PIR) and N/S and S/N links, Daily delivery service, Secondary capacities' market) Down-stream capacities (Industrial customers, Public distributions); Wholesale markets PEG (Volumes exchanged and number of exchanges at PEGs, Average price P1 by zones)

Behaviours, transmissions, generations: why is energy efficiency not enough?

Energy Technology Data Exchange (ETDEWEB)

Garabuau-Moussaoui, Isabelle (Electricite de France, Research and Development (France))

2009-07-01

Energy use is nowadays a very important question, in the context of global warming and expensive prices of energy. 'Energy conservation' is a paradox: environmental awareness increases, but also energy demand. Sociological knowledge concerning energy uses and energy savings remains important to understand the possible evolutions of practices and values and thus the possible future energy policies. Can the 'consumer society' become a 'less energy-intensive' society? This paper proposes to innovate with a 'new' way to analyse behaviours and to help policy makers to break the walls of 'the behavioural complexity'. We argue that energy efficiency, energy-using products and activities are socially embedded. More specifically, they depend on the 'social age' of people (children, teenagers, young adults, parents, old age people) and on their generation (events, experiences that people did live). The demonstration is based on the analysis of several qualitative studies carried out in France, showing that the generational and social ages analysis could be very efficient and innovative to understand: How are information, policies and energy-efficient technologies understood and embodied by people according to their age and their 'life story'? What kind of 'energy-related material culture' have people, and how does it evolve during the life? In a context of increasing energy demand, is it possible to change the energy-intensive 'socio-technical' mainstream towards a more sustainable way of life? What are the best moments during life for a behavioural change towards a less energy intensive way of life? Can we count on the new generation, to be more aware and less 'energy-intensive'?

Comparing solar photovoltaic energy versus stretch of the lines on transmission: real case of lacking rural community without electric energy; Comparativo entre energia solar fotovoltaica versus extensao de rede, aplicado em caso concreto de uma comunidade carente e remota

Energy Technology Data Exchange (ETDEWEB)

Mesquita, Rafael Pimenta; Souza, Teofilo Miguel de; Gastaldi, Andre Fava [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Guaratingueta, SP (Brazil). Centro de Energias Renovaveis], e-mail: teofilo@feg.unesp.br

2004-07-01

In the work observed a lacking rural community and without electric energy. They were analyzed and compared two approaches of lead energy to this population: Photovoltaic energy and stretch of the lines of transmission from the concessionaire. It carried out himself a study about the photovoltaic system as well as electric kinds of batteries, controllers, panels photovoltaic and invertors. Had also a hoist about the costs of acquisition, installation and maintenance of the photovoltaic system and of the conventional system (stretch from the net from the concessionaire of energy). Finally compared the two systems regarding the costs. (author)

75 FR 81264 - Critical Path Transmission, LLC; Clear Power, LLC; v. California Independent System Operator, Inc...

Science.gov (United States)

2010-12-27

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. EL11-11-000] Critical Path Transmission, LLC; Clear Power, LLC; v. California Independent System Operator, Inc.; Notice of Complaint... and 306 of the Federal Power Act, 16 U.S.C. 824e and 825e (2006), Critical Path Transmission, LLC and...

Reducing Wind Curtailment through Transmission Expansion in a Wind Vision Future

Energy Technology Data Exchange (ETDEWEB)

Jorgensen, Jennie [National Renewable Energy Lab. (NREL), Golden, CO (United States); Mai, Trieu [National Renewable Energy Lab. (NREL), Golden, CO (United States); Brinkman, Greg [National Renewable Energy Lab. (NREL), Golden, CO (United States)

2017-01-01

The Department of Energy's 2015 Wind Vision study, which analyzed an ambitious scenario where wind power served 35% of U.S. electricity consumption in 2050, showed the potential for wind energy to provide substantial health, environmental, and economic benefits. Using a commercial unit commitment and economic dispatch model, we build on this research by assessing the hourly operational feasibility of a similar high wind future in the Western United States. Our detailed simulations found no hours of unmet load or reserve violations with more than 35% potential wind (and 12% potential solar) available on the system, which highlights the technical possibility of integrating large amounts of wind energy. However, absent significant changes to the western grid, we find that substantial wind curtailment could be an issue, as it could degrade the potential for wind power to reduce fuel costs and lowering the emission benefits. To assess the value of transmission to mitigate wind curtailment, we model a suite of transmission expansion scenarios. We find that wind curtailment could be reduced by approximately half under a scenario where new transmission is based only on proposed projects. This avoided wind curtailment could lower annual production costs and reduce carbon dioxide emissions substantially. Greater transmission expansion was found to yield further benefits, although the marginal benefits of these new lines were found to decline. Overall, these results suggest that power systems operation can be realized with more than 35% wind penetration, but that transmission expansion is likely to play a vital role.

Transmission electron microscope studies of extraterrestrial materials

Science.gov (United States)

Keller, Lindsay P.

1995-01-01

Transmission Electron Microscopy, X-Ray spectrometry and electron-energy-loss spectroscopy are used to analyse carbon in interplanetary dust particles. Optical micrographs are shown depicting cross sections of the dust particles embedded in sulphur. Selected-area electron diffraction patterns are shown. Transmission Electron Microscope specimens of lunar soil were prepared using two methods: ion-milling and ultramicrotomy. A combination of high resolution TEM imaging and electron diffraction is used to characterize the opaque assemblages. The opaque assemblages analyzed in this study are dominated by ilmenite with lesser rutile and spinel exsolutions, and traces of Fe metal.

77 FR 73646 - Essar Steel Minnesota, LLC v. Great Lakes Gas Transmission Limited Partnership; Notice of Complaint

Science.gov (United States)

2012-12-11

... Transmission Limited Partnership (Respondent), alleging that the Respondent has failed to comply with the... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. RP13-313-000] Essar Steel Minnesota, LLC v. Great Lakes Gas Transmission Limited Partnership; Notice of Complaint Take notice that on...

Design of electron wave filters in monolayer graphene by tunable transmission gap

OpenAIRE

Chen, Xi; Tao, Jia-Wei

2009-01-01

We have investigated the transmission in monolayer graphene barrier at nonzero angle of incidence. Taking the influence of parallel wave vector into account, the transmission as the function of incidence energy has a gap due to the evanescent waves in two cases of Klein tunneling and classical motion. The modulation of the transmission gap by the incidence angle, the height, and width of potential barrier may lead to potential applications in graphene-based electronic devices.

Probabilistic costing of transmission services

International Nuclear Information System (INIS)

Wijayatunga, P.D.C.

1992-01-01

Costing of transmission services of electrical utilities is required for transactions involving the transport of energy over a power network. The calculation of these costs based on Short Run Marginal Costing (SRMC) is preferred over other methods proposed in the literature due to its economic efficiency. In the research work discussed here, the concept of probabilistic costing of use-of-system based on SRMC which emerges as a consequence of the uncertainties in a power system is introduced using two different approaches. The first approach, based on the Monte Carlo method, generates a large number of possible system states by simulating random variables in the system using pseudo random number generators. A second approach to probabilistic use-of-system costing is proposed based on numerical convolution and multi-area representation of the transmission network. (UK)

Can the BestGrid Process Improve Stakeholder Involvement in Electricity Transmission Projects?

Directory of Open Access Journals (Sweden)

Nadejda Komendantova

2015-08-01

Full Text Available The European Union has set ambitious targets for deployment of renewable energy sources to reach goals of climate change mitigation and energy security policies. However, the current state of electricity transmission infrastructure is a major bottleneck for further scaling up of renewable energy in the EU. Several thousands of kilometers of new lines have to be constructed and upgraded to accommodate growing volumes of intermittent renewable electricity. In many countries, construction of electricity transmission projects has been delayed for several years due to concerns of local stakeholders. The innovative BESTGRID approach, reported here, brings together transmission system operators (TSOs and non-governmental organizations (NGOs to discuss and understand the nature of stakeholder concerns. This paper has three objectives: (1 to understand stakeholder concerns about the deployment of electricity transmission grids in four pilot projects according to five guiding principles: need, transparency, engagement, environment, and impacts on human health as well as benefits; (2 to understand how these principles can be addressed to provide a basis for better decision-making outcomes; and (3 to evaluate the BESTGRID process based on feedback received from stakeholders and the level of participation achieved according to the ladder of Arnstein. This paper goes beyond a discussion of “measures to mitigate opposition” to understand how dialogue between TSOs and the public—represented mainly by NGOs and policy-makers—might lead to a better decision-making process and more sustainable electricity transmission infrastructure deployment.

Study on frequency characteristics of wireless power transmission system based on magnetic coupling resonance

Science.gov (United States)

Liang, L. H.; Liu, Z. Z.; Hou, Y. J.; Zeng, H.; Yue, Z. K.; Cui, S.

2017-11-01

In order to study the frequency characteristics of the wireless energy transmission system based on the magnetic coupling resonance, a circuit model based on the magnetic coupling resonant wireless energy transmission system is established. The influence of the load on the frequency characteristics of the wireless power transmission system is analysed. The circuit coupling theory is used to derive the minimum load required to suppress frequency splitting. Simulation and experimental results verify that when the load size is lower than a certain value, the system will appear frequency splitting, increasing the load size can effectively suppress the frequency splitting phenomenon. The power regulation scheme of the wireless charging system based on magnetic coupling resonance is given. This study provides a theoretical basis for load selection and power regulation of wireless power transmission systems.

Proceedings of the North American transmission and distribution conference

Energy Technology Data Exchange (ETDEWEB)

NONE

2006-07-01

This conference profiled new transmission and distribution technologies and solutions designed for electric utility operators. Emerging trends in transmission and distribution systems were reviewed. New directions in energy management were discussed in relation to aging infrastructure and anticipated manpower shortages. Computerized control strategies were described, as well as recent advances in monitoring technologies. Issues related to alternative energy and grid interconnections were also discussed. The conference was divided into the following 6 sections, along with a special session for keynote presentations: (1) cybersecurity panel; (2) equipment and apparatus; (3) asset management and network technologies; (4) business solutions; (5) information technology; and (6) workforce panel. The conference featured 57 presentations, of which 13 have been indexed separately for inclusion in this database. refs., tabs., figs.

Proceedings of the North American transmission and distribution conference

International Nuclear Information System (INIS)

2006-01-01

This conference profiled new transmission and distribution technologies and solutions designed for electric utility operators. Emerging trends in transmission and distribution systems were reviewed. New directions in energy management were discussed in relation to aging infrastructure and anticipated manpower shortages. Computerized control strategies were described, as well as recent advances in monitoring technologies. Issues related to alternative energy and grid interconnections were also discussed. The conference was divided into the following 6 sections, along with a special session for keynote presentations: (1) cybersecurity panel; (2) equipment and apparatus; (3) asset management and network technologies; (4) business solutions; (5) information technology; and (6) workforce panel. The conference featured 57 presentations, of which 13 have been indexed separately for inclusion in this database. refs., tabs., figs

Improved cost–benefit analysis for market-based transmission planning, a European perspective

International Nuclear Information System (INIS)

Papaemmanouil, A.; Bertling Tjernberg, L.; Tuan, L.A.; Andersson, G.

2013-01-01

This paper addresses the problem of transmission planning in interconnected power systems under the uncertainty of future generation parks and fast varying marginal production costs. The decision maker has to consider many different aspects during the definition of different transmission planning strategies that sometimes might even be contradicting. Major contributions are the incorporation of energy policy measurements in the evaluation process of candidate transmission plans and the inclusion of short- and long-term uncertainties. The proposed methodology, so-called C-TRAP, is based on a semi-dynamic heuristic approach that solves the social welfare maximization problem for several discrete steps considering different preferences for energy policy and transmission network reinforcements. The flexibility provided through the heuristic analysis is very important for decision makers in the new uncertain environment in power systems. - Highlights: • Consideration of environmental policy in the decision of transmission expansion plans. • Semi-dynamic heuristic approach including societal, economic and availability standards. • Market-based approach using nodal pricing. • The amount of reduced unserved load is not equal to the amount of capacity increase of a line. • Less environmental costs lead usually to higher congestion costs due to overly power trading

Efficiency of Finish power transmission network companies

International Nuclear Information System (INIS)

Anon.

2001-01-01

The Finnish Energy Market Authority has investigated the efficiency of power transmissions network companies. The results show that the intensification potential of the branch is 402 million FIM, corresponding to about 15% of the total costs of the branch and 7.3 % of the turnout. Energy Market Authority supervises the reasonableness of the power transmission prices, and it will use the results of the research in supervision. The research was carried out by the Quantitative Methods Research Group of Helsinki School of Economics. The main objective of the research was to create an efficiency estimation method for electric power distribution network business used for Finnish conditions. Data of the year 1998 was used as basic material in the research. Twenty-one of the 102 power distribution network operators was estimated to be totally efficient. Highest possible efficiency rate was 100, and the average of the efficiency rates of all the operators was 76.9, the minimum being 42.6

Alberta's transmission development policy : review and recommendations

International Nuclear Information System (INIS)

Stubbings, R.V.

2004-01-01

Alberta's Department of Energy (ADOE) released a policy paper in November 2003 regarding power transmission development for the province. The transmission development policy (TDP) is intended to promote economic growth in Alberta while ensuring consumers with reliable, reasonably priced electricity. This presentation reviewed the main features of the policy and then focused on the allocation of costs to generation customers. The author argued that the proposed changes would result in a sub-optimal development of generation and higher total electricity bills for consumers. He argued that the policy will spare generation customers of any obligation to pay wire-related costs other than local interconnection costs. This would weaken a long-standing ADOE policy which requires generators to pay costs that depend on their location on the transmission system. With the new proposal, generators would not be responsible for ancillary service costs even when they provide direct benefits, and they would pay for system losses on a zonal basis. The author recommended that location charges should be large enough to influence the siting decisions of generators. He also recommended that generators should pay their fare share of transmission use-of-system charges, including ancillary services that provide benefits to generators in the form of a stable, reliable transmission system. 2 tabs., 2 figs

Characterisation of nano-structured titanium and aluminium nitride coatings by indentation, transmission electron microscopy and electron energy loss spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Girleanu, M., E-mail: maria.girleanu@uha.fr [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Pac, M.-J.; Louis, P. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Ersen, O.; Werckmann, J. [Departement Structures et Interfaces, IPCMS (UMR CNRS 7504), Universite de Strasbourg, 23 rue du Loess, F-67087 Strasbourg (France); Rousselot, C. [Departement Micro Nano Sciences et Systemes, FEMTO-ST (UMR CNRS 6174), Universite de Franche-Comte, BP 71427, F-25211 Montbeliard (France); Tuilier, M.-H. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France)

2011-07-01

Titanium and aluminium nitride Ti{sub 1-x}Al{sub x}N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti{sub 0.14}Al{sub 0.86}N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti{sub 0.14}Al{sub 0.86}N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.

Characterisation of nano-structured titanium and aluminium nitride coatings by indentation, transmission electron microscopy and electron energy loss spectroscopy

International Nuclear Information System (INIS)

Girleanu, M.; Pac, M.-J.; Louis, P.; Ersen, O.; Werckmann, J.; Rousselot, C.; Tuilier, M.-H.

2011-01-01

Titanium and aluminium nitride Ti 1-x Al x N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti 0.14 Al 0.86 N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti 0.14 Al 0.86 N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.

Transmission of climate risks across sectors and borders

Science.gov (United States)

Challinor, Andy J.; Adger, W. Neil; Benton, Tim G.; Conway, Declan; Joshi, Manoj; Frame, Dave

2018-06-01

Systemic climate risks, which result from the potential for cascading impacts through inter-related systems, pose particular challenges to risk assessment, especially when risks are transmitted across sectors and international boundaries. Most impacts of climate variability and change affect regions and jurisdictions in complex ways, and techniques for assessing this transmission of risk are still somewhat limited. Here, we begin to define new approaches to risk assessment that can account for transboundary and trans-sector risk transmission, by presenting: (i) a typology of risk transmission that distinguishes clearly the role of climate versus the role of the social and economic systems that distribute resources; (ii) a review of existing modelling, qualitative and systems-based methods of assessing risk and risk transmission; and (iii) case studies that examine risk transmission in human displacement, food, water and energy security. The case studies show that policies and institutions can attenuate risks significantly through cooperation that can be mutually beneficial to all parties. We conclude with some suggestions for assessment of complex risk transmission mechanisms: use of expert judgement; interactive scenario building; global systems science and big data; innovative use of climate and integrated assessment models; and methods to understand societal responses to climate risk. These approaches aim to inform both research and national-level risk assessment.

Modelling the geographic distribution of wind power and the impact on transmission needs

DEFF Research Database (Denmark)

Østergaard, Poul Alberg

2003-01-01

Through energy systems modelling, transmission systems modelling and geographical modelling, the article examines the sensitivity of the response of the transmission system to the geographic distributions of wind power and in particular the sensitivity of the results to the accuracy...... of the distributed modelled. The results show that accuracy of the geographic modelling while important for the analysis of specific single transmission lines is not important for the analysis of the general response of the transmission system. The analyses thus corroborate previous analyses that demonstrated...

New schemes for high-voltage pulsed generators based on stepped transmission lines

International Nuclear Information System (INIS)

Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.

1993-01-01

Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally

Survey of Transmission Cost Allocation Methodologies for Regional Transmission Organizations

Energy Technology Data Exchange (ETDEWEB)

Fink, S.; Porter, K.; Mudd, C.; Rogers, J.

2011-02-01

The report presents transmission cost allocation methodologies for reliability transmission projects, generation interconnection, and economic transmission projects for all Regional Transmission Organizations.

How coupling affects closely packed rectenna arrays used for wireless power transmission

Science.gov (United States)

Walls, Deidra; Choi, Sang H.; Yoon, Hargsoon; Geddis, Demetris; Song, Kyo D.

2017-04-01

The development of power transmission by microwave beam power harvesting attracts manufactures for use of wireless power transmission. Optimizing maximum conversion efficiency is affected by many design parameters, and has been mainly focused previously. Combining several rectennas in one array potentially aides in the amount of microwave energy that can be harvested for energy conversion. Closely packed rectenna arrays is the result of the demand to minimize size and weight for flexibility. This paper specifically focuses on the coupling effects on power; mutual coupling, comparing sparameters and gain total while varying effective parameters. This paper investigates how coupling between each dipole positively and negatively affects the microwave energy, harvesting, and the design limitations.

Vision of future energy networks - Final report; Vision of future energy networks - Schlussbericht

Energy Technology Data Exchange (ETDEWEB)

Froehlich, K.; Andersson, G.

2008-07-01

In the framework of the project 'Vision of Future Networks', models and methods have been developed that enable a greenfield approach for energy systems with multiple energy carriers. Applying a greenfield approach means that no existing infrastructure is taken into account when designing the energy system, i.e. the system is virtually put up on a green field. The developed models refer to the impacts of energy storage on power systems with stochastic generation, to the integrated modelling and optimization of multi-carrier energy systems, to reliability considerations of future energy systems as well as to possibilities of combined transmission of multiple energy carriers. Key concepts, which have been developed in the framework of this project, are the Energy Hub (for the conversion and storage of energy) and the Energy Interconnector (for energy transmission). By means of these concepts, it is possible to design structures for future energy systems being able to cope with the growing requirements regarding energy supply. (author)

76 FR 79206 - Commercial Renewable Energy Transmission on the Outer Continental Shelf (OCS) Offshore Mid...

Science.gov (United States)

2011-12-21

...-circuit, high-voltage direct current (HVDC) transmission line that would collect power generated by wind...-voltage alternating current into HVDC using voltage sourced converters. Each offshore converter platform... transmission grid at up to seven locations where AWC terrestrial converter stations would convert the HVDC...

Communication strategies for two models of discrete energy harvesting

DEFF Research Database (Denmark)

Trillingsgaard, Kasper Fløe; Popovski, Petar

2014-01-01

Energy harvesting is becoming a viable option for powering small wireless devices. Energy for data transmission is supplied by the nature, such that when a transmission is about to take place in an arbitrary instant, the amount of available energy is a random quantity. The arrived energy is stored...... in a battery and transmissions are interrupted if the battery runs out of energy. We address communication in slot-based energy harvesting systems, where the transmitter communicates with ON-OFF signaling: in each slot it can either choose to transmit (ON) or stay silent (OFF). Two different models...... strategies and compare the slot- with the frame-based model in the case of an errorless transmission channel. Additionally, for the slot-based model and channel with errors, we provide a new proof of the capacity achieved by the save-and-transmit scheme....

18 CFR 35.34 - Regional Transmission Organizations.

Science.gov (United States)

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Regional Transmission Organizations. 35.34 Section 35.34 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... accommodates the open architecture condition set forth in paragraph (l) of this section. (2) Market participant...

On Transmission Policies in Multihop Device-to-Device Communications with Network Coded Cooperation

DEFF Research Database (Denmark)

Hernandez, Nestor; Heide, Janus; Roetter, Daniel Enrique Lucani

2016-01-01

Ideal transmission policies are relevant nowadays to reduce energy consumption or increase throughput in mobile networks. In this work, we propose two recoding schemes with collision avoidance mechanism to reduce the number of transmission required to convey a batch of packets from a source...

Evaluation of the water equivalence of solid phantoms using gamma ray transmission measurements

International Nuclear Information System (INIS)

Hill, R.F.; Brown, S.; Baldock, C.

2008-01-01

Gamma ray transmission measurements have been used to evaluate the water equivalence of solid phantoms. Technetium-99m was used in narrow beam geometry and the transmission of photons measured, using a gamma camera, through varying thickness of the solid phantom material and water. Measured transmission values were compared with Monte Carlo calculated transmission data using the EGSnrc Monte Carlo code to score fluence in a geometry similar to that of the measurements. The results indicate that the RMI457 Solid Water, CMNC Plastic Water and PTW RW3 solid phantoms had similar transmission values as compared to water to within ±1.5%. However, Perspex had a greater deviation in the transmission values up to ±4%. The agreement between the measured and EGSnrc calculated transmission values agreed to within ±1% over the range of phantom thickness studied. The linear attenuation coefficients at the gamma ray energy of 140.5 keV were determined from the measured and EGSnrc calculated transmission data and compared with predicted values derived from data provided by the National Institute of Standards and Technology (NIST) using the XCOM program. The coefficients derived from the measured data were up to 6% lower than those predicted by the XCOM program, while the coefficients determined from the Monte Carlo calculations were between measured and XCOM values. The results indicate that a similar process can be followed to determine the water equivalency of other solid phantoms and at other photon energies

The transmission diffraction patterns of silicon implanted with high-energy α-particles

International Nuclear Information System (INIS)

Wieteska, K.; Wierzchowski, W.

1995-01-01

2 mm thick silicon wafers, implanted with 4.8 MeV α-particles are studied by means of transmission section topography and additionally by Lang and double-crystal methods. It was found that all three methods produced a negligible contrast in the symmetric transmission reflection apart from some fragments of the implanted area's boundaries. The interference fringes were observed in the case of asymmetric reflections. The asymmetric section topographs revealed distinct interference fringes, which cannot be explained in terms of simple bicrystal models. In particular, the curvature of these fringes may be interpreted as being due to the change in the implanted ion dose along the beam intersecting the crystal. Some features of the fringe pattern were reproduced by numerical integration of Takagi-Taupin equations. (author)

Energy Storage and Distributed Energy Generation Project, Final Project Report

Energy Technology Data Exchange (ETDEWEB)

Schwank, Johannes; Mader, Jerry; Chen, Xiaoyin; Mi, Chris; Linic, Suljo; Sastry, Ann Marie; Stefanopoulou, Anna; Thompson, Levi; Varde, Keshav

2008-03-31

This report serves as a Final Report under the “Energy Storage and Distribution Energy Generation Project” carried out by the Transportation Energy Center (TEC) at the University of Michigan (UM). An interdisciplinary research team has been working on fundamental and applied research on: -distributed power generation and microgrids, -power electronics, and -advanced energy storage. The long-term objective of the project was to provide a framework for identifying fundamental research solutions to technology challenges of transmission and distribution, with special emphasis on distributed power generation, energy storage, control methodologies, and power electronics for microgrids, and to develop enabling technologies for novel energy storage and harvesting concepts that can be simulated, tested, and scaled up to provide relief for both underserved and overstressed portions of the Nation’s grid. TEC’s research is closely associated with Sections 5.0 and 6.0 of the DOE "Five-year Program Plan for FY2008 to FY2012 for Electric Transmission and Distribution Programs, August 2006.”

Study for wireless power transmission of nuclear robot system

International Nuclear Information System (INIS)

Kim, Jongseog

2013-01-01

Gasoline engine or electric motor is generally used for driving power of working. Gasoline tank is uncomfortable to carry. Battery capacity does not sustain long time working. Frequent moving back of robot to power charger or refueling tank is inconvenient. Long power cable connection occur winding problem if there are complex structures in walking way. We need some solution for continuous supply of robot energy at the free moving condition of robot. 'Wireless power transmission' is one of the solutions. Some experiment result to transmit wireless power to moving robot is described herein. To find possible wireless power transmission method for nuclear robot, wireless power transmission tests were performed. As result of these tests, it was confirmed that wireless power transmission by using dipole and mat type magnetic induction were possible. As result of flying robot experiment, it was realized that development of light weight core for receiver and wave reflection device for high directional transmitter are necessary for practical use of the dipole type wireless power transmission. Small size core and high directional transmitter will be next target. Mat type wireless power transmission is regarded as useful for robot power charging station in the inside containment

Study for wireless power transmission of nuclear robot system

Energy Technology Data Exchange (ETDEWEB)

Kim, Jongseog [Central Research Institute of Korea Hydro and Nuclear Power Co., Daejeon (Korea, Republic of)

2013-05-15

Gasoline engine or electric motor is generally used for driving power of working. Gasoline tank is uncomfortable to carry. Battery capacity does not sustain long time working. Frequent moving back of robot to power charger or refueling tank is inconvenient. Long power cable connection occur winding problem if there are complex structures in walking way. We need some solution for continuous supply of robot energy at the free moving condition of robot. 'Wireless power transmission' is one of the solutions. Some experiment result to transmit wireless power to moving robot is described herein. To find possible wireless power transmission method for nuclear robot, wireless power transmission tests were performed. As result of these tests, it was confirmed that wireless power transmission by using dipole and mat type magnetic induction were possible. As result of flying robot experiment, it was realized that development of light weight core for receiver and wave reflection device for high directional transmitter are necessary for practical use of the dipole type wireless power transmission. Small size core and high directional transmitter will be next target. Mat type wireless power transmission is regarded as useful for robot power charging station in the inside containment.

Electron transmission through coupled quantum dots in an Aharonov-Bohm ring

International Nuclear Information System (INIS)

Joe, Y. S.; Kim, Y. D.

2006-01-01

Stimulated by recent intriguing experiments with a quantum dot in an Aharonov-Bohm (AB) ring, we investigate novel resonant phenomena by studying the total transmission probability of nanoscale AB ring with embedded double quantum dots in one arm and a magnetic flux passing through the rings' center. In this system, we show an overlapping and merging of Fano resonances as the interaction parameter between the dots changes. In the strong overlapping region of Fano resonances, the transmission zeros leave the real-energy axis and move away in opposite directions in the complex-energy plane. The behavior of the Fano zero-pole resonances in the complex-energy plane as a function of the external magnetic flux is also investigated for various coupling integrals between the quantum dots in the ring.

Nuclear stopping in transmission experiments

International Nuclear Information System (INIS)

Glazov, Lev G.; Sigmund, Peter

2003-01-01

Energy-loss spectra, mean and peak energy loss, and straggling due to elastic nuclear scattering have been studied theoretically as a function of target thickness and deflection angle of an initially monochromatic and well-collimated ion beam. The goal of this work has been to provide a generally valid scheme for nuclear-stopping corrections, allowing to determine electronic-stopping forces from energy-loss spectra measured in transmission geometry. Calculations have been based on the generalized Bothe-Landau theory of energy loss and multiple scattering. Our peak energy losses at zero emergence angle show close (∼10%) agreement with predictions of Fastrup et al. on the basis of the Bohr-Williams theory. However, predicted mean and peak energy losses are found to more sensitively depend on the underlying interatomic potential than unrestricted, i.e. angle-integrated mean or peak energy losses. Both elastic energy loss and multiple scattering are known to obey scaling laws involving only two combinations of the pertinent variables and atomic parameters. The dependence on deflection angle and foil thickness of mean and peak energy loss obeys a simple combination of these scaling laws. Comments are made on potential errors due to uncertainties in the nuclear-stopping correction applied in the literature with specific reference to central papers in low-velocity stopping

European concerted action on offshore wind energy deployment: inventory and analysis of power transmission barriers in eight member states

International Nuclear Information System (INIS)

Woyte, Achim; Gardner, Paul; Snodin, Helen

2007-01-01

The European Concerted Action for Offshore Wind Energy Deployment (COD) was carried out by eight sea-bordering European Union member states, with the objective to remove not explicitly technical barriers to offshore wind energy. Within the COD, an inventory of relevant aspects affecting the grid integration of offshore wind energy on a large scale in the eight countries has been made. Collected data items for this inventory are national plans and prospects for offshore wind energy, information about the transmission system, possibilities for grid connection, aspects of the grid codes, balancing, connection and energy pricing. The comprehensive COD reports were published and presented in October 2005 during the Copenhagen Offshore wind conference. This paper provides a short description of the situation for each country. Thereafter, country-specific information is grouped based on geography and membership in a synchronous zone. Additionally, a view is developed on the desirable facilities for the trans-European exchange of power from large wind farms. Finally, we elaborate overall conclusions in order to arrive at generalized observations, recommendations for policy makers and issues that will emerge in the near future. As a general conclusion, many things need to be done on a technical level in order to integrate large amounts of offshore wind power into our power systems. However, none of these measures is technically unknown. Therefore, the feasibility of integrating large amounts of offshore wind power is mainly a question of finance and hence based on political decisions. (Author)

Open Access Transmission Tariff: Effective December 18, 1998 (Revised June 16, 1999).

Energy Technology Data Exchange (ETDEWEB)

United States. Bonneville Power Administration.

1999-06-16

Bonneville will provide Network Integration Transmission Service pursuant to the terms and conditions contained in this Tariff and Service Agreement. The service that Bonneville will provide under this Tariff allows a Transmission Customer to integrate, economically dispatch and regulate its current and planned Network Resources to serve its Network Load. Network Integration Transmission Service also may be used by the Transmission Customer to deliver nonfirm energy purchases to its Network Load without additional charge. To the extent that the transmission path for moving power from a Network Resource to a Network Load includes the Eastern and Southern Interties, the terms and conditions for service over such intertie facilities are provided under Part 2 of this Tariff. Also, transmission service for third-party sales which are not designated as Network Load will be provided under Bonneville's Point-to-Point Transmission Service (Part 2 of this Tariff).

A wireless power transmission system for an active capsule endoscope for colon inspection.

Science.gov (United States)

Jia, Zhiwei; Yan, Guozheng; Shi, Yu; Zhu, Bingquan

2012-07-01

Multipurpose active capsule endoscopes (ACE) have drawn considerable attention in recent years, but these devices continue to suffer from energy limitations. In order to deliver stable and sufficient energy safely, a wireless power transmission system based on inductive coupling is presented. The system consists of a double-layer solenoid pair primary coil outside and a multiple secondary coils inside the body. At least 500 mW usable power can be transmitted under the worst geometrical conditions and the safety restraints in a volume of Φ13 × 13 mm. The wireless power transmission system is integrated to an ACE and applied in animal experiments. The designed wireless power transmission is proved to be feasible and potentially safe in a future application.

Alternative approaches to transmission investment

Energy Technology Data Exchange (ETDEWEB)

Vlahos, P. [Ontario Energy Board, Toronto, ON (Canada)

2004-07-01

The current regulatory framework at the Ontario Energy Board (OEB) was outlined with reference to the 10-year outlook of the Independent Electricity Market Operator (IMO). Power transmitters currently respond to the IMO's outlook, while the OEB approves applications and cost recovery in rates. The Working Group on Congestion has recommended that the IMO produce a 10-year resource plan, that transmitters produce a 10-year expansion plan, and that the OEB develop a framework for project assessment and rate relief. The Task Force has concluded that merchant transmission is not proven, that transmission is an essential public infrastructure, and that regulatory responsibilities and approval processes should be clarified and streamlined. It was noted that the OEB's approach to regulation should be consistent, clear, predictable, fair, timely and in the public interest.

Transmission eigenvalues

Science.gov (United States)

Cakoni, Fioralba; Haddar, Houssem

2013-10-01

In inverse scattering theory, transmission eigenvalues can be seen as the extension of the notion of resonant frequencies for impenetrable objects to the case of penetrable dielectrics. The transmission eigenvalue problem is a relatively late arrival to the spectral theory of partial differential equations. Its first appearance was in 1986 in a paper by Kirsch who was investigating the denseness of far-field patterns for scattering solutions of the Helmholtz equation or, in more modern terminology, the injectivity of the far-field operator [1]. The paper of Kirsch was soon followed by a more systematic study by Colton and Monk in the context of developing the dual space method for solving the inverse scattering problem for acoustic waves in an inhomogeneous medium [2]. In this paper they showed that for a spherically stratified media transmission eigenvalues existed and formed a discrete set. Numerical examples were also given showing that in principle transmission eigenvalues could be determined from the far-field data. This first period of interest in transmission eigenvalues was concluded with papers by Colton et al in 1989 [3] and Rynne and Sleeman in 1991 [4] showing that for an inhomogeneous medium (not necessarily spherically stratified) transmission eigenvalues, if they existed, formed a discrete set. For the next seventeen years transmission eigenvalues were ignored. This was mainly due to the fact that, with the introduction of various sampling methods to determine the shape of an inhomogeneous medium from far-field data, transmission eigenvalues were something to be avoided and hence the fact that transmission eigenvalues formed at most a discrete set was deemed to be sufficient. In addition, questions related to the existence of transmission eigenvalues or the structure of associated eigenvectors were recognized as being particularly difficult due to the nonlinearity of the eigenvalue problem and the special structure of the associated transmission

Analysis and dashboards on GRTgaz transmission activity - January-February 2016

International Nuclear Information System (INIS)

2017-01-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the monthly key figures of GRTgaz activity in 2016: Shipper markets, Consumer markets; Transported quantities (GRTgaz network inputs and outputs, Monthly allocated quantities at PIR and PITTM); Consumptions (Gross monthly consumptions and average temperature, Gross consumptions and daily temperatures, Gross and climate-corrected consumptions for the public distributions, Industrial customers: consumptions by sectors of activity); GRTgaz customers (Key figures); Up-stream capacities (Capacities reserved on the Network Interface Points (PIR) and N/S and S/N links, Daily delivery service, Secondary capacities' market) Down-stream capacities (Industrial customers, Public distributions); Wholesale markets PEG (Volumes exchanged and number of exchanges at PEGs, Average price P1 by zones). Data in French cover the January-December period, while data in English cover the January-February 2016 period only

Analysis and dashboards on GRTgaz transmission activity - January-February 2017

International Nuclear Information System (INIS)

2018-01-01

GRTgaz is a European leader in natural gas transmission, a world expert in gas transmission networks and systems, and an operator firmly committed to the energy transition. It owns and operates the gas transmission network throughout most of France and it manages the transmission network in Germany, thereby helping to ensure correct operation of the French and European gas market. It contributes to the energy security of regional supply systems and performs a public service mission to ensure the continuity of consumer supply. This document presents the monthly key figures of GRTgaz activity in 2017: Shipper markets, Consumer markets; Transported quantities (GRTgaz network inputs and outputs, Monthly allocated quantities at PIR and PITTM); Consumptions (Gross monthly consumptions and average temperature, Gross consumptions and daily temperatures, Gross and climate-corrected consumptions for the public distributions, Industrial customers: consumptions by sectors of activity); GRTgaz customers (Key figures); Up-stream capacities (Capacities reserved on the Network Interface Points (PIR) and N/S and S/N links, Daily delivery service, Secondary capacities' market) Down-stream capacities (Industrial customers, Public distributions); Wholesale markets PEG (Volumes exchanged and number of exchanges at PEGs, Average price P1 by zones). Data in French cover the January-September period, while data in English cover the January-February 2017 period only

Inter-regional transmission and power trading opportunities : making operating agreements work

International Nuclear Information System (INIS)

DesRosiers, D.

2001-01-01

International electric power transmission issues were the focus of this power point presentation which included a corporate profile of the Detroit Edison and International Transmission Company (ITC) and an overview of the midwest U.S. market and the Michigan-Ontario interconnections. ITC owns the transmission assets of its parent company Detroit Edison. It has a commitment with the Federal Energy Regulatory Commission (FERC) to be independent of all market participants within 18 months. ITC's peak load is 11,000 MW with 3 interconnections with Hydro One in Ontario, Consumers Energy in Michigan and First Energy in Ohio. The Ontario-Michigan interface includes four tie lines, 3 near Sarnia and 1 near Windsor, with a total capacity of 1,400 MW into Ontario and 2,000 MW out of Ontario. However, the amount of commercially available power is significantly inhibited by a phenomenon called loopflow, which is the difference between the scheduled and actual power flow. The problems and solutions to loopflow were also outlined. This presentation also briefly discussed the agreement reached between the Alliance RTO and the Midwest ISO that will allow the two to co-exist in the Midwest. tabs., figs

Proceedings of the North American Transmission and Distribution Conference and Expo. CD ed.

International Nuclear Information System (INIS)

2005-01-01

This conference provided power suppliers with technology information regarding the transmission and distribution marketplace. It profiled industry solutions, information and education regarding the latest products and technologies to help utility professionals in their design, specifications, planning and reliability efforts. More than 1200 decision makers, suppliers and utility professionals attended the conference, including electrical utility chief executive officers, presidents, operations managers, billing experts, customer care facility managers, system planners, transmission/distribution managers, asset management, system operations management, and engineering consultants. Vendors also demonstrated the latest equipment, software and technology for the transmission and distribution market. Transmission was the focal point of core business activities with emphasis on energy management, new technologies, operations, maintenance, and planning and design. Topics of discussion ranged from load response strategies, metering systems, modernization of large industrial plants for interconnection with utilities, streetlight management systems, improvements to circuit utilization, energy fraud detection, power surge protection, de-icing systems, cyber security, and the Canadian electricity workforce. tabs., figs

Hydraulic fluid used for power transmission

Energy Technology Data Exchange (ETDEWEB)

Heikkilae, M.; Pikulinsky, K.; Leisio, C.

1996-11-01

In early October another 50-kilowatt wind turbine was provided with new power transmission technology at the Kopparnaes Energy Park in Inkoo, Finland, west of Helsinki. The new technology is thought to make this wind turbine located on the south coast of Finland more efficient, lighter, and cheaper. Certain aspects of this new technology can be applied to older wind turbines. (orig.)

Small passenger car transmission test; Chevrolet LUV transmission

Science.gov (United States)

Bujold, M. P.

1980-01-01

A 1978 Chevrolet LUV manual transmission tested per the applicable portions of a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the upper ninety percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Chevrolet LUV transmission.

New plans for increasing transmission and intertie capacity : moving towards a more integrated power market in Atlantic Canada

International Nuclear Information System (INIS)

Roberge, F.

2003-01-01

This PowerPoint presentation provided a brief review of the electric power industry in Quebec after deregulation. It included an outline of non-regulated activity and regulated activities in terms of power generation, transmission, distribution and customer service. Both the transmission and distribution components of the power industry in Quebec are regulated by the Regie de l'energie. Transmission networks offer access to all wholesalers. Quebec does not have an energy spot market and electricity prices are currently very low. Hydro-Quebec TransEnergie was created in 1997 as a functionally independent open access transmission provider with high reliability standards. TransEnergie can address seams issues with neighbouring networks. The three types of services offered in terms of tariffs were also discussed in this presentation along with data regarding Hydro-Quebec assets, revenue and net income. Hydro-Quebec's relation with the Atlantic provinces were also described. Interconnection with New Brunswick totals 785 MW. No new interconnection is planned. 1 tab., 4 figs

Electron transmission through a periodically driven graphene magnetic barrier

Energy Technology Data Exchange (ETDEWEB)

Biswas, R., E-mail: rbiswas.pkc@gmail.com [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Maiti, S. [Ajodhya Hills G.S.A.T High School, Ajodhya, Purulia, West Bengal – 723152 (India); Mukhopadhyay, S. [Purulia Zilla School, Dulmi Nadiha, Purulia, West Bengal – 723102 (India); Sinha, C. [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science, Jadavpur – 700032 (India)

2017-05-10

Electronic transport through graphene magnetic barriers is studied theoretically in presence of an external time harmonic scalar potential in the framework of non-perturbative Landau–Floquet Formalism. The oscillating field mostly suppresses the transmission for rectangular magnetic barrier structure and exhibits the Fano resonance for multiphoton processes due to the presence of bound state inside the barrier. While, for a pair of delta function barriers of larger separation, the oscillating potential suppresses the usual Fabry–Perot oscillations in the transmission and a new type of asymmetric Fano resonance is noted for smaller separation, occurring due to extended states between the barriers. - Highlights: • Tunnelling of the Dirac Fermions through oscillating pure magnetic barriers is reported for the first time. • The high energy transmission through a graphene magnetic barrier is suppressed by the application of time periodic modulation. • Suppression of the Fabry Perot transmission is noted due to the application of an external time harmonic potential. • Two kinds of the Fano resonances are noted in transmission through a pair of modulated δ-function magnetic barriers.

Canby Area Service Project substation and associated transmission line

International Nuclear Information System (INIS)

1992-02-01

Bonneville Power Administration (BPA) provides power to Surprise Valley Electrification Corporation (SVEC) in Modoc County, California. BPA uses PacificCorp's substation and transmission facilities between Alturas and Canby, California to transfer power to SVEC's Canby Substation. In the next year, SVEC expects increased industrial, agricultural, and residential electric loads on their 69-kV transmission system south of Canby. SVEC's substation can accommodate only about 10 percent of the expected additional electric load. BPA's proposed action is intended to meet SVEC's increasing electric load. BPA proposes to meet SVEC's increasing energy load by tapping into BPA's existing BPA Malin-Warner 230-kV transmission line, and building an 7.9-mile transmission line to a new BPA substation. BPA proposes to build the new substation next to the west side of SVEC's Canby Substation (Figure 1). This new substation will allow SVEC to move the additional power over their existing transmission or distribution lines. This report is the environmental assessment of the potential impact of the proposed project. The assessment determined that no ''environmental impact statement'' is not required

Investment in Electricity Generation and Transmission: Decision Making Under Uncertainty

DEFF Research Database (Denmark)

Conejo, Antonio J.; Baringo, Luis; Kazempour, Jalal

This book provides an in-depth analysis of investment problems pertaining to electric energy infrastructure, including both generation and transmission facilities. The analysis encompasses decision-making tools for expansion planning, reinforcement, and the selection and timing of investment...... undergraduate and graduate students in the fields of electric energy systems, operations research, management science, and economics. Practitioners in the electric energy sector will also benefit from the concepts and techniques presented here....

Transmission issues

International Nuclear Information System (INIS)

Bradford, J.; Wilson, L.; Thon, S.; Millar, N.

2005-01-01

This session on transmission issues focused on the role that transmission plays in electricity markets and the importance of getting the market structure right in terms of generation divestiture with buy back contracts, demand side responsive programs, transmission upgrades and long term contracts. The difficulties of distinguishing between market power and scarcity were examined along with some of the complications that ensue if transmission experiences congestion, as exemplified by the August 2003 blackout in eastern North America. The presentations described the best ways to handle transmission issues, and debated whether transmission should be deregulated or follow market forces. Issues of interconnections and reliability of connections were also debated along with the attempt to integrate renewables into the grid. Some presentations identified what new transmission must be built and what must be done to ensure that transmission gets built. The challenges and business opportunities for transmission in Alberta were discussed with reference to plans to invest in new infrastructure, where it is going outside of the province and how it works with other jurisdictions. Manitoba's Conawapa Hydro Project and its 2000 MW tie line to Ontario was also discussed. Some examples of non-optimal use of interconnections in Europe were also discussed in an effort to learn from these mistakes and avoid them in Canada. tabs., figs

Monochromated scanning transmission electron microscopy

International Nuclear Information System (INIS)

Rechberger, W.; Kothleitner, G.; Hofer, F.

2006-01-01

Full text: Electron energy-loss spectroscopy (EELS) has developed into an established technique for chemical and structural analysis of thin specimens in the (scanning) transmission electron microscope (S)TEM. The energy resolution in EELS is largely limited by the stability of the high voltage supply, by the resolution of the spectrometer and by the energy spread of the source. To overcome this limitation a Wien filter monochromator was recently introduced with commercially available STEMs, offering the advantage to better resolve EELS fine structures, which contain valuable bonding information. The method of atomic resolution Z-contrast imaging within an STEM, utilizing a high-angle annular dark-field (HAADF) detector can perfectly complement the excellent energy resolution, since EELS spectra can be collected simultaneously. In combination with a monochromator microscope not only high spatial resolution images can be recorded but also high energy resolution EELS spectra are attainable. In this work we investigated the STEM performance of a 200 kV monochromated Tecnai F20 with a high resolution Gatan Imaging Filter (HR-GIF). (author)

Asymmetric acoustic transmission in graded beam

Energy Technology Data Exchange (ETDEWEB)

Jing, Li, E-mail: lj94172350@hotmail.com [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Wu, Jiu Hui, E-mail: ejhwu@mail.xjtu.edu.cn [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Guan, Dong; Lu, Kuan [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Gao, Nansha [School of Marine Science and Technology, Northwestern Polytechnical University, Xi’an, Shaanxi 710072 (China); Songhua, Cao [School of Mechanical Engineering and State Key laboratory for Strength and Vibration of Mechanical Structures, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China)

2016-12-01

We demonstrate the dynamic effective material parameters and vibration performance of a graded beam. The structure of the beam was composed of several unit cells with different fill factors. The dispersion relations and energy band structures of each unit cell were calculated using the finite element method (FEM). The dynamic effective material parameters in each unit cell of the graded beam were determined by the dispersion relations and energy band structures. Longitudinal wave propagation was investigated using a numerical method and FEM. The results show that the graded beam allows asymmetric acoustic transmission over a wide range of frequencies.

Getting to Gender Equality in Energy Infrastructure : Lessons from Electricity Generation, Transmission, and Distribution Projects

OpenAIRE

Orlando, Maria Beatriz; Janik, Vanessa Lopes; Vaidya, Pranav; Angelou, Nicolina; Zumbyte, Ieva; Adams, Norma

2018-01-01

Getting to Gender Equality in Electricity Infrastructure: Lessons from Electricity Generation, Transmission, and Distribution Projects examines the social and gender footprint of large-scale electricity generation, transmission, and distribution projects to establish a foundation on which further research and replication of good practices can be built. The main impact pathways analyzed are...

Cooling and heating of the ion flux on the transmission through crystals

International Nuclear Information System (INIS)

Karamyan, S.A.; Gruener, F.; Assmann, W.

2003-01-01

Transmission of charged particles through a monocrystalline medium is accompanied by many interesting phenomena, and a new one - redistribution of the isotropic flux - is now studied experimentally and described. The cooling or heating in the transverse momentum coordinate arises as a result of crystal-induced modification of the transmission trajectories. This indicates the violation of the reversibility rule, and cannot be explained within prevailing theory of channeling. The type of image (enhancement or reduction) and its intensity are dependent on the ion and crystal species, on the energy of ions and on the crystal thickness. Such dependencies have been studied experimentally and the mechanism involving the regular sequence of charge-exchange events with the transverse-energy non-conservation is attracted for understanding. The crystal response to ion flux transmission is also reviewed and characterized by the original results

Design of Chebychev’s Low Pass Filters Using Nonuniform Transmission Lines

Directory of Open Access Journals (Sweden)

Said Attamimi

2016-03-01

Full Text Available Transmission lines are utilized in many applications to convey energy as well as information. Nonuniform transmission lines (NTLs are obtained through variation of the characteristic quantities along the axial direction. Such NTLs can be used to design network elements, like matching circuits, delay equalizers, filters, VLSI interconnections, etc. In this work, NTLs were analyzed with a numerical method based on the implementation of method of moment. In order to approximate the voltage and current distribution along the transmission line, a sum of basis functions with unknown amplitudes was introduced. As basis function, a constant function was used. In this work, we observed several cases such as lossless and lossy uniform transmission lines with matching and arbitrary load. These cases verified the algorithm developed in this work. The second example consists of nonuniform transmission lines in the form of abruptly changing transmission lines. This structure was used to design a Chebychev’s low pass filter. The calculated reflection and transmission factors of the filters showed some coincidences with the measurements.

Northern States Power Company's open transmission tariff from a customer's perspective

International Nuclear Information System (INIS)

Marietta, K.E.; Achinger, S.K.

1993-01-01

In October of 1990, Northern States Power Company (NSP or Company), filed a unique open transmission tariff for both captive customers and through-system transactions. This is an important step towards expanding transmission services in the United States. Many individuals in the utility industry, who may be considering Imposing generation costs on transmission services, have been closely monitoring NSP's case which is currently before the Federal Energy Regulatory Commission (FERC). NSP's innovative generation costs include charges for reactive power production, frequency control, load dispatching, and load following. The results of this case may also have an important impact on the future of open transmission tariffs. Rates for these services depend on the customer's classification as either a captive or through-system consumer. The proposed tariff raises critical issues related to the costing of these transmission services. NSP's methodology has caused serious concern because the proposed tariff would increase transmission costs by an average of 53%. This paper will discuss the benefits of transmission, proposed rates, contract terms, and costing methodologies of NSP's plan

Energy harvesting solar, wind, and ocean energy conversion systems

CERN Document Server

Khaligh, Alireza

2009-01-01

Also called energy scavenging, energy harvesting captures, stores, and uses ""clean"" energy sources by employing interfaces, storage devices, and other units. Unlike conventional electric power generation systems, renewable energy harvesting does not use fossil fuels and the generation units can be decentralized, thereby significantly reducing transmission and distribution losses. But advanced technical methods must be developed to increase the efficiency of devices in harvesting energy from environmentally friendly, ""green"" resources and converting them into electrical energy.Recognizing t

A Novel Power-Saving Transmission Scheme for Multiple-Component-Carrier Cellular Systems

Directory of Open Access Journals (Sweden)

Yao-Liang Chung

2016-04-01

Full Text Available As mobile data traffic levels have increased exponentially, resulting in rising energy costs in recent years, the demand for and development of green communication technologies has resulted in various energy-saving designs for cellular systems. At the same time, recent technological advances have allowed multiple component carriers (CCs to be simultaneously utilized in a base station (BS, a development that has made the energy consumption of BSs a matter of increasing concern. To help address this concern, herein we propose a novel scheme aimed at efficiently minimizing the power consumption of BS transceivers during transmission, while still ensuring good service quality and fairness for users. Specifically, the scheme utilizes the dynamic activation/deactivation of CCs during data transmission to increase power usage efficiency. To test its effectiveness, the proposed scheme was applied to a model consisting of a BS with orthogonal frequency division multiple access-based CCs in a downlink transmission environment. The results indicated that, given periods of relatively light traffic loads, the total power consumption of the proposed scheme is significantly lower than that of schemes in which all the CCs of a BS are constantly activated, suggesting the scheme’s potential for reducing both energy costs and carbon dioxide emissions.

Vehicle transmission gear 2009; Getriebe in Fahrzeugen 2009

Energy Technology Data Exchange (ETDEWEB)

NONE

2009-07-01

with single dry clutch and electric torque support (G. Hellenbroich); (37) New solutions to increase cost-effectiveness of city bus drive lines with modern automatic powershift transmissions (P. Wunderlich); (38) Evaluation of the gearchanging comfort at commercial vehicles (W. Wessel); (39) New structure-optimised transmission systems for advanced commercial vehicles (R. Resch); (40) Depth of details of powertrain models for depocting driveability effects (F. Matthies); (41) A nonlinear transmission approach for dual mass flywheels (C. Benatzky); (42) Clattering and rattling is still a challenge for vehicle transmission developers (M. Dally); (43) Study on the effect of driving cycles on energy efficiency of electric vehicles (J. Fenzhu); (44) Modular modelling and simulation of hybrid power trains (G. Kelz); (45) The integration of electrical axle drives in hybrid vehicle and electric vehicles (H. Schaefer); (46) Energy balance of the optimized CVT hybrid driveline (B.-R. Hoehm); (47) Functional efficiency comparison between split- and parallel-hybrid using advanced energy flow analysis methods (P. Guttenberg); (48) Simulation of the fuel consumption benefits of various transmission arrangements and control strategies within a flywheel based mechanical hybrid system (W. Body); (49) Ideal test specifications for transmissions (T. Kassel); (50) The 'Hybrid Effect': Influence of hybridisation on the durability of automatic transmissions (T. Lavall); (51) Schaeffler lightweight differentials (R. Malik); (52) Integrated all wheel drive in the ZF eight-speed automatic gear (D. Baasch); (53) Optimized structures for amplifying torque vectoring systems (A. Sue); (54) The new sport differential in the Audi S4 (U. Pinschmidt).

BC Transmission Corporation : working towards a smarter grid

Energy Technology Data Exchange (ETDEWEB)

Morison, K. [British Columbia Transmission Corp., Vancouver, BC (Canada)

2009-07-01

This presentation discussed smart grid initiatives implemented as part of the British Columbia Transmission Corporation's (BCTC) transmission technology roadmap. The BCTC system is comprised of 18,000 km of transmission lines with 292 stations and 2 system control centers. BCTC is now aiming to maximize transfer capability and plan transmission system expansions for electricity security and increased capacity. BCTC's smart grid program was also designed to address emerging concerns over sustainability and the environmental impacts of electricity generation. The smart grid program will reduce system congestion, enable the integration of renewable energy, and be used as part of a broader risk assessment strategy. The program includes the use of power electronics, advanced composites and nano-materials, and field work robotics. Advance control centre technologies and synchrophasors will be used to enable wide area control and security assessment. BCTC's other smart grid initiatives include the use of smart equipment monitoring and remote sensing technologies. It was concluded that information and grid-based technologies will increase the efficiency, reliability, and flexibility of the electricity delivery infrastructure. tabs., figs.

An Energy-Efficient Scheme for Multirelay Cooperative Networks with Energy Harvesting