48 CFR 803.570 - Commercial advertising.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Commercial advertising. 803.570 Section 803.570 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS GENERAL... Commercial advertising. ...

29 CFR 570.128 - Good faith defense.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Good faith defense. 570.128 Section 570.128 Labor... Provisions of the Fair Labor Standards Act of 1938, as Amended Enforcement § 570.128 Good faith defense. Link... commerce goods which he acquired in good faith in reliance on written assurance from the producer...

29 CFR 570.50 - General.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false General. 570.50 Section 570.50 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS... by the Bureau of Apprenticeship and Training of the United States Department of Labor as employed in...

48 CFR 1403.570 - Restrictions on contractor advertising.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Restrictions on contractor advertising. 1403.570 Section 1403.570 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR... 1403.570 Restrictions on contractor advertising. ...

48 CFR 536.570-8 - Specifications and drawings.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Specifications and drawings. 536.570-8 Section 536.570-8 Federal Acquisition Regulations System GENERAL SERVICES... 536.570-8 Specifications and drawings. Insert the clause at 552.236-77, Specifications and Drawings...

48 CFR 223.570 - Drug-free work force.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Drug-free work force. 223.570 Section 223.570 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM... TECHNOLOGIES, OCCUPATIONAL SAFETY, AND DRUG-FREE WORKPLACE Drug-Free Workplace 223.570 Drug-free work force. ...

28 CFR 570.45 - Violation of escorted trip.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Violation of escorted trip. 570.45 Section 570.45 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE COMMUNITY PROGRAMS Escorted Trips § 570.45 Violation of escorted trip. (a) Staff shall process as...

48 CFR 570.105-1 - Contracting by negotiation.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contracting by negotiation. 570.105-1 Section 570.105-1 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION SPECIAL CONTRACTING PROGRAMS ACQUIRING LEASEHOLD INTERESTS IN REAL PROPERTY General 570.105-1 Contracting by negotiation. Contracting by negotiation...

29 CFR 570.12 - Revoked certificates of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Revoked certificates of age. 570.12 Section 570.12 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of Age § 570.12 Revoked certificates of age...

48 CFR 2009.570 - NRC organizational conflicts of interest.

Science.gov (United States)

2010-10-01

... conflicts of interest. 2009.570 Section 2009.570 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION COMPETITION AND ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570 NRC organizational conflicts of interest. ...

VizieR Online Data Catalog: Spectrum of VY CMa in 220.65-224.25GHz range (Kaminski+, 2013)

Science.gov (United States)

Kaminski, T.; Gottlieb, C. A.; Menten, K. M.; Patel, N. A.; Young, K. H.; Brunken, S.; Muller, H. S. P.; McCarthy, M. C.; Winters, J. M.; Decin, L.

2013-02-01

A spectrum of VY Canis Majoris obtained with the Plateau de Bure Interferometer on 22 April and 13 October 2012 in the frequency range 220.65-224.25GHz. The interferometer was used in its D configuration with six antennas and the synthesized beam was 4.9x2.2-arcsec. The spectrum was extracted from the central pixel of the map obtained with the gridding of 0.65-arcsec. (2 data files).

7 CFR 3560.570 - Construction financing.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Construction financing. 3560.570 Section 3560.570 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF... financing. The requirements established in § 3560.71 apply to all applications involving off-farm labor...

48 CFR 536.570-11 - Heat.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Heat. 536.570-11 Section... OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Contract Clauses 536.570-11 Heat. Insert the clause at 552.236-80, Heat, in solicitations and contracts if construction, dismantling...

29 CFR 570.126 - Parental exemption.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Parental exemption. 570.126 Section 570.126 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor...

48 CFR 536.570-3 - Specialist.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Specialist. 536.570-3... CATEGORIES OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Contract Clauses 536.570-3 Specialist. Insert 552.236-72, Specialist, in solicitations and contracts for construction if the technical sections...

24 CFR 241.570 - Insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Insurance endorsement. 241.570... § 241.570 Insurance endorsement. (a) Initial endorsement. The Commissioner shall indicate his/her insurance of the mortgage by endorsing the original credit instrument and identifying the section of the Act...

48 CFR 570.306 - Evaluating offers.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Evaluating offers. 570.306... Real Property 570.306 Evaluating offers. (a) You must evaluate offers solely in accordance with the... solicitation. The file must include the basis for evaluation, an analysis of each offer, and a summary of...

48 CFR 570.401 - Renewal options.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Renewal options. 570.401... Requirements 570.401 Renewal options. (a) Exercise of options. Before exercising an option to renew, follow the... survey. Before exercising an option to renew a lease, review current market information to ensure the...

48 CFR 570.203-3 - Soliciting offers.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Soliciting offers. 570.203... 570.203-3 Soliciting offers. (a) Solicit offers by providing each prospective offeror a proposed short..., evaluation procedures and submissions of offers. ...

21 CFR 570.18 - Tolerances for related food additives.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Tolerances for related food additives. 570.18 Section 570.18 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES General Provisions § 570.18 Tolerances...

Kilovoltage energy imaging with a radiotherapy linac with a continuously variable energy range.

Science.gov (United States)

Roberts, D A; Hansen, V N; Thompson, M G; Poludniowski, G; Niven, A; Seco, J; Evans, P M

2012-03-01

In this paper, the effect on image quality of significantly reducing the primary electron energy of a radiotherapy accelerator is investigated using a novel waveguide test piece. The waveguide contains a novel variable coupling device (rotovane), allowing for a wide continuously variable energy range of between 1.4 and 9 MeV suitable for both imaging and therapy. Imaging at linac accelerating potentials close to 1 MV was investigated experimentally and via Monte Carlo simulations. An imaging beam line was designed, and planar and cone beam computed tomography images were obtained to enable qualitative and quantitative comparisons with kilovoltage and megavoltage imaging systems. The imaging beam had an electron energy of 1.4 MeV, which was incident on a water cooled electron window consisting of stainless steel, a 5 mm carbon electron absorber and 2.5 mm aluminium filtration. Images were acquired with an amorphous silicon detector sensitive to diagnostic x-ray energies. The x-ray beam had an average energy of 220 keV and half value layer of 5.9 mm of copper. Cone beam CT images with the same contrast to noise ratio as a gantry mounted kilovoltage imaging system were obtained with doses as low as 2 cGy. This dose is equivalent to a single 6 MV portal image. While 12 times higher than a 100 kVp CBCT system (Elekta XVI), this dose is 140 times lower than a 6 MV cone beam imaging system and 6 times lower than previously published LowZ imaging beams operating at higher (4-5 MeV) energies. The novel coupling device provides for a wide range of electron energies that are suitable for kilovoltage quality imaging and therapy. The imaging system provides high contrast images from the therapy portal at low dose, approaching that of gantry mounted kilovoltage x-ray systems. Additionally, the system provides low dose imaging directly from the therapy portal, potentially allowing for target tracking during radiotherapy treatment. There is the scope with such a tuneable system

Energy-dependent etching-related impacts on CR-39 alpha detection efficiency for the Rn-222 and Rn-220 decay chains

Science.gov (United States)

Tan, Y.; Yuan, H.; Kearfott, K. J.

2018-04-01

CR-39 detectors are widely used to measure environmental levels of Rn-222, Rn-220 and their progeny. Prior research reported the CR-39 detection efficiency for alpha particles from Rn-222, Rn-220 and their progeny under a variety of etching conditions. This paper provides an explanation for interesting observations included in that work, namely that the critical incidence angle decreases with the increasing particle energy and the detection efficiency for 8.78 MeV alpha particles is zero. This paper explains these phenomena from a consideration of the interaction of alpha particles with the CR-39 detectors and the physics of etching dynamics. The proposed theory provides a rationale for an approach to optimizing the etching conditions of CR-39 detector for measuring Rn-222, Rn-220 and their progenies.

High-energy X-ray diffraction studies of short- and intermediate-range structure in oxide glasses

International Nuclear Information System (INIS)

Suzuya, Kentaro

2002-01-01

The feature of high-energy X-ray diffraction method is explained. The oxide glasses studies by using BL04B2, high-energy X-ray diffraction beam line of SPring-8, and the random system materials by high-energy monochromatic X-ray diffraction are introduced. An advantage of third generation synchrotron radiation is summarized. On SPring-8, the high-energy X-ray diffraction experiments of random system are carried out by BL04B2 and BL14B1 beam line. BL04B2 can select Si (111)(E=37.8 keV, λ=0.033 nm) and Si(220)(E=61.7 keV, λ=0.020 nm) as Si monochromator. The intermediate-range structure of (MgO) x (P 2 O 5 ) 1-x glass ,MgP 2 O 6 glass, B 2 O 3 glass, SiO 2 and GeO 2 are explained in detail. The future and application of high-energy X-ray diffraction are stated. (S.Y.)

48 CFR 2009.570-5 - Contract clauses.

Science.gov (United States)

2010-10-01

... COMPETITION AND ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570-5 Contract clauses. (a) General contract clause. All contracts and simplified acquisitions of the types set forth in 2009.570-4(b) must include the clause entitled, “Contractor Organizational Conflicts of...

21 CFR 570.38 - Determination of food additive status.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Determination of food additive status. 570.38... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES Food Additive Safety § 570.38 Determination of food additive status. (a) The Commissioner may, in accordance with § 570.35 (b)(4) or (c)(5...

48 CFR 536.570-5 - Working hours.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Working hours. 536.570-5... CATEGORIES OF CONTRACTING CONSTRUCTION AND ARCHITECT-ENGINEER CONTRACTS Contract Clauses 536.570-5 Working hours. Insert 552.236-74, Working Hours, in solicitations and contracts if construction, dismantling...

29 CFR 570.53 - Coal-mine occupations (Order 3).

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Coal-mine occupations (Order 3). 570.53 Section 570.53... § 570.53 Coal-mine occupations (Order 3). (a) Finding and declaration of fact. All occupations in or about any coal mine, except the occupation of slate or other refuse picking at a picking table or...

28 CFR 570.37 - Violation of furlough.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Violation of furlough. 570.37 Section 570.37 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE.... (a) Staff shall process as an escapee an inmate who absconds from furlough. (b) Staff may take...

14 CFR 121.570 - Airplane evacuation capability.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airplane evacuation capability. 121.570... REQUIREMENTS: DOMESTIC, FLAG, AND SUPPLEMENTAL OPERATIONS Flight Operations § 121.570 Airplane evacuation capability. (a) No person may cause an airplane carrying passengers to be moved on the surface, take off, or...

48 CFR 1836.570 - NASA solicitation provisions and contract clause.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NASA solicitation provisions and contract clause. 1836.570 Section 1836.570 Federal Acquisition Regulations System NATIONAL... CONTRACTS Contract Clauses 1836.570 NASA solicitation provisions and contract clause. (a) The contracting...

24 CFR 570.611 - Conflict of interest.

Science.gov (United States)

2010-04-01

...: (i) A disclosure of the nature of the conflict, accompanied by an assurance that there has been... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Conflict of interest. 570.611... § 570.611 Conflict of interest. (a) Applicability. (1) In the procurement of supplies, equipment...

24 CFR 570.610 - Uniform administrative requirements and cost principles.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Uniform administrative requirements and cost principles. 570.610 Section 570.610 Housing and Urban Development Regulations Relating to... GRANTS Other Program Requirements § 570.610 Uniform administrative requirements and cost principles. The...

24 CFR 570.613 - Eligibility restrictions for certain resident aliens.

Science.gov (United States)

2010-04-01

... certain resident aliens. 570.613 Section 570.613 Housing and Urban Development Regulations Relating to... GRANTS Other Program Requirements § 570.613 Eligibility restrictions for certain resident aliens. (a) Restriction. Certain newly legalized aliens, as described in 24 CFR part 49, are not eligible to apply for...

29 CFR 570.11 - Continued acceptability of certificates of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Continued acceptability of certificates of age. 570.11 Section 570.11 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of Age § 570.11...

29 CFR 570.70 - Purpose and scope.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Purpose and scope. 570.70 Section 570.70 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR... “provisions of section 12 [of the Act] relating to child labor shall apply to an employee below the age of 16...

Near-infrared light and the morphology of Arp 220

International Nuclear Information System (INIS)

Smith, J.; Grasdalen, G.L.; Gehrz, R.D.; Hackwell, J.A.; Dietz, R.D.

1988-01-01

This paper presents 2.2 micron imaging and a near-IR energy distribution for the luminous galaxy Arp 220. In the near-IR, Arp 220 appears as a single isolated galaxy with the projected axial symmetry of either a face-on disk or spheroid. The near-IR images contradict the original interpretation of the galaxy as the ongoing collision of two galaxies. No single component morphology can explain the galaxy adequately; this paper explains it as a hybrid galaxy form related to the class of radio galaxies with dust lanes. Some radio galaxies have properties in common with Arp 220. Hot stars are probable sources for heating of the diffuse dust in Arp 220 and perhaps some portion of a nuclear component. Heating by a nonstellar source of ultraviolet radiation is possible at the nucleus. 31 references

29 CFR 570.71 - Occupations involved in agriculture.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Occupations involved in agriculture. 570.71 Section 570.71... CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION 1-Occupations in Agriculture... agriculture. (a) Findings and declarations of fact as to specific occupations. The following occupations in...

9 CFR 590.570 - Pasteurization of liquid eggs.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Pasteurization of liquid eggs. 590.570..., Processing, and Facility Requirements § 590.570 Pasteurization of liquid eggs. (a) Pasteurization facilities: The facilities for pasteurization of egg products shall be adequate and of approved construction so...

Autophosphorylation of JAK2 on tyrosines 221 and 570 regulates its activity

DEFF Research Database (Denmark)

Argetsinger, Lawrence S; Kouadio, Jean-Louis K; Steen, Hanno

2004-01-01

or which of the 49 tyrosines in JAK2 are autophosphorylated. In this study, mass spectrometry and two-dimensional peptide mapping were used to determine that tyrosines 221, 570, and 1007 in JAK2 are autophosphorylated. Phosphorylation of tyrosine 570 is particularly robust. In response to growth hormone......, JAK2 was rapidly and transiently phosphorylated at tyrosines 221 and 570, returning to basal levels by 60 min. Analysis of the sequences surrounding tyrosines 221 and 570 in JAK2 and tyrosines in other proteins that are phosphorylated in response to ligands that activate JAK2 suggests that the YXX......[L/I/V] motif is one of the motifs recognized by JAK2. Experiments using JAK2 with tyrosines 221 and 570 mutated to phenylalanine suggest that tyrosines 221 and 570 in JAK2 may serve as regulatory sites in JAK2, with phosphorylation of tyrosine 221 increasing kinase activity and phosphorylation of tyrosine 570...

29 CFR 570.8 - Issuance of a Federal certificate of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Issuance of a Federal certificate of age. 570.8 Section 570.8 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of Age § 570.8...

29 CFR 570.32 - Effect of subpart C.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR... (Child Labor Reg. 3) § 570.32 Effect of subpart C. Link to an amendment published at 75 FR 28448, May 20... conditions specified in § 570.35 shall not be deemed to be oppressive child labor within the meaning of the...

Opacification of the C-flex 570C intraocular lens after sulcus fixation.

Science.gov (United States)

Daigle, Patrick; Carbonneau, Marjorie

2017-09-08

To report a case of diffuse intraocular lens (IOL) opacification in a patient who started complaining of blurred vision in his left eye over the course of three years after having phacoemulsification surgery combined with capsular bag fixation of a C-flex 570C IOL. The IOL had been repositioned in the ciliary sulcus following its subluxation. An IOL exchange was performed, and the explanted IOL was sent for histopathological analysis. Scanning electron microscopy identified multiple crystalline-like deposits on both sides of the IOL. The optic was more extensively involved than the haptics. Energy-dispersive X-ray spectroscopy confirmed the predominance of calcium within the deposits. The breakdown of the blood-aqueous barrier seems to be a key component of this calcification process. Ciliary sulcus fixation is not a suitable option for C-flex 570C IOLs.

570 miljonit Mondriani maali eest

Index Scriptorium Estoniae

1998-01-01

Hollandi maalikunsti fond ostis Piet Modigliani viimase maali ameerika ajakirja-kirjastaja S. I. Newhouse erakogult 80 miljoni kuldna (570 miljoni krooni) eest. 1944. a. valminud 'Victory Boogie Woogie' eksponeeritakse Haagi linnamuuseumis

DEC VT220

CERN Multimedia

1983-01-01

The DEC (Digital Equipment Corporation) VT220 is a text terminal which uses an redesigned keyboard(LK201). The VT220 improved on the earlier VT100 series of terminals with much smaller physical packaging and and a much faster microprocessor.

77 FR 68768 - Electricity Market Transparency Provisions of Section 220 of the Federal Power Act; Notice of...

Science.gov (United States)

2012-11-16

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. RM10-12-000] Electricity Market Transparency Provisions of Section 220 of the Federal Power Act; Notice of Technical Conference...., Washington, DC 20426. \\1\\ Electricity Market Transparency Provisions of Section 220 of the Federal Power Act...

20 CFR 410.570 - Underpayments.

Science.gov (United States)

2010-04-01

...-BLACK LUNG BENEFITS (1969- ) Payment of Benefits § 410.570 Underpayments. (a) General. As used in this... (ii) In the case of a deceased miner, entitled for the month of death to widow's black lung benefits...

Autophosphorylation of JAK2 on tyrosines 221 and 570 regulates its activity.

Science.gov (United States)

Argetsinger, Lawrence S; Kouadio, Jean-Louis K; Steen, Hanno; Stensballe, Allan; Jensen, Ole N; Carter-Su, Christin

2004-06-01

The tyrosine kinase JAK2 is a key signaling protein for at least 20 receptors in the cytokine/hematopoietin receptor superfamily and is a component of signaling by insulin receptor and several G-protein-coupled receptors. However, there is only limited knowledge of the physical structure of JAK2 or which of the 49 tyrosines in JAK2 are autophosphorylated. In this study, mass spectrometry and two-dimensional peptide mapping were used to determine that tyrosines 221, 570, and 1007 in JAK2 are autophosphorylated. Phosphorylation of tyrosine 570 is particularly robust. In response to growth hormone, JAK2 was rapidly and transiently phosphorylated at tyrosines 221 and 570, returning to basal levels by 60 min. Analysis of the sequences surrounding tyrosines 221 and 570 in JAK2 and tyrosines in other proteins that are phosphorylated in response to ligands that activate JAK2 suggests that the YXX[L/I/V] motif is one of the motifs recognized by JAK2. Experiments using JAK2 with tyrosines 221 and 570 mutated to phenylalanine suggest that tyrosines 221 and 570 in JAK2 may serve as regulatory sites in JAK2, with phosphorylation of tyrosine 221 increasing kinase activity and phosphorylation of tyrosine 570 decreasing kinase activity and thereby contributing to rapid termination of ligand activation of JAK2.

Energy-range relation and mean energy variation in therapeutic particle beams

International Nuclear Information System (INIS)

Kempe, Johanna; Brahme, Anders

2008-01-01

Analytical expressions for the mean energy and range of therapeutic light ion beams and low- and high-energy electrons have been derived, based on the energy dependence of their respective stopping powers. The new mean energy and range relations are power-law expressions relevant for light ion radiation therapy, and are based on measured practical ranges or known tabulated stopping powers and ranges for the relevant incident particle energies. A practical extrapolated range, R p , for light ions was defined, similar to that of electrons, which is very closely related to the extrapolated range of the primary ions. A universal energy-range relation for light ions and electrons that is valid for all material mixtures and compounds has been developed. The new relation can be expressed in terms of the range for protons and alpha particles, and is found to agree closely with experimental data in low atomic number media and when the difference in the mean ionization energy is low. The variation of the mean energy with depth and the new energy-range relation are useful for accurate stopping power and mass scattering power calculations, as well as for general particle transport and dosimetry applications

24 CFR 570.513 - Lump sum drawdown for financing of property rehabilitation activities.

Science.gov (United States)

2010-04-01

... DEVELOPMENT BLOCK GRANTS Grant Administration § 570.513 Lump sum drawdown for financing of property... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Lump sum drawdown for financing of property rehabilitation activities. 570.513 Section 570.513 Housing and Urban Development Regulations...

48 CFR 1403.570-2 - Procedures.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 1403.570-2... response shall be coordinated with the cognizant Public Affairs Office and Ethics Officer. ...

21 CFR 570.20 - General principles for evaluating the safety of food additives.

Science.gov (United States)

2010-04-01

... food additives. 570.20 Section 570.20 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES Food Additive Safety § 570.20 General principles for evaluating the safety of food additives. (a) In reaching a...

Dicty_cDB: SLH220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH220 (Link to dictyBase) - - - Contig-U15409-1 SLH220F (Link to Original site) SLH2...20F 510 - - - - - - Show SLH220 Library SL (Link to library) Clone ID SLH220 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH220Q.Seq.d/ Representative seq. ID SLH22...0F (Link to Original site) Representative DNA sequence >SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/ GAAGA...gnificant alignments: (bits) Value SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/

Quantum efficiency of cesium iodide photocathodes in the 120-220 nm spectral range traceable to a primary detector standard

CERN Document Server

Rabus, H; Richter, M; Ulm, G; Friese, J; Gernhäuser, R; Kastenmüller, A; Maier-Komor, P; Zeitelhack, K

1999-01-01

Differently prepared CsI samples have been investigated in the 120-220 nm spectral range for their quantum efficiency, spatial uniformity and the effect of radiation aging. The experiments were performed at the PTB radiometry laboratory at the Berlin synchrotron radiation facility BESSY. A calibrated GaAsP Schottky photodiode was used as transfer detector standard to establish traceability to the primary detector standard, because this type of photodiode - unlike silicon p-on-n photodiodes - proved to be of sufficiently stable response when exposed to vacuum ultraviolet radiation. The paper reviews the experimental procedures that were employed to characterize and calibrate the GaAsP photodiode and reports the results that were obtained on the investigated CsI photocathodes.

7 CFR 1280.220 - Collections.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Collections. 1280.220 Section 1280.220 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Assessments § 1280.220 Collections. (a) Each first handler and each exporter responsible for the collection of assessments under this subpart shall...

19 CFR 10.570 - Goods re-entered after repair or alteration in Singapore.

Science.gov (United States)

2010-04-01

... Singapore. 10.570 Section 10.570 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... States-Singapore Free Trade Agreement Goods Returned After Repair Or Alteration § 10.570 Goods re-entered after repair or alteration in Singapore. (a) General. This section sets forth the rules which apply for...

48 CFR 503.570-1 - Policy.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 503.570-1 Policy. GSA policy precludes contractors from making references to GSA contracts in commercial advertising in...

Development of an aerosol chamber for calibration of 220Rn progeny detectors

Science.gov (United States)

Sorimachi, Atsuyuki; Ishikawa, Tetsuo; Tokonami, Shinji

2014-09-01

This paper describes an aerosol chamber system that can be used for calibrations and performance experiments of passive 220Rn progeny detectors. For the purpose of this study, an aerosol generation system using carnauba wax as the aerosol material was mounted into the 220Rn chamber. We used the chamber to measure characteristics of the equilibrium factor (F) of 220Rn and unattached fraction (fp) of 220Rn progeny, which are important parameters for dose estimation. The first experiment showed that continuous and stable generation of the unattached and aerosol-attached 220Rn progeny concentrations was obtained. We observed that the spatial distributions in the chamber of the vertical profiles of the unattached and aerosol-attached 220Rn progeny concentrations were homogeneous, as were the particle number concentration and count median diameter. The values of F and fp and their characteristics observed in this study were in the same range as the values reported from indoor measurements. We found that the characteristics of F and fp were dependent on the aerosol conditions (particle diameter and particle number concentration).

14 CFR 13.220 - Discovery.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 13.220 Section 13.220... INVESTIGATIVE AND ENFORCEMENT PROCEDURES Rules of Practice in FAA Civil Penalty Actions § 13.220 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or...

7 CFR 220.3 - Administration.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 220.3 Section 220.3 Agriculture... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program covered by this part. Within...

20 CFR 663.570 - What is the consumer reports system?

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What is the consumer reports system? 663.570....570 What is the consumer reports system? The consumer reports system, referred to in WIA as... consumer reports system must contain the information necessary for an adult or dislocated worker customer...

28 CFR 570.43 - Inmates requiring a high degree of control and supervision.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Inmates requiring a high degree of control and supervision. 570.43 Section 570.43 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE COMMUNITY PROGRAMS Escorted Trips § 570.43 Inmates requiring a high degree of control and supervision. Only the...

49 CFR 220.7 - Penalty.

Science.gov (United States)

2010-10-01

..., or has caused death or injury, a penalty not to exceed $100,000 per violation may be assessed; and... 49 Transportation 4 2010-10-01 2010-10-01 false Penalty. 220.7 Section 220.7 Transportation Other... TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.7 Penalty. Any person (including but not limited to a...

9 CFR 354.220 - Buildings.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Buildings. 354.220 Section 354.220... CERTIFICATION VOLUNTARY INSPECTION OF RABBITS AND EDIBLE PRODUCTS THEREOF Buildings and Plant Facilities § 354.220 Buildings. The buildings shall be of sound construction and kept in good repair, and shall be of...

30 CFR 220.032 - Inventories.

Science.gov (United States)

2010-07-01

... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...

28 CFR 570.20 - Purpose.

Science.gov (United States)

2010-07-01

..., halfway house, restitution center, mental health facility, alcohol or drug rehabilitation center, or other... Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE COMMUNITY PROGRAMS AND RELEASE COMMUNITY PROGRAMS Pre-Release Community Confinement § 570.20 Purpose. The purpose of this subpart is to provide the procedures...

48 CFR 570.102 - Definitions.

Science.gov (United States)

2010-10-01

... Section 570.102 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION SPECIAL CONTRACTING... lease, including option periods and excluding the cost of operational services. Small business means a..., principle, and substance of the FAR or GSAR provision or clause and related coverage on the subject matter. ...

21 CFR 570.6 - Opinion letters on food additive status.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Opinion letters on food additive status. 570.6... (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES General Provisions § 570.6 Opinion letters on food additive status. (a) Over the years the Food and Drug Administration has given informal...

48 CFR 3036.570 - Special precautions for work at operating airports.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Special precautions for work at operating airports. 3036.570 Section 3036.570 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY ACQUISITION REGULATION (HSAR) SPECIAL CATEGORIES OF...

The reaction np→ pp π- from threshold up to 570 MeV

International Nuclear Information System (INIS)

Daum, M.; Finger, M.; Slunecka, M.; Finger, M. Jr.; Janata, A.; Franz, J.; Heinsius, F.H.; Koenigsmann, K.; Lacker, H.; Schmitt, H.; Schweiger, W.; Sereni, P.

2002-01-01

The reaction np→ppπ - has been studied in a kinematically complete measurement with a large acceptance time-of-flight spectrometer for incident neutron energies between threshold and 570 MeV. The proton-proton invariant mass distributions show a strong enhancement due to the pp( 1 S 0 ) final state interaction. A large anisotropy was found in the pion angular distributions in contrast to the reaction pp→ppπ 0 . At small energies, a large forward/backward asymmetry has been observed. From the measured integrated cross section σ(np→ppπ - ), the isoscalar cross section σ 01 has been extracted. Its energy dependence indicates that mainly partial waves with Sp final states contribute. (orig.)

29 CFR 570.117 - General.

Science.gov (United States)

2010-07-01

... to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Oppressive Child Labor § 570.117 General. (a...

48 CFR 570.303-3 - Late offers, modifications of offers, and withdrawals of offers.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Late offers, modifications of offers, and withdrawals of offers. 570.303-3 Section 570.303-3 Federal Acquisition Regulations... PROPERTY Contracting Procedures for Leasehold Interests in Real Property 570.303-3 Late offers...

Dicty_cDB: VHK220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

48 CFR 2009.570-4 - Representation.

Science.gov (United States)

2010-10-01

... type required by the organizational conflicts of interest representation provisions has previously been... ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570-4 Representation... whether situations or relationships exist which may constitute organizational conflicts of interest with...

29 CFR 570.25 - Effect on laws other than the Federal child labor standards.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Effect on laws other than the Federal child labor standards. 570.25 Section 570.25 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION... of Age Provisions of Other Laws § 570.25 Effect on laws other than the Federal child labor standards...

49 CFR 220.2 - Preemptive effect.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Preemptive effect. 220.2 Section 220.2 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.2 Preemptive effect. Link to an amendment...

29 CFR 570.122 - General.

Science.gov (United States)

2010-07-01

... newspapers to the consumer; (c) Employment of children as actors or performers in motion pictures or in... 28459, May 20, 2010, § 570.122 was revised, effective July 19, 2010. For the convenience of the user... engaged in the delivery of newspapers to the consumer; (3) Employment of children as actors or performers...

29 CFR 570.1 - Definitions.

Science.gov (United States)

2010-07-01

... to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS...) Oppressive child labor means employment of a minor in an occupation for which he does not meet the minimum age standards of the Act, as set forth in § 570.2 of this subpart. (c) Oppressive child labor age...

46 CFR 129.220 - Basic safety.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Basic safety. 129.220 Section 129.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS ELECTRICAL INSTALLATIONS General Requirements § 129.220 Basic safety. (a) Electrical equipment and installations must be suitable...

36 CFR 223.220 - Quantity determination.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Quantity determination. 223.220 Section 223.220 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE SALE AND DISPOSAL OF NATIONAL FOREST SYSTEM TIMBER Special Forest Products § 223.220 Quantity determination...

48 CFR 3009.570-2 - Policy.

Science.gov (United States)

2010-10-01

... ACQUISITION REGULATION (HSAR) ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational and Consultant... took appropriate steps to prevent any organizational conflict of interest in the selection process; or... process over which the entity exercised no control. (c) CONSTRUCTION—Nothing in this section 3009.570...

Dicty_cDB: SFL220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 0Z (Link to Original site) Representative DNA sequence >SFL220 (SFL220Q) /CSM/SF/SFL2-A/SFL220Q.Seq.d/ XXXXXXXXXXGTCCANATTTCCATANA...end seq. - 3' end seq. ID SFL220Z 3' end seq. >SFL220Z.Seq ----------GTCCANATTTCCATANATGTGTTTAAAAACGTGGNGGNA

10 CFR 600.220 - Standards for financial management systems.

Science.gov (United States)

2010-01-01

... financial reporting requirements of the grant or subgrant. (2) Accounting records. Grantees and subgrantees... advances to the grantees. (c) An awarding agency may review the adequacy of the financial management system... 10 Energy 4 2010-01-01 2010-01-01 false Standards for financial management systems. 600.220...

46 CFR 184.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Cooking equipment. 184.220 Section 184.220 Shipping...) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.220 Cooking equipment. (a) Doors on a cooking appliance must be provided with hinges and locking devices to prevent...

48 CFR 803.570-2 - Contract clause.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 803.570-2 Contract clause. The contracting officer shall insert the clause at 852.203-70, Commercial advertising, in...

48 CFR 503.570-2 - Contract clause.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 503.570-2 Contract clause. Insert the clause at 552.203-71, Restriction on Advertising, in solicitations and contracts...

45 CFR 148.220 - Excepted benefits.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Excepted benefits. 148.220 Section 148.220 Public... FOR THE INDIVIDUAL HEALTH INSURANCE MARKET Preemption; Excepted Benefits § 148.220 Excepted benefits... provision of the benefits described in paragraphs (a) and (b) of this section (or any combination of the...

24 CFR 570.703 - Eligible activities.

Science.gov (United States)

2010-04-01

....705(b)(1). (l) Acquisition, construction, reconstruction, rehabilitation or historic preservation, or... the CDBG program account or line of credit for costs incurred by the public entity or designated... environmental assessment costs not otherwise eligible under § 570.205. (f) Site preparation, including...

49 CFR 179.220-10 - Welding.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.220-10 Section 179.220-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-10 Welding. (a) All joints... of this subchapter). Welding procedures, welders, and fabricators shall be approved. (b) Radioscopy...

7 CFR 58.220 - Drying systems.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Drying systems. 58.220 Section 58.220 Agriculture....220 Drying systems. (a) Spray dryers. Spray dryers shall be of a continuous discharge type and all... filter system shall comply with the applicable requirements of the 3-A Accepted Practices for Milk and...

46 CFR 121.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Cooking equipment. 121.220 Section 121.220 Shipping... SYSTEMS AND EQUIPMENT Cooking and Heating § 121.220 Cooking equipment. (a) Doors on a cooking appliance... cooking appliance must be installed to prevent movement in heavy seas. (c) For a grill or similar type of...

49 CFR 570.59 - Service brake system.

Science.gov (United States)

2010-10-01

... 10,000 Pounds § 570.59 Service brake system. (a) Service brake performance. Compliance with any one of the following performance criteria will satisfy the requirements of this section. Verify that tire...

21 CFR 189.220 - Flectol H.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Flectol H. 189.220 Section 189.220 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Addition to Human Food Through Food-Contact Surfaces § 189.220 Flectol H. (a) Flectol H is the chemical 1,2...

48 CFR 2009.570-2 - Definitions.

Science.gov (United States)

2010-10-01

... ACQUISITION PLANNING CONTRACTOR QUALIFICATIONS Organizational Conflicts of Interest 2009.570-2 Definitions... concern or individual controls or has the power to control another, or when a third party controls or has the power to control both. Contract means any contractual agreement or other arrangement with the NRC...

29 CFR 570.115 - Joint applicability.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor... 12(a) and 12(c) § 570.115 Joint applicability. The child labor coverage provisions contained in...

2 CFR 801.220 - What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered...

Science.gov (United States)

2010-01-01

... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered transactions? 801.220 Section 801.220 Grants and... DEBARMENT AND SUSPENSION Covered Transactions § 801.220 What contracts and subcontracts, in addition to...

49 CFR 220.3 - Application.

Science.gov (United States)

2010-10-01

... general railroad system of transportation; or (2) Rapid transit operations in an urban area that are not... 49 Transportation 4 2010-10-01 2010-10-01 false Application. 220.3 Section 220.3 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF...

24 CFR 570.482 - Eligible activities.

Science.gov (United States)

2010-04-01

... certification from the assisted business that neither it, nor any of its subsidiaries, has plans to relocate... Block Grant Program § 570.482 Eligible activities. (a) General. The choice of activities on which block... accordance with the state's program design and procedures, as to which approach or approaches will best serve...

48 CFR 803.570-1 - Policy.

Science.gov (United States)

2010-10-01

... BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 803.570-1 Policy. It is VA policy that contractors will not advertise the award of contracts or refer to VA contracts in contractors' commercial advertising in such a manner as to state or imply that VA endorses a...

38 CFR 52.220 - Transportation.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Transportation. 52.220... FOR ADULT DAY HEALTH CARE OF VETERANS IN STATE HOMES Standards § 52.220 Transportation. Transportation... management must provide or contract for transportation to enable participants, including persons with...

Soil as a source of indoor 220Rn

International Nuclear Information System (INIS)

Li, Y.; Schery, S.D.; Turk, B.

1992-01-01

Two suggestions for sources of indoor 220Rn (thoron) have appeared in the literature: (1) building materials and outside air, and (2) soil beneath the house. Due to the difficulty of 220Rn measurement and limited data, both suggestions lack sufficient supporting evidence. We have investigated sources of indoor 220Rn in seven occupied houses in northern New Mexico, U.S. A two-filter system was used to measure indoor 220Rn levels continuously, and 220Rn progeny were measured with single filters and specialized alpha-track detectors. The amount of 220Rn entry from soil was curtailed by cutting off soil gas flow to the indoor air with subfloor depressurization mitigation systems. Four of the houses showed significant reductions in 220Rn with mitigation systems on. The average effect for these houses was to reduce indoor 220Rn levels by 70%. The other three houses had no clear reductions but in one of these houses, the mitigation system was not effective for stopping soil gas flow. Our results provide some of the most clear evidence to date supporting soil as an important source of indoor 220Rn

49 CFR 220.38 - Communication equipment failure.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Communication equipment failure. 220.38 Section 220.38 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... § 220.38 Communication equipment failure. (a) Any radio or wireless communication device found not to be...

24 CFR 220.801 - Initial insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Initial insurance endorsement. 220.801 Section 220.801 Housing and Urban Development Regulations Relating to Housing and Urban... AREAS Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.801 Initial...

48 CFR 570.110 - Cost or pricing data and information other than cost or pricing data.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Cost or pricing data and information other than cost or pricing data. 570.110 Section 570.110 Federal Acquisition Regulations System... PROPERTY General 570.110 Cost or pricing data and information other than cost or pricing data. (a) The...

49 CFR 220.301 - Purpose and application.

Science.gov (United States)

2010-10-01

... being distracted by the inappropriate use of electronic devices, such as mobile telephones (cell phones... 49 Transportation 4 2010-10-01 2010-10-01 false Purpose and application. 220.301 Section 220.301..., DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS Electronic Devices § 220.301 Purpose and application. (a...

20 CFR 220.63 - Conflict of interest.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Conflict of interest. 220.63 Section 220.63 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.63 Conflict of interest. All implications of possible conflict of...

29 CFR 570.106 - “Ship or deliver for shipment in commerce”.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false âShip or deliver for shipment in commerceâ. 570.106 Section 570.106 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of...

7 CFR 3052.220 - Frequency of audits.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Frequency of audits. 3052.220 Section 3052.220 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 3052.220...

12 CFR 19.220 - Scope.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Scope. 19.220 Section 19.220 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE Procedures for... the OCC pursuant to section 38 of the Federal Deposit Insurance Act and this part. ...

20 CFR 220.35 - Introduction.

Science.gov (United States)

2010-04-01

... term is defined in the Social Security Act. In making these decisions the Board must apply the... Services in making disability decisions under the Social Security Act. Regulations of the Social Security... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 220.35 Section 220.35 Employees...

46 CFR 402.220 - Registration of pilots.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 402.220 Section 402.220 Shipping... ORDERS Registration of Pilots § 402.220 Registration of pilots. (a) Each applicant pilot must complete the number of round trips specified in this section prior to registration as a U.S. registered pilot...

46 CFR 401.220 - Registration of pilots.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 401.220 Section 401.220 Shipping... Registration of Pilots § 401.220 Registration of pilots. (a) The Director shall determine the number of pilots... waters of the Great Lakes and to provide for equitable participation of United States Registered Pilots...

29 CFR 99.220 - Frequency of audits.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Frequency of audits. 99.220 Section 99.220 Labor Office of the Secretary of Labor AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 99.220 Frequency of audits. Except for the provisions for biennial audits provided in paragraphs (a) and...

29 CFR 570.9 - States in which State certificates of age are accepted.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false States in which State certificates of age are accepted. 570.9 Section 570.9 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates of...

12 CFR 220.6 - Good faith account.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Good faith account. 220.6 Section 220.6 Banks... BY BROKERS AND DEALERS (REGULATION T) § 220.6 Good faith account. In a good faith account, a creditor...) Securities entitled to good faith margin—(1) Permissible transactions. A creditor may effect and finance...

29 CFR 570.33 - Prohibited occupations for minors 14 and 15 years of age.

Science.gov (United States)

2010-07-01

... 28448, May 20, 2010, § 570.33 was revised, effective July 19, 2010. For the convenience of the user, the... as permitted by § 570.34(i). (j) Youth peddling, which entails the selling of goods or services to...

24 CFR 220.811 - Date of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Date of default. 220.811 Section... and Obligations-Projects Insured Project Improvement Loans § 220.811 Date of default. For the purposes of §§ 220.800 et seq., the date of default shall be considered as: (a) The date of the first...

24 CFR 220.812 - Notice of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Notice of default. 220.812 Section... and Obligations-Projects Insured Project Improvement Loans § 220.812 Notice of default. (a) If the default as defined in § 220.810 is not cured within the 30 day grace period, the lender shall, within 30...

Validering av Evolution 220

OpenAIRE

Krakeli, Tor-Arne

2013-01-01

- Det har blitt kjøpt inn et nytt spektrofotometer (Evolution 220, Thermo Scientific) til BioLab Nofima. I den forbindelsen har det blitt utført en validering som involverer kalibreringsstandarder fra produsenten og en test på normal distribusjon (t-test) på to metoder (Total fosfor, Tryptofan). Denne valideringen fant Evolution 220 til å være et akseptabelt alternativ til det allerede benyttede spektrofotometeret (Helios Beta). På bakgrunn av noen instrumentbegrensninger må de aktuelle an...

21 CFR 570.30 - Eligibility for classification as generally recognized as safe (GRAS).

Science.gov (United States)

2010-04-01

...), it may be used in food only within such limitation(s) (including the category of food(s), the... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Eligibility for classification as generally recognized as safe (GRAS). 570.30 Section 570.30 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF...

Long-range prospects of world energy demands and future energy sources

International Nuclear Information System (INIS)

Kozaki, Yasuji

1998-01-01

The long-range prospects for world energy demands are reviewed, and the major factors which are influential in relation to energy demands are discussed. The potential for various kinds of conventional and new energy sources such as fossil fuels, solar energies, nuclear fission, and fusion energies to need future energy demands is also discussed. (author)

CompTIA A+ complete study guide exams 220-801 and 220-802

CERN Document Server

Docter, Quentin; Skandier, Toby

2012-01-01

CompTIA Authorized, fully updated Study Guide for the leading IT certification: CompTIA A+ CompTIA A+ is the de facto certification for IT technicians. Some vendors even require employees to achieve certification as part of their job training. This book prepares you for both required exams: 220-801 and 220-802. Totally updated to cover the 2012 exams, this popular prep guide covers all the exam objectives. Readers will also have access to additional study tools, including the Sybex Test Engine with bonus practice exams, electronic flashcards, and a glossary of important terms in searchable PD

24 CFR 570.466 - Additional application submission requirements for Pockets of Poverty-employment opportunities.

Science.gov (United States)

2010-04-01

... requirements for Pockets of Poverty-employment opportunities. 570.466 Section 570.466 Housing and Urban... application submission requirements for Pockets of Poverty—employment opportunities. Applicants for Action Grants under the Pockets of Poverty provision must describe the number and, to the extent possible, the...

29 CFR 570.119 - Fourteen-year minimum.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Oppressive Child Labor § 570.119 Fourteen-year...

29 CFR 570.118 - Sixteen-year minimum.

Science.gov (United States)

2010-07-01

... Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Oppressive Child Labor § 570.118 Sixteen-year...

An assessment method of dose equivalent due to indoor 220Rn progeny by using 220Rn concentration measured at a 20 cm distance from wall

International Nuclear Information System (INIS)

Iida, T.; Ikebe, Y.; Okamoto, K.; Guo, Q.; Yamasaki, T.

1996-01-01

A pair of passive cup monitors with a different air exchange openings was developed for measuring simultaneously 222 Rn and 220 Rn concentrations. Indoor 220 Rn concentrations were very high in traditional Japanese dwellings with soil walls. The 220 Rn concentration decreases exponentially with the distance from wall. The effective diffusion coefficient of 220 Rn in dwelling and the exhalation rate of 220 Rn from wall were evaluated from the distribution of the 220 Rn concentrations. Then, indoor 220 Rn progeny concentration could be estimated from the 220 Rn concentration at a 20 cm distance from wall. From the results of the surveys. the average annual effective dose equivalent due to 220 Rn progeny was expected to be 0.67 mSv/year in the traditional Japanese dwellings. (author)

40 CFR 300.220 - Related Title III issues.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Related Title III issues. 300.220 Section 300.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... PLAN Planning and Preparedness § 300.220 Related Title III issues. Other related Title III requirements...

24 CFR 570.205 - Eligible planning, urban environmental design and policy-planning-management-capacity building...

Science.gov (United States)

2010-04-01

... environmental design and policy-planning-management-capacity building activities. 570.205 Section 570.205..., urban environmental design and policy-planning-management-capacity building activities. (a) Planning... known or suspected environmental contamination. (5) [Reserved] (6) Policy—planning—management—capacity...

29 CFR 570.7 - Documentary evidence required for issuance of a certificate of age.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Documentary evidence required for issuance of a certificate of age. 570.7 Section 570.7 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Certificates...

Range energy for heavy ions in CR-39

International Nuclear Information System (INIS)

Gil, L.R.; Marques, A.

1987-01-01

Range-energy relations in CR-39, for ions from He to Ar, are obtained after their effective nuclear charge. Comparison with earlier calculations and numerical results in the energy range 0,1 to 200 Mev/ Nucleon are also given. (M.W.O.)

7 CFR 220.1 - General purpose and scope.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 220.1 Section 220.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.1 General purpose and scope. This part...

Factorisation of RSA-220 with CADO-NFS

OpenAIRE

Bai , Shi; Gaudry , Pierrick; Kruppa , Alexander; Thomé , Emmanuel; Zimmermann , Paul

2016-01-01

We give details of the factorization of RSA-220 with CADO-NFS. This is a new record computation with this open-source software. We report on the factorization of RSA-220 (220 decimal digits), which is the 3rd largest integer factorization with the General Number Field Sieve (GNFS), after the factorization of RSA-768 (232 digits) in December 2009 [3], and that of 3 697 + 1 (221 digits) in February 2015 by NFS@home.

24 CFR 91.220 - Action plan.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Action plan. 91.220 Section 91.220 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development..., evaluate and reduce lead-based paint hazards, reduce the number of poverty-level families, develop...

40 CFR 86.220-94 - [Reserved

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 18 2010-07-01 2010-07-01 false [Reserved] 86.220-94 Section 86.220-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty Passenger...

24 CFR 220.804 - Insurance premiums.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Insurance premiums. 220.804 Section... and Obligations-Projects Insured Project Improvement Loans § 220.804 Insurance premiums. (a) First premium. The lender, upon the initial endorsement of the loan for insurance, shall pay to the Commissioner...

24 CFR 570.506 - Records to be maintained.

Science.gov (United States)

2010-04-01

... (Continued) OFFICE OF ASSISTANT SECRETARY FOR COMMUNITY PLANNING AND DEVELOPMENT, DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT COMMUNITY FACILITIES COMMUNITY DEVELOPMENT BLOCK GRANTS Grant Administration § 570.506...) which are projected to become available to low and moderate income persons through job turnover within...

Energy dependence of polymer gels in the orthovoltage energy range

Directory of Open Access Journals (Sweden)

Yvonne Roed

2014-03-01

Full Text Available Purpose: Ortho-voltage energies are often used for treatment of patients’ superficial lesions, and also for small- animal irradiations. Polymer-Gel dosimeters such as MAGAT (Methacrylic acid Gel and THPC are finding increasing use for 3-dimensional verification of radiation doses in a given treatment geometry. For mega-voltage beams, energy dependence of MAGAT has been quoted as nearly energy-independent. In the kilo-voltage range, there is hardly any literature to shade light on its energy dependence.Methods: MAGAT was used to measure depth-dose for 250 kVp beam. Comparison with ion-chamber data showed a discrepancy increasing significantly with depth. An over-response as much as 25% was observed at a depth of 6 cm.Results and Conclusion: Investigation concluded that 6 cm water in the beam resulted in a half-value-layer (HVL change from 1.05 to 1.32 mm Cu. This amounts to an effective-energy change from 81.3 to 89.5 keV. Response measurements of MAGAT at these two energies explained the observed discrepancy in depth-dose measurements. Dose-calibration curves of MAGAT for (i 250 kVp beam, and (ii 250 kVp beam through 6 cm of water column are presented showing significant energy dependence.-------------------Cite this article as: Roed Y, Tailor R, Pinksy L, Ibbott G. Energy dependence of polymer gels in the orthovoltage energy range. Int J Cancer Ther Oncol 2014; 2(2:020232. DOI: 10.14319/ijcto.0202.32 

Comparison of Sampling Probe and Thermal Desorber in Hazardous Air Pollutants on Site (HAPSITE) Extended Range (ER) for Analysis of Toxic Organic (TO)-15 Compounds

Science.gov (United States)

2014-03-01

compounds in a bag To prepare 20 ppbv TO-15 compounds in a 5 L ALTEF polypropylene bag (Jensen Inert Products , Coral Springs, FL, USA), 100 mL was taken...Bromopentafluorobenzene (BPFB; an IS)  117  5.70 6,730,000 8,500,000 11,400,000 8,876,667 1,220,000  1,200,000 1,190,000 1,203,333 Ethylbenzene   91  5.91 136 1,960,000...Trichloroethane Toluene Methyl Butyl Ketone (2-Hexanone) Dibromochloromethane 12-Dibromoethane Tetrachloroethylene Chlorobenzene Ethylbenzene p/m

24 CFR 232.570 - Endorsement of credit instrument.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Endorsement of credit instrument... of Fire Safety Equipment Eligible Security Instruments § 232.570 Endorsement of credit instrument. The Commissioner shall indicate his insurance of the loan by endorsing the credit instrument and...

24 CFR 570.203 - Special economic development activities.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Special economic development... § 570.203 Special economic development activities. A recipient may use CDBG funds for special economic... part of an economic development project. Guidelines for selecting activities to assist under this...

Evaluation of the ID220 single photon avalanche diode for extended spectral range of photon time-of-flight spectroscopy

DEFF Research Database (Denmark)

Nielsen, Otto Højager Attermann; Dahl, Anders Bjorholm; Anderson-Engels, Stefan

This paper describe the performance of the ID220 single photon avalanche diode for single photon counting, and investigates its performance for photon time-of-flight (PToF) spectroscopy. At first this report will serve as a summary to the group for PToF spectroscopy at the Department of Physics...

21 CFR 111.570 - Under this subpart O, what records must you make and keep?

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Under this subpart O, what records must you make and keep? 111.570 Section 111.570 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CURRENT GOOD MANUFACTURING PRACTICE IN...

Energy-range relations for hadrons in nuclear matter

Science.gov (United States)

Strugalski, Z.

1985-01-01

Range-energy relations for hadrons in nuclear matter exist similarly to the range-energy relations for charged particles in materials. When hadrons of GeV kinetic energies collide with atomic nuclei massive enough, events occur in which incident hadron is stopped completely inside the target nucleus without causing particle production - without pion production in particular. The stoppings are always accompanied by intensive emission of nucleons with kinetic energy from about 20 up to about 400 MeV. It was shown experimentally that the mean number of the emitted nucleons is a measure of the mean path in nuclear matter in nucleons on which the incident hadrons are stopped.

36 CFR 2.20 - Skating, skateboards, and similar devices.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Skating, skateboards, and similar devices. 2.20 Section 2.20 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.20 Skating, skateboards, and...

48 CFR 2103.570 - Misleading, Deceptive, or Unfair Advertising.

Science.gov (United States)

2010-10-01

... MANAGEMENT, FEDERAL EMPLOYEES GROUP LIFE INSURANCE FEDERAL ACQUISITION REGULATION GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Other Improper Business Practices 2103.570 Misleading..., serves as certification of the employee's coverage under the FEGLI Program. Any marketing/advertising...

Environmental thoron (220Rn): a review

International Nuclear Information System (INIS)

Ramachandran, T.V.

2013-01-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment and considerable data is generated on the levels of 222 Rn in the environment across the worlds and is periodically reported by UNSCEAR. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. Many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. This component is not adequately estimated for any country so far on a national level. 220 Rn problem will also be a problem in industries which uses thorium nitrate. Including India lamps using thoriated gas mantles are being still used for indoor and outdoor lighting and hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this article current status of 220 Rn levels in the indoor environment workplaces as well as in other industries where large amount of 232 Th is being handled are being summarized. (author)

36 CFR 220.7 - Environmental assessment and decision notice.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental assessment and decision notice. 220.7 Section 220.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.7 Environmental assessment and decision notice. (a) Environmental assessment...

Environmental thoron (220Rn): a review

International Nuclear Information System (INIS)

Ramachandran, T.V.

2008-01-01

Studies on natural background radiation is a topic, which evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true from the recent studies resulted in observing high 220 Rn levels in living environments and work places in various countries and it is increasingly felt that it may be necessary to have data on 220 Rn levels in environment for obtaining a complete picture of inhalation dose. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products, like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. Due to this it was necessary to supplement the external component with inhalation component. This component is not

20 CFR 220.132 - Physical exertion requirements.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Physical exertion requirements. 220.132 Section 220.132 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... of walking and standing is often necessary in carrying out job duties. Jobs are sedentary if walking...

7 CFR 220.5 - Method of payment to States.

Science.gov (United States)

2010-01-01

... reimbursement to School Food Authorities through presentation by designated State officials of a payment Voucher... 7 Agriculture 4 2010-01-01 2010-01-01 false Method of payment to States. 220.5 Section 220.5... AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.5 Method of payment to States. Funds to be...

12 CFR 220.132 - Credit to brokers and dealers.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Credit to brokers and dealers. 220.132 Section 220.132 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T) Interpretations § 220.132 Credit to brokers and...

43 CFR 17.220 - Preschool, elementary, and secondary education.

Science.gov (United States)

2010-10-01

... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Preschool, elementary, and secondary education. 17.220 Section 17.220 Public Lands: Interior Office of the Secretary of the Interior NONDISCRIMINATION IN FEDERALLY ASSISTED PROGRAMS OF THE DEPARTMENT OF THE INTERIOR Nondiscrimination on the Basis of Handicap § 17.220 Preschool, elementary,...

An accurate energy-range relationship for high-energy electron beams in arbitrary materials

International Nuclear Information System (INIS)

Sorcini, B.B.; Brahme, A.

1994-01-01

A general analytical energy-range relationship has been derived to relate the practical range, R p to the most probable energy, E p , of incident electron beams in the range 1 to 50 MeV and above, for absorbers of any atomic number. In the present study only Monte Carlo data determined with the new ITS.3 code have been employed. The standard deviations of the mean deviation from the Monte Carlo data at any energy are about 0.10, 0.12, 0.04, 0.11, 0.04, 0.03, 0.02 mm for Be, C, H 2 O, Al, Cu, Ag and U, respectively, and the relative standard deviation of the mean is about 0.5% for all materials. The fitting program gives some priority to water-equivalent materials, which explains the low standard deviation for water. A small error in the fall-off slope can give a different value for R p . We describe a new method which reduces the uncertainty in the R p determination, by fitting an odd function to the descending portion of the depth-dose curve in order to accurately determine the tangent at the inflection point, and thereby the practical range. An approximate inverse relation is given expressing the most probable energy of an electron beam as a function of the practical range. The resultant relative standard error of the energy is less than 0.7%, and the maximum energy error ΔE p is less than 0.3 MeV. (author)

48 CFR 504.570 - Procedures for using the EPS.

Science.gov (United States)

2010-10-01

... GENERAL ADMINISTRATIVE MATTERS Electronic Commerce in Contracting 504.570 Procedures for using the EPS. (a... [Identify address block in the solicitation]. (e) The Electronic Posting System Manual provides detailed... that electronic access to a solicitation will result in adequate competition, distribute the...

24 CFR 220.810 - Definition of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Definition of default. 220.810... Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.810 Definition of default... note or security instrument and such default continues for a period of 30 days, the note or security...

33 CFR 2.20 - Territorial sea baseline.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Territorial sea baseline. 2.20... JURISDICTION Jurisdictional Terms § 2.20 Territorial sea baseline. Territorial sea baseline means the line.... Normally, the territorial sea baseline is the mean low water line along the coast of the United States...

Dimensional verification and location of the reactive static compensator in 220 kV; Verificacion del dimensionamiento y ubicacion del compensador estatico de reactivos en 220 kV

Energy Technology Data Exchange (ETDEWEB)

Fernandez Krekeler, Ubaldo [Administracion Nacional de Electricidad (ANDE), Asuncion (Paraguay)]. E-mail: ufernandez@ieee.org; Cardozo Sanchez, Freddy [Mirant Americas (United States)

2001-07-01

This work presents a determination verification of the compensation range and the location of reactive static compensator (RSC) in 220 kV. The verification is accomplished by analyses of the RSC effects in relation to the losses, loading and system voltage stability. The needed compensation range is investigated in full details, whereas that the required conversion level is directly related to this range. It is concluded that the RSC installation, foreseen for 2002, might be postponed for 2005/10 still without reinforcements in 500 kV. The Limpio substation seems to be the more suitable location in relation to the most analysed cases.

Measurements of Rn-222, Rn-220 and their decay products in the environmental air of the high background radiation areas in Yangjiang, China

International Nuclear Information System (INIS)

Yuan Yongling; Shen Tong; Morishima, Hiroshige; Koga, Taeko; Wei Luxin; Sugahara, Tsutomu

2000-01-01

For the renewal of dose estimation from internal irradiation in the high background radiation areas (HBRA) of Yangjiang, the measurements of radon, thoron and their decay products in the environmental air were conducted, including: integrating measurements of Rn-222 and Rn-220 concentrations; equilibrium factor F for Rn-222 and alpha-potential energy value of Rn-220; external gamma radiation in places where radon measurements were undertaken; cumulative exposure to indoor radon for each family in a case-control study on lung cancer. The Rn-Tn cup monitor method was used for the integrating measurement of Rn-222 and Rn-220 concentration. An alpha track detector was used for the integration measurement of Rn-222 concentration in the case-control study on lung cancer. The results of measurements show that although the investigated areas are located between the Equator and the Tropic of Cancer, and that people live in well-ventilated dwellings, the concentrations of radon, especially of Rn-220 are significantly higher in the indoor air of HBRA than those in the control area. The value of equilibrium factors for Rn-222, the alpha potential energy of decay products from Rn-222 and Rn-220 are determined. (author)

29 CFR 570.58 - Occupations involved in the operation of power-driven hoisting apparatus (Order 7).

Science.gov (United States)

2010-07-01

... hoisting apparatus (Order 7). 570.58 Section 570.58 Labor Regulations Relating to Labor (Continued) WAGE... trucks, or stacking trucks, but shall not mean low-lift trucks or low-lift platform trucks that are... stacking trucks, but shall not mean low-lift trucks or low-lift platform trucks that are designed for the...

29 CFR 570.55 - Occupations involved in the operation of power-driven woodworking machines (Order 5).

Science.gov (United States)

2010-07-01

... woodworking machines (Order 5). 570.55 Section 570.55 Labor Regulations Relating to Labor (Continued) WAGE AND... woodworking machines (Order 5). Link to an amendment published at 75 FR 28455, May 20, 2010. (a) Finding and declaration of fact. The following occupations involved in the operation of power-driven wood-working machines...

50 CFR 665.220 - Hawaii coral reef ecosystem fisheries. [Reserved

Science.gov (United States)

2010-10-01

... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Hawaii coral reef ecosystem fisheries. [Reserved] 665.220 Section 665.220 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL... PACIFIC Hawaii Fisheries § 665.220 Hawaii coral reef ecosystem fisheries. [Reserved] ...

RESOLUTION OF THE COMPACT RADIO CONTINUUM SOURCES IN Arp220

International Nuclear Information System (INIS)

Batejat, Fabien; Conway, John E.; Hurley, Rossa; Parra, Rodrigo; Diamond, Philip J.; Lonsdale, Colin J.; Lonsdale, Carol J.

2011-01-01

We present 2 cm and 3.6 cm wavelength very long baseline interferometry images of the compact radio continuum sources in the nearby ultra-luminous infrared galaxy Arp220. Based on their radio spectra and variability properties, we confirm these sources to be a mixture of supernovae (SNe) and supernova remnants (SNRs). Of the 17 detected sources we resolve 7 at both wavelengths. The SNe generally only have upper size limits. In contrast all the SNRs are resolved with diameters ≥0.27 pc. This size limit is consistent with them having just entered their Sedov phase while embedded in an interstellar medium (ISM) of density 10 4 cm -3 . These objects lie on the diameter-luminosity correlation for SNRs (and so also on the diameter-surface brightness relation) and extend these correlations to very small sources. The data are consistent with the relation L∝D -9/4 . Revised equipartition arguments adjusted to a magnetic field to a relativistic particle energy density ratio of 1% combined with a reasonable synchrotron-emitting volume filling factor of 10% give estimated magnetic field strengths in the SNR shells of ∼15-50 mG. The SNR shell magnetic fields are unlikely to come from compression of ambient ISM fields and must instead be internally generated. We set an upper limit of 7 mG for the ISM magnetic field. The estimated energy in relativistic particles, 2%-20% of the explosion kinetic energy, is consistent with estimates from models that fit the IR-radio correlation in compact starburst galaxies.

POST-STARBURST TIDAL TAILS IN THE ARCHETYPICAL ULTRA LUMINOUS INFRARED GALAXY Arp 220

International Nuclear Information System (INIS)

Taniguchi, Y.; Matsubayashi, K.; Kajisawa, M.; Shioya, Y.; Ideue, Y.; Ohyama, Y.; Nagao, T.; Murayama, T.; Koda, J.

2012-01-01

We present our new deep optical imaging and long-slit spectroscopy for Arp 220, the archetypical ultra luminous infrared galaxy in the local universe. Our sensitive Hα imaging has newly revealed large-scale Hα absorption, i.e., post-starburst regions in this merger. One is found in the eastern superbubble and the other is in the two tidal tails that are clearly revealed in our deep optical imaging. The size of the Hα absorption region in the eastern bubble is 5 kpc × 7.5 kpc, and the observed Hα equivalent widths are ∼2 Å ± 0.2 Å. The sizes of the northern and southern Hα-absorption tidal tails are ∼5 kpc × 10 kpc and ∼6 kpc × 20 kpc, respectively. The observed Hα equivalent widths range from 4 Å to 7 Å. In order to explain the presence of the two post-starburst tails, we suggest a possible multiple-merger scenario for Arp 220 in which two post-starburst disk-like structures merged into one, causing the two tails. This favors Arp 220 as a multiple merging system composed of four or more galaxies arising from a compact group of galaxies. Taking our new results into account, we discuss a star formation history in the last 1 Gyr in Arp 220.

Range-separated density-functional theory for molecular excitation energies

International Nuclear Information System (INIS)

Rebolini, E.

2014-01-01

Linear-response time-dependent density-functional theory (TDDFT) is nowadays a method of choice to compute molecular excitation energies. However, within the usual adiabatic semi-local approximations, it is not able to describe properly Rydberg, charge-transfer or multiple excitations. Range separation of the electronic interaction allows one to mix rigorously density-functional methods at short range and wave function or Green's function methods at long range. When applied to the exchange functional, it already corrects most of these deficiencies but multiple excitations remain absent as they need a frequency-dependent kernel. In this thesis, the effects of range separation are first assessed on the excitation energies of a partially-interacting system in an analytic and numerical study in order to provide guidelines for future developments of range-separated methods for excitation energy calculations. It is then applied on the exchange and correlation TDDFT kernels in a single-determinant approximation in which the long-range part of the correlation kernel vanishes. A long-range frequency-dependent second-order correlation kernel is then derived from the Bethe-Salpeter equation and added perturbatively to the range-separated TDDFT kernel in order to take into account the effects of double excitations. (author)

48 CFR 1823.570 - Drug- and alcohol-free workforce.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Drug- and alcohol-free..., OCCUPATIONAL SAFETY, AND DRUG-FREE WORKPLACE Drug-Free Workplace 1823.570 Drug- and alcohol-free workforce. This section sets sets forth NASA requirements for mandatory drug and alcohol testing of certain...

42 CFR 403.220 - Supplemental Health Insurance Panel.

Science.gov (United States)

2010-10-01

... 42 Public Health 2 2010-10-01 2010-10-01 false Supplemental Health Insurance Panel. 403.220... Programs § 403.220 Supplemental Health Insurance Panel. (a) Membership. The Supplemental Health Insurance... determines whether or not a State regulatory program for Medicare supplemental health insurance policies...

29 CFR 570.102 - General scope of statutory provisions.

Science.gov (United States)

2010-07-01

... REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended General § 570.... The most important of the child labor provisions are contained in sections 12(a), 12(c), and 3(l) of...

49 CFR 220.23 - Publication of radio information.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Publication of radio information. 220.23 Section... § 220.23 Publication of radio information. Each railroad shall designate where radio base stations are.... The publication shall indicate the periods during which base and wayside radio stations are...

Energy resolution of a lead scintillating fiber electromagnetic calorimeter

International Nuclear Information System (INIS)

Budagov, Yu.; Chirikov-Zorin, I.; Glagolev, V.

1993-01-01

A calorimeter module was fabricated using profiled lead plates and scintillating fibers with diameter 1 mm and attenuation length about 80 cm. The absorber-to-fiber volume ratio was 1.17 and the module average radiation length X 0 = 1.05 cm. The energy resolution of the module was investigated using the electron beams of U-70 at Serpukhov and of the SPS at CERN in the energy range 5-70 GeV. The energy resolution at θ = 3 0 (the angle between the fiber axis and the beam direction) may be expressed by the formula σ/E(%) = 13.1/√E ± 1.7. The energy resolution was also simulated by Monte Carlo and good agreement with the experiment has been achieved. 12 refs.; 13 figs.; 4 tabs

Properties of short-range and long-range correlation energy density functionals from electron-electron coalescence

International Nuclear Information System (INIS)

Gori-Giorgi, Paola; Savin, Andreas

2006-01-01

The combination of density-functional theory with other approaches to the many-electron problem through the separation of the electron-electron interaction into a short-range and a long-range contribution is a promising method, which is raising more and more interest in recent years. In this work some properties of the corresponding correlation energy functionals are derived by studying the electron-electron coalescence condition for a modified (long-range-only) interaction. A general relation for the on-top (zero electron-electron distance) pair density is derived, and its usefulness is discussed with some examples. For the special case of the uniform electron gas, a simple parametrization of the on-top pair density for a long-range only interaction is presented and supported by calculations within the ''extended Overhauser model.'' The results of this work can be used to build self-interaction corrected short-range correlation energy functionals

31 CFR 515.570 - Remittances to Nationals of Cuba.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Remittances to Nationals of Cuba. 515..., Authorizations, and Statements of Licensing Policy § 515.570 Remittances to Nationals of Cuba. (a) Family... older are authorized to make remittances to nationals of Cuba who are close relatives, as defined in...

20 CFR 404.220 - Average-monthly-wage method.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Average-monthly-wage method. 404.220 Section... INSURANCE (1950- ) Computing Primary Insurance Amounts Average-Monthly-Wage Method of Computing Primary Insurance Amounts § 404.220 Average-monthly-wage method. (a) Who is eligible for this method. You must...

47 CFR 25.220 - Non-conforming transmit/receive earth station operations.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 2 2010-10-01 2010-10-01 false Non-conforming transmit/receive earth station operations. 25.220 Section 25.220 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Standards § 25.220 Non-conforming transmit/receive...

Long-range outlook of energy demands and supplies

International Nuclear Information System (INIS)

1984-01-01

An interim report on the long-range outlook of energy demands and supplies in Japan as prepared by an ad hoc committee, Advisory Committee for Energy was given for the period up to the year 2000. As the energy demands in terms of crude oil, the following figures are set: 460 million kl for 1990, 530 million kl for 1995, and 600 million kl for 2000. In Japan, without domestic energy resources, over 80% of the primary energy has been imported; the reliance on Middle East where political situation is unstable, for petroleum is very large. The following things are described. Background and policy; energy demands in industries, transports, and people's livelihood; energy supplies by coal, nuclear energy, petroleum, etc.; energy demand/supply outlook for 2000. (Mori, K.)

Long range energy transfer in graphene hybrid structures

International Nuclear Information System (INIS)

Gonçalves, Hugo; Bernardo, César; Moura, Cacilda; Belsley, Michael; Schellenberg, Peter; Ferreira, R A S; André, P S; Stauber, Tobias

2016-01-01

In this work we quantify the distance dependence for the extraction of energy from excited chromophores by a single layer graphene flake over a large separation range. To this end hybrid structures were prepared, consisting of a thin (2 nm) layer of a polymer matrix doped with a well chosen strongly fluorescent organic molecule, followed by an un-doped spacer layer of well-defined thicknesses made of the same polymer material and an underlying single layer of pristine, undoped graphene. The coupling strength is assessed through the variation of the fluorescence decay kinetics as a function of distance between the graphene and the excited chromophore molecules. Non-radiative energy transfer to the graphene was observed at distances of up to 60 nm; a range much greater than typical energy transfer distances observed in molecular systems. (paper)

Chandra Observations of Extended X-Ray Emission in ARP 220

Science.gov (United States)

McDowell, J. C.; Clements, D. L.; Lamb, S. A.; Shaked, S.; Hearn, N. C.; Colina, L.; Mundell, C.; Borne, K.; Baker, A. C.; Arribas, S.

2003-01-01

We resolve the extended X-ray emission from the prototypical ultraluminous infrared galaxy Arp 220. Extended, faint, edge-brightened, soft X-ray lobes outside the optical galaxy are observed to a distance of 1CL 15 kpc on each side of the nuclear region. Bright plumes inside the optical isophotes coincide with the optical line emission and extend 1 1 kpc from end to end across the nucleus. The data for the plumes cannot be fitted by a single-temperature plasma and display a range of temperatures from 0.2 to 1 keV. The plumes emerge from bright, diffuse circumnuclear emission in the inner 3 kpc centered on the Ha peak, which is displaced from the radio nuclei. There is a close morphological correspondence between the Ha and soft X-ray emission on all spatial scales. We interpret the plumes as a starburst-driven superwind and discuss two interpretations of the emission from the lobes in the context of simulations of the merger dynamics of Arp 220.

29 CFR 570.63 - Occupations involved in the operation of paper-products machines, scrap paper balers, and paper...

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Occupations involved in the operation of paper-products machines, scrap paper balers, and paper box compactors (Order 12). 570.63 Section 570.63 Labor Regulations... involved in the operation of paper-products machines, scrap paper balers, and paper box compactors (Order...

25 CFR 1000.220 - What regulations apply to self-governance Tribes?

Science.gov (United States)

2010-04-01

... 25 Indians 2 2010-04-01 2010-04-01 false What regulations apply to self-governance Tribes? 1000.220 Section 1000.220 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE...-DETERMINATION AND EDUCATION ACT Waiver of Regulations § 1000.220 What regulations apply to self-governance...

33 CFR 96.220 - What makes up a safety management system?

Science.gov (United States)

2010-07-01

... system? 96.220 Section 96.220 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY VESSEL OPERATING REGULATIONS RULES FOR THE SAFE OPERATION OF VESSELS AND SAFETY MANAGEMENT SYSTEMS Company and Vessel Safety Management Systems § 96.220 What makes up a safety management system? (a) The...

Numerical simulation on range of high-energy electron moving in accelerator target

International Nuclear Information System (INIS)

Shao Wencheng; Sun Punan; Dai Wenjiang

2008-01-01

In order to determine the range of high-energy electron moving in accelerator target, the range of electron with the energy range of 1 to 100 MeV moving in common target material of accelerator was calculated by Monte-Carlo method. Comparison between the calculated result and the published data were performed. The results of Monte-Carlo calculation are in good agreement with the published data. Empirical formulas were obtained for the range of high-energy electron with the energy range of 1 to 100 MeV in common target material by curve fitting, offering a series of referenced data for the design of targets in electron accelerator. (authors)

20 CFR 220.131 - Work which exists in the national economy.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work which exists in the national economy. 220.131 Section 220.131 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Vocational Considerations § 220.131 Work which exists in the national economy. (a) General. The Board considers...

20 CFR 220.102 - Non-severe impairment(s), defined.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Non-severe impairment(s), defined. 220.102 Section 220.102 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... these include— (1) Physical functions such as walking, standing, sitting, lifting, pushing, pulling...

Transcript of the proceedings of the first Albuquerque informal range/energy workshop

International Nuclear Information System (INIS)

Brice, D.K.

1981-04-01

An informal workshop was held to discuss aspects of the calculation of range and energy deposition distributions which are of interest in ion implantation experiments. Topics covered include: problems encountered in using published range and energy deposition tabulations; some limitations in the solutions of range/energy transport equations; the effect of the scattering cross section on straggle; Monte Carlo calculations of ranges and straggling; damage studies in aluminum; simulation of heavy-ion irradiation of gold using MARLOWE; and MARLOWE calculations of range distribution parameters - dependence on input data and calculational model

45 CFR 400.220 - Counting time-eligibility of refugees.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 2 2010-10-01 2010-10-01 false Counting time-eligibility of refugees. 400.220 Section 400.220 Public Welfare Regulations Relating to Public Welfare OFFICE OF REFUGEE RESETTLEMENT, ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES REFUGEE RESETTLEMENT PROGRAM...

Correlation between blister skin thickness, the maximum in the damage-energy distribution, and projected ranges of helium ions in Nb for the energy range 10 to 1500 keV

International Nuclear Information System (INIS)

St-Jacques, R.G.; Martel, J.G.; Terreault, B.; Veilleux, G.; Das, S.K.; Kaminsky, M.; Fenske, G.

1976-01-01

The skin thickness of blisters formed on polycrystalline niobium by 4 He + irradiation at room temperature for energies from 15 to 80 keV have been measured. Similar measurements were conducted for 10 keV 4 He + irradiation at 500 0 C to increase blister exfoliation, and thereby allow examination of a larger number of blister skins. For energies smaller than 100 keV the skin thicknesses are compared with the projected range and the damage-energy distributions constructed from moments interpolated from Winterbon's tabulated values. For energies of 10 and 15 keV the projected ranges and damage-energy distributions have also been computed with a Monte Carlo program. For energies larger than 100 keV the projected ranges of 4 He + in Nb were calculated using either Brice's formalism or the one given by Schiott. The thicknesses for 60 and 80 keV, and those reported earlier for 100 to 1500 keV correlate well with calculated projected ranges. For energies lower than 60 keV the measured thicknesses are larger than the calculated ranges

Measurement of 222Rn and 220Rn exhalation rate from soil samples of Kumaun Hills, India

Science.gov (United States)

Semwal, Poonam; Singh, Kuldeep; Agarwal, T. K.; Joshi, Manish; Pant, Preeti; Kandari, Tushar; Ramola, R. C.

2018-03-01

The source terms, i.e., exhalation and emanation from soil and building materials are the primary contributors to the radon (222Rn)/thoron (220Rn) concentration levels in the dwellings, while the ecological constraints like ventilation rate, temperature, pressure, humidity, etc., are the influencing factors. The present study is focused on Almora District of Kumaun, located in Himalayan belt of Uttarakhand, India. For the measurement of 222Rn and 220Rn exhalation rates, 24 soil samples were collected from different locations. Gamma radiation level was measured at each of these locations. Chamber technique associated with Smart Rn Duo portable monitor was employed for the estimation of 222Rn and 220Rn exhalation rates. Radionuclides (226Ra, 232Th and 40K) concentrations were also measured in soil samples using NaI(Tl) scintillation based gamma ray spectrometry. The mass exhalation rate for 222Rn was varying between 16 and 54 mBq/kg/h, while the 220Rn surface exhalation rate was in the range of 0.65-6.43 Bq/m2/s. Measured gamma dose rate for the same region varied from 0.10 to 0.31 µSv/h. Inter-correlation of exhalation rates and intra-correlation with background gamma levels were studied.

40 CFR 415.220 - Applicability; description of the titanium dioxide production subcategory.

Science.gov (United States)

2010-07-01

... titanium dioxide production subcategory. 415.220 Section 415.220 Protection of Environment ENVIRONMENTAL... SOURCE CATEGORY Titanium Dioxide Production Subcategory § 415.220 Applicability; description of the titanium dioxide production subcategory. This subpart applies to discharges to waters of the United States...

220 Names/Faces 220 Dolch Words Are Too Many for Students with Memories Like Mine. AVKO "Great Idea" Reprint Series No. 601.

Science.gov (United States)

McCabe, Don

This booklet discusses a procedure to assist students experiencing difficulty in learning the "Dolch Basic Sight Vocabulary of 220 Words" and rearranges a list of 220 words to make it easier for students to learn. The procedure discussed in the booklet is based on the "word family" approach, in which words like "all call,…

29 CFR 570.10 - Rules for certificates of age in the State of Alaska and the Territory of Guam.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Rules for certificates of age in the State of Alaska and the Territory of Guam. 570.10 Section 570.10 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF...

Study on the muon spectra at the depth of 570 m.w.e. underground with 100t scintillation detector

International Nuclear Information System (INIS)

Enikeev, R.I.; Zatsepin, G.T.; Korol'kova, E.V.; Kudryavtsev, V.A.; Mal'gin, A.S.; Ryazhskaya, O.G.; Khal'chugov, F.F.

1988-01-01

The experiment was carried out with 100-ton scintillation detector placed in the salt mine at the depth of 570 m.w.e. Detector measured the spectrum of energy release of electromagnetic cascades generated by muons underground. Electromagnetic and nuclear cascades were separated by the number of neutrons contained in the cascades. The measured spectrum of energy releases agrees with π- and K-meson spectrum with γ π,K =1.75±0.08 for muon energies at sea level E μ 0 > 0.7 TeV. The experimental data transformed to the vertical muon spectrum at sea level are in good agreement with the results of other works. The primary cosmic ray spectrum and the characteristics of pA-interactions up to energies of ∼ 100 TeV have not a changes which would lead to the increase of the γ π,K value higher than 1.85

Mid-range adiabatic wireless energy transfer via a mediator coil

International Nuclear Information System (INIS)

Rangelov, A.A.; Vitanov, N.V.

2012-01-01

A technique for efficient mid-range wireless energy transfer between two coils via a mediator coil is proposed. By varying the coil frequencies, three resonances are created: emitter–mediator (EM), mediator–receiver (MR) and emitter–receiver (ER). If the frequency sweeps are adiabatic and such that the EM resonance precedes the MR resonance, the energy flows sequentially along the chain emitter–mediator–receiver. If the MR resonance precedes the EM resonance, then the energy flows directly from the emitter to the receiver via the ER resonance; then the losses from the mediator are suppressed. This technique is robust against noise, resonant constraints and external interferences. - Highlights: ► Efficient and robust mid-range wireless energy transfer via a mediator coil. ► The adiabatic energy transfer is analogous to adiabatic passage in quantum optics. ► Wireless energy transfer is insensitive to any resonant constraints. ► Wireless energy transfer is insensitive to noise in the neighborhood of the coils.

Battery electric vehicle energy consumption modelling for range estimation

NARCIS (Netherlands)

Wang, J.; Besselink, I.J.M.; Nijmeijer, H.

2017-01-01

Range anxiety is considered as one of the major barriers to the mass adoption of battery electric vehicles (BEVs). One method to solve this problem is to provide accurate range estimation to the driver. This paper describes a vehicle energy consumption model considering the influence of weather

Mechanism of long-range penetration of low-energy ions in botanic samples

International Nuclear Information System (INIS)

Liu Feng; Wang Yugang; Xue Jianming; Wang Sixue; Du Guanghua; Yan Sha; Zhao Weijiang

2002-01-01

The authors present experimental evidence to reveal the mechanism of long-range penetration of low-energy ions in botanic samples. In the 100 keV Ar + ion transmission measurement, the result confirmed that low-energy ions could penetrate at least 60 μm thick kidney bean slices with the probability of about 1.0 x 10 -5 . The energy spectrum of 1 MeV He + ions penetrating botanic samples has shown that there is a peak of the count of ions with little energy loss. The probability of the low-energy ions penetrating the botanic sample is almost the same as that of the high-energy ions penetrating the same samples with little energy loss. The results indicate that there are some micro-regions with mass thickness less than the projectile range of low-energy ions in the botanic samples and they result in the long-range penetration of low-energy ions in botanic samples

Range and energy functions of interest in neutron dosimetry

International Nuclear Information System (INIS)

Bhatia, D.P.; Nagarajan, P.S.

1978-01-01

This report documents the energy and range functions generated and used in fast neutron interface dosimetry studies. The basic data of stopping power employed are the most recent. The present report covers a number of media mainly air, oxygen, nitrogen, polythene, graphite, bone and tissue, and a number of charged particles, namely protons, alphas, 9 Be, 11 B, 12 C, 13 C, 14 N and 16 O. These functions would be useful for generation of energy and range values for any of the above particles in any of the above media within +- 1% in any dosimetric calculations. (author)

Internal services simulation control in 220/110kV power transformer station Mintia

Science.gov (United States)

Ciulica, D.; Rob, R.

2018-01-01

The main objectives in developing the electric transport and distribution networks infrastructure are satisfying the electric energy demand, ensuring the continuity of supply to customers, minimizing electricity losses in the transmission and distribution networks of public interest. This paper presents simulations in functioning of the internal services system 400/230 V ac in the 220/110 kV power transformer station Mintia. Using simulations in Visual Basic, the following premises are taken into consideration. All the ac consumers of the 220/110 kV power transformer station Mintia will be supplied by three 400/230 V transformers for internal services which can mutual reserve. In case of damaging at one transformer, the others are able to assume the entire consumption using automatic release of reserves. The simulation program studies three variants in which the continuity of supply to customers are ensured. As well, by simulations, all the functioning situations are analyzed in detail.

7 CFR 220.17 - Prohibitions.

Science.gov (United States)

2010-01-01

..., curriculum, instructions, methods of instruction, and materials of instruction in any school as a condition... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.17 Prohibitions. (a) In carrying out the... limited to, laws relating to taxation, welfare, and public assistance programs. Expenditure of funds from...

Electron beam absorption in solid and in water phantoms: depth scaling and energy-range relations

International Nuclear Information System (INIS)

Grosswendt, B.; Roos, M.

1989-01-01

In electron dosimetry energy parameters are used with values evaluated from ranges in water. The electron ranges in water may be deduced from ranges measured in solid phantoms. Several procedures recommended by national and international organisations differ both in the scaling of the ranges and in the energy-range relations for water. Using the Monte Carlo method the application of different procedures for electron energies below 10 MeV is studied for different phantom materials. It is shown that deviations in the range scaling and in the energy-range relations for water may accumulate to give energy errors of several per cent. In consequence energy-range relations are deduced for several solid phantom materials which enable a single-step energy determination. (author)

Joint determination of the concentrations of the 222Rn and 220Rn decay products in air

International Nuclear Information System (INIS)

Terent'ev, M.V.

1987-01-01

The authors describe a modification of the Kuznets and Markov methods normally employed for the determination of radon 220 and 222 daughter alpha product concentration in air in which an air sample is taken for 10 minutes on a filter at a flow rate of 10-40 liters per minute. After the conclusion of sampling the filter activity is measured for another 10 minutes. In order to then determine the latent energy of the radon 222 daughter products and to bring into account the radon 220 daughter products in the total activity measurements of the filter are taken for a second time for 30 minutes five hours after initial sampling. The level of latent energy of the combined daughter products are calculated by an equation which incorporates alpha particle detection efficiency, aerosol retention efficiency in the filter, and the Kuznets coefficients, and analyzes the separate and combined contributions of both daughter products from both sampling periods. A statistical analysis employing the Markov method is also depicted in modified form and is recommended when a more rapid analysis of air radioactivity is mandated

20 CFR 405.220 - Decision by the Federal reviewing official.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Decision by the Federal reviewing official. 405.220 Section 405.220 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW... Medical and Vocational Expert System before making a decision. At all times, the Federal reviewing...

Primary measuring of equipment factor of 222Rn/220Rn indoor

International Nuclear Information System (INIS)

Liu Yanyang; Liu Fudong; Wang Chunhong; Sheng Mingwei

2010-01-01

The activity concentration of 222 Rn, 220 Rn and their progenies of certain working places and dwellings in Baotou city were measured simultaneously. Based on these results, the equipment factor of 222 Rn is 0.35 for working places and 0.43 for dwellings, while equipment factor of 220 Rn measured at 20 cm distance from wall is 0.030 for both working places and dwellings. Preliminary results show that the temporal change of 220 Rn equilibrium equivalent concentration is same as 222 Rn which is high in midnight and low in afternoon,and significant difference between instant and accumulated measure result of 222 Rn, 220 Rn activity concentration is found, with the factor of 2.1 and 1.7. (authors)

Study on a charcoal-based monitor for Rn-220 in air

International Nuclear Information System (INIS)

Yu Yiqiao; Solomon, S.B.

1993-01-01

Activated charcoal has been used in both passive monitors (Cohen, Pondy et al. 1987) and active monitors (Solomon and Gan, 1989) for the measurements of 222 Rn in air. Cooled, charcoal-impregnated filters, viewed in-situ by a solid state alpha detector, have been used for 220 Rn-in-breath studies. In general, γ ray counting of 220 Rn samples collected on activated charcoal has not been used. This paper describes the development and calibration of a charcoal based monitor designed to measure 220 Rn levels down to a lower limit of 10 Bq m -3 over sampling periods of 4 to 15 h. The activity of 212 Pb (10.6 h) produced from 220 Rn (55.6 s) collected in an activated charcoal-based sampler is 1/700 the total 220 Rn activity. A typical Hp-Ge detector has a MDL for a two-hours count of approximately 0.1 Bq of 212 Pb for the 239 keV γ-ray. For a MDL of 10 Bq·m -3 of 220 Rn in air, a volume of at least 7 m 3 must be sampled, assuming no breakthrough. The present charcoal-based 220 Rn monitor is designed to maximize the path length through the activated charcoal while sufficient cross-sectional area is retained to allow flow rates up to 0.03 m 3 ·kg -1 is packed into a specially designed aluminum container. The container is modeled on a Marinelli beaker to maximize the counting efficiency, while the sample flow through the chambers of the monitor is optimized to maintain radial symmetry. experiments demonstrated that 94% of 220 Rn was adsorbed by the charcoal in the monitor under a flow rate of 0.03 m 3 ·min -1 at 25 degree C and 85%. RH in 15 h. The monitor is designed to fit over a 70 mm diameter Hp-Ge detector. Preliminary measurements of 220 Rn in two buildings and a cave, using the active monitors and 'grabing' samples under a flow rate of 0.03 m 3 ·min -1 and a period of 4 h, indicated concentrations of between 18.6 and 142.0 Bq·m 3

29 CFR 570.35a - Work experience and career exploration program.

Science.gov (United States)

2010-07-01

... LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Employment of Minors Between 14 and 16 Years of Age (Child Labor Reg. 3) § 570.35a Work experience and career exploration... therefore is not deemed to be oppressive child labor. (b)(1) A school-supervised and school-administered...

29 CFR 570.109 - “Establishment situated in the United States”.

Science.gov (United States)

2010-07-01

... LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION General Statements of Interpretation of the Child Labor Provisions of the Fair Labor Standards Act of 1938, as Amended Coverage of... 29 Labor 3 2010-07-01 2010-07-01 false âEstablishment situated in the United Statesâ. 570.109...

Strong cytotoxic effect of the bradykinin antagonist BKM-570 in ovarian cancer cells--analysis of the molecular mechanisms of its antiproliferative action.

Science.gov (United States)

Jutras, Stephanie; Bachvarova, Magdalena; Keita, Mamadou; Bascands, Jean-Loup; Mes-Masson, Anne-Marie; Stewart, John M; Gera, Lajos; Bachvarov, Dimcho

2010-12-01

The standard chemotherapy for epithelial ovarian cancer (EOC) patients is currently a combination of taxane and platinum. However, most EOC patients still suffer relapses, and there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly disease. Recently, the nonpeptide bradykinin (BK) antagonist 2,3,4,5,6-pentafluorocinnamoyl-(o-2,6-dichlorobenzyl)-l-tyrosine-N-(4-amino-2,2,6,6-tetramethyl-piperidyl) amide (BKM-570) was shown to cause impressive growth inhibition of lung and prostate tumors, displaying superior in vivo inhibitory effects than convential chemotherapeutic drugs. Here, we investigated BKM-570 cytotoxic effects in two EOC cell lines, derived from different EOC histopathologies: a clear cell carcinoma (TOV-21), and an endometrioid carcinoma (TOV-112). We showed that BKM-570 effectively inhibited the growth of ovarian cancer cells, as its cytotoxic effects were comparable to those of cisplatin, and were independent of the functional status of BK receptors. Moreover, BKM-570 synergized with cisplatin in inhibiting EOC cell growth. To better understand the molecular mechanisms of the antiproliferative action of this BK antagonist in EOC cells, we performed gene expression profiling in TOV-21 and TOV-112 cells following treatment with 10 μM BKM-570 for 24 h. BKM-570 displayed similar cytotoxic effects in the two cell lines analyzed, as genes with previously shown involvement in apoptosis/antiapoptosis and cell adhesion were proportionally upregulated and downregulated in both cell lines, whereas genes involved in basic cellular mechanisms, including cell growth and maintenance, metabolism, cell cycle control, inflammatory and immune response, signal transduction, protein biosynthesis, transcription regulation, and transport, were predominantly downregulated upon treatment. Our data are indicative of the therapeutic potential of BKM-570 and related compounds in EOC management. © 2010 The Authors

neutron multiplicity measurements on 220 l waste drums containing Pu in the range 0.1-1 g 240Pueff with the time interval analysis method

International Nuclear Information System (INIS)

Baeten, P.; Bruggeman, M.; Carchon, R.; De Boeck, W.

1998-01-01

Measurement results are presented for the assay of plutonium in 220 l waste drums containing Pu-masses in the range 0.1-1 g 240 Pu eff obtained with the time interval analysis (TIA) method. TIA is a neutron multiplicity method based on the concept of one- and two-dimensional Rossi-alpha distributions. The main source of measurement bias in neutron multiplicity measurements at low count-rates is the impredictable variation of the high-multiplicity neutron background of spallation neutrons induced by cosmic rays. The TIA-method was therefore equipped with a special background filter, which is designed and optimized to reduce the influence of these spallation neutrons by rejecting the high-multiplicity events. The measurement results, obtained with the background correction filter outlined in this paper, prove the repeatability and validity of the TIA-method and show that multiplicity counting with the TIA-technique is applicable for masses as low as 0.1 g 240 Pu eff even at a detection efficiency of 12%. (orig.)

Kidins220/ARMS as a functional mediator of multiple receptor signalling pathways.

Science.gov (United States)

Neubrand, Veronika E; Cesca, Fabrizia; Benfenati, Fabio; Schiavo, Giampietro

2012-04-15

An increasing body of evidence suggests that several membrane receptors--in addition to activating distinct signalling cascades--also engage in substantial crosstalk with each other, thereby adjusting their signalling outcome as a function of specific input information. However, little is known about the molecular mechanisms that control their coordination and integration of downstream signalling. A protein that is likely to have a role in this process is kinase-D-interacting substrate of 220 kDa [Kidins220, also known as ankyrin repeat-rich membrane spanning (ARMS), hereafter referred to as Kidins220/ARMS]. Kidins220/ARMS is a conserved membrane protein that is preferentially expressed in the nervous system and interacts with the microtubule and actin cytoskeleton. It interacts with neurotrophin, ephrin, vascular endothelial growth factor (VEGF) and glutamate receptors, and is a common downstream target of several trophic stimuli. Kidins220/ARMS is required for neuronal differentiation and survival, and its expression levels modulate synaptic plasticity. Kidins220/ARMS knockout mice show developmental defects mainly in the nervous and cardiovascular systems, suggesting a crucial role for this protein in modulating the cross talk between different signalling pathways. In this Commentary, we summarise existing knowledge regarding the physiological functions of Kidins220/ARMS, and highlight some interesting directions for future studies on the role of this protein in health and disease.

20 CFR 220.11 - Definitions as used in this subpart.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Definitions as used in this subpart. 220.11 Section 220.11 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT..., mobility, endurance and capacity to perform physically demanding tasks, such as standing, walking, lifting...

An improved energy-range relationship for high-energy electron beams based on multiple accurate experimental and Monte Carlo data sets

International Nuclear Information System (INIS)

Sorcini, B.B.; Andreo, P.; Hyoedynmaa, S.; Brahme, A.; Bielajew, A.F.

1995-01-01

A theoretically based analytical energy-range relationship has been developed and calibrated against well established experimental and Monte Carlo calculated energy-range data. Only published experimental data with a clear statement of accuracy and method of evaluation have been used. Besides published experimental range data for different uniform media, new accurate experimental data on the practical range of high-energy electron beams in water for the energy range 10-50 MeV from accurately calibrated racetrack microtrons have been used. Largely due to the simultaneous pooling of accurate experimental and Monte Carlo data for different materials, the fit has resulted in an increased accuracy of the resultant energy-range relationship, particularly at high energies. Up to date Monte Carlo data from the latest versions of the codes ITS3 and EGS4 for absorbers of atomic numbers between four and 92 (Be, C, H 2 O, PMMA, Al, Cu, Ag, Pb and U) and incident electron energies between 1 and 100 MeV have been used as a complement where experimental data are sparse or missing. The standard deviation of the experimental data relative to the new relation is slightly larger than that of the Monte Carlo data. This is partly due to the fact that theoretically based stopping and scattering cross-sections are used both to account for the material dependence of the analytical energy-range formula and to calculate ranges with the Monte Carlo programs. For water the deviation from the traditional energy-range relation of ICRU Report 35 is only 0.5% at 20 MeV but as high as - 2.2% at 50 MeV. An improved method for divergence and ionization correction in high-energy electron beams has also been developed to enable use of a wider range of experimental results. (Author)

2 CFR 220.15 - Policy.

Science.gov (United States)

2010-01-01

... Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST PRINCIPLES FOR EDUCATIONAL INSTITUTIONS (OMB CIRCULAR A-21) § 220.15 Policy. The principles in this part are designed to provide that the... accounting principles, except where restricted or prohibited by law. Agencies are not expected to place...

49 CFR 220.49 - Radio communication used in shoving, backing or pushing movements.

Science.gov (United States)

2010-10-01

... pushing movements. 220.49 Section 220.49 Transportation Other Regulations Relating to Transportation... Wireless Communication Procedures § 220.49 Radio communication used in shoving, backing or pushing movements. When radio communication is used in connection with the shoving, backing or pushing of a train...

33 CFR 334.570 - Banana River near Orsino, Fla.; restricted area.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Banana River near Orsino, Fla... THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.570 Banana River near Orsino, Fla.; restricted area. (a) The area. That part of Banana River N of the NASA Banana River...

20 CFR 220.130 - Work experience as a vocational factor.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work experience as a vocational factor. 220.130 Section 220.130 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD... amount of walking, standing, sitting, lifting and carrying the claimant did during the work day, as well...

42 CFR 412.220 - Special treatment of certain hospitals located in Puerto Rico.

Science.gov (United States)

2010-10-01

... Puerto Rico. 412.220 Section 412.220 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT... SERVICES Prospective Payment System for Inpatient Operating Costs for Hospitals Located in Puerto Rico § 412.220 Special treatment of certain hospitals located in Puerto Rico. Subpart G of this part sets...

46 CFR 185.220 - Records of a voyage resulting in a marine casualty.

Science.gov (United States)

2010-10-01

....220 Section 185.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) OPERATIONS Marine Casualties and Voyage Records § 185.220 Records of a... officer, or person responsible for the custody thereof, shall make these records available upon request...

46 CFR 122.220 - Records of a voyage resulting in a marine casualty.

Science.gov (United States)

2010-10-01

....220 Section 122.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER... OPERATIONS Marine Casualties and Voyage Records § 122.220 Records of a voyage resulting in a marine casualty... custody thereof, shall make these records available upon request, to a duly authorized investigating...

24 CFR 570.209 - Guidelines for evaluating and selecting economic development projects.

Science.gov (United States)

2010-04-01

..., where the recreational benefit to users or members clearly outweighs employment or other benefits to low... DEVELOPMENT BLOCK GRANTS Eligible Activities § 570.209 Guidelines for evaluating and selecting economic... activities to be carried out for economic development purposes. Specifically, these guidelines are applicable...

Range-energy relations and stopping power of water, water vapour and tissue equivalent liquid for α particles over the energy range 0.5 to 8 MeV

International Nuclear Information System (INIS)

Palmer, R.B.J.; Akhavan-Rezayat, Ahmad

1978-01-01

Experimental range-energy relations are presented for alpha particles in water, water vapour and tissue equivalent liquid at energies up to 8 MeV. From these relations differential stopping powers are derived at 0.25 MeV energy intervals. Consideration is given to sources of error in the range-energy measurements and to the uncertainties that these will introduce into the stopping power values. The ratio of the differential stopping power of muscle equivalent liquid to that of water over the energy range 0.5 to 7.5 MeV is discussed in relation to the specific gravity and chemical composition of the muscle equivalent liquid. Theoretical molecular stopping power calculations based upon the Bethe formula are also presented for water. The effect of phase upon the stopping power of water is discussed. The molecular stopping power of water vapour is shown to be significantly higher than that of water for energies below 1.25 MeV and above 2.5 MeV, the ratio of the two stopping powers rising to 1.39 at 0.5 MeV and to 1.13 at 7.0 MeV. Stopping power measurements for other liquids and vapours are compared with the results for water and water vapour and some are observed to have stopping power ratios in the vapour and liquid phases which vary with energy in a similar way to water. It is suggested that there may be several factors contributing to the increased stopping power of liquids. The need for further experimental results on a wider range of liquids is stressed

Intracranial inertial cavitation threshold and thermal ablation lesion creation using MRI-guided 220-kHz focused ultrasound surgery: preclinical investigation.

Science.gov (United States)

Xu, Zhiyuan; Carlson, Carissa; Snell, John; Eames, Matt; Hananel, Arik; Lopes, M Beatriz; Raghavan, Prashant; Lee, Cheng-Chia; Yen, Chun-Po; Schlesinger, David; Kassell, Neal F; Aubry, Jean-Francois; Sheehan, Jason

2015-01-01

In biological tissues, it is known that the creation of gas bubbles (cavitation) during ultrasound exposure is more likely to occur at lower rather than higher frequencies. Upon collapsing, such bubbles can induce hemorrhage. Thus, acoustic inertial cavitation secondary to a 220-kHz MRI-guided focused ultrasound (MRgFUS) surgery is a serious safety issue, and animal studies are mandatory for laying the groundwork for the use of low-frequency systems in future clinical trials. The authors investigate here the in vivo potential thresholds of MRgFUS-induced inertial cavitation and MRgFUS-induced thermal coagulation using MRI, acoustic spectroscopy, and histology. Ten female piglets that had undergone a craniectomy were sonicated using a 220-kHz transcranial MRgFUS system over an acoustic energy range of 5600-14,000 J. For each piglet, a long-duration sonication (40-second duration) was performed on the right thalamus, and a short sonication (20-second duration) was performed on the left thalamus. An acoustic power range of 140-300 W was used for long-duration sonications and 300-700 W for short-duration sonications. Signals collected by 2 passive cavitation detectors were stored in memory during each sonication, and any subsequent cavitation activity was integrated within the bandwidth of the detectors. Real-time 2D MR thermometry was performed during the sonications. T1-weighted, T2-weighted, gradient-recalled echo, and diffusion-weighted imaging MRI was performed after treatment to assess the lesions. The piglets were killed immediately after the last series of posttreatment MR images were obtained. Their brains were harvested, and histological examinations were then performed to further evaluate the lesions. Two types of lesions were induced: thermal ablation lesions, as evidenced by an acute ischemic infarction on MRI and histology, and hemorrhagic lesions, associated with inertial cavitation. Passive cavitation signals exhibited 3 main patterns identified as

Simultaneous quantification of MTC-220 and its metabolites in beagle dog plasma by liquid chromatography-tandem mass spectrometry.

Science.gov (United States)

Liu, Xin; Zhao, Manman; Mi, Jiaqi; Liu, Zhihao; Hu, Jinping; Sheng, Li; Wang, Baolian; Li, Dan; Yang, Shuang; Li, Yan

2014-10-01

A sensitive LC-ESI-MS/MS method for simultaneous determination of MTC-220 and its metabolites (paclitaxel and MDA-linker) in dog plasma has been developed and validated. After addition of docetaxel (internal standard), plasma samples containing MTC-220, paclitaxel and MDA-linker were prepared based on a simple protein precipitation by adding two volumes of acetonitrile. The separation was performed on a ZorbaxSB-C18 column (3.5μm, 2.1mm×100mm) at a flow rate of 0.2ml/min, using acetonitrile/water containing 0.1% formic acid (v/v) as mobile phase. The detection was performed on a triple quadrupole tandem mass spectrometer equipped with electrospray ionization (ESI) by selected reaction monitoring (SRM). The MS/MS ion transit ions monitored were 1444.4→623.8 for MTC-220, 876.4→307.9 for paclitaxel, 631.2→531.2 for MDA-linker and 830.2→549.1 for the internal standard. Linear detection responses were obtained for MTC-220, paclitaxel and MDA-linker ranging from 10 to 5000, 5 to 2500 and 5 to 500ng/ml, respectively. The lower limits of quantitation (LLOQs) for MTC-220, paclitaxel and MDA-linker were 10, 5 and 5ng/ml, respectively. The intra-day and inter-day precisions (RSD, %) of the three analytes do not exceed 10.9% except for LLOQs (≤17.50), and the accuracy (RE, %) were within ±17.5% for LLOQs and ±12.6% for the others. The average recoveries of three compounds were greater than 85.0%. The analytes were proved to be stable during all sample storage, preparation and analytic procedures. The validated method was successfully applied to pharmacokinetic studies of MTC-220 and its metabolites in beagle dogs after intravenous infusion of MTC-220 at 2.5mg/kg. Copyright © 2014 Elsevier B.V. All rights reserved.

75 FR 36471 - Seventh Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-06-25

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Committee 220: Automatic Flight Guidance and [[Page 36472

20 CFR 220.184 - If the annuitant becomes disabled by another impairment(s).

Science.gov (United States)

2010-04-01

... impairment(s). 220.184 Section 220.184 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE... Activity or Medical Improvement § 220.184 If the annuitant becomes disabled by another impairment(s). If a new severe impairment(s) begins in or before the month in which the last impairment(s) ends, the Board...

Assessment of tidal range energy resources based on flux conservation in Jiantiao Bay, China

Science.gov (United States)

Du, Min; Wu, He; Yu, Huaming; Lv, Ting; Li, Jiangyu; Yu, Yujun

2017-12-01

La Rance Tidal Range Power Station in France and Jiangxia Tidal Range Power Station in China have been both long-term successful commercialized operations as kind of role models for public at large for more than 40 years. The Sihwa Lake Tidal Range Power Station in South Korea has also developed to be the largest marine renewable power station with its installed capacity 254 MW since 2010. These practical applications prove that the tidal range energy as one kind of marine renewable energy exploitation and utilization technology is becoming more and more mature and it is used more and more widely. However, the assessment of the tidal range energy resources is not well developed nowadays. This paper summarizes the main problems in tidal range power resource assessment, gives a brief introduction to tidal potential energy theory, and then we present an analyzed and estimated method based on the tide numerical modeling. The technical characteristics and applicability of these two approaches are compared with each other. Furthermore, based on the theory of tidal range energy generation combined with flux conservation, this paper proposes a new assessment method that include a series of evaluation parameters and it can be easily operated to calculate the tidal range energy of the sea. Finally, this method is applied on assessment of the tidal range power energy of the Jiantiao Harbor in Zhejiang Province, China for demonstration and examination.

NEUTRON-PROTON EFFECTIVE RANGE PARAMETERS AND ZERO-ENERGY SHAPE DEPENDENCE.

Energy Technology Data Exchange (ETDEWEB)

HACKENBURG, R.W.

2005-06-01

A completely model-independent effective range theory fit to available, unpolarized, np scattering data below 3 MeV determines the zero-energy free proton cross section {sigma}{sub 0} = 20.4287 {+-} 0.0078 b, the singlet apparent effective range r{sub s} = 2.754 {+-} 0.018{sub stat} {+-} 0.056{sub syst} fm, and improves the error slightly on the parahydrogen coherent scattering length, a{sub c} = -3.7406 {+-} 0.0010 fm. The triplet and singlet scattering lengths and the triplet mixed effective range are calculated to be a{sub t} = 5.4114 {+-} 0.0015 fm, a{sub s} = -23.7153 {+-} 0.0043 fm, and {rho}{sub t}(0,-{epsilon}{sub t}) = 1.7468 {+-} 0.0019 fm. The model-independent analysis also determines the zero-energy effective ranges by treating them as separate fit parameters without the constraint from the deuteron binding energy {epsilon}{sub t}. These are determined to be {rho}{sub t}(0,0) = 1.705 {+-} 0.023 fm and {rho}{sub s}(0,0) = 2.665 {+-} 0.056 fm. This determination of {rho}{sub t}(0,0) and {rho}{sub s}(0,0) is most sensitive to the sparse data between about 20 and 600 keV, where the correlation between the determined values of {rho}{sub t}(0,0) and {rho}{sub s}(0,0) is at a minimum. This correlation is responsible for the large systematic error in r{sub s}. More precise data in this range are needed. The present data do not event determine (with confidence) that {rho}{sub t}(0,0) {ne} {rho}{sub t}(0, -{epsilon}{sub t}), referred to here as ''zero-energy shape dependence''. The widely used measurement of {sigma}{sub 0} = 20.491 {+-} 0.014 b from W. Dilg, Phys. Rev. C 11, 103 (1975), is argued to be in error.

75 FR 59326 - Eighth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-09-27

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include: Welcome...

Gamma-ray astronomy in the medium energy (10-50 MeV) range

International Nuclear Information System (INIS)

Kniffen, D.A.; Bertsch, D.L.; Palmeira, R.A.R.; Rao, K.R.

1977-01-01

Gamma-ray astronomy in the medium energy (10-50 MeV) range can provide unique information with which to study many astrophysical problems. Observations in the 10-50 MeV range provide the cleanest window with which to view the isotropic diffuse component of the radiation and to study the possible cosmological implications of the spectrum. For the study of compact sources, this is the important region between the X-ray sky and the vastly different γ-ray sky seen by SAS-2 and COS-B. To understand the implications of medium energy γ-ray astronomy to the study of the galactic diffuse γ-radiation, the model developed to explain the high energy γ-ray observations of SAS-2 is extended to the medium energy range. This work illustrates the importance of medium energy γ-ray astronomy for studying the electromagnetic component of the galactic cosmic rays. To observe the medium energy component of the intense galactic center γ-ray emission, two balloon flights of a medium energy γ-ray spark chamber telescope were flown in Brazil in 1975. These results indicate the emission is higher than previously thought and above the predictions of the theoretical model

24 CFR 180.220 - Separation of functions.

Science.gov (United States)

2010-04-01

... AND BUSINESS OPPORTUNITY CONSOLIDATED HUD HEARING PROCEDURES FOR CIVIL RIGHTS MATTERS Administrative Law Judge § 180.220 Separation of functions. No officer, employee, or agent of the Federal Government...

76 FR 22163 - Tenth Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2011-04-20

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220 meeting: Automatic Flight Guidance and Control. SUMMARY: The FAA is... hereby given for a Special Committee 220, Automatic Flight Guidance and Control. Agenda Tuesday May 10...

75 FR 15770 - Sixth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-03-30

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... hereby given for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will...

75 FR 80886 - Ninth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-12-23

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include...

Photoproduction in the Energy Range 70-200 GeV

CERN Multimedia

2002-01-01

This experiment continues the photoproduction studies of WA4 and WA57 up to the higher energies made available by the upgrading of the West Hall. An electron beam of energy 200 GeV is used to produce tagged photons in the range 65-180 GeV; The photon beam is incident on a 60 cm liquid hydrogen target in the Omega Spectrometer. A Ring Image Cherenkov detector provides pion/kaon separation up to 150 GeV/c. The Transition Radiation Detector extends the charged pion identification to the momentum range from about 80 GeV/c upwards. The large lead/liquid scintillator calorimeter built by the WA70 collaboration and the new lead/scintillating fibre det (Plug) are used for the detection of the $\\gamma$ rays produced by the interactions of the primary photons in the hydrogen target. \\\\ \\\\ The aim is to make a survey of photoproduction reactions up to photon energies of 200 GeV. The large aperture of the Omega Spectrometer will particularly enable study of fragmentation of the photon to states of high mass, up to @C 9 G...

Exploring the range of energy savings likely from energy efficiency retrofit measures in Ireland's residential sector

International Nuclear Information System (INIS)

Dineen, D.; Ó Gallachóir, B.P.

2017-01-01

This paper estimates the potential energy savings in the Irish residential sector by 2020 due to the introduction of an ambitious retrofit programme. We estimate the technical energy savings potential of retrofit measures targeting energy efficiency of the space and water heating end uses of the 2011 stock of residential dwellings between 2012 and 2020. We build eight separate scenarios, varying the number of dwellings retrofitted and the depth of retrofit carried out in order to investigate the range of energy savings possible. In 2020 the estimated technical savings potential lies in the range from 1713 GWh to 10,817 GWh, but is more likely to fall within the lower end of this range, i.e. between 1700 and 4360 GWh. When rebound effects are taken into account this reduces further to 1100 GWh and 2800 GWh per annum. The purpose of this paper was to test the robustness of the NEEAP target savings for residential retrofit, i.e. 3000 GWh by 2020. We conclude that this target is technically feasible but very challenging and unlikely to be achieved based on progress to date. It will require a significant shift towards deeper retrofit measures compared to what has been achieved by previous schemes. - Highlights: • Paper estimates range of energy savings likely from Irish residential retrofit. • Achieving NEEAP target savings of 3000 GWh by 2020 is feasible but very challenging. • Likely savings of 1100–2800 GWh per annum in 2020, including rebound. • NEEAP target unlikely to be achieved based on current trends.

Alpha Beam Energy Determination Using a Range Measuring Device for Radioisotope Production

Energy Technology Data Exchange (ETDEWEB)

Choi, Jun Yong; Kim, Byeon Gil; Hong, Seung Pyo; Kim, Ran Young; Chun, Kwon Soo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

2016-05-15

The threshold energy of the {sup 209}Bi(α,3n){sup 210} At reaction is at about 30MeV. Our laboratory suggested an energy measurement method to confirm the proton-beam's energy by using a range measurement device. The experiment was performed energy measurement of alpha beam. The alpha beam of energy 29 MeV has been extracted from the cyclotron for the production of {sup 211}At. This device was composed of four parts: an absorber, a drive shaft, and a servo motor and a Faraday cup. The drive shaft was mounted on the absorber and connects with the axis of the servo motor and rotates linearly and circularly by this servo motor. A Faraday cup is for measuring the beam flux. As this drive shaft rotates, the thickness of the absorber varies depending on the rotation angle of the absorber. The energy of the alpha particle accelerated and extracted from MC-50 cyclotron was calculated with the measurement of the particle range in Al foil and using ASTAR, SRIM, MCNPX software. There were a little discrepancy between the expected energy and the calculated energy within the 0.5MeV error range. We have a plan to make an experiment with various alpha particle energies and another methodology, for example, the cross section measurement of the nuclear reaction.

75 FR 3959 - Fifth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-01-25

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is issuing this notice to advise the public of a meeting of RTCA Special Committee 220: Automatic Flight...

Long-range Coulomb interactions in low energy (e,2e) data

International Nuclear Information System (INIS)

Waterhouse, D.

2000-01-01

Full text: Proper treatment of long-range Coulomb interactions has confounded atomic collision theory since Schrodinger first presented a quantum-mechanical model for atomic interactions. The long-range Coulomb interactions are difficult to include in models in a way that treats the interaction sufficiently well but at the same time ensures the calculation remains tractable. An innovative application of an existing multi-parameter (e,2e) data acquisition system will be described. To clarify the effects of long-range Coulomb interactions, we will report the correlations and interactions that occur at low energy, observed by studying the energy sharing between outgoing electrons in the electron-impact ionisation of krypton

7 CFR 220.7 - Requirements for participation.

Science.gov (United States)

2010-01-01

... items such a grade, purchase units, style, condition, weight, ingredients, formulations, and delivery... citations affecting § 220.7, see the List of CFR Sections Affected, which appears in the Finding Aids...

A preliminary investigation of 222Rn and 220Rn levels in non-uranium mines in China

International Nuclear Information System (INIS)

Shang Bing; Cui Hongxing; Wu Yunyun; Zhang Qingzhao; Su Xu

2008-01-01

Objective: To measure levels of 222 Rn and 220 Rn in typical non-uranium mines, China, and to estimate dose from the occupational radon exposure in the miners. Methods: Using typical sampling scheme, 44 mines were selected in 12 provinces, which can be classified into 4 categories and 17 types of mines. The radon-thoron discriminative detectors were used to measure 222 Rn and 220 Rn concentrations in mines. Result: The concentration of 222 Rn or 220 Rn was log-normally distributed. The arithmetic mean (AM) concentration and geometric mean (GM) concentration of 222 Rn and 220 Rn in 25 metal mines (n=147) were estimated to be (1211 ±2359) Bq/m 3 (AM) and (311 ± 5.5) Bq/m 3 (GM), and (269 ±700) Bq/m 3 (AM) and (71 ± 4.4)Bq/m 3 (GM), respectively. The mean concentrations of 222 Rn and 220 Rn in 18 non-metal mines (n=118) were (98 ± 207) Bq/m 3 (AM) and(55 ± 2.5) Bq/m 3 (GM), and (60 ± 76) Bq/m 3 (AM) and (38 ± 2.4) Bq/m 3 (GM) respectively. In total, we measured 222 Rn concentration in 44 underground mines, 6 of them, accounted for 15%, with the mean radon concentration exceeding 1000 Bqm -3 (limit of workplace in China). Approximately 7% of radon concentration in mines measured were higher than 3700 Bq/m 3 (current limit in uranium mine in China), some points even exceeded 10 000 Bq/m 3 . Based on this typical measurements, the equilibrium factor for 222 Rn was estimated to be 0.33 ± 0.15 in underground mines and 0.47 ±0.18 in nearby houses. Equilibrium factor for 220 Rn ranged from 0.001 to 0.032. Using the data obtained in this typical survey, the average annual effective dose of underground miners exposed to radon and thoron was estimated to be 8.15 mSv/a. Conclusions: High levels of 222 Rn exists in metal mines, such as copper, tin, lead and zinc, gold, and aluminum mines among others. More study and administrative measures are needed to address the radiation protection of workers occupationally exposed to high radon in mines. (authors)

24 CFR 570.614 - Architectural Barriers Act and the Americans with Disabilities Act.

Science.gov (United States)

2010-04-01

... with disabilities. Further, the ADA requires the removal of architectural barriers and communication... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Architectural Barriers Act and the... GRANTS Other Program Requirements § 570.614 Architectural Barriers Act and the Americans with...

Laser driven single shock compression of fluid deuterium from 45 to 220 GPa

Energy Technology Data Exchange (ETDEWEB)

Hicks, D; Boehly, T; Celliers, P; Eggert, J; Moon, S; Meyerhofer, D; Collins, G

2008-03-23

The compression {eta} of liquid deuterium between 45 and 220 GPa under laser-driven shock loading has been measured using impedance matching to an aluminum (Al) standard. An Al impedance match model derived from a best fit to absolute Hugoniot data has been used to quantify and minimize the systematic errors caused by uncertainties in the high-pressure Al equation of state. In deuterium below 100 GPa results show that {eta} {approx_equal} 4.2, in agreement with previous impedance match data from magnetically-driven flyer and convergent-explosive shock wave experiments; between 100 and 220 GPa {eta} reaches a maximum of {approx}5.0, less than the 6-fold compression observed on the earliest laser-shock experiments but greater than expected from simple extrapolations of lower pressure data. Previous laser-driven double-shock results are found to be in good agreement with these single-shock measurements over the entire range under study. Both sets of laser-shock data indicate that deuterium undergoes an abrupt increase in compression at around 110 GPa.

Thoron (220Rn) in the indoor environment and work places

Science.gov (United States)

Ramachandran, T. V.; Sahoo, B. K.

2009-08-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222Rn and its progeny, there was a great upsurge of interest in the measurement of 222Rn in the environment. Subsequently, considerable data is being generated on the levels of 222Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220Rn in indoors and workplace environment is scaree due to the genral perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon (222Rn), and thoron (220Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222Rn, 220Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232Th is being handled is being summarized. Methods of measurement and

Thoron (220Rn) in the indoor environment and work places

International Nuclear Information System (INIS)

Ramchandran, T.V.; Sahoo, B.K.

2009-01-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scaree due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220 Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220 Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232 Th is being handled is being summarized. Methods of

Thoron (220Rn) in the indoor atmospheric environment

International Nuclear Information System (INIS)

Ramachandran, T.V.

2006-01-01

Naturally occurring background radiation is a topic, which has evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Many locations around the world have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It has been estimated that inhalation of 222 Rn, 2 20 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. In the Indian context, in an earlier national survey, the external gamma radiation dose rates have been more or less well mapped using thermo luminescent dosimeters covering more than 214 locations, which has yielded a national average of 775 mGy/y. Of this, nearly 48.7% contribution of the dose rate is from 40 K and the rest from the uranium (33.6%) and thorium (17.7%) series. A good database pertaining to the country wide levels of uranium, thorium and potassium in geological materials also exists. Thus, there exists a good database on the total external gamma radiation level across the country. Since the contribution from inhalation of 222 Rn, 220 Rn and their short lived progenies contributes more than 54% of the total background radiation dose, it was necessary to supplement the external component with inhalation component. This component is not adequately estimated for the country so far on national level. With this in mind, a national survey has been executed by this center involving a large number of universities and other allied research institutions from different parts of the country for the estimation of inhalation component of the dose

36 CFR 220.4 - General requirements.

Science.gov (United States)

2010-07-01

... natural and physical environment and the relationship of people with that environment (see 40 CFR 1508.14... for environmental assessments, findings of no significant impact and categorical exclusions (FSM 1950... ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.4 General requirements. (a) Proposed actions subject to the...

Mean range and energy of 28Si ions some Makrofol track detectors

International Nuclear Information System (INIS)

Shyam, S.; Mishra, R.; Tripathy, S.P.; Mawar, A.K.; Dwivedi, K.K.; Khathing, D.T.; Srivastava, A.; Avasthi, D.K.

2000-01-01

The rate of energy loss of the impinging ion as it passes through succeeding layers of the target material gives information regarding the nature of material and helps to calculate the range of the ions in a thick target in which the ions are stopped. Here the range, energy loss of 118 MeV 28 Si were measured in Makrofol-N, Makrofol-G and Makrofol-KG, using nuclear track technique. The experimental range data are compared with the theoretical values obtained from different computer codes. (author)

Analysis for mass distribution of proton-induced reactions in intermediate energy range

CERN Document Server

Xiao Yu Heng

2002-01-01

The mass and charge distribution of residual products produced in the spallation reactions needs to be studied, because it can provide useful information for the disposal of nuclear waste and residual radioactivity generated by the spallation neutron target system. In present work, the Many State Dynamical Model (MSDM) is based on the Cascade-Exciton Model (CEM). The authors use it to investigate the mass distribution of Nb, Au and Pb proton-induced reactions in energy range from 100 MeV to 3 GeV. The agreement between the MSDM simulations and the measured data is good in this energy range, and deviations mainly show up in the mass range of 90 - 150 for the high energy proton incident upon Au and Pb

22 CFR 1508.220 - Are any procurement contracts included as covered transactions?

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Are any procurement contracts included as covered transactions? 1508.220 Section 1508.220 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION.... (3) The contract is for federally-required audit services. ...

Dynamic interaction of p220NPAT and CBP/p300 promotes S-phase entry

International Nuclear Information System (INIS)

Wang, Aiyan; Ikura, Tsuyoshi; Eto, Kazuhiro; Ota, Masato S.

2004-01-01

Cajal bodies contain cyclin E/cdk2 and the substrate p220 NPAT to regulate the transcription of histones, which is essential for cell proliferation, however, recent mouse knockout studies indicate that cyclin E and cdk2 are dispensable for these events. Because the CBP/p300 histone acetyltransferase are also known to be involved in cell proliferation, we examined the molecular and functional interactions of p220 NPAT with the CBP/p300 at the G1/S boundary as cell cycle regulators. The subnuclear localization of p220 NPAT and CBP/p300 proteins showed that their foci partially overlapped in a cell cycle dependent manner. Overexpression of p220 NPAT and CBP/p300 cooperatively enhanced G1/S transition and DNA synthesis even without cdk2 phosphorylation site. Finally, molecular alignment analysis indicated that p220 NPAT contains several potential substrate sites for CBP/p300. Overall, our findings demonstrate that p220 NPAT and CBP/p300 form a transient complex at the G1/S boundary to play cooperative roles to promote the S-phase entry

Measurement of 222Rn, 220Rn and their decay products in high background radiation area in Yangjiang

International Nuclear Information System (INIS)

Yuan Yongling

2000-01-01

The investigators have measured concentrations of Rn-222, rn-220 and their decay products in high background radiation area (HBRA) and the neighboring control area (CA), as well as the equilibrium factor F for Rn-222. The average concentrations of Rn-222 in the air indoors and outdoors in the HBRA are 42.6 and 17.3 Bq/m 3 respectively, and CA, 13.2 and 11.7 Bq/m 3 , respectively. The average α-potential energy concentrations for daughters of Rn-222 indoors and outdoors in HBRA are 0.109 and 0.051 μJ/m 3 , CA, 0.045 and 0.041 μJ/m 3 , respectively. The average α-potential energy values for daughters of Rn-220 indoor and outdoor in HBRA are 0.249 and 0.053 μJ/m 3 , CA, 0.051 and 0.025 μJ/m 3 , respectively. With regard to equilibrium factor F for Rn-222, the authors have also measured 52 points of 10 hamlets in HBRA (indoor 31, outdoor 21), 9 points of 2 hamlets in CA (indoor 5, outdoor 4), respectively. These figures are 0.46, 0.53, 0.62 and 0.64, respectively

22 CFR 1006.220 - Are any procurement contracts included as covered transactions?

Science.gov (United States)

2010-04-01

... covered transactions? 1006.220 Section 1006.220 Foreign Relations INTER-AMERICAN FOUNDATION GOVERNMENTWIDE... the consent of a(n) Inter-American Foundation official. In that case, the contract, regardless of the... appendix to this part. (3) The contract is for federally-required audit services. ...

Alternative separation of exchange and correlation energies in range-separated density-functional perturbation theory

DEFF Research Database (Denmark)

Cornaton, Y.; Stoyanova, A.; Jensen, Hans Jørgen Aagaard

2013-01-01

of the noninteracting Kohn-Sham one. When second-order corrections to the density are neglected, the energy expression reduces to a range-separated double-hybrid (RSDH) type of functional, RSDHf, where "f" stands for "full-range integrals" as the regular full-range interaction appears explicitly in the energy...

Annual effective dose equivalents arising from inhalation of 222Rn, 220Rn and their decay products in high background radiation area in China

International Nuclear Information System (INIS)

Zhang Zhonghou

1985-01-01

The author presents the data of on-the-sport investigations in the high background radiation area in Yangjiang County in 1975 and 1981. Monazite sand is contained in the soil of this area. The average concentrations of 222 Rn in the air indoors and out doors of the high background radiation area are 31.8 and 16.4 Bqm -3 respectively, which are equal to 2.9 and 1.5 times the average concentrations in the control area. The average concentrations of 220 Rn in the air indoors and outdoors of the high background area are 167.5 and 18.4 Bqm -3 , corresponding to 9.6 and 4.8 times those of the control area respectively. The average potential alpha energy concentrations for daughters of 222 Rn indoors and outdoors are 0.1 and 0.097 μJm -3 , which are equal to 2.6 and 2.2 times those of the control are respectively. The average potential alpha energy concentrations for daughters of 220 Rn indoors and outdoors are 0.255 and 0.053 μJm -3 , corresponding to 3.7 and 2.7 times those of the control area respectively. The average annual effective dose equivalents arising from inhalation of 222 Rn, 220 Rn and their decay products in high background radiation area are estimated to be 2.8 mSv per caput, in which 40.5% arise from 220 Rn and its decay products. This result is about 3 times that in the neighboring control area

Survey of trapped low energy electrons near the inner boundary of the inner radiation zone from the OSO-7

International Nuclear Information System (INIS)

Neighbors, J.E.; Clark, G.W.

1974-01-01

Data from the MIT x-ray experiment on the OSO-7 satellite were used to delineate the regions in B-L and geographic spaces where trapped radiation was encountered. The results pertain specifically to electrons with energies in a range of 10 keV centered on 55 keV which were encountered in an orbit between altitudes of 330 and 570 km and latitudes of +-33.3 0 . A typical pitch angle distribution is fitted by a Gaussian with a FWHM of 28 degrees. (U.S.)

High- and middle-energy geothermics

International Nuclear Information System (INIS)

Anon.

1995-01-01

High and middle energy geothermal resources correspond to temperature intervals of 220-350 C and 90-180 C, respectively, and are both exploited for electricity production. Exploitation techniques and applications of high and of middle energy geothermics are different. High energy geothermics is encountered in active volcanic and tectonic zones, such as the circum-Pacific fire-belt, the lesser Antilles, the peri-Mediterranean Alpine chain or the African rift zone. The geothermal steam is directly expanded in a turbine protected against gas and minerals corrosion. About 350 high energy plants are distributed in more than 20 different countries and represent 6000 M We. The cost of high energy installed geothermal kWh ranges from 0.20 to 0.50 French Francs. Middle energy geothermics is encountered in sedimentary basins (between 2000 and 4000 m of depth), in localized fractured zones or at lower depth in the high energy geothermal fields. Heat exchangers with organic fluid Rankine cycle technology is used to produce electricity. Unit power of middle energy plants generally ranges from few hundreds of k W to few MW and correspond to a worldwide installed power of about 400 M We. The annual progression of geothermal installed power is estimated to 4 to 8 % in the next years and concerns principally the circum-Pacific countries. In France, geothermal resources are mainly localized in overseas departments. (J.S.). 3 photos

CMOS Active Pixel Sensors as energy-range detectors for proton Computed Tomography

International Nuclear Information System (INIS)

Esposito, M.; Waltham, C.; Allinson, N.M.; Anaxagoras, T.; Evans, P.M.; Poludniowski, G.; Green, S.; Parker, D.J.; Price, T.; Manolopoulos, S.; Nieto-Camero, J.

2015-01-01

Since the first proof of concept in the early 70s, a number of technologies has been proposed to perform proton CT (pCT), as a means of mapping tissue stopping power for accurate treatment planning in proton therapy. Previous prototypes of energy-range detectors for pCT have been mainly based on the use of scintillator-based calorimeters, to measure proton residual energy after passing through the patient. However, such an approach is limited by the need for only a single proton passing through the energy-range detector in a read-out cycle. A novel approach to this problem could be the use of pixelated detectors, where the independent read-out of each pixel allows to measure simultaneously the residual energy of a number of protons in the same read-out cycle, facilitating a faster and more efficient pCT scan. This paper investigates the suitability of CMOS Active Pixel Sensors (APSs) to track individual protons as they go through a number of CMOS layers, forming an energy-range telescope. Measurements performed at the iThemba Laboratories will be presented and analysed in terms of correlation, to confirm capability of proton tracking for CMOS APSs

CMOS Active Pixel Sensors as energy-range detectors for proton Computed Tomography.

Science.gov (United States)

Esposito, M; Anaxagoras, T; Evans, P M; Green, S; Manolopoulos, S; Nieto-Camero, J; Parker, D J; Poludniowski, G; Price, T; Waltham, C; Allinson, N M

2015-06-03

Since the first proof of concept in the early 70s, a number of technologies has been proposed to perform proton CT (pCT), as a means of mapping tissue stopping power for accurate treatment planning in proton therapy. Previous prototypes of energy-range detectors for pCT have been mainly based on the use of scintillator-based calorimeters, to measure proton residual energy after passing through the patient. However, such an approach is limited by the need for only a single proton passing through the energy-range detector in a read-out cycle. A novel approach to this problem could be the use of pixelated detectors, where the independent read-out of each pixel allows to measure simultaneously the residual energy of a number of protons in the same read-out cycle, facilitating a faster and more efficient pCT scan. This paper investigates the suitability of CMOS Active Pixel Sensors (APSs) to track individual protons as they go through a number of CMOS layers, forming an energy-range telescope. Measurements performed at the iThemba Laboratories will be presented and analysed in terms of correlation, to confirm capability of proton tracking for CMOS APSs.

COREL, Ion Implantation in Solids, Range, Straggling Using Thomas-Fermi Cross-Sections. RASE4, Ion Implantation in Solids, Range, Straggling, Energy Deposition, Recoils. DAMG2, Ion Implantation in Solids, Energy Deposition Distribution with Recoils

International Nuclear Information System (INIS)

Brice, D. K.

1979-01-01

1 - Description of problem or function: COREL calculates the final average projected range, standard deviation in projected range, standard deviation in locations transverse to projected range, and average range along path for energetic atomic projectiles incident on amorphous targets or crystalline targets oriented such that the projectiles are not incident along low index crystallographic axes or planes. RASE4 calculates the instantaneous average projected range, standard deviation in projected range, standard deviation in locations transverse to projected range, and average range along path for energetic atomic projectiles incident on amorphous targets or crystalline targets oriented such that the projectiles are not incident along low index crystallographic axes or planes. RASE4 also calculates the instantaneous rate at which the projectile is depositing energy into atomic processes (damage) and into electronic processes (electronic excitation), the average range of target atom recoils projected onto the direction of motion of the projectiles, and the standard deviation in the recoil projected range. DAMG2 calculates the distribution in depth of the energy deposited into atomic processes (damage), electronic processes (electronic excitation), or other energy-dependent quality produced by energetic atomic projectiles incident on amorphous targets or crystalline targets oriented such that the projectiles are not incident along low index crystallographic axes or planes. 2 - Method of solution: COREL: The truncated differential equation which governs the several variables being sought is solved through second-order by trapezoidal integration. The energy-dependent coefficients in the equation are obtained by rectangular integration over the Thomas-Fermi elastic scattering cross section. RASE4: The truncated differential equation which governs the range and straggling variables is solved through second-order by trapezoidal integration. The energy

Prediction of the metabolizable energy requirements of free-range laying hens.

Science.gov (United States)

Brainer, M M A; Rabello, C B V; Santos, M J B; Lopes, C C; Ludke, J V; Silva, J H V; Lima, R A

2016-01-01

This experiment was conducted with the aim of estimating the ME requirements of free-range laying hens for maintenance, weight gain, and egg production. These experiments were performed to develop an energy requirement prediction equation by using the comparative slaughter technique and the total excreta collection method. Regression equations were used to relate the energy intake, the energy retained in the body and eggs, and the heat production of the hens. These relationships were used to determine the daily ME requirement for maintenance, the efficiency energy utilization above the requirements for maintenance, and the NE requirement for maintenance. The requirement for weight gain was estimated from the energy content of the carcass, and the diet's efficiency energy utilization was determined from the weight gain, which was measured during weekly slaughter. The requirement for egg production was estimated by considering the energy content of the eggs and the efficiency of energy deposition in the eggs. The requirement and efficiency energy utilization for maintenance were 121.8 kcal ME/(kg∙d)and 0.68, respectively. Similarly, the NE requirement for maintenance was 82.4 kcal ME/(kg∙d), and the efficiency energy utilization above maintenance was 0.61. Because the carcass body weight and energy did not increase during the trial, the weight gain could not be estimated. The requirements for egg production requirement and efficiency energy utilization for egg production were 2.48 kcal/g and 0.61, respectively. The following energy prediction equation for free-range laying hens (without weight gain) was developed: ME /(hen ∙ d) = 121.8 × W + 2.48 × EM, in which W = body weight (kg) and EM = egg mass (g/[hen ∙ d]).

Scientific Opinion on Flavouring Group Evaluation 220 Revision 3 (FGE.220Rev3): Consideration of genotoxic potential for α,β-unsaturated 3(2H)-Furanones from subgroup 4.4 of FGE.19

DEFF Research Database (Denmark)

Beltoft, Vibe Meister; Nørby, Karin Kristiane

The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 10 flavouring substances from FGE.19 subgroup 4.4, in the Flavouring Group Evaluation 220 (FGE.220). FGE.220 is subdivided...... into two subgroups: subgroup 4.4a containing [FL-no: 13.089, 13.117, 13.119, 13.157 and 13.175] and subgroup 4.4b containing [13.010, 13.084 and 13.085, 13.099 and 13.176]. For both subgroups the Panel concluded that the genotoxicity alert could not be ruled out based on the data available and accordingly...... additional genotoxicity data were requested. In FGE.220, Revision 1, the Panel concluded that for the substances in subgroup 4.4b there is no concern for genotoxicity. In FGE.220, Revision 2, the Panel evaluated genotoxicity studies on two representative substances of subgroup 4.4a: 2,5-dimethylfuran-3(2H...

40 CFR 80.220 - What are the downstream standards for GPA gasoline?

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 16 2010-07-01 2010-07-01 false What are the downstream standards for GPA gasoline? 80.220 Section 80.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... downstream location other than at a retail outlet or wholesale purchaser-consumer facility, and during the...

32 CFR 37.220 - How involved should the Government program official be in the project?

Science.gov (United States)

2010-07-01

... official be in the project? 37.220 Section 37.220 National Defense Department of Defense OFFICE OF THE... Technology Investment Agreements § 37.220 How involved should the Government program official be in the project? (a) TIAs are used to carry out cooperative relationships between the Federal Government and the...

Ion implantation range and energy deposition codes COREL, RASE4, and DAMG2

International Nuclear Information System (INIS)

Brice, D.K.

1977-07-01

The FORTRAN codes COREL, RASE4 and DAMG2 can be used to calculate quantities associated with ion implantation range and energy deposition distributions within an amorphous target, or for ions incident far from low index directions and planes in crystalline targets. RASE4 calculates the projected range, R/sub p/, the root mean square spread in the projected range, ΔR/sub p/, and the root mean square spread of the distribution perpendicular to the projected range ΔR/sub perpendicular to/. These parameters are calculated as a function of incident ion energy, E, and the instantaneous energy of the ion, E'. They are sufficient to determine the three dimensional spatial distribution of the ions in the target in the Gaussian approximation when the depth distribution is independent of the lateral distribution. RASE4 can perform these calculations for targets having up to four different component atomic species. The code COREL is a short, economical version of RASE4 which calculates the range and straggling variables for E' = 0. Its primary use in the present package is to provide the average range and straggling variables for recoiling target atoms which are created by the incident ion. This information is used by RASE4 in calculating the redistribution of deposited energy by the target atom recoils. The code DAMG2 uses the output from RASE4 to calculate the depth distribution of energy deposition into either atomic processes or electronic processes. With other input DAMG2 can be used to calculate the depth distribution of any energy dependent interaction between the incident ions and target atoms. This report documents the basic theory behind COREL, RASE4 and DAMG2, including a description of codes, listings, and complete instructions for using the codes, and their limitations

Daily energy expenditure in free-ranging Gopher Tortoises (Gopherus polyphemus)

Science.gov (United States)

Jodice, P.G.R.; Epperson, D.M.; Visser, G. Henk

2006-01-01

Studies of ecological energetics in chelonians are rare. Here, we report the first measurements of daily energy expenditure (DEE) and water influx rates (WIRs) in free-ranging adult Gopher Tortoises (Gopherus polyphemus). We used the doubly labeled water (DLW) method to measure DEE in six adult tortoises during the non-breeding season in south-central Mississippi, USA. Tortoise DEE ranged from 76.7-187.5 kj/day and WIR ranged from 30.6-93.1 ml H2O/day. Daily energy expenditure did not differ between the sexes, but DEE was positively related to body mass. Water influx rates varied with the interaction of sex and body mass. We used a log/log regression model to assess the allometric relationship between DEE and body mass for Gopher Tortoises, Desert Tortoises (Gopherus agassizii), and Box Turtles (Terrapene carolina), the only chelonians for which DEE has been measured. The slope of this allometric model (0.626) was less than that previously calculated for herbivorous reptiles (0.813), suggesting that chelonians may expend energy at a slower rate per unit of body mass compared to other herbivorous reptiles. We used retrospective power analyses and data from the DLW isotope analyses to develop guidelines for sample sizes and duration of measurement intervals, respectively, for larger-scale energetic studies in this species. ?? 2006 by the American Society of Ichthyologists and Herpetologists.

Range-energy relation, range straggling and response function of CsI(Tl), BGO and GSO(Ce) scintillators for light ions

CERN Document Server

Avdeichikov, V; Jakobsson, B; Rodin, A M; Ter-Akopian, G M

2000-01-01

Range-energy relations and range straggling of sup 1 sup , sup 2 sup , sup 3 H and sup 4 sup , sup 6 He isotopes with the energy approx 50A MeV are measured for the CsI(Tl), BGO and GSO(Ce) scintillators with an accuracy better than 0.2% and 5%, respectively. The Si-Sci/PD telescope was exposed to secondary beams from the mass separator ACCULINNA. The experimental technique is based on the registration of the 'jump' in the amplitude of the photodiode signal for ions passing through the scintillation crystal. Light response of the scintillators for ions 1<=Z<=4 is measured in energy range (5-50)A MeV, the results are in good agreement with calculations based on Birks model. The energy loss straggling for particles with DELTA E/E=0.01-0.50 and mass up to A=10 in 286 mu m DELTA E silicon detector is studied and compared with theoretical prescriptions. The results allow a precise absolute calibration of the scintillation crystal and to optimize the particle identification by the DELTA E-E(Sci/PD) method.

Alternative separation of exchange and correlation energies in multi-configuration range-separated density-functional theory.

Science.gov (United States)

Stoyanova, Alexandrina; Teale, Andrew M; Toulouse, Julien; Helgaker, Trygve; Fromager, Emmanuel

2013-10-07

The alternative separation of exchange and correlation energies proposed by Toulouse et al. [Theor. Chem. Acc. 114, 305 (2005)] is explored in the context of multi-configuration range-separated density-functional theory. The new decomposition of the short-range exchange-correlation energy relies on the auxiliary long-range interacting wavefunction rather than the Kohn-Sham (KS) determinant. The advantage, relative to the traditional KS decomposition, is that the wavefunction part of the energy is now computed with the regular (fully interacting) Hamiltonian. One potential drawback is that, because of double counting, the wavefunction used to compute the energy cannot be obtained by minimizing the energy expression with respect to the wavefunction parameters. The problem is overcome by using short-range optimized effective potentials (OEPs). The resulting combination of OEP techniques with wavefunction theory has been investigated in this work, at the Hartree-Fock (HF) and multi-configuration self-consistent-field (MCSCF) levels. In the HF case, an analytical expression for the energy gradient has been derived and implemented. Calculations have been performed within the short-range local density approximation on H2, N2, Li2, and H2O. Significant improvements in binding energies are obtained with the new decomposition of the short-range energy. The importance of optimizing the short-range OEP at the MCSCF level when static correlation becomes significant has also been demonstrated for H2, using a finite-difference gradient. The implementation of the analytical gradient for MCSCF wavefunctions is currently in progress.

Monte Carlo simulation of semiconductor detector response to "2"2"2Rn and "2"2"0Rn environments

International Nuclear Information System (INIS)

Irlinger, J.; Trinkl, S.; Wielunksi, M.; Tschiersch, J.; Rühm, W.

2016-01-01

A new electronic radon/thoron monitor employing semiconductor detectors based on a passive diffusion chamber design has been recently developed at the Helmholtz Zentrum München (HMGU). This device allows for acquisition of alpha particle energy spectra, in order to distinguish alpha particles originating from radon and radon progeny decays, as well as those originating from thoron and its progeny decays. A Monte-Carlo application is described which uses the Geant4 toolkit to simulate these alpha particle spectra. Reasonable agreement between measured and simulated spectra were obtained for both "2"2"0Rn and "2"2"2Rn, in the energy range between 1 and 10 MeV. Measured calibration factors could be reproduced by the simulation, given the uncertainties involved in the measurement and simulation. The simulated alpha particle spectra can now be used to interpret spectra measured in mixed radon/thoron atmospheres. The results agreed well with measurements performed in both radon and thoron gas environments. It is concluded that the developed simulation allows for an accurate prediction of calibration factors and alpha particle energy spectra. - Highlights: • A method was developed to simulate alpha particle spectra from radon/thoron decay. • New monitor features alpha-particle-spectroscopy based on silicon detectors. • A method is presented to quantify radon/thoron concentrations in mixed atmospheres. • The calibration factor can be simulated for various environmental parameters.

Short-range second order screened exchange correction to RPA correlation energies

Science.gov (United States)

Beuerle, Matthias; Ochsenfeld, Christian

2017-11-01

Direct random phase approximation (RPA) correlation energies have become increasingly popular as a post-Kohn-Sham correction, due to significant improvements over DFT calculations for properties such as long-range dispersion effects, which are problematic in conventional density functional theory. On the other hand, RPA still has various weaknesses, such as unsatisfactory results for non-isogyric processes. This can in parts be attributed to the self-correlation present in RPA correlation energies, leading to significant self-interaction errors. Therefore a variety of schemes have been devised to include exchange in the calculation of RPA correlation energies in order to correct this shortcoming. One of the most popular RPA plus exchange schemes is the second order screened exchange (SOSEX) correction. RPA + SOSEX delivers more accurate absolute correlation energies and also improves upon RPA for non-isogyric processes. On the other hand, RPA + SOSEX barrier heights are worse than those obtained from plain RPA calculations. To combine the benefits of RPA correlation energies and the SOSEX correction, we introduce a short-range RPA + SOSEX correction. Proof of concept calculations and benchmarks showing the advantages of our method are presented.

Study of the muon spectrum at a depth 570 m.w.e. underground by means of the 100-ton scintillation detector

International Nuclear Information System (INIS)

Enikeev, R.I.; Zatsepin, G.T.; Korol'kova, E.V.; Kudryavtsev, V.A.; Mal'gin, A.S.; Ryazhskaya, O.G.; Khal'chukov, F.F.

1988-01-01

The experiment was carried out using the 100-ton apparatus at the Artemovsk Scientific Station of the Institute of Nuclear Research, USSR Academy of Sciences, located in a salt mine at a depth 570 m.w.e. underground. The spectrum of the energy release in the electromagnetic cascades which are generated by muons underground was measured. The electromagnetic and nuclear cascades were separated on the basis of the number of neutrons in these cascades. The spectrum of the energy release obtained is consistent with a spectrum of π and K mesons with γ/sub π//sub ,//sub K/ = 1.75 +- 0.08 for muon energies at sea level E 0 /sub μ/ >0.7 TeV. The experimental data recalculated to the vertical spectrum of muons at sea level agree with the results of other studies. Up to energies of about 100 TeV neither the spectrum of the primary cosmic rays nor the characteristics of the pA interaction undergo changes which could lead to an increase of γ/sub π//sub ,//sub K/ to a value exceeding 1.85

Energy-Efficient Algorithm for Sensor Networks with Non-Uniform Maximum Transmission Range

Directory of Open Access Journals (Sweden)

Yimin Yu

2011-06-01

Full Text Available In wireless sensor networks (WSNs, the energy hole problem is a key factor affecting the network lifetime. In a circular multi-hop sensor network (modeled as concentric coronas, the optimal transmission ranges of all coronas can effectively improve network lifetime. In this paper, we investigate WSNs with non-uniform maximum transmission ranges, where sensor nodes deployed in different regions may differ in their maximum transmission range. Then, we propose an Energy-efficient algorithm for Non-uniform Maximum Transmission range (ENMT, which can search approximate optimal transmission ranges of all coronas in order to prolong network lifetime. Furthermore, the simulation results indicate that ENMT performs better than other algorithms.

Ion range estimation by using dual energy computed tomography

Energy Technology Data Exchange (ETDEWEB)

Huenemohr, Nora; Greilich, Steffen [German Cancer Research Center (DKFZ), Heidelberg (Germany). Medical Physics in Radiation Oncology; Krauss, Bernhard [Siemens AG, Forchheim (Germany). Imaging and Therapy; Dinkel, Julien [German Cancer Research Center (DKFZ), Heidelberg (Germany). Radiology; Massachusetts General Hospital, Boston, MA (United States). Radiology; Gillmann, Clarissa [German Cancer Research Center (DKFZ), Heidelberg (Germany). Medical Physics in Radiation Oncology; University Hospital Heidelberg (Germany). Radiation Oncology; Ackermann, Benjamin [Heidelberg Ion-Beam Therapy Center (HIT), Heidelberg (Germany); Jaekel, Oliver [German Cancer Research Center (DKFZ), Heidelberg (Germany). Medical Physics in Radiation Oncology; Heidelberg Ion-Beam Therapy Center (HIT), Heidelberg (Germany); University Hospital Heidelberg (Germany). Radiation Oncology

2013-07-01

Inaccurate conversion of CT data to water-equivalent path length (WEPL) is one of the most important uncertainty sources in ion treatment planning. Dual energy CT (DECT) imaging might help to reduce CT number ambiguities with the additional information. In our study we scanned a series of materials (tissue substitutes, aluminum, PMMA, and other polymers) in the dual source scanner (Siemens Somatom Definition Flash). Based on the 80 kVp/140Sn kVp dual energy images, the electron densities Q{sub e} and effective atomic numbers Z{sub eff} were calculated. We introduced a new lookup table that translates the Q{sub e} to the WEPL. The WEPL residuals from the calibration were significantly reduced for the investigated tissue surrogates compared to the empirical Hounsfield-look-up table (single energy CT imaging) from (-1.0 {+-} 1.8)% to (0.1 {+-} 0.7)% and for non-tissue equivalent PMMA from -7.8% to -1.0%. To assess the benefit of the new DECT calibration, we conducted a treatment planning study for three different idealized cases based on tissue surrogates and PMMA. The DECT calibration yielded a significantly higher target coverage in tissue surrogates and phantom material (i.e. PMMA cylinder, mean target coverage improved from 62% to 98%). To verify the DECT calibration for real tissue, ion ranges through a frozen pig head were measured and compared to predictions calculated by the standard single energy CT calibration and the novel DECT calibration. By using this method, an improvement of ion range estimation from -2.1% water-equivalent thickness deviation (single energy CT) to 0.3% (DECT) was achieved. If one excludes raypaths located on the edge of the sample accompanied with high uncertainties, no significant difference could be observed. (orig.)

Physics of ep collisions in the TeV energy range

International Nuclear Information System (INIS)

Altarelli, G.; Mele, B.; Rueckl, R.

1984-01-01

We study the physics of electron-proton collisions in the range of centre-of-mass energies between √s approx.= 0.3 TeV (HERA) and √s approx.= (1-2) TeV. The latter energies would be achieved if the electron or positron beam of LEP [Esub(e) approx.= (50-100) GeV] is made to collide with the proton beam of LHC [Esub(p) approx.= (5-10) TeV]. (orig.)

Devulcanization of styrene butadiene rubber by microwave energy: Effect of the presence of ionic liquid

Directory of Open Access Journals (Sweden)

S. Seghar

2015-12-01

Full Text Available In this study, styrene butadiene rubber (SBR was devulcanized using microwave irradiation. In particular, effect of ionic liquid (IL, pyrrolidinium hydrogen sulfate [Pyrr][HSO4], on the devulcanization performance was studied. It was observed that the evolution of the temperature reached by rubber powder exposed to microwave irradiation for different energy values was favored by the presence of ionic liquid [Pyrr][HSO4] significantly over the whole range of the microwave energy values. Beyond the threshold point of 220 Wh/kg, the soluble fraction after devulcanization sharply increased with increasing devulcanization microwave energy. For the powder mixed with [Pyrr][HSO4], the increase was more significant. Furthermore, the crosslink density was observed to decrease slowly with the microwave energy up to 220 Wh/kg, beyond which the crosslink density decreased significantly for the rubber impregnated with IL. For the rubber with IL, significant and continuous increase in Tg with microwave energy values was observed in comparison with the SBR where no change in transition temperature was observed. Mechanical shearing of rubber gums in the two-roll mill favored the devulcanization process, which indicated that the combination of mechanical loading with microwave energy and IL is an efficient procedure allowing an optimal devulcanization of rubbers.

77 FR 42945 - Delegation of Certain Functions Under Section 570(e) of the Foreign Operations, Export Financing...

Science.gov (United States)

2012-07-20

... Certain Functions Under Section 570(e) of the Foreign Operations, Export Financing, and Related Programs... the Foreign Operations, Export Financing, and Related Programs Appropriations Act, 1997 (Public Law...

Sistem Monitoring Pendeteksi Kebocoran LPG berbasis Mikrokontroller ATmega16 menggunakan RF APC220

Directory of Open Access Journals (Sweden)

RATNA SUSANA

2016-02-01

and displayed the levels of concentration in 200 up to 1000 range ppm. When the concentration of gas reached 5000 ppm, the alarm activated automatically and provided alert status. The wirelless sending data with a number of barriers was carried out successfully up to a distance of 200 m. Keywords: Monitoring System, Remote Controller, Master Controller, LPG, RF APC220

25 CFR 166.220 - What are the basic steps for acquiring a permit through negotiation?

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false What are the basic steps for acquiring a permit through negotiation? 166.220 Section 166.220 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER GRAZING PERMITS Permit Requirements Obtaining A Permit § 166.220 What are the basic steps for acquiring a permit through negotiation? The...

Measurement of airborne concentrations of radon-220 daughter products by alpha-particle spectrometry

International Nuclear Information System (INIS)

Kerr, G.D.; Ryan, M.T.; Perdue, P.T.

1978-01-01

The decay of naturally occurring uranium-238 and thorium-232 produces radon-222 and radon-220 isotopes which can escape into the atmosphere. If these radon gases become concentrated in air, their daughter products may present an inhalation hazard to man. The airborne concentrations of radon-222 can usually be measured very accurately in the presence of normal airborne concentrations of radon-220 and its daughters. In contrast, the measurements of the airborne concentrations of radon-220 daughters are usually complicated by the presence of radon-222 and its daughters even at normally occurring airborne concentrations. The complications involved in these measurements can be overcome in most situations by using an alpha particle spectrometer to distinguish the activity of radon-222 daughters from that due to radon-220 daughters collected on a filter. A practical spectrometer for field measurements of alpha particle activity on a filter is discussed

Corrective Action Decision Document/Closure Report for Corrective Action Unit 570: Area 9 Yucca Flat Atmospheric Test Sites, Nevada National Security Site, Nevada, Revision 0

Energy Technology Data Exchange (ETDEWEB)

Matthews, Patrick [Navarro-Intera, LLC (N-I), Las Vegas, NV (United States)

2013-11-01

This Corrective Action Decision Document/Closure Report presents information supporting the closure of Corrective Action Unit (CAU) 570: Area 9 Yucca Flat Atmospheric Test Sites, Nevada National Security Site, Nevada. This complies with the requirements of the Federal Facility Agreement and Consent Order (FFACO) that was agreed to by the State of Nevada; U.S. Department of Energy (DOE), Environmental Management; U.S. Department of Defense; and DOE, Legacy Management. The purpose of the CADD/CR is to provide justification and documentation supporting the recommendation that no further corrective action is needed.

29 CFR 570.62 - Occupations involved in the operation of bakery machines (Order 11).

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Occupations involved in the operation of bakery machines... Health or Well-Being § 570.62 Occupations involved in the operation of bakery machines (Order 11). Link... following occupations involved in the operation of power-driven bakery machines are particularly hazardous...

29 CFR 570.57 - Exposure to radioactive substances and to ionizing radiations (Order 6).

Science.gov (United States)

2010-07-01

... to Their Health or Well-Being § 570.57 Exposure to radioactive substances and to ionizing radiations... radioactive substances and to ionizing radiations are particularly hazardous and detrimental to health for... involves exposure to ionizing radiations in excess of 0.5 rem per year. (b) Definitions. As used in this...

29 CFR 570.60 - Occupations in connection with mining, other than coal (Order 9).

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Occupations in connection with mining, other than coal... Health or Well-Being § 570.60 Occupations in connection with mining, other than coal (Order 9). (a) Finding and declaration of fact. All occupations in connection with mining, other than coal, are...

Application of long range energy alternative planning (LEAP) model for Thailand energy outlook 2030 : reference case

International Nuclear Information System (INIS)

Charusiri, W.; Eua-arporn, B.; Ubonwat, J.

2008-01-01

In 2004, the total energy consumption in Thailand increased 8.8 per cent, from 47,806 to 60,260 ktoe. Long-range Energy Alternatives Planning (LEAP) is an accounting tool that simulates future energy scenarios. According to a Business As Usual (BAU) case, the overall energy demand in Thailand is estimated to increase from 61,262 to 254,200 ktoe between 2004 and 2030. Commercial energy consumption, which comprises petroleum products, natural gas, coal and its products, and electricity, increased by 9.0 per cent in Thailand in 2004, and new and renewable energy increased by 7.8 per cent. Nearly 60 per cent of the total commercial energy supply in Thailand was imported and increased for a fifth year in a row. The changes in energy consumption can be attributed to population growth and increase in economic activity and development. 10 refs., 5 tabs., 14 figs

30 CFR 70.220 - Status change reports.

Science.gov (United States)

2010-07-01

... MANDATORY HEALTH STANDARDS-UNDERGROUND COAL MINES Sampling Procedures § 70.220 Status change reports. (a) If there is a change in operational status that affects the respirable dust sampling requirements of this... produced. (iii) Abandoned—the work of all miners has been terminated and production activity has ceased. (2...

40 CFR 1065.220 - Fuel flow meter.

Science.gov (United States)

2010-07-01

... follows: (1) Use the actual value of calculated raw exhaust flow rate in the following cases: (i) For... ENGINE-TESTING PROCEDURES Measurement Instruments Flow-Related Measurements § 1065.220 Fuel flow meter. (a) Application. You may use fuel flow in combination with a chemical balance of carbon (or oxygen...

Renewable Energy Opportunities at White Sands Missile Range, New Mexico

Energy Technology Data Exchange (ETDEWEB)

Chvala, William D.; Solana, Amy E.; States, Jennifer C.; Warwick, William M.; Weimar, Mark R.; Dixon, Douglas R.

2008-09-01

The document provides an overview of renewable resource potential at White Sands Missile Range (WSMR) based primarily upon analysis of secondary data sources supplemented with limited on-site evaluations. The effort was funded by the U.S. Army Installation Management Command (IMCOM) as follow-on to the 2005 DoD Renewable Energy Assessment. This effort focuses on grid-connected generation of electricity from renewable energy sources and also ground source heat pumps (GSHPs) for heating and cooling buildings, as directed by IMCOM.

Determining chance coincidence, survival factor and decay factor in 220Rn delayed coincidence measurement

International Nuclear Information System (INIS)

Huang Derong; Yan Yongjun; Zhou Jianliang; Qiu Shoukang

2013-01-01

The method and calculation formulas to determine the chance coincidence in the 220 Rn coincidence measurement are introduced in this paper. The poisson distribution is introduced to correct the chance coincidence. The relative deviation of the true coincidence between the method and the Giffin's is within 5% after the correction of the cohance coincidence. The measurement of 220 Rn is done by comparative measurement with RAD7. The results shows that 220 Rn can be measured by the method with a relative deviation of 14%. Mean while, for the 220 Rn flow regime is difficult to meet the condition of calculation formulas, a solution to solve the survival factor and decay factor is proposed and the error come from the useage of theoretical calculation formula is avoided. (authors)

Manufacturing of 380/220 V 63 A power supply panel on UO2 kernel coating unit

International Nuclear Information System (INIS)

Triyono; Mudjiman, Supardjono; Hidayat, Nur

2013-01-01

The panel 380/220 Volts voltage source current 63 Amperes relay AC output on UO 2 kernel coating unit has been manufactured. The activities include: installation and function panel test. The electrical installation of load includes : 220 Volts temperature monitor/controller, 220 Volts scraber pump, 220 Volts vacuum pump, 220 Volts solenoid valve gas and 380 Volts induction furnace. The component of installation includes: 380 Volts earth leakage circuit breaker, 380 Volts relay AC, 220 Volts magnetic circuit breaker, 100/5 Amperes current transformator ratio, voltmeter, ampermeter and push button normally open-close and temperature monitor/control in the box size 70x50x20 cm. The testing of voltage source has been unload and full load to determine the performance of the tool. The result of manufacture and function test voltage source 380/220 Volts at the UO 2 kernel coating unit showed that: the voltage source can work without load and full load safely. The load includes: voltage 380-382 Volts current 4-4,1 Amperes of induction furnace, voltage 223 Volts current 0,5 Amperes of vacuum pump, voltage 223 Volts current 4 Amperes of scraber pump, voltage 223 Volts current 0,3 Amperes of solenoid valve gas and 222 Volts current 0,03 Amperes temperature monitor/control. (author)

Controlling the opto-electronic properties of nc-SiOx:H films by promotion of 〈220〉 orientation in the growth of ultra-nanocrystallites at the grain boundary

Science.gov (United States)

Das, Debajyoti; Samanta, Subhashis

2018-01-01

A systematic development of undoped nc-SiOx:H thin films from (SiH4 + CO2) plasma diluted by a combination of H2 and He has been investigated through structural, optical and electrical characterization and correlation. Gradual inclusion of O into a highly crystalline silicon network progressively produces a two-phase structure where Si-nanocrystals (Si-nc) are embedded into the a-SiOx:H matrix. However, at the intermediate grain boundary region the growth of ultra-nanocrystallites controls the effectiveness of the material. The ultra-nanocrystallites are the part and portion of crystallinity accommodating the dominant fraction of thermodynamically preferred 〈220〉 crystallographic orientation, most favourable for stacked layer device performance. Atomic H plays a dominant role in maintaining an improved nanocrystalliny in the network even during O inclusion, while He in its excited state (He*) maintains a good energy balance at the grain boundary and produces a significant fraction of ultra-nanocrystalline component which has been demonstrated to organize the energetically favourable 〈220〉 crystallographic orientation in the network. The nc-SiOx:H films, maintaining proportionally good electrical conductivity over an wide range of optical band gap, remarkably low microstructure factor and simultaneous high crystalline volume fraction dominantly populated by ultra-nanocrystallites of 〈220〉 crystallographic orientation mostly at the grain boundary, have been obtained in technologically most popular 13.56 MHz PECVD SiH4 plasma even at a low substrate temperature ∼250 °C, convenient for device fabrication.

Autonomous Vehicles Have a Wide Range of Possible Energy Impacts (Poster)

Energy Technology Data Exchange (ETDEWEB)

Brown, A.; Repac, B.; Gonder, J.

2013-07-01

This poster presents initial estimates of the net energy impacts of automated vehicles (AVs). Automated vehicle technologies are increasingly recognized as having potential to decrease carbon dioxide emissions and petroleum consumption through mechanisms such as improved efficiency, better routing, lower traffic congestion, and by enabling advanced technologies. However, some effects of AVs could conceivably increase fuel consumption through possible effects such as longer distances traveled, increased use of transportation by underserved groups, and increased travel speeds. The net effect on petroleum use and climate change is still uncertain. To make an aggregate system estimate, we first collect best estimates for the energy impacts of approximately ten effects of AVs. We then use a modified Kaya Identity approach to estimate the range of aggregate effects and avoid double counting. We find that depending on numerous factors, there is a wide range of potential energy impacts. Adoption of automated personal or shared vehicles can lead to significant fuel savings but has potential for backfire.

24 CFR 220.802 - Final insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Final insurance endorsement. 220... insurance endorsement. When all advances of loan proceeds have been made, and all the terms and conditions... on the original credit instrument the total of advances he has approved for insurance and again...

50 CFR 600.220 - Oath of office.

Science.gov (United States)

2010-10-01

..., DEPARTMENT OF COMMERCE MAGNUSON-STEVENS ACT PROVISIONS Council Membership § 600.220 Oath of office. Link to... United States of America by carrying out the business of the Council for the greatest overall benefit of... conduct prescribed by the Secretary of Commerce. This oath is given freely and without mental reservation...

Tables of range and rate of energy loss of charged particles of energy 0,5 to 150 MeV

Energy Technology Data Exchange (ETDEWEB)

Williamson, C; Boujot, J P [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1962-07-01

The accurate knowledge of ranges and rates of energy loss of charged particles is very important for physicists working with nuclear accelerators. The tabulations of Aron, Hoffmann, and Williams and later of Madey and Rich have proved extremely useful. However, recent experimental range measurements have indicated the need for a new tabulation of the range-energy relation. It was felt that a useful purpose would be served by performing the calculations for a large number of stopping materials distributed throughout the periodic table, including the materials most commonly used as targets, detectors, and entrance foils. (authors)

Interstellar He Flow Analysis over the Past 9 Years with Observations over the Full IBEX-Lo Energy Range

Science.gov (United States)

Moebius, E.; Bower, E.; Bzowski, M.; Fuselier, S. A.; Heirtzler, D.; Kubiak, M. A.; Kucharek, H.; Lee, M. A.; McComas, D. J.; Schwadron, N.; Swaczyna, P.; Sokol, J. M.; Wurz, P.

2017-12-01

The Sun's motion relative to the surrounding interstellar medium leads to an interstellar neutral (ISN) wind through the heliosphere. This wind is moderately depleted by ionization and can be analyzed in-situ with pickup ions and direct neutral atom imaging. Since 2009, observations of the ISN wind at 1 AU with the Interstellar Boundary Explorer (IBEX) have returned a very precise 4-dimensional parameter tube for the flow vector (speed VISN, longitude λISN, and latitude βISN) and temperature TISN of interstellar He in the local cloud, which organizes VISN, βISN, and TISN as a function of λISN, and the local flow Mach number (VThISN/VISN). Typically, the uncertainties along this functional dependence are larger than across it. Here we present important refinements of the determination of this parameter tube by analyzing the spin-integrated ISN flux for its maximum as a function of ecliptic longitude for each year through 2017. In particular, we include a weak energy dependence of the sensor efficiency by comparing the response in all four energy steps that record the ISN He flow. In addition, a recent operational extension of letting the spin axis pointing of IBEX drift to the maximum offset west of the Sun, results in an additional constraint that helps breaking the degeneracy of the ISN parameters along the 4D tube. This constraint is part of the complement of drivers for the determination of all four ISN parameters effective in the full χ2-minimization by comparing the observed count rate distribution with detailed modeling of the ISN flow (e.g. Bzowski et al., 2015, ApJS, 220:28; Schwadron et al., 2015, ApJS, 220:25) and is complementary to the independent determination of λISN using the longitude dependence of the He+ pickup ion cut-off speed with STEREO PLASTIC and ACE SWICS (Möbius et al., 2015, ApJ 815:20).

30 CFR 90.220 - Status change reports.

Science.gov (United States)

2010-07-01

... MANDATORY HEALTH STANDARDS-COAL MINERS WHO HAVE EVIDENCE OF THE DEVELOPMENT OF PNEUMOCONIOSIS Sampling Procedures § 90.220 Status change reports. If there is a change in the status of a part 90 miner that affects the respirable dust sampling requirements of this part (such as entering a terminated, injured or ill...

Energy System Expectations for Nuclear in the 21. Century: A Plausible Range

International Nuclear Information System (INIS)

Langlois, Lucille M.; McDonald, Alan; Rogner, Hans-Holger; Vera, Ivan

2002-01-01

This paper outlines a range of scenarios describing what the world's energy system might look like in the middle of the century, and what nuclear energy's most profitable role might be. The starting point is the 40 non-greenhouse-gas-mitigation scenarios in the Special Report on Emissions Scenarios (SRES) of the Intergovernmental Panel on Climate Change (IPCC, 2000). Given their international authorship and comprehensive review by governments and scientific experts, the SRES scenarios are the state of the art in long-term energy scenarios. However, they do not present the underlying energy system structures in enough detail for specific energy technology and infrastructure analyses. This paper therefore describes initial steps within INPRO (The International Project on Innovative Nuclear Reactors and Fuel Cycles of the International Atomic Energy Agency) to translate the SRES results into a range of possible nuclear energy technology requirements for mid-century. The paper summarizes the four SRES scenarios that will be used in INPRO and the reasons for their selection. It provides illustrative examples of the sort of additional detail that is being developed about the overall energy system implied by each scenario, and about specific scenario features particularly relevant to nuclear energy. As recommended in SRES, the selected scenarios cover all four SRES 'story-line families'. The energy system translations being developed in INPRO are intended to indicate how energy services may be provided in mid-century and to delineate likely technology and infrastructure implications. They will indicate answers to questions like the following. The list is illustrative, not comprehensive. - What kind of nuclear power plants will best fit the mid-century energy system? - What energy forms and other products and services provided by nuclear reactors will best fit the mid-century energy system? - What would be their market shares? - How difficult will it be to site new nuclear

Energy and angular distributions of secondary electrons from 5--100-keV-proton collisions with hydrogen and nitrogen molecules

International Nuclear Information System (INIS)

Rudd, M.E.

1979-01-01

Cross sections for the ejection of electrons from hydrogen and nitrogen by protons have been measured as a function of the energy and angle of ejection of the electrons at incident proton energies of 5--70 keV and 100 keV for hydrogen. The range of angles measured was 10--160 0 and the electron energy range was 1.5--300 eV. The doubly differential cross sections were also integrated over angle, over electron energy, or over both to obtain singly differential and total cross sections for electron production. Average electron energies were also calculated from the data. The angular distributions of electrons are peaked in the forward direction but become more isotropic as the proton energy decreases. Nitrogen yields a more isotropic distribution than hydrogen. In this range of proton energies the cross sections integrated over angle are found to fall off approximately exponentially with electron energy, and a simple empirical equation has been found that describes the singly differential and total cross sections within a factor of 2 for several targets. A theoretical interpretation of this result in terms of the molecular promotion model is given in which Meyerhof's method of calculating cross sections for K-shell excitation is applied for the first time to the ionization of outer shells of atoms

Energy Impacts of Effective Range Hood Use for all U.S. Residential Cooking

Energy Technology Data Exchange (ETDEWEB)

Logue, Jennifer M; Singer, Brett

2014-06-01

Range hood use during residential cooking is essential to maintaining good indoor air quality. However, widespread use will impact the energy demand of the U.S. housing stock. This paper describes a modeling study to determine site energy, source energy, and consumer costs for comprehensive range hood use. To estimate the energy impacts for all 113 million homes in the U.S., we extrapolated from the simulation of a representative weighted sample of 50,000 virtual homes developed from the 2009 Residential Energy Consumption Survey database. A physics-based simulation model that considered fan energy, energy to condition additional incoming air, and the effect on home heating and cooling due to exhausting the heat from cooking was applied to each home. Hoods performing at a level common to hoods currently in U.S. homes would require 19?33 TWh [69?120 PJ] of site energy, 31?53 TWh [110-190 PJ] of source energy; and would cost consumers $1.2?2.1 billion (U.S.$2010) annually in the U.S. housing stock. The average household would spend less than $15 annually. Reducing required airflow, e.g. with designs that promote better pollutant capture has more energy saving potential, on average, than improving fan efficiency.

Advanced Range Safety System for High Energy Vehicles

Science.gov (United States)

Claxton, Jeffrey S.; Linton, Donald F.

2002-01-01

The advanced range safety system project is a collaboration between the National Aeronautics and Space Administration and the United States Air Force to develop systems that would reduce costs and schedule for safety approval for new classes of unmanned high-energy vehicles. The mission-planning feature for this system would yield flight profiles that satisfy the mission requirements for the user while providing an increased quality of risk assessment, enhancing public safety. By improving the speed and accuracy of predicting risks to the public, mission planners would be able to expand flight envelopes significantly. Once in place, this system is expected to offer the flexibility of handling real-time risk management for the high-energy capabilities of hypersonic vehicles including autonomous return-from-orbit vehicles and extended flight profiles over land. Users of this system would include mission planners of Space Launch Initiative vehicles, space planes, and other high-energy vehicles. The real-time features of the system could make extended flight of a malfunctioning vehicle possible, in lieu of an immediate terminate decision. With this improved capability, the user would have more time for anomaly resolution and potential recovery of a malfunctioning vehicle.

Demonstration of a High-Order Mode Input Coupler for a 220-GHz Confocal Gyrotron Traveling Wave Tube

Science.gov (United States)

Guan, Xiaotong; Fu, Wenjie; Yan, Yang

2018-02-01

A design of high-order mode input coupler for 220-GHz confocal gyrotron travelling wave tube is proposed, simulated, and demonstrated by experimental tests. This input coupler is designed to excite confocal TE 06 mode from rectangle waveguide TE 10 mode over a broadband frequency range. Simulation results predict that the optimized conversion loss is about 2.72 dB with a mode purity excess of 99%. Considering of the gyrotron interaction theory, an effective bandwidth of 5 GHz is obtained, in which the beam-wave coupling efficiency is higher than half of maximum. The field pattern under low power demonstrates that TE 06 mode is successfully excited in confocal waveguide at 220 GHz. Cold test results from the vector network analyzer perform good agreements with simulation results. Both simulation and experimental results illustrate that the reflection at input port S11 is sensitive to the perpendicular separation of two mirrors. It provides an engineering possibility for estimating the assembly precision.

Heterozygous KIDINS220/ARMS nonsense variants cause spastic paraplegia, intellectual disability, nystagmus, and obesity

NARCIS (Netherlands)

Josifova, Dragana J.; Monroe, Glen R.; Tessadori, Federico; de Graaff, Esther; van der Zwaag, Bert; Mehta, Sarju G.; Harakalova, Magdalena; Duran, Karen J.; Savelberg, Sanne M. C.; Nijman, Isaäc J.; Jungbluth, Heinz; Hoogenraad, Casper C.; Bakkers, Jeroen; Knoers, Nine V.; Firth, Helen V.; Beales, Philip L.; van Haaften, Gijs; van Haelst, Mieke M.

2016-01-01

We identified de novo nonsense variants in KIDINS220/ARMS in three unrelated patients with spastic paraplegia, intellectual disability, nystagmus, and obesity (SINO). KIDINS220 is an essential scaffold protein coordinating neurotrophin signal pathways in neurites and is spatially and temporally

Daily energy expenditure in free-ranging Gopher Tortoises (Gopherus polyphemus)

NARCIS (Netherlands)

Jodice, PGR; Epperson, DM; Visser, GH

2006-01-01

Studies of ecological energetics in chelonians are rare. Here, we report the first measurements of daily energy expenditure (DEE) and water influx rates (WIRS) in free-ranging adult Gopher Tortoises (Gopherus polyphemus). We used the doubly labeled water (DLW) method to measure DEE in six adult

Decreased expression of thyroid receptor-associated protein 220 in temporal lobe tissue of patients with refractory epilepsy

International Nuclear Information System (INIS)

Li Jinmei; Wang Xuefeng; Xi Zhiqin; Gong Yun; Liu Fengying; Sun Jijun; Wu Yuan; Luan Guoming; Wang Yuping; Li Yunlin; Zhang Jianguo; Lu Yong; Li Hongwei

2006-01-01

Purpose: TRAP220 (thyroid hormone receptor-associated protein) functions as a coactivator for nuclear receptors and stimulates transcription by recruiting the TRAP mediator complex to hormone responsive promoter regions. Thus, TRAP220 enhances the function of thyroid/steroid hormone receptors such as thyroid hormone and oestrogen receptors. This study investigated the expression of TRAP220 mRNA and protein level in epileptic brains comparing with human control. Methods: We examined the expression of TRAP220 mRNA and protein levels in temporal lobes from patients with chronic pharmacoresistant epilepsy who have undergone surgery. Results: Expression of TRAP220 mRNA and protein was shown to be decreased significantly in the temporal cortex of the patients with epilepsy. Conclusions: Our work showed that a decrease in TRAP220 mRNA and protein levels may be involved in the pathophysiology of epilepsy and may be associated with impairment of the brain caused by frequent seizures

24 CFR 220.830 - Debenture interest rate.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Debenture interest rate. 220.830... rate. Debentures shall bear interest from the date of issue, payable semiannually on the first day of... rates of interest will be published twice each year as a notice in the Federal Register. [47 FR 26125...

27 CFR 28.220 - Notice of return.

Science.gov (United States)

2010-04-01

... OF THE TREASURY LIQUORS EXPORTATION OF ALCOHOL Exportation of Wine With Benefit of Drawback § 28.220 Notice of return. If an exporter desires to return wine to a bonded wine cellar or wholesale liquor... wine cellar from which withdrawn; (b) Date and serial number of the Form 1582-A (5120.24) on which the...

Millimeter and Submillimeter Wave Spectroscopy of Higher Energy Conformers of 1,2-PROPANEDIOL

Science.gov (United States)

Zakharenko, Olena; Bossa, Jean-Baptiste; Lewen, Frank; Schlemmer, Stephan; Müller, Holger S. P.

2017-06-01

We have performed a study of the millimeter/submillimeter wave spectrum of four higher energy conformers of 1,2-propanediol (continuation of the previous study on the three lowest energy conformers. The present analysis of rotational transitions carried out in the frequency range 38 - 400 GHz represents a significant extension of previous microwave work. The new data were combined with previously-measured microwave transitions and fitted using a Watson's S-reduced Hamiltonian. The final fits were within experimental accuracy, and included spectroscopic parameters up to sixth order of angular momentum, for the ground states of the four higher energy conformers following previously studied ones: g'Ga, gG'g', aGg' and g'Gg. The present analysis provides reliable frequency predictions for astrophysical detection of 1,2-propanediol by radio telescope arrays at millimeter wavelengths. J.-B. Bossa, M.H. Ordu, H.S.P. Müller, F. Lewen, S. Schlemmer, A&A 570 (2014) A12)

Thoron (RN-220) interference in the determination of RN-222 exhalation rate of soils

Energy Technology Data Exchange (ETDEWEB)

Amaral, Déric S.; Farias, Emerson E.G.; Santos, Mariana L.O.; Silva, Karolayne E.M.; Hazin, Clovis A.; França, Elvis J., E-mail: emersonemiliano@yahoo.com [Centro Regional de Ciências Nucleares do Nordeste (CRCN-NE/CNEN-PE), Recife, PE (Brazil); Souza Neto, João A., E-mail: adauto@ufpe.br [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Geologia

2017-07-01

The transport of Rn-222 from the soil to the atmosphere known as exhalation is influenced by meteorological conditions and soil geophysical parameters. In closed and poorly ventilated rooms, this radioactive gas can reach high activity concentrations, in which the energy of alpha particles released by this radionuclide and its progeny is the second leading cause of lung cancer. Soil exhalation rate is an important parameter for assessing human health risks associated with radon. For radon determination using an exhalation chamber, an ionization chamber detector is used to count the electrical pulses generated by the interaction between the alpha particles produced by Rn-222 and its progeny and the air inside the chamber. In this work, the interference of thoron (Rn-220) in the determination of soil exhalation rate of Rn-222 was studied. For this, the RadonBOX exhalation chamber and the AlphaGuard ionization chamber detector were utilized for analyzing the same soil during two hours on different days under similar meteorological conditions. From zero up to approximately 2,400 s, the radon activity concentrations decreased. After 40 minutes, the radon concentrations started to increase, thereby allowing the calculation of soil exhalation rate. This initial decreasing could be explained by a high Rn-220 than Rn-222 presence in the soil, in which, because of its short half-life, after 40 minutes, most thoron present in the chamber has undergone so that the main alpha emitter become Rn-222. In order to confirm this, Rn-220 activity was estimated by the Ra-228 concentration in the soil determined after 30 days using High Resolution Gamma-Ray Spectrometry with HPGe detectors. Therefore, the thoron interference in the determination of soil radon exhalation rate was considered negligible after 40 minutes of measurement time for the analyzed soil. (author)

Long-range energy transfer in self-assembled quantum dot-DNA cascades

Science.gov (United States)

Goodman, Samuel M.; Siu, Albert; Singh, Vivek; Nagpal, Prashant

2015-11-01

The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient transport of energy across QD-DNA thin films.The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient

76 FR 38742 - Eleventh Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2011-07-01

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220 Meeting: Automatic Flight Guidance and Control. SUMMARY: The..., Automatic Flight Guidance and Control. Agenda Tuesday August 9-Thursday, August 11, 2011 Tuesday, August 9...

24 CFR 570.511 - Use of escrow accounts for rehabilitation of privately owned residential property.

Science.gov (United States)

2010-04-01

... Regulations Relating to Housing and Urban Development (Continued) OFFICE OF ASSISTANT SECRETARY FOR COMMUNITY... neighborhood-scale non-residential space within the same structure, if any, e.g., a store front below a... rehabilitation services costs under § 570.202(b)(9), are not permissible uses of escrowed funds. Such other...

Sub-arcsecond imaging of the water emission in Arp 220⋆ ⋆⋆

Science.gov (United States)

König, S.; Martín, S.; Muller, S.; Cernicharo, J.; Sakamoto, K.; Zschaechner, L. K.; Humphreys, E. M. L.; Mroczkowski, T.; Krips, M.; Galametz, M.; Aalto, S.; Vlemmings, W. H. T.; Ott, J.; Meier, D. S.; Fuente, A.; García-Burillo, S.; Neri, R.

2017-01-01

Aims Extragalactic observations of water emission can provide valuable insights into the excitation of the interstellar medium. In particular they allow us to investigate the excitation mechanisms in obscured nuclei, i.e. whether an active galactic nucleus or a starburst dominate. Methods We use sub-arcsecond resolution observations to tackle the nature of the water emission in Arp 220. ALMA Band 5 science verification observations of the 183 GHz H2O 313−220 line, in conjunction with new ALMA Band 7 H2O 515−422 data at 325 GHz, and supplementary 22 GHz H2O 616 − 523 VLA observations, are used to better constrain the parameter space in the excitation modelling of the water lines. Results We detect 183 GHz H2O and 325 GHz water emission towards the two compact nuclei at the center of Arp 220, being brighter in Arp 220 West. The emission at these two frequencies is compared to previous single-dish data and does not show evidence of variability. The 183 and 325 GHz lines show similar spectra and kinematics, but the 22 GHz profile is significantly different in both nuclei due to a blend with an NH3 absorption line. Conclusions Our findings suggest that the most likely scenario to cause the observed water emission in Arp 220 is a large number of independent masers originating from numerous star-forming regions. PMID:29151605

18 CFR 2.20 - Good faith requests for transmission services and good faith responses by transmitting utilities.

Science.gov (United States)

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Good faith requests for transmission services and good faith responses by transmitting utilities. 2.20 Section 2.20 Conservation of... Power Act § 2.20 Good faith requests for transmission services and good faith responses by transmitting...

27 CFR 28.220a - Responsibility for return of wine withdrawn for export with benefit of drawback.

Science.gov (United States)

2010-04-01

... of wine withdrawn for export with benefit of drawback. 28.220a Section 28.220a Alcohol, Tobacco... EXPORTATION OF ALCOHOL Exportation of Wine With Benefit of Drawback § 28.220a Responsibility for return of wine withdrawn for export with benefit of drawback. The exporter shall be responsible for arranging the...

CORROSION RATE OF STEELS DX51D AND S220GD IN DIFFERENT CORROSION ENVIRONMENT

Directory of Open Access Journals (Sweden)

Alina Crina CIUBOTARIU

2016-06-01

Full Text Available Corrosion in the marine environment is an important issue because the costs causes by marine corrosion increased year upon year. It is necessary a correctly approach to materials selection, protection and corrosion control to reduce this burden of wasted materials, wasted energy and wasted money. Many different types of corrosion attack can be observed to structures, ships and other equipment used in sea water service. Shipping containers are exposed to various corrosive mediums like as airborne salt, industrial pollutants, rain and saltwater. Transport damage during loading onto and unloading off trucks, train beds and ships breaches the paint coating which further contributes to corrosion. The result is shortened container life and high costs for container repair or replacement. The paper intends to evaluate, by gravimetric method, the corrosion rate and corrosion penetration rate of two types of carbon steel DX51D and S220GD. Carbon steel DX51D and hot-dip galvanized steel S220GD are used in marine and industrial applications for buildings cargo vessels, container ships and oil tankers. For testing it was used different corrosive environments: 5% NaOH solution; 5% HCL solution and 0.5M NaCl solution. The samples were immersed in 400mL of testing solution for exposure period of 28 days. Periodically at 3 days, 7 days, 14 days, 21 days and 28 days was measured de mass loss and evaluate the corrosion rate and corrosion stability coefficient. The steel DX51D was stable in 5% NaOH solution for 28 days, the values of corrosion stability coefficient was 7 after 3 days and 6 after 28 days of immersion in corrosive medium. In 5% HCL solution steels DX51D and S220GD was completely corroded in 21 days with a corrosion stability coefficient equal with 9 for 7 days and 8 for 21 days of immersion in corrosive solution. It was observed a good resistance for 3 days in 0.5M NaCl solution with a corrosion stability coefficient equal with 5, but after that

Low-energy modes and medium-range correlated motions in Pd79Ge21 alloy glass

International Nuclear Information System (INIS)

Shibata, Kaoru; Mizuseki, Hiroshi; Suzuki, Kenji

1993-01-01

It is well known that there are excess modes over the sound wave in low energy region below about 10 meV in glass materials, which do not exist in corresponding crystalline materials. We examined the low energy modes in a Pd 79 Ge 21 alloys glass by means of inelastic neutron scattering. Measurements were performed on the crystal analyzer type time-of-flight spectrometer LAM-40 with PG(002) and Ge(311) analyzer mirror, which is installed at KENS. The dynamic structure factor S(Q,ω) was obtained over the wide momentum range from 0.5 to 5.2A -1 . The measured S(Q,ω)'s have almost same momentum (Q) dependence at each energy (ℎω) in the energy range from 2.0 to 8.0 meV. In the energy region below 3 meV, we found a small shoulder peak at Q = 1.7A -1 in the momentum dependence of S(Q,ω). It corresponds to a prepeak in S(Q). Therefore it is concluded that the low energy modes in Pd 79 Ge 21 alloy glass is mainly contributed from medium-range correlated motions in the cluster consisting of a few chemical short-range structure units of Pd 6 Ge trigonal prism. (author)

Darwin: Dose monitoring system applicable to various radiations with wide energy ranges

International Nuclear Information System (INIS)

Sato, T.; Satoh, D.; Endo, A.; Yamaguchi, Y.

2007-01-01

A new radiation dose monitor, designated as DARWIN (Dose monitoring system Applicable to various Radiations with Wide energy ranges), has been developed for real-time monitoring of doses in workspaces and surrounding environments of high-energy accelerator facilities. DARWIN is composed of a Phoswitch-type scintillation detector, which consists of liquid organic scintillator BC501A coupled with ZnS(Ag) scintillation sheets doped with 6 Li, and a data acquisition system based on a Digital-Storage-Oscilloscope. DARWIN has the following features: (1) capable of monitoring doses from neutrons, photons and muons with energies from thermal energy to 1 GeV, 150 keV to 100 MeV and 1 MeV to 100 GeV, respectively, (2) highly sensitive with precision and (3) easy to operate with a simple graphical user-interface. The performance of DARWIN was examined experimentally in several radiation fields. The results of the experiments indicated the accuracy and wide response range of DARWIN for measuring dose rates from neutrons, photons and muons with wide energies. It was also found from the experiments that DARWIN enables us to monitor small fluctuations of neutron dose rates near the background level because of its high sensitivity. With these properties, DARWIN will be able to play a very important role for improving radiation safety in high-energy accelerator facilities. (authors)

76 FR 50809 - Eleventh Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2011-08-16

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Correction of Notice of RTCA Special Committee 220 meeting: Automatic Flight Guidance and Control...: Automatic Flight Guidance and Control DATES: The meeting will be held September 13-15, 2011, from 9 a.m. to...

2 CFR 220.40 - Relationship to previous issuance.

Science.gov (United States)

2010-01-01

...) The Attachment to the circular, entitled “Principles For Determining Costs Applicable to Grants... attachment to the circular, entitled “CASB's Cost Accounting Standards (CAS),” Attachment A, CASB's Cost... Section 220.40 Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST...

Performance tests of a special ionization chamber for X-rays in mammography energy range

Energy Technology Data Exchange (ETDEWEB)

Silva, J.O., E-mail: jonas.silva@ufg.br [Universidade Federal de Goiás (UFG), Goiânia (Brazil). Instituto de Física; Caldas, L.V.E. [Instituto de Pesquisas Energéticas e Nucleares (IPEN-CNEN/SP), São Paulo, SP (Brazil). Centro de Metrologia das Radiações

2017-07-01

A special mammography homemade ionization chamber was developed to be applied for mammography energy range dosimetry. This chamber has a total sensitive volume of 6 cm{sup 3} and is made of a PMMA body and graphite coated collecting electrode. Performance tests as saturation, ion collection efficiency, linearity of chamber response versus air kerma rate and energy dependence were determined. The results obtained with this special homemade ionization chamber are within the limits stated in international recommendations. This chamber can be used in quality control programs of mammography energy range. All measurements were carried out at the Calibration Laboratory of IPEN. (author)

20 CFR 220.37 - When a child's disability determination is governed by the regulations of the Social Security...

Science.gov (United States)

2010-04-01

...) Inclusion as a disabled child in the employee's annuity rate under the social security overall minimum. (2... governed by the regulations of the Social Security Administration. 220.37 Section 220.37 Employees... Disability Determinations Governed by the Regulations of the Social Security Administration § 220.37 When a...

Neutron bombardment of single wall carbon nanohorn (SWCNH). DSC determination of the stored Wigner-Szilard energy

International Nuclear Information System (INIS)

Franco Cataldo; Susana Iglesias-Groth; Yaser Hafez; Giancarlo Angelini

2014-01-01

Single wall carbon nanohorn (SWCNH) were neutron-bombarded to a dose of 3.28 × 10 16 n/cm 2 . The Wigner or stored energy was determined by a differential scanning calorimeter and was found 5.49 J/g, 50 times higher than the Wigner energy measured on graphite flakes treated at the same neutron dose. The activation energy for the thermal annealing of the accumulated radiation damage in SWCNH was determined in the range 6.3-6.6 eV against a typical activation energy for the annealing of the radiation-damaged graphite which is in the range of 1.4-1.5 eV. Furthermore the stored energy in neutron-damaged SWCNH is released at 400-430 deg C while the main peak in the neutron-damaged graphite occurs at 200-220 deg C. The radiation damaged SWCNH were examined with FT-IR spectroscopy showing the formation of acetylenic and aliphatic moieties suggesting the aromatic C=C breakdown caused by the neutron bombardment. (author)

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV strain 220-90

Directory of Open Access Journals (Sweden)

LaPatra Scott E

2010-01-01

Full Text Available Abstract Background Infectious hematopoietic necrosis virus (IHNV is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939 with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American

Use of Activated Charcoal for 220Rn Adsorption for Operations Associated with the Uranium Deposit in the Auxiliary Charcoal Bed at the Molten Salt Reactor Experiment Facility

International Nuclear Information System (INIS)

Coleman, R.L.

1999-01-01

Measurements have been collected with the purpose of evaluating the effectiveness of activated charcoal for the removal of 220 Rn from process off-gas at the Molten Salt Reactor Experiment (MSRE) at Oak Ridge National Laboratory. A series of bench-scale tests were performed at superficial flow velocities of 10, 18, 24, and 33 cm/s (20, 35, 47, and 65 ft/min) with a continuous input concentration of 220 Rn in the range of 9 x 10 3 pCi/L. In addition, two tests were performed at the MSRE facility by flowing helium through the auxiliary charcoal bed uranium deposit. These tests were performed so that the adsorptive effectiveness could be evaluated with a relatively high concentration of 220 Rn. In addition to measuring the effectiveness of activated charcoal as a 220 Rn adsorption media, the source term for available 220 Rn in the deposit is actually available for removal and that the relative activity of fission gases is very small when compared to 220 Rn. The measurement data were then used to evaluate the expected effectiveness of a proposed charcoal adsorption bed consisting of a right circular cylinder having a diameter of 43 cm and a length of 91 cm (17 in. I.D. x 3 ft.). The majority of the measurement data predicts an overall 220Rn activity reduction factor of about 1 x 10 9 for such a design; however, two measurements collected at a flow velocity of 18 cm/s (35 ft/min) indicated that the reduction factor could be as low as 1 x 10 6 . The adsorptive capacity of the proposed trap was also evaluated to determine the expected life prior to degradation of performance. Taking a conservative vantage point during analysis, it was estimated that the adsorption effectiveness should not begin to deteriorate until a 220 Rn activity on the order of 10 10 Ci has been processed. It was therefore concluded that degradation of performance would likely occur as the result of causes other than filling by radon progeny

48 CFR 212.570 - Applicability of certain laws to contracts and subcontracts for the acquisition of commercially...

Science.gov (United States)

2010-10-01

..., DEPARTMENT OF DEFENSE ACQUISITION PLANNING ACQUISITION OF COMMERCIAL ITEMS Applicability of Certain Laws to the Acquisition of Commercial Items 212.570 Applicability of certain laws to contracts and... laws to contracts and subcontracts for the acquisition of commercially available off-the-shelf items...

49 CFR 179.220-11 - Postweld heat treatment.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Postweld heat treatment. 179.220-11 Section 179... Postweld heat treatment. (a) Postweld heat treatment of the inner container is not a specification requirement. (b) Postweld heat treatment of the cylindrical portions of the outer shell to which the anchorage...

[The maximum heart rate in the exercise test: the 220-age formula or Sheffield's table?].

Science.gov (United States)

Mesquita, A; Trabulo, M; Mendes, M; Viana, J F; Seabra-Gomes, R

1996-02-01

To determine in the maximum cardiac rate in exercise test of apparently healthy individuals may be more properly estimated through 220-age formula (Astrand) or the Sheffield table. Retrospective analysis of clinical history and exercises test of apparently healthy individuals submitted to cardiac check-up. Sequential sampling of 170 healthy individuals submitted to cardiac check-up between April 1988 and September 1992. Comparison of maximum cardiac rate of individuals studied by the protocols of Bruce and modified Bruce, in interrupted exercise test by fatigue, and with the estimated values by the formulae: 220-age versus Sheffield table. The maximum cardiac heart rate is similar with both protocols. This parameter in normal individuals is better predicted by the 220-age formula. The theoretic maximum cardiac heart rate determined by 220-age formula should be recommended for a healthy, and for this reason the Sheffield table has been excluded from our clinical practice.

Autophosphorylation of JAK2 on Tyrosines 221 and 570 Regulates Its Activity

OpenAIRE

Argetsinger, Lawrence S.; Kouadio, Jean-Louis K.; Steen, Hanno; Stensballe, Allan; Jensen, Ole N.; Carter-Su, Christin

2004-01-01

The tyrosine kinase JAK2 is a key signaling protein for at least 20 receptors in the cytokine/hematopoietin receptor superfamily and is a component of signaling by insulin receptor and several G-protein-coupled receptors. However, there is only limited knowledge of the physical structure of JAK2 or which of the 49 tyrosines in JAK2 are autophosphorylated. In this study, mass spectrometry and two-dimensional peptide mapping were used to determine that tyrosines 221, 570, and 1007 in JAK2 are a...

32 CFR 220.11 - Special rules for automobile liability insurance and no-fault automobile insurance.

Science.gov (United States)

2010-07-01

... and no-fault automobile insurance. 220.11 Section 220.11 National Defense Department of Defense... insurance and no-fault automobile insurance. (a) Active duty members covered. In addition to Uniformed.... 1095 and this part. (c) Exclusion of automobile liability insurance and no-fault automobile insurance...

20 CFR 725.220 - Determination of relationship; child.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Determination of relationship; child. 725.220... Determination of relationship; child. For purposes of determining whether an individual may qualify for benefits as the child of a deceased miner, the provisions of § 725.208 shall be applicable. As used in this...

First SN Discoveries from the Dark Energy Survey

Science.gov (United States)

Abbott, T.; Abdalla, F.; Achitouv, I.; Ahn, E.; Aldering, G.; Allam, S.; Alonso, D.; Amara, A.; Annis, J.; Antonik, M.; Aragon-Salamanca, A.; Armstrong, R.; Ashall, C.; Asorey, J.; Bacon, D.; Balbinot, E.; Banerji, M.; Barbary, K.; Barkhouse, W.; Baruah, L.; Bauer, A.; Bechtol, K.; Becker, M.; Bender, R.; Benoist, C.; Benoit-Levy, A.; Bernardi, M.; Bernstein, G.; Bernstein, J. P.; Bernstein, R.; Bertin, E.; Beynon, E.; Bhattacharya, S.; Biesiadzinski, T.; Biswas, R.; Blake, C.; Bloom, J. S.; Bocquet, S.; Brandt, C.; Bridle, S.; Brooks, D.; Brown, P. J.; Brunner, R.; Buckley-Geer, E.; Burke, D.; Burkert, A.; Busha, M.; Campa, J.; Campbell, H.; Cane, R.; Capozzi, D.; Carlstrom, J.; Carnero Rosell, A.; Carollo, M.; Carrasco-Kind, M.; Carretero, J.; Carter, M.; Casas, R.; Castander, F. J.; Chen, Y.; Chiu, I.; Chue, C.; Clampitt, J.; Clerkin, L.; Cohn, J.; Colless, M.; Copeland, E.; Covarrubias, R. A.; Crittenden, R.; Crocce, M.; Cunha, C.; da Costa, L.; d'Andrea, C.; Das, S.; Das, R.; Davis, T. M.; Deb, S.; DePoy, D.; Derylo, G.; Desai, S.; de Simoni, F.; Devlin, M.; Diehl, H. T.; Dietrich, J.; Dodelson, S.; Doel, P.; Dolag, K.; Efstathiou, G.; Eifler, T.; Erickson, B.; Eriksen, M.; Estrada, J.; Etherington, J.; Evrard, A.; Farrens, S.; Fausti Neto, A.; Fernandez, E.; Ferreira, P. C.; Finley, D.; Fischer, J. A.; Flaugher, B.; Fosalba, P.; Frieman, J.; Furlanetto, C.; Garcia-Bellido, J.; Gaztanaga, E.; Gelman, M.; Gerdes, D.; Giannantonio, T.; Gilhool, S.; Gill, M.; Gladders, M.; Gladney, L.; Glazebrook, K.; Gray, M.; Gruen, D.; Gruendl, R.; Gupta, R.; Gutierrez, G.; Habib, S.; Hall, E.; Hansen, S.; Hao, J.; Heitmann, K.; Helsby, J.; Henderson, R.; Hennig, C.; High, W.; Hirsch, M.; Hoffmann, K.; Holhjem, K.; Honscheid, K.; Host, O.; Hoyle, B.; Hu, W.; Huff, E.; Huterer, D.; Jain, B.; James, D.; Jarvis, M.; Jarvis, M. J.; Jeltema, T.; Johnson, M.; Jouvel, S.; Kacprzak, T.; Karliner, I.; Katsaros, J.; Kent, S.; Kessler, R.; Kim, A.; Kim-Vy, T.; King, L.; Kirk, D.; Kochanek, C.; Kopp, M.; Koppenhoefer, J.; Kovacs, E.; Krause, E.; Kravtsov, A.; Kron, R.; Kuehn, K.; Kuemmel, M.; Kuhlmann, S.; Kunder, A.; Kuropatkin, N.; Kwan, J.; Lahav, O.; Leistedt, B.; Levi, M.; Lewis, P.; Liddle, A.; Lidman, C.; Lilly, S.; Lin, H.; Liu, J.; Lopez-Arenillas, C.; Lorenzon, W.; LoVerde, M.; Ma, Z.; Maartens, R.; Maccrann, N.; Macri, L.; Maia, M.; Makler, M.; Manera, M.; Maraston, C.; March, M.; Markovic, K.; Marriner, J.; Marshall, J.; Marshall, S.; Martini, P.; Marti Sanahuja, P.; Mayers, J.; McKay, T.; McMahon, R.; Melchior, P.; Merritt, K. W.; Merson, A.; Miller, C.; Miquel, R.; Mohr, J.; Moore, T.; Mortonson, M.; Mosher, J.; Mould, J.; Mukherjee, P.; Neilsen, E.; Ngeow, C.; Nichol, R.; Nidever, D.; Nord, B.; Nugent, P.; Ogando, R.; Old, L.; Olsen, J.; Ostrovski, F.; Paech, K.; Papadopoulos, A.; Papovich, C.; Patton, K.; Peacock, J.; Pellegrini, P. S. S.; Peoples, J.; Percival, W.; Perlmutter, S.; Petravick, D.; Plazas, A.; Ponce, R.; Poole, G.; Pope, A.; Refregier, A.; Reyes, R.; Ricker, P.; Roe, N.; Romer, K.; Roodman, A.; Rooney, P.; Ross, A.; Rowe, B.; Rozo, E.; Rykoff, E.; Sabiu, C.; Saglia, R.; Sako, M.; Sanchez, A.; Sanchez, C.; Sanchez, E.; Sanchez, J.; Santiago, B.; Saro, A.; Scarpine, V.; Schindler, R.; Schmidt, B. P.; Schmitt, R. L.; Schubnell, M.; Seitz, S.; Senger, R.; Sevilla, I.; Sharp, R.; Sheldon, E.; Sheth, R.; Smith, R. C.; Smith, M.; Snigula, J.; Soares-Santos, M.; Sobreira, F.; Song, J.; Soumagnac, M.; Spinka, H.; Stebbins, A.; Stoughton, C.; Suchyta, E.; Suhada, R.; Sullivan, M.; Sun, F.; Suntzeff, N.; Sutherland, W.; Swanson, M. E. C.; Sypniewski, A. J.; Szepietowski, R.; Talaga, R.; Tarle, G.; Tarrant, E.; Balan, S. Thaithara; Thaler, J.; Thomas, D.; Thomas, R. C.; Tucker, D.; Uddin, S. A.; Ural, S.; Vikram, V.; Voigt, L.; Walker, A. R.; Walker, T.; Wechsler, R.; Weinberg, D.; Weller, J.; Wester, W.; Wetzstein, M.; White, M.; Wilcox, H.; Wilman, D.; Yanny, B.; Young, J.; Zablocki, A.; Zenteno, A.; Zhang, Y.; Zuntz, J.

2012-12-01

The Dark Energy Survey (DES) report the discovery of the first set of supernovae (SN) from the project. Images were observed as part of the DES Science Verification phase using the newly-installed 570-Megapixel Dark Energy Camera on the CTIO Blanco 4-m telescope by observers J. Annis, E. Buckley-Geer, and H. Lin. SN observations are planned throughout the observing campaign on a regular cadence of 4-6 days in each of the ten 3-deg2 fields in the DES griz filters.

CO-ANALYSIS OF SOLAR MICROWAVE AND HARD X-RAY SPECTRAL EVOLUTIONS. I. IN TWO FREQUENCY OR ENERGY RANGES

International Nuclear Information System (INIS)

Song Qiwu; Huang Guangli; Nakajima, Hiroshi

2011-01-01

Solar microwave and hard X-ray spectral evolutions are co-analyzed in the 2000 June 10 and 2002 April 10 flares, and are simultaneously observed by the Owens-Valley Solar Array in the microwave band and by Yohkoh/Hard X-ray Telescope or RHESSI in the hard X-ray band, with multiple subpeaks in their light curves. The microwave and hard X-ray spectra are fitted by a power law in two frequency ranges of the optical thin part and two photon energy ranges, respectively. Similar to an earlier event in Shao and Huang, the well-known soft-hard-soft pattern of the lower energy range changed to the hard-soft-hard (HSH) pattern of the higher energy range during the spectral evolution of each subpeak in both hard X-ray flares. This energy dependence is actually supported by a positive correlation between the overall light curves and spectral evolution in the lower energy range, while it becomes an anti-correlation in the higher energy range. Regarding microwave data, the HSH pattern appears in the spectral evolution of each subpeak in the lower frequency range, which is somewhat similar to Huang and Nakajima. However, it returns back to the well-known pattern of soft-hard-harder for the overall spectral evolution in the higher frequency range of both events. This frequency dependence is confirmed by an anti-correlation between the overall light curves and spectral evolution in the lower frequency range, but it becomes a positive correlation in the higher frequency range. The possible mechanisms are discussed, respectively, for reasons why hard X-ray and microwave spectral evolutions have different patterns in different energy and frequency intervals.

20 CFR 670.220 - Are we responsible for the protection and maintenance of center facilities?

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Are we responsible for the protection and maintenance of center facilities? 670.220 Section 670.220 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR THE JOB CORPS UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT Site Selection...

21 CFR 570.13 - Indirect food additives resulting from packaging materials prior sanctioned for animal feed and...

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Indirect food additives resulting from packaging... ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES General Provisions § 570.13 Indirect food additives resulting from packaging materials...

Energy of N two-dimensional bosons with zero-range interactions

Science.gov (United States)

Bazak, B.; Petrov, D. S.

2018-02-01

We derive an integral equation describing N two-dimensional bosons with zero-range interactions and solve it for the ground state energy B N by applying a stochastic diffusion Monte Carlo scheme for up to 26 particles. We confirm and go beyond the scaling B N ∝ 8.567 N predicted by Hammer and Son (2004 Phys. Rev. Lett. 93 250408) in the large-N limit.

SU-G-TeP1-02: Analytical Stopping Power and Range Parameterization for Therapeutic Energy Intervals

Energy Technology Data Exchange (ETDEWEB)

Donahue, W [Louisiana State University, Baton Rouge, LA (United States); Newhauser, W [Louisiana State University, Baton Rouge, LA (United States); Mary Bird Perkins Cancer Center, Baton Rouge, LA (United States); Ziegler, J F [United States Naval Academy, Annapolis, MD (United States)

2016-06-15

Purpose: To develop a simple, analytic parameterization of stopping power and range, which covers a wide energy interval and is applicable to many species of projectile ions and target materials, with less than 15% disagreement in linear stopping power and 1 mm in range. Methods: The new parameterization was required to be analytically integrable from stopping power to range, and continuous across the range interval of 1 µm to 50 cm. The model parameters were determined from stopping power and range data for hydrogen, carbon, iron, and uranium ions incident on water, carbon, aluminum, lead and copper. Stopping power and range data was taken from SRIM. A stochastic minimization algorithm was used to find model parameters, with 10 data points per energy decade. Additionally, fitting was performed with 2 and 26 data points per energy decade to test the model’s robustness to sparse Results: 6 free parameters were sufficient to cover the therapeutic energy range for each projectile ion species (e.g. 1 keV – 300 MeV for protons). The model agrees with stopping power and range data well, with less than 9% relative stopping power difference and 0.5 mm difference in range. As few as, 4 bins per decade were required to achieve comparable fitting results to the full data set. Conclusion: This study successfully demonstrated that a simple analytic function can be used to fit the entire energy interval of therapeutic ion beams of hydrogen and heavier elements. Advantages of this model were the small number (6) of free parameters, and that the model calculates both stopping power and range. Applications of this model include GPU-based dose calculation algorithms and Monte Carlo simulations, where available memory is limited. This work was supported in part by a research agreement between United States Naval Academy and Louisiana State University: Contract No N00189-13-P-0786. In addition, this work was accepted for presentation at the American Nuclear Society Annual Meeting

SU-G-TeP1-02: Analytical Stopping Power and Range Parameterization for Therapeutic Energy Intervals

International Nuclear Information System (INIS)

Donahue, W; Newhauser, W; Ziegler, J F

2016-01-01

Purpose: To develop a simple, analytic parameterization of stopping power and range, which covers a wide energy interval and is applicable to many species of projectile ions and target materials, with less than 15% disagreement in linear stopping power and 1 mm in range. Methods: The new parameterization was required to be analytically integrable from stopping power to range, and continuous across the range interval of 1 µm to 50 cm. The model parameters were determined from stopping power and range data for hydrogen, carbon, iron, and uranium ions incident on water, carbon, aluminum, lead and copper. Stopping power and range data was taken from SRIM. A stochastic minimization algorithm was used to find model parameters, with 10 data points per energy decade. Additionally, fitting was performed with 2 and 26 data points per energy decade to test the model’s robustness to sparse Results: 6 free parameters were sufficient to cover the therapeutic energy range for each projectile ion species (e.g. 1 keV – 300 MeV for protons). The model agrees with stopping power and range data well, with less than 9% relative stopping power difference and 0.5 mm difference in range. As few as, 4 bins per decade were required to achieve comparable fitting results to the full data set. Conclusion: This study successfully demonstrated that a simple analytic function can be used to fit the entire energy interval of therapeutic ion beams of hydrogen and heavier elements. Advantages of this model were the small number (6) of free parameters, and that the model calculates both stopping power and range. Applications of this model include GPU-based dose calculation algorithms and Monte Carlo simulations, where available memory is limited. This work was supported in part by a research agreement between United States Naval Academy and Louisiana State University: Contract No N00189-13-P-0786. In addition, this work was accepted for presentation at the American Nuclear Society Annual Meeting

Deuteron stripping on beryllium target in the 100-2300 MeV energy range

International Nuclear Information System (INIS)

Lecolley, J.F.; Varignon, C.; Durand, D.; Le Brun, C.; Lecolley, F.R.; Lefebvres, F.; Louvel, M.; Thun, J.; Borne, F.; Martinez, E.; Menard, S.; Pras, P.; Boudard, A.; Duchazeaubeneix, J.C.; Durand, J.M.; Frehaut, J.; Hanappe, F.; Ledoux, X.; Legrain, R.; Leray, S.; Milleret, G.; Patin, Y.; Stuttge, L.; Terrien, Y.

1999-01-01

Cross sections for stripping and dissociation of deuterons interacting with Be targets in the 100-2300 MeV energy range have been measured. Comparisons with model calculations suggest a dominant contribution of the stripping process. It is also shown that the deuteron break-up cross section exhibits the same energy dependence as the nucleon-nucleon cross section. (orig.)

Carbon and energy balances for a range of biofuels options

Energy Technology Data Exchange (ETDEWEB)

Elsayed, M.A.; Matthews, R.; Mortimer, N.D.

2003-03-01

This is the final report of a project to produce a set of baseline energy and carbon balances for a range of electricity, heat and transport fuel production systems based on biomass feedstocks. A list of 18 important biofuel technologies in the UK was selected for study of their energy and carbon balances in a consistent approach. Existing studies on these biofuel options were reviewed and their main features identified in terms of energy input, greenhouse gas emissions (carbon dioxide, methane, nitrous oxide and total), transparency and relevance. Flow charts were produced to represent the key stages of the production of biomass and its conversion to biofuels. Outputs from the study included primary energy input per delivered energy output, carbon dioxide outputs per delivered energy output, methane output per delivered energy output, nitrous oxide output per delivered energy output and total greenhouse gas requirements. The net calorific value of the biofuel is given where relevant. Biofuels studied included: biodiesel from oilseed rape and recycled vegetable oil; combined heat and power (CHP) by combustion of wood chip from forestry residues; CHP by gasification of wood chip from short rotation coppice; electricity from the combustion of miscanthus, straw, wood chip from forestry residues and wood chip from short rotation coppice; electricity from gasification of wood chip from forestry residues and wood chip from short rotation coppice; electricity by pyrolysis of wood chip from forestry residues and wood chip from short rotation coppice; ethanol from lignocellulosics, sugar beet and wheat; heat (small scale) from combustion of wood chip from forestry residues and wood chip from short rotation coppice; and rapeseed oil from oilseed rape.

Experimental investigation of dd reaction in range of ultralow energies using Z-pinch

International Nuclear Information System (INIS)

Bystritskij, V.M.; Grebenyuk, V.M.; Parzhitskij, S.S.

1998-01-01

Results of the experiments to measure the dd reaction cross section in the range of deuteron collision energies from 0.1 keV to 1.5 keV using Z-pinch technique are presented. The experiment was performed at the Pulsed Ion Beam Accelerator of the High-Current Electronics Institute in Tomsk. The dd fusion neutrons were registered by scintillation detectors using time-of-flight method and BF 3 detectors of thermal neutrons. At 90% confidence level, the upper limits of the neutron producing dd reaction cross sections are obtained for average deuteron collision energies of 0.11, 0.34, 0.37 and 1.46 keV. The results demonstrate that high-intensity pulsed accelerators with a generator current of 2-3 MA allow the dd reaction cross sections to be measured in the range of deuteron collision energies from 0.8 keV to 3 keV

Passively-switched energy harvester for increased operational range

International Nuclear Information System (INIS)

Liu, Tian; Livermore, Carol; Pierre, Ryan St

2014-01-01

This paper presents modeling and experimental validation of a new type of vibrational energy harvester that passively switches between two dynamical modes of operation to expand the range of driving frequencies and accelerations over which the harvester effectively extracts power. In both modes, a driving beam with a low resonant frequency couples into ambient vibrations and transfers their energy to a generating beam that has a higher resonant frequency. The generating beam converts the mechanical power into electrical power. In coupled-motion mode, the driving beam bounces off the generating beam. In plucked mode, the driving beam deflects the generating beam until the driving beam passes from above the generating beam to below it or vice versa. Analytical system models are implemented numerically in the time domain for driving frequencies of 3 Hz to 27 Hz and accelerations from 0.1 g to 2.6 g, and both system dynamics and output power are predicted. A corresponding switched-dynamics harvester is tested experimentally, and its voltage, power, and dynamics are recorded. In both models and experiments, coupled-motion harvesting is observed at lower accelerations, whereas plucked harvesting and/or mixed mode harvesting are observed at higher accelerations. As expected, plucked harvesting outputs greater power than coupled-motion harvesting in both simulations and experiments. The predicted (1.8 mW) and measured (1.56 mW) maximum average power levels are similar under measured conditions at 0.5 g. When the system switches to dynamics that are characteristic of higher frequencies, the difference between predicted and measured power levels is more pronounced due to non-ideal mechanical interaction between the beams’ tips. Despite the beams’ non-ideal interactions, switched-dynamics operation increases the harvester’s operating range. (paper)

21 CFR 570.14 - Indirect food additives resulting from packaging materials for animal feed and pet food.

Science.gov (United States)

2010-04-01

..., DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS FOOD ADDITIVES General Provisions § 570.14 Indirect food additives resulting from packaging materials for animal feed and... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Indirect food additives resulting from packaging...

Department of the Navy. FY 1994/FY 1995 Biennial Budget Estimates. Military Construction Program. FY 1994

Science.gov (United States)

1992-01-01

CONTRACT COST ..... ................ - - - 2,920 SUPERVISION. INSPECTION & OVERHEAD ( 6.0%) . - - - ISO TOTAL REQUEST. ................. - - - 3.100...3,570CONTINGENCY ( 5.0%) . . . . . . . . . . . ISO TOTAL CONTRACT COST . .. .. .. .. .. . .. - - - 3.700 SUPERVISION. INSPECTION & OVERHEAD ( 6.0%) . - - - 220...CONTINUED) b. Renovation/Modernization: Building 27001 is an Air Force excess and substandard facility that was vacated when the Air Force B-52 Bomber

9 CFR 93.220 - Inspection at port of entry.

Science.gov (United States)

2010-01-01

... CERTAIN ANIMALS, BIRDS, FISH, AND POULTRY, AND CERTAIN ANIMAL, BIRD, AND POULTRY PRODUCTS; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry Mexico 8 § 93.220 Inspection at port of entry. (a) All poultry offered for entry from Mexico, including such poultry intended for movement through...

29 CFR 570.113 - Employment “in commerce or in the production of goods for commerce”.

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Employment âin commerce or in the production of goods for... Amended Coverage of Section 12(c) § 570.113 Employment “in commerce or in the production of goods for... acquiescence in addition to those who employ by oral or written contract. A typical illustration of employment...

Energy- and time-resolved detection of prompt gamma-rays for proton range verification.

Science.gov (United States)

Verburg, Joost M; Riley, Kent; Bortfeld, Thomas; Seco, Joao

2013-10-21

In this work, we present experimental results of a novel prompt gamma-ray detector for proton beam range verification. The detection system features an actively shielded cerium-doped lanthanum(III) bromide scintillator, coupled to a digital data acquisition system. The acquisition was synchronized to the cyclotron radio frequency to separate the prompt gamma-ray signals from the later-arriving neutron-induced background. We designed the detector to provide a high energy resolution and an effective reduction of background events, enabling discrete proton-induced prompt gamma lines to be resolved. Measuring discrete prompt gamma lines has several benefits for range verification. As the discrete energies correspond to specific nuclear transitions, the magnitudes of the different gamma lines have unique correlations with the proton energy and can be directly related to nuclear reaction cross sections. The quantification of discrete gamma lines also enables elemental analysis of tissue in the beam path, providing a better prediction of prompt gamma-ray yields. We present the results of experiments in which a water phantom was irradiated with proton pencil-beams in a clinical proton therapy gantry. A slit collimator was used to collimate the prompt gamma-rays, and measurements were performed at 27 positions along the path of proton beams with ranges of 9, 16 and 23 g cm(-2) in water. The magnitudes of discrete gamma lines at 4.44, 5.2 and 6.13 MeV were quantified. The prompt gamma lines were found to be clearly resolved in dimensions of energy and time, and had a reproducible correlation with the proton depth-dose curve. We conclude that the measurement of discrete prompt gamma-rays for in vivo range verification of clinical proton beams is feasible, and plan to further study methods and detector designs for clinical use.

Investigation of the neutron-proton-interaction in the energy range from 20 to 50 MEV

International Nuclear Information System (INIS)

Wilczynski, J.

1984-07-01

In the framework of the investigation of the isospin singlet part of the nucleon-nucleon-interaction in the energy range below 100 MeV two experiments were conducted, which were selected by sensitivity calculations. At the Karlsruhe polarized neutron facility POLKA the analyzing powers Asub(y) and Asub(yy) of the elastic n vector-p- and n vector-p vector-scattering were measured in the energy range from 20 to 50 MeV. The results of this epxeriment are compared to older data. In the energy range from 20 to 50 MeV the new data were analyzed together with other selected data of the nucleon-nucleon-system in phase shift analyses. The knowledge of the isospin singlet phase shifts 1 P 1 and 3 D 3 was improved by the new data. (orig./HSI) [de

Energy dependence of the zero-range DWBA normalization of the /sup 58/Ni(/sup 3/He,. cap alpha. )/sup 57/Ni reaction. [15 to 205 GeV, finite-range and nonlocality corrections

Energy Technology Data Exchange (ETDEWEB)

Shepard, J R; Zimmerman, W R; Kraushaar, J J [Colorado Univ., Boulder (USA). Dept. of Physics and Astrophysics

1977-01-04

Strong transitions in the /sup 58/Ni(/sup 3/He,..cap alpha..)/sup 57/Ni reaction were analyzed using both the zero-range and exact finite-range DWBA. Data considered covered a range of bombarding energies from 15 to 205 MeV. The zero-range DWBA described all data well when finite-range and non-locality corrections were included in the local energy approximation. Comparison of zero-range and exact finite-range calculations showed the local energy approximation correction to be very accurate over the entire energy region. Empirically determined D/sub 0/ values showed no energy dependence. A theoretical D/sub 0/ value calculated using an ..cap alpha.. wave function which reproduced the measured ..cap alpha.. rms charge radius and the elastic electron scattering form factor agreed well the empirical values. Comparison was made between these values and D/sub 0/ values quoted previously in the literature.

29 CFR 570.31 - Secretary's determinations concerning the employment of minors 14 and 15 years of age.

Science.gov (United States)

2010-07-01

... AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR REGULATIONS, ORDERS AND STATEMENTS OF INTERPRETATION Employment of Minors Between 14 and 16 Years of Age (Child Labor Reg. 3) § 570.31 Secretary's... or with their health and well-being and shall not be deemed to be oppressive child labor. Effective...

Corrective Action Investigation Plan for Corrective Action Unit 570: Area 9 Yucca Flat Atmospheric Test Sites Nevada National Security Site, Nevada, Revision 0

Energy Technology Data Exchange (ETDEWEB)

Patrick Matthews

2012-08-01

CAU 570 comprises the following six corrective action sites (CASs): • 02-23-07, Atmospheric Test Site - Tesla • 09-23-10, Atmospheric Test Site T-9 • 09-23-11, Atmospheric Test Site S-9G • 09-23-14, Atmospheric Test Site - Rushmore • 09-23-15, Eagle Contamination Area • 09-99-01, Atmospheric Test Site B-9A These sites are being investigated because existing information on the nature and extent of potential contamination is insufficient to evaluate and recommend corrective action alternatives (CAAs). Additional information will be obtained by conducting a corrective action investigation before evaluating CAAs and selecting the appropriate corrective action for each CAS. The results of the field investigation will support a defensible evaluation of viable CAAs that will be presented in the Corrective Action Decision Document. The sites will be investigated based on the data quality objectives (DQOs) developed on April 30, 2012, by representatives of the Nevada Division of Environmental Protection and the U.S. Department of Energy (DOE), National Nuclear Security Administration Nevada Site Office. The DQO process was used to identify and define the type, amount, and quality of data needed to develop and evaluate appropriate corrective actions for CAU 570. The site investigation process will also be conducted in accordance with the Soils Activity Quality Assurance Plan, which establishes requirements, technical planning, and general quality practices to be applied to this activity. The presence and nature of contamination at CAU 570 will be evaluated based on information collected from a field investigation. Radiological contamination will be evaluated based on a comparison of the total effective dose at sample locations to the dose-based final action level. The total effective dose will be calculated as the total of separate estimates of internal and external dose. Results from the analysis of soil samples will be used to calculate internal radiological

Rehabilitation of broken-down chamber for the Gammacell-220 Irradiation Facility

International Nuclear Information System (INIS)

Emi-Reynolds, G.; Banini, G.K.; Ennison, I.

1997-01-01

The broken-down chamber of the gammacell-220 irradiation facility used for the calibration of dosimeters at the National Nuclear Research has been repaired. This repair work involved the identification of suitable components for the aluminum welding capable of ensuring double welding of the inside and outside joints of the chamber. Of paramount importance is the ability of the welded joint to physically sustain the safety column which is made of 26.9 kg of reinforce lead. The wielding was also expected to ensure that the shape of the chamber is retained after installation, apart from allowing uninhibited movement of the chamber which carries samples to be taken into the belly of the gamma cell for irradiation. The Ferrous ammonium sulfate (Fricke) solution was used as the dosimetry standard to check the gamma dose after restoration of the equipment. This report presents information on the procedure and justification for undertaking the repairs of this unit. By this successful repairs and putting into operation of the Gammacell-220, the maintenance team at the Center have demonstrated their ability to undertake similar works on the Gammacell-220 in the future even to other countries in the sub-region. (author). 2 refs., 2 figs

Constructing high-accuracy intermolecular potential energy surface with multi-dimension Morse/Long-Range model

Science.gov (United States)

Zhai, Yu; Li, Hui; Le Roy, Robert J.

2018-04-01

Spectroscopically accurate Potential Energy Surfaces (PESs) are fundamental for explaining and making predictions of the infrared and microwave spectra of van der Waals (vdW) complexes, and the model used for the potential energy function is critically important for providing accurate, robust and portable analytical PESs. The Morse/Long-Range (MLR) model has proved to be one of the most general, flexible and accurate one-dimensional (1D) model potentials, as it has physically meaningful parameters, is flexible, smooth and differentiable everywhere, to all orders and extrapolates sensibly at both long and short ranges. The Multi-Dimensional Morse/Long-Range (mdMLR) potential energy model described herein is based on that 1D MLR model, and has proved to be effective and accurate in the potentiology of various types of vdW complexes. In this paper, we review the current status of development of the mdMLR model and its application to vdW complexes. The future of the mdMLR model is also discussed. This review can serve as a tutorial for the construction of an mdMLR PES.

High yield of low-energy pions from a high-energy primary proton beam

International Nuclear Information System (INIS)

Bertin, A.; Capponi, S.; De Castro, S.

1987-01-01

This paper presents the results of the first measurement on the yield of pions with momentum smaller than 220 MeV/c, produced by a 300 GeV/c proton beam. The measurements, performed at the CERN super proton synchrotron using tungsten production targets of different lengths, are discussed referring to the possibility of extending to high-energy laboratories the access to fundamental research involving low-energy pions and muons

Average fast neutron flux in three energy ranges in the Quinta assembly irradiated by two types of beams

Directory of Open Access Journals (Sweden)

Strugalska-Gola Elzbieta

2017-01-01

Full Text Available This work was performed within the international project “Energy plus Transmutation of Radioactive Wastes” (E&T - RAW for investigations of energy production and transmutation of radioactive waste of the nuclear power industry. 89Y (Yttrium 89 samples were located in the Quinta assembly in order to measure an average high neutron flux density in three different energy ranges using deuteron and proton beams from Dubna accelerators. Our analysis showed that the neutron density flux for the neutron energy range 20.8 - 32.7 MeV is higher than for the neutron energy range 11.5 - 20.8 MeV both for protons with an energy of 0.66 GeV and deuterons with an energy of 2 GeV, while for deuteron beams of 4 and 6 GeV we did not observe this.

Study of the spectral and energy characteristics of lasing in the green spectral region by lithium fluoride with radiation color centers

Energy Technology Data Exchange (ETDEWEB)

Voitovich, A.P.; Kalinov, V.S.; Mikhnov, S.A.; Ovseichuk, S.I.

1987-06-01

The spectral and energy characteristics of lasers utilizing lithium fluoride with F2 and F3(+) color centers in transverse and longitudinal pumping schemes are studied. The feasibility of obtaining stable narrow-band radiation in the 510-570 nm range using a selective resonator is demonstrated. Consideration is given to the effect of lithium-fluoride crystal processing by excimer laser radiation at a wavelength of 308 nm on the spectroscopic and lasing characteristics of the F3(+) color center. After this processing, the laser efficiency in the green spectral region increases by more than a factor of two (reaching an efficiency of 14 percent). 7 references.

Evaluation of energy requirements for all-electric range of plug-in hybrid electric two-wheeler

International Nuclear Information System (INIS)

Amjad, Shaik; Rudramoorthy, R.; Neelakrishnan, S.; Sri Raja Varman, K.; Arjunan, T.V.

2011-01-01

Recently plug-in hybrid electric vehicles (PHEVs) are emerging as one of the promising alternative to improve the sustainability of transportation energy and air quality especially in urban areas. The all-electric range in PHEV design plays a significant role in sizing of battery pack and cost. This paper presents the evaluation of battery energy and power requirements for a plug-in hybrid electric two-wheeler for different all-electric ranges. An analytical vehicle model and MATLAB simulation analysis has been discussed. The MATLAB simulation results estimate the impact of driving cycle and all-electric range on energy capacity, additional mass and initial cost of lead-acid, nickel-metal hydride and lithium-ion batteries. This paper also focuses on influence of cycle life on annual cost of battery pack and recommended suitable battery pack for implementing in plug-in hybrid electric two-wheelers. -- Research highlights: → Evaluates the battery energy and power requirements for a plug-in hybrid electric two-wheeler. → Simulation results reveal that the IDC demand more energy and cost of battery compared to ECE R40. → If cycle life is considered, the annual cost of Ni-MH battery pack is lower than lead-acid and Li-ion.

The effectiveness of heat pumps as part of CCGT-190/220 Tyumen CHP-1

Directory of Open Access Journals (Sweden)

Tretyakova Polina

2017-01-01

Full Text Available The article considers the possibility of increasing the energy efficiency of CCGT-190/220 Tyumen CHP-1 due to the utilization of low-grade heat given off in the condenser unit of the steam turbine. To assess the effectiveness of the proposed system, the indexes of thermal efficiency are given. As a result of a research the following conclusions are received: The heat-transfer agent heat pump, when heated uses low-grade heat TPP and increases heat output, but consumes the electricity. Using a heat pump is effective for a small temperature difference between the condenser and the evaporator. Good example is heating water before chemical treatment. This method is more efficient than using a replacement boiler and it is used in steam selection.

29 CFR 570.64 - Occupations involved in the manufacture of brick, tile, and kindred products (Order 13).

Science.gov (United States)

2010-07-01

... 29 Labor 3 2010-07-01 2010-07-01 false Occupations involved in the manufacture of brick, tile, and... Detrimental to Their Health or Well-Being § 570.64 Occupations involved in the manufacture of brick, tile, and... term clay construction products shall mean the following clay products: Brick, hollow structural tile...

41 CFR 101-29.220 - Market research and analysis.

Science.gov (United States)

2010-07-01

... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Market research and... PRODUCT DESCRIPTIONS 29.2-Definitions § 101-29.220 Market research and analysis. Market research and... to determine whether they meet user needs and to identify the market practices of firms engaged in...

Long-Range Energy Propagation in Nanometer Arrays of Light Harvesting Antenna Complexes

NARCIS (Netherlands)

Escalantet, Maryana; Escalante Marun, M.; Lenferink, Aufrid T.M.; Zhao, Yiping; Tas, Niels Roelof; Huskens, Jurriaan; Hunter, C. Neil; Subramaniam, Vinod; Otto, Cornelis

2010-01-01

Here we report the first observation of long-range transport of excitation energy within a biomimetic molecular nanoarray constructed from LH2 antenna complexes from Rhodobacter sphaeroides. Fluorescence microscopy of the emission of light after local excitation with a diffraction-limited light beam

International energy annual 1996

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-02-01

The International Energy Annual presents an overview of key international energy trends for production, consumption, imports, and exports of primary energy commodities in over 220 countries, dependencies, and areas of special sovereignty. Also included are population and gross domestic product data, as well as prices for crude oil and petroleum products in selected countries. Renewable energy reported in the International Energy Annual includes hydroelectric power, geothermal, solar, and wind electric power, biofuels energy for the US, and biofuels electric power for Brazil. New in the 1996 edition are estimates of carbon dioxide emissions from the consumption of petroleum and coal, and the consumption and flaring of natural gas. 72 tabs.

THE RECEPTION OF GALATIANS 2:20 IN THE PATRISTIC PERIOD ...

African Journals Online (AJOL)

This article explores the reception of Galatians 2:20 in the Patristic period, and ... theological framework in which later generations placed the communities wherein ... quality of reality – and in Christ that is as perfect as eternal life can ever be.

7 CFR 220.14 - Claims against school food authorities.

Science.gov (United States)

2010-01-01

..., DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.14 Claims against school food authorities. (a) State agencies shall disallow any portion of a claim and recover any payment made... FNSRO, when FNSRO disallows a claim or a portion of a claim, or makes a demand for refund of an alleged...

EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 220, Revision 2 (FGE.220Rev1): α,β-Unsaturated ketones and precursors from chemical subgroup 4.4 of FGE.19: 3(2H)-Furanones

DEFF Research Database (Denmark)

Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia

The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 10 flavouring substances from subgroup 4.4 of FGE.19 in the Flavouring Group Evaluation 220 (FGE.220). FGE.220 is subdivided int...

High energy ion range and deposited energy calculation using the Boltzmann-Fokker-Planck splitting of the Boltzmann transport equation

International Nuclear Information System (INIS)

Mozolevski, I.E.

2001-01-01

We consider the splitting of the straight-ahead Boltzmann transport equation in the Boltzmann-Fokker-Planck equation, decomposing the differential cross-section into a singular part, corresponding to small energy transfer events, and in a regular one, which corresponds to large energy transfer. The convergence of implantation profile, nuclear and electronic energy depositions, calculated from the Boltzmann-Fokker-Planck equation, to the respective exact distributions, calculated from Monte-Carlo method, was exanimate in a large-energy interval for various values of splitting parameter and for different ion-target mass relations. It is shown that for the universal potential there exists an optimal value of splitting parameter, for which range and deposited energy distributions, calculated from the Boltzmann-Fokker-Planck equation, accurately approximate the exact distributions and which minimizes the computational expenses

20 CFR 220.142 - General information about work activity.

Science.gov (United States)

2010-04-01

... gainful activity. (e) Time spent in work. While the time the claimant spends in work is important, the... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false General information about work activity. 220... of whether the claimant spends more time or less time at the job than workers who are not impaired...

Synthetic Biology Open Language (SBOL) Version 2.2.0.

Science.gov (United States)

Cox, Robert Sidney; Madsen, Curtis; McLaughlin, James Alastair; Nguyen, Tramy; Roehner, Nicholas; Bartley, Bryan; Beal, Jacob; Bissell, Michael; Choi, Kiri; Clancy, Kevin; Grünberg, Raik; Macklin, Chris; Misirli, Goksel; Oberortner, Ernst; Pocock, Matthew; Samineni, Meher; Zhang, Michael; Zhang, Zhen; Zundel, Zach; Gennari, John H; Myers, Chris; Sauro, Herbert; Wipat, Anil

2018-04-02

Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year's JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Synthetic Biology Open Language (SBOL) Version 2.2.0

KAUST Repository

Cox, Robert Sidney

2018-04-04

Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year\\'s JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Synthetic Biology Open Language (SBOL Version 2.2.0

Directory of Open Access Journals (Sweden)

Cox Robert Sidney

2018-04-01

Full Text Available Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year’s JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Synthetic Biology Open Language (SBOL) Version 2.2.0

KAUST Repository

Cox, Robert Sidney; Madsen, Curtis; McLaughlin, James Alastair; Nguyen, Tramy; Roehner, Nicholas; Bartley, Bryan; Beal, Jacob; Bissell, Michael; Choi, Kiri; Clancy, Kevin; Grunberg, Raik; Macklin, Chris; Misirli, Goksel; Oberortner, Ernst; Pocock, Matthew; Samineni, Meher; Zhang, Michael; Zhang, Zhen; Zundel, Zach; Gennari, John H.; Myers, Chris; Sauro, Herbert; Wipat, Anil

2018-01-01

Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year's JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Search for solar Axion Like Particles in the low energy range at CAST

International Nuclear Information System (INIS)

Cantatore, G.; Karuza, M.; Lozza, V.; Raiteri, G.

2010-01-01

Axion Like Particles (ALPs) could be continuously produced in the Sun via the Primakoff process. The ALP flux could be seen on Earth by observing the photons produced by the ALP decay. The expected energy distribution of reconverted photons is peaked at 3 keV. There could be, however, a low energy tail due to various processes active in the Sun. We report results of the first test measurements in the low energy range performed at CAST along with a description of the experimental setup. Future detector developments are discussed and preliminary results on a liquid nitrogen cooled Avalanche Photodiode are presented.

True coincidence summing corrections for an extended energy range HPGe detector

Energy Technology Data Exchange (ETDEWEB)

Venegas-Argumedo, Y. [Centro de Investigación en Materiales Avanzados (CIMAV), Miguel de Cervantes 120, Chihuahua, Chih 31109 (Mexico); M.S. Student at CIMAV (Mexico); Montero-Cabrera, M. E., E-mail: elena.montero@cimav.edu.mx [Centro de Investigación en Materiales Avanzados (CIMAV), Miguel de Cervantes 120, Chihuahua, Chih 31109 (Mexico)

2015-07-23

True coincidence summing (TCS) effect for natural radioactive families of U-238 and Th-232 represents a problem when an environmental sample with a close source-detector geometry measurement is performed. By using a certified multi-nuclide standard source to calibrate an energy extended range (XtRa) HPGe detector, it is possible to obtain an intensity spectrum slightly affected by the TCS effect with energies from 46 to 1836 keV. In this work, the equations and some other considerations required to calculate the TCS correction factor for isotopes of natural radioactive chains are described. It is projected a validation of the calibration, performed with the IAEA-CU-2006-03 samples (soil and water)

Transport properties of gaseous ions over a wide energy range, IV

International Nuclear Information System (INIS)

Viehland, L.A.; Mason, E.A.

1995-01-01

This paper updates three previous papers entitled open-quotes Transport Properties of Gaseous Ions over a Wide Energy Range.close quotes. These papers referred to as Parts I, II, and III, were by H.W.Ellis, P.Y. Pai, E.W. McDaniel, E.A. Mason, and L.A. Viehland, S.L. Lin, M.G. Thackston. Part IV contains compilations of experimental data on ionic mobilities and diffusion coefficients (both longitudinal and transverse) for ions in neutral gases in an externally applied electrostatic field, at various gas temperatures; the data are tabulated as a function of the ionic energy parameter E/N, where E is the electric field strength and N is the number density of the neutral gas. Part IV also contains a locator key to ionic mobilities and diffusion coefficients compiled in Parts I-IV. The coverage of the literature extends into 1994. The criteria for selection of the data are; (1) the measurements must cover a reasonably wide range of E/N; (2) the identity of the ions must be well established; and (3) the accuracy of the data must be good. 26 refs., 6 tabs

Theoretical study of cylindrical energy analyzers for MeV range heavy ion beam probes

International Nuclear Information System (INIS)

Fujisawa, A.; Hamada, Y.

1993-07-01

A cylindrical energy analyzer with drift spaces is shown to have a second order focusing for beam incident angle when the deflection angle is properly chosen. The analyzer has a possibility to be applied to MeV range heavy ion beam probes, and will be also available for accurate particle energy measurements in many other fields. (author)

Energy consumption, costs and environmental impacts for urban water cycle services: Case study of Oslo (Norway)

International Nuclear Information System (INIS)

Venkatesh, G.; Brattebo, Helge

2011-01-01

Energy consumption in the operation and maintenance phase of the urban water and wastewater network is directly related to both the quantity and the desired quality of the supplied water/treated wastewater - in other words, to the level of service provided to consumers. The level of service is dependent on not just the quantity and quality of the water but also the state of the infrastructure. Maintaining the infrastructure so as to be able to provide the required high level of service also demands energy. Apart from being a significant operational cost component, energy use also contributes to life-cycle environmental impacts. This paper studies the direct energy consumption in the operation and maintenance phase of the water and wastewater system in Oslo; and presents a break-up among the different components of the network, of quantities, costs and environmental impacts. Owing to the diversity in the periods of time for which comprehensive data for the whole system are available, the study period is restricted to years 2000-2006. The per-capita annual consumption of energy in the operational phase of the system varied between 220 and 260 kWh; and per-capita annual expenses on energy in inflation-adjusted year-2006-Euros ranged between 6.5 and 11 Euros. The energy consumed on the upstream, per unit volume water supplied was around 0.4 kWh on average, while the corresponding value for the downstream was 0.8 kWh per cubic metre wastewater treated. The upstream Greenhouse gas (GHG) emissions ranged between 70 and 80 g per cubic metre of water supplied, about 22% greater on average than the corresponding specific GHG emissions on the downstream. -- Research highlights: → Annual per-capita energy consumption in the Operation and Maintenance (O and M) phase of the system varied between 220 and 260 kWh. → Annual per-capita annual expenses on energy in inflation-adjusted year-2006-Euros ranged between 6.5 and 11 Euros. → Upstream O and M energy consumption per

ALMA IMAGING OF HCN, CS, AND DUST IN ARP 220 AND NGC 6240

Energy Technology Data Exchange (ETDEWEB)

Scoville, Nick; Manohar, Swarnima; Murchikova, Lena [California Institute of Technology, MC 249-17, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Sheth, Kartik [North American ALMA Science Center, National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22901 (United States); Walter, Fabian; Zschaechner, Laura [Max-Planck-Institut fur Astronomie, Konigstuhl 17, D-69117 Heidelberg (Germany); Yun, Min [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Koda, Jin [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Sanders, David; Barnes, Joshua [Institute for Astronomy, 2680 Woodlawn Drive, University of Hawaii, Honolulu, Hawaii, HI 96822 (United States); Thompson, Todd [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Robertson, Brant; Tacconi, Linda; Narayanan, Desika [Department of Astronomy and Steward Observatory, University of Arizona, Tucson AZ 85721 (United States); Genzel, Reinhard; Davies, Richard [Max-Planck-Institut fur extraterrestrische Physik (MPE), Giessenbachstrasse, D-85748 Garching (Germany); Hernquist, Lars [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Brown, Robert [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22901 (United States); Hayward, Christopher C. [TAPIR 350-17, California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Kartaltepe, Jeyhan [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); and others

2015-02-10

We report ALMA Band 7 (350 GHz) imaging at 0.''4-0.''6 resolution and Band 9 (696 GHz) at ∼0.''25 resolution of the luminous IR galaxies Arp 220 and NGC 6240. The long wavelength dust continuum is used to estimate interstellar medium masses for Arp 220 east and west and NGC 6240 of 1.9, 4.2, and 1.6 × 10{sup 9} M {sub ☉}within radii of 69, 65, and 190 pc. The HCN emission was modeled to derive the emissivity distribution as a function of radius and the kinematics of each nuclear disk, yielding dynamical masses consistent with the masses and sizes derived from the dust emission. In Arp 220, the major dust and gas concentrations are at radii less than 50 pc in both counter-rotating nuclear disks. The thickness of the disks in Arp 220 estimated from the velocity dispersion and rotation velocities are 10-20 pc and the mean gas densities are n{sub H{sub 2}}∼10{sup 5} cm{sup –3} at R <50 pc. We develop an analytic treatment for the molecular excitation (including photon trapping), yielding volume densities for both the HCN and CS emission with n {sub H2} ∼ 2 × 10{sup 5} cm{sup –3}. The agreement of the mean density from the total mass and size with that required for excitation suggests that the volume is essentially filled with dense gas, i.e., it is not cloudy or like swiss cheese.

ALMA IMAGING OF HCN, CS, AND DUST IN ARP 220 AND NGC 6240

International Nuclear Information System (INIS)

Scoville, Nick; Manohar, Swarnima; Murchikova, Lena; Sheth, Kartik; Walter, Fabian; Zschaechner, Laura; Yun, Min; Koda, Jin; Sanders, David; Barnes, Joshua; Thompson, Todd; Robertson, Brant; Tacconi, Linda; Narayanan, Desika; Genzel, Reinhard; Davies, Richard; Hernquist, Lars; Brown, Robert; Hayward, Christopher C.; Kartaltepe, Jeyhan

2015-01-01

We report ALMA Band 7 (350 GHz) imaging at 0.''4-0.''6 resolution and Band 9 (696 GHz) at ∼0.''25 resolution of the luminous IR galaxies Arp 220 and NGC 6240. The long wavelength dust continuum is used to estimate interstellar medium masses for Arp 220 east and west and NGC 6240 of 1.9, 4.2, and 1.6 × 10 9 M ☉ within radii of 69, 65, and 190 pc. The HCN emission was modeled to derive the emissivity distribution as a function of radius and the kinematics of each nuclear disk, yielding dynamical masses consistent with the masses and sizes derived from the dust emission. In Arp 220, the major dust and gas concentrations are at radii less than 50 pc in both counter-rotating nuclear disks. The thickness of the disks in Arp 220 estimated from the velocity dispersion and rotation velocities are 10-20 pc and the mean gas densities are n H 2 ∼10 5  cm –3 at R <50 pc. We develop an analytic treatment for the molecular excitation (including photon trapping), yielding volume densities for both the HCN and CS emission with n H2 ∼ 2 × 10 5  cm –3 . The agreement of the mean density from the total mass and size with that required for excitation suggests that the volume is essentially filled with dense gas, i.e., it is not cloudy or like swiss cheese

Optimized design of a low-resistance electrical conductor for the multimegahertz range

Science.gov (United States)

Kurs, André; Kesler, Morris; Johnson, Steven G.

2011-04-01

We propose a design for a conductive wire composed of several mutually insulated coaxial conducting shells. With the help of numerical optimization, it is possible to obtain electrical resistances significantly lower than those of a heavy-gauge copper wire or litz wire in the 2-20 MHz range. Moreover, much of the reduction in resistance can be achieved for just a few shells; in contrast, litz wire would need to contain ˜104 strands to perform comparably in this frequency range.

Thermal expansion analysis and structural characteristics of the (Pb, Ca)TiO{sub 3} solid solutions from 150 to 570 K; Analise da expansao termica volumetrica e das caracteristicas estruturais de solucoes solidas de (Pb, Ca)TiO{sub 3} entre 150 e 570 K

Energy Technology Data Exchange (ETDEWEB)

Estrada, F.R.; Eiras, J.A.; Garcia, D., E-mail: frestrada@df.ufscar.br, E-mail: eiras@df.ufscar.br, E-mail: ducinei@df.ufscar.br [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Fisica. Grupo de Materiais Ferroicos

2017-01-15

Ceramic samples of lead modified calcium titanate (Pb{sub 1-x}Ca{sub x} TiO{sub 3}) with calcium concentration between 0.24≤x≤0.55 were prepared and analyzed in order to determine the structural origin of the negative thermal expansion observed in this ferroelectric system. The Rietveld structural refinement method was used to assess the thermal evolution of the structural parameters using powder X-ray diffraction data collected between 150 and 570 K. Since the Pb{sub 1-x}Ca{sub x} TiO{sub 3} phase diagram and space groups are still unknown for the temperature range investigated, the structural analyses were based on adjustments of the refinement protocol. The results revealed the existence of a correlation between symmetry transitions and anomalies in the thermal expansion of the unit cell, being such transitions not necessarily of the ferroelectric-paraelectric nature. (author)

Inhalation exposures due to radon and thoron ((222)Rn and (220)Rn): Do they differ in high and normal background radiation areas in India?

Science.gov (United States)

Mishra, Rosaline; Sapra, B K; Prajith, R; Rout, R P; Jalaluddin, S; Mayya, Y S

2015-09-01

In India, High Background Radiation Areas (HBRAs) due to enhanced levels of naturally occurring radionuclides in soil (thorium and, to a lesser extent, uranium), are located along some parts of the coastal tracts viz. the coastal belt of Kerala, Tamilnadu and Odisha. It is conjectured that these deposits will result in higher emissions of radon isotopes ((222)Rn and (220)Rn) and their daughter products as compared to Normal Background Radiation Areas (NBRAs). While the annual external dose rates contributed by gamma radiations in these areas are about 5-10 times higher, the extent of increase in the inhalation dose rates attributable to (222)Rn and (220)Rn and their decay products is not well quantified. Towards this, systematic indoor surveys were conducted wherein simultaneous measurements of time integrated (222)Rn and (220)Rn gas and their decay product concentrations was carried out in around 800 houses in the HBRAs of Kerala and Odisha to estimate the inhalation doses. All gas measurements were carried out using pin-hole cup dosimeters while the progeny measurements were with samplers and systems based on the Direct radon/thoron Progeny sensors (DRPS/DTPS). To corroborate these passive measurements of decay products concentrations, active sampling was also carried out in a few houses. The results of the surveys provide a strong evidence to conclude that the inhalation doses due to (222)Rn and (220)Rn gas and their decay products in these HBRAs are in the same range as observed in the NBRAs in India. Copyright © 2015 Elsevier Ltd. All rights reserved.

Geothermal energy, a new energy source

Energy Technology Data Exchange (ETDEWEB)

Murr, K

1960-05-01

A survey is made of the historical development of geothermal energy, and the geological situations appropriate for its exploitation are described. When prospecting for steam sources, several vertical drillings of about 200 m depth and 60-120 mm diameter are usually sufficient to give adequate knowledge of subsurface conditions. In Iceland, geothermal energy is used primarily for domestic space-heating and climate control in greenhouses, but due to the ready availability of hydroelectricity, geothermal energy is not widely applied for the generation of electricity. In Katanga (Congo), a tin mine is supplied by 220-275 kW power plant which is driven by a nearby hot-water source. Other major developments at the time (1960) included Larderello in Italy and Wairakei in New Zealand. Preliminary results from exploratory boreholes in El Salvador are discussed.

Interplay of short-range correlations and nuclear symmetry energy in hard-photon production from heavy-ion reactions at Fermi energies

Science.gov (United States)

Yong, Gao-Chan; Li, Bao-An

2017-12-01

Within an isospin- and momentum-dependent transport model for nuclear reactions at intermediate energies, we investigate the interplay of the nucleon-nucleon short-range correlations (SRCs) and nuclear symmetry energy Esym(ρ ) on hard-photon spectra in collisions of several Ca isotopes on 112Sn and 124Sn targets at a beam energy of 45 MeV/nucleon. It is found that over the whole spectra of hard photons studied, effects of the SRCs overwhelm those owing to the Esym(ρ ) . The energetic photons come mostly from the high-momentum tails (HMTs) of single-nucleon momentum distributions in the target and projectile. Within the neutron-proton dominance model of SRCs based on the consideration that the tensor force acts mostly in the isosinglet and spin-triplet nucleon-nucleon interaction channel, there are equal numbers of neutrons and protons, thus a zero isospin asymmetry in the HMTs. Therefore, experimental measurements of the energetic photons from heavy-ion collisions at Fermi energies have the great potential to help us better understand the nature of SRCs without any appreciable influence by the uncertain Esym(ρ ) . These measurements will be complementary to but also have some advantages over the ongoing and planned experiments using hadronic messengers from reactions induced by high-energy electrons or protons. Because the underlying physics of SRCs and Esym(ρ ) are closely correlated, a better understanding of the SRCs will, in turn, help constrain the nuclear symmetry energy more precisely in a broad density range.

Excitation energies from Görling-Levy perturbation theory along the range-separated adiabatic connection

Science.gov (United States)

Rebolini, Elisa; Teale, Andrew M.; Helgaker, Trygve; Savin, Andreas; Toulouse, Julien

2018-06-01

A Görling-Levy (GL)-based perturbation theory along the range-separated adiabatic connection is assessed for the calculation of electronic excitation energies. In comparison with the Rayleigh-Schrödinger (RS)-based perturbation theory this GL-based perturbation theory keeps the ground-state density constant at each order and thus gives the correct ionisation energy at each order. Excitation energies up to first order in the perturbation have been calculated numerically for the helium and beryllium atoms and the hydrogen molecule without introducing any density-functional approximations. In comparison with the RS-based perturbation theory, the present GL-based perturbation theory gives much more accurate excitation energies for Rydberg states but similar excitation energies for valence states.

Sn-doped polyhedral In2O3 particles: Synthesis, characterization, and origins of luminous emission in wide visible range

International Nuclear Information System (INIS)

Zhu Yunqing; Chen Yiqing

2012-01-01

Sn-doped octahedronal and tetrakaidecahedronal In 2 O 3 particles were successfully synthesized by simple thermal evaporation of indium grains using SnO as dopant. Structural characterization results demonstrated that the Sn-doped tetrakaidecahedronal In 2 O 3 particle had additional six {001} crystal surfaces compared with the octahedronal one. The luminous properties of both samples were characterized by photoluminescence (PL) and cathodoluminescence (CL) spectroscopy. A broad visible luminous emission around 570 nm was observed. Studies revealed that the emission consisted of three peaks of 511 nm, 564 nm, and 622 nm, which were attributed to radioactive recombination centers such as single ionized oxygen vacancy, indium interstitial, and antisite oxygen, respectively. We believe that the Sn donor level plays an important role in the visible luminous emission. - Graphical abstract: With more oxygen vacancies and tin doping. ITO particles can exhibit a better CL performance. Sn donor level near the conduction band edge plays an important role in luminous emission in wide visible range. Highlights: ► Polyhedral ITO particles synthesized by thermal evaporation using SnO as dopant. ► Broad visible luminous emission around 570 nm. ► Sn donor level plays an important role in the visible emission. ► ITO particles with more oxygen vacancies have better CL performance in visible range.

The effects of aquifer thermal energy storage on groundwater quality and the consequences for drinking water production: A case study from the Netherlands

NARCIS (Netherlands)

Bonte, M.; van der Berg, G.; Stuijfzand, P.J.; Boukes, H.

2011-01-01

We used data from an aquifer thermal energy storage (ATES) system located 570 m from a public water supply well field in the south of the Netherlands to investigate the relation between production of renewable energy with an ATES system and the production of drinking water. The data show that the

How does Germany's green energy policy affect electricity market volatility? An application of conditional autoregressive range models

International Nuclear Information System (INIS)

Auer, Benjamin R.

2016-01-01

Based on a dynamic model for the high/low range of electricity prices, this article analyses the effects of Germany's green energy policy on the volatility of the electricity market. Using European Energy Exchange data from 2000 to 2015, we find rather high volatility in the years 2000–2009 but also that the weekly price range has significantly declined in the period following the year 2009. This period is characterised by active regulation under the Energy Industry Law (EnWG), the EU Emissions Trading Directive (ETD) and the Renewable Energy Law (EEG). In contrast to the preceding period, price jumps are smaller and less frequent (especially for day-time hours), implying that current policy measures are effective in promoting renewable energies while simultaneously upholding electricity market stability. This is because the regulations strive towards a more and more flexible and market-oriented structure which allows better integration of renewable energies and supports an efficient alignment of renewable electricity supply with demand. - Highlights: • We estimate a CARR model for German electricity price data. • We augment the model by dummies capturing important regulations. • We find a significant decline in the price range after the year 2009. • This implies effective price stabilisation by German energy policy.

Analyses of Alpha-Alpha Elastic Scattering Data in the Energy Range 140 - 280 MeV

Energy Technology Data Exchange (ETDEWEB)

Shehadeh, Zuhair F. [Taif University, Taif (Saudi Arabia)

2017-01-15

The differential and the reaction cross-sections for 4He-4He elastic scattering data have been nicely obtained at four energies ranging from 140 MeV to 280 MeV (lab system), namely, 140, 160, 198 and 280 MeV, by using a new optical potential with a short-range repulsive core. The treatment has been handled relativistically as υ/c > 0.25 for the two lower energies and υ/c > 0.31 for the two higher ones. In addition to explaining the elastic angular distributions, the adopted potentials accounted for the structure that may exist at angles close to 90◦ , especially for the 198 and the 280-MeV incident energies. No renormalization has been used, and all our potential parameters are new. The necessity of including a short-range repulsive potential term in our real nuclear potential part has been demonstrated. Our results contribute to solving a long-standing problem concerning the nature of the alpha-alpha potential. This is very beneficial in explaining unknown alpha-nucleus and nucleus-nucleus relativistic reactions by using the cluster formalism.

First electrons from the new 220 TW Frascati Laser for Acceleration and Multidisciplinary Experiments (FLAME) at Frascati National Laboratories (LNF)

International Nuclear Information System (INIS)

Levato, T.; Calvetti, M.; Anelli, F.; Batani, D.; Benocci, R.; Cacciotti, L.; Cecchetti, C.A.; Cerafogli, O.; Chimenti, P.; Clozza, A.; Drenska, N.; Esposito, A.; Faccini, R.; Fioravanti, S.; Gamucci, A.; Gatti, C.; Giulietti, A.; Giulietti, D.; Labate, L.; Lollo, V.

2013-01-01

A new era of laser based plasma accelerators is emerging following the commissioning of many high power laser facilities around the world. Extremely short (tens of fs) laser pulses with energy of multi-joules level are available at these newly built facilities. Here we describe the new 220 TW FLAME facility. In particular we discuss the laser system general layout, the main measurements on the laser pulse parameters, the underground target area. Finally we give an overview of the first results of the Self-Injection Test Experiment (SITE), obtained at a low laser energy. This initial low laser energy experimental campaign was necessary for the validation of the radio-protection shielding (Esposito, 2011 [1]) we discuss here. With respect to our preliminary configuration, with a pulse duration of 30 fs and a focusing optic of F/15, we discuss here the minimum laser energy requirements for electron acceleration and the forward transmitted optical radiation

Autothermal reforming of liquid hydrocarbons for H{sub 2} production

Energy Technology Data Exchange (ETDEWEB)

Palm, C.; Montel, S.; Cremer, P.; Peters, R.; Stolten, D. [Forschungszentrum Juelich GmbH (Germany). Inst. for Materials and Processes in Energy Systems IWV-3: Process Engineering

2001-07-01

The process of autothermal reforming of hydrocarbons can be used for the production of hydrogen within a fuel cell system. The application of three precious metal catalysts for the autothermal reforming of alkane mixtures with boiling ranges between 235 and 325 C was examined. The experiments were carried out at n(O{sub 2})/n(C) = 0.40, n(H{sub 2}O)/n(C) = 2.20, a catalyst bed temperature between 730 and 570 C and a hydrocarbon feed of 30 g/h. The catalysts yielded different hydrocarbon conversions, which can be explained by differences in the activity for the steam reforming reaction. The most active catalyst was also successfully utilized in the conversion of 400 g/h hydrocarbon feed. (orig.)

Electron response of some low-Z scintillators in wide energy range

International Nuclear Information System (INIS)

Swiderski, L; Marcinkowski, R; Moszynski, M; Czarnacki, W; Szawlowski, M; Szczesniak, T; Pausch, G; Plettner, C; Roemer, K

2012-01-01

Light yield nonproportionality and the intrinsic resolution of some low atomic number scintillators were studied by means of the Wide Angle Compton Coincidence (WACC) technique. The plastic and liquid scintillator response to Compton electrons was measured in the energy range of 10 keV up to 4 MeV, whereas a CaF 2 :Eu sample was scanned from 3 keV up to 1 MeV. The nonproportionality of the CaF 2 :Eu light yield has characteristics typical for inorganic scintillators of the multivalent halides group, whereas tested organic scintillators show steeply increasing nonproportionality without saturation point. This is in contrast to the behavior of all known inorganic scintillators having their nonproportionality curves at saturation above energies between tens and several hundred keV.

Electron response of some low-Z scintillators in wide energy range

Science.gov (United States)

Swiderski, L.; Marcinkowski, R.; Moszynski, M.; Czarnacki, W.; Szawlowski, M.; Szczesniak, T.; Pausch, G.; Plettner, C.; Roemer, K.

2012-06-01

Light yield nonproportionality and the intrinsic resolution of some low atomic number scintillators were studied by means of the Wide Angle Compton Coincidence (WACC) technique. The plastic and liquid scintillator response to Compton electrons was measured in the energy range of 10 keV up to 4 MeV, whereas a CaF2:Eu sample was scanned from 3 keV up to 1 MeV. The nonproportionality of the CaF2:Eu light yield has characteristics typical for inorganic scintillators of the multivalent halides group, whereas tested organic scintillators show steeply increasing nonproportionality without saturation point. This is in contrast to the behavior of all known inorganic scintillators having their nonproportionality curves at saturation above energies between tens and several hundred keV.

Measurement of charged particle yields from PMMA irradiated by a 220 MeV/u12Cbeam

CERN Document Server

Piersanti, L; Bini, FU. Rome La Sapienza (main); Collamati, F; De Lucia, E; Durante, M; Faccini, R; Ferroni, F; Fiore, S; Iarocci, E; La Tessa, C; Marafini, M; Mattei, I; Patera, V; Ortega, P G; Sarti, A; Schuy, C; Sciubba, A; Vanstalle, M; Voena, C

2014-01-01

The radiation used in hadrontherapy treatments interacts with the patient body producing secondary particles, either neutral or charged, that can be used for dose and Bragg peak monitoring and to provide a fast feedback on the treatment plans. Recent results obtained from the authors on simplified setups (mono-energetic primary beams interacting with homogeneous tissue like target) have already indicated the correlation that exists between the flux of these secondaries coming from the target (e.g. protons and photons) and the position of the primary beam Bragg peak. In this paper, the measurements of charged particle fluxes produced by the interaction of a 220 MeV/u carbon ion beam at GSI, Darmstadt, with a polymethyl methacrylate target are reported. The emission region of protons (p), deuterons (d) and tritons (t) has been characterized using a drift chamber while the particle time-of-flight, used to compute the kinetic energy spectra, was measured with a LYSO scintillator.The energy released in the LYSO cr...

Unsynchronized scanning with a low-cost laser range finder for real-time range imaging

Science.gov (United States)

Hatipoglu, Isa; Nakhmani, Arie

2017-06-01

Range imaging plays an essential role in many fields: 3D modeling, robotics, heritage, agriculture, forestry, reverse engineering. One of the most popular range-measuring technologies is laser scanner due to its several advantages: long range, high precision, real-time measurement capabilities, and no dependence on lighting conditions. However, laser scanners are very costly. Their high cost prevents widespread use in applications. Due to the latest developments in technology, now, low-cost, reliable, faster, and light-weight 1D laser range finders (LRFs) are available. A low-cost 1D LRF with a scanning mechanism, providing the ability of laser beam steering for additional dimensions, enables to capture a depth map. In this work, we present an unsynchronized scanning with a low-cost LRF to decrease scanning period and reduce vibrations caused by stop-scan in synchronized scanning. Moreover, we developed an algorithm for alignment of unsynchronized raw data and proposed range image post-processing framework. The proposed technique enables to have a range imaging system for a fraction of the price of its counterparts. The results prove that the proposed method can fulfill the need for a low-cost laser scanning for range imaging for static environments because the most significant limitation of the method is the scanning period which is about 2 minutes for 55,000 range points (resolution of 250x220 image). In contrast, scanning the same image takes around 4 minutes in synchronized scanning. Once faster, longer range, and narrow beam LRFs are available, the methods proposed in this work can produce better results.

Evaluation in the resonance range of nuclei with a mass number above 220

International Nuclear Information System (INIS)

Ribon, P.

1970-01-01

The author discusses the problems posed by the evaluation of neutron data for fissile or fertile nuclei in the range of resolved or unresolved resonances. It appears to take several years until the data of an experiment are used by the reactor physicists. If one wants to have recent data at one's disposal, one cannot have recourse to evaluated-data libraries. Moreover, the existing parameter sets are only fragmentary. A new evaluation is, therefore, necessary for nearly all of these nuclei, but it cannot be based upon different parameter sets; these are indeed contradictory, and the evaluator will have to go back to the original data. The author shows for the set of σ f of 235 U, that a careful comparison of the data shows up unsuspected local defects. Some examples illustrate the deviation between analyses carried out by different methods and between the results on the established divergences. The parameters or cross-sections are far from being known with the precision one would desire. This fact gives rise to anomalies in the interpretation of data necessary for understanding and simulation in the range of unresolved resonances. But the introduction of concepts connected with sub-threshold fission noticeably furthers this understanding. Therefore a comparison of the methods of analysis must be made in more and more accurate measurements (evaluation and correction of systematic errors). (author) [fr

Prospects for bioenergy use in Ghana using Long-range Energy Alternatives Planning model

DEFF Research Database (Denmark)

Kemausuor, Francis; Nygaard, Ivan; Mackenzie, Gordon A.

2015-01-01

biomass sources, through the production of biogas, liquid biofuels and electricity. Analysis was based on moderate and high use of bioenergy for transportation, electricity generation and residential fuel using the LEAP (Long-range Energy Alternatives Planning) model. Results obtained indicate...

Low energy range dielectronic recombination of Fluorine-like Fe17+ at the CSRm

Science.gov (United States)

Khan, Nadir; Huang, Zhong-Kui; Wen, Wei-Qiang; Mahmood, Sultan; Dou, Li-Jun; Wang, Shu-Xing; Xu, Xin; Wang, Han-Bing; Chen, Chong-Yang; Chuai, Xiao-Ya; Zhu, Xiao-Long; Zhao, Dong-Mei; Mao, Li-Jun; Li, Jie; Yin, Da-Yu; Yang, Jian-Cheng; Yuan, You-Jin; Zhu, Lin-Fan; Ma, Xin-Wen

2018-05-01

The accuracy of dielectronic recombination (DR) data for astrophysics related ions plays a key role in astrophysical plasma modeling. The absolute DR rate coefficient of Fe17+ ions was measured at the main cooler storage ring at the Institute of Modern Physics, Lanzhou, China. The experimental electron-ion collision energy range covers the first Rydberg series up to n = 24 for the DR resonances associated with the {}2P1/2\\to {}2P3/2{{Δ }}n=0 core excitations. A theoretical calculation was performed by using FAC code and compared with the measured DR rate coefficient. Overall reasonable agreement was found between the experimental results and calculations. Moreover, the plasma rate coefficient was deduced from the experimental DR rate coefficient and compared with the available results from the literature. At the low energy range, significant discrepancies were found, and the measured resonances challenge state-of-the-art theory at low collision energies. Supported by the National Key R&D Program of China (2017YFA0402300), the National Natural Science Foundation of China through (11320101003, U1732133, 11611530684) and Key Research Program of Frontier Sciences, CAS (QYZDY-SSW-SLH006)

Combined production of free-range pigs and energy crops – animal behaviour and crop damages

DEFF Research Database (Denmark)

Horsted, Klaus; Kongsted, Anne Grete; Jørgensen, Uffe

2012-01-01

Intensive free-range pig production on open grasslands has disadvantages in that it creates nutrient hotspots and little opportunity for pigs to seek shelter from the sun. Combining a perennial energy crop and pig production might benefit the environment and animal welfare because perennial energy...... crops like willow (Salix sp.) and Miscanthus offer the pigs protection from the sun while reducing nutrient leaching from pig excrements due to their deep rooting system. The objectives of this study were to evaluate how season and stocking density of pigs in a free-range system with zones of willow...

20 CFR 220.178 - Determining medical improvement and its relationship to the annuitant's ability to do work.

Science.gov (United States)

2010-04-01

... relationship to the annuitant's ability to do work. 220.178 Section 220.178 Employees' Benefits RAILROAD... improvement and its relationship to the annuitant's ability to do work. (a) General. Paragraphs (a), (b), and... ability to work and medical improvement that is related to the ability to work. How the Board will arrive...

Ultrafast Microscopy of Energy and Charge Transport

Science.gov (United States)

Huang, Libai

The frontier in solar energy research now lies in learning how to integrate functional entities across multiple length scales to create optimal devices. Advancing the field requires transformative experimental tools that probe energy transfer processes from the nano to the meso lengthscales. To address this challenge, we aim to understand multi-scale energy transport across both multiple length and time scales, coupling simultaneous high spatial, structural, and temporal resolution. In my talk, I will focus on our recent progress on visualization of exciton and charge transport in solar energy harvesting materials from the nano to mesoscale employing ultrafast optical nanoscopy. With approaches that combine spatial and temporal resolutions, we have recently revealed a new singlet-mediated triplet transport mechanism in certain singlet fission materials. This work demonstrates a new triplet exciton transport mechanism leading to favorable long-range triplet exciton diffusion on the picosecond and nanosecond timescales for solar cell applications. We have also performed a direct measurement of carrier transport in space and in time by mapping carrier density with simultaneous ultrafast time resolution and 50 nm spatial precision in perovskite thin films using transient absorption microscopy. These results directly visualize long-range carrier transport of 220nm in 2 ns for solution-processed polycrystalline CH3NH3PbI3 thin films. The spatially and temporally resolved measurements reported here underscore the importance of the local morphology and establish an important first step towards discerning the underlying transport properties of perovskite materials.

X-Ray Emission from the Nuclear Region of Arp 220

Science.gov (United States)

Paggi, Alessandro; Fabbiano, Giuseppina; Risaliti, Guido; Wang, Junfeng; Karovska, Margarita; Elvis, Martin; Maksym, W. Peter; McDowell, Jonathan; Gallagher, Jay

2017-05-01

We present an imaging and spectral analysis of the nuclear region of the ultraluminous infrared galaxy merger of Arp 220, using deep Chandra-ACIS observations summing up to ˜ 300 {{ks}}. Narrowband imaging with subpixel resolution of the innermost nuclear region reveals two distinct Fe-K emitting sources, coincident with the infrared and radio nuclear clusters. These sources are separated by 1‧ (˜380 pc). The X-ray emission is extended and elongated in the eastern (E) nucleus, like the disk emission observed in millimeter radio images, suggesting a starburst dominance in this region. We estimate an Fe-K equivalent width of ≳ 1 {keV} for both sources and observe 2-10 keV luminosities of ˜ 2× {10}40 {{erg}} {{{s}}}-1 (western, W) and ˜ 3× {10}40 {{erg}} {{{s}}}-1 (E). In the 6-7 keV band the emission from these regions is dominated by the 6.7 keV Fe xxv line, suggesting a contribution from collisionally ionized gas. The thermal energy content of this gas is consistent with the kinetic energy injection in the interstellar medium by SNe II. However, nuclear winds from a hidden active galactic nucleus (AGN) (\\upsilon ˜ 2000 {{km}} {{{s}}}-1) cannot be excluded. The 3σ upper limits on the neutral Fe-Kα flux of the nuclear regions correspond to the intrinsic AGN 2-10 keV luminosities of < 1× {10}42 {{erg}} {{{s}}}-1 (W) and < 0.4× {10}42 {{erg}} {{{s}}}-1 (E). For typical AGN spectral energy distributions the bolometric luminosities are < 3× {10}43 {{erg}} {{{s}}}-1 (W) and < 8× {10}43 {{erg}} {{{s}}}-1 (E), and black hole masses of < 1× {10}5 {M}⊙ (W) and < 5× {10}5 {M}⊙ (E) are evaluated for Eddington limited AGNs with a standard 10% efficiency.

Harnessing Big-Data for Estimating the Energy Consumption and Driving Range of Electric Vehicles

DEFF Research Database (Denmark)

Fetene, Gebeyehu Manie; Prato, Carlo Giacomo; Kaplan, Sigal

-effects econometrics model used in this paper predicts that the energy saving speed of driving is between 45 and 56 km/h. In addition to the contribution to the literature about energy efficiency of electric vehicles, the findings from this study enlightens consumers to choose appropriate cars that suit their travel......This study analyses the driving range and investigates the factors affecting the energy consumption rate of fully-battery electric vehicles under real-world driving patterns accounting for weather condition, drivers’ characteristics, and road characteristics. Four data sources are used: (i) up...

A portable and wide energy range semiconductor-based neutron spectrometer

Energy Technology Data Exchange (ETDEWEB)

Hoshor, C.B. [Department of Physics, University of Missouri, Kansas City, MO (United States); Oakes, T.M. [Nuclear Science and Engineering Institute, University of Missouri, Columbia, MO (United States); Myers, E.R.; Rogers, B.J.; Currie, J.E.; Young, S.M.; Crow, J.A.; Scott, P.R. [Department of Physics, University of Missouri, Kansas City, MO (United States); Miller, W.H. [Nuclear Science and Engineering Institute, University of Missouri, Columbia, MO (United States); Missouri University Research Reactor, Columbia, MO (United States); Bellinger, S.L. [Department of Mechanical and Nuclear Engineering, Kansas State University, Manhattan, KS (United States); Sobering, T.J. [Electronics Design Laboratory, Kansas State University, Manhattan, KS (United States); Fronk, R.G.; Shultis, J.K.; McGregor, D.S. [Department of Mechanical and Nuclear Engineering, Kansas State University, Manhattan, KS (United States); Caruso, A.N., E-mail: carusoan@umkc.edu [Department of Physics, University of Missouri, Kansas City, MO (United States)

2015-12-11

Hand-held instruments that can be used to passively detect and identify sources of neutron radiation—either bare or obscured by neutron moderating and/or absorbing material(s)—in real time are of interest in a variety of nuclear non-proliferation and health physics applications. Such an instrument must provide a means to high intrinsic detection efficiency and energy-sensitive measurements of free neutron fields, for neutrons ranging from thermal energies to the top end of the evaporation spectrum. To address and overcome the challenges inherent to the aforementioned applications, four solid-state moderating-type neutron spectrometers of varying cost, weight, and complexity have been designed, fabricated, and tested. The motivation of this work is to introduce these novel human-portable instruments by discussing the fundamental theory of their operation, investigating and analyzing the principal considerations for optimal instrument design, and evaluating the capability of each of the four fabricated spectrometers to meet the application needs.

A portable and wide energy range semiconductor-based neutron spectrometer

International Nuclear Information System (INIS)

Hoshor, C.B.; Oakes, T.M.; Myers, E.R.; Rogers, B.J.; Currie, J.E.; Young, S.M.; Crow, J.A.; Scott, P.R.; Miller, W.H.; Bellinger, S.L.; Sobering, T.J.; Fronk, R.G.; Shultis, J.K.; McGregor, D.S.; Caruso, A.N.

2015-01-01

Hand-held instruments that can be used to passively detect and identify sources of neutron radiation—either bare or obscured by neutron moderating and/or absorbing material(s)—in real time are of interest in a variety of nuclear non-proliferation and health physics applications. Such an instrument must provide a means to high intrinsic detection efficiency and energy-sensitive measurements of free neutron fields, for neutrons ranging from thermal energies to the top end of the evaporation spectrum. To address and overcome the challenges inherent to the aforementioned applications, four solid-state moderating-type neutron spectrometers of varying cost, weight, and complexity have been designed, fabricated, and tested. The motivation of this work is to introduce these novel human-portable instruments by discussing the fundamental theory of their operation, investigating and analyzing the principal considerations for optimal instrument design, and evaluating the capability of each of the four fabricated spectrometers to meet the application needs.

Measurement of home-made LaCl3 : Ce scintillation detector sensitivity with different energy points in range of fission energy

International Nuclear Information System (INIS)

Hu Mengchun; Li Rurong; Si Fenni

2010-01-01

Gamma rays of different energy were obtained in the range of fission energy by Compton scattering in intense 60 Co gamma source and the standard isotopic gamma sources which are 0.67 MeV 137 Cs and l.25 MeV 60 Co sources of point form. Sensitivity of LaCl 3 : Ce scintillator was measured in these gamma ray energy by a fast response scintillation detector with the home-made LaCl 3 : Ce scintillator. Results were normalized by the sensitivity to 0.67 MeV gamma ray. Sensitivity of LaCl 3 : Ce to 1.25 MeV gamma ray is about l.28. For ø40 mm × 2 mm LaCl 3 : Ce scintillator, the biggest sensitivity is l.18 and the smallest is 0.96 with gamma ray from 0.39 to 0.78 MeV. And for ø40 mm × 10 mm LaCl 3 : Ce scintillator, the biggest sensitivity is l.06 and the smallest is 0.98. The experimental results can provide references for theoretical study of the LaCl 3 : Ce scintillator and data to obtain the compounded sensitivity of LaCl 3 : Ce scintillator in the range of fission energy. (authors)

42 CFR 413.220 - Methodology for calculating the per-treatment base rate under the ESRD prospective payment system...

Science.gov (United States)

2010-10-01

... rate under the ESRD prospective payment system effective January 1, 2011. 413.220 Section 413.220...-treatment base rate under the ESRD prospective payment system effective January 1, 2011. (a) Data sources. The methodology for determining the per treatment base rate under the ESRD prospective payment system...

40 CFR 280.220 - Ownership of an underground storage tank or underground storage tank system or facility or...

Science.gov (United States)

2010-07-01

... tank or underground storage tank system or facility or property on which an underground storage tank or underground storage tank system is located. 280.220 Section 280.220 Protection of Environment ENVIRONMENTAL... underground storage tank or underground storage tank system or facility or property on which an underground...

Photodissociation of HCN and HNC isomers in the 7-10 eV energy range

Energy Technology Data Exchange (ETDEWEB)

Chenel, Aurelie; Roncero, Octavio, E-mail: octavio.roncero@csic.es [Instituto de Física Fundamental (IFF-CSIC), C.S.I.C., Serrano 123, 28006 Madrid (Spain); Aguado, Alfredo [Departamento de Química Física Aplicada (UAM), Unidad Asociada a IFF-CSIC, Facultad de Ciencias Módulo 14, Universidad Autónoma de Madrid, 28049 Madrid (Spain); Agúndez, Marcelino; Cernicharo, José [Instituto de Ciencia de Materiales de Madrid, CSIC, C/ Sor Juana Inés de la Cruz 3, 28049 Cantoblanco (Spain)

2016-04-14

The ultraviolet photoabsorption spectra of the HCN and HNC isomers have been simulated in the 7-10 eV photon energy range. For this purpose, the three-dimensional adiabatic potential energy surfaces of the 7 lowest electronic states, and the corresponding transition dipole moments, have been calculated, at multireference configuration interaction level. The spectra are calculated with a quantum wave packet method on these adiabatic potential energy surfaces. The spectra for the 3 lower excited states, the dissociative electronic states, correspond essentially to predissociation peaks, most of them through tunneling on the same adiabatic state. The 3 higher electronic states are bound, hereafter electronic bound states, and their spectra consist of delta lines, in the adiabatic approximation. The radiative lifetime towards the ground electronic states of these bound states has been calculated, being longer than 10 ns in all cases, much longer that the characteristic predissociation lifetimes. The spectra of HCN is compared with the available experimental and previous theoretical simulations, while in the case of HNC there are no previous studies to our knowledge. The spectrum for HNC is considerably more intense than that of HCN in the 7-10 eV photon energy range, which points to a higher photodissociation rate for HNC, compared to HCN, in astrophysical environments illuminated by ultraviolet radiation.

Supplementary shutdown system of 220 MWe standard PHWR in India

International Nuclear Information System (INIS)

Muktibodh, U.C.

1997-01-01

The design objective of the shutdown system is to make the reactor subcritical and hold it in that state for an extended period of time. This objective must be realised under all anticipated operational occurrences and postulated abnormal conditions even during most reactive state of the core. PHWR design criteria for shutdown stipulates requirement of two independent diverse and fast acting shutdown systems, either of which acting alone should meet the above objectives. This requirement would normally call for a large number of reactivity mechanism penetrations into the calandria. From the point of view of space availability at the reactivity mechanism area on top of calandria, for the relatively small core of 220 MWe PHWRs, and ease of maintenance realisation of the total worth by either of the shutdown systems acting alone was difficult. To overcome this engineering constraint and at the same time to satisfy the design criteria, a unique approach to meet the reactivity demands for shutdown was adopted. The reactivity requirements of the shutdown consists of fast and slow reactivity changes. For the shutdown system of 220 MWe PHWRs, the approach of realizing fast reactivity changes with dual redundant, diverse, fast acting shutdown systems aided by a slow acting shutdown system to counter delayed reactivity changes was conceived. The supplementary slow acting shutdown system is called upon to act after actuation of either of the two redundant fast acting systems and is referred to as Liquid Poison Injection System (LPIS). The system adds bulk amount of neutron poison (boric acid), equivalent to 45 mk, directly into the moderator through two nozzles in calandria using pneumatic pressure. This paper describes the design of LPIS as envisaged for the standardised 220 MWe PHWRs. (author)

EXTREME DUST DISKS IN Arp 220 AS REVEALED BY ALMA

Energy Technology Data Exchange (ETDEWEB)

Wilson, C. D. [Department of Physics and Astronomy, McMaster University, Hamilton, ON L8S 4M1 (Canada); Rangwala, N.; Glenn, J.; Maloney, P. R. [Center for Astrophysics and Space Astronomy, 389-UCB, University of Colorado, Boulder, CO 80303 (United States); Spinoglio, L.; Pereira-Santaella, M. [Istituto di Astrofisica e Planetologia Spaziali, INAF-IAPS, Via Fosso del Cavaliere 100, I-00133 Roma (Italy)

2014-07-10

We present new images of Arp 220 from the Atacama Large Millimeter/submillimeter Array with the highest combination of frequency (691 GHz) and resolution (0.''36 × 0.''20) ever obtained for this prototypical ultraluminous infrared galaxy. The western nucleus is revealed to contain warm (200 K) dust that is optically thick (τ{sub 434} {sub μm} = 5.3), while the eastern nucleus is cooler (80 K) and somewhat less opaque (τ{sub 434} {sub μm} = 1.7). We derive full width at half-maximum diameters of 76 × ≤ 70 pc and 123 × 79 pc for the western and eastern nucleus, respectively. The two nuclei combined account for (83{sub −38}{sup +65} (calibration) {sub −34}{sup +0} (systematic))% of the total infrared luminosity of Arp 220. The luminosity surface density of the western nucleus (log (σT{sup 4})=14.3±0.2{sub −0.7}{sup +0} in units of L {sub ☉} kpc{sup –2}) appears sufficiently high to require the presence of an active galactic nucleus (AGN) or a ''hot starburst'', although the exact value depends sensitively on the brightness distribution adopted for the source. Although the role of any central AGN remains open, the inferred mean gas column densities of (0.6-1.8) × 10{sup 25} cm{sup –2} mean that any AGN in Arp 220 must be Compton-thick.

Frontier applications of rf superconductivity for high energy physics in the TeV range

International Nuclear Information System (INIS)

Tigner, M.; Padamsee, H.

1988-01-01

The authors present understanding of the fundamental nature of matter is embodied in the standard theory. This theory views all matter as composed of families of quarks and leptons with their interactions mediated by the family of force-carrying particles. Progress in particle accelerators has been a vital element in bringing about this level of understanding. Although the standard theory is successful in relating a wide range of phenomena, it raises deeper questions about the basic nature of matter and energy. Among these are: why are the masses of the various elementary particles and the strengths of the basic forces what they are? It is expected that over the next decade a new generation of accelerators spanning the 100 Gev mass range will shed light on some of these questions. These accelerators, will provide the means to thoroughly explore the energy regime corresponding to the mass scale of the weak interactions to reveal intimate details of the force carrying particles, the weak bosons, Z0 and W+-. Superconducting rf technology will feature in a major way in the electron storage rings. Current theoretical ideas predict that to make further progress towards a more fundamental theory of matter, it will be necessary to penetrate the TeV energy regime. At this scale a whole new range of phenomena will manifest the nature of the symmetry breaking mechanism that must be responsible for the differences they observe in the familiar weak and electromagnetic forces. History has shown that unexpected discoveries made in a new energy regime have proven to be the main engine of progress. The experimental challenge to accelerator designers and builders is clear. 11 references, 3 figures, 1 table

30 CFR 220.014 - Allocation of joint costs and credits.

Science.gov (United States)

2010-07-01

... allocation principles apply in allocating joint costs: (1) G & G. G & G shall be allocated on a line mile per... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Allocation of joint costs and credits. 220.014... MANAGEMENT ACCOUNTING PROCEDURES FOR DETERMINING NET PROFIT SHARE PAYMENT FOR OUTER CONTINENTAL SHELF OIL AND...

3He(α, γ7Be cross section in a wide energy range

Directory of Open Access Journals (Sweden)

Szücs Tamás

2017-01-01

Full Text Available The reaction rate of the 3He(α,γ7 Be reaction is important both in the Big Bang Nucleosynthesis (BBN and in the Solar hydrogen burning. There have been a lot of experimental and theoretical efforts to determine this reaction rate with high precision. Some long standing issues have been solved by the more precise investigations, like the different S(0 values predicted by the activation and in-beam measurement. However, the recent, more detailed astrophysical model predictions require the reaction rate with even higher precision to unravel new issues like the Solar composition. One way to increase the precision is to provide a comprehensive dataset in a wide energy range, extending the experimental cross section database of this reaction. This paper presents a new cross section measurement between Ecm = 2.5 − 4.4 MeV, in an energy range which extends above the 7Be proton separation threshold.

Home in the heat: Dramatic seasonal variation in home range of desert golden eagles informs management for renewable energy development

Science.gov (United States)

Braham, Melissa A.; Miller, Tricia A.; Duerr, Adam E.; Lanzone, Michael J.; Fesnock, Amy; LaPre, Larry; Driscoll, Daniel; Katzner, Todd E.

2015-01-01

Renewable energy is expanding quickly with sometimes dramatic impacts to species and ecosystems. To understand the degree to which sensitive species may be impacted by renewable energy projects, it is informative to know how much space individuals use and how that space may overlap with planned development. We used global positioning system–global system for mobile communications (GPS-GSM) telemetry to measure year-round movements of golden eagles (Aquila chrysaetos) from the Mojave Desert of California, USA. We estimated monthly space use with adaptive local convex hulls to identify the temporal and spatial scales at which eagles may encounter renewable energy projects in the Desert Renewable Energy Conservation Plan area. Mean size of home ranges was lowest and least variable from November through January and greatest in February–March and May–August. These monthly home range patterns coincided with seasonal variation in breeding ecology, habitat associations, and temperature. The expanded home ranges in hot summer months included movements to cooler, prey-dense, mountainous areas characterized by forest, grasslands, and scrublands. Breeding-season home ranges (October–May) included more lowland semi-desert and rock vegetation. Overlap of eagle home ranges and focus areas for renewable energy development was greatest when eagle home ranges were smallest, during the breeding season. Golden eagles in the Mojave Desert used more space and a wider range of habitat types than expected and renewable energy projects could affect a larger section of the regional population than was previously thought.

Development of dose monitoring system applicable to various radiations with wide energy ranges

International Nuclear Information System (INIS)

Sato, Tatsuhiko; Satoh, Daiki; Endo, Akira; Yamaguchi, Yasuhiro

2005-01-01

A new inventive radiation dose monitor, designated as DARWIN (Dose monitoring system Applicable to various Radiations with WIde energy raNges), has been developed for monitoring doses in workspaces and surrounding environments of high energy accelerator facilities. DARWIN is composed of a phoswitch-type scintillation detector, which consists of liquid organic scintillator BC501A coupled with ZnS(Ag) scintillation sheets doped with 6 Li, and a data acquisition system based on a Digital-Storage-Oscilloscope. Scintillations from the detector induced by thermal and fast neutrons, photons and muons were discriminated by analyzing their waveforms, and their light outputs were directly converted into the corresponding doses by applying the G-function method. Characteristics of DARWIN were studied by both calculation and experiment. The calculated results indicate that DARWIN gives reasonable estimations of doses in most radiation fields. It was found from the experiment that DARWIN has an excellent property of measuring doses from all particles that significantly contribute to the doses in surrounding environments of accelerator facilities - neutron, photon and muon with wide energy ranges. The experimental results also suggested that DARWIN enables us to monitor small fluctuation of neutron dose rates near the background-level owing to its high sensitivity. (author)

46 CFR 199.220 - Survival craft and rescue boat embarkation arrangements.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Survival craft and rescue boat embarkation arrangements... APPLIANCES AND ARRANGEMENTS LIFESAVING SYSTEMS FOR CERTAIN INSPECTED VESSELS Additional Requirements for Passenger Vessels § 199.220 Survival craft and rescue boat embarkation arrangements. (a) Survival craft...

36 CFR 220.5 - Environmental impact statement and record of decision.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental impact..., DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.5 Environmental impact statement and record of decision. (a) Classes of actions normally requiring environmental impact statements...

Electron transport in furfural: dependence of the electron ranges on the cross sections and the energy loss distribution functions

Science.gov (United States)

Ellis-Gibbings, L.; Krupa, K.; Colmenares, R.; Blanco, F.; Muńoz, A.; Mendes, M.; Ferreira da Silva, F.; Limá Vieira, P.; Jones, D. B.; Brunger, M. J.; García, G.

2016-09-01

Recent theoretical and experimental studies have provided a complete set of differential and integral electron scattering cross section data from furfural over a broad energy range. The energy loss distribution functions have been determined in this study by averaging electron energy loss spectra for different incident energies and scattering angles. All these data have been used as input parameters for an event by event Monte Carlo simulation procedure to obtain the electron energy deposition patterns and electron ranges in liquid furfural. The dependence of these results on the input cross sections is then analysed to determine the uncertainty of the simulated values.

Simultaneous determination of Rn-220 and Rn-222 concentrations in atmospheres by cellulose nitrate ionographic detectors

International Nuclear Information System (INIS)

Lobao, N.

1977-01-01

A method for the indoor determination of airborne radon and radon daughters is described, based in the utilization of cellulose nitrate (CN) ionographic detectors (LR-115-Kodak-Pathe) These track-etching detectors are coupled to an air sample and to a difusion chamber respectively. In the first system ambient air is pulled through a fiber glass filter for collection of airborne radon daughters (Flow: 230 ml/min). In the second system, the cellulose nitrate detectors is coupled/min). In the second system, the cellulose nitrate detectors is coupled to a difusion chamber electrostatic precipitator arrangement. Here the CN detector will register only the alpha particles given off by the decay products of Rn-222 formed within the sensitive volume of electrostatic precipitator. The construction of calibration curves for the two systems using adequate steady-state concentrations of Rn-220 and Rn-222 in an exposure chamber (1 cubic meter), will allow the use of the system for measurement of measurement of averaged integrated radon concentrations. The CN attached to the CN attached to the air sampler is exposed in the reference atmosphere with and without a mylar filter for discrimination of alpha particles with different energies Field sampling indicated however, that efficiency of the two systems are still low for the measurement of environmental levels of Rn-220 and Rn-222 within houses of the AENR, recommendations for efficienty improvement of the system are proposed [pt

Effects of air conditioning, dehumidification and natural ventilation on indoor concentrations of 222Rn and 220Rn

International Nuclear Information System (INIS)

Lee, Thomas K.C.; Yu, K.N.

2000-01-01

A bedroom was selected for detailed measurements on 220 Rn and 222 Rn concentrations and environmental parameters including CO 2 concentration, temperature and relative humidity. To simulate different sealing conditions, five conditions were artificially created in the sampling period of 25 consecutive days. It was concluded that natural ventilation is the most efficient way to lower the 222 Rn levels, while air conditioning is the next. Dehumidification provides only a marginal reduction of 222 Rn levels. The 220 Rn concentrations are not affected by natural ventilation, air conditioner or dehumidification, and were all around 10 Bq m -3 . There are no significant correlations between the 220 Rn and 222 Rn concentrations and environmental conditions such as CO 2 concentrations, temperature, relative humidity and pressure

Calibration efficiency of HPGe detector in the 50-1800 KeV energy range

International Nuclear Information System (INIS)

Venturini, Luzia

1996-01-01

This paper describes the efficiency of an HPGe detector in the 50 - 1800 keV energy range, for two geometries for water measurements: Marinelli breaker (850 ml) and a polyethylene flask (100 ml). The experimental data were corrected for the summing effect and fitted to a continuous, differentiable and energy dependent function given by 1n(ε)=b 0 +b 1 .1n(E/E 0 )+ β.1n(E/E 0 ) 2 , where β = b 2 if E>E 0 and β =a 2 if E ≤E 0 ; ε = the full absorption peak efficiency; E is the gamma-ray energy and {b 0 , b 1 , b 2 , a 2 , E 0 } is the parameter set to be fitted. (author)

Online Energy Management of Plug-In Hybrid Electric Vehicles for Prolongation of All-Electric Range Based on Dynamic Programming

Directory of Open Access Journals (Sweden)

Zeyu Chen

2015-01-01

Full Text Available The employed energy management strategy plays an important role in energy saving performance and exhausted emission reduction of plug-in hybrid electric vehicles (HEVs. An application of dynamic programming for optimization of power allocation is implemented in this paper with certain driving cycle and a limited driving range. Considering the DP algorithm can barely be used in real-time control because of its huge computational task and the dependence on a priori driving cycle, several online useful control rules are established based on the offline optimization results of DP. With the above efforts, an online energy management strategy is proposed finally. The presented energy management strategy concerns the prolongation of all-electric driving range as well as the energy saving performance. A simulation study is deployed to evaluate the control performance of the proposed energy management approach. All-electric range of the plug-in HEV can be prolonged by up to 2.86% for a certain driving condition. The energy saving performance is relative to the driving distance. The presented energy management strategy brings a little higher energy cost when driving distance is short, but for a long driving distance, it can reduce the energy consumption by up to 5.77% compared to the traditional CD-CS strategy.

Total photoabsorption cross section on nuclei measured in energy range 0.5-2.6 GeV

International Nuclear Information System (INIS)

Mirazita, M.

1998-03-01

The total photoabsorption cross section on several nuclei has been measured in the energy range 0.5 - 2.6 GeV. Nuclear data show a significant reduction of the absorption strength with respect to the free nucleon case suggesting a shadowing effect at low energies

The spin correlation parameter and analyzing power in n-p elastic scattering at intermediate energies

International Nuclear Information System (INIS)

Abegg, R.; Davis, C.A.; Delheij, P.P.J.; Greeniaus, L.G.; Healey, D.C.; Miller, C.A.; Wait, G.D.; Ahmad, M.; Green, P.W.; Lapointe, C.; McDonald, W.J.; Moss, G.A.; Rodning, N.L.; Roy, G.; Ye, Y.

1989-06-01

In order to improve existing I=0 phase shift solutions, the spin correlation parameter, A NN , and the analyzing powers, A 0N and A N0 , have been measured in n-p elastic scattering over an angular range of 50 degrees -150 degrees (c.m.) at three neutron energies, 220, 325 and 425 MeV to an absolute accuracy of ±0.03. The data have a profound effect on various phase parameters, particularly the 1 P 1 , 3 D 2 and ε 1 phase parameters which in some cases change by almost a degree. With exception of the highest energy, the data support the predictions of the latest version of the Bonn potential. Also the analyzing power data (A 0N and A N0 ) measured at 477 MeV in a different experiment over a limited angular range (60 degrees - 80 degrees (c.m.)) are reported here. (Author) 30 refs., 10 figs., 5 tabs

Prospects for bioenergy use in Ghana using Long-range Energy Alternatives Planning model

International Nuclear Information System (INIS)

Kemausuor, Francis; Nygaard, Ivan; Mackenzie, Gordon

2015-01-01

As Ghana's economy grows, the choice of future energy paths and policies in the coming years will have a significant influence on its energy security. A Renewable Energy Act approved in 2011 seeks to encourage the influx of renewable energy sources in Ghana's energy mix. The new legal framework combined with increasing demand for energy has created an opportunity for dramatic changes in the way energy is generated in Ghana. However, the impending changes and their implication remain uncertain. This paper examines the extent to which future energy scenarios in Ghana could rely on energy from biomass sources, through the production of biogas, liquid biofuels and electricity. Analysis was based on moderate and high use of bioenergy for transportation, electricity generation and residential fuel using the LEAP (Long-range Energy Alternatives Planning) model. Results obtained indicate that introducing bioenergy to the energy mix could reduce GHG (greenhouse gas) emissions by about 6 million tonnes CO_2e by 2030, equivalent to a 14% reduction in a business-as-usual scenario. This paper advocates the use of second generation ethanol for transport, to the extent that it is economically exploitable. Resorting to first generation ethanol would require the allocation of over 580,000 ha of agricultural land for ethanol production. - Highlights: • This paper examines modern bioenergy contribution to Ghana's future energy mix. • Three scenarios are developed and analysed. • Opportunities exist for modern bioenergy to replace carbon intensive fuels. • Introducing modern bioenergy to the mix could result in a 14% reduction in GHG.

UV spectroscopy of Titan's atmosphere, planetary organic chemistry and prebiological synthesis. II - Interpretation of new IUE observations in the 220-335 nm range

Science.gov (United States)

Courtin, Regis; Wagener, Richard; Mckay, Christopher P.; Caldwell, John; Fricke, Karl-Heinrich

1991-01-01

The theoretical model developed by McKay et al. (1989) to characterize the size distribution, thermal structure, and chemical composition of the stratospheric haze of Titan is applied to new 220-335-nm albedo measurements obtained with the long-wavelength prime camera of the IUE during August 1987. Data and model predictions are presented in extensive graphs and discussed in detail. It is shown that a simple model with particles of one size at a given altitude does not accurately reproduce the observed features in all spectral regions, but that good general agreement is obtained using a model with a uniformly mixed layer at 150-600 km and a bimodal distribution of small 'polymer' haze particles (radius less than 20 nm) and larger haze particles (radius 100-500 nm). The number densities implied by this model require, however, a mechanism such as electrostatic charging or reaction kinetics to inhibit coagulation of the smaller particles.

Development of dose monitoring system applicable to various radiations with wide energy ranges

International Nuclear Information System (INIS)

Sato, Tatsuhiko; Satoh, Daiki; Endo, Akira

2006-01-01

A new radiation dose monitor, designated as DARWIN (Dose monitoring system Applicable to various Radiations with WIde energy raNges), has been developed for real-time monitoring of doses in workspaces and surrounding environments of high energy accelerator facilities. DARWIN is composed of a phoswitch-type scintillation detector, which consists of liquid organic scintillator BC501A coupled with ZnS(Ag) scintillation sheets doped with 6 Li, and a data acquisition system based on a Digital-Storage-Oscilloscope. DARWIN has the following features: (1) capable of monitoring doses from neutrons, photons and muons with energies from thermal energy to 1 GeV, 150 keV to 100 MeV, and 1 MeV to 100 GeV, respectively, (2) highly sensitive with precision, and (3) easy to operate with a simple graphical user-interface. The performance of DARWIN was examined experimentally in several radiation fields. The results of the experiments indicated the accuracy and rapid response of DARWIN for measuring dose rates from neutrons, photons and muons with wide energies. With these properties, we conclude that DARWIN will be able to play a very important role for improving radiation safety in high energy accelerator facilities. (author)

rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts

Science.gov (United States)

Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.

2016-01-01

Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

Partitioning of late gestation energy expenditure in ewes using indirect calorimetry and a linear regression approach

DEFF Research Database (Denmark)

Kiani, Alishir; Chwalibog, André; Nielsen, Mette O

2007-01-01

Late gestation energy expenditure (EE(gest)) originates from energy expenditure (EE) of development of conceptus (EE(conceptus)) and EE of homeorhetic adaptation of metabolism (EE(homeorhetic)). Even though EE(gest) is relatively easy to quantify, its partitioning is problematic. In the present...... study metabolizable energy (ME) intake ranges for twin-bearing ewes were 220-440, 350- 700, 350-900 kJ per metabolic body weight (W0.75) at week seven, five, two pre-partum respectively. Indirect calorimetry and a linear regression approach were used to quantify EE(gest) and then partition to EE......(conceptus) and EE(homeorhetic). Energy expenditure of basal metabolism of the non-gravid tissues (EE(bmng)), derived from the intercept of the linear regression equation of retained energy [kJ/W0.75] and ME intake [kJ/W(0.75)], was 298 [kJ/ W0.75]. Values of the intercepts of the regression equations at week seven...

Mass energy-absorption coefficients and average atomic energy-absorption cross-sections for amino acids in the energy range 0.122-1.330 MeV

Energy Technology Data Exchange (ETDEWEB)

More, Chaitali V., E-mail: chaitalimore89@gmail.com; Lokhande, Rajkumar M.; Pawar, Pravina P., E-mail: pravinapawar4@gmail.com [Department of physics, Dr. Babasaheb Ambedkar Marathwada University, Aurangabad 431004 (India)

2016-05-06

Mass attenuation coefficients of amino acids such as n-acetyl-l-tryptophan, n-acetyl-l-tyrosine and d-tryptophan were measured in the energy range 0.122-1.330 MeV. NaI (Tl) scintillation detection system was used to detect gamma rays with a resolution of 8.2% at 0.662 MeV. The measured attenuation coefficient values were then used to determine the mass energy-absorption coefficients (σ{sub a,en}) and average atomic energy-absorption cross sections (μ{sub en}/ρ) of the amino acids. Theoretical values were calculated based on XCOM data. Theoretical and experimental values are found to be in good agreement.

The astrophysical S-factor for dd-reactions at keV-energy range

International Nuclear Information System (INIS)

Bystritskii, V.; Bystritsky, V.; Chaikovsky, S.

2001-01-01

The experimental results of measurements of the astrophysical S-factor for dd-reaction at keV-energy range collision energies using liner plasma technique are presented. The experiments were carried out at the high current generator of the Institute of High-Current Electronics in Tomsk, Russia. The measured values of the S-factors for the deuteron collision energies 1.80, 2.06 and 2.27 keV are S dd =(114±68), (64±30), (53±16) b x keV, respectively. The corresponding cross sections for dd-reactions, described as a product of the barrier factor and measured astrophysical S-factor, are σ dd n (E col =1.80 keV)=(4.3±2.6) x 10 -33 cm 2 ; σ dd n (E col =2.06 keV)=(9.8±4.6) x 10 -33 cm 2 ; σ dd n (E col =2.27 keV)=(2.1±0.6) x 10 -32 cm 2 . (orig.) [de

Water mist effect on cooling range and efficiency of casting die

Directory of Open Access Journals (Sweden)

R. Władysiak

2008-12-01

Full Text Available This project is showing investigation results of cooling process of casting die in the temperature range 570÷100 °C with 0.40 MPa compressed air and water mist streamed under pressure 0.25÷0.45 MPa in air jet 0.25÷0.50 MPa using open cooling system.The character and the speed of changes of temperature, forming of the temperture’s gradient along parallel layer to cooled surface of die is shawing with thermal and derivative curves. The effect of kind of cooling factor on the temperature and time and distance from cooling nozzle is presented in the paper. A designed device for generating the water mist cooling the die and the view of sprying water stream is shown here. It’s proved that using of the water mist together with the change of heat transfer interface increases intensity of cooling in the zone and makes less the range cooling zone and reduces the porosity of cast microstructure.

Calibration of a large multi-element neutron counter in the energy range 85-430 MeV

CERN Document Server

Strong, J A; Esterling, R J; Garvey, J; Green, M G; Harnew, N; Jane, M R; Jobes, M; Mawson, J; McMahon, T; Robertson, A W; Thomas, D H

1978-01-01

Describes the calibration of a large 60 element neutron counter with a threshold of 2.7 MeV equivalent electron energy. The performance of the counter has been measured in the neutron kinetic energy range 8.5-430 MeV using a neutron beam at the CERN Synchrocyclotron. The results obtained for the efficiency as a function of energy are in reasonable agreement with a Monte Carlo calculation. (7 refs).

Investigation of the 232Th neutron cross-sections in resonance energy range

International Nuclear Information System (INIS)

Grigoriev, Yu.V.; Kitaev, V.Ya.; Sinitsa, V.V.; Zhuravlev, B.V.; Borzakov, S.B.; Faikov-Stanchik, H.; Ilchev, G.L.; Panteleev, Ts.Ts.; Kim, G.N.

2001-01-01

The alternative path in the development of atomic energy is the uranium-thorium cycle. In connection with this, the measurements of the 232 Th neutron capture and total cross-sections and its resonance self-shielding coefficients in resonance energy range are necessary because of their low accuracy. In this work, the results of the investigations of the thorium-232 neutron cross-sections are presented. The measurements have been carried out on the gamma-ray multisection liquid detector and neutron detector as a battery of boron counters on the 120 m flight path of the pulsed fast reactor IBR-30. As the filter samples were used the metallic disks of various thickness and diameter of 45 mm. Two plates from metallic thorium with thickness of 0.2 mm and with the square of 4.5x4.5 cm 2 were used as the radiator samples. The group neutron total and capture cross-sections within the accuracy of 2-7% in the energy range of (10 eV-10 keV) were obtained from the transmissions and the sum spectra of g-rays from the fourth multiplicity to the seventh one. The neutron capture group cross-sections of 238 U were used as the standard for obtaining of thorium ones. Analogous values were calculated on the GRUCON code with the ENDF/B-6, JENDL-3 evaluated data libraries. Within the limits of experimental errors an agreement between the experiment and calculation is observed, but in some groups the experimental values are larger than the calculated ones. (author)

Kidins220/ARMS depletion is associated with the neural-to Schwann-like transition in a human neuroblastoma cell line model.

Science.gov (United States)

Rogers, Danny A; Schor, Nina F

2013-03-10

Peripheral neuroblastic tumors exist as a heterogeneous mixture of neuroblastic (N-type) cells and Schwannian stromal (S-type) cells. These stromal cells not only represent a differentiated and less aggressive fraction of the tumor, but also have properties that can influence the further differentiation of nearby malignant cells. In vitro neuroblastoma cultures exhibit similar heterogeneity with N-type and S-type cells representing the neuroblastic and stromal portions of the tumor, respectively, in behavior, morphology, and molecular expression patterns. In this study, we deplete kinase D-interacting substrate of 220kD (Kidins220) with an shRNA construct and thereby cause morphologic transition of the human SH-SY5Y neuroblastoma cell line from N-type to S-type. The resulting cells have similar morphology and expression profile to SH-EP1 cells, a native S-type cell line from the same parent cell line, and to SH-SY5Y cells treated with BrdU, a treatment that induces S-type morphology. Specifically, both Kidins220-deficient SH-SY5Y cells and native SH-EP1 cells demonstrate down-regulation of the genes DCX and STMN2, markers for the neuronal lineage. We further show that Kidins220, DCX and STMN2 are co-down-regulated in cells of S-type morphology generated by methods other than Kidins220 depletion. Finally, we report that the association of low Kidins220 expression with S-type morphology and low DCX and STMN2 expression is demonstrated in spontaneously occurring human peripheral neuroblastic tumors. We propose that Kidins220 is critical in N- to S-type transition of neural crest tumor cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Standardization of radiation protection measurements in mixed fields of an extended energy range

International Nuclear Information System (INIS)

Hoefert, M.; Stevenson, G.R.

1977-01-01

The improved ICRU concept of dose equivalent index aims at standardizing both area and personnel dose measurements so that the results on the dosimetry of external irradiations in radiation protection become compatible. It seems that for photon and neutron energies up to 3 and 20 MeV respectively the realization of dose-equivalent index is straightforward, but the inclusion of higher energies and/or other types of radiation will lead both to conceptual and practical difficulties. It will be shown that practical measurements in mixed radiation fields of an extended energy range for protection purposes will overestimate the standardized quantity. While area measurements can be performed to represent a good approximation, greater uncertainties have to be accepted in personnel dosimetry for stray radiation fields around GeV proton accelerators

30 CFR 220.020 - Calculation of the allowance for capital recovery.

Science.gov (United States)

2010-07-01

... recovery factor. The negative product of this calculation shall be debited to the NPSL capital account as... the capital recovery factor, and shall be debited to the NPSL capital account as specified in § 220... credits related to any time period after the end of the capital recovery period. ...

The Dosepix detector—an energy-resolving photon-counting pixel detector for spectrometric measurements

CERN Document Server

Zang, A; Ballabriga, R; Bisello, F; Campbell, M; Celi, J C; Fauler, A; Fiederle, M; Jensch, M; Kochanski, N; Llopart, X; Michel, N; Mollenhauer, U; Ritter, I; Tennert, F; Wölfel, S; Wong, W; Michel, T

2015-01-01

The Dosepix detector is a hybrid photon-counting pixel detector based on ideas of the Medipix and Timepix detector family. 1 mm thick cadmium telluride and 300 μm thick silicon were used as sensor material. The pixel matrix of the Dosepix consists of 16 x 16 square pixels with 12 rows of (200 μm)2 and 4 rows of (55 μm)2 sensitive area for the silicon sensor layer and 16 rows of pixels with 220 μm pixel pitch for CdTe. Besides digital energy integration and photon-counting mode, a novel concept of energy binning is included in the pixel electronics, allowing energy-resolved measurements in 16 energy bins within one acquisition. The possibilities of this detector concept range from applications in personal dosimetry and energy-resolved imaging to quality assurance of medical X-ray sources by analysis of the emitted photon spectrum. In this contribution the Dosepix detector, its response to X-rays as well as spectrum measurements with Si and CdTe sensor layer are presented. Furthermore, a first evaluation wa...

China's building energy demand: Long-term implications from a detailed assessment

International Nuclear Information System (INIS)

Eom, Jiyong; Clarke, Leon; Kim, Son H.; Kyle, Page; Patel, Pralit

2012-01-01

Buildings are an important contributor to China's energy consumption and attendant CO 2 emissions. Measures to address energy consumption and associated emissions from the buildings sector will be an important part of strategy to reduce the country's CO 2 emissions. This study presents a detailed, service-based model of China's building energy demand, nested in the GCAM (Global Change Assessment Model) integrated assessment framework. Using the model, we explored long-term pathways of China's building energy demand and identified opportunities to reduce greenhouse gas emissions. A range of different scenarios was also developed to gain insights into how China's building sector might evolve and what the implications might be for improved building energy technology and carbon policies. The analysis suggests that China's building energy growth will not wane anytime soon, although technology improvement will put downward pressure on this growth: In the reference scenarios, the sector's final energy demand will increase by 110–150% by 2050 and 160–220% by 2095 from its 2005 level. Also, regardless of the scenarios represented, the growth will involve the continued, rapid electrification of the buildings sector throughout the century, and this transition will be accelerated by the implementation of carbon policy. -- Highlights: ► We developed a building energy model for China, nested in an integrated-assessment framework. ► We explore long-term pathways of China's building energy use by implementing a range of scenarios. ► China's building energy consumption will continue to grow and be electrified over the century. ► Improved building energy technology will slow down the growth in building energy consumption. ► Electrification will be accelerated by the implementation of carbon policy.

Alanine-EPR as a transfer standard dosimetry system for low energy X radiation

International Nuclear Information System (INIS)

Khoury, H.J.; Silva, E.J. da; Mehta, K.; Barros, V.S. de; Asfora, V.K.; Guzzo, P.L.; Parker, A.G.

2015-01-01

The purpose of this paper is to evaluate the use of alanine-EPR as a transfer standard dosimetry system for low energy X radiation, such as that in RS-2400, which operates in the range from 25 to 150 kV and 2 to 45 mA. Two types of alanine dosimeters were investigated. One is a commercial alanine pellets from Aérial-Centre de Ressources Technologiques, France and one was prepared in our laboratory (LMRI-DEN/UFPE). The EPR spectra of the irradiated dosimeters were recorded in the Nuclear Energy Department of UFPE, using a Bruker EMX10 EPR spectrometer operating in the X-band. The alanine-EPR dosimetry system was calibrated in the range of 20–220 Gy in this X-ray field, against an ionization chamber calibrated at the relevant X-ray energy with traceability to PTB. The results showed that both alanine dosimeters presented a linear dose response the same sensitivity, when the EPR signal was normalized to alanine mass. The total uncertainty in the measured dose was estimated to be about 3%. The results indicate that it is possible to use the alanine-EPR dosimetry system for validation of a low-energy X ray irradiator, such as RS-2400.

Two-dimensional 220 MHz Fourier transform EPR imaging

International Nuclear Information System (INIS)

Placidi, Giuseppe; Brivati, John A.; Alecci, Marcello; Testa, Luca; Sotgiu, Antonello

1998-01-01

In the last decade radiofrequency continuous-wave EPR spectrometers have been developed to detect and localize free radicals in vivo. Only recently, pulsed radiofrequency EPR spectrometers have been described for imaging applications with small samples. In the present work, we show the first two-dimensional image obtained at 220 MHz on a large phantom (40 ml) that simulates typical conditions of in vivo EPR imaging. This pulsed EPR apparatus has the potential to make the time required for three-dimensional imaging compatible with the biological half-life of normally used paramagnetic probes. (author)

Theoretical photoionization spectra in the UV photon energy range for a Mg-like Al+ ion

International Nuclear Information System (INIS)

Kim, Dae-Soung; Kim, Young Soon

2008-01-01

In the present work, we report the photoionization cross sections of the Al + ion calculated for the photon energy range 20-26 eV and 30-50 eV. We have expanded our previous calculation (2007 J. Phys. Soc. Japan 76 014302) with an optimized admixture of the initial ground state 3s 21 S and exited states 3s3p 1,3 P, 3s3d 1,3 D and 3s4s 1,3 S, and obtained significantly improved predictions for the main background and autoionizing resonance structures of the reported experimental spectra. The absolute measurements of the photoionization cross sections of the Al + ion in these energy ranges have been performed by West et al (2001 Phys. Rev. A 63 052719), and they reported that the prominent peaks around 21 eV were attributed to the effects of the significant influence of the small fraction of the fourth-order radiation with energies around 84 eV from the synchrotron source. In our previous work, the main shape for these cross sections was calculated assuming an admixture of initial 3s 21 S and 3s3p 3 P states, only with a rough overall estimate for the experimental spectra in the photon energy range 20-26 eV, and without these peaks around 21 eV. The report of the experimental assignment attributes these peaks to the excitation of a 2p electron from the core. However, our present results with the new admixture reveal similar peaks without considering the possibility of the core excitation

20 CFR 627.220 - Coordination with programs under title IV of the Higher Education Act including the Pell grant...

Science.gov (United States)

2010-04-01

... the Higher Education Act including the Pell grant program. 627.220 Section 627.220 Employees' Benefits... of the Higher Education Act including the Pell grant program. (a) Coordination. Financial assistance programs under title IV of the Higher Education Act of 1965, as amended (HEA) (the Pell Grant program, the...

Status of the Dark Energy Survey Camera (DECam) Project

Energy Technology Data Exchange (ETDEWEB)

Flaugher, Brenna L.; Abbott, Timothy M.C.; Angstadt, Robert; Annis, Jim; Antonik, Michelle, L.; Bailey, Jim; Ballester, Otger.; Bernstein, Joseph P.; Bernstein, Rebbeca; Bonati, Marco; Bremer, Gale; /Fermilab /Cerro-Tololo InterAmerican Obs. /ANL /Texas A-M /Michigan U. /Illinois U., Urbana /Ohio State U. /University Coll. London /LBNL /SLAC /IFAE

2012-06-29

The Dark Energy Survey Collaboration has completed construction of the Dark Energy Camera (DECam), a 3 square degree, 570 Megapixel CCD camera which will be mounted on the Blanco 4-meter telescope at CTIO. DECam will be used to perform the 5000 sq. deg. Dark Energy Survey with 30% of the telescope time over a 5 year period. During the remainder of the time, and after the survey, DECam will be available as a community instrument. All components of DECam have been shipped to Chile and post-shipping checkout finished in Jan. 2012. Installation is in progress. A summary of lessons learned and an update of the performance of DECam and the status of the DECam installation and commissioning will be presented.

Status of the Dark Energy Survey Camera (DECam) project

Energy Technology Data Exchange (ETDEWEB)

Flaugher, Brenna L.; McLean, Ian S.; Ramsay, Suzanne K.; Abbott, Timothy M. C.; Angstadt, Robert; Takami, Hideki; Annis, Jim; Antonik, Michelle L.; Bailey, Jim; Ballester, Otger; Bernstein, Joseph P.; Bernstein, Rebecca A.; Bonati, Marco; Bremer, Gale; Briones, Jorge; Brooks, David; Buckley-Geer, Elizabeth J.; Campa, Juila; Cardiel-Sas, Laia; Castander, Francisco; Castilla, Javier; Cease, Herman; Chappa, Steve; Chi, Edward C.; da Costa, Luis; DePoy, Darren L.; Derylo, Gregory; de Vincente, Juan; Diehl, H. Thomas; Doel, Peter; Estrada, Juan; Eiting, Jacob; Elliott, Anne E.; Finley, David A.; Flores, Rolando; Frieman, Josh; Gaztanaga, Enrique; Gerdes, David; Gladders, Mike; Guarino, V.; Gutierrez, G.; Grudzinski, Jim; Hanlon, Bill; Hao, Jiangang; Holland, Steve; Honscheid, Klaus; Huffman, Dave; Jackson, Cheryl; Jonas, Michelle; Karliner, Inga; Kau, Daekwang; Kent, Steve; Kozlovsky, Mark; Krempetz, Kurt; Krider, John; Kubik, Donna; Kuehn, Kyler; Kuhlmann, Steve E.; Kuk, Kevin; Lahav, Ofer; Langellier, Nick; Lathrop, Andrew; Lewis, Peter M.; Lin, Huan; Lorenzon, Wolfgang; Martinez, Gustavo; McKay, Timothy; Merritt, Wyatt; Meyer, Mark; Miquel, Ramon; Morgan, Jim; Moore, Peter; Moore, Todd; Neilsen, Eric; Nord, Brian; Ogando, Ricardo; Olson, Jamieson; Patton, Kenneth; Peoples, John; Plazas, Andres; Qian, Tao; Roe, Natalie; Roodman, Aaron; Rossetto, B.; Sanchez, E.; Soares-Santos, Marcelle; Scarpine, Vic; Schalk, Terry; Schindler, Rafe; Schmidt, Ricardo; Schmitt, Richard; Schubnell, Mike; Schultz, Kenneth; Selen, M.; Serrano, Santiago; Shaw, Terri; Simaitis, Vaidas; Slaughter, Jean; Smith, R. Christopher; Spinka, Hal; Stefanik, Andy; Stuermer, Walter; Sypniewski, Adam; Talaga, R.; Tarle, Greg; Thaler, Jon; Tucker, Doug; Walker, Alistair R.; Weaverdyck, Curtis; Wester, William; Woods, Robert J.; Worswick, Sue; Zhao, Allen

2012-09-24

The Dark Energy Survey Collaboration has completed construction of the Dark Energy Camera (DECam), a 3 square degree, 570 Megapixel CCD camera which will be mounted on the Blanco 4-meter telescope at CTIO. DECam will be used to perform the 5000 sq. deg. Dark Energy Survey with 30% of the telescope time over a 5 year period. During the remainder of the time, and after the survey, DECam will be available as a community instrument. All components of DECam have been shipped to Chile and post-shipping checkout finished in Jan. 2012. Installation is in progress. A summary of lessons learned and an update of the performance of DECam and the status of the DECam installation and commissioning will be presented.

20 CFR 220.27 - What is needed to show an impairment.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false What is needed to show an impairment. 220.27... is needed to show an impairment. A physical or mental impairment must result from anatomical... diagnostic techniques. A physical or mental impairment must be established by medical evidence consisting of...

Possible manifestation of long range forces in high energy hadron collisions

International Nuclear Information System (INIS)

Kuraev, Eh.A.; Ferro, P.; Trentadue, L.

1997-01-01

Pion-pion and photon-photon scattering are discussed.. We obtain, starting from the impact representation introduced by Cheng and Wu a new contribution to the high energy hadron-hadron scattering amplitude for small transferred momentum q 2 of the form is (q 2 /m 4 )ln(-q 2 /m 2 ). This behaviour may be interpreted as a manifestation of long transverse-range forces between hadrons which, for ρ>> m -1 fall off as ρ -4 . We consider the examples of pion and photon scattering with photons converted in the intermediate state to two pairs of quarks interacting by exchanging two gluon colorless state. A phenomenological approach for proton impact factor is used to analyze proton-proton scattering. The analysis of the lowest order radiative corrections for the case of photon-photon scattering is done. We discuss the possibility of observing the effects of these long range forces

Correlation between blister skin thickness, the maximum in the damage-energy distribution, and projected ranges of He+ ions in metals: Nb

International Nuclear Information System (INIS)

Kaminsky, M.; Das, S.K.; Fenske, G.

1975-01-01

The skin thicknesses of blisters formed on niobium by helium-ion irradiation at room temperature for energies from 100 to 1500 keV have been measured. The projected ranges of helium ions in Nb for this energy range were calculated using either Brice's formalism or the one given by Schiott. For the damage-energy distribution Brice's formalism was used. The measured skin-thickness values corrleate more closely with the maxima in the projected-range probability distributions than with the maxima in the damage-energy distributions. The results are consistent with our model for blister formation and rupture proposed earlier

Voltage and reactive power in the 380/220 kV power network of the new German Laender - state and prospects. Spannung und Blindleistung im 380/220-kV-Verbundnetz der neuen Bundeslaender - Stand und Ausblick

Energy Technology Data Exchange (ETDEWEB)

Behnke, M; Luettig, K; Radtke, H [Verbundnetz Elektroenergie AG, Berlin (Germany)

1991-01-01

With the preparation for restoring a German power network after nearly 40 years of separate development of the EES of the former DDR, the voltage/reactive power regulation must be examined and evaluated in the conditions of: - parting the connections to the present VES partners Poland and Czechoslovakia with the option of rectification - taking up parallel operation with the adjacent network undertakings of the old West German Laender (Preussen Elektra AG and Bayernwerke AG), ie: combined operation with DVG (superregional network of old West German Laender) and UCPTE (European electrical energy union). The aim is to configure this in the 380/220 kV network of the new German Laender, so that with a regionally compensated reactive power system, the voltage can be kept steady much better at times of heavy and light load, and the network losses can be reduced. (orig./GL).

Correlation between blister skin thickness, the maximum in the damage-energy distribution, and the projected ranges of He+ ions in metals

International Nuclear Information System (INIS)

Das, S.K.; Kaminsky, M.; Fenske, G.

1976-01-01

The skin thickness of blisters formed on aluminium by helium-ion irradiation at room temperature for energies from 100 to 1000 keV have been measured. The projected ranges of helium ions in Al for this energy range were calculated using either Brice's formalism (Brice, D.K., 1972, Phys. Rev., vol. A6, 1791) or the one given by Schioett (Schioett, H.E., 1966, K. Danske Vidensk.Selsk., Mat.-Fys. Meddr., vol.35, No.9). For the damage-energy distribution Brice's formalism was used. The measured skin thickness values are smaller than the calculated values of the maxima in the projected range distributions over the entire energy range studied. These results on the ductile metal aluminium are contrasted with the results on relatively brittle refractory metals V and Nb where the measured skin thickness values correlate more closely with the maxima in the projected range probability distributions than with the maxima in the damage-energy distributions. Processes affecting the blister skin fracture and the skin thickness are discussed. (author)

Energy Impacts of Wide Band Gap Semiconductors in U.S. Light-Duty Electric Vehicle Fleet.

Science.gov (United States)

Warren, Joshua A; Riddle, Matthew E; Graziano, Diane J; Das, Sujit; Upadhyayula, Venkata K K; Masanet, Eric; Cresko, Joe

2015-09-01

Silicon carbide and gallium nitride, two leading wide band gap semiconductors with significant potential in electric vehicle power electronics, are examined from a life cycle energy perspective and compared with incumbent silicon in U.S. light-duty electric vehicle fleet. Cradle-to-gate, silicon carbide is estimated to require more than twice the energy as silicon. However, the magnitude of vehicle use phase fuel savings potential is comparatively several orders of magnitude higher than the marginal increase in cradle-to-gate energy. Gallium nitride cradle-to-gate energy requirements are estimated to be similar to silicon, with use phase savings potential similar to or exceeding that of silicon carbide. Potential energy reductions in the United States vehicle fleet are examined through several scenarios that consider the market adoption potential of electric vehicles themselves, as well as the market adoption potential of wide band gap semiconductors in electric vehicles. For the 2015-2050 time frame, cumulative energy savings associated with the deployment of wide band gap semiconductors are estimated to range from 2-20 billion GJ depending on market adoption dynamics.

High energy storage density over a broad temperature range in sodium bismuth titanate-based lead-free ceramics.

Science.gov (United States)

Yang, Haibo; Yan, Fei; Lin, Ying; Wang, Tong; Wang, Fen

2017-08-18

A series of (1-x)Bi 0.48 La 0.02 Na 0.48 Li 0.02 Ti 0.98 Zr 0.02 O 3 -xNa 0.73 Bi 0.09 NbO 3 ((1-x)LLBNTZ-xNBN) (x = 0-0.14) ceramics were designed and fabricated using the conventional solid-state sintering method. The phase structure, microstructure, dielectric, ferroelectric and energy storage properties of the ceramics were systematically investigated. The results indicate that the addition of Na 0.73 Bi 0.09 NbO 3 (NBN) could decrease the remnant polarization (P r ) and improve the temperature stability of dielectric constant obviously. The working temperature range satisfying TCC 150  °C  ≤±15% of this work spans over 400 °C with the compositions of x ≥ 0.06. The maximum energy storage density can be obtained for the sample with x = 0.10 at room temperature, with an energy storage density of 2.04 J/cm 3 at 178 kV/cm. In addition, the (1-x)LLBNTZ-xNBN ceramics exhibit excellent energy storage properties over a wide temperature range from room temperature to 90 °C. The values of energy storage density and energy storage efficiency is 0.91 J/cm 3 and 79.51%, respectively, for the 0.90LLBNTZ-0.10NBN ceramic at the condition of 100 kV/cm and 90 °C. It can be concluded that the (1-x)LLBNTZ-xNBN ceramics are promising lead-free candidate materials for energy storage devices over a broad temperature range.

46 CFR 130.220 - Design of equipment for cooking and heating.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Design of equipment for cooking and heating. 130.220... Design of equipment for cooking and heating. (a) Doors on each cooking appliance must be provided with heavy-duty hinges and locking-devices to prevent accidental opening in heavy weather. (b) Each cooking...

30 CFR 220.015 - Pricing of materiel purchases, transfers, and dispositions.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Pricing of materiel purchases, transfers, and... CONTINENTAL SHELF OIL AND GAS LEASES § 220.015 Pricing of materiel purchases, transfers, and dispositions. (a... shall be priced under the provisions for tubular goods pricing in paragraph (a)(2)(i)(A) of this section...

3C 220.3: A Radio Galaxy Lensing a Submillimeter Galaxy

NARCIS (Netherlands)

Haas, Martin; Leipski, Christian; Barthel, Peter; Wilkes, Belinda J.; Vegetti, Simona; Bussmann, R. Shane; Willner, S. P.; Westhues, Christian; Ashby, Matthew L. N.; Chini, Rolf; Clements, David L.; Fassnacht, Christopher D.; Horesh, Assaf; Klaas, Ulrich; Koopmans, Léon V. E.; Kuraszkiewicz, Joanna; Lagattuta, David J.; Meisenheimer, Klaus; Stern, Daniel; Wylezalek, Dominika

2014-01-01

Herschel Space Observatory photometry and extensive multiwavelength follow-up have revealed that the powerful radio galaxy (PRG) 3C 220.3 at z = 0.685 acts as a gravitational lens for a background submillimeter galaxy (SMG) at z = 2.221. At an observed wavelength of 1 mm, the SMG is lensed into

CGC/saturation approach for soft interactions at high energy: long range rapidity correlations

International Nuclear Information System (INIS)

Gotsman, E.; Maor, U.; Levin, E.

2015-01-01

In this paper we continue our program to construct a model for high energy soft interactions that is based on the CGC/saturation approach. The main result of this paper is that we have discovered a mechanism that leads to large long range rapidity correlations and results in large values of the correlation function R(y 1 , y 2 ) ≥ 1, which is independent of y 1 and y 2 . Such a behavior of the correlation function provides strong support for the idea that at high energies the system of partons that is produced is not only dense but also has strong attractive forces acting between the partons. (orig.)

Attached, unattached fraction of progeny concentrations and equilibrium factor for dose assessments from {sup 222}Rn and {sup 220}Rn

Energy Technology Data Exchange (ETDEWEB)

Singh, Parminder; Saini, Komal; Bajwa, Bikramjit Singh [Guru Nanak Dev University, Department of Physics, Amritsar, Punjab (India); Mishra, Rosaline; Sahoo, Bijay Kumar [Bhabha Atomic Research Centre, Radiological Physics and Advisory Division, Mumbai (India)

2016-08-15

In this study, measurements of indoor radon ({sup 222}Rn), thoron ({sup 220}Rn) and their equilibrium equivalent concentration (EEC) were carried out in 96 dwellings from 22 different villages situated in Hamirpur district, Himachal Pradesh, India, by using LR-115 type II-based pinhole twin cup dosimeters and deposition-based progeny sensors (DRPS/DTPS). The annual average indoor {sup 222}Rn and {sup 220}Rn concentrations observed in these dwellings were 63.82 and 89.59 Bq/m{sup 3}, respectively, while the average EEC (attached + unattached) for {sup 222}Rn and {sup 220}Rn was 29.28 and 2.74 Bq/m{sup 3}. For {sup 222}Rn (f{sub Rn}) and {sup 220}Rn (f{sub Tn}), the average values of unattached fraction were 0.11 and 0.09, respectively. The equilibrium factors for radon (F{sub Rn}) and thoron (F{sub Tn}) varied from 0.12 to 0.77 with an average of 0.50, and from 0.01 to 0.34 with an average of 0.05, respectively. The annual inhalation dose due to mouth and nasal breathing was calculated using dose conversion factors and unattached fractions. The indoor annual effective doses for {sup 222}Rn (AEDR) and {sup 220}Rn (AEDT) were found to be 1.92 and 0.83 mSv a{sup -1}, respectively. The values of {sup 222}Rn/{sup 220}Rn concentrations and annual effective doses obtained in the present study are within the safe limits as recommended by the International Commission on Radiological Protection for indoor dwelling exposure conditions. (orig.)

Energy loss of muons in the energy range 1-10000 GeV

International Nuclear Information System (INIS)

Lohmann, W.; Kopp, R.; Voss, R.

1985-01-01

A summary is given of the most recent formulae for the cross-sections contributing to the energy loss of muons in matter, notably due to electro-magnetic interactions (ionization, bremsstrahlung and electron-pair production) and nuclear interactions. Computed energy losses dE/dx are tabulated for muons with energy between 1 GeV and 10,000 GeV in a number of materials commonly used in high-energy physics experiments. In comparison with earlier tables, these show deviations that grow with energy and amount to several per cent at 200 GeV muon energy. (orig.)

Designing and overproducing a tandem epitope of gp350/220 that shows a potential to become an EBV vaccine

Directory of Open Access Journals (Sweden)

Widodo

2018-03-01

Full Text Available Background: Epstein-Barr virus (EBV can cause cancer in people from around the world. There is no EBV vaccine available for use on a global scale. However, emerging evidence suggests that the epitope on the gp350/220 capsid protein may be developed into an EBV vaccine. Nevertheless, the production of small, single epitope is challenging of stability issues and possible alteration of peptide structure. In this study, a tandem epitope was developed consisting of three single epitopes, aimed to improve stability, antigenicity and preserve epitope structure. Materials and methods: A tandem epitope was designed using bioinformatics based on the epitope structure of the gp350/220 protein. The tandem epitope structure was analyzed using a protein folding method with Abalone software, which was further refined via YASARA force field and molecular repairing using a FoldX method. Immunogenicity was examined with Epitopia software, whereas allergen properties were tested using AlgPred. The pattern of the tandem epitope binding with anti-gp350/220 antibodies was performed using Z-dock and snugDock. The tandem epitope was then overproduced in E. coli strain BL21 as a host cell. Result: Our model demonstrated a successfully designed and overproduced tandem epitope. The tandem epitope demonstrated a similar structure compared with the epitope of whole protein gp350/220. Our epitope also demonstrated non-allergen and antigenicity properties, and possessed antibody binding patterns consistent with whole protein gp350/220. Conclusion and recommendation: These data suggest a novel tandem epitope composed of three similar epitopes demonstrates antigenicity, structure, and binding properties consistent with whole protein gp350/220. We also demonstrate successful production of the tandem epitope using E. coli strain BL21 as a host. Future in vivo experimental animal research is necessary to test the ability of this tandem epitope to stimulate antibody production

Distinction of [220] and [204] textures of Cu(In,Ga)Se{sub 2} film and their growth behaviors depending on substrate nature and Na incorporation

Energy Technology Data Exchange (ETDEWEB)

Cho, Dae-Hyung, E-mail: dhcho@etri.re.kr [IT Components and Materials Industry Technology Research Department, Electronics and Telecommunications Research Institute (ETRI), 218 Gajeongno, Yuseong-gu, Daejeon 305-700 (Korea, Republic of); Kim, Jeha [Department of Solar & Energy Engineering, Cheongju University, 298 Daeseongro, Sangdang-gu, Cheongju, Chungbuk 360-764 (Korea, Republic of); Chung, Yong-Duck [IT Components and Materials Industry Technology Research Department, Electronics and Telecommunications Research Institute (ETRI), 218 Gajeongno, Yuseong-gu, Daejeon 305-700 (Korea, Republic of); Korea University of Science and Technology (UST), 217 Gajeongno, Yuseong-gu, Daejeon 305-350 (Korea, Republic of)

2015-08-31

For better understanding of the structural property of polycrystalline tetragonal Cu(In,Ga)Se{sub 2} (CIGS) thin films grown on soda-lime glass, it is necessary to characterize the [220]- and [204]-oriented textures clearly that are related to the different physical properties. However, the distinction between the [220]- and [204]-oriented textures is very difficult because of their nearly identical plane spacings and atomic arrangements. Using X-ray diffraction techniques of high resolution θ–2θ scanning and reciprocal space mapping, we distinguished the [220]- and [204]-oriented textures of CIGS films and observed that the behaviors of [220] and [204] textures independently depended on both substrate nature and Na presence. We report the Na- and substrate-related dependence of the physical properties of the CIGS film was attributed to the independent growth behaviors of the [220] and [204] textures in the CIGS. - Highlights: • We investigated [220]- and [204]-oriented textures of Cu(In,Ga)Se{sub 2} (CIGS) films. • X-ray diffraction methods distinguished two textures. • The growth behaviors were influenced by underlying substrate and Na. • The [220] and [204] textures in CIGS should be differentially observed.

42 CFR 484.220 - Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and...

Science.gov (United States)

2010-10-01

... address changes to the case-mix that are a result of changes in the coding or classification of different...-day episode payment rate for case-mix and area wage levels. 484.220 Section 484.220 Public Health... Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and area wage levels...

20 CFR 220.57 - Types of purchased examinations and selection of sources.

Science.gov (United States)

2010-04-01

... RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.57 Types of purchased examinations and selection of sources. (a) Additional evidence needed for disability determination. The types... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Types of purchased examinations and selection...

Diverse IgG serum response to novel glycopeptide epitopes detected within immunodominant stretches of Epstein-Barr virus glycoprotein 350/220

DEFF Research Database (Denmark)

D'Arrigo, Isotta; Cló, Emiliano; Bergström, Tomas

2013-01-01

/220 and demonstrate a remarkable variability between individual samples with respect to their reactivity patterns to peptides and glycopeptides. The study provides additional insights into the complex B-cell response towards the EBV gp350/220 envelope protein, which may have implications for diagnostic and vaccine...

30 CFR 250.220 - If I propose activities in the Alaska OCS Region, what planning information must accompany the EP?

Science.gov (United States)

2010-07-01

... Region, what planning information must accompany the EP? 250.220 Section 250.220 Mineral Resources... activities in the Alaska OCS Region, what planning information must accompany the EP? If you propose exploration activities in the Alaska OCS Region, the following planning information must accompany your EP: (a...

OBSERVATIONS OF Arp 220 USING HERSCHEL-SPIRE: AN UNPRECEDENTED VIEW OF THE MOLECULAR GAS IN AN EXTREME STAR FORMATION ENVIRONMENT

Energy Technology Data Exchange (ETDEWEB)

Rangwala, Naseem; Maloney, Philip R.; Glenn, Jason; Kamenetzky, Julia [Center for Astrophysics and Space Astronomy, University of Colorado, 1255 38th street, Boulder, CO 80303 (United States); Wilson, Christine D.; Mentuch, Erin; Schirm, Maximilien R. P. [Department of Physics and Astronomy, McMaster University, Hamilton, Ontario, L8S 4M1 (Canada); Rykala, Adam [School of Physics and Astronomy, Cardiff University, Queens Buildings The Parade, Cardiff CF24 3AA (United Kingdom); Isaak, Kate [ESA Astrophysics Missions Division, ESTEC, PO Box 299, 2200 AG Noordwijk (Netherlands); Baes, Maarten [Sterrenkundig Observatorium, Universiteit Gent, Krijgslaan 281 S9, B-9000 Gent (Belgium); Bendo, George J. [UK ALMA Regional Centre Node, Jordell Bank Center for Astrophysics, School of Physics and Astronomy, University of Manchester, Oxford Road, Manchester M13 9PL (United Kingdom); Boselli, Alessandro [Laboratoire d' Astrophysique de Marseille, UMR6110 CNRS, 38 rue F. Joliot-Curie, F-13388 Marseille (France); Bradford, Charles M. [JPL, Pasadena, CA 91109 (United States); Clements, D. L. [Astrophysics Group, Imperial College, Blackett Laboratory, Prince Consort Road, London SW7 2AZ (United Kingdom); Cooray, Asantha [Department of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Fulton, Trevor; Imhof, Peter [Blue Sky Spectroscopy Inc, Suite 9-740 4th Avenue South, Lethbridge, Alberta T1J 0N9 (Canada); Madden, Suzanne C.; Sauvage, Marc [CEA, Laboratoire AIM, Irfu/SAp, Orme des Merisiers, F-91191 Gif-sur-Yvette (France); Sacchi, Nicola [Istituto di Fisica dello Spazio Interplanetario, INAF, Via del Fosso del Cavaliere 100, I-00133 Roma (Italy); and others

2011-12-10

We present Herschel Spectral and Photometric Imaging Receiver Fourier Transform Spectrometer (Herschel SPIRE-FTS) observations of Arp 220, a nearby ultra-luminous infrared galaxy. The FTS provides continuous spectral coverage from 190 to 670 {mu}m, a wavelength region that is either very difficult to observe or completely inaccessible from the ground. The spectrum provides a good measurement of the continuum and detection of several molecular and atomic species. We detect luminous CO (J = 4-3 to 13-12) and water rotational transitions with comparable total luminosity {approx}2 Multiplication-Sign 10{sup 8} L{sub Sun }; very high-J transitions of HCN (J = 12-11 to 17-16) in absorption; strong absorption features of rare species such as OH{sup +}, H{sub 2}O{sup +}, and HF; and atomic lines of [C I] and [N II]. The modeling of the continuum shows that the dust is warm, with T = 66 K, and has an unusually large optical depth, with {tau}{sub dust} {approx} 5 at 100 {mu}m. The total far-infrared luminosity of Arp 220 is L{sub FIR} {approx} 2 Multiplication-Sign 10{sup 12} L{sub Sun }. Non-LTE modeling of the extinction corrected CO rotational transitions shows that the spectral line energy distribution of CO is fit well by two temperature components: cold molecular gas at T {approx} 50 K and warm molecular gas at T {approx} 1350{sup +280}{sub -100} K (the inferred temperatures are much lower if CO line fluxes are not corrected for dust extinction). These two components are not in pressure equilibrium. The mass of the warm gas is 10% of the cold gas, but it dominates the CO luminosity. The ratio of total CO luminosity to the total FIR luminosity is L{sub CO}/L{sub FIR} {approx} 10{sup -4} (the most luminous lines, such as J = 6-5, have L{sub CO,J=6-5}/L{sub FIR} {approx} 10{sup -5}). The temperature of the warm gas is in excellent agreement with the observations of H{sub 2} rotational lines. At 1350 K, H{sub 2} dominates the cooling ({approx}20 L{sub Sun} M{sup -1}{sub

Spallation of terbium by 170 MeV protons. First part: qualitative study

International Nuclear Information System (INIS)

Olkowsky, J.; Le Pape, M.; Gratot, I.; Cohen, L.

1959-01-01

The products of the reaction Tb+p (170 MeV) have been studied by radiochemical methods. For each element, α, β, γ and X rays have been studied and results compared to literature data. The cross sections will be given in a further work. We observe a new alpha emitter of gadolinium, half-life 7 h, with the following γ-rays: X (43 keV), 220 keV, 340 keV, 550 keV, 720 keV. New γ-rays are given: 155 Tb: 480 keV; 880 keV 146 Eu (38 h): 125 keV; 570 keV 147 Eu: 570 keV 145 Eu: 180 keV. Reprint of a paper published in 'Le journal de physique et le radium', tome 20, N. 5, may 1959, p. 549-556 [fr

CGC/saturation approach for soft interactions at high energy: long range rapidity correlations

Energy Technology Data Exchange (ETDEWEB)

Gotsman, E.; Maor, U. [Tel Aviv University, Department of Particle Physics, School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Science, Tel Aviv (Israel); Levin, E. [Tel Aviv University, Department of Particle Physics, School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Science, Tel Aviv (Israel); Universidad Tecnica Federico Santa Maria and Centro Cientifico- Tecnologico de Valparaiso, Departemento de Fisica, Valparaiso (Chile)

2015-11-15

In this paper we continue our program to construct a model for high energy soft interactions that is based on the CGC/saturation approach. The main result of this paper is that we have discovered a mechanism that leads to large long range rapidity correlations and results in large values of the correlation function R(y{sub 1}, y{sub 2}) ≥ 1, which is independent of y{sub 1} and y{sub 2}. Such a behavior of the correlation function provides strong support for the idea that at high energies the system of partons that is produced is not only dense but also has strong attractive forces acting between the partons. (orig.)

HIGH-RESOLUTION RADIO CONTINUUM MEASUREMENTS OF THE NUCLEAR DISKS OF Arp 220

Energy Technology Data Exchange (ETDEWEB)

Barcos-Muñoz, L.; Evans, A. S.; Privon, G. C.; Stierwalt, S. [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States); Leroy, A. K.; Condon, J.; Reichardt, A. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22904 (United States); Armus, L. [Spitzer Science Center, California Institute of Technology, MC 220-6, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Mazzarella, J. M.; Murphy, E. J. [Infrared Processing and Analysis Center, MS 100-22, California Institute of Technology, Pasadena, CA 91125 (United States); Meier, D. S. [New Mexico Institute of Mining and Technology, 801 Leroy Place, Socorro, NM 87801 (United States); Momjian, E.; Ott, J. [National Radio Astronomy Observatory, P.O. Box O, 1003 Lopezville Road, Socorro, NM 87801 (United States); Sakamoto, K. [Academia Sinica, Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 10617, Taiwan (China); Sanders, D. B. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96816 (United States); Schinnerer, E.; Walter, F. [Max-Planck-Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Surace, J. A. [Spitzer Science Center, MS 314-6, California Institute of Technology, Pasadena, CA 91125 (United States); Thompson, T. A., E-mail: ldb7et@virginia.edu [Department of Astronomy and Center for Cosmology and Astro-Particle Physics, The Ohio State University, Columbus, OH 43210 (United States)

2015-01-20

We present new Karl G. Jansky Very Large Array radio continuum images of the nuclei of Arp 220, the nearest ultra-luminous infrared galaxy. These new images have both the angular resolution to study the detailed morphologies of the two nuclei that power the galaxy merger and sensitivity to a wide range of spatial scales. At 33 GHz, we achieve a resolution of 0.''081 × 0.''063 (29.9 × 23.3 pc) and resolve the radio emission surrounding both nuclei. We conclude from the decomposition of the radio spectral energy distribution that a majority of the 33 GHz emission is synchrotron radiation. The spatial distributions of radio emission in both nuclei are well described by exponential profiles. These have deconvolved half-light radii (R {sub 50d}) of 51 and 35 pc for the eastern and western nuclei, respectively, and they match the number density profile of radio supernovae observed with very long baseline interferometry. This similarity might be due to the fast cooling of cosmic rays electrons caused by the presence of a strong (∼mG) magnetic field in this system. We estimate extremely high molecular gas surface densities of 2.2{sub −1.0}{sup +2.1}×10{sup 5} (east) and 4.5{sub −1.9}{sup +4.5}×10{sup 5} (west) M {sub ☉} pc{sup –2}, corresponding to total hydrogen column densities of N {sub H} = 2.7{sub −1.2}{sup +2.7}×10{sup 25} (east) and 5.6{sub −2.4}{sup +5.5}×10{sup 25} cm{sup –2} (west). The implied gas volume densities are similarly high, n{sub H{sub {sub 2}}}∼3.8{sub −1.6}{sup +3.8}×10{sup 4} (east) and ∼11{sub −4.5}{sup +12}×10{sup 4} cm{sup –3} (west). We also estimate very high luminosity surface densities of Σ{sub IR}∼4.2{sub −0.7}{sup +1.6}×10{sup 13} (east) and Σ{sub IR}∼9.7{sub −2.4}{sup +3.7}×10{sup 13} (west) L{sub ⊙} kpc{sup −2}, and star formation rate surface densities of Σ{sub SFR} ∼ 10{sup 3.7} {sup ±} {sup 0.1} (east) and Σ{sub SFR} ∼ 10{sup 4.1} {sup ±} {sup 0.1}(west) M

High-pressure 3He-Xe gas scintillators for simultaneous detection of neutrons and gamma rays over a large energy range

International Nuclear Information System (INIS)

Tornow, W.; Esterline, J.H.; Leckey, C.A.; Weisel, G.J.

2011-01-01

We report on features of high-pressure 3 He-Xe gas scintillators which have not been sufficiently addressed in the past. Such gas scintillators can be used not only for the efficient detection of low-energy neutrons but at the same time for the detection and identification of γ-rays as well. Furthermore, 3 He-Xe gas scintillators are also very convenient detectors for fast neutrons in the 1-10 MeV energy range and for high-energy γ-rays in the 7-15 MeV energy range. Due to their linear pulse-height response and self calibration via the 3 He(n,p) 3 H reaction, neutron and γ-ray energies can easily be determined in this high-energy regime.

Neutron-rich rare isotope production from projectile fission of heavy beams in the energy range of 20 MeV/nucleon

OpenAIRE

Vonta, N.; Souliotis, G. A.; Loveland, W. D.; Kwon, Y. K.; Tshoo, K.; Jeong, S. C.; Veselsky, M.; Bonasera, A.; Botvina, A.

2016-01-01

We investigate the possibilities of producing neutron-rich nuclides in projectile fission of heavy beams in the energy range of 20 MeV/nucleon expected from low-energy facilities. We report our efforts to theoretically describe the reaction mechanism of projectile fission following a multinucleon transfer collision at this energy range. Our calculations are mainly based on a two-step approach: the dynamical stage of the collision is described with either the phenomenological Deep-Inelastic Tr...

Investigation of the 93Nb neutron cross-sections in resonance energy range

International Nuclear Information System (INIS)

Grigoriev, Yu.V.; Kitaev, V.Ya.; Zhuravlev, B.V.; Sinitsa, V.V.; Borzakov, S.B.; Faikov-Stanchik, H.; Ilchev, G.; Mezentseva, Zh.V.; Panteleev, Ts.Ts.; Kim, G.N.

2002-01-01

The results of gamma-ray multiplicity spectra and transmission measurements for 93 Nb in energy range 21.5 eV-100 keV are presented. Gamma spectra from 1 to 7 multiplicity were measured on the 501 m and 121 m flight paths of the IBR-30 using a 16-section scintillation detector with a NaI(Tl) crystals of a total volume of 36 l and a 16-section liquid scintillation detector of a total volume of 80 l for metallic samples of 50, 80 mm in diameter and 1, 1.5 mm thickness with 100% 93 Nb. Besides, the total and scattering cross-section of 93 Nb were measured by means batteries of B-10 and He-3 counters on the 124 m, 504 m and 1006 m flight paths of the IBR-30. Spectra of multiplicity distribution were obtained for resolved resonances in the energy region E=30-6000 eV and for energy groups in the energy region E=21.5 eV- 100 keV. They were used for determination of the average multiplicity, resonance parameters and capture cross-section in energy groups and for low-laying resonances of 93 Nb. Standard capture cross-sections of 238 U and experimental gamma-ray multiplicity spectra were also used for determination of capture cross section 93 Nb in energy groups. Similar values were calculated using the ENDF/B-6 and JENDL-3 evaluated data libraries with the help of the GRUKON computer program. Within the limits of experimental errors there is observed an agreement between the experiment and calculation, but in some groups the experimental values differ from the calculated ones. (author)

Characterization of the Vectron PX-570 Crystal Oscillator for Use in Harsh Environments

Science.gov (United States)

Li, Jacob; Patterson, Richard L.; Hammoud, Ahmad

2012-01-01

Computing hardware, data-acquisition systems, communications systems, and many electronic control systems require well-controlled timing signals for proper and accurate operation. These signals are, in most cases, provided by circuits that employ crystal oscillators due to availability, cost, ease of operation, and accuracy. In some cases, the electronic systems are expected to survive and operate under harsh conditions that include exposure to extreme temperatures. These applications exist in terrestrial systems as well as in aerospace products. Well-logging, geothermal systems, and industrial process control are examples of ground-based applications, while distributed jet engine control in aircraft, space-based observatories (such as the James Webb Space Telescope), satellites, and lunar and planetary landers are typical environments where electronics are exposed to harsh operating conditions. To ensure these devices produce reliable results, the digital heartbeat from the oscillator must deliver a stable signal that is not affected by external temperature or other conditions. One such solution is a recently introduced commercial-off-the-shelf (COTS) oscillator, the PX-570 series from Vectron International. The oscillator was designed for high-temperature applications and as proof, the crystal oscillator was subjected to a wide suite of tests to determine its ruggedness for operation in harsh environments. The tests performed by Vectron included electrical characterization under wide range of temperature, accelerated life test/aging, shock and vibration, internal moisture analysis, ESD threshold, and latch-up testing. The parametric evaluation was performed on the oscillator's frequency, output signal rise and fall times, duty cycle, and supply current over the temperature range of -125 C to +230 C. The evaluations also determined the effects of thermal cycling and the oscillator's re-start capability at extreme hot and cold temperatures. These thermal cycling

29 CFR 1472.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness...

Science.gov (United States)

2010-07-01

... 29 Labor 4 2010-07-01 2010-07-01 false By when must I publish my drug-free workplace statement and establish my drug-free awareness program? 1472.220 Section 1472.220 Labor Regulations Relating to Labor (Continued) FEDERAL MEDIATION AND CONCILIATION SERVICE GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Requirements...

The anisotropy of cosmic ray particles in the energy range 1011-1019 eV

International Nuclear Information System (INIS)

Xu Chunxian

1985-01-01

A study of the anisotropy of primary cosmic ray is presented. The expression of the anisotropy is derived in a model of statistical discrete sources in an infinite galaxy. Using these derived formulas, the amplitudes of the first harmonic anisotropies caused by eleven supernovea nearby the Earth are estimated individually and the trend of the resultant anisotropy is investigated. It is found that the expected results can account for the power law of Esup(0.5) of the anisotropy above the energy 5 x 10 15 eV. The Compton-getting effect can cause an additional anisotropy which is independent of energy and added to the resultant anisotropy of these discrete sources. It is apparent that the anisotropies available in the low energy range 10 11 - 10 14 eV are caused by the Compton-Getting effect. Taking the differential spectrum index γ = 2.67 measured in the same energy bound we get the streaming velocity of 35 km/s with respect to the cosmic ray background

B220 analysis with the local lymph node assay: proposal for a more flexible prediction model.

Science.gov (United States)

Betts, Catherine J; Dearman, Rebecca J; Kimber, Ian; Ryan, Cindy A; Gerberick, G Frank; Lalko, Jon; Api, Anne Marie

2007-01-01

The mouse local lymph node assay (LLNA) has been developed and validated for the identification of chemicals that have the potential to induce skin sensitisation. In common with other predictive test methods the accuracy of the LLNA is not absolute and experience has revealed that a few chemicals, including for instance a minority of skin irritants, may elicit false-positive reactions in the assay. To improve further the performance of the LLNA, and to eliminate or reduce false-positives, there has been interest in an adjunct method in which the ability of chemicals to cause increases in the frequency of B220(+) lymphocytes in skin-draining lymph nodes is measured. Previous studies suggest that the use of B220 analyses aligned with the standard LLNA may serve to distinguish further between contact allergens and skin irritants. In the original predictive model, chemicals were regarded as being skin sensitisers if they were able to induce a 1.25-fold or greater increase in the percentage of B220(+) cells within lymph nodes compared with concurrent vehicle controls. Although this first prediction model has proven useful, in the light of more recent experience, and specifically as a consequence of some variability observed in the frequency of B220(+) lymphocytes in nodes taken from vehicle control-treated animals, it is timely now to reconsider and refine the model. As a result a new prediction model is proposed in which reliance on the use of absolute thresholds is reduced, and in which small changes in control values can be better accommodated. (c) 2007 John Wiley & Sons, Ltd.

International Standardisation in the Field of Renewable Energy

Energy Technology Data Exchange (ETDEWEB)

NONE

2013-03-15

Renewable energy standards, regularly reviewed and updated by international committees of technical experts, can help policy makers as an instrument to demonstrate national regulatory compliance, as well as ensuring successful deployment of renewable energy technologies (RET). This study identifies over 570 standards in the current RET landscape, yet finds gaps in the existing standards, particularly for post-installation aspects of RET, such as operation, maintenance and repair. The study calls for a more structured information platform to make appropriate standards accessible to a variety of users. All stakeholders, including those from developing countries, need to be engaged in the standardisation process. IRENA's analysis also underlines the importance of RET certification schemes as a risk-mitigation tool, particularly to help small-scale projects obtain financing.

Development of a picture of the van der Waals interaction energy between clusters of nanometer-range particles

International Nuclear Information System (INIS)

Arunachalam, V.; Marlow, W.H.; Lu, J.X.

1998-01-01

The importance of the long-range Lifshitz-van der Waals interaction energy between condensed bodies is well known. However, its implementation for interacting bodies that are highly irregular and separated by distances varying from contact to micrometers has received little attention. As part of a study of collisions of irregular aerosol particles, an approach based on the Lifshitz theory of van der Waals interaction has been developed to compute the interaction energy between a sphere and an aggregate of spheres at all separations. In the first part of this study, the iterated sum-over-dipole interactions between pairs of approximately spherical molecular clusters are compared with the Lifshitz and Lifshitz-Hamaker interaction energies for continuum spheres of radii equal to those of the clusters' circumscribed spheres and of the same masses as the clusters. The Lifshitz energy is shown to converge to the iterated dipolar energy for quasispherical molecular clusters for sufficiently large separations, while the energy calculated by using the Lifshitz-Hamaker approach does not. Next, the interaction energies between a contacting pair of these molecular clusters and a third cluster in different relative positions are calculated first by coupling all molecules in the three-cluster system and second by ignoring the interactions between the molecules of the adhering clusters. The error calculated by this omission is shown to be very small, and is an indication of the error in computing the long-range interaction energy between a pair of interacting spheres and a third sphere as a simple sum over the Lifshitz energies between individual, condensed-matter spheres. This Lifshitz energy calculation is then combined with the short-separation, nonsingular van der Waals energy calculation of Lu, Marlow, and Arunachalam, to provide an integrated picture of the van der Waals energy from large separations to contact. copyright 1998 The American Physical Society